Treatment of anemia
By increasing SEC23A expression using LSD1 and DNMT1 inhibitors, the erythroid defects in CDAII are effectively addressed, enhancing RBC count and hemoglobin levels without affecting erythropoiesis.
Patent Information
- Application Number
- PCT/US2025/037326
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-11
- Filing Date
- 2025-07-11
- Publication Date
- 2026-01-15
AI Technical Summary
Congenital dyserythropoietic anemia type II (CDAII) is characterized by ineffective erythropoiesis, erythroblast morphological abnormalities, and hemolysis, with standard treatments only managing symptoms and not addressing the underlying cause, which is a bi-allelic loss-of-function mutation in the SEC23B gene.
Increasing SEC23A expression through the use of inhibitors of lysine-specific demethylase-1 (LSD1) and DNA methyltransferase-1 (DNMT1), such as ORY-1001 and decitabine, to alter the SEC23A promoter sequence or genetically downregulate LSD1, thereby rescuing the erythroid defects associated with SEC23B deficiency.
The methods significantly ameliorate erythroid defects in CDAII by increasing SEC23A levels, improving RBC count and hemoglobin levels without impairing erythropoiesis or erythroid differentiation.
Smart Images

Figure US2025037326_15012026_PF_FP_ABST
Abstract
Description
[0001] TREATMENT OF ANEMIA
[0002] FIELD
[0003] [1] The present disclosure provides methods for treating congenital dyserythropoietic anemia type II (CDAII). Particularly, the present disclosure provides methods for treating congenital dyserythropoietic anemia type II with one or more agents which increase SEC23A level.
[0004] CROSS REFERENCE TO RELATED APPLICATIONS
[0005] [2] This application claims the benefit of U.S. Provisional Application No. 63 / 669,963, filed July 11, 2024, the content of which is herein incorporated by reference in its entirety.
[0006] SEQUENCE LISTING STATEMENT
[0007] [3] The content of the electronic sequence listing titled UM_43110_601_SequenceListing.xml (Size: 24,489 bytes; and Date of Creation: June 27, 2025) is herein incorporated by reference in its entirety.
[0008] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0009] [4] This invention was made with government support under HL148333 awarded by the National Institutes of Health. The government has certain rights in the invention.
[0010] BACKGROUND
[0011] [5] Anemia due to defects in terminal erythroid maturation is the most common type of anemia. The congenital dyserythropoietic anemias (CDAs) are a group of heterogeneous hereditary red blood cell disorders characterized by ineffective erythropoiesis, erythroblast morphological abnormalities, hemolysis, and hypoglycosylation of red-blood-cell membrane proteins and lipids. There are multiple types of the disease identified, and all of them are associated with abnormal maturation and division of erythroid precursors. CDA type II (CDAII), the most common CDA, is an autosomal recessive disease characterized by anemia, increased bone marrow bi-nucleated erythroblasts, among other characteristics. Anemia in CDAII is of variable severity, ranging from mild to transfusion dependent (and to hydrops fetalis in the most severe cases). Standard treatment for CDAII includes maintenance of symptoms through blood transfusions and medications to prevent iron overload. Transfusion-dependent patients or those with massive splenomegaly may benefit from splenectomy. Allogeneic hematopoietic stem transplantation has been successfully used in severely anemic patients. SUMMARY
[0012] [6] Disclosed herein are methods for increasing the level of SEC23A in a cell. In some embodiments, the methods comprise contacting the cell with: one or more inhibitors of lysine specific demethylase- 1 (LSD1); one or more inhibitors of DNA methyltransferase 1 (DNMT1); or any combination thereof.
[0013] [7] In some embodiments, the one or more inhibitors of LSD1 comprise a gene silencing or downregulating oligonucleotide, one or more components of a gene editing system, a protein configured to bind LSD 1 , a small molecule inhibitor, or combinations thereof. In some embodiments, the one or more inhibitors of ESDI comprise ORY-lOOl or RN1. In some embodiments, the one or more components of a gene editing system are configured to alter the SEC23A promoter sequence in the region occupied by LSD1.
[0014] [8J In some embodiments, the one or more inhibitors of DNMT1 comprise gene silencing or downregulating oligonucleotides, a protein configured to bind DNMT1, a small molecule inhibitor, or combinations thereof. In some embodiments, the one or more inhibitors of DNMT1 comprise decitabine.
[0015] [9] In some embodiments, the contacting comprises introducing into the cell.
[0016] [10| In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is in vitro or ex vivo.
[0017]
[0011] In some embodiments, the cell is in vivo. In some embodiments, the contacting comprises administering the one or more inhibitors of LSD1 , the one or more inhibitors of DNMT1 , or any combination thereof to a subject.
[0018]
[0012] Also provided herein are methods for treating or preventing a disease or disorder mediated by decreased function or level of SEC23B in a subject in need thereof. In some embodiments, the methods comprise administering to the subject a therapeutically effective amount of one or more agents which increase the level of SEC23A in the subject. In some embodiments, the one or more agents comprise one or more inhibitors of lysine specific demethylase- 1 (ESDI); one or more inhibitors of DNA methyltransferase 1 (DNMT1); or any combination thereof.
[0019]
[0013] In some embodiments, the one or more inhibitors of LSD1 comprise a gene silencing or downregulating oligonucleotide, one or more components of a gene editing system, a protein configured to bind ESDI, a small molecule inhibitor, or combinations thereof. In some embodiments, the one or more inhibitors of LSD 1 comprise ORY-lOOl or RN1. In some embodiments, the one or more components of a gene editing system are configured to alter the SEC23A promoter sequence in the region occupied by LSD1.
[0020]
[0014] In some embodiments, the one or more inhibitors of DNMT1 comprise gene silencing or downregulating oligonucleotides, a protein configured to bind DNMT1, a small molecule inhibitor, or combinations thereof. In some embodiments, the one or more inhibitors of DNMT1 comprise decitabine.
[0021]
[0015] In some embodiments, the subject has a loss of function mutation in a gene encoding SEC23B.
[0022]
[0016] In some embodiments, the disease or disorder is congenital dyserythropoietic anemia type II (CD All). In some embodiments, the methods rescue CDAII erythroid defects.
[0023]
[0017] In some embodiments, the methods do not impair erythropoiesis and or erythroid differentiation. In some embodiments, the methods increase RBC count, hemoglobin level, and / or orthochromatic erythroblasts.
[0024]
[0018] Other aspects and embodiments of the disclosure will be apparent in light of the following detailed description and accompanying figures.
[0025] BRIEF DESCRIPTION OF THE DRAWINGS
[0026]
[0019] FIGS. 1A-1E show screening for small molecules that increase the SEC23A level. FIG. 1 A is a schematic of the strategy to generate reporter K562 and HUDEP2 cell lines expressing SEC23A-eGFP fusion protein from the endogenous SEC23A locus. FIG. IB shows SEC23A deletion using CRISPR / Cas9 results in reduced eGFP fluorescence. FIG. 1C shows CRISPRa mediated transcriptional activation of SEC23A results in enhanced eGFP fluorescence. FIG. ID shows the -5,000 compounds from a drug repurposing library tested for their abilities to increase the SEC23A- eGFP level, using the automated BioRad ZE5 cell analyzer. FIG. IE is a schematic of an exemplary experimental workflow of compound screening.
[0027]
[0020] FIGS. 2A-2J show RN1 induces SEC23A expression in primary human erythroid cells. FIG. 2A is a schematic of an exemplary experimental workflow of erythroid differentiation from human CD34+ HSPCs. Treatment with compounds (or DMSO as control) was initiated at day 7 of differentiation and erythroid cells were analyzed at day 14 of differentiation. FIG. 2B is SEC23A mRNA levels in HSPC-derived erythroid cells from 3 independent donors treated with various concentrations of RN1 or DMSO as control. Growth rates (FIG. 2C) and differentiation (FIG. 2D) of erythroid cells treated with RN1 or DMSO. FIG. 2E is differentiated CD71+CD235a+erythroid cells assessed by flow cytometry. FIG. 2F is erythroid SEC23A protein levels (upper panel) in RN1 versus DMSO treated cells. Vinculin was used as internal control (lower panel). FIG. 2G is the quantification of SEC23A protein levels compared to vinculin (n=3 / condition). FIGS. 2H-2I are summaries of the average SEC23A mRNA levels in HSPC-derived erythroid cells treated with various a range of RN1 concentrations or DMSO (FIG. 2H), relative cell growth rates (FIG. 21), and percentages of CD71+CD235a+erythroid cells (FIG. 21) at day 14 of differentiation (n=3 / condition). Data is presented as means ± SD. (*p<0.05, **p<0.01, ***p<0.001, ns: not significant; unpaired Student’s t-test).
[0028]
[0021] FIGS. 3A-3F show genetic downregulation of LSD1 induces SEC23A expression in primary human erythroid cells. FIG. 3A is a schematic of the experimental workflow of shRNA mediated LSD1 downregulation in HSPC-derived erythroid cells. Cells were transduced with shRNA at differentiation day 4 and erythroid cells were analyzed at differentiation day 14. LSD1 (FIG. 3B) and SEC23A (FIG. 3C) mRNA levels in primary human erythroid cells following transduction with 5 independent LSD1 -targeting shRNAs or scramble shRNA as control. FIGS. 3D and 3E are summaries of the LSD1 (FIG. 3D) and SEC23A (FIG. 3E) mRNA levels in primary human erythroid cells derived from three independent HSPC donors. FIG. 3F is differentiated CD71+CD235a+erythroid cells following LSD1 downregulation assessed by flow cytometry.
[0029] [22| FIGS. 4A-4H show RN1 rescues the erythroid defect observed in CDA1I in vitro. HSPCs differentiating into erythroid cells were electroporated at day 4 with a ribonucleoprotein complex composed of Cas9 / SE'C23B-sgRNA or Cas9 / NT-gRNA (FIG. 4A). Cells electroporated with S,£'C23B-sgRNA were treated with various RN1 concentrations (2.5nM, 1.25nM or 0.625nM) or DMSO beginning at day 7 of differentiation, and erythroid cells were analyzed at day 14 of differentiation. FIG. 4B is a comparison of the growth rates of WT erythroid cells receiving NT- sgRNA and treated with DMSO, erythroid cells deleted for SEC23B and treated with RN1, and erythroid cells deleted for SEC23B and treated with DMSO. The experiment was performed 3 times, using HSPCs harvested from 3 independent donors. FIG. 4C is the average results of the 3 experiments performed in FIG. 4B. FIGS. 4D and 4E are erythroid differentiation determined by flow cytometry evaluating the percentage of CD7 l+CD235a+erythroid cells. FIG. 4F is the percentage of CD71+CD235a+erythroid cells among live cells at day 14 (n=3 / condition). FIG. 4G is the percentage of Annexin V (+) cells at day 12 of differentiation. FIG. 4H is erythroid cell morphology at day 14 of differentiation. Data in FIGS. 4C and 4E-4G are presented as means + SD. Results in FIG. 4C were compared to cells receiving SEC23B sgRNA and treated with DMSO, while results in FIG. 4E are compared to cells receiving NT-sgRNA and treated with DMSO.
[0030] *** / ?<0.0001; *p<0.05; ns: not significant; unpaired Student’s t-test.
[0031] [23| FIGS. 5A-5G show RN1 rescues CDAII in vivo. FIG. 5A shows control mice expressing Gum7-CreERT2(referred to as GIB) and tamoxifen-inducible Lsdl knockout mice (Lsdl—1GIB) were generated by crossing Lsdl+ / flGIB to Lsdl^1mice. Following tamoxifen administration, CD71+Terl 19+CD44+FSChlgherythroid cells were isolated and evaluated for Lsdl (FIG. 5B) and Sec23a (FIG. 5C) mRNA levels by qRT-PCR. Tamoxifen-inducible CDAII mice (Sec23a+ / flSec23b’l / ’1Gatal -CreERT2) and control mice iSec23a+ / +Sec23b+ / +Gatal -CreERT2) were generated and placed on tamoxifen for 24 days (FIG. 5D). CDAII mice were treated with RN1 from days 8-24 or left untreated. Mice were analyzed at day 24. Lower RBC counts (FIG. 5E) and hemoglobin levels (FIG. 5F) observed in CDAII compared to control mice, are significantly rescued by RN1 administration. FIG. 5G shows quantification of bone marrow proerythroblasts (ProE), basophilic erythroblasts (BasoE), polychromatic erythroblasts (PolyE) and orthochromatic erythroblasts (OrthoE), demonstrate complete rescue of the reduced OrthoE in CDAII mice by RN1 administration. Data in FIGS. 5B-5C and 5E-5G are presented as means ± SD. (ns: not significant*** p<0.001 ; ** p<0.01; * p<0.05; unpaired Student’s t-test).
[0032]
[0024] FIGS. 6A-6F show deletion of the SEC23A promoter sequence occupied by LSD1 rescues CDAII. FIG. 6A is CUT&RUN using anti-LSDl antibody or IgG as control in HSPC-derived erythroid cells at days 11 and 14 of differentiation. The experiment was done 3 times using HSPCs harvested from 3 independent donors. SEC23B null HUDEP-2 cells were transduced with an sgRNA targeting the SEC23A promoter sequence occupied by LSD1 or control NT-sgRNA. FIG. 6B shows the deletion of the SEC23A promoter sequence occupied by LSD1 results in increased SEC23A mRNA level and FIG. 6C shows the improvement of the cell growth defect resulting from SEC23B deletion, as shown in 2 independent experiments. FIG. 6D shows LSD1 binds the SEC23A promoter, resulting in repressed SEC23A transcription. LSD 1 inhibition (or deletion of the SEC23A promoter sequence occupied by LSD1) results in increased SEC23A expression and CDAII rescue. FIGS. 6E and 6F are from SEC23B null HUDEP-2 cells transduced with an sgRNA targeting the SEC23A promoter sequence occupied by LSD1 or control NT-sgRNA. Deletion of the SEC23A promoter sequence occupied by ESDI results in increased SEC23A mRNA level (FIG. 6E) and improvement of the cell growth defect (FIG. 6F), as shown for three independent experiments.
[0033]
[0025] FIGS. 7A and 7B show LSD1 inhibition using ORYlOOl results in increased SEC23A- eGFP fluorescence in a dose-dependent manner. FIG. 7A is a graph of the SEC23A eGFP fluorescence compared between WT parental HUDEP-2 cells (n=3 ), reporter HUDEP-2 cells treated with DMSO (n=3), reporter HUDEP-2 cells treated with a range of ORY 1001 concentrations (0.04- lOpM, n=6) and reporter HUDEP-2 cells post-activation of SEC23A expression using CRISPRa (n=3). ***p<0.001; unpaired Student’s t-test. FIG. 7B is the same data shown in FIG. 7A, except that eGFP fluorescence for each ORYlOOl dose ( n=l) is shown separately.
[0026] FIGS. 8A and 8B show the impact of LSD1 inhibition using GSK690 on the SEC23A mRNA level. FIG. 8A is erythroid cells derived from 3 independent HSPC donors were treated with lOOnM GSK690 or DMSO control. GSK690 treatment resulted in profoundly increased SEC23A mRNA levels. FIG. 8B is the average SEC23A mRNA levels from FIG. 8A. Data is presented as means ± SD. **p<0.01 unpaired Student’s t-test.
[0034]
[0027] FIG. 9 shows the gating strategy for terminally differentiated murine bone marrow erythroid cells. Bone marrow erythroid cells from control mice, CDAII mice, and CD All mice treated with RN 1 were analyzed by flow cytometry to determine the absolute numbers of proerythrolasts (ProE), basophilic erythroblasts (BasoE), polychromatic erythroblasts (PolyE) and orthochromatic erythroblasts (OrthoE).
[0035]
[0028] FIG. 10 shows the editing efficiency of the sgRNA targeting the SEC23A promoter sequence (target sequence is SEQ ID NO: 10) occupied by LSD1, analyzed by ICE, for two different sets of experiments. (-2 indel - SEQ ID NOs: 11 and 14; -1 indel - SEQ ID NO: 12; -6 indel - SEQ ID NO: 13; -7 indel - SEQ ID NO: 15 and 18; -3 indel - SEQ ID NO: 16; 0 indel - SEQ ID NO: 17; -4 indel - SEQ ID NO: 19; +1 indel - SEQ ID NO: 20; -9 indel - SEQ ID NO: 21; -8 indel - SEQ ID NO: 22)
[0036]
[0029] FIG. 11 shows that decitabine results in increased SEC23A mRNA in a dose dependent fashion in erythroblasts differentiated from human HSPCs, with no detriment in differentiation. Error bars = SD.
[0037]
[0030] FIG. 12 shows that conditional Dnmtl deletion in mouse erythroid erythroblasts, results in reduced Dnmtl mRNA (left) and increased Sec23A mRNA (right) in erythroid cells. Error bars = SD.
[0038] [3.1] FIG. 13 is a graph of the absolute counts of erythroid cells treated with RN1 or DMSO at day 14 of differentiation, as in FIGS. 2B-2G.
[0039]
[0032] FIG. 14 is a graph of HBG1 / 2 mRNA levels in RN1 treated erythroid cells. Average HBG1 / 2 mRNA levels in HSPC-derived erythroid cells treated with RN1 or DMSO (as in FIG. 2A) at day 14 of differentiation. Data from 3 independent HSPC donors are shown. Data are presented as means + / - SD. *p<0.05, ns: not significant; unpaired Student’s t-test.
[0040]
[0033] FIGS. 15A-15G show RN1 partially rescues CDAII in vitro. FIG. 15A is a comparison of the growth rates of erythroid cells transduced with a SEC23B targeting or NT sgRNA and treated with DMSO or RN1. Comparisons were made to erythroid cells receiving 5EC25R-sgRNA and treated with DMSO. Percentage of CD235a+CD71+cells (FIG. 15B) and of CD235a+CD105lowcells (FIG. 15C) at day 18 of differentiation. FIG. 15D is the gating strategy for FIG. 15B. FIG. 15E is the gating strategy for FIG. 15C. FIG. 15F are images of cytospins of erythroid cells at day 18 of differentiation. FIG. 15G shows the percentage of Annexin V (+) cells at day 12 of differentiation. **p<0.01; ***p<0.0001; ns: not significant; unpaired Student’s t-test. All experiments were performed 3 times.
[0041]
[0034] FIGS. 16A-16E show peripheral blood studies in CD All mice. Mean corpuscular hemoglobin (MCH; FIG. 16A), white blood cell counts (WBC; FIG. 16B), platelet counts (pit; FIG. 16C), and peripheral blood reticulocyte percentage (FIG. 16D) in control and CDAII mice treated with PBS or RN1. FIG. 16E is the gating strategy for reticulocyte staining. **p<0.001, ns: not significant; unpaired Student’s t-test.
[0042]
[0035] FIGS. 17A and 17B show the analysis of progenitor cells. FIG. 17A is a graph of the absolute numbers of PreMegE, Pre-CFU-E, CFU-E, and Pre-GM cells in bone marrow of control or CDAII mice treated with RN1 or PBS, demonstrating no statistical difference among the 4 groups. FIG. 17B is a graph of the numbers of CFU-GM and BFU-E colonies per 100,000 live bone marrow cells harvested from control or CDAII mice treated with RN1 or PBS.
[0043] DETAILED DESCRIPTION
[0044]
[0036] The present disclosure provides methods for treating or preventing congenital dyserythropoietic anemia type II (CDAII) in a subject. CDAII results from bi-allelic loss-of-function mutations in SEC23B, which encodes a component of coat complex protein II (COPII) vesicles / tubules. Approximately 7,000 mammalian proteins are trafficked from the endoplasmic reticulum to the Golgi apparatus via COPII vesicles / tubules, which suggests that mutations in genes encoding COPII components would result in profound multi- systemic defects. However, that is not the case, as mutations in SEC23B merely result in a phenotype restricted to the red blood cell (RBC).
[0045]
[0037] Increasing SEC23A expression, the other paralogous gene for SEC23, SEC23A and SEC23B, using CRISPR activation or cDNA expression, completely rescues the S£'C23B-null erythroid defect. A reporter human erythroid cell line that expresses eGFP from the endogenous genomic locus of SEC23A was generated and used to screen approximately 5,000 compounds for their ability to increase the SEC23A-eGFP level using high-throughput flow cytometry. The top compound identified following filtering of the data was an LSD1 inhibitor. LSD1 inhibition using RN 1 or genetic downregulation of LSD1 expression resulted in increased SEC23A expression in primary human erythroid cells. RN1 treatment rescued the erythroid defect resulting from SEC23B deficiency. LSD1 deletion in murine erythroid cells resulted in increased SEC23A expression and treatment of CDAII mice with RN 1 significantly ameliorated the erythroid defect observed in these mice. Finally, using CUT&RUN, LSD1 was found to occupy a sequence in the SEC23A promoter, which when deleted results in increased SEC23 A expression and amelioration of the SEC23B-null erythroid defect. Therefore, induction of SEC23A expression using a small molecule that inhibits LSD1 is of therapeutic value for CDAII. Similarly, deletion of the SEC23A promoter sequence that is occupied by ESDI provides an alternative, genetic approach to treat CDAII. Deletion of Dnmtl and inhibition of Dnmtl by decitabine also resulted in a significant increase in Sec23a mRNA levels.
[0046]
[0038] Section headings as used in this section and the entire disclosure herein are merely for organizational purposes and are not intended to be limiting.
[0047] Definitions
[0048]
[0039] The terms “comprise(s),” “include(s),” “having,” “has,” “can,” “contain(s),” and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional acts or structures. The singular forms “a,” “and” and “the” include plural references unless the context clearly dictates otherwise. The present disclosure also contemplates other embodiments “comprising,” “consisting of’ and “consisting essentially of,” the embodiments or elements presented herein, whether explicitly set forth or not. In addition, as used herein, the term “or” is an inclusive “or” operator and is equivalent to the term “and / or” unless the context clearly dictates otherwise. The term “based on” is not exclusive and allows for being based on additional factors not described, unless the context clearly dictates otherwise. The meaning of “in” includes “in” and “on.”
[0049]
[0040] For the recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.
[0050]
[0041] Unless otherwise defined herein, scientific, and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. For example, any nomenclatures used in connection with, and techniques of, molecular biology, immunology, and protein and nucleic acid chemistry and hybridization described herein are those that are well known and commonly used in the art. The meaning and scope of the terms should be clear; in the event, however of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.
[0051]
[0042] A “vector” or “expression vector” is a replicon, such as plasmid, phage, virus, or cosmid, to which another DNA segment, e.g., an “insert,” may be attached or incorporated so as to bring about the replication of the attached segment in a cell.
[0043] A cell has been “genetically modified,” “transformed,” or “transfected” by exogenous DNA, e.g., a recombinant expression vector, when such DNA has been introduced inside the cell. The presence of the exogenous DNA results in permanent or transient genetic change. The transforming DNA may or may not be integrated (covalently linked) into the genome of the cell. For example, the transforming DNA may be maintained on an episomal element such as a plasmid. With respect to eukaryotic cells, a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones that comprise a population of daughter cells containing the transforming DNA. A “clone” is a population of cells derived from a single cell or common ancestor by mitosis. A “cell line” is a clone of a primary cell that is capable of stable growth in vitro for many generations.
[0052]
[0044] The term “gene” refers to a DNA sequence that comprises control and coding sequences necessary for the production of an RNA having a non-coding function (e.g., a ribosomal or transfer RNA), a polypeptide, or a precursor of any of the foregoing. The RNA or polypeptide can be encoded by a full-length coding sequence or by any portion of the coding sequence so long as the desired activity or function is retained. Thus, a “gene” refers to a DNA or RNA, or portion thereof, that encodes a polypeptide or an RNA chain that has functional role to play in an organism. For the purpose of this disclosure, it may be considered that genes include regions that regulate the production of the gene product, whether or not such regulatory sequences are adjacent to coding and / or transcribed sequences. Accordingly, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites, and locus control regions.
[0053]
[0045] “Polynucleotide” or “oligonucleotide” or “nucleic acid,” as used herein, means at least two nucleotides covalently linked together. The polynucleotide may be DNA, RNA, or a hybrid, where the polynucleotide may contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine and isoguanine. The nucleic acid, whether DNA or RNA may comprise non-natural nucleotides, modified nucleotides, and / or non- nucleotide building blocks that can exhibit the same function as natural nucleotides (e.g., “nucleotide analogs”). Nucleic acids may be obtained by chemical synthesis methods or by recombinant methods. Polynucleotides may be single- or doublestranded or may contain portions of both double stranded and single stranded sequence. The depiction of a single strand also defines the sequence of the complementary strand. Thus, a nucleic acid also encompasses the complementary strand of a depicted single strand. Many variants of a nucleic acid may be used for the same purpose as a given nucleic acid. Thus, a nucleic acid also encompasses substantially identical nucleic acids and complements thereof.
[0054]
[0046] A “peptide” or “polypeptide” is a linked sequence of two or more amino acids linked by peptide bonds. The polypeptide can be natural, synthetic, or a modification or combination of natural and synthetic. Peptides and polypeptides include proteins such as binding proteins, receptors, and antibodies. The proteins may be modified by the addition of sugars, lipids or other moieties not included in the amino acid chain. The terms “polypeptide” and “protein” are used interchangeably herein.
[0055]
[0047] “Antibody” and “antibodies” as used herein refers to monoclonal antibodies, monospecific antibodies (e.g., which can either be monoclonal, or may also be produced by other means than producing them from a common germ cell), multi-specific antibodies, human antibodies, humanized antibodies (fully or partially humanized), animal antibodies such as, but not limited to, a bird (for example, a duck or a goose), a shark, a whale, and a mammal, including a non-primate (for example, a cow, a pig, a camel, a llama, a horse, a goat, a rabbit, a sheep, a hamster, a guinea pig, a cat, a dog, a rat, a mouse, etc.) or a non-human primate (for example, a monkey, a chimpanzee, etc.), recombinant antibodies, chimeric antibodies, single-chain Fvs (“scFv”), single chain antibodies, single domain antibodies, Fab fragments, F(ab’) fragments, F(ab’)2 fragments, disulfide-linked Fvs (“sdFv”), and anti-idiotypic (“anti-Id”) antibodies, dual-domain antibodies, dual variable domain (DVD) or triple variable domain (TVD) antibodies (dual- variable domain immunoglobulins and methods for making them are described in Wu, C., et al., Nature Biotechnology, 25(11): 1290- 1297 (2007) and PCT International Application WO 2001 / 058956, the contents of each of which are herein incorporated by reference), or domain antibodies (dAbs) (e.g., such as described in Holt et al., Trends in Biotechnology 21:484-490 (2014)), and including single domain antibodies sdAbs that are naturally occurring, e.g., as in cartilaginous fishes and camelid, or which are synthetic, e.g., nanobodies, VHH, or other domain structure), and functionally active epitope-binding fragments of any of the above. In particular, antibodies include immunoglobulin molecules and immunologically active fragments of immunoglobulin molecules, namely, molecules that contain an analyte-binding site. Immunoglobulin molecules can be of any type (for example, IgG, IgE, IgM, IgD, IgA, and IgY), class (for example, IgGl, IgG2, IgG3, IgG4, IgAl, and IgA2), or subclass. For simplicity sake, an antibody against an analyte is frequently referred to herein as being either an “anti-analyte antibody” or merely an “analyte antibody”.
[0056]
[0048] “Antibody fragment” as used herein refers to a portion of an intact antibody comprising the antigen-binding site or variable region. The portion does not include the constant heavy chain domains (i.e., CH2, CH3, or CH4, depending on the antibody isotype) of the Fc region of the intact antibody. Examples of antibody fragments include, but are not limited to, Fab fragments, Fab’ fragments, Fab’-SH fragments, F(ab’)2 fragments, Fd fragments, Fv fragments, diabodies, singlechain Fv (scFv) molecules, single-chain polypeptides containing only one light chain variable domain, single-chain polypeptides containing the three CDRs of the light-chain variable domain, single-chain polypeptides containing only one heavy chain variable region, and single-chain polypeptides containing the three CDRs of the heavy chain variable region.
[0057]
[0049] As used herein, “treat,” “treating” and the like means a slowing, stopping, or reversing of progression of a disease or disorder when provided a composition described herein to an appropriate control subject. The term also means a reversing of the progression of such a disease or disorder to a point of eliminating or greatly reducing the progression. As such, “treating” means carrying out the methods described herein on a subject, where the subject has a disease or a symptom of a disease, where the purpose is to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, or affect the disease or symptoms of the disease.
[0058]
[0050] As used herein, the term “preventing” refers to partially or completely delaying onset of an infection, disease, disorder and / or condition; partially or completely delaying onset of one or more symptoms, features, or manifestations of a particular infection, disease, disorder, and / or condition; partially or completely delaying progression from an infection, a particular disease, disorder and / or condition; and / or decreasing the risk of developing pathology associated with the infection, the disease, disorder, and / or condition.
[0059]
[0051] A “subject” or “patient” may be human or non-human and may include, for example, animal strains or species used as “model systems” for research purposes, such a mouse model as described herein. Eikewise, patient may include either adults or juveniles (e.g., children). Moreover, patient may mean any living organism, preferably a mammal (e.g., a human or a non-human) that may benefit from the administration of compositions contemplated herein. Examples of mammals include, but are not limited to, any member of the Mammalian class: humans, non-human primates such as chimpanzees, and other apes and monkey species; farm animals such as cattle, horses, sheep, goats, swine; domestic animals such as rabbits, dogs, and cats; laboratory animals including rodents, such as rats, mice and guinea pigs, and the like. Examples of non-mammals include, but are not limited to, birds, fish, and the like. In one embodiment of the methods and compositions provided herein, the mammal is a human.
[0060]
[0052] As used herein, the terms “providing,” “administering,” “introducing,” are used interchangeably herein and refer to the placement into a subject by a method or route which results in at least partial localization to a desired site. Administration can be by any appropriate route which results in delivery to a desired location in the subject.
[0053] A “variant” or a “derivative” when used in reference to a particular inhibitor refers to a chemical or molecular compound having at least 50% identity to a parent or original inhibitor. In some embodiments a variant inhibitor may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater identity relative to a reference parent or original inhibitor.
[0061]
[0054] Preferred methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the present disclosure. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting.
[0062] Increasing SEC23A Levels
[0063]
[0055] The present disclosure provides methods for increasing the level of SEC23A in a cell. The methods comprise contacting the cell with one or more inhibitors of chromatin modifying enzymes. In some embodiments, the one or more inhibitors of chromatin modifying enzymes comprise one or more inhibitors of lysine specific demethylase- 1 (LSD1, also known as KDM1A); one or more inhibitors of DNA methyltransferase 1 (DNMT1); or any combination thereof. In some embodiments, the contacting comprises introducing into the cell.
[0064]
[0056] The cell may be any type of cell. In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is a mammalian cell (e.g., a human cell).
[0065]
[0057] In some cases, the cell is in culture or in vitro (e.g., immortalized cell line). Cells may be from established cell lines or they may be primary cells, where “primary cells,” “primary cell lines,” and “primary cultures” are used interchangeably herein to refer to cells and cells cultures that have been derived from a subject and allowed to grow in vitro for a limited number of passages of the culture. For example, primary cultures are cultures that may have been passaged 0 times, 1 time, 2 times, 4 times, 5 times, 10 times, or 15 times, but not enough times go through the crisis stage. Typically, the primary cell lines are maintained for fewer than 10 passages in culture. In some embodiments, the cell is ex vivo (e.g., fresh isolate - early passage).
[0066]
[0058] In some embodiments, the cell is in vivo. In some embodiments, the contacting comprises administering to a subject. In some embodiments, the methods comprise contacting an ex vivo cell (e.g. a stem cell), and then the treated cell is transplanted into a subject.
[0067]
[0059] In some embodiments, the subject has a disease or disorder mediated by decreased function or level of SEC23B. Thus, the disclosure also provides methods for treating or preventing a disease or disorder mediated by decreased function or level of SEC23B in a subject in need thereof. The methods comprise, administering to the subject a therapeutically effective amount of one or more agents which increase the level of SEC23A in the subject. In some embodiments, the one or more agents comprise one or more inhibitors of lysine specific demethylase-1 (LSD1); one or more inhibitors of DNA methyltransferase 1 (DNMT1); or any combination thereof.
[0068] 160] In some embodiments, the subject has a loss of function mutation in a gene encoding SEC23B. Thus, in some embodiments, the methods further comprise determining or identifying if a subject has a loss of function mutation in a gene encoding SEC23B. The loss of function mutation may be a missense or nonsense mutation, a frameshift, an indel, or a splicing variant of SEC23B. Over 100 different variants of the SEC23B gene have been described to result in loss of function, see for example, Musri MM. Int J Mol Sci. 2023 Jun 9;24(12):9935.
[0069]
[0061] In some embodiments, the subject has a congenital dyserythropoietic anemia. In some embodiments, the subject has or is suspected of having congenital dyserythropoietic anemia type II (CD All).
[0070]
[0062] The methods disclosed herein may rescue some of the symptoms of CDAII including fatigue, jaundice, pale skin, enlarged spleen or liver, and gallstone formation. In some embodiments, the methods rescue CDAII erythroid defects. In some embodiments, the methods do not impair erythropoiesis and or erythroid differentiation. In some embodiments, the methods increase RBC count, hemoglobin level, and / or orthochromatic erythroblasts. a) Inhibitors of LSD1
[0071]
[0063] In some embodiments, the methods comprise contacting a cell with one or more inhibitors of lysine specific demethylase-1 (LSD1) or administering to a subject one or more inhibitors of lysine specific demethylase-1 (LSD1). Lysine-specific demethylase 1A (LSD1), also named KDM1 A and AOF2, is a flavin-dependent demethylase that can remove di- and mono-methyl groups from the fourth and nine positions on histone 3 protein (H3K4me2 / l and H3K9me2 / l), which results in transcriptional repression or activation, respectively.
[0072]
[0064] As used herein, the terms “LSD1 inhibitor” of “inhibitor of LSD1” refer to an agent that reduces, decreases, blocks or inhibits the expression or activity of LSD1. For example, the LSD1 inhibitor can block or disrupt the catalytic active site of LSD1 or block or disrupt the generation of LSD1 protein. The LSD1 inhibitor can be, e.g., a selective LSD1 inhibitor or a non- selective LSD1 inhibitor.
[0073]
[0065] Inhibitors of LSD1 include, but are not limited to those described in U.S. Patent Nos. 9,493,442; 9,346,840; 9,388,123; 9,670,210; 7,970,196; 9,795,597; 9,809,541 ; 9,944,647; 10,059,668; 10,064,854; 10,174,030; 10,233,152; 10,265,279; 10,300,051 ; 10,329,255; 10,717,737; 10,723,700; 10, 800, 779;11,013,698; 11,247,992; 11,433,053; 11,498,900, U.S. Patent Application Nos. US20170283397, US20170209432, US20170044101, 20220119401 ; 20220064126; and International Patent Application Nos. W02020052647, each of which is herein incorporated by reference in its entirety.
[0074]
[0066] In some embodiments, the LSD1 inhibitors include a gene silencing or downregulating oligonucleotide (e.g., an siRNA, an antisense oligonucleotide, a short-hairpin RNA, a miRNA, a dicer-substrate RNA, a DNAzyme, a guide RNA, a small circular RNA, an aptamer targeting the gene or messenger RNA), one or more components of a gene editing system, a protein configured to bind LSD1 (e.g., an antibody (e.g., a monoclonal, polyclonal, murine, chimeric, humanized, or human antibody targeting)), a small molecule inhibitor of LSD 1, or combinations thereof.
[0075]
[0067] Exemplary LSD1 inhibitors include, MAO inactivators and derivatives thereof (e.g., Pargyline, tranylcypromine phenelzine, Tran.v-2-phenylcyclopropylamine hydrochloride (2-PCPA), ORY-1001 (ladademstat dihydrochloride), GSK2879552, NCL-1, NCL-2, any derivatives thereof), natural products and derivatives thereof (e.g., baicalin, resveratrol, geranylgeranoic acid (GGA), protoberberine, curcumin, xanthones, stilbenes, flavonoids and cyclic peptides (e.g., polymyxins B and E)), peptide inhibitors, (e.g., peptides targeting the substrate-binding domain of LSD 1), polyamine-based inhibitors (e.g., bisguanidine, biguanide, (bis)-thioureidopropyldiamine compounds), and metal-based inhibitors (e.g., rhodium(III) complexes).
[0076]
[0068] Suitable small molecule LSD 1 inhibitors include, but are not limited to, tranylcypromine ((lR,2S)-2-phenylcyclopropan-l -amine), iadademstat (ORY-1001; N'-((lR,2S)-2- phenylcyclopropyl)-cyclohexane-l,4-diamine dihydrochloride), Vafidemstat (GRY-2001; 5- ((((lR,2S)-2-(4-(benzyloxy)-phenyl)cyclopropyl)amino)methyl)-l,3,4-oxadiazol-2-amine), GSK- 2879552 (4-((4-(((lR,2S)-2-phenylcyclopropyl)-amino)cyclohexyl)amino)benzoic acid dihydrochloride), bomedemstat (IMG-7289; N-[(2S)-5-{ [(lR, 2S)-2-(4-fluorophenyl) cyclopropyl]amino } - 1 -(4-methylpiperazin- 1 -yl)- 1 -oxopentan-2-yl]-4-( 1H- 1 ,2,3-triazoL 1 - yl)benzamide ditosylate), INCB059872 (l-((4-(methoxymethyl)-4-((((lR,2S)-2- phenylcyclopropyl)amino)methyl)piperidin- 1 -yl)methyl)cyclobutane- 1 -carboxylic acid ditosylate), TAK-418 (5-{(lR,2R)-2-[(Cyclopropylmethyl)amino]cyclopropyl}-N-(tetrahydro-2H-pyran-4- yl)thiophene-3-carboxamide monohydrochloride), pulrodemstat (CC-90011; 4-(6-(4- aminocyclohexyl)-3-(3-fluoro-4-methoxyphenyl)-2-oxo-l,2-dihydropyridin-4-yl)-2- fluorobenzonitrile besylate), JB 1-802, and seclidemstat (SP-2577; (E)-N-(l-(5-chloro-2- hydroxyphenyl)-ethylidene)-3-((4-methylpiperazin- 1 -yl)sulfonyl)benzohydrazide) have entered clinical trials for cancer studies. See also Fang, Y. Acta Pharmaceutica Sinica B, 2021, 1 1(3), 621- 631 and Yang, G.-J.; Molecules 2018, 23, 3194. In select embodiments, the LSD1 inhibitor is RN1 (7-e / -l-(4-methyl-l-piperazinyl)-2-[[(lR,2S)-2-[4-(phenylmethoxy)phenyl]cyclopropyl]amino]- ethanone, dihydrochloride) or iadademstat (ORY-1001). b) Inhibitors of DNMT1
[0077] [69| In some embodiments, the methods comprise contacting a cell with one or more inhibitors of DNA-methyltransferase 1 (DNMT1) or administering to a subject one or more inhibitors of DNA- methyltransferase 1 (DNMT1). DNMT1 is primarily responsible for maintaining the methylation pattern in daughter strands following DNA replication
[0078]
[0070] As used herein, the terms “DNMT1 inhibitor” of “inhibitor of DNMT1” refer to an agent that reduces, decreases, blocks or inhibits the expression or activity of DNMT1. For example, the DNMT1 inhibitor can block or disrupt the catalytic active site of DNMT1 or block or disrupt the generation of DNMT1 protein. The DNMT1 inhibitor can be, e.g., a selective DNMT1 inhibitor or a non-selective DNMT1 inhibitor.
[0079]
[0071] Inhibitors of DNMT1 include, but are not limited to those described in U.S. Patent Nos. 9,383,364; 9,737,493; 9,840,500; 9,963,705; 10,975,056; 11,518,779; and International Patent Application Nos. W02020052647, each of which is hereby incorporated by reference in its entirety.
[0080]
[0072] In some embodiments, the DNMT1 inhibitors include a gene silencing or downregulating oligonucleotide (e.g., an siRNA, an antisense oligonucleotide (e.g., MG98), a short-hairpin RNA, a miRNA, a dicer-substrate RNA, a DNAzyme, a guide RNA, a small circular RNA, an aptamer targeting the gene or messenger RNA), one or more components of a gene editing system, a protein configured to bind DNMT1 (e.g., an antibody (e.g., a monoclonal, polyclonal, murine, chimeric, humanized, or human antibody targeting)), a small molecule inhibitor of DNMT1, or combinations thereof.
[0081]
[0073] Exemplary small molecule DNMT1 inhibitors include, but are not limited to, 5'- azacytadine and 5'-aza-2' deoxycytidine (decitabine), SGI-110 (2’- deoxy-5-azacytidylyl-(3’- 5')-2’- deoxyguanosine), disulfiram, GSK3484862 ((R)-2-((3,5-dicyano-6-(dimethylamino)-4-ethylpyridin- 2-yl)thio)-2-phenylacetamide), RG108 (N-phthalyl-L- tryptophan), zebularine (pyrimidin-2-one beta-ribofuranoside), procainamide, procaine, hydralazine, NSC 14778, Olsalazine, (A2)isoxazoline, epigallocatechin-3-gallate (EGCG), SGI-1027, SW155246, SW15524601, and SW155246-2. See also Medina-Franco et al., Int. J. Mol. Sci. 2014, 15(2), 3253-3261; Medina-Franco et al., Molecular Diversity, 2013, 17(10), 1007; and Yoo et al., Computations Molecular Bioscience, 1 (1):7- 16 (2011). In some embodiments, the DNMT1 inhibitor is a 2'-deoxycytidine analog. In select embodiments, the DNMT1 inhibitor is decitabine. c) Gene Silencing and Downregulating Oligonucleotides
[0082]
[0074] In some embodiments, the inhibitors of LSD 1 and DNMT1 include gene silencing and downregulating oligonucleotides. Gene silencing and downregulating olignucleotides include antisense oligonucleotides, ribozymes, guide oligonucleotides, siRNA compounds, single- or double- stranded RNA interference (RNAi) compounds such as siRNA compounds, modified hases / locked nucleic acids (LNAs), peptide nucleic acids (PNAs), and other oligomeric compounds or oligonucleotide mimetics which hybridize to at least a portion of the target nucleic acid and modulate its function. In some embodiments, the gene silencing or downregulating oligonucleotides include antisense RNA, antisense DNA, chimeric antisense oligonucleotides, antisense oligonucleotides comprising modified linkages, interference RNA (RNAi), short interfering RNA (siRNA); a micro, interfering RNA (miRNA); a small, temporal RNA (stRNA); or a short, hairpin RNA (shRNA); small RNA-induced gene activation (RNAa); small activating RNAs (saRNAs), or combinations thereof.
[0083]
[0075] In some embodiments, the gene silencing or downregulating oligonucleotides (e.g., an siRNA, an antisense oligonucleotide, a short-hairpin RNA, a miRNA, a dicer-substrate RNA, a DNAzyme, a guide RNA, a small circular RNA, an aptamer targeting the gene or messenger RNA) comprise at least one chemical modification or chemically modified base or nucleoside. The chemical modifications may comprise any modification which is or is not present in naturally occurring forms of adenosine, guanosine, uridine, thymidine, or cytidine ribonucleosides or deoxyribnucleosides. For example, an engineered target nucleic acid may include both naturally occurring and non-naturally occurring modifications. Chemical modifications may be located in any portion of the engineered target nucleic acid and the engineered target nucleic acid may contain any percentage of modified nucleosides (1-100%). A particular modification may be used for every particular type of nucleoside or base (e.g., every uridine is modified to a 1 -methyl-pseudouridine) or on a per base level. In some embodiments, the at least one chemical modification comprises a modified uridine residue. In some embodiments, the at least one chemical modification comprises a modified thymidine residue. In some embodiments, the at least one chemical modification comprises a modified cytosine residue. In some embodiments, the at least one chemical modification comprises a modified adenine residue. In some embodiments, the at least one chemical modification comprises a modified guanine residue.
[0084]
[0076] In some embodiments, the nucleosides of the gene silencing or downregulating oligonucleotides may be linked together using one or more modified intemucleoside linkages. Representative phosphorus-containing intemucleoside linkages include, but are not limited to, phosphates, which contain a phosphodiester bond, phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates, and phosphorodithioates. Modified internucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide
[0085]
[0077] In some embodiments, the gene silencing or downregulating oligonucleotides are 10 to 50, 10 to 20, 10 to 25, 13 to 50, or 13 to 30 nucleotides in length. The gene silencing or downregulating oligonucleotides may be 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, or any range therein.
[0086]
[0078] The gene silencing or downregulating oligonucleotides are sufficiently complementary to the target sequence, e.g., hybridize sufficiently well and with sufficient specificity, to give the desired effect. “Complementary” refers to the capacity for pairing, through hydrogen bonding, between two sequences comprising naturally or non-naturally occurring bases or analogs thereof. For example, if a base at one position of a gene silencing and downregulating oligonucleotides is capable of hydrogen bonding with a base at the corresponding position of a target nucleic acid, then the bases are considered to be complementary to each other at that position. The target sequence and gene silencing or downregulating oligonucleotide sequence need not exhibit complete complementarity, provided that there is sufficient complementarity to cause hybridization.
[0087]
[0079] Suitable methods can be used to design a gene silencing and downregulating oligonucleotides that binds to the target sequence with sufficient specificity. In some embodiments, the methods include using bioinformatics methods known in the art to identify regions of secondary structure, e.g., one, two, or more stem-loop structures, or pseudoknots, and selecting those regions to target with an inhibitory nucleic acid. For example, gene walk methods can be used to optimize the inhibitory activity of the nucleic acid; for example, a series of oligonucleotides of 10-30 nucleotides spanning the length of a target RNA can be prepared, followed by testing for activity. Optionally, gaps, e.g., of 5-10 nucleotides or more, can be left between the target sequences to reduce the number of oligonucleotides synthesized and tested. GC content is preferably between about 30-60%. Contiguous runs of three or more Gs or Cs should be avoided where possible (for example, it may not be possible with very short (e.g., about 9-10 nt) oligonucleotides).
[0088]
[0080] In some embodiments, the gene silencing or downregulating oligonucleotides can be designed to target a specific region of the RNA sequence or gene. For example, a specific functional region can be targeted, e.g., a region comprising a known localization motif (i.e., a region complementary to the target nucleic acid on which the RNA acts). Alternatively or in addition, highly conserved regions can be targeted, e.g., regions identified by aligning sequences from disparate species such as primate (e.g., human) and rodent (e.g., mouse) and looking for regions with high degrees of identity. d) Gene Editing System
[0089]
[0081] In some embodiments, the gene silencing or downregulating oligonucleotides are part of a gene editing system. Thus, in some embodiments, the inhibitors of LSD1 and DNMT1 include a gene editing system. The gene editing system may be used to modulate (e.g., repress or activate (e.g., via CRISPRi or CRISPRa) a target gene (e.g., LSD1 or DNMT1), introduce one or more nucleotide substitutions, addition, or deletions into a target gene (e.g., to insert a mutation, disrupt target gene expression, or alter a promoter region for a target gene), or delete a target gene. For example, the gene editing system may alter the SEC23A promoter sequence to modulate transcription. In some embodiments, the region of the SEC23 A promoter that is altered may be that which interacts with epigenetic and chromatin modifying enzymes, e.g., the promoter region of SEC23A which is recognized and occupied by LSD1 to downregulate SEC23A. Alternatively, the gene editing system may alter the LSD1 gene or the DNMT1 gene to decrease their expression.
[0090]
[0082] The gene editing system may encode a zinc-finger nuclease, a homing endonuclease, a TALEN (transcription activator-like effector nuclease), a NgAgo (argonaute endonuclease), a SGN (structure-guided endonuclease), or an RNA-guided endonuclease or components of a CRISPR-Cas system. Thus, the inhibitors may further include one or more components of a gene editing system.
[0091]
[0083] A “CRISPR-Cas system” refers collectively to transcripts and other elements involved in the expression of and / or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, Cas protein, a cr (CRISPR) sequence (e.g., crRNA or an active partial crRNA), or other sequences and transcripts from a CRISPR locus. In some embodiments, one or more elements of a CRISPR system is derived from a type I, type II, or type III CRISPR system. The CRISPR-Cas system can be an engineered system for use in activation, repression, or deletion of a target gene (e.g., CRISPRi, CRISPRa). CRISPR-Cas editing technology is described in detail in, for example, U.S. Patent Nos. 8,546,553, 8,697,359; 8,771,945; 8,795,965; 8,865,406; 8,871,445; 8,889,356; 8,889,418; 8,895,308; 8,9066,616; 8,932,814; 8,945,839; 8,993,233; 8,999,641;
[0092] 9,115,348; 9,149,049; 9,493,844; 9,567,603; 9,637,739; 9,663,782; 9,404,098; 9,885,026; 9,951,342; 10,087,431 ; 10,227,610; 10,266,850; 10,601,748; 10,604,771 ; and 10,760,064; and U.S. Patent Application Publication Nos. US2010 / 0076057; US2014 / 0113376; US2015 / 0050699;
[0093] US2015 / 0031134; US2014 / 0357530; US2014 / 0349400; US2014 / 0315985; US2014 / 0310830; US2014 / 0310828; US2014 / 0309487; US2014 / 0294773; US2014 / 0287938; US2014 / 0273230; US2014 / 0242699; US2014 / 0242664; US2014 / 0212869; US2014 / 0201857; US2014 / 0199767; US2014 / 0189896; US2014 / 0186919; US2014 / 0186843; and US2014 / 0179770, each incorporated herein by reference in its entirety.
[0094]
[0084] For example, the gene editing system may comprise one or more Cas proteins (e.g., Cas9), or other RN A- guided nucleases, to work in conjunction with one or more guide RNAs directed to the target gene (e.g., LSD1 or DNMT1). RNA sequences employed in CRISPR / Cas systems are referred to collectively as “guide RNA” (gRNA) or single guide RNA (sgRNA). Thus, the terms “guide RNA,” “single guide RNA,” and “synthetic guide RNA,” are used interchangeably herein and may refer to a nucleic acid sequence comprising a tracrRNA and a pre-crRNA array containing a guide sequence. The terms “guide sequence,” “guide,” and “spacer,” are used interchangeably herein and refer to the nucleotide sequence within a guide RNA that specifies the target gene. Similar to the gene silencing and downregulating oligonucleotides, the guide sequence of the gRNA does not need to be completely complementary to the target site for modification. e) Nucleic Acids & Delivery
[0095]
[0085] The present disclosure also provides for DNA segments encoding the proteins (e.g., antibodies, or fragments thereof to LSD1 or DNMT1 ; Cas proteins or other nucleases) and nucleic acids (e.g., nucleic acids and vectors encoding the disclosed proteins, gene silencing or downregulating oligonucleotides) disclosed herein, vectors containing these segments and cells containing the vectors. The vectors may be used to propagate the segment in an appropriate cell and / or to allow expression from the segment (e.g., an expression vector). The person of ordinary skill in the art would be aware of the various vectors available for propagation and expression of a nucleic acid sequence.
[0096]
[0086] The nucleic acid encoding the proteins or nucleic acids disclosed herein may be any nucleic acid including DNA, RNA, or combinations thereof. In some embodiments, the nucleic acid encoding the proteins comprises a messenger RNA or a vector.
[0097]
[0087] In certain embodiments, engineering the nucleic acid for use in eukaryotic cells may involve codon-optimization. It will be appreciated that changing native codons to those most frequently used in mammals allows for maximum expression of the system proteins in mammalian cells (e.g., human cells). Such modified nucleic acid sequences are commonly described in the art as “codon-optimized,” or as utilizing “mammalian-preferred” or “human-preferred” codons. In some embodiments, the nucleic acid sequence is considered codon-optimized if at least about 60% (e.g., 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%) of the codons encoded therein are mammalian preferred codons.
[0088] The present disclosure further provides engineered, non-naturally occurring vectors and vector systems, which can encode the proteins (e.g., Cas proteins or other nucleases) or nucleic acids (e.g., nucleic acids and vectors encoding the disclosed proteins, gene silencing or downregulating oligonucleotides) disclosed herein. The vector(s) can be introduced into a cell that is capable of expressing the polypeptide encoded thereby, including any suitable prokaryotic or eukaryotic cell.
[0098]
[0089] Viral and non-viral based gene transfer methods can be used to introduce nucleic acids encoding the proteins (e.g., Cas proteins or other nucleases) or nucleic acids (e.g., nucleic acids and vectors encoding the disclosed proteins, gene silencing or downregulating oligonucleotides) disclosed herein into cells, tissues, or a subject. Such methods can be used to administer nucleic acids encoding the proteins (e.g., Cas proteins or other nucleases) or nucleic acids (e.g., nucleic acids and vectors encoding the disclosed proteins, gene silencing or downregulating oligonucleotides) disclosed herein to cells in culture, or in a host organism. Non-viral vector delivery systems include DNA plasmids, cosmids, RNA (e.g., a transcript of a vector described herein), a nucleic acid, and a nucleic acid complexed with a delivery vehicle. Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell. Viral vectors include, for example, retroviral, lentiviral, adenoviral, adeno-associated and herpes simplex viral vectors.
[0099]
[0090] In certain embodiments, plasmids that are non-replicative, or plasmids that can be cured by high temperature may be used, such that the nucleic acid encoding the proteins or nucleic acids disclosed herein may be removed from the cells under certain conditions.
[0100]
[0091] A variety of viral constructs may be used to deliver the proteins or nucleic acids disclosed herein to the targeted cells and / or a subject. Nonlimiting examples of such recombinant viruses include recombinant adeno-associated virus (AAV), recombinant adenoviruses, recombinant lentiviruses, recombinant retroviruses, recombinant herpes simplex viruses, recombinant poxviruses, phages, etc. The present disclosure provides vectors capable of integration in the host genome, such as retrovirus or lentivirus. See, e.g., Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989; Kay, M. A., et al., 2001 Nat. Medic. 7(1 ):33-40; and Walther W. and Stein U., 2000 Drugs, 60(2): 249-71, incorporated herein by reference.
[0101]
[0092] In one embodiment, a DNA segment encoding the proteins or nucleic acids disclosed herein is contained in a plasmid vector that allows expression of the protein(s) and subsequent isolation and purification of the protein produced by the recombinant vector. Accordingly, the proteins can be purified following expression, obtained by chemical synthesis, or obtained by recombinant methods.
[0093] In certain embodiments, vectors of the present disclosure can drive the expression of one or more sequences in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 (Seed, Nature (1987) 329:840, incorporated herein by reference) and pMT2PC (Kaufman, et al., EMBO J. (1987) 6: 187, incorporated herein by reference). When used in mammalian cells, the expression vector's control functions are typically provided by one or more regulatory elements. For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, simian virus 40, and others disclosed herein and known in the art. For other suitable expression systems for both prokaryotic and eukaryotic cells see, e.g., Chapters 16 and 17 of Sambrook, et al., MOLECULAR CLONING: A LABORATORY MANUAL. 2nd eds., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989, incorporated herein by reference.
[0102]
[0094] Vectors of the present disclosure can comprise any of a number of promoters known to the art, wherein the promoter is constitutive, regulatable or inducible, cell type specific, tissue-specific, or species specific. In addition to the sequence sufficient to direct transcription, a promoter sequence of the invention can also include sequences of other regulatory elements that are involved in modulating transcription (e.g., enhancers, Kozak sequences and introns). Many promoter / regulatory sequences useful for driving constitutive expression of a gene are available in the art and include, but are not limited to, for example, CMV (cytomegalovirus promoter), EFla (human elongation factor 1 alpha promoter), SV40 (simian vacuolating virus 40 promoter), PGK (mammalian phosphoglycerate kinase promoter), Ubc (human ubiquitin C promoter), human beta-actin promoter, rodent beta-actin promoter, CBh (chicken beta-actin promoter), CAG (hybrid promoter contains CMV enhancer, chicken beta actin promoter, and rabbit beta-globin splice acceptor), TRE (Tetracycline response element promoter), Hl (human polymerase III RNA promoter), U6 (human U6 small nuclear promoter), and the like. Additional promoters that can be used for expression of the components of the present system, include, without limitation, cytomegalovirus (CMV) intermediate early promoter, a viral LTR such as the Rous sarcoma virus LTR, HIV-LTR, HTLV-1 LTR, Maloney murine leukemia virus (MMLV) LTR, myeoloproliferative sarcoma virus (MPSV) LTR, spleen focusforming virus (SFFV) LTR, the simian virus 40 (SV40) early promoter, herpes simplex tk virus promoter, elongation factor 1 -alpha (EFl -a) promoter with or without the EFl -a intron. Additional promoters include any constitutively active promoter. Alternatively, any regulatable promoter may be used, such that its expression can be modulated within a cell.
[0103]
[0095] Moreover, inducible and tissue specific expression of a nucleic acid or protein can be accomplished by placing the nucleic acid encoding such a molecule under the control of an inducible or tissue specific promoter / regulatory sequence. Examples of tissue specific or inducible promoter / regulatory sequences which are useful for this purpose include, but are not limited to, the rhodopsin promoter, the MMTV LTR inducible promoter, the SV40 late enhancer / promoter, synapsin 1 promoter, ET hepatocyte promoter, GS glutamine synthase promoter and many others. Various ubiquitous as well as tissue-specific promoters and tumor- specific are commercially available, for example from InvivoGen. In addition, promoters which are well known in the art can be induced in response to inducing agents such as metals, glucocorticoids, tetracycline, hormones, and the like, are also contemplated for use with the invention. Thus, it will be appreciated that the present disclosure includes the use of any promoter / regulatory sequence known in the art that is capable of driving expression of the desired protein or RNA operably linked thereto.
[0104]
[0096] The vectors of the present disclosure may direct expression of the nucleic acid in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid). Such regulatory elements include promoters that may be tissue specific or cell specific. The term “tissue specific” as it applies to a promoter refers to a promoter that is capable of directing selective expression of a nucleotide sequence of interest to a specific type of tissue (e.g., seeds) in the relative absence of expression of the same nucleotide sequence of interest in a different type of tissue. The term “cell type specific” as applied to a promoter refers to a promoter that is capable of directing selective expression of a nucleotide sequence of interest in a specific type of cell in the relative absence of expression of the same nucleotide sequence of interest in a different type of cell within the same tissue. The term “cell type specific” when applied to a promoter also means a promoter capable of promoting selective expression of a nucleotide sequence of interest in a region within a single tissue. Cell type specificity of a promoter may be assessed using methods well known in the art, e.g., immunohistochemical staining.
[0105]
[0097] Additionally, the vector may contain, for example, some or all of the following: a selectable marker gene, such as the neomycin gene for selection of stable or transient transfectants in host cells; enhancer / promoter sequences from the immediate early gene of human CMV for high levels of transcription; transcription termination and RNA processing signals from SV40 for mRNA stability; 5 ’-and 3 ’-untranslated regions for mRNA stability and translation efficiency from highly- expressed genes like a-globin or (3-globin; SV40 polyoma origins of replication and ColEl for proper episomal replication; internal ribosome binding sites (IRESes), versatile multiple cloning sites; T7 and SP6 RNA promoters for in vitro transcription of sense and antisense RNA; a “suicide switch” or “suicide gene” which when triggered causes cells carrying the vector to die (e.g., HSV thymidine kinase, an inducible caspase such as iCasp9), and reporter gene for assessing expression of the chimeric receptor. Suitable vectors and methods for producing vectors containing transgenes are well known and available in the art. Selectable markers also include chloramphenicol resistance, tetracycline resistance, spectinomycin resistance, streptomycin resistance, erythromycin resistance, rifampicin resistance, bleomycin resistance, thermally adapted kanamycin resistance, gentamycin resistance, hygromycin resistance, trimethoprim resistance, dihydrofolate reductase (DHFR), GPT; the URA3, HIS4, LEU2, and TRP1 genes of S. cerevisiae.
[0106]
[0098] When introduced into the cell, the vectors may be maintained as an autonomously replicating sequence or extrachromosomal element or may be integrated into host DNA.
[0107]
[0099] The present proteins, nucleic acids, and compositions comprising the proteins and / or nucleic acids described herein may be delivered by any suitable means. In certain embodiments, they are delivered in vivo, as described above. In other embodiments, the proteins, nucleic acids, and compositions comprising the proteins and / or nucleic acids are delivered to isolated / cultured cells (e.g., autologous iPS cells) in vitro to provide modified cells useful for in vivo delivery to patients afflicted with a disease or condition.
[0108]
[0100] As described above, the proteins or nucleic acids may be introduced into cells by methods known in the art. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a mammalian cell (e.g., a cell of a non-human primate or a human cell). Accordingly, provided herein are cells comprising the disclosed proteins or nucleic acids encoding thereof.
[0109]
[0101] Vectors according to the present disclosure can be transformed, transfected, or otherwise introduced into a wide variety of host cells. Transfection refers to the taking up of a vector by a host cell whether or not any coding sequences are in fact expressed. Numerous methods of transfection are known to the ordinarily skilled artisan, for example, lipofectamine, calcium phosphate coprecipitation, electroporation, DEAE-dextran treatment, microinjection, viral infection, and other methods known in the art. Transduction refers to entry of a virus into the cell and expression (e.g., transcription and / or translation) of sequences delivered by the viral vector genome. In the case of a recombinant vector, “transduction” generally refers to entry of the recombinant viral vector into the cell and expression of a nucleic acid of interest delivered by the vector genome.
[0110]
[0102] Any of the vectors comprising a nucleic acid sequence that encodes proteins (e.g., Cas proteins or other nucleases) or nucleic acids (e.g., nucleic acids and vectors encoding the disclosed proteins, gene silencing or downregulating oligonucleotides) disclosed herein is also within the scope of the present disclosure. Such a vector may be delivered into host cells by a suitable method.
[0111] Methods of delivering vectors to cells are well known in the art and may include DNA or RNA electroporation, transfection reagents such as liposomes or nanoparticles to delivery DNA or RNA; delivery of DNA, RNA, or protein by mechanical deformation (see, e.g., Share! et al. Proc. Natl. Acad. Sci. USA (2013) 110(6): 2082-2087, incorporated herein by reference); or viral transduction. In some embodiments, the vectors are delivered to host cells by viral transduction. Nucleic acids can be delivered as part of a larger construct, such as a plasmid or viral vector, or directly, e.g., by electroporation, lipid vesicles, viral transporters, microinjection, and biolistics (high-speed particle bombardment). Similarly, the vector can be delivered by any method appropriate for introducing nucleic acids into a cell.
[0112]
[0103] Additionally, delivery vehicles such as nanoparticle- and lipid-based mRNA or protein delivery systems can be used. Further examples of delivery vehicles include lentiviral vectors, ribonucleoprotein (RNP) complexes, lipid-based delivery system, gene gun, hydrodynamic, electroporation or nucleofection microinjection, and biolistics. Various gene delivery methods are discussed in detail by Nayerossadat et al. (Adv Biomed Res. 2012; 1 : 27) and Ibraheem et al. (Int J Pharm. 2014 Jan 1 ;459(1 -2) :70-83), incorporated herein by reference. f) Dosage and Administration
[0113]
[0104] The terms “effective amount” or “therapeutically effective amount,” as used herein, refer to a sufficient amount that is delivered to a subject, either in a single dose or as part of a series, which is effective for inducing a response in the subject. This amount varies depending upon the health and physical condition of the subject to be treated, the selected inhibitor and formulations thereof, and other relevant factors. It is expected that the amount will fall in a relatively broad range that can be determined by one of skill in the art through routine trials.
[0114]
[0105] The route and regimen of administration will vary depending upon the subject and is to be determined by the skilled practitioner. For example, the inhibitors disclosed herein may be administered parentally, e.g., in intravenous (either by bolus or infusion methods), intraperitoneal, subcutaneous, topical with or without occlusion, or intramuscular form. In any of the uses or methods described herein, administration may be by various routes known to those skilled in the art, including without limitation oral, inhalation, intravenous, intramuscular, topical, subcutaneous, systemic, and / or intraperitoneal administration to a subject in need thereof.
[0115]
[0106] The administration may comprise an initial dose and at least one subsequent dose. The subsequent doses will be adequately spaced at such times where the levels of inhibitor fall below a desired level. Subsequent does may be the same or different dosage, and comprise the same or different formulations. The specific dose level may depend upon a variety of factors including the activity of the inhibitor, the age, body weight, general health, and diet of the subject, time of administration, and route of administration. For prophylaxis purposes, the amount in each dose is an amount which induces a protective response without significant adverse side effects.
[0116]
[0107] The administration of any of the above inhibitors can be in the form of a composition comprising excipients or pharmaceutically acceptable carriers. The choice of excipients or pharmaceutically acceptable carriers will depend on factors including, but not limited to, the particular mode of administration, the effect of the excipient on solubility and stability, and the nature of the dosage form.
[0117]
[0108] Excipients and carriers may include any and all solvents, dispersion media, antibacterial and antifungal agents, isotonic and absorption delaying agents. Some examples of materials which can serve as excipients and / or carriers are sugars including, but not limited to, lactose, glucose and sucrose; starches including, but not limited to, com starch and potato starch; cellulose and its derivatives including, but not limited to, sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients including, but not limited to, cocoa butter and suppository waxes; oils including, but not limited to, peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; glycols; including propylene glycol; esters including, but not limited to, ethyl oleate and ethyl laurate; agar; buffering agents including, but not limited to, magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol, and phosphate buffer solutions, as well as other nontoxic compatible lubricants including, but not limited to, sodium lauryl sulfate and magnesium stearate, as well as coloring agents, releasing agents, preservatives, and antioxidants. Techniques and formulations may be found, for example, in Remington's Pharmaceutical Sciences, 19th Edition (Mack Publishing Company, 1995). The route or administration and the form of the composition usually dictates the type of carrier to be used.
[0118]
[0109] The compositions may be formulated for any appropriate manner of administration, and thus administered, including for example, oral, nasal, intraocular, intravenous, intravaginal, epicutaneous, sublingual, intracranial, intradermal, intraperitoneal, subcutaneous, intramuscular administration, or via inhalation. Techniques and formulations may generally be found in “Remington’s Pharmaceutical Sciences,” (Meade Publishing Co., Easton, Pa.). Therapeutic or pharmaceutical compositions must typically be sterile and stable under the conditions of manufacture and storage.
[0119] [HO] The inhibitors or a composition thereof can be evaluated for efficacy and toxicity using known methods. For example, the toxicology may be established by determining in vitro toxicity towards a cell line, such as a mammalian, and preferably human, cell line. The results of such studies are often predictive of toxicity in animals, such as mammals, or more specifically, humans. Alternatively, the toxicity in an animal model, such as mice, rats, rabbits, dogs, or monkeys, may be determined using known methods. The efficacy may be established using several recognized methods, such as in vitro methods, animal models, or human clinical trials. When selecting a model to determine efficacy, the skilled artisan can be guided by the state of the art to choose an appropriate model, dose, route of administration and / or regime.
[0120] [1H] It should be noted that the attending physician would know how to and when to terminate, interrupt, or adjust administration due to toxicity or organ dysfunctions. Conversely, the attending physician would also know to adjust treatment to higher levels if the clinical response were not adequate (precluding toxicity). The magnitude of an administrated dose in the management of the disorder of interest will vary with the severity of the aneurysm and the route of administration. Further, the dose, and perhaps dose frequency, will also vary according to the age, body weight, and response of the individual patient. A program comparable to that discussed above may be used in veterinary medicine.
[0121]
[0112] A wide range of additional therapies may be used in conjunction with the methods of the present disclosure. The additional therapy may be administration of an additional active agent or may be a second therapy not connected to administration of another agent. Such additional therapies include, but are not limited to, transfusions, hematopoietic stem cell transplantation, bone marrow transplantations, splenectomy, and medications to prevent iron overload (e.g., deferoxamine, deferiprone, deferasirox).
[0122] Examples
[0123]
[0113] The following are examples of the present invention and are not to be construed as limiting.
[0124] Example 1
[0125]
[0114] A K562 cell line that reports the SEC23A protein level To identify compounds that increase the SEC23A level, a reporter human erythroid K562 cell line expressing SEC23A-eGFP from the SEC23A endogenous locus was generated (FIG. 1 A). eGFP expression from an off-target site was ruled out by showing that deletion of SEC23A (using CRISPR / Cas9) resulted in decreased intracellular eGFP (FIG. IB) and that activation of SEC23A (using CRISPRa) resulted in increased intracellular eGFP (FIG. 1C).
[0126] [H5] Screening for compounds that increase the SEC23A protein level Approximately 5,000 compounds from a drug repurposing library, including compounds tested in human studies and FDA approved compounds, were tested for their ability to increase SEC23A-eGFP. The screen was performed in a high-throughput fashion using multichannel plate handling robotics for compound application in 384-well plates. Compounds were incubated with the reporter cell line at lOuM for 48 hours, and eGFP fluorescence was measured using the automated BioRad ZE5 cell analyzer (FIG. ID).
[0116] Validation in a HUDEP2 cell line that reports the SEC23A level One hundred and fifty- four compounds were found to increase eGFP levels in the reporter K562 cell line (FIG. IE). These compounds were tested in a HUDEP2 reporter cell line that expresses SEC23A-eGFP from the SEC23A endogenous locus, which was generated as described above for the reporter K562 cell line. These compounds were screened at four different concentrations (lOuM, 3.3uM, l.luM, and 0.37uM) using the same strategy as in FIG. ID. Forty-four compounds were found to increase the eGFP fluorescence level in the reporter HUDEP2 cell line (FIG. IE).
[0127]
[0117] These 44 compounds were individually tested for their impact on SEC23A-eGFP fluorescence in the HUDEP2 reporter cell line. The compound resulting in the highest increase in SEC23A-eGFP was ORY-lOOl, a potent and covalent LSD1 inhibitor. ORY-lOOl resulted in a dosedependent increase in SEC23A-eGFP fluorescence intensity (FIG. 7).
[0128] Example 2
[0129]
[0118] LSD1 inhibition results in increased SEC23A mRNA in primary hitman erythroid cells To exclude the possibility that the findings described above may be an artifact of immortalized cell lines, the impact of LSD1 inhibition on SEC23A expression was examined in primary human erythroid cells differentiated from human CD34+ hematopoietic stem and progenitor cells (HSPCs) in vitro (FIGS. 2 and 13). The ESDI inhibitor RN 1 , previously tested in vivo demonstrating safety in both mouse model of sickle cell disease and baboon, was used. Treatment of differentiating HSPCs isolated from in 3 independent donors with 0.16 nM to 12 nM RN1 (FIG. 2A) resulted in increased erythroid SEC23A mRNA levels in a dose-dependent fashion (FIG. 2B and 2H). For example, RN1 treatment at the doses of 0.16 nM, 0.47 nM, and 1.4 nM, resulted in 1.52, 3.24, and 15.3-fold increase in SEC23A mRNA expression in primary erythroid cells (FIG. 2B and 2H). HSPCs were obtained from an additional donor and a statistically significant increase in erythroid SEC23A mRNA levels was seen with RN1 treatment (FIG. 2H). Similarly, another LSD1 inhibitor, GSK690, also resulted in increased SEC23A mRNA levels in erythroid cells differentiated from HSPCs harvested from 3 independent donors (FIG. 8).
[0130]
[0119] Impact ofRNl administration on erythroid development RN1 administration did not impair erythropoiesis at most doses tested, including at doses that significantly increased SEC23A mRNA expression. The growth rate of erythroid cells differentiated from HSPCs was not affected by RN1 at 0.16 nM, 0.47 nM, and 1.4 nM, but was reduced at higher doses of RN1 (FIGS. 2C, 21). Similarly, the erythroid differentiation capacity of HSPCs treated with 0.16 nM, 0.47 nM, and 1.4 nM of RN1 was indistinguishable from that of control cells treated with DMSO, but appeared to be mildly impaired at the higher RN1 concentrations tested (FIGS. 2D, 2J).
[0120] LSD1 inhibition was previously shown to induce the expression of HBG1 / 2, which encodes gamma-globin. However, the RN 1 dose required to induce HBG1 / 2 to a meaningful level for sickle cell disease was higher than the dose needed to meaningfully induce SEC23A for CD AIL For example, 500 nM RN1 was shown to increase the HBG1 / 2 mRNA level by ~15-fold, while 1.4 nM RN1 was sufficient to induce SEC23A mRNA to the same extent. At concentrations that do not impair erythroid differentiation, RN1 results in no or little induction of HBG1 / 2 mRNA (FIG. 14), suggesting that the dose of RN 1 needed to significantly induce SEC23A is notably smaller than the dose needed to meaningfully induce HBG1 / 2.
[0131]
[0121] RN1 increases the SEC23A protein level To determine if RN1 results in increased SEC23A protein level at concentrations that do not impair erythropoiesis, differentiating HSPCs were treated with 0.16 nM, 0.47 nM, and 1.4 nM of RN1, and a dose-dependent increase in the SEC23A protein level was seen (FIGS. 2F-2G). Thus, certain doses of LSD1 inhibitors result in increased SEC23A expression without impairing erythropoiesis.
[0132] Example 3
[0133]
[0122] Impact of genetic LSD1 downregulation on the SEC23A mRNA level Using 5 independent shRNAs, LSD1 expression level was downregulated in HSPCs undergoing differentiation and the impact of LSD1 downregulation on the SEC23A mRNA level and on erythroid differentiation was measured (FIG. 3A). shRNA clones obtained from MISSION shRNA from Millipore Sigma are listed below.
[0134] LSD1 shRNAl: AGGAAGGCUCUUCUAGCAAUA (TRCN0000382249; SEQ ID NO: 1) ESDI shRNA2: GCCUAGACAUUAAACUGAAUA (TRCN0000046068; SEQ ID NO: 2) LSD1 shRNA3: CCAACAAUUAGAAGCACCUUA (TRCN0000046070; SEQ ID NO: 3) LSD1 shRNA4: GCUACAUCUUACCUUAGUCAU (TRCN0000046071 ; SEQ ID NO: 4) LSD1 shRNA5: GGAGCUCCUGAUUUGACAAAG (TRCN0000382379; SEQ ID NO: 5)
[0135]
[0123] The experiment was performed in biological triplicates, using HSPCs harvested from 3 independent donors. All 5 LSD -targeting shRNAs were efficient, resulting in 81 -94% reduction in LSD1 mRNA levels (FIGS. 3B and 3D). Notably, compared to control cells transduced with scramble shRNA, LSD1 downregulation resulted in a profound increase in SEC23A mRNA levels, ranging from 7-59 fold (FIGS. 3C and 3E), with no detrimental impact on erythroid differentiation, as demonstrated by analysis of the percentage of CD7 l+CD235a+ erythroid cells by flow cytometry at dayl4 of differentiation (FIG. 3D).
[0136] Example 4
[0137]
[0124] Rescue of SEC23B null human erythroid cells with RN1 To test if RN 1 rescues the erythroid differentiation defect observed in SEC23B-deficient CDAII, human CD34+ HSPCs from 3 donors were obtained and differentiated into erythroid cells in vitro. At day 4 of differentiation, cells were electroporated with a ribonucleoprotein complex (RNP) composed of Cas9 protein and either SEC255-targeting sgRNA (GUUGGCCUGCUGCAAAGCAC; SEQ ID NO: 6) or NT-sgRNA (CGCUUCCGCGGCCCGUUCAA; SEQ ID NO: 7) as control. At day 7, differentiating erythroid cells were treated with RN1 or DMSO (FIG. 4A).
[0138]
[0125] SEC23B deletion in differentiating HSPCs was performed by electroporation of Cas9 + 5£'C25B-targeting sgRNA ribonucleoprotein complex at day4 of differentiation. 1.2 uL of Cas9 protein (IDT, Cat# 1081059) was combined with 0.5uL of lOOuM 5EC255-targeting sgRNA (or NT- sgRNA) at room temperature for 25-minutes. For each electroporation reaction, 105CD34+ HSPCs were washed with PBS once and re-suspended with 16.4 uL nucleofector solution + 3.6 uL supplement (both supplied by P3 Primary cell 4D-nucleofector™ X Kit, Cat# V4XP-3032) + 1 uL electroporation enhancer (IDT, Cat# 1075916). Cells were mixed with sgRNA / Cas9 complex and transferred to nucleocuvette for electroporation using DZ-100 program (Lonza 4D-Nucleofactor). After electroporation, cells were immediately washed with pre-warmed medium once and subsequently cultured.
[0139]
[0126] Electroporation with Cas9 / .S'£’C23 / :LsgRN A RNP resulted in >90% insertion and deletion mutations (indels). Compared to control cells electroporated with NT-sgRNA, disruption of SEC23B results in a significant reduction in erythroid cells at day 14 of differentiation (FIGS. 4B-4C). Treatment of SEC23B deleted cells with RN 1 resulted in significant improvement in the number of HSPC-derived erythroid cells (FIGS. 4B-4C). RN1 treatment did not impair erythroid differentiation, as assessed by flow cytometry for CD71 and CD235a expression (FIGS. 4D-4F) and morphologic evaluation (FIG. 4H).
[0140]
[0127] To further validate the role of RN1 in rescuing CDAII, the latter experiment was repeated and the analyses were expanded. It was confirmed that RN 1 treatment results in amelioration of the SEC23B null erythroid cell counts throughout differentiation (FIG. 15 A). The erythroid differentiation defect observed in SEC23B deleted cells was significantly ameliorated with RN1 treatment, as demonstrated by flow cytometry analyses using two different cell surface marker sets (FIGS. 15B-15E) and cytospin analysis (FIG. 15F). Additionally, cells were evaluated for apoptosis at day 12 of differentiation, when the most dramatic fall in cell counts occurs. SEC23B null erythroid cells exhibited an increased proportion of Annexin V positive cells, which was reversed by RN1 (FIGS. 4G and 15G). RN1 treatment rescues the CDAII erythroid defect in primary erythroid cells in vitro, with minimal / no toxicity detected. Example 5
[0141]
[0128] Lsdl deletion in mouse erythroid cells Lsdl was deleted in mouse erythroid cells, using a developed tamoxifen-inducible erythroid specific Gatal-Cr& mouse line (Gata7-CreERT2or GIB) (FIG. 5A). Following tamoxifen administration, basophilic erythroblasts (CD71+Terl l9+CD44+FSChigh) were isolated from Lsdlfl / flGatal -CreERT2and Lsdl+ / +Gatal -CreERT2control mice. Lsdl deletion in erythroid cells resulted in a profound reduction in Lsdl mRNA level as expected (FIG. 5B), associated with a significant increase in Sec23a mRNA level(FIG. 5C).
[0142]
[0129] Treatment of CDAH mice with RN1 Multiple mouse crosses were performed using Sec23a and Sec23b alleles to generate a tamoxifen-inducible murine model for CDAII (Sec23a+ / l1Sec23b!‘'!‘ G / / -CreERT2mice). These mice and Sec23a+ / +Sec23b+ / +Gatoi -CreERT2control mice were placed on tamoxifen chow from days 1-24 and were administered RN1 (1 pM) from days 8-24 (FIG. 5D).
[0143]
[0130] Complete blood counts analysis and peripheral blood reticulocyte percentage were evaluated at day 24 (FIGS. 5E-5F, 16). At the dose used in this report, RN1 did not result in a reduction in white blood cell counts, platelet counts, or peripheral blood reticulocytes (FIG. 16). Compared to control mice, CDAII mice exhibited a significant reduction in RBC counts (FIG. 5E) and hemoglobin levels (FIG. 5F), which were significantly improved with RN1 administration (FIGS. 5E-5F). Bone marrow evaluation demonstrated a significant reduction in orthochromatic erythroblasts in CDAII mice, which was rescued by RN1 treatment (FIGS. 5G and 9). Therefore, RN 1 ameliorates CDAII in vivo.
[0144]
[0131] Lsdl deletion in murine erythroid cells was previously shown to result in erythroid-to- myeloid cell fate conversion. The dose of RN 1 used herein was analyzed to see if it results in the same erythroid lineage decommitment observed with Lsdl deletion. The number of myeloid and erythroid progenitors were not significantly altered in WT or CDAII mice with or without RN 1 treatment (FIG. 17A). Similarly, the numbers of myeloid and erythroid colonies were indistinguishable among WT and CDAII mice treated with RN1 or PBS (FIG. 17B). Altogether, RN1 ameliorates CDAII at a dose that does not appear to result in a notable hematopoietic toxicity.
[0145] Example 6
[0146]
[0132] LSD1 occupies the SEC23A promoter in human erythroid cells To investigate the mechanism by which LSD1 inhibition rescues CDAII, CUT&RUN was performed using a LSD1 antibody in day 11 and day 14 erythroid cells derived from human CD34+ HSPCs. LSD1 occupies the SEC23A promoter (FIG. 6A), suggesting LSD1 represses SEC23A expression.
[0147]
[0133] To validate this finding, lentiviral particles that express Cas9, an sgRNA targeting the middle of the SEC23A promoter sequence bound by LSD1 (SEC23A promoter sgRNA), and a puromycin resistance cassette were generated and transduced in SEC23B deleted HUDEP2 cells, previously shown to exhibit erythroid defects mimicking human CD All. Lentivirus expressing a control NT-sgRNA was used for comparison.
[0148]
[0134] sgRNA targeting the LSD1 binding site at SEC23A promoter (UUAAGCAAGCUCAGGGGUC; SEQ ID NO: 8) or control non-targeting sgRNA (GUUCAUUUCCAAGUCCGCUG; SEQ ID NO: 9) were cloned into LentiCRISPRv2 vectors. Constructs were then packaged into lenti viral particles. HUDEP2 cells were spinfected with lentiviral particles using 4 pg / ml polybrene (lOOOxg for 2-hours at 33° C). After spinfection, cells were pelleted and re-suspended in fresh HUDEP2 expansion media. 24 hours later, 0.3 ug / ml puromycin was added to media for 6 days to remove uninfected cells.
[0149]
[0135] The SEC23A promoter sgRNA resulted in >85% editing efficiency (FIG. 10). SEC23B deficient HUDEP-2 cells transduced with SEC23A promoter sgRNA exhibited increased SEC23A mRNA levels at day 8 of differentiation, in two independent experiments (FIG. 6B). The cell growth defect observed in SEC23B null HUDEP2 cells undergoing differentiation was ameliorated following transduction of SEC23A promoter sgRNA (FIG. 6C). Taken together, these findings suggest that LSD1 occupies the SEC23A promoter, repressing SEC23A transcription and that in the setting of LSD1 inhibition (or disruption of the SEC23A promoter sequence occupied by LSD1), SEC23A expression is de-repressed, resulting in rescue of the CDAII erythroid defect caused by SEC23B deficiency (FIG. 6D).
[0150] Example 7
[0151]
[0136] Impact of decitabine and downregulation ofDnmtl on the SEC23A mRNA level Decitabine treatment also resulted in increased SEC23A mRNA level in erythroid cells differentiated from HSPCs, in a dose-dependent fashion (FIG. 11, left), with no significant detrimental effect on erythroid differentiation, as demonstrated by flow cytometry (FIG. 11 , right). Deletion of Dnmtl , which is inhibited by decitabine, in mouse erythroid cells (using a tamoxifen-inducible Gatal-Cre), also resulted in a significant increase in Sec23a mRNA levels in sorted
[0152] (CD71+Terl 19+CD44+FSChlgh) erythroblasts compared to wildtype stage matched controls (FIG. 12).
[0153] Methods
[0154]
[0137] Generation of clonal erythroid cell lines that express SEC23A-eGFP from the endogenous SEC23A locus. A PUC19 vector that contains sequentially an 800 base pair homology sequence upstream of the SEC23A stop codon, a sequence encoding a linker polypeptide (GGAPAPAPAPAPAPAPAPG; SEQ ID NO: 23), a sequence encoding eGFP followed by a stop codon, and an 800 base pair homology sequence downstream of the SEC23A stop codon, was assembled by Gibson assembly and electroporated into K562 cells. Single cells were sorted into 96 well plates and clonal cell lines were analyzed for insertion of eGFP at the endogenous locus of SEC23A by Sanger sequencing. A clonal HUDEP2 cell line expressing SEC23A-eGFP from the endogenous SEC23A locus was generated using the same strategy. The initial screen was performed using the K562 reporter cell line, which was generated first. Subsequently, compounds were tested in the reporter HUDEP2 cell line, once it was generated.
[0155]
[0138] High throughput screening for compounds that increase the SEC23A level. Reporter cells expressing SEC23A-eGFP from the endogenous SEC23A locus were seeded on 384-well plates (5 x 103cells / well at a concentration of 0.125 x 106 / ml) using a ThermoS cientific multidrop combi. 4,718 small molecules from a drug repurposing library (that includes compounds tested in humans and compounds approved by the Food and Drug Administration) were incubated with the reporter K562 cell lines at 10 p VI. Compounds were added using an Echo 650 acoustic liquid handler high- throughput multichannel plate handling robotics and incubated with cells for 48 hours. Subsequently, DAPI was added and cells were analyzed using the automated ZE5 flow cytometer. DAPI negative live cells were examined for intracellular eGFP fluorescence, as a measure of the SEC23A protein level. The top 154 compounds with the most profound increase in eGFP fluorescence were tested in the reporter HUDEP2 cell line as above, but at four concentrations per compound, 0.37 M, 1.1 pM, 3.3 pM, and 10 pM.
[0156]
[0139] Cell Culture K562 cells were cultured using RPMI 1640 (Gibco, Cat# 11875093) supplemented with 10% FBS (Gibco, Cat# A5256701) and 1% penicillin / streptomycin (Gibco, Cat# 15140122). HUDEP2 cells were expanded and differentiated as previously described (Yu, L. et al. Blood Advances 6, 3280-3285 (2022)). Erythroid differentiation from CD34+ HSPCs was done as previously described (Yu, L. et al. Blood 138, 1691-1704 (2021)). Treatment of differentiating erythroid cells with compounds was initiated at differentiation day 7.
[0157]
[0140] CRISPR-knockout and CRISPR activation Deletion of SEC23A using CRISPR / Cas9 (sgRNA sequences: UCGACUGGAAGCUACAAGAA (SEQ ID NO: 24) and GUAGCUUCCAGUCGACUUGA (SEQ ID NO: 25)) and activation of SEC23A expression using CRISPRa (sgRNA sequence AAGCAAGCUCAGGGGUCCGG (SEQ ID NO: 26)) were done as previously described (King, R. et al. Sci Adv , eabj5293 (2021)). To delete the sequence in the SEC23A promoter that is occupied by LSD1, an sgRNA targeting the latter sequence (TTAAGCAAGCTCAGGGGTC (SEQ ID NO: 10)) was generated, cloned into the Lenti-CRISPRv2 construct, and the construct was packaged into lentiviral particles to perform lentiviral spinfections, all as previously described (Yu, L. et al. (2022)).
[0158]
[0141] Gene downregulation or deletion in primary human erythroid cells LSD1 downregulation was performed using shRNA clones obtained from Sigma LSD] shRNAl : TRCN0000382249; LSD1 shRNA2: TRCN0000046068; LSD1 shRNA3: TRCN0000046070; LSD1 shRNA4: TRCN0000046071 ; LSD1 shRNA5: TRCN0000382379). Scramble shRNA (SHC202, Sigma) was used as control. Lentiviral production was performed as previously described (Yu, L. et al. (2021)). HSPCs differentiating into erythroid cells were transduced by spinfection (1000g at 33°C for 2 hours) at day 4 of differentiation with 5 pg / mL polybrene. Following spinfection, transduced cells underdoing differentiation were selected with 1.5 pg / mL puromycin for 2 days.
[0159]
[0142] SEC23B deletion in differentiating HSPCs was performed by electroporation of Cas9 + sgRNA {SEC23B sgRNA: GUUGGCCUGCUGCAAAGCAC (SEQ ID NO: 6); non-targeting sgRNA: CGCUUCCGCGGCCCGUUCAA (SEQ ID NO: 7)) ribonucleoprotein complex at day 4 of differentiation. 1.2 pL of Cas9 protein (IDT, Cat# 1081059) was combined with 0.5pL of lOOpM sgRNA stock at 25°C for 25 minutes. For each electroporation reaction, 105CD34+ HSPCs were washed with PBS once and resuspended in 16.4 pL nucleofector solution + 3.6 pL supplement (both supplied by P3 Primary cell 4D-nucleofector™ X Kit, Cat# V4XP-3032) + 1 pL electroporation enhancer (IDT, Cat# 1075916). The cell suspension was then mixed with Cas9 / sgRNA complex and transferred to a nucleocuvette for electroporation (Lonza 4D-Nucleofactor, DZ-100 program). After electroporation, cells were washed immediately with pre-warmed media once before culturing.
[0160] H43] Mice Mice expressing tamoxifen-inducible Cre recombinase under the control of the Gatal regulatory elements (Gatal -CreERT2, referred to as GIB) were used to generate Lsdl^1GIB mice. The latter mice (and control Esdl+ / +GIB mice) were given tamoxifen by intraperitoneal injections as previously described (Yu, L. el al. (2021)). CDAII mice with tamoxifen inducible biallelic deletion for Sec23b and haploinsufficiency for Sec23a in the erythroid compartment (Sec23a’l / +Sec23b^ / flGIB mice) were generated by crossing GIB mice with the previously reported Sec23a" and Sec23lC alleles (King, R. et al., Khoriaty, R. et al. Mol Cell Biol 34, 3721-3734 (2014), and Khoriaty, R. et al. Sci Rep 6, 27802 (2016)). CDAII or control mice (Sec23a+ / +Sec23b+ / +GIB) were placed on tamoxifen chow (Envigo, Cat# TD130859) from days 1-24 days. CDAII mice were treated with RN1 from days 8-24 or left untreated. RN1 was dissolved in sterile PBS and administered daily at 1 mg / Kg by intraperitoneal injections. Peripheral blood counts were analyzed on a Hemavet (Drew Scientific) on day 24 per manufacturer’s instructions and bone marrow erythroid cells were analyzed by flow cytometry, also on day 24.
[0161]
[0144] Flow cytometry Bone marrows were harvested and stained as previously described (Yu, L. et al. Blood (2021)). The absolute numbers of terminally differentiated erythroid cells were analyzed as previously described (King, R. et al.). CD71+Terl l9+CD44+FSChlgherythroid cells were sorted on an Aria II flow cytometer (BD Biosciences).
[0162]
[0145] mRNA analysis mRNA isolation and complementary DNA (cDNA) synthesis were performed as previously described ((Yu, L. et al. (2021) and Yu, L. et al. Genes & Development 32, 1537-1549 (2018)). Reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) was done and analyzed as previously described (Khoriaty, R. et al. Mol Biol Cell 28, 2146-2154 (2017)).
[0163]
[0146] Western blot Primary antibodies used include rabbit anti-SEC23A (Invitrogen, PAS- 28984) at 1:5000; mouse anti-Vinculin (Sigma, V9131) at 1 :10000. Secondary antibodies used include anti-mouse IgG (Cell Signaling, 7076S) at 1 :1000 and anti-rabbit IgG (Cell Signaling, 7074S) at 1: 1000.
[0164]
[0147] CUT&RUN
[0165]
[0148] Nuclei from IxlO6cells were isolated using NE buffer (20 mM HEPES-KOH, pH 7.9, 10 mM KC1, 0.1% Triton X-100, 20% Glycerol, InM MnC12, 0.5 mM Spermidine, and lx EDTA-free protease inhibitor cocktails from Sigma (CPI)). Nuclei were conjugated to Concanavalin A-coated magnetic beads (Bangs Laboratories, Cat# BP531) by incubation at room temperature for 10 minutes. Nuclei:bead slurry was incubated with rabbit anti-LSDl antibody (Abeam, Cat# abl7721) or control IgG in antibody buffer (20 mM HEPES-NaOH, pH 7.5, 150mM NaCl, 0.5 mM Spermidine, IxCPI, 0.05% Digitonin and 2mM EDTA) at 4°C overnight. After washing away unbound antibody with Dig-wash buffer (20 mM HEPES-NaOH pH 7.5, 150 mM NaCl, 0.5 mM Spermidine, lx CPI and 0.05% Digitonin) twice, protein A / G-MNase (EpiCypher, Cat# 15-1116) was added according to manufacturer’s instructions and incubated for 2 hours at 4°C. Samples were washed twice with Dig-wash buffer and once with Low-salt rinse buffer (20 mM HEPES-NaOH pH 7.5, 0.5 mM Spermidine, and 0.05% Digitonin). Protein A / G-MNase was then activated by incubating samples in 0°C ice water with Incubation buffer (3.5 mM HEPES-NaOH pH 7.5, lOmM CaC12, and 0.05% Digitonin). After MNase digestion for 2 hours, the reaction was stopped by replacing with equal volume of STOP buffer (170 mM NaCl, 20 mM EGTA, 0.05% Digitonin, 50 pg / mL RNase A and 25 pg / mL glycogen). The protein-DNA complexes were released by incubation at 37°C for 30 minutes. After proteinase K digestion at 55°C for 1 hour, DNA purification was performed using phenol chloroform extraction. DNA were evaluated by Qubit fluorometer and bioanalyzer for quality control followed by library preparation.
[0166]
[0149] Library preparation was performed following the modified protocol for TF-targeted short fragments using NEBNext Ultra II DNA Library Prep Kit as described (Liu, N. et al. Cell Y1 , 430- 442 e417 (2018)). Briefly, the dA-tailing reaction was modified to 50°C for Ihr. After adaptor ligation, 1.75x volume of size-selection beads was added to increase the recovery of short fragments. DNA was then PCR amplified for 12 cycles with reduced amount of universal and individual index primer. After PCR amplification, size selection of 160-350bp fragments was carried out by sequentially adding 0.6x and 0.6x volume of beads. Quantity and size distribution of libraries were measured by Qubit fluorometer and Bioanalyzer, respectively. Libraries were sequenced using the Illumina Novaseq (S4) platform and paired-end sequencing.
[0167]
[0150] Datasets were processed using the nf-core CUT&RUN pipeline version 3.2.1 (nf- co.re / cutandrun / 3.2.1 / ). Raw sequencing reads were trimmed with “Trim Galore!” and aligned to the GRCh38 assembly. The reference genome and annotations were retrieved from the AWS iGenomes program. The raw read counts were normalized to RPKM (Reads Per Kilobase per Million mapped reads) with a bin size of 50. Peak calling was performed using MACS2 with a p-value of 0.05. CUT&RUN data are available at GEO: accession number GSE275767.
[0168]
[0151] The scope of the present invention is not limited by what has been specifically shown and described hereinabove. Those skilled in the art will recognize that there are suitable alternatives to the depicted examples of materials, configurations, constructions, and dimensions. Variations, modifications, and other implementations of what is described herein will occur to those of ordinary skill in the art without departing from the spirit and scope of the invention.
[0169]
[0152] Numerous references, including patents and various publications, are cited and discussed in the description of this invention. The citation and discussion of such references is provided merely to clarify the description of the present invention and is not an admission that any reference is prior art to the invention described herein. All references cited and discussed in this specification are incorporated herein by reference in their entirety.
Claims
CLAIMSWhat is claimed is:
1. A method for increasing the level of SEC23A in a cell, comprising contacting the cell with: one or more inhibitors of lysine specific demethylase-1 (LSD1); one or more inhibitors of DNA methyltransferase 1 (DNMT1); or any combination thereof.
2. The method of claim 1, wherein the one or more inhibitors of LSD1 comprise a gene silencing or downregulating oligonucleotide, one or more components of a gene editing system, a protein configured to bind LSD 1 , a small molecule inhibitor, or combinations thereof.
3. The method of claim 1 or 2, wherein the one or more inhibitors of LSD 1 comprise ORY-lOOl or RN1.
4. The method of any of claims 1-3, wherein the one or more components of a gene editing system are configured to alter the SEC23A promoter sequence in the region occupied by LSD1.
5. The method of any of claims 1-4, wherein the one or more inhibitors of DNMT1 comprise gene silencing or downregulating oligonucleotides, a protein configured to bind DNMT1, a small molecule inhibitor, or combinations thereof.
6. The method of any of claims 1-5, wherein the one or more inhibitors of DNMT1 comprise decitabine.
7. The method of any of claims 1-6, wherein the contacting comprises introducing into the cell.
8. The method of any of claims 1-7, wherein the cell is a eukaryotic cell.
9. The method of any of claims 1-8, wherein the cell is a mammalian cell.
10. The method of any of claims 1-9, wherein the cell is a human cell.
11. The method of any of claims 1-10, wherein the cell is in vitro or ex vivo.
12. The method of any of claims 1-11, wherein the cell is in vivo.
13. The method of claim 12, wherein the contacting comprises administering the one or more inhibitors of LSD 1 , the one or more inhibitors of DNMT 1 , or any combination thereof to a subj ect.
14. A method for treating or preventing a disease or disorder mediated by decreased function or level of SEC23B in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of one or more agents which increase the level of SEC23A in the subject, wherein the one or more agents comprise one or more inhibitors of lysine specific demethylase-1 (LSD1); one or more inhibitors of DNA methyltransferase 1 (DNMT1); or any combination thereof.
15. The method of claim 14, wherein the one or more inhibitors of LSD1 comprise a gene silencing or downregulating oligonucleotide, one or more components of a gene editing system, a protein configured to bind LSD1, a small molecule inhibitor, or combinations thereof.
16. The method of claim 14 or 15, wherein the one or more inhibitors of LSD1 comprise ORY-lOOl or RNl.
17. The method of any of claims 14-16, wherein the one or more components of a gene editing system are configured to alter the SEC23A promoter sequence occupied by LSD1.
18. The method of any of claims 14-17, wherein the one or more inhibitors of DNMT1 comprise gene silencing or downregulating oligonucleotides, a protein configured to bind DNMT1, a small molecule inhibitor, or combinations thereof.
19. The method of any of claims 14-18, wherein the one or more inhibitors of DNMT1 comprise decitabine.
20. The method of any of claims 14-19, wherein the subject has a loss of function mutation in a gene encoding SEC23B.
21. The method of any of claims 14-20, wherein the disease or disorder is congenital dyserythropoietic anemia type II (CD All).
22. The method of claim 21, wherein the method rescues a CD All erythroid defect.
23. The method of any of claims 14-22, wherein the method does not impair erythropoiesis and or erythroid differentiation.
24. The method of any of claims 14-23, wherein the method increases RBC count, hemoglobin level, and / or orthochromatic erythroblasts.
25. A composition comprising one or more inhibitors of lysine specific demethylase- 1 (LSD1); one or more inhibitors of DNA methyltransferase 1 (DNMT1); or any combination thereof for use in treating or preventing a disease or disorder mediated by decreased function or level of SEC23B.
Citation Information
Patent Citations
Combinations of LSD1 inhibitors for the treatment of hematological malignancies
US11013698B2
LSD1 inhibitors for use in the treatment and prevention of fibrosis of tissues
WO2022053520A1