Compositions comprising humicola fuscoatra and methods of use thereof

Inoculating agricultural soils with Humicola fuscoatra strains increases stable organic carbon and enhances crop yields by improving soil health and aggregation, addressing the decline in SOC due to intensive cultivation.

WO2026015879A1PCT designated stage Publication Date: 2026-01-15LOAM BIO PTY LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/037417
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-11
Filing Date
2025-07-11
Publication Date
2026-01-15

AI Technical Summary

Technical Problem

Intensive cultivation has led to a decline in soil organic carbon (SOC), making the land unsuitable for commercial crop production, and there is a need for methods to increase stable organic carbon in agricultural soils to sequester atmospheric carbon and improve soil quality.

Method used

Inoculating agricultural soils with heterologously disposed fungal strains, such as Humicola fuscoatra, which have specific ITS sequences at least 97% identical to SEQ ID NOs: 1-3, to enhance soil organic carbon content and promote microbial activity, nutrient cycling, and increase crop yields.

Benefits of technology

The fungal strains effectively increase stable organic carbon in soils and enhance crop yields by improving soil health, aggregation, and nutrient retention, leading to better plant growth and carbon sequestration.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000050_0001
    Figure IMGF000050_0001
  • Figure IMGF000050_0002
    Figure IMGF000050_0002
  • Figure IMGF000050_0003
    Figure IMGF000050_0003
Patent Text Reader

Abstract

The disclosure provides a method of increasing stable organic carbon in an agricultural soil, comprising: heterologously disposing one or more fungal strains to treat a plant element, wherein the one or more fungal strains comprises a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3; and the one or more fungal strains are heterologously disposed in an effective amount to increase stable organic carbon in agricultural soil supporting a plant derived from the treated plant element relative to agricultural soil supporting a reference plant derived from a reference plant element.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Attorney Docket No. LOAM-F005-01WO COMPOSITIONS COMPRISING HUMICOLA FUSCOATRA AND METHODS OF USE THEREOF CROSS REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 670,008, filed on July 11, 2024, the contents of which are incorporated herein by reference in their entirety. TECHNICAL FIELD The present disclosure relates to methods and compositions for increasing carbon content in the soil, mitigating atmospheric carbon dioxide, and increasing plant yield with Humicola fuscoatra. STATEMENT REGARDING ELECTRONIC FILING OF A SEQUENCE LISTING A Sequence Listing in XML format, submitted under 37 C.F.R. § 1.821, entitled LOAM-F005-00US.xml, 50,938 bytes in size, generated on July 10, 2024, and filed via EFS- Web, is provided in lieu of a paper copy. This Sequence Listing is incorporated by reference into the specification for its disclosures.  BACKGROUND Carbon dioxide and methane absorb and retain heat in the atmosphere; therefore, both gasses play a pivotal role in the greenhouse effect. As methane is much more short-lived than carbon dioxide, carbon dioxide is often considered more important than methane to the greenhouse effect. The life cycle of carbon includes the removal of carbon dioxide from the atmosphere by plants through photosynthesis. During photosynthesis, the carbon dioxide gets absorbed through the stroma of leaves, and the carbon dioxide is further converted into sugars. Such sugars become nutrients for plants, and microbes present in the soil. Finally, carbon enters back into the atmosphere in the form of carbon dioxide through respiration and combustion. Hence, a balanced amount of carbon dioxide release and absorption is an essential step for balancing the ecosystem. Human activities such as the combustion of fuels, overpopulation, forest degradation, soil erosion, etc., have increased atmospheric carbon dioxide. Therefore, approaches for Attorney Docket No. LOAM-F005-01WO sequestering carbon dioxide from the atmosphere present an essential component of a strategy for reducing or controlling atmospheric carbon dioxide. However, for this to be successful, there must also be a reduction in the release of carbon dioxide from the soil back into the atmosphere. Decay of plants, animals, and microbes into the soil can lead to the build-up of soil organic carbon (SOC), an essential nutrient which promotes physical stability of the structure of the soil, soil aeration, water drainage and retention, thus reducing soil erosion and nutrient leaching. However, intensive cultivation has also led to a decline in SOC, eventually making the land unsuitable for commercial crop production. As such, the benefits associated with SOC can be seen as two-fold: the sequestration of atmospheric carbon, provided the soil, and the overall improvement of the soil quality retain the carbon. It would be advantageous to develop compositions, treatments, and methods for increasing soil carbon in a manner that will produce more stable carbon in the soil by sequestering atmospheric carbon and provide benefits to commercial crop plants. SUMMARY The present disclosure relates to a method of increasing stable organic carbon in an agricultural soil, the method comprising: heterologously disposing one or more fungal strains to treat a plant element, wherein the one or more fungal strains comprises a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3; and the one or more fungal strains are heterologously disposed in an effective amount to increase stable organic carbon in the agricultural soil supporting a plant derived from the treated plant element relative to agricultural soil supporting a reference plant derived from a reference plant element. In certain aspects, the disclosure provides a method of increasing stable organic carbon in an agricultural soil, the method comprising: mechanically inoculating an agricultural soil with a synthetic combination of one or more heterologously disposed fungal strains, wherein the one or more fungal strains comprises a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3; and the one or more fungal strains are in an effective amount to increase organic carbon in the inoculated agricultural soil relative to a reference agricultural soil. In some aspects, the present disclosure provides a method of increasing soil organic carbon (SOC), comprising: heterologously disposing one or more fungal strains to treat a plant element, wherein the one or more fungal strains comprises a nuclear ribosomal internal Attorney Docket No. LOAM-F005-01WO transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3; and the one or more fungal strains are heterologously disposed in an effective amount to increase organic carbon in soil supporting a plant derived from the treated plant element relative to soil supporting a reference plant derived from a reference plant element. In other aspects, the present disclosure relates to a method of increasing soil organic carbon (SOC), comprising: mechanically inoculating a soil with a synthetic combination of one or more heterologously disposed fungal strains, wherein the one or more fungal strains comprise a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3; and the one or more fungal strains are in an effective amount to increase organic carbon in the inoculated soil relative to a reference soil. In one aspect, the one or more fungal strains further comprises: (i) a TUB2 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 4-6; (ii) a TEF1 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 7-9; (iii) an RPB1 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 10-12; (iv) an RPB2 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 13-15; or (v) any combination (i) to (iv). In some aspects, the one or more fungal strains belong to the species Humicola fuscoatra. In one aspect, the one or more fungal strains are selected from the group consisting of: Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645), Humicola fuscoatra US- 735 (ATCC Accession No. PTA-127783), Humicola fuscoatra US-946 (ATCC Accession No. PTA-127784), and a mutant thereof having all identifying characteristics of the respective strain. In one aspect, the mutant of the fungal strain has a genomic sequence with greater than about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the respective strain. The term “mutant” refers to a genetic variant derived from a fungal strain disclosed herein. In one embodiment, the mutant has one or more of or all the identifying (functional) characteristics of Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645), Humicola fuscoatra US-735 (ATCC Accession No. PTA-127783), or Humicola fuscoatra US-946 (ATCC Accession No. PTA-127784). In a particular instance, the mutant increases SOC or improves agricultural crop yield (as an identifying functional characteristic) at least as well as the parent strain. Mutants may be obtained by treating the fungal cells with chemicals or Attorney Docket No. LOAM-F005-01WO irradiation or by selecting spontaneous mutants from a population of fungal cells (such as fungicide resistant mutants) or by other means well known to those practiced in the art. The mutant strain can be any mutant strain that has one or more or all the identifying characteristics of Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645), Humicola fuscoatra US-735 (ATCC Accession No. PTA-127783), or Humicola fuscoatra US-946 (ATCC Accession No. PTA-127784) and in particular carbon sequestration activity that is comparable or better than that of the respective strain. In certain aspects, the one or more fungal strains are capable of enhancing microbial activity, facilitating the breakdown and synthesis of organic materials, and contributing to nutrient cycling to improve soil health and increase soil organic carbon content via alpha amylase, nitrite reduction, riboflavin biosynthesis, and mixed acid: lactate pathways. In other aspects, the disclosed methods further comprise an initial step of identifying the soil as having a soil organic carbon (SOC) below a threshold level. In one aspect, the threshold level is an SOC (% wt / wt) below 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%. In one aspect, the soil and / or plant elements are non-native to the one or more fungal strains. In some aspects, the non-native plant element is from a plant selected from the group consisting of wheat, rice, corn (maize), canola, rye, oats, barley, sorghum, millet, flax, hemp, jute, cotton, sugar cane, sugar beet, sunflower, soybeans, alfalfa, clover, Desmanthus, peanuts, lentils, lupins, peas, and chickpea. In other aspects, the non-native plant element is from a plant selected from the group consisting of lucerne, arrow leaf clover, balansa clover, chicory, plantain, phalaris, cocksfoot, fescue, prairie grass, Warrego summer grass, Italian rye grass, perennial ryegrass, biserrula, serradella, gland clover, bladder clover, switchgrass, radish, medic, buckwheat, cowpea, lablab, sunn hemp, sunflower, tillage radish, and subterranean clover. In certain aspects, the organic carbon in the soil is increased in the stable forms of aggregate carbon fraction (AggC), aggregate occluded particulate organic carbon (oPOC), and / or mineral-associated organic carbon (MAOC). In yet other aspects, the present disclosure relates to a method for sequestering atmospheric carbon for storage as soil organic carbon (SOC), comprising: heterologously disposing of one or more fungal strains to treat a plant element, wherein the one or more fungal strains comprises a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3; and the one or more fungal strains are in an effective amount to increase sequestered atmospheric carbon in soil Attorney Docket No. LOAM-F005-01WO supporting a plant derived from the treated plant element relative to soil supporting a reference plant derived from a reference plant element. In some aspects, the present disclosure provides a method for sequestering atmospheric carbon for storage as stable organic carbon in an agricultural soil, the method comprising: heterologously disposing one or more fungal strains to treat a plant element, wherein the one or more fungal strains comprises a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3; and the one or more fungal strains are in an effective amount to increase sequestered atmospheric carbon in agricultural soil supporting a plant derived from the treated plant element relative to agricultural soil supporting a reference plant derived from a reference plant element. In other aspects, the disclosure relates to a method for sequestering atmospheric carbon for storage as stable organic carbon in an agricultural soil, the method comprising: mechanically inoculating an agricultural soil with a synthetic combination of one or more heterologously disposed fungal strains, wherein the one or more fungal strains comprises a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3; and the one or more fungal strains are in an effective amount to increase sequestered atmospheric carbon in the inoculated agricultural soil relative to a reference agricultural soil. In one aspect, the present disclosure provides a method for sequestering atmospheric carbon for storage as soil organic carbon (SOC), comprising: mechanically inoculating a soil with a synthetic combination of one or more heterologously disposed fungal strains, wherein one or more fungal strains comprises a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3; and the one or more fungal strains are in an effective amount to increase sequestered atmospheric carbon in the inoculated soil relative to a reference soil. In some aspects, the one or more fungal strains further comprises: (i) a TUB2 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 4-6; (ii) a TEF1 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 7-9; (iii) an RPB1 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 10-12; (iv) an RPB2 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 13-15; or (v) any combination (i) to (iv). In some aspects, the one or more fungal strains belong to the species Humicola fuscoatra. In one aspect, the one or more fungal strains are selected from the group consisting Attorney Docket No. LOAM-F005-01WO of: Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645), Humicola fuscoatra US- 735 (ATCC Accession No. PTA-127783), Humicola fuscoatra US-946 (ATCC Accession No. PTA-127784), and a mutant thereof having all identifying characteristics of the respective strain. In other aspects, the disclosure relates to a method of increasing soil aggregation or soil aggregate stability in an agricultural soil, the method comprising: heterologously disposing one or more fungal strains to treat a plant element, wherein the one or more fungal strains comprises a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3; and the one or more fungal strains are in an effective amount to increase soil aggregation or soil aggregate stability in the agricultural soil supporting a plant derived from the treated plant element relative to agricultural soil supporting a reference plant derived from a reference plant element. In certain aspects, the disclosure provides a method increasing soil aggregation or soil aggregate stability in an agricultural soil, the method comprising: mechanically inoculating the agricultural soil with a synthetic combination of one or more heterologously disposed fungal strains, wherein the one or more fungal strains comprises a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3; and the one or more fungal strains are in an effective amount to increase soil aggregation or soil aggregate stability in the inoculated agricultural soil relative to a reference agricultural soil. In some aspects, the present disclosure provides a method of increasing soil aggregation or soil aggregate stability, the method comprising: heterologously disposing one or more fungal strains to treat a plant element, wherein the one or more fungal strains comprises a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3; and the one or more fungal strains are in an effective amount to increase soil aggregation or soil aggregate stability in soil supporting a plant derived from the treated plant element relative to soil supporting a reference plant derived from a reference plant element. In other aspects, the present disclosure relates to a method increasing soil aggregation or soil aggregate stability, the method comprising: mechanically inoculating a soil with a synthetic combination of one or more heterologously disposed fungal strains, wherein the one or more fungal strains comprises a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: Attorney Docket No. LOAM-F005-01WO 1-3; and the one or more fungal strains are in an effective amount to increase soil aggregation or soil aggregate stability in the inoculated soil relative to a reference soil. In one aspect, the one or more fungal strains further comprises: (i) a TUB2 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 4-6; (ii) a TEF1 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 7-9; (iii) an RPB1 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 10-12; (iv) an RPB2 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 13-15; or (v) any combination (i) to (iv). In one aspect, the one or more fungal strains belong to the species Humicola fuscoatra. In another aspect, the one or more fungal strains are selected from the group consisting of: Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645), Humicola fuscoatra US- 735 (ATCC Accession No. PTA-127783), Humicola fuscoatra US-946 (ATCC Accession No. PTA-127784), and a mutant thereof having all identifying characteristics of the respective strain. In some aspects, the soil and / or plant elements are non-native to the one or more fungal strains. In other aspects, the increase in soil aggregate stability is indicated by an increase in soil mean weight diameter (MWD), geometric mean diameter (GMD), fractal dimension (D), or water-stable aggregates stability rate (WSAR); or the increase in soil aggregate stability is indicated by a decrease in percentage of aggregates destruction (PAD). In one aspect, increased soil aggregation or soil aggregate stability improves water retention and porosity in soil inoculated or treated with the one or more fungal strains compared to a reference soil. In some aspects, the disclosure relates to a method of enhancing plant growth, the method comprising: heterologously disposing one or more fungal strains to treat a plant element, wherein the one or more fungal strains comprises a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3; and the one or more fungal strains are in an effective amount to enhance the growth of a plant derived from the treated plant element relative to a reference plant derived from a reference plant element. In other aspects, the present disclosure relates to a method of enhancing plant growth, comprising: heterologously disposing one or more fungal strains to treat a plant element, wherein the one or more fungal strains comprises a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3; and the one or more fungal strains are in an effective amount to enhance the Attorney Docket No. LOAM-F005-01WO growth of a plant derived from the treated plant element relative to a reference plant derived from a reference plant element. In some aspects, the one or more fungal strains further comprises: (i) a TUB2 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 4-6; (ii) a TEF1 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 7-9; (iii) an RPB1 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 10-12; (iv) an RPB2 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 13-15; or (v) any combination (i) to (iv). In some aspects, the one or more fungal strains belong to the species Humicola fuscoatra. In one aspect, the one or more fungal strains are selected from the group consisting of: Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645), Humicola fuscoatra US- 735 (ATCC Accession No. PTA-127783), Humicola fuscoatra US-946 (ATCC Accession No. PTA-127784), and a mutant thereof having all identifying characteristics of the respective strain. In certain aspects, the plant exhibits at least one of increased root number, increased root length, increased root mass, increased root volume, increased leaf area, increased leaf number, increased pod number, increased plant height, increased shoot mass, increased chlorophyll content, increased nodulation, and increased yield, as compared to the reference plant. In some aspects, the disclosure relates to a synthetic combination comprising a purified population of one or more fungal strains heterologously disposed to a plant element, wherein the one or more fungal strains are heterologous to the plant element and comprise a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3; and an agriculturally acceptable carrier; wherein the one or more fungal strains are present in an effective amount to increase stable organic carbon in an agricultural soil supporting a plant derived from the plant element in the synthetic combination relative to agricultural soil supporting a reference plant derived from a reference plant element. In other aspects, the present disclosure provides a synthetic combination comprising a purified population of one or more fungal strains heterologously disposed to a plant element, wherein the one or more fungal strains are heterologous to the plant element and comprise a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3; and an agriculturally acceptable carrier; wherein the one or more fungal strains are present in an effective amount to increase Attorney Docket No. LOAM-F005-01WO soil organic carbon (SOC) in soil supporting a plant derived from the plant element in the synthetic combination relative to soil supporting a reference plant derived from a reference plant element. In some aspects, the one or more fungal strains further comprises: (i) a TUB2 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 4-6; (ii) a TEF1 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 7-9; (iii) an RPB1 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 10-12; (iv) an RPB2 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 13-15; or (v) any combination (i) to (iv). In some aspects, the one or more fungal strains belong to the species Humicola fuscoatra. In one aspect, the one or more fungal strains are selected from the group consisting of: Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645), Humicola fuscoatra US- 735 (ATCC Accession No. PTA-127783), Humicola fuscoatra US-946 (ATCC Accession No. PTA-127784), and a mutant thereof having all identifying characteristics of the respective strain. In certain aspects, (a) the combination is formulated as a solid, liquid or gel; (b) the combination is formulated as a powder, pellet or granules; or (c) the combination is formulated as an emulsion, colloid, suspension or solution. In other aspects, the one or more fungal strains are present in the combination at a concentration of at least 103colony forming units (CFU) per milliliter or gram. In some aspects, the plant element is a whole plant, seedling, meristematic tissue, ground tissue, vascular tissue, dermal tissue, seed, leaf, root, shoot, stem, flower, fruit, stolon, bulb, tuber, corm, keikis, shoot, or bud. In certain aspects, the present disclosure provides a plant grown from a disclosed synthetic combination, wherein soil supporting the plant exhibits increased soil organic carbon (SOC) relative to soil supporting a reference plant. In one aspect, the present disclosure provides a bag or container comprising a disclosed synthetic combination. In another aspect, the present disclosure provides a kit comprising a disclosed synthetic combination. In other aspects, the present disclosure relates to a cell or a biologically pure culture of one or more fungal strains selected from the group consisting of Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645), Humicola fuscoatra US-735 (ATCC Accession No. PTA-127783), Humicola fuscoatra US-946 (ATCC Accession No. PTA-127784), and a mutant thereof having all identifying characteristics of the respective strain. Attorney Docket No. LOAM-F005-01WO In one aspect, an agricultural composition comprising the disclosed cell or a biologically pure culture and, optionally, an agriculturally acceptable carrier is provided. In some aspects, the agricultural composition is heterologously disposed on at least a portion of an outer surface of a plant, plant part or plant seed. In other aspects, the present disclosure relates to a bioorganic soil conditioner comprising a disclosed cell or a biologically pure culture and, optionally, an agriculturally acceptable carrier. In one aspect, the agriculturally acceptable carrier comprises one or more of talc, an oil, kaolin clay, a dispersant, a surfactant, and a nutrient. BRIEF DESCRIPTION OF THE DRAWINGS FIG.1 depicts the results of a KEGG pathway analysis comparing Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645), Humicola fuscoatra US-735 (ATCC Accession No. PTA-127783), and Humicola fuscoatra US-946 (ATCC Accession No. PTA-127784) with Dictyochaeta assamica strain X. DETAILED DESCRIPTION The present disclosure relates to methods and related technologies for increasing stable organic carbon in an agricultural soil and / or increasing yield of a crop plant. The method comprises inoculating the agricultural soil and / or the plant with an effective amount of one or more compatible, non-pathogenic strains of fungal species. It will be appreciated that the strains of fungi will be fungal strains that are crop- compatible with the crop plant to which they are to be applied, but the crop need not necessarily be a native host of the fungi. A fungal strain that is crop-compatible with a crop plant is a strain that is non-pathogenic to that crop plant. Methods for assessing whether a strain of fungus is non-pathogenic to a particular crop plant are known in the art. An increase in stable organic carbon in an agricultural soil is an increase in the amount of stable organic carbon in the soil associated with the crop plant inoculated with the one or more fungal species relative to the amount of organic carbon in uninoculated agricultural soil. In this context, the soil associated with the crop plant is soil surrounding the roots of the crop plant and from which the crop plant derives nutrients. An increase in plant yield is an increase in fruit, grain or vegetative tissue production of the plant relative to that of a plant that has not been treated with the one or more fungal species described herein. For example, an increase in the yield of a soybean plant is an increase in the number and / or weight of seed pods produced by a soybean plant relative to that of an untreated soybean plant. Attorney Docket No. LOAM-F005-01WO The inventors have found that growing a crop plant that has been inoculated with certain crop-compatible fungal strains results in an increase in stable organic carbon in agricultural soil and / or an increase in yield of crop plants. The inventors have found that various crop plants inoculated with fungal species, and in particular, endophytic fungal species, exhibit increased yield relative to uninoculated plants. The inventors have further found that the agricultural soil in which these plants are grown has increased stable organic carbon content relative to agricultural soil in which uninoculated plants are grown. An “agricultural soil” is soil that is managed and cultivated for crop production, livestock grazing, or other agricultural purposes. It serves as a medium for plant growth, providing essential nutrients, water retention, aeration, and a habitat for beneficial microorganisms. The term “endophytic” relates to a microbe that generally lives within a plant for at least part of its lifecycle, often due to the microbe being able to grow inward into plant tissues in finger-like projections from a superficial site of origin. These fungi can infiltrate plant living tissues for at least a portion of the fungal life cycle often without causing any apparent diseases or harm to the plant that is a native host, in that they are generally not pathogenic to their native hosts. It would be understood that the one or more fungal genera, species or strains of the methods described herein can exist during some portion of the fungal life cycle within the roots of a plant host as an endophyte and in other parts of its life cycle within the soil and will typically alternate or cycle between an endophytic root phase and a free-living soil phase. Though some endophytic fungi are known for enriching the organic carbon in the soil, each fungal species will generally behave differently when associated with different, and / or non-native plant hosts and / or soil environments and will stabilize the organic carbon with varying efficiency. In some embodiments, the one or more fungal species has a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 90% identical, typically at least 91%, least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical, more typically 100% identical, with the nucleotide sequence of SEQ ID NO: 1, 2, or 3. In other embodiments, the one or more fungal species has a TUB2 sequence that is at least 90% identical, typically at least 91%, least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical, more typically 100% identical, with the nucleotide sequence of SEQ ID NO: 4, 5, or 6. Attorney Docket No. LOAM-F005-01WO In other embodiments, the one or more fungal species has a TEF1 sequence that is at least 90% identical, typically at least 91%, least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical, more typically 100% identical, with the nucleotide sequence of SEQ ID NO: 7, 8, or 9. In other embodiments, the one or more fungal species has a RPB1 sequence that is at least 90% identical, typically at least 91%, least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical, more typically 100% identical, with the nucleotide sequence of SEQ ID NO: 10, 11, or 12. In other embodiments, the one or more fungal species has a RPB2 sequence that is at least 90% identical, typically at least 91%, least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical, more typically 100% identical, with the nucleotide sequence of SEQ ID NO: 13, 14, or 15. The terms “identical” or “% identical,” in the context of two or more nucleic acids refers to two or more sequences that are the same or have a specified percentage of nucleotides that are the same (i.e., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site http: / / www.ncbi.nlm.nih.gov / BLAST / , or the like). Algorithms for determining % identity are known in the art. Examples of algorithms suitable for determining percent sequence identity are the BLAST and BLAST 2.0 algorithms, described in Altschul et al., Nuc. Acids Res.25:3389-3402 (1977) and Altschul et al., J. Mol. Biol.215:403-410 (1990), respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. A “soil conditioner” denotes a mixture of substances or a blend that can be added directly to the soil to improve soil characteristics or to an agricultural or fertilizer composition, which, in turn, is added to the soil. The soil conditioner can be applied to any type of soil, including black cotton soil, saline soil, medium to high saline soil, yellow soil, sandy soil, loamy soil, alluvial soil (delta soil), lava soil, topsoil, and subsoil that can be used in crop / plant production. As used herein, the term “effective amount” means a sufficient quantity of a substance (e.g., fungus) to promote an increase in soil carbon in a treated soil and / or a plant trait (e.g., yield) in a treated plant compared to an untreated soil or untreated plant. This term is not to be Attorney Docket No. LOAM-F005-01WO construed to limit the disclosure to a specific quantity, e.g., the number of fungal cells. Rather, the present disclosure encompasses any amount of one or more fungal species sufficient to achieve the stated purpose. The amount of one or more fungal species should not be so large as to cause adverse effects on the plant. Generally, the amount of one or more fungal species may vary with how the fungi are applied (e.g., to the soil, to the seed or to the seedling) and can be determined by a person skilled in the art. Throughout the specification and claims, unless the context requires otherwise, the term "substantially" or "about" will be understood to not be limited to the value for the range qualified by the terms. For example, the term “about” may include a range that is ±5%, ±2.5% or ±1% of the value to which the term is applied. A “plant element” is intended to generically reference either a whole plant or a plant component, including but not limited to plant tissues and regions thereof, plant parts and regions thereof, and to plant cell types. A plant element is preferably one of the following: whole plant, seedling, meristematic tissue, ground tissue, vascular tissue, dermal tissue, seed, leaf, root, shoot, stem, flower, fruit, stolon, bulb, tuber, corm, keikis, shoot, bud. A treatment (e.g., a fungal strain) is “heterologously disposed” when mechanically or manually applied, artificially inoculated or disposed onto or into a plant element, seedling, plant or onto or into a plant growth medium or onto or into a treatment formulation so that the treatment exists on or in the plant element, seedling, plant, plant growth medium, or formulation in a manner not found in nature prior to the application of the treatment, e.g., said combination which is not found in nature in that plant variety, at that stage in plant development, in that plant tissue, in that abundance, or in that growth environment for example, drought, flood, cold, nutrient deficiency, etc.). In some embodiments, such a manner is contemplated to be selected from the group consisting of: the presence of the fungal strain; presence of the fungal strain in a different number of cells, concentration, or amount; the presence of the fungal strain in a different plant element, tissue, cell type, or other physical location in or on the plant; the presence of the fungal strain at different time period, e.g. developmental phase of the plant or plant element, time of day, time of season, and combinations thereof. In some embodiments, “heterologously disposed” means that the fungal strain is applied to a different tissue or cell type of the plant element than that in which the fungal strain is naturally found. In some embodiments, “heterologously disposed” means that the fungal strain is applied to a developmental stage of the plant element, seedling, or plant in which said fungal strain is not naturally associated but may be associated at other stages. For example, if a fungal strain is normally found at the flowering stage of a plant and no other Attorney Docket No. LOAM-F005-01WO stage, a fungal strain applied at the seedling stage may be considered to be heterologously disposed. In some embodiments, a fungal strain is heterologously disposed when the fungal strain is normally found in the root tissue of a plant element but not in the leaf tissue, and the fungal strain is applied to the leaf. In another non-limiting example, if a fungal strain is naturally found in the mesophyll layer of leaf tissue but is being applied to the epithelial layer, the fungal strain would be considered to be heterologously disposed. In some embodiments, “heterologously disposed” means that the native plant element, seedling, or plant does not contain detectable levels of the microbe in that same plant element, seedling, or plant. In some embodiments, “heterologously disposed” means that the fungal strain being applied is at a greater concentration, number, or amount on the plant element, seedling, or plant, than that which is naturally found in said plant element, seedling, or plant. For example, a fungal strain is heterologously disposed when present at a concentration that is at least 1.5 times greater, between 1.5 and 2 times greater, 2 times greater, between 2 and 3 times greater, 3 times greater, between 3 and 5 times greater, 5 times greater, between 5 and 7 times greater, 7 times greater, between 7 and 10 times greater, 10 times greater, or even greater than 10 times higher number, amount, or concentration than the concentration that was present prior to the disposition of said fungal strain. In another non-limiting example, a fungal strain that is naturally found in a leaf tissue of a cupressaceous tree would be considered heterologous to leaf tissue of a maize, wheat, cotton, soybean plant. In another example, a fungal strain that is naturally found in leaf tissue of a maize, spring wheat, cotton, soybean plant is considered heterologous to a leaf tissue of another maize, spring wheat, cotton, soybean plant that naturally lacks said fungal strain. A “reference plant”, “reference plant element”, “reference agricultural plant” or “reference seed” is a similarly situated plant or seed of the same species, strain, or cultivar to which a treatment, formulation, composition or fungal endophyte preparation as described herein is not administered or contacted. A reference plant, therefore, is identical to the treated plant except for the presence of the active ingredient (e.g. fungal endophyte) to be tested and can serve as a control for detecting the effects of the treatment (e.g. active ingredient) conferred to the plant. A plurality of reference plants may be referred to as a “reference population”. A “reference environment” refers to the environment, treatment or condition of the plant in which a measurement is made. For example, carbon sequestration or soil organic carbon accumulation with a plant heterologously disposed to a fungal endophyte can be measured in a reference environment of drought stress and compared with the carbon sequestration or soil organic carbon accumulation in a reference agricultural plant under the Attorney Docket No. LOAM-F005-01WO same conditions of drought stress. Alternatively, the carbon sequestration or soil organic carbon accumulation with a plant heterologously disposed to a fungal endophyte and reference agricultural plant can be measured under identical conditions of no stress. A “reference soil” is a similarly situated soil with respect to composition (e.g., organic content or mineral composition), texture, pH, structure, moisture content, biological activity, compaction, nutrient levels, geological origin, etc. to which a treatment, formulation, composition or fungal endophyte preparation as described herein is not administered, applied, inoculated, or contacted. A reference soil, therefore, is similar or identical to the treated soil except for the presence of the active ingredient (e.g. fungal endophyte) to be tested and can serve as a control for detecting the effects of the treatment (e.g. active ingredient) conferred to the soil. A “synthetic composition” (also known as a “synthetic combination”) comprises one or more fungal endophytes combined by human endeavor with a heterologously disposed plant element or a heterologously disposed treatment formulation, said combination which is not found in nature. In some embodiments, a synthetic composition comprises both one or more plant elements and one or more formulation components combined by human Endeavor with an isolated, purified fungal endophyte composition. In some embodiments, said purified fungal endophyte composition is mechanically or manually applied, artificially inoculated or disposed on a plant element in a manner that is not found on or in the plant element before application of the purified fungal endophyte composition, e.g., said combination or association which is not found in nature. A “biologically pure culture” refers to a carefully cultivated population of microorganisms containing only a single species or strain, devoid of any contamination by other microorganisms. This purity ensures consistency and reliability in the production of various commercial products such as biological inoculants or conditioners applied to plant elements or soil. The purity of the culture also allows for precise control over the microbial characteristics and performance, ensuring high-quality and standardized outcomes in industrial processes and product formulations. In some embodiments, a synthetic composition is applied mechanically or manually or artificially inoculated to a plant element in a seed treatment, root wash, seedling soak, foliar application, soil inocula, in-furrow application, sidedress application, soil pre-treatment, wound inoculation, drip tape irrigation, vector-mediation via a pollinator, injection, osmopriming, hydroponics, aquaponics, aeroponics, and combinations thereof. Application to the plant may be achieved, for example, as a powder for surface deposition onto plant leaves Attorney Docket No. LOAM-F005-01WO or seeds, as a spray to the whole plant or selected plant element, as part of a drip to the soil or the roots, or as a coating onto the plant element prior to or after planting. Such examples are meant to be illustrative and not limiting to the scope of the invention. An “effective amount” of one or more fungal endophytes is the amount capable of improving a trait of agronomic importance or tolerance by at least 0.1%, at least 0.5%, at least 1%, at least 2%, at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, at least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, at least 100%, between 100% and 150%, at least 150%, between 150% and 200%, at least 200%, between 200% and 300%, at least 300% or more, as compared to a reference plant element not further comprising said fungal endophyte. In some embodiments, an effective amount of treatment comprising an endophyte is at least 10 CFU per unit of plant element, at least 102CFU per unit of plant element, between 102and 103CFU per unit of plant element, at least about 103CFU per unit of plant element, between 103and 104CFU per unit of plant element, at least about 104CFU per unit of plant element, between 104and 105CFU per unit of plant element, at least about 105CFU, between 105and 106CFU per unit of plant element, at least about 106CFU per unit of plant element, between 106and 107CFU per unit of plant element, at least about 107CFU per unit of plant element, between 107and 108CFU per unit of plant element, or even greater than 108CFU per unit of plant element. A unit of a plant element may be an individual plant element, e.g. an individual seed, or a unit of the surface area of a plant element, e.g. a square centimeter of leaf tissue, or a unit of surface area of a plant element, e.g. a cubic centimeter of root. Deposited Fungal Strains Biological deposits of each of the fungal strains listed in Table 1 were made on the dates shown at the American Type Culture Collection (ATCC®), located at 10801 University Blvd., Manassas, VA 20110, USA, under the provisions of the Budapest Treaty and assigned by the International Depositary Authority (IDA) the accession numbers indicated. Upon issuance of a patent, all restrictions upon the deposits will be irrevocably removed. The deposits are intended to meet the requirements of 37 CFR §§ 1.801-1.809. The deposits will be maintained in the IDAs for a period of 30 years, or 5 years after the last request, or for the effective, enforceable life of the patent, whichever is longer, and will be replaced, if necessary, during that period; and the requirements of 37 CFR §§ 1.801-1.809 are met. Attorney Docket No. LOAM-F005-01WO Table 1 It would be understood that fungal strains from the same species as those described herein would have similar desirable attributes and are encompassed by the treatments and methods of the present invention. Genetic Biomarker Sequences Identifying the Fungal Strains In one aspect, the fungal strain comprises a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3 (see Table 2). In another aspect, the fungal strain comprises a TUB2 sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of any one of SEQ ID NOs: 4-6 (see Table 3). In one aspect, the fungal strain comprises an TEF1 sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of any one of SEQ ID NOs: 7-9 (see Table 4). In one aspect, the fungal strain comprises an RPB1 sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% Attorney Docket No. LOAM-F005-01WO identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of any one of SEQ ID NOs: 10-12 (see Table 5). In one aspect, the fungal strain comprises a RPB2 sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of any one of SEQ ID NOs: 13-15 (see Table 6).

[0002] OWAC1TTTGT ACGC G A ACGC G A0ATGCTTG CTTG C-500F-MAOL.oNtekcoDyenrottA GACGTGTAACCGG AC G TATAA ATCTT AATA AATGATCAAACTA AAG TGATCA AGTTGTC ACGGGT TCGGAC CTGCCGTGGTGAC CTGCCGGGTCAAGA T G AGATAATCA AAG GCTGCAATCAAG GCTGC ACCGATACGAC GACGAAC G G TGGCCACTCGTTGCCGTTGCC TGTCTTCTG TG GGCGCG AGCTCTAC TCGTTGCGCG TCGCGCTCTAC TCGTTGC CGC AC T AGATCGGAACGAAACTGA TA ACCAG TCCTCAGTTTATAGCC ACTGATG GTGGCC ACTGATG GTG CTTGATACGTTAGCCTAATACGTTCA AGCTGTG CTCGTCG CC G GCTCTCAATAC A GCAGTCA GTTAC A GCAGTCA G CCATGA A ACCTTAC CCG CG A ACCTTAC CCG CG TCCA GGTCTTATTCACTGGCTG C CGATATCTGGCGGCTAC A AC G C TGA AGGACGTA GGT TCGGCGCTGGTTGTCCA CGGCGCG A G C A G G C A A C G A G G G C A A C GTTG A G nrie6ab5645rt m83-9S-7- SuUS SN U U 2.elQoNb E1 2 3a SDTI O W1CCCGTCA CCC T0GTAAACCTTTCGATCCCCGT GCA TCCC A -500F-MAOL.oNtekcoDyenrottA C CG TCA ACGGTGTT TCGCGCCGCTCTGAGCG CA GGGTACGGTGTCG CCCTGGGTGACC GCGTATTGGGTA GCTACC CGC TC CACCCTCCTTCGAGCTACC CGC TC CGCGC C AAGGTACGC AGCGC C C TTGCCAC GTTGATGTGGCCTGC AAGGTCTCA ATTC CCGTCAAC GC ATG C GG C ACAGCTATACC CCC A GC GC C A G CGTC C AGCTATCCGTCGGGCTGTCCGG CCACGCATC GATC A GGGCTGTGGCCCGCG GAGGGCC CGG AATG G AGGGCCCGCG G GCCA ACCCCAGTATG GCCGTCTGGGTTGGGCTAC CCAAGTCCACATGCCGATTTGCG AC CCAGTGGGGTTGTTCTGTGACCCTGTACCGGTTCCCTTGGTTATAGGAGGTCTGACGGAACGCTCGTCTGTCCTGTACCGTC A A A C C C GTC ATC C C G C CTTC C A A A C C C GGTC nrie6 6ab5rt m84-9- Su SUSN U 3.elQoNb E4 5a SDTI O W10-500F-MAOL.oNtekcoDyenrottA GTTTGGGC CCCAG CAGTC C CGATGC AGCGA C ACAG CCGTGTGGG GCTTCCCAG CAG CG CT TATGGACG CCGT TATG CGCCTGCCTTAAGCCA CGGTGTCTGC CGCCTGCCTTA CCC GG CGTATG G ACCC GG CCCCGGGTA C CC CCCGGG A C CTCGTTCGAGCTCCGTCACCTCGTTC A C GTTGATGTAG GGCGCGC C C CCTAAGGTCTCACATTGATGTGG G CTCCA CCACAGCAAGTTCG CACCG CGTCCA CCACAG GTGC CCGGGC C CCACGCACGCCGTGATA CG GTTACGGCTGATGC CCGGGC C ACGC G CGAG GGCCGCG CCCGGACGGTGC TCCATAAGTGC C ACATGGAGGTGC TCCATG C TGGCTACC TATG C G G ACTGGGCTCG C GGCTACC TATCCGTTGTTCGA GTGGCTCCTAGGCGTTCGTCGTCGA GTG TATA GA C GA GGAACGC GC C C G C CTTCTCTGTCCTA CGTCCTTTATA GA GGAACG ATC C A A A C C C GGTC AGTC C C G C CTTnrieab 53rt7Smu-SN U . QoENSD6I O W10-500F - G G C C M G AGGA CTAATGCCC CCGAACAAAG G C GG C CGACGATCCGA AA A AAA CGGTC A G G GCACGTTC GCCC CGTTTCAAAAA GGOLG GCC C CGACAAAGAGTCG CCC.TG GCGAAAGoNtekcoDyenrottA GA AAAGATGACACGCTCCGATGTAAA AG C C C GCGCT TATAACCC C CG AC CG GCA CGGAGGTGACGTGTTATCCGCACC CTGTG GACGAGCCATC GGACTG CG A G CGCTATCC G GCCAAACCGTGTCA GA CTCCAG CCTGC AACACTCGTTCGA GGCA CCATGCG CGACCCA CGGA CTC ATC GCG CC GG AGACTC CTCACACGC CGCG GTTCGGTTGTACGTGCAGA AAG AAATCTGGA G CG CGTATGC GCTG CCCGCG GCGCCGCTGATTCC C A GCGACCCCCG CGGGGTG G GCCTAGTGGCTA GCTGGTACCCCTGATTGCCG TG CC GAG TC CGTTC CCTC GCTCC GCGCG CG ACTGGTAGG CGCCGTCAGTC C C A A G C C C CCTCC A CT TGTC C C C C C A A A G nr rie n6ab ieb564ratr 8-9- Smut mu S SNSN U U . Qo4 .oENSeDlQN7 8Ib EaSDTI O W10-500F-MAOL.oNtekcoDyenrottA A A GAGTG ACACGCCCGACTGTATA AA AGTG ACAA CGCCGCG GGCGCTTGTATAACCCCCG CGCG GGCGCTTTATA GCTCC CACACCCGAGGCTTGA GTGTTATCC CACCG C C CCGCTG GCA C CCA GGA A C ACCGTGTGCTG CAGCCA C GCCGTG GCA CCA T AGGCGATGCATCAGGGA A C CCC AA GCC A CTGCCC ATGGCCCGAC GGCC CTGC TCCATC CTTCACCACGC CCGCGAAC CCATTTCG ACC GTTCGGTTGTACGTGCAGACTC C GTTGGTTATGCAGCTG C CGCATCCCCTAGGAGGAGCATGC CGCATC G GCCGCTGGTTGCGACCGCTC CCCTTGCCCGGTTCCTAA TCTTG GTGGGTACCCCTGG ATCG G CCGCTA G G GCCTAGTGG GTGATG CGTCTTGGTACCC CC GCC GC CGGCGCCCC G GCATGTG GCCTATCC GGG C C C C A CATGTGCTCTC GCA C C C C C A A A G C C CTC ATCATGTGCTnrie5ab3rt m7- Su SN U . QoENSD9I O W10-500F-MAOL.oNt eC C AA ACAGTA AGGCTCGCkCAcGTCCC G CGCGAG CTGAG CTCGATG ACCGTG CC GAoCGTA AGTACATAA CAATCDCAAGGA ACG G GCCGAGG AGy TGCAATC GGA C GC CCTGAGeA G AGAATACTAA GnrottA CCGATG CTTCTTACGA AGTAA AA ACGGCGTTGTAA TATAATCAGCAC GCGAG GGGAGGC GTACA CGGCGTG CCTCGGATGGGTC GATACGATC A C ACCGTGTAA ACACGAGAGCTTA CTGCAC AGTGTCGC AATGCT TGCCGGTCGTAG CG CCGACC ACGCGCG CGC GC CACTTATA GTCTGCA AACACCCTAC C C G C CGTGCCAGCC GTACTACGAGAGG GTGTC GA CCCTAG GCG C ACACGGCGACATCCCG GCG ACC G A G AGTGGGGGGTTCC CCGCATCC CCCTA GGCCGTCAC AACA TCTCTCGGAG C CGGTG G CG CGCCCTTA A AGACC A AGTC GCCCTGA TGCCTCAGTTATAAGGTA ACCGTGGGGTTCG T TTG C C C C A ATG G C G A C CTA C G C GTA A nrie nre6ab irab5t8Smu rt m -SNS uN U . Qo.oEN 5elQ EN 0SD bS 1I aDTI O W10-500F-MAOL.oNtekcoDyenrottA C CTTTCGAG CGCCGTACCCGCTCGTTTGG GG G CAGGTTA CGGTCATTCAGGTGCTTTTGCTGGCA ATGTC GCACC CGTACATTCCGAACACTGC ATTACCTGG G CTACAGCTCTG CCCGACTCGCA ACGACGTCGGACCAATCCCGCTC GCCCGGTATCTG CG A ACGTC GGC GCCTTGTGCTCGGG C CAG GGAGGCC A GCATTTTG GGTATTTTCACGTAC AAA GAAGAGAGCTCTCGTTTCATCTC G CTG AGACCGACAGGAAAAGTGCCATATCATGTGCTGTCCGCTA CTCGGACGCCCTTGATTTCA CCTATTGTTAGCGG CATGA TAGCCTCGG ACATAGA CTCGAAAAC GACG A ACGTCAAGGGATTC AGC CGGTAAGGGTA ATACTACG C GGTCTCA A CACCC C GCCCGTGG G CGGTAAGC CA G AGAG G CATA C GAGG TG G C A C A G C AGTC G C A ACTAG G C CGTG GTATAAGGAG G A A A C C GTC nrieabrtSmuN . QoENSDI O W10-500F-MAOL.oNtekcoDyenrottA ACTC C GACGCCCGG CA GGGACGCCTC CC C GC GGTTTA AA CATGGC GA A GACTCCCCAGAGC CACCGATAACAG TGAGGA G GCCTGTGATGGGGACC GTCGCG CTAC AGCAGC G AGCCGTTTGG CAACC ACTCCTCCCAAG TCTCA ACACATGTGAATCAAAGGCTCATATGTTGTTGCTACTTCGTCGCGACTGTGGTCC C C GTCCCGC GTC AGAGTAAAGTGGG C GCCTACATA G C GCCTCAC GC AGGGA CAGATTAAAGGTGTTC CTACGTCAG CG AGGATCTTGAGGGCCG CGTAATCCA CGCCATTACA AACTTTAGAATGTGTGACTC CACGTCCTC CCGCA AGCGCGA CCGCTCGGTCGC CGGCTCTCCTC C CC CA CTG C ACGC CTCG C GCTATG C G C A TATCTA A CTCAG AAGG C C GT CG GAGACCGGTA GGTCCT TCTATC CCGACCG C C C C C A C G G C CATTTA ACATCGC G A C G CTTAAGTTG nrie6ab4rt9- Smu SN U . QoEN 1SD1I O W10-500F-MAOL.oNtekcoDyenrottA CGA C G AA AAGGTAAAACCGTTTGC AACTTTCGA CGCCGTACCACGC TCGGCCGGAGTGGGTTA CGG CTCATTCAGGTAGTTGGCC ATTCCCACCGTACATTCCG G AAC GCCAG AC CGAGAGCTTAGTCAGCTCTCGCA CGA CA TTACGTGGTG G ATCGTTCGC TAG CGCA G CCCGA CCTCGCA GCCC CCCCTG TTGTCGGG C CAG G CTC AA C CGCAGCA GTA CCGTATTTCACGTAC AAA AGAGGTGCTGCATCCGACTCATCTCCTGG GA ACC C GCGAGATCCCGCGATCAG TGTGA CTGTCCGCTA GG TCC GCCCAGC CCAGCTG TTGGGTCAAACAGTTCATTGTAGCGGTC A TCTCC A A ACGT TTAGGGCATA T A AGTA AGACC A CCAT TACG CCAGAC GCCCTGACGGACTG GTTAAGGGA A GTAC CCGGGCA GTCGTG GTTTGCA G A AGTG C A C A G C AGTGCCA G C G A C CTA C G C GTA A G G C A ACTnrieabrtSmuN . QoENSDI O W10-500F-MAOL.oNtekcoDyenrottA G CGCTCGTTTGG G GACAGACTACGCC CCGG CAGGA GCTTTTGTCTGGCATGTAAGTGGCAAACTG CCCCAACACGC ATTACCTGG GCAAGGG AG G GCTGTGATCGTCGGACC GAATC CCTCTGCAGC CG AGC GTTGG GGTATCTG C A ACGTGGCATG CTCATGTGCATTAC GAGGCC A GCATCTTTG GGACACATTCGATCCA CGA GAAGAGAGC TAGTCTCGTTTGTCACGAAAGTG GGGA G CGGAAAAGTGCCATGCAGATGAAGAGA GCGACGCCCTTGATAGGTA CG TG TGCGGTTAAA GCCGG TC TTTCGGTCACAAGCGAAAAC AAACTTTAA C GAATGGTG ATGACGA ACGTCAACGCGACGCTTGTCCTCA CCAGTG AGGGC CC G GGCGGAAGCCATACTGTCC CATCTGCGC CAGGCTC GA G C CGT TTAAGGAGTGA CA CCCG G A G A A A C C GTCCTGGTA GGTG CCTGAGAC G C C C CTCTA nrieabrtSmuN . QoENSDI O W10-500F-MAOL.oNtekcoDyenrottA CG C C CCTC CC C GCAGGTTTACGAAAGGTCAATTGAA AGAGC CACCGTAACAGAA CACCG CGCGGAGTCGGGGGG C AA CACGTCGCG CTACATCGG AGTTAGGCATTC GGC C CACTTCACCTCC TACAAGG C TGTGGTCCTG AACAG CGAGC AGCTTA CTTCAGTGTTGCTCCAGGGTG GTTC C GG G CCCGCGTTTACTATCGTA CCCC CCC TACATG C GCCTCACC C CGCAGAA CCAC GTA CC GGTGTTC CTACGTCAG CGAGAGGTGTGCATCCGA TAATA CCCCGCCATTACACGGCGAG CATCCCG GCG ACTGCCAC ACGTCC CCTC CCCG CCA AGTCC CCTAG GGCCTAG CACTAACAGTCGG ATCT TCC C GCTG GTCA TAAGGTCCG C C GTGCC CCCCGAACTCTA ACATCGTTATATA AGAGGTTA ACA ACC ACCGTGCCCTGA GGGGTTC G G C CTC G A C G C AGTG G C G A C CTTA C G C GTTTG A A nrie5ab3rt7- Smu SN U . QoEN 2SD1I O W10-500F-MAOL.oNtekcoDyenrottA C CTTTCGAG CGCCGTACCCGCTCGTTTGG GG G CAGGTTA CGGTCATTCAGGTGCTTTTGCTGGCA ATGTC GCACC CGTACATTCCGAACACTGC ATTACCTGG G CTACAGCTCTG CCCGACTCGCA ACGACGTCGGACCAATCCCGCTC GCCCGGTATCTG CG A ACGTC GGC GCCTTGTGCTCGGG C CAG GGAGGCC A GCATTTTG GGTATTTTCACGTAC AAA GAAGAGAGCTCTCGTTTCATCTC G CTG AGACCGACAGGAAAAGTGCCATATCATGTGCTGTCCGCTA CTCGGACGCCCTTGATTTCA CCTATTGTTAGCGG CATGA TAGCCTCGG ACATAGA CTCGAAAAC GACG A ACGTCAAGGGATTC AGC CGGTAAGGGTA ATACTACG C GGTCTCA A CACCC C GCCCGTGG G CGGTAAGC CA G AGAG G CATA C GAGG TG G C A C A G C AGTC G C A ACTAG G C CGTG GTATAAGGAG G A A A C C GTC nrieabrtSmuN . QoENSDI O W10-500F-MAOL.oNtekcoDyenrottA CTATGGG G GTTGCAGCAG AACCTGATTTAGAGGGCC GCGCCGC CTCCTCCACC CCAGGCA GGGGTG TTTCTTCGTCCTTCG GCTATC ACTATCGTGTGGCGGGCCCCA GCTAGCGTCTGGACTCGTGG ACTTC ACGCCCC GGAGG GTTTCG ACC C GACGCCTCC C G AAGATGGC GACA GACCTG CCCCAGAGCC CACG CC GATG AA C AGG CGTGTGATGGGG CTCG TG AGAG CGTG A CACGCTGCC AGCTCAC TAGTCCGTATTG ACA C GGCACTCAC CC TAGTTC TCACAGCGACA ACGT TCTG ACTTGTCGCGATGGTCCC GCGTCAC AGAGTAA AAGTAGGGGTCCC TAC TA CTA G CC GCCTGC G AGTTAAAGGTGT TACTC AGGAGGGCGG CCGT TCA GATAATCCTTTTTAAAAG TGGCG AAGACTCC CC GCGC CCCTCTAA C AG CGCTG GCCGCTCTGGTTCGCCATCGGCCTCCCCC CC G C ATGTC CACTG C CAGT TC ACTGCTCAAAGGTCCGCAGTTTA CA C G TGAGACGGTC A GGTCCG C C C CTCTAATCCGA C G G C CACTTCCTACAC G A C G C nrieabrtSmuN . QoENSDI OW CCTGC1 GAGGTCTTTCTTATCT CCGGCCCAA AGAGC CCG GG0-500F-MAOL.oNtekcoDyenrottA ACGTG A GACG G GAAGC C AGCAGCCGTCCGAGTG G CA ATGCTAACC G GTGC CG C C A GTCGACTCGCC TC GGCTACGC CCAACAGG GCGCAGTCCGTATTGTTTG CCCC AACAGGG GACACATG CCGACTGCATA CGCGC AC TGTATG CCG T AC ACGAACCGACATCA ACGCGTTGGGGCC CTTGTGCGCGCATAGAA GCGGCGGCACTGTATAGGTCACCT GAAGG C AG GTGC GCCGCCAGCGCTG GCCG GGTATCATTAAG GTA CCTAGGGGACAC GAG CTCAGCATAC GGC AAGGCCCGTTTAAA CGTTC CATTC CTC C A AGTCCC GGC TCG A C G GCTGTCACTCA CTGGCATGTGGGACGG TA A GA TGG ACGAGCTT TGCAAGCACGC A A A GCCCGTTCCCTC CCGC C CTA CCCTA CC A GGTCTC G ATTCA A G C G G C G C C G G A G C AGTA G G A GTTnrieab 65rt8- Smu SN U 6.elQoN3b E1a SDTI O W10-500F-MAOL.oNtekcoDyenrottA TGG CAAATACCGTTG AATAATGCCGTGGTGCCTAGG TG CTGTCAC GACGCAGAGGGCTGCCTTAGGGC GC C G CAATGACCATGGCTCGTCTCCCGGGTTCCGCGCTTG CCAAGCCG TGGCGTCTATCAAACGAAGCCCC G TCCCCCCGACCA CGTTTCGAC GCC CCCACTGGGTCAGGCTTCCACCCTTCTCGCC GTC ACCTA GTGA AGGCAGTTCCTTTG G C GATG CCTGTCCC C ACGTGGGCGGTGCTTGACTGCCA CATA CTCCAGGAGCAGTAGTTAAAGC CTGCCAAAGAG GTGCGCGCCTCGGG AA GGGAGCTTCTAGACAGATAACTTCG AGAGCTAG C CC CC GGC TAACCCG CCGGTG GG GA CCTCCTGCTACTGGA G A GTCAC A A TTC GATG A GC G GCGTACG G G GCTG G CG AA CA TGTCGG C CGCCG C CGTGC A C C A A AATTACC G GC A GAAAG AGA G A A A A GCTA G A CGTCTA A GGTnrie6ab4rt9- Smu SN U . QoEN 4SD1I O W10-500F-MAOL.oNtekcoDyenrottA CTA G GAGAGC GCAACG AGGAG C G CTGCGTAGGGATG AGATCCCTCAGGCCA CGCAGGCTCGTGTCCTGGA ACGCAA A GGCGCGTACGACGTCGTCCTTCCCA C A CCCAGGATACGCTGGTCCTA ATCTGTATGTGA CG AACCGAACCGA CG GCCCGCTGAATCGCGTCTCGC CA CAGTGCGCGACAAGAACACGCG GTTGGCTGGC C ACTTTAGGTCACATGCGGC TG CAC A GGGTCAGGGCGCCCCGTC CAAGCGCCTGCGCCGTAGTA CTAAGGCTTGGCCCTCCGGTAGGGGACAA CTGAGAGTA TAC C CG ACGTTCTAATAATCATCTCATCCGCGAAGG C TA GTGAA GCCTCGCG CTACTTGTCCA G GC GGACGGG ATC AACGA TAGTAACCC C GTCTCCGTGCAAGCACGCTG A TGCATT TC CCGC C CTA CCCC G CTCGTCTG CGTCTCA A G C C G G A G C AGTA G GTATGGCCCTA GTTGCA A G AATnrieabrtSmuN . QoENSDI O W10-500F-MAOL.oNtekcoDyenrottA TTACACATG CCAC GGTAATGG A CA CCTAGCAAGGCTAGATGAGCGTTAAGAGGG G CCCGGTGCCTGC GCAGAC G CACGCA GCGCTCGTCTCTCC CGTTAGGCGCACGC TTCCATGAAACGAA GGG GCCCTCCTGTC CGAC CCACCCTCCGGCTCCCA GGGGTATACCCTAA ACC AACCCCCGTGCC CTCTATCCTTCTGCTAGACCAGGGTCAG CTTTG G CAGATGCGGCCACGTTGGCCTTTACTTAAGTCCTCTCCCGTACCTTCCCACGAGTAGCCTCCGATG AAAGAGTTTCCAGGAGCGGGC CCGC CG GCCTGCCAGACAG GAGTCGCGC GCTCCTAGTACACTTCTCTC GGCCGCACGAACTC AGC A A AG A CGTC CGTTT TA GTCAG GTGG CTG GAGA GAAGG A G ATG C C G T GCATTCTC C G AC G ACC AA CGCGCCGCAG GGCGACCGTA A GCA G C G G G A C C A A A ACTC A A A G G A A GGTCTC G C nrie5ab3rt7- Smu SN U . QoEN 5SD1I O W10-500F-MAOL.oNtekcoDyenrottA G GAGC GCAACGAAGGAG C G CTGCGTAGGGATGTACA CCTA AC GGCCCGCAGGCTC GGTGTCCTGGATCAC A A GGGCGCGTACGACGTTCTCCTTCCCA C AGAGC A GGATACGCTAACCGATGG CTCC A GATCTGTATGTGA CGGCC CCGCCCCTGAATCGCGTCTCGCGTCCTAGCGCGACAG CGGTCACATAGAACACGCGTGCGGC TGGCACTGGCTGGCTAACC A GGGTCAGGGGGTC AAGCGCCTGCGCCGTAGTA CTAAGGCTTACTTTGGCC TCTCCGGTAGGGGACAA CTGAGAGTAAAGC CGTCTAATAATCATCTCATCCGCGAAGG CCGC CTAA CGCCCGCGTCTTTGCCA G GCGGTCACGA C GTGTTC TGTTGTCTC CCGGTGCTCA GCATGGACG A AGCACGCTGAATCCACCGCACGCTA CCCA G GTATA C GGCCCTG CCGTC A A GTTCA A G AATATA G CT TCT TG C C G G A G C ATATTG nrieabrtSmuN . QoENSDI O W10-500F-MAOL.oNtekcoDyenrottA S2AGGGGG GCCCG B AAAPCGTG CTGACACGCATAGCG CG AAAGCCCGGC A CAGGGAGA RTCATCCGC AAGGCGCCG ATCTC CCCAGCGTA GCCTC G CCTTGC TCCTATGCCCC GCTGGCGGGATG GCCTGTAGGGAGTACGT7CAT 3GA ACGGAGGA CACCGCG CCCGGTTTG GAGCCGTCGGTCTCTC TAATGGCTCG CACATCTTCGGCATTGTTC CTAGGC AAGTCCCAGCTTGAGCCC C CAG CCAGTTGAG C GGTGTA GC CCG ACG G CTTCG AA CGGGTAA TCGTCAGCCCCG CGATC G CGCA TCCCCCG AGTAGCGG G GTGCTGCCCGG CGCGTCAG C AGGGACCCA TTGGCATAAGTGGAA CAGCCCTGAGTAGC G GAG GCGGTCATCTAACCGGTCC CTCCCTGTC AGG AG TC GGTACGTACG CGGGTCCG GTCAA CGACA CAG CCC CCTGTAA CC AGCGCCTTTTGCCCGCGTCTTGGGTTCTCTC GATA GCCC GCCTG A G CTA G CTACGC C CTCC GGTCTTTCC CG C GGA GATAA ATC A AGC GCCA AGAG CAG GAGCGCGCCTC TCTCTA CCCG AG GGGCCTGCTACTGA ATGAG G CC TCA TGAGATCGAAGG GCAGGTAC CGCGCCGCA GGCGACC C G G G A C C A A A ACTC A A A G G A nrieabrtSmuN . QoENSDI Attorney Docket No. LOAM-F005-01WO Crop Plants A “plant” means any plant of economic importance and includes cereals (such as wheat, barley, rye, triticale, millet, oats), maize (corn), canola, cotton, soya bean, rice, potatoes, sunflowers, beans, coffee, beets (e.g. sugar beets and fodder beets), peanuts, oilseed rape, poppies, olives, coconuts, cacao, sugar cane, sugar beet, sunflower, tobacco, vegetables (such as tomatoes, cucumbers, onions and lettuce), lawn and ornamental plants. In a preferred embodiment, the plant is a crop plant. “Crop plant” generally means any cultivated plant grown to produce a harvested horticultural product for sale and / or profit, as well as subsistence crops that may be grown to support other agricultural products, such as livestock. The crop plant may be any crop of agronomic importance cultivated for food, animal feed, fiber, fuel, and / or industrial purposes. The crop plant may vary from region to region worldwide, wherein the variance may depend on factors such as dietary requirements and environmental conditions. “Plant cultivars” are understood to mean plants that have new properties ("traits") and have been obtained by conventional breeding, mutagenesis or recombinant DNA techniques. They can be cultivars, varieties, bio- or genotypes. “Plant parts” are understood to mean all parts and organs of plants above and below the ground, such as shoots, leaves, needles, stalks, stems, flowers, fruit bodies, fruits, seeds, roots, tubers, and rhizomes. The plant parts also include harvested material and vegetative and generative propagation material, for example, cuttings, tubers, rhizomes, slips and seeds. An “increase in yield” of a crop plant treated with one or more fungal species includes an increase in fruit, grain or vegetative tissue production of the treated plant relative to that of a crop plant that is the same, but which has not been treated with the one or more fungal species described herein when the treated and untreated plant is grown under the same growing conditions. An “untreated control plant” used herein is grown in a similar soil type under similar conditions (e.g., fertilizer application, watering, etc.) except that no fungal strain is applied to the plant. For example, an increase in yield of a treated wheat plant is an increase in the number and / or weight of wheat grains produced by the treated wheat plant relative to that of an untreated wheat plant grown under the same growth conditions. Typically, the increase in yield of a plant treated with one or more fungal species is an increase in fruit, grain or vegetative tissue production of the treated plant relative to that of a healthy plant of the same type that has not been treated with the one or more fungal species described herein when the treated and untreated plant is grown under the same growing conditions. A healthy plant is a plant that is not infected with, or affected by, a plant pathogen. Typically, a healthy plant is a Attorney Docket No. LOAM-F005-01WO plant that is not infected with, or affected by, a plant pathogen and which is grown under conditions for normal growth of that plant (e.g., is not under stress, such as nutrient or drought stress), such as, for example, the conditions under which the crop plant would be grown under during commercial crop production. Increased yield in plants can result from improved plant physiology, growth and development, such as water use efficiency, water retention efficiency, improved nitrogen use, enhanced carbon assimilation, improved photosynthesis, increased germination efficiency and accelerated growth maturation. Yield can furthermore be affected by improved plant architecture (under stress and non-stress conditions), including but not limited to, early flowering, flowering control for hybrid seed production, seedling vigor, plant size, chlorophyll content, nodulation, internode number and distance, root growth (e.g., root number, root length, root mass, root volume), shoot growth (e.g., shoot mass, leaf area, leaf number, plant height) seed size, fruit size, pod size, pod or ear number, seed number per pod or ear, seed mass, enhanced seed filling, reduced seed dispersal, reduced pod dehiscence and lodging resistance. As used herein, “agronomic benefits” means improving one or more of these factors thereby increasing the yield of the plant. The crop plant may, for example, be one or more compatible crops selected from the group consisting of species of the genus Triticum, Glycine, Brassica, Gossypium, Zea, Corchorus, Saccharum, Medicago, Lolium, Coffea, Camellia, Oryza, Hordeum, Boehmeria, Nicotiana, Cannabis, oilseeds, grain legumes, vegetables, fruits, and / or combinations or hybrids thereof. It is contemplated that the list of the crop plants disclosed herein are mere examples for the skilled persons to understand the present disclosure. The crop plants may further include new future species and breeds as well as hybrids produced by grafting or transgenic species. In preferred embodiments of the invention, the crop plant may, for example, be one or more crops selected from the group consisting of the species Triticum aestivum, Brassica napus, Brassica rapa, Brassica juncea, Gossypium hirsutum, Gossypium barbadense, Gossypium arboretum, Gossypium Herbaceum, Zea mays, Medicago sativa, Lolium multiflorum, Corchorus capsularis, Saccharum officinarum, Cannabis sativa, Coffea Arabica, Coffea Robusta, Camellia sinensis, Oryza sativa, Hordeum vulgare, Boehmeria nivea and Nicotiana tabacum. In one embodiment, the crop plant is a cereal plant. Cereal plants include, for example, wheat, rice, corn (maize), canola, rye, oats, barley, sorghum, and some of the millets. In various Attorney Docket No. LOAM-F005-01WO embodiments, the crop plant is a cereal plant selected from the group consisting of wheat, rice and corn. In one aspect, the plant is a millet selected from the group consisting of finger millet (Eleusine coracana), foxtail millet (Setaria italica), browntop millet (Urochloa ramose), pearl millet (Pennisetum glaucum), Japanese millet / barnyard millet (Echinochloa esculenta), little millet (Panicum sumatrense), broomcorn millet / proso millet (Panicum miliaceum), Kodo millet (Paspalum scrobiculatum), fonio millet (Digitaria exilis), guinea millet (Brachiaria deflexa), great millet (Sorghum bicolor), Sonoran millet (Panicum hirticaule), Polish millet (Digitaria sanguinalis), adlay millet (Coix lacryma-jobi), and Taiwan oil millet (Spodiopogon formosanus). In another embodiment, the crop plant is a fiber plant. Fiber plants include, for example, flax, hemp, jute, and cotton. In various embodiments, the crop plant is a fiber plant that is cotton. In one embodiment, the crop plant is a legume. Legume plants include, for example, soybeans, alfalfa, clover, peanuts, lentils, lupins, peas, Desmanthus, and chickpea. In various embodiments, the crop plant is a legume that is soybeans. In one aspect, the crop plant is Desmanthus. In another aspect, the Desmanthus is Desmanthus virgatus, Desmanthus leptophyllus, or Desmanthus pubescens. In some aspects, the crop plant is a cover crop. Cover crops include but are not limited to ryegrass, clover, red clover, white clover, crimson clover, annual medics, annual ryegrass, Italian ryegrass, canola, fine fescue, Kentucky bluegrass, orchard grass, and other grasses. In other aspects, the crop plant is a grass such as switchgrass, tall fescue, meadow fescue, perennial ryegrass, Italian ryegrass, orchard grass, guinea grass, foxtail millet, pearl millet, Bahia grass and Miscanthus. In embodiments of the invention, the plant is a “non-native” plant host of the fungal strain. “Non-native” plant host means that the fungi are heterologous to said plant insofar as the fungal strain was collected from a host other than said crop plant. Endophytic fungi are known to have preferred hosts and growth conditions. Consequently, they will not necessarily flourish, and, therefore, will not produce the desired stable SOC, in the absence of their typical growth environment or an association with their native hosts. Moreover, when considering the survival of the fungi in non-native plant hosts, it is difficult to anticipate whether the fungi will be pathogenic to the non-native host. Therefore, fungal species may not readily be compatible with a non-native crop plant host. Attorney Docket No. LOAM-F005-01WO Inoculation As used herein, the terms “inoculate,” “apply,” “treat,” and “deploy” are used interchangeably, as are their associated nouns (i.e., “inoculation, “application,” “treatment,” and “deployment”). The inoculation of the plant with one or more fungal species may be achieved by any suitable means, such as direct addition to the soil and / or plant roots and / or to soil proximal to plant roots, or may be achieved by an initial fungal inoculation of any propagation material, seeds, seedlings and / or immature plants of the crop plant prior to placement of the seed, seedling or immature plant in the soil within which the plant will grow. The inoculation of the one or more fungal species may also be achieved by direct addition to a cultivated soil prior to sowing seeds or planting seedlings that are coated or partially coated with one or more fungal species such that the fungi will become associated with, or grow proximal to, or grow into the roots of a crop plant as the crop matures. By means of the inoculation, the fungi are deliberately encouraged to become established in the soil and / or grow proximal to, or grow into the roots of a plant (i.e., become associated with) that is a crop plant, wherein it would be understood the fungi may exist and grow in the soil or exist within the plant, or in both simultaneously. In aspects of the invention wherein the treatments or methods rely on the inoculation of a plant with a fungus, it would be understood that the fungus need only be associated with the plant for parts of the fungus’ lifecycle and that the fungus may survive in the soil in the absence of a plant host or host crop plant. In other embodiments, the inoculation may be considered a semi-permanent inoculation to a plot of cultivated soil, such that the fungus is deployed to said plot of soil and is retained by the soil as the crops are rotated, even in the absence of crops for periods of time. In some embodiments, the soil is inoculated with the one or more fungal species. The soil may be inoculated with one or more fungal species prior to planting the plant, for example, before, during, or after tilling the soil in preparation for planting. In other embodiments, the soil may be inoculated with the one or more fungal species after the plant has been planted. In some embodiment, the soil is inoculated with the one or more fungal species by planting in the soil plants that have been inoculated with the one or more fungal species. In some embodiments, the step of inoculating a crop plant comprises applying the one or more fungal species to the seeds of the plant prior to planting. In some embodiments, the step of inoculating a crop plant comprises applying the one or more fungal species to seedlings of the plant. Attorney Docket No. LOAM-F005-01WO In some embodiments, the step of inoculating soil comprises deploying the one or more fungal species to a plot of cultivated soil, such that the fungus is retained by the soil as the crops are rotated, even in the absence of crops for periods of time. In one embodiment, the plants are inoculated with one or more fungal species as a seed coating before, during or after one or more of the seed germination stages or as a root inoculant of a seedling. For example, the treatment may be applied as a seed coating to seeds en masse prior to sowing a crop. The one or more fungal species for inoculation may be in any suitable form, including, for example, as hyphae, mycelia, conidia and / or combinations thereof. In general, the one or more fungal species for inoculating the plant will be in a form that is substantially free of contaminating microorganisms, with the exception that additional desirable microbes may be added for additional benefits. In some embodiments, the inoculant may be in the form of a dried powder, a spray, a slurry, a sachet, a liquid, a jelly, a seed coating, an enhancer, and / or combinations thereof. In some embodiments, the inoculant is in the form of a seed coating, a foliar spray, granule, powder, soil drench or a root dip. In one embodiment, the inoculant is in the form of a seed coating. In one embodiment, the inoculant is in the form of a foliar spray. In one embodiment, the inoculant is in the form of a root dip. In one embodiment, the inoculant is a granule. In one embodiment, the inoculant is a powder. In one embodiment, the composition is a soil drench. In some aspects, the fungal inoculant is applied to seed at a rate of about 1 x 106colony forming units (CFU) per kg seed to about 1 x 1012CFU per kg seed, about 1 x 107(CFU) per kg seed to about 1 x 1012CFU per kg seed, about 1 x 108(CFU) per kg seed to about 1 x 1012CFU per kg seed, about 1 x 109(CFU) per kg seed to about 1 x 1012CFU per kg seed, or about 1 x 1010(CFU) per kg seed to about 1 x 1012CFU per kg seed. In other aspects, the fungal inoculant is applied to seed at a rate of about 1 x 102CFU per seed to about 1 x 105CFU per seed, about 1 x 103CFU per seed to about 1 x 105CFU per seed, about 1 x 104CFU per seed to about 1 x 105CFU per seed, about 1 x 102CFU per seed to about 1 x 104CFU per seed, or about 1 x 103CFU per seed to about 1 x 104CFU per seed. In other aspects, the fungal inoculant is applied as a soil amendment at a rate of about 1 x 104CFU per hectare to about 1 x 1012CFU per hectare, about 1 x 105CFU per hectare to Attorney Docket No. LOAM-F005-01WO about 1 x 1012CFU per hectare, about 1 x 106CFU per hectare to about 1 x 1012CFU per hectare, about 1 x 107CFU per hectare to about 1 x 1012CFU per hectare, about 1 x 108CFU per hectare to about 1 x 1012CFU per hectare, about 1 x 109CFU per hectare to about 1 x 1012CFU per hectare, about 1 x 1010CFU per hectare to about 1 x 1012CFU per hectare, about 1 x 104CFU per hectare to about 1 x 1010CFU per hectare, about 1 x 105CFU per hectare to about 1 x 1010CFU per hectare, about 1 x 106CFU per hectare to about 1 x 1010CFU per hectare, about 1 x 107CFU per hectare to about 1 x 1010CFU per hectare, about 1 x 108CFU per hectare to about 1 x 1010CFU per hectare, about 1 x 104CFU per hectare to about 1 x 108CFU per hectare, about 1 x 105CFU per hectare to about 1 x 108CFU per hectare, or about 1 x 106CFU per hectare to about 1 x 108CFU per hectare. In some embodiments, the one or more fungal species are compatible with commonly used agricultural fungicides. “Compatible" means the one or more fungal species in the treatment is not killed or substantially inhibited (growth or germination or otherwise) by the fungicide, thereby allowing the fungi in the treatment to flourish while restricting the growth of undesirable fungal strains that may have a deleterious effect on the soil, the proximal crops or plants, and / or the level of carbon sequestration and stable carbon production. The fungicide may be any synthetic or natural compound that has a fungistatic or fungicidal function and are commonly used in agriculture. Based on their mode of action, they may kill the fungi or inhibit the germination of fungal spores. The composition and / or inoculant may comprise suitable solid or liquid carriers and / or adhesive agents. Suitable solid carriers include mineral earths (e.g., calcium phosphate, calk, clay, diatomaceous earth, dolomite, kaolin, silicates, silica gels, talc, etc.), cellulose, and starch. Suitable liquid carriers include water, or any other liquid solvents which are not toxic to the fungus or the plant. The composition may be prepared in a known manner, by mixing it with customary adjuvants, such as, for example, customary extenders and also solvents or diluents, colorants, wetters, dispersants, emulsifiers, antifoams, preservatives, secondary thickeners, stickers, and also water. Colorants which may be present in the composition which can be used in accordance with the invention include all colorants which are customary for such purposes. In this context it is possible to use not only pigments, which are of low solubility in water, but also water- Attorney Docket No. LOAM-F005-01WO soluble dyes. Examples include the colorants known under the designations Rhodamine B, C.I. Pigment Red 112 and C.I. Solvent Red 1. Wetters that may be present in the composition include all of the substances which promote wetting and which are customary in the formulation of active agrochemical ingredients. Use may be made preferably of alkylnaphthalenesulphonates, such as diisopropyl- or diisobutyl-naphthalenesulphonates. Dispersants and / or emulsifiers which may be present in the composition include all of the nonionic, anionic and cationic dispersants that are customary in the formulation of active agrochemical ingredients. Use may be made preferably of nonionic or anionic dispersants or of mixtures of nonionic or anionic dispersants. Suitable nonionic dispersants are, in particular, ethylene oxide-propylene oxide block polymers, alkylphenol polyglycol ethers and also tristryrylphenol polyglycol ethers, and the phosphated or sulphated derivatives of these. Suitable anionic dispersants are, in particular, lignosulphonates, salts of polyacrylic acid, and arylsulphonate-formaldehyde condensates. Antifoams which may be present in the composition include all of the foam inhibitors that are customary in the formulation of active agrochemical ingredients. Use may be made preferably of silicone antifoams and magnesium stearate. Preservatives which may be present in the composition include all of the substances which can be employed for such purposes in agrochemical compositions. Examples include dichlorophen and benzyl alcohol hemiformal. Secondary thickeners which may be present in the composition include all substances which can be used for such purposes in agrochemical compositions. Those contemplated with preference include cellulose derivatives, acrylic acid derivatives, xanthan, modified clays and highly disperse silica. Stickers which may be present in the composition include all customary binders which can be used in seed-dressing products. Preferred mention may be made of polyvinylpyrrolidone, polyvinyl acetate, polyvinyl alcohol and tylose. The purified fungal populations described herein can be formulated using an agriculturally compatible carrier. The formulation useful for these embodiments generally typically includes at least one member selected from the group consisting of a tackifier, a microbial stabilizer, a fungicide, an antibacterial agent, an herbicide, a nematicide, an insecticide, a plant growth regulator, a rodenticide, a desiccant, and a nutrient. Attorney Docket No. LOAM-F005-01WO In some cases, the purified fungal population is mixed with an agriculturally compatible carrier. The carrier can be a solid carrier or liquid carrier, and in various forms including microspheres, powders, emulsions and the like. The carrier may be any one or more of a number of carriers that confer a variety of properties, such as increased stability, wettability, or dispersibility. Wetting agents such as natural or synthetic surfactants, which can be nonionic or ionic surfactants, or a combination thereof can be included in a composition of the invention. Water-in-oil emulsions can also be used to formulate a composition that includes the purified fungal population (see, for example, U.S. Pat. No.7,485,451, which is incorporated herein by reference in its entirety). Suitable formulations that may be prepared include wettable powders, granules, gels, agar strips or pellets, thickeners, and the like, microencapsulated particles, and the like, liquids such as aqueous flowables, aqueous suspensions, water-in-oil emulsions, etc. The formulation may include grain or legume products, for example, ground grain or beans, broth or flour derived from grain or beans, starch, sugar, or oil. In some embodiments, the agricultural carrier may be soil or a plant growth medium. Other agricultural carriers that may be used include water, fertilizers, plant-based oils, humectants, or combinations thereof. Alternatively, the agricultural carrier may be a solid, such as diatomaceous earth, loam, silica, alginate, clay, bentonite, vermiculite, seed cases, other plant and animal products, or combinations, including granules, pellets, or suspensions. Mixtures of any of the aforementioned ingredients are also contemplated as carriers, such as but not limited to, pesta (flour and kaolin clay), agar or flour-based pellets in loam, sand, or clay, etc. Formulations may include food sources for the cultured organisms, such as barley, rice, or other biological materials such as seed, plant parts, sugar cane bagasse, hulls or stalks from grain processing, ground plant material or wood from building site refuse, sawdust or small fibers from recycling of paper, fabric, or wood. Other suitable formulations will be known to those skilled in the art. In one embodiment, the formulation can include a tackifier or adherent. Such agents are useful for combining the fungal population of the invention with carriers that can contain other compounds (e.g., control agents that are not biologic), to yield a coating composition. Such compositions help create coatings around the plant or seed to maintain contact between the microbe and other agents with the plant or plant part. In one embodiment, adherents are selected from the group consisting of: alginate, gums, starches, lecithins, formononetin, polyvinyl alcohol, alkali formononetinate, hesperetin, polyvinyl acetate, cephalins, Gum Arabic, Xanthan Gum, Mineral Oil, Polyethylene Glycol (PEG), Polyvinyl pyrrolidone (PVP), Attorney Docket No. LOAM-F005-01WO Arabino-galactan, Methyl Cellulose, PEG 400, Chitosan, Polyacrylamide, Polyacrylate, Polyacrylonitrile, Glycerol, Triethylene glycol, Vinyl Acetate, Gellan Gum, Polystyrene, Polyvinyl, Carboxymethyl cellulose, Gum Ghatti, and polyoxyethylene-polyoxybutylene block copolymers. Other examples of adherent compositions that can be used in the synthetic preparation include those described in EP 0818135, CA 1229497, WO 2013090628, EP 0192342, WO 2008103422 and CA 1041788, each of which is incorporated herein by reference in its entirety. The formulation can also contain a surfactant. Non-limiting examples of surfactants include nitrogen-surfactant blends such as Prefer 28 (Cenex), Surf-N (US), Inhance (Brandt), P-28 (Wilfarm) and Patrol (Helena); esterified seed oils include Sun-It II (AmCy), MSO (UAP), Scoil (Agsco), Hasten (Wilfarm) and Mes-100 (Drexel); and organo-silicone surfactants include Silwet L77 (UAP), Silikin (Terra), Dyne-Amic (Helena), Kinetic (Helena), Sylgard 309 (Wilbur-Ellis) and Century (Precision). In one embodiment, the surfactant is present at a concentration of between 0.01% v / v to 10% v / v. In another embodiment, the surfactant is present at a concentration of between 0.1% v / v to 1% v / v. In certain cases, the formulation includes a microbial stabilizer. Such an agent can include a desiccant. As used herein, a “desiccant” can include any compound or mixture of compounds that can be classified as a desiccant regardless of whether the compound or compounds are used in such concentrations that they in fact have a desiccating effect on the liquid inoculant. Such desiccants are ideally compatible with the fungal population used and should promote the ability of the microbial population to survive application on the seeds and to survive desiccation. Examples of suitable desiccants include one or more of trehalose, sucrose, glycerol, and Methylene glycol. Other suitable desiccants include, but are not limited to, non-reducing sugars and sugar alcohols (e.g., mannitol or sorbitol). The amount of desiccant introduced into the formulation can range from about 5% to about 50% by weight / volume, for example, between about 10% to about 40%, between about 15% and about 35%, or between about 20% and about 30%. In some cases, it is advantageous for the formulation to contain agents such as a fungicide, an antibacterial agent, an herbicide, a nematicide, an insecticide, a plant growth regulator, a rodenticide, or a nutrient. Such agents are ideally compatible with the agricultural seed or seedling onto which the formulation is applied (e.g., it should not be deleterious to the growth or health of the plant). Furthermore, the agent is ideally one which does not cause safety concerns for human, animal or industrial use (e.g., no safety issues, or the compound is Attorney Docket No. LOAM-F005-01WO sufficiently labile that the commodity plant product derived from the plant contains negligible amounts of the compound). The fungal endophytic populations of the present invention can be mixed or suspended in water or aqueous solutions in liquid form, for example, solutions or suspensions. Suitable liquid diluents or carriers include water, aqueous solutions, petroleum distillates, or other liquid carriers. Solid compositions can be prepared by dispersing the invention's fungal endophytic populations in and on an appropriately divided solid carrier, such as peat, wheat, bran, vermiculite, clay, talc, bentonite, diatomaceous earth, Fuller's earth, pasteurized soil, and the like. When such formulations are used as wettable powders, biologically compatible dispersing agents such as non-ionic, anionic, amphoteric, or cationic dispersing and emulsifying agents can be used. The solid carriers used upon formulation include, for example, mineral carriers such as kaolin clay, pyrophyllite, bentonite, montmorillonite, diatomaceous earth, acid white soil, vermiculite, and pearlite, and inorganic salts such as ammonium sulfate, ammonium phosphate, ammonium nitrate, urea, ammonium chloride, and calcium carbonate. Also, organic fine powders such as wheat flour, wheat bran, and rice bran may be used. The liquid carriers include vegetable oils such as soybean oil and cottonseed oil, glycerol, ethylene glycol, polyethylene glycol, propylene glycol, polypropylene glycol, etc. In one particular embodiment, the formulation is ideally suited for coating of the endophytic microbial population onto seeds. The fungal endophytic populations described in the present invention are capable of conferring many fitness benefits to the host plants. The ability to confer such benefits by coating the fungal populations on the surface of seeds has many potential advantages, particularly when used on a commercial (agricultural) scale. The fungal endophytic populations herein can be combined with one or more of the agents described above to yield a formulation suitable for combining with an agricultural seed or seedling. The fungal population can be obtained from growth in culture, for example, using a synthetic growth medium. In addition, the microbe can be cultured on solid media, for example on petri dishes, scraped off and suspended into the preparation. Microbes at different growth phases can be used. For example, microbes at lag phase, early-log phase, mid-log phase, late-log phase, stationary phase, early death phase, or death phase can be used. The formulations comprising the fungal endophytic population of the present invention typically contains between about 0.1 to 95% by weight, for example, between about 1% and Attorney Docket No. LOAM-F005-01WO 90%, between about 3% and 75%, between about 5% and 60%, between about 10% and 50% in wet weight of the fungal population of the present invention. It is preferred that the formulation contains at least about 103 CFU per ml of formulation, for example, at least about 104, at least about 105, at least about 106, at least 107 CFU, at least 108 CFU per ml of formulation. Soil Organic Carbon The fungi used in the methods described herein will generally be capable of stabilizing and fixing carbon sequestered by plants from atmospheric carbon dioxide and converting this carbon to complex polysaccharides for storage as stable carbon in the soil. The sequestered and fixed carbon may also be converted and stored as a stable carbon source by the fungi in the fungi itself as, for example, melanin, chitin, lignin, suberin and carotenoid compounds, or the fungi may exude these compounds to increase the stable carbon in the soil. The deployed fungal endophyte may also convert simple polysaccharide exudate from a host plant into complex polysaccharides for storage as stable carbon in the soil, or within the fungi itself. Lastly, the stability of organic carbon may be enhanced in soil with more stable soil aggregates and minerals. The methods and treatments of the present invention may increase the overall levels of carbon in the soil, but even in cases where overall carbon remains the same or is only slightly increased, it would be understood that the levels of stable carbon in the soil may be increased due to the production and exudation in the soil of complex polysaccharides by the disclosed fungal species. The fungi may be particularly useful in increasing overall levels of carbon in the soil and / or levels of stable carbon in the soil where the soil organic carbon (SOC) level is below a particular threshold. In some aspects, the threshold is a SOC level below 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%. Analysis of soil organic carbon (SOC) content by percent in soil samples typically involves determining the carbon content of a sample using a method such as dry combustion or the Walkley-Black method, and then expressing this as a percentage of the total soil mass. See Nelson, D.W. & Sommers, L.E., (1996); and Walkley, A. & Black, I.A. (1934). A general overview of each method is outlined below. Attorney Docket No. LOAM-F005-01WO Dry Combustion Method 1. Dry the Soil Sample: Dry a known weight of soil sample at 105°C to a constant weight to remove all moisture. 2. Combust the Soil Sample: Use a CHN analyzer to combust the soil sample at high temperatures. This analyzer measures the amount of carbon dioxide (CO2) released, which is then used to calculate the total carbon content. 3. Calculate the Organic Carbon Content: o The analyzer typically provides the carbon content in milligrams per gram (mg / g) or percentage (%). 4. Formula: Walkley-Black Method 1. Prepare the Sample: Take a known weight of the air-dried soil sample. 2. Oxidize Organic Carbon: Add potassium dichromate (K2Cr2O7) and sulfuric acid (H2SO4) to oxidize the organic carbon in the soil. 3. Titrate: Titrate the remaining dichromate with ferrous ammonium sulfate (Fe(NH4)2(SO4)2) to determine the amount of dichromate that was not reduced by organic carbon. 4. Calculate Organic Carbon: The amount of carbon oxidized is calculated using the volume of dichromate reduced. 5. Correction Factor: The Walkley-Black method typically recovers about 77% of the total organic carbon, so a correction factor (1.3) is applied. 6. Formula: Here, 0.003 is the conversion factor from meq to grams of carbon. Modifications to these methods can be made by those skilled in the art and similar results obtained. The increase in overall soil carbon and stable soil carbon of a soil that is subjected to the treatments and / or methods of the present disclosure compared to an untreated control (i.e., Attorney Docket No. LOAM-F005-01WO a "non-inoculated control soil") may be quantified by any methods known to those skilled in the art. The control would be a similar soil sample that had not been exposed to an endophytic fungus as claimed herein (i.e., a fungus had not been deployed in the soil or associated with a plant that had been cultivated in said soil). “Similar soil sample” means that the soil would be from a proximal area with a similar climate and, if the soil had been cultivated, the control sample would have been cultivated by the same plant as the test soil. In one embodiment, an increase in soil organic carbon is an increase in stable carbon. An increase in the sequestration of atmospheric carbon for storage as stable carbon in the soil and increasing the levels of stable carbon in the soil, is an increase relative to the amount of sequestration of atmospheric carbon for storage as stable carbon in the soil, and levels of stable carbon in the soil, produced by a plant that has not been treated with the methods of the present disclosure. Application of the fungi to the plant and / or soil may have one or more desirable effects on the soil and / or associated crops cultivated in the treated soil, including for example, sequestering atmospheric carbon for storage as stable carbon in the soil; and / or increasing the levels of stabilized carbon in the soil. The inoculation of the soil and / or plants with the fungi may have simultaneous beneficial effects on the soil. For example, sequestration of atmospheric carbon by endophytic fungi as described herein can lead to an increase in the complex polysaccharides in the soil resulting in long-term storage of sequestered atmospheric carbon in a stable form. Soil organic carbon is the overall soil carbon content of a soil and may be also generally referred to as total organic carbon (TOC) or total carbon (TC) (the terms may be used interchangeably), and this refers only to the carbon component of the organic matter in the soil. However, fluctuations in soil organic carbon may not necessarily correlate to the same fluctuations in stable soil carbon. Indeed, soils subjected to the treatments and methods may demonstrate minimal increases in TOC, but the percentage of said TOC that is captured in a stable form in the soil or in the fungi proliferating in the soil (i.e., complex polysaccharides, melanin, chitin, lignin, suberin and carotenoid compounds) may increase. The skilled addressee would also understand that changes in TOC and stable carbon in soil as a result of the treatments and methods of the present may take weeks, months or years, and therefore appropriate measurement timeframes must be applied. In one embodiment, the increase in soil organic carbon (SOC) comprises an increase in stable carbon in the soil. Attorney Docket No. LOAM-F005-01WO The soil carbon may be measured by methods including, but not limited to, dry combustion or elemental tests that may be analyzed using, for example, the LECO method, and loss on ignition (LOI) tests that may be analyzed using the Walkley-Black method (see, for example, Walkley A, and Black IA (1934) An examination of the Degtjareff method for determining soil organic matter, and a proposed modification of the chromic acid titration method. Soil Science 37, 29–38.). To assess the prevalence of different types of carbon on the TOC (i.e., to measure the stable, or “recalcitrant” organic carbon), methods may be employed to fractionate to TOC by, for example, measuring soil respiration or the bulk density of the soil. In embodiments of the invention, the fungal inoculation of soil and / or the plant results in an increase in soil aggregate stability. The increase in soil aggregate stability, or soil aggregation per se, of a soil that is subjected to the treatments and / or methods described herein compared to a control may be quantified by any methods known to those skilled in the art. The control would be a similar soil sample that had not been exposed to the relevant fungus (i.e., a fungus had not been deployed in the soil or associated with a plant that had been cultivated in said soil). “Similar soil sample” means that the soil would be from a proximal area with a similar climate and, if the soil had been cultivated, the control sample would have been cultivated by the same plant as the test soil. The soil aggregate stability may be quantified by measurements compared to controls such as, but not limited to, soil mean weight diameter (MWD), geometric mean diameter (GMD), fractal dimension (D), percentage of aggregates destruction (PAD) and water-stable aggregates stability rate (WSAR). An increase in the MWD, GMD, WSAR and D values are indicative of an increase in soil aggregate stability, while a decrease in PAD value is indicative of an increase in soil aggregate stability. In various embodiments of the invention, the fungal inoculation may have one or more desirable effects on the soil and / or associated crop plants cultivated in the treated soil, including, but not limited to, sequestering atmospheric carbon for storage as stable carbon in the soil; providing agronomic benefits to the crop plants; increasing the levels of stabilized carbon in the soil used to cultivate the crop plants; and / or increasing the soil aggregate stability of the soil used to cultivate crop plants. In other embodiments of the invention, the fungal inoculation may have two or more of the aforementioned desirable effects on the soil and / or associated crop plants cultivated in the treated soil, or three or more of the aforementioned desirable effects on the soil and / or associated crop plants cultivated in the treated soil. That the fungal inoculation of the methods of the invention may have numerous, simultaneous effects on the soil and / or associated crop plants cultivated in the treated soil is, Attorney Docket No. LOAM-F005-01WO in part, possible because some of the desirable effects contribute to other desirable effects. For example, increasing soil aggregate stability is related to the enhanced (and / or longer-term) storage of sequestered atmospheric carbon as well as providing agronomic benefits to said crop plants by virtue of stably aggregated soil being more productive through, for example, improved water retention. In another example, sequestration of atmospheric carbon by the melanized fungi as described herein can lead to an increase in the complex polysaccharides in the soil resulting in long-term storage of sequestered atmospheric carbon in a stable form. The disclosed fungal strains and methods increase soil organic carbon (SOC). Increased SOC plays an important role in enhancing soil structure and health through its effects on soil aggregation, soil aggregate stability, and soil porosity. Soil aggregation refers to the process by which individual soil particles (sand, silt, and clay) bind together to form aggregates or clumps. These aggregates can range in size from a few micrometers to several millimeters. SOC, especially in the form of decomposed organic matter, acts as a binding agent that holds soil particles together. Organic matter, such as plant residues and microbial biomass, contributes to the formation of soil aggregates by providing the necessary organic glues that stick particles together. This process is facilitated by soil microorganisms such as the disclosed fungal strains that decompose organic matter, producing polysaccharides and other organic compounds that act as binding agents. Soil aggregate stability is the ability of soil aggregates to resist disintegration when subjected to external forces such as water, wind, and mechanical disturbances. SOC enhances aggregate stability through the formation of strong bonds between soil particles. Higher organic carbon content improves the resilience of these aggregates against physical disturbances and water erosion. Stable aggregates are crucial for preventing soil erosion, maintaining soil structure, and promoting water infiltration and retention. The presence of stable aggregates also supports a healthy soil ecosystem by providing habitats for soil microorganisms and roots. Soil porosity refers to the proportion of the soil volume that is occupied by pores (spaces between soil particles). These pores can be filled with air or water and are essential for various soil functions, including root penetration, water movement, and gas exchange. Increased SOC improves soil porosity by enhancing the formation and stabilization of soil aggregates. Well- aggregated soil has a more extensive network of pores, which includes both macropores (i.e., large pores) and micropores (i.e., small pores). Macropores facilitate rapid water drainage and air exchange, while micropores retain water and provide a slow-release moisture supply to Attorney Docket No. LOAM-F005-01WO plants. The presence of organic matter also helps to create a more friable soil structure, reducing soil compaction and allowing for better root growth and microbial activity. In certain aspects, the increased soil organic carbon resulting from treatment with the disclosed fungal strains positively influences soil health by: a) enhancing soil aggregation, which improves soil structure and provides a better environment for plant roots and soil organisms; b) improving soil aggregate stability, which helps prevent soil erosion and maintains soil integrity; and c) increasing soil porosity, which enhances water infiltration, retention, and air exchange, leading to improved plant growth and soil microbial activity. By promoting these key aspects of soil structure, the disclosed fungal strains and the increases in SOC they produce plays an important role in maintaining and improving soil health, fertility, and productivity Fractionation of Soil Organic Carbon In certain aspects, the disclosed methods and synthetic combinations increase organic carbon in the soil. Soil organic C (SOC) concentration in mineral soils (0-10 cm depth) varies from <0.2% to ≥11.6% C; above this concentration, a soil is classified as a ‘peat’ soil, for example, in peatlands or tundra lands. Soil organic C in mineral soils contains a range of organic substances at various stages of decomposition such as plant materials – both produced aboveground (straw, litter) and belowground (roots, root exudates), fungal hyphae, soil fauna, and microbial biomass and their products. Organic compounds include lipids, proteins, carbohydrates, quinones, and their derivatives. Major functional groups include alkyl C (10-45 ppm), N-alkyl and methoxy C (45- 60 ppm), O-alkyl C (60-110 ppm), aromatic C (110-145 ppm), phenolic C (145-165 ppm), and amide and carboxyl C (165–215 ppm), as identified in13C NMR spectra of SOC (Almeida et al.2021). These are also grouped as aromatic, aliphatic and polysaccharide groups. Since SOC consists of different C substances, which turnover (decompose) at different rates, persist in soil for different periods, stabilize with minerals with different mechanisms, and contribute to bio-physico-chemical functions in separate ways (Chenu et al. 2015). Most components of SOC are separated by chemical oxidation (acids, alkali, oxidants), biological (decomposition rates, microbial respiration), and physical methods. Of these, physical methods are preferred because these methods cause minimum disturbance, disruption, and alteration of Attorney Docket No. LOAM-F005-01WO SOC substances in soil. The physical methods are based on density, size, and sedimentation of soil, and justification of these methods are given by Poeplau et al. (2018). Density, size, and sedimentation procedures broadly fractionate SOC or SOM in three groups, fPOC or fPOM, aggregate occluded particulate organic carbon (oPOC or oPOM) and silt+clay size associated or fine mineral-associated organic C (MAOC or MAOM). Dissolved organic C, DOC or DOM are also measured and plays a significant role in MAOM formation although it accounts for <2% of total Plant C or SOC. The stabilized MAOM are separated from labile organic matter using density and size fractionation procedure (Poeplau et al. 2018; Mayer et al. 2022; Rodrigues et al. 2022). The organic matter that floats in the heavy density liquid, either sodium iodide (NAI) solution or sodium polytungstate (SPT, Na6[H2W12O40] or 3Na2WO4.9WO3.H2O) at 1.8 Mg m-3(1.8 g cm-3) or <1.8 Mg m-3density soil organic matter are considered as fPOM. After separation of fPOM, occluded particulate organic matter within aggregates, oPOM and MAOM are usually dispersed either using ultrasonic energy or sodium hexametaphosphate (Na6[(PO3)6] solution to disperse the soil particles. In the former, ultrasonic energy, ~400 - 500 J mL-1is applied to the soil in the SPT solution (1.8 Mg m-3) contained in a temperature-controlled container. Excess oPOM is separated, and the remaining soil is sieved through 53 µm sieve to collect < 53 µm as MAOM. The >53 µm fraction remaining on the sieve is considered the organic matter in the sand-size fraction, usually containing a small amount of organic C and could be added to the fPOM fraction. This is circumvented when after separation of fPOM, excess SPT is washed from the remaining soil and the soil is dispersed in sodium hexametaphosphate and sieved through a 53 µm sieve to collect < 53 µm as MAOM. The >53 µm fraction that remained on the sieve is considered the organic matter occluded in the sand-size aggregates or aggregate C since sand fraction contains only a small amount of organic C. Thus, SOC is separated into three fractions: fPOM, oPOM, and MAOM. Obviously, dissolved organic matter (DOM) is either lost or added to the MAOM fraction, although, in most mineral soils, DOM constitutes <2% of SOC (Poeplau et al.2018). For practical purposes and routine SOC fractionation, SOM can be separated into >53µm POM (fPOM + oPOM) and <53µm MAOM (Lavallee et al.2019). The MAOM fraction provides the long-term storage of SOC (Kleber et al. 2015; Hemingway et al.2019). However, MAOM is subject to the C saturation of fine silt+clay (<53 µm) or fine mineral fraction, which is dependent on silt+clay contents (Feng et al.2013) and their mineralogy, Fe and Al (hydro-)oxides, specific surface area, soil architecture, nature of organic C inputs, especially their C and N contents, and soil pH. Once the C saturation of Attorney Docket No. LOAM-F005-01WO mineral fraction is achieved, further SOC sequestration for the long-term storage as MAOM is not likely to occur. However, the potential turnover through C mineralization and fresh C addition may still be required (Mayer et al.2022; Rodrigues et al. 2022). From the boundary line approach, Feng et al. (2013) estimated that the silt+clay size fraction (<2 µm) may store 84±1 g C kg-1 silt+clay size fraction in 2:1 clay dominant (smectite, illite, vermiculite) soil, and 43±1 g C kg-1 silt+clay in 1:1 clay dominant (kaolinite) soil. This provides a ‘rule of thumb’ estimate to identify soil, in which SOC may be sequestered long-term in the MAOM fraction. It is worth noting here that the 20-53 µm MAOM fraction may contain silt-size micro- aggregates, which may have a faster turnover rate than the <20 µm MAOM. Further, organic C. may not uniformly cover the surface of the fine mineral fraction. For example, Schweizer et al. (2021) found that clay surfaces of the soil containing low clay contents (5-18%) had twice as much organic C in the MAOM than the high clay soils. It is sobering to note that long-term field experiments have shown that it is less likely that SOC will be sequestered in the stabilized MAOM fraction if this fraction is already saturated (Mayer et al., 2022; Rodrigues et al., 2022), and further C inputs will be stabilized in the oPOM fraction (occluded in aggregates) or remain fPOM. However, oPOM is readily lost when the soil is disturbed. Furthermore, it is not known whether there is a saturation limit for the oPOM fraction. fPOM can be increased in the soil indefinitely although this fraction is affected by global warming and the quantity and quality of continuous C inputs more than the other SOM fractions (Lugato et al.2021; Rocci et al.2021). SOC fractionation protocols vary widely. Therefore, Poeplau et al (2018) compared two protocols in use at the time of the study. Details of these protocols and a preferred protocol are given by Poeplau et al. (2018). In conclusion, they found that no SOC fraction identified the rapid turnover rate component, that particle-size separation was better for separating the fPOM than that the oPOM incorporated into aggregates, and the separation of silt + clay-size fraction from the sand-size fraction was the most effective protocol in identifying fractions of different turnover rates. Admittedly, since microbial inoculants in the rhizosphere may be involved in aggregation (Mugerwa and McGee 2017; Buss et al. 2021) and, therefore, soil structure, it is recommended that in such situations, oPOM separation may be desirable to detect the effect of inoculants in C accumulation in the rhizosphere of the microbial inoculated plants. However, as stated above, since the turnover rate of oPOM is uncertain, and subject to disturbance, it should not be considered for long-term C sequestration in soil. Attorney Docket No. LOAM-F005-01WO In the claims that follow and in the preceding description of the invention, except where the context requires otherwise due to express language or necessary implication, the word “comprise” or variations such as “comprises” or “comprising” is used in an inclusive sense, i.e., to specify the presence of the stated features but not to preclude the presence or addition of further features in various embodiments of the invention. All headings are for the reader's convenience and should not be used to limit the meaning of the text that follows the heading, unless so specified. The present invention is further illustrated by the following examples that should not be construed as limiting. The contents of all references, patents, and published patent applications cited throughout this application and the Figures are incorporated herein by reference in their entirety for all purposes. In order to exemplify the nature of the present invention so that it may be more clearly understood, the following non-limiting examples are provided. EXAMPLES Example 1. Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645) Demonstrates Plant Growth Promotion (PGP) Properties Background Humicola fuscoatra is a moderately rapid-growing fungus belonging to the family Chaetomiaceae (order Sordariales; Phylum: Ascomycota) and is commonly found worldwide. Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645) was isolated from a cotton plant collected in the state of Nebraska, USA. H. fuscoatra, often characterized as a halotolerant fungus, has also been found as an endophyte of halophytic plants and has been isolated from soil, paddy fields, sandy and clay soils, grasslands, forest soil, plants, and bird feathers (Moghaddam et al 2020 and 2021; Naik et al 2009). Studies have identified an increased abundance of H. fuscoatra on plant roots when grown under different levels of salt stress (Yaish et al 2016; Moghaddam et al 2021). Fungal endophytes metabolize carbon from their host plant exudates to build the hyphae which extend into the soil. Long term, this process can offset the release of greenhouse gases into the atmosphere by sequestering these more stable forms of carbon in the soil (Behie et al 2017). Carbon sequestration has demonstrated benefits for plant growth promotion, including improvement in soil fertility and improved water retention which has important implications for drought tolerance and increases the potential for nutrient retention in the soil. Attorney Docket No. LOAM-F005-01WO Genomic Prediction of Beneficial Traits The mechanisms of plant growth promotion (PGP) and the soil benefits conferred by endophytes are complex and multidimensional. A variety of direct and indirect PGP mechanisms, including carbon sequestration, solubilization and transportation of minerals, production of volatile organic compounds, exploitation of microbial enzymes, increases in nutrient uptake, amelioration of abiotic stresses and suppression of deleterious phytopathogens are well documented (Reviewed by Hossain and Sultana 2020; Mandal and Tiru 2022). The genome of Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645) was sequenced, and a proprietary genome-enabled computational domain-omics approach was developed to evaluate its potential as a plant growth promoting beneficial endophyte. Essentially, domain- omics is a mathematical modelling approach based on functional genomics that identifies gene sequences shown to code for enzymes with specific traits, in this case, traits that are beneficial for plant growth and carbon sequestration. Table 7 summarizes the number and types of genomic domains identified in this process that are putatively responsible for the beneficial traits listed in the first column. Table 7 Attorney Docket No. LOAM-F005-01WO Carbon sequestration is the process of capturing and storing atmospheric carbon dioxide as plant biomass and soil organic carbon (SOC). SOC is distributed between particulate organic matter (POM) and mineral associated organic matter (MAOM) fractions (reviewed by Bai and Cotrufo 2022). Below ground carbon inputs including root exudates, microbial metabolites and residues have an SOC stabilization efficiency that is five times greater than aboveground carbon inputs (Jackson et al 2017). Fungal necromass plays a vital role in the formation of both POM and MAOM. MAOM has a proportionally higher microbial origin and longer mean residence time in soils (from decades to centuries) compared with POM (<10 years to decades) (Lavallee et al 2020; Bai and Cotrufo 2022). Therefore, MAOM contributes to longer-term, more stable carbon sequestration in soil. Our genomics analysis of Humicola fuscoatra US- 856 (ATCC Accession No. PTA-127645) revealed over 100 genomic domains for genes related to carbon sequestration (Table 7). Phosphate Solubilization Properties Phosphorus is essential for the growth and productivity of plants. It plays an important role in plants in many physiological activities such as cell division, photosynthesis, development of a healthy root system, and utilization of carbohydrates. Phosphorus (P) has long been considered the second most limiting nutrient for plant growth in terrestrial ecosystems after nitrogen (N). Organic P is often the dominant form of P found in soils and may constitute up to 90% of the total P in soil (Sharma et al 2013). P mineralization is a prerequisite for the conversion of organic P into a plant available form. Microbes able to solubilize phosphate can help improve plant growth when growers opt for fertilizers containing less soluble forms of phosphate. Attorney Docket No. LOAM-F005-01WO Our genomic analysis predicted the presence of two genomic domains for alkaline phosphatase, phoD, which codes for the main enzyme responsible for organic P mineralization. The ability of Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645) to solubilize P was tested in vitro by plating a fungal plug on solid Pikovskaya (PVK) media containing insoluble superphosphate (Doilom et al 2020). Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645) showed a clear zone of dissolved phosphate in solid Pikovskaya medium, indicating the ability to solubilize phosphate and validating our genomic analysis (data not shown). Conclusion Our analysis provides evidence of the PGP properties of Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645). The evidence includes bioinformatic analysis indicating multiple domains within the genome of Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645) whose expression is connected to recognized plant growth promotion mechanisms. In addition, both genomic and in vitro data substantiating the predicted genomic potential for improved plant performance are presented as further evidence. Example 2. Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645) Increases Soil Carbon and Improves Yield in Corn Field Trials Background To evaluate the effects of Humicola fuscoatra US-856 (ATCC Accession No. PTA- 127645) on soil carbon and crop yield, a corn field trial was conducted in Porto Nacional, Tocantins, Brazil. Materials and Methods Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645) was applied directly to corn seed at a rate of about 1,000 CFU per seed immediately prior to sowing with a carrier. Untreated corn seeds were sown as a control. Three TOC replicates for each group were evaluated at baseline (i.e., prior to sowing) and at harvest, and the changes in TOC measurements over time for each group were determined. TOC measurements were performed with a LECO®instrument using combustion of carbon. Three yield replicates were also evaluated for each group. Attorney Docket No. LOAM-F005-01WO Results Results for TOC and crop yield are shown in Tables 8 and 9, respectively. Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645) increased both TOC and yield compared to untreated control corn plants. Table 8 Table 9 Example 3. Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645) Increases Soil Carbon and Improves Yield in Soybean Field Trials Background To evaluate the effects of Humicola fuscoatra US-856 (ATCC Accession No. PTA- 127645) on soil carbon and crop yield, two soybean field trials was conducted in Minnesota and Nebraska, USA. Materials and Methods Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645) was applied directly to soybean seed at a rate of about 1,000 CFU per seed immediately prior to sowing with a carrier. Untreated soybean seeds were sown as a control. Three TOC replicates for each group were evaluated at baseline (i.e., prior to sowing) and at harvest, and the changes in TOC measurements over time for each group were determined. TOC measurements were performed Attorney Docket No. LOAM-F005-01WO with a LECO®instrument using combustion of carbon. Three yield replicates were also evaluated for each group. Results Average results for TOC are shown in Table 10. “Carbon Build” is defined as the difference between the TOC at harvest and the TOC at baseline (i.e., at sowing) divided by TOC at baseline. Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645) increased Carbon Build by 4%. It also improved soybean yield by +2% compared to the untreated control. Table 10 Example 4. Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645) Increases Soil Carbon and Improves Yield in Winter Wheat Field Trials Background To evaluate the effects of Humicola fuscoatra US-856 (ATCC Accession No. PTA- 127645) on soil carbon and crop yield, a winter wheat field trial was conducted in Hutchinson, Kansas, USA. Materials and Methods Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645) was applied directly to winter wheat seed at a rate of about 1.4 x 1010CFU per hectare. Untreated wheat seeds were sown as a control. Four TOC replicates for each group were evaluated at baseline (i.e., prior to sowing) and at harvest, and the changes in TOC measurements over time for each group were determined. TOC measurements were performed with a LECO®instrument using combustion of carbon. Four yield replicates were also evaluated for each group. Attorney Docket No. LOAM-F005-01WO Results Results for TOC and crop yield are shown in Tables 11 and 12, respectively. Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645) increased both TOC and yield compared to untreated control wheat plants. Table 11 Table 12 Example 5. Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645) Increases Yield in Winter Wheat Field Trials Background To evaluate the effects of Humicola fuscoatra US-856 (ATCC Accession No. PTA- 127645) on crop yield, a winter wheat field trial was conducted in Wellington, Kansas, USA. Materials and Methods Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645) was applied directly to winter wheat seed at a rate of about 1.4 x 1010CFU per hectare. Untreated wheat seeds were sown as a control. Four yield replicates were evaluated for each group. Results Results for wheat yield are shown in Table 13. Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645) increased yield compared to untreated control wheat plants. Attorney Docket No. LOAM-F005-01WO Table 13 Example 6. Comparison of Humicola fuscoatra and Dictyochaeta assamica Background Under similar conditions, Humicola fuscoatra US-856 (ATCC Accession No. PTA- 127645) (“H. fuscoatra US-856”) and Dictyochaeta assamica strain X (D. assamica strain X) performed very differently under similar conditions. Both strains were applied to winter wheat in field trials. Whereas the soil around the wheat plants treated with H. fuscoatra US-856 experienced an average +9.3% increase in TOC from baseline to harvest, the soil around the wheat plants treated with D. assamica strain X an average -22.4% decrease in TOC from baseline to harvest. To evaluate what genomic factors might be responsible for this difference between the performance of H. fuscoatra US-856 and D. assamica strain X, a bioinformatics analysis was performed. Materials and Methods Genome Sequencing The genomes of the following strains were sequenced and annotated: Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645), Humicola fuscoatra US-735 (ATCC Accession No. PTA-127783), Humicola fuscoatra US-946 (ATCC Accession No. PTA- 127784), D. assamica strain X, and four additional strains of D. assamica. Carbohydrate Active Enzymes Microbial communities catabolize energy-rich carbohydrates such as cellulose, starch, glycogen. Carbohydrate active enzymes are key enzymes in the degradation of soil organic matter. Carbohydrate active enzymes are classified into different groups that are related to specific activities, some of which are important in the dynamics of soil carbon (Salam 2018; Gong et al., 2022; Merino et al., 2016; Yan et al., 2022). The CAZy database was used to compare H. fuscoatra and D. assamica genes with the corresponding enzymes. Attorney Docket No. LOAM-F005-01WO KEGG Pathway Analysis KEGG pathway analysis is a method used to identify and categorize genes involved in metabolic pathways, which is important as it helps elucidate the microbial and enzymatic processes that may drive carbon cycling and storage in ecosystems (Minoru et al., 2000; Nguyen et al., 2019). A KEGG pathway analysis was performed with the H. fuscoatra and D. assamica genomes. Results Genome Sizes The genome sizes of the H. fuscoatra strains are approximately 35 Mb long, making them more than 50% smaller than that of the D. assamica genomes, which are about 76 Mb long. The H. fuscoatra genomes contain approximately half as many protein coding genes as do the D. assamica genomes. Carbohydrate Active Enzymes The following families or modules of enzymes involved in the breakdown, biosynthesis, or modification of carbohydrates were analyzed using the CAZy database: ● AA (Auxiliary Activities): These enzymes are involved in the degradation of lignin and other components of plant cell walls. They assist in breaking down complex carbohydrates by modifying their structure, making them more accessible to other enzymes. ● CBM (Carbohydrate-Binding Modules): These are non-catalytic domains found in carbohydrate-active enzymes. CBMs help enzymes bind to their carbohydrate substrates more effectively, increasing the efficiency of the catalytic process. ● CE (Carbohydrate Esterases): These enzymes catalyze the de-esterification of substituted saccharides. They remove ester groups from carbohydrates, which can be a crucial step in the degradation of complex polysaccharides. ● GH (Glycoside Hydrolases): This large family of enzymes hydrolyzes the glycosidic bond between two or more carbohydrates or between a carbohydrate and a non-carbohydrate moiety. GHs are essential in the breakdown of complex sugars into simpler sugars. Attorney Docket No. LOAM-F005-01WO ● GT (Glycosyl Transferases): These enzymes are responsible for the biosynthesis of glycosidic bonds. They transfer sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds and synthesizing oligosaccharides, polysaccharides, and glycoconjugates. ● PL (Polysaccharide Lyases): These enzymes cleave glycosidic bonds in polysaccharides through a lyase mechanism, which often involves the elimination of a group from the substrate, forming a double bond. A comparison of genes present in D. assamica strain X with those found in Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645), Humicola fuscoatra US-735 (ATCC Accession No. PTA-127783), Humicola fuscoatra US-946 (ATCC Accession No. PTA-127784), with the CAZy database revealed the differences shown in Table 14. D. assamica strain X’s larger genome is reflected in the overall greater number of enzyme families. Table 14 A closer look at the differences between the expression of the carbohydrate active enzyme families present in in the H. fuscoatra strains and not in D. assamica strain X revealed that the following enzyme families are present in at least one H. fuscoatra strain but not in D. assamica strain X: AA13, CBM1, CBM35, CBM38, CBM43, GH127, GH134, GH15, GH152, GH24, GH26, GH49, GT15, GT2_Glyco_tranf_2, GT2_Glycos_transf, and GT90. This analysis identified several carbohydrate active enzyme families that were present in only the H. fuscoatra strains and not in D. assamica strain X. These included one auxiliary activity (AA), four carbohydrate-binding module (CBM), seven glycoside hydrolase (GH), and four glycosyltransferase (GT) enzyme families. Attorney Docket No. LOAM-F005-01WO Further analysis showed that D. assamica strain X had only one count whereas the H. fuscoatra strains had multiple counts in the following carbohydrate active enzyme families: GH132, GH32, GH12, GH6, GH62, AA11, CE15, GH13, GH11, GH10. This group includes one auxiliary activity (AA), eight glycoside hydrolase (GH), and one carbohydrate esterase (CE) enzyme family. These enzyme families are important players in decomposing plant biomass, enhancing soil health, promoting plant growth, and forming stable soil organic matter. This analysis suggests that H. fuscoatra possesses genomic features that promote its ability to improve soil organic carbon and to enhance crop growth and yield. KEGG Pathway Analysis KEGG pathway analysis is a method used to identify and categorize genes involved in metabolic pathways, which is important as it helps elucidate the microbial and enzymatic processes that may drive carbon cycling and storage in ecosystems. From this analysis, we identified four different pathways that are more complete in H. fuscoatra than in D. assamica. These pathways are the alpha amylase, nitrite reduction, riboflavin biosynthesis, and mixed acid: lactate pathways (see FIG.1). These pathways contribute to the increase in soil organic carbon (SOC) observed in agricultural fields treated with H. fuscoatra. Alpha amylase is an enzyme that catalyzes the hydrolysis of starch into sugars. The breakdown of these carbohydrates provides a readily available carbon source that could be incorporated into the fungal biomass, which is a significant component of soil organic matter (SOM). The decomposition of this biomass contributes to the accumulation of SOC. Nitrite reduction is involved in the nitrogen cycle, which can help enhance plant growth and soil health. Nitrogen cycling also plays a role in the synthesis of organic compounds by soil microbes. Efficient nitrogen cycling promotes plant growth and the input of organic residues into the soil. Additionally, some by-products of denitrification can contribute to the formation of humic substances, which are complex organic molecules that are components of SOC. Riboflavin can act as a growth factor for soil microorganisms, enhancing their activity and biomass production. Increased microbial activity leads to more rapid decomposition of organic materials and the formation of microbial-derived organic matter, which is stable and contributes to SOC. Furthermore, riboflavin can influence the redox state of the soil, affecting the stabilization of organic matter. Attorney Docket No. LOAM-F005-01WO The production of lactate and other organic acids can lead to the formation of complex organic molecules that contribute to SOC. These organic acids can act as chelating agents, binding to soil minerals and promoting the stabilization of organic matter. Additionally, the fermentation process increases microbial biomass and activity, leading to more substantial contributions to SOC. By enhancing microbial activity, facilitating the breakdown and synthesis of organic materials, and contributing to nutrient cycling, these pathways collectively improve soil health and increase soil organic carbon content when H. fuscoatra is applied to agricultural crops and soils. Example 7. Comparison of Humicola fuscoatra and Dictyochaeta assamica Background To better understand the genomic factors that may underlie the divergent effects of H. fuscoatra US-856 and D. assamica strain X on soil organic carbon levels, further comparative analyses were conducted. These included antiSMASH cluster comparisons to identify potential differences in secondary metabolite biosynthesis and analysis of Pathogen Host Interaction (PHI) genes to explore host-microbe interactions. Additionally, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were used to contextualize functional gene distributions and metabolic capabilities across both strains. Together, these investigations help clarify how genomic content influences observed environmental outcomes. Materials and Methods Genome sequencing, analysis of carbohydrate active enzymes (CAZymes), and KEGG pathway analysis were performed generally as outlined in Example 6. antiSMASH (antibiotics & Secondary Metabolite Analysis Shell), a bioinformatics tool used to identify and analyze secondary metabolite biosynthesis gene clusters (BGCs) in microbial genomes, was employed to analyze the genomes of the strains. antiSMASH detected these clusters by scanning the genome sequences for signature genes and motifs characteristic of known biosynthetic pathways. InterProScan was used to functionally annotate the protein-coding sequences and assign Gene Ontology (GO) terms to each gene (Evgeni et al., 2001). GO terms are used to help classify gene functions into categories of biological processes, molecular functions, and Attorney Docket No. LOAM-F005-01WO cellular components (Ashburner et al., 2000). GO terms were extracted and quantified by copy number, allowing us to compare the relative abundance of specific biological functions between strains. Results Antismash Clusters Using the program antismash, several secondary metabolite clusters present in both the H. fuscoatra and D. assamica strains were identified. The D. assamica strain produces several secondary metabolites that could be detrimental to the soil as they are potential toxins. These include: Beauvericin, Botrydial, Cercosporin, Fusarielin H, Naphthalene, Nivalenol and related trichothecenes, Oosporein, Cytochalasins, and Betaenone. The H. fuscoatra strains produce metabolites, such as Radicicol, with antifungal properties that can inhibit growth of pathogenic fungi. The H. fuscoatra strains contains only about half as many secreted Pathogen Host Interaction (PHI) genes as D. assamica strain X (see Table 15). This indicates that the H. fuscoatra strains are less pathogenic or may have a reduced ability to infect host organisms compared to D. assamica strain X. Table 15 Gene Ontology (GO) Analysis The Humicola fuscoatra strains contain higher copy numbers of various GO terms related to redox balance and energy metabolism when compared to D. assamica strain X (see Table 16). The increase of copy numbers of NAD(P)H dehydrogenase (quinone) activity (GO:0003955) and NADH dehydrogenase (ubiquinone) activity (GO:0008137) suggests an enhanced electron transport chain, supporting aerobic respiration and energy generation under diverse soil conditions. Additionally, the enrichment of L-lactate dehydrogenase activity (GO:0004459) may reflect genomic adaptation for metabolic flexibility in low-oxygen Attorney Docket No. LOAM-F005-01WO environments, allowing for NAD⁺ regeneration during anaerobic glycolysis, which is often present in carbon-rich soils. Lastly, the elevated copy numbers of genes associated with glycerol-3-phosphate dehydrogenase (quinone) activity (GO:0004368) and the glycerol-3- phosphate dehydrogenase complex (GO:0009331) further support enhanced redox cycling and lipid metabolism, which could contribute to long-term carbon assimilation and storage within fungal biomass. Table 16 The higher copy numbers of genes associated with carbon backbone metabolism suggest that the Humicola fuscoatra strains have greater potential for building biomass and storing carbon in comparison to the D. assamica strain. The genes associated with acyl-CoA dehydrogenase activity (GO:0003995) play a central role in fatty acid β-oxidation. Similarly, the higher number of genes associated with aspartate-semialdehyde dehydrogenase activity (GO:0004073) suggests greater capacity for synthesizing amino acids and cell wall precursors. The increased copy number of genes linked to glycerol-3-phosphate dehydrogenase activity (GO:0004368) and the glycerol-3-phosphate dehydrogenase complex (GO:0009331) also supports a strong potential for integrating energy production with glycerolipid metabolism, which is important for membrane synthesis and stable carbon storage. Attorney Docket No. LOAM-F005-01WO While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth. INCORPORATION BY REFERENCE All references, articles, publications, patents, patent publications, and patent applications cited herein within the above text and / or cited below are incorporated by reference in their entireties for all purposes. However, mention of any reference, article, publication, patent, patent publication, and patent application cited herein is not, and should not be taken as acknowledgment or any form of suggestion that they constitute valid prior art or form part of the common general knowledge in any country in the world.

[0003] Attorney Docket No. LOAM-F005-01WO REFERENCES Ashburner, M., Ball, C., Blake, J. et al. Gene Ontology: tool for the unification of biology. Nat Genet 25, 25–29 (2000). Alexander, D. B., & Zuberer, D. A. (1991). Use of chrome azurol S reagents to evaluate siderophore production by rhizosphere bacteria. Biology and Fertility of soils, 12(1), 39-45. Almagro Armenteros JJ, Tsirigos KD, Sønderby CK, Petersen TN, Winther O, Brunak S, et al. SignalP 5.0 improves signal peptide predictions using deep neural networks. Nat Biotechnol.2019 Apr;37(4):420–3. Almeida, L. F. J., Souza, I. F., Hurtarte, L. C. C., Teixeira, P. P. C., Inagaki, T. M., Silva, I. R., Mueller, C. W. 2021. Forest litter constraints on the pathways controlling soil organic matter formation. Soil Biology and Biochemistry, 163, 106447. Bai, H., Euring, D., Volmer, K., Janz, D., & Polle, A. (2013). The nitrate transporter (NRT) gene family in poplar. PloS one, 8(8), e72126. Bai, Y., & Cotrufo, M. F. (2022). Grassland soil carbon sequestration: Current understanding, challenges, and solutions. Science, 377(6606), 603-608. Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, et al. SPAdes: A New Genome Assembly Algorithm and Its Applications to Single-Cell Sequencing. J Comput Biol.2012 May;19(5):455–77. Behie, S. W., Moreira, C. C., Sementchoukova, I., Barelli, L., Zelisko, P. M., & Bidochka, M. J. (2017). Carbon translocation from a plant to an insect-pathogenic endophytic fungus. Nature communications, 8(1), 1-5. Biely P, Cziszárová M, Agger JW, Li XL, Puchart V, Vršanská M, et al. Trichoderma reesei CE16 acetyl esterase and its role in enzymatic degradation of acetylated hemicellulose. Biochim Biophys Acta BBA - Gen Subj.2014 Jan;1840(1):516–25. Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics.2014 Aug 1;30(15):2114–20. Buss, W., Sharma, R., Ferguson, C., Borevitz, J. (2021) Soil organic carbon fractionation and metagenomics pipeline to link carbon content and stability with microbial composition – first results investigating fungal endophytes. Genomics. Chen B, Sun Y, Li S, Yin Y, Wang C. Inductive Production of the Iron-Chelating 2- Pyridones Benefits the Producing Fungus To Compete for Diverse Niches. Turgeon BG, editor. mBio.2021 Dec 21;12(6):e03279-21. Attorney Docket No. LOAM-F005-01WO Chenu, C., Rumpel, C., Lehmann, J. (2015) Methods for studying soil organic matter: nature, dynamics, spatial accessibility, and interactions with minerals. Soil Microbiology, Ecology and Biochemistry. del Cerro C, Erickson E, Dong T, Wong AR, Eder EK, Purvine SO, et al. Intracellular pathways for lignin catabolism in white-rot fungi. Proc Natl Acad Sci. 2021 Mar 2;118(9):e2017381118. Doilom, M., Guo, J. W., Phookamsak, R., Mortimer, P. E., Karunarathna, S. C., Dong, W., ... & Xu, J. C. (2020). Screening of phosphate-solubilizing fungi from air and soil in Yunnan, China: four novel species in Aspergillus, Gongronella, Penicillium, and Talaromyces. Frontiers in microbiology, 11, 585215. Evgeni M. Zdobnov, Rolf Apweiler, InterProScan – an integration platform for the signature-recognition methods in InterPro , Bioinformatics, 2001, 17(9): 847–848. Feng, W., Plante, A.F., Six, J. (2013) Improving estimates of maximal organic carbon stabilization by fine soil particles. Biogeochemistry, 112, 81-93. Fernandez CW, Heckman K, Kolka R, Kennedy PG. Melanin mitigates the accelerated decay of mycorrhizal necromass with peatland warming. Klironomos J, editor. Ecol Lett.2019 Mar;22(3):498–505. Friedlingstein, P, Jones, M.W., O'Sullivan, M., Andrew, R.M., Dorothee, C., Bakker, C.E., Hauck, J, Le Quere, C., Peters, G.P., Peters, W., Pongratz, J., Sitch, S., Canadell, J.G., Ciais, P., Jackson, R.B., Alin, S.R., Anthoni, P., Bates, N.R., Becker, M., Bellouin, N., Bopp, L., Chau, T.T.T., Chevallier, F., Chini, L.P., Cronin, M., Currie, K.I., Decharme, B., Djeutchouang, L.M., Dou, X., Evans W, Feely, R.A., Feng, L., Gasser, T., Gilfillan, D., Gkritzalis, T., Grassi, G., Gregor, L., Gruber, N., Gurses, O., Harris, I., Houghton, R.A., Hurtt, G.C., Ilyina, T., Luijkx, I.C., Jain, A.K., Jones, S.D., Kato, E., Kennedy, D., Goldewijk, K.K., Knauer, J., Korsbakken, J.I., Kortzinger, A., Landschützer, P., Lauvset, S.K., Lefèvre, N., Lienert, S., Liu, J., Marland, G., McGuire, P.C., Melton, J.R., Munro, D.R., Nabel, J.E.M.S., Nakaoka, S.I., Niwa, Y., Ono, T., Pierrot, D., Poulter, B., Rehder, G., Resplandy, L., Robertson, E., Rödenbeck, C., Rosan, T.M., Schwinger, J., Schwingshacki, C., Séférian, R., Sutton, A.J., Sweeney, C., Tanhua, T., Tans, P.P., Tian, H., Tilbrook, B., Tubiello, F., van der Werf, G., Vuichard, N., Wada, C., Wanninkhof, R., Watson, A.J., Willis, D., Wiltshire, A.J., Yuan, W., Yue, C., Yue, X., Zaehle, S. Zheng, J. (2021) Global Carbon Budget 2021. Earth Syst Sci Data 14: 1917-2005. Attorney Docket No. LOAM-F005-01WO Fujieda, N., Yabuta, S., Ikeda, T., Oyama, T., Muraki, N., Kurisu, G., & Itoh, S. (2013). Crystal structures of copper-depleted and copper-bound fungal pro-tyrosinase: insights into endogenous cysteine-dependent copper incorporation. Journal of Biological Chemistry, 288(30), 22128-22140. Gayathri R, Mahboob S, Govindarajan M, Al-Ghanim KA, Ahmed Z, Al-Mulhm N, et al. A review on biological carbon sequestration: A sustainable solution for a cleaner air environment, less pollution and lower health risks. J King Saud Univ - Sci. 2021 Mar;33(2):101282. Gong Y, Lebreton A, Zhang F, Martin F. Role of carbohydrate-active enzymes in mycorrhizal symbioses. Essays Biochem.2022 Dec 23;EBC20220127. Gougoulias C, Clark JM, Shaw LJ. The role of soil microbes in the global carbon cycle: tracking the below-ground microbial processing of plant-derived carbon for manipulating carbon dynamics in agricultural systems: Role of soil microbes in global carbon cycle: carbon tracking & agro-cosystem management. J Sci Food Agric.2014 Sep;94(12):2362–71. Haas BJ, Salzberg SL, Zhu W, Pertea M, Allen JE, Orvis J, et al. Automated eukaryotic gene structure annotation using EVidenceModeler and the Program to Assemble Spliced Alignments. Genome Biol.2008;9(1):R7. Hemingway, J.D., Rothman, D.H., Grant, K.E., Rosengard, S.Z., Elington, T.I., Derry, L.A., Galy V.V. (2019). Mineral protection regulates long-term global preservation of natural organic carbon. Nature, 570, 228-231). Herrmann, A., et al. "Mixed acid fermentation of plant biomass hydrolysates by anaerobic bacteria." Biotechnology for Biofuels 9.1 (2016): 103. Heymann, P., Gerads, M., Schaller, M., Dromer, F., Winkelmann, G., & Ernst, J. F. (2002). The siderophore iron transporter of Candida albicans (Sit1p / Arn1p) mediates uptake of ferrichrome-type siderophores and is required for epithelial invasion. Infection and immunity, 70(9), 5246-5255. Hider, R. C., & Kong, X. (2010). Chemistry and biology of siderophores. Natural product reports, 27(5), 637-657. Holesova Z, Jakubkova M, Zavadiakova I, Zeman I, Tomaska L, Nosek J. Gentisate and 3-oxoadipate pathways in the yeast Candida parapsilosis: identification and functional analysis of the genes coding for 3-hydroxybenzoate 6-hydroxylase and 4-hydroxybenzoate 1- hydroxylase. Microbiology.2011 Jul 1;157(7):2152–63. Attorney Docket No. LOAM-F005-01WO Hossain, M. M., & Sultana, F. (2020). Application and mechanisms of plant growth promoting fungi (PGPF) for phytostimulation. Organic agriculture, 1-31. Hosseyni Moghaddam, M. S., Safaie, N., Soltani, J., & Pasdaran, A. (2020). Endophytic association of bioactive and halotolerant Humicola fuscoatra with halophytic plants, and its capability of producing anthraquinone and anthranol derivatives. Antonie Van Leeuwenhoek, 113(2), 279-291. IPCC (2021) Summary for policymakers. In: V Masson-Delmotte, P Zhai, A Pirani, SL Connors, C Péan, S Berger, N Caud, Y Chen, L Goldfarb, MI Gomis, M Huang, K Leitzell, E Lonnoy, JBR Matthews, TK Maycock, T Waterfield, O Yelekçi, R Yu, B Zhou (eds) Climate Change 2021: The Physical Science Basis Contribution of Working Group I to the Sixth Assessment Report of the Intergovernmental Panel on Climate Change. Cambridge University Press. Jackson, R. B., Lajtha, K., Crow, S. E., Hugelius, G., Kramer, M. G., & Piñeiro, G. (2017). The ecology of soil carbon: pools, vulnerabilities, and biotic and abiotic controls. Annual Review of Ecology, Evolution, and Systematics, 48(1), 419-445 Käll L, Krogh A, Sonnhammer ELL. A Combined Transmembrane Topology and Signal Peptide Prediction Method. J Mol Biol.2004 May;338(5):1027–36. Katoh K, Misawa K, Kuma K, Miyata T. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 2002 Jul 15;30(14):3059-66. Keatinge-Clay, A. (2008). Crystal structure of the erythromycin polyketide synthase dehydratase. Journal of molecular biology, 384(4), 941-953. Kleber, M., Eusterhues, K., Keiluweit, M., Mikutta, C., Mikutta, R., Nico, P.S. (2015). Mineral-organic associations: Formation, properties, and relevance in soil environments. Advances in Agronomy, 130, 3-140. Korf I. [No title found]. BMC Bioinformatics.2004;5(1):59. Kozlov, AM, et al., RAxML-NG: a fast, scalable and user-friendly tool for maximum likelihood phylogenetic inference, Bioinformatics, Volume 35, Issue 21, November 2019, Pages 4453–4455 Kuypers, M. M., et al. "Nitrogen transformations in oxygen minimum zones." Annual Review of Marine Science 10 (2018): 361-386. Lah L, Podobnik B, Novak M, Korošec B, Berne S, Vogelsang M, et al. The versatility of the fungal cytochrome P450 monooxygenase system is instrumental in xenobiotic Attorney Docket No. LOAM-F005-01WO detoxification: Fungal P450 systems in xenobiotic detoxification. Mol Microbiol. 2011 Sep;81(5):1374–89. Lal, A., Schutzbach, J. S., Forsee, W. T., Neame, P. J., & Moremen, K. W. (1994). Isolation and expression of murine and rabbit cDNAs encoding an alpha 1, 2-mannosidase involved in the processing of asparagine-linked oligosaccharides. Journal of Biological Chemistry, 269(13), 9872-9881. Lal, R. (2018) Digging deeper. A holistic perspective of factors affecting soil carbon sequestration in agroecosystems. Global Change Biology, 24, 3285-3301. Lavallee, J. M., Soong, J. L., & Cotrufo, M. F. (2020). Conceptualizing soil organic matter into particulate and mineral‐associated forms to address global change in the 21st century. Global Change Biology, 26(1), 261-273. Lenaers M, Reyns W, Czech J, Carleer R, Basak I, Deferme W, et al. Links Between Heathland Fungal Biomass Mineralization, Melanization, and Hydrophobicity. Microb Ecol. 2018 Oct;76(3):762–70. Lücking, R., Aime, M.C., Robbertse, B. et al. Unambiguous identification of fungi: where do we stand and how accurate and precise is fungal DNA barcoding?. IMA Fungus 11, 14 (2020). Lugato, E., Lavallee, J.M., Haddix, M.L., Panagos, P., Cotrufo M.F. (2021) Different climate sensitivity of particulate and mineral-associated soil organic matter. Nature Geoscience, 14, 295-300. Majoros WH, Pertea M, Salzberg SL. TigrScan and GlimmerHMM: two open source ab initio eukaryotic gene-finders. Bioinformatics.2004 Nov 1;20(16):2878–9. Mandal, P., & Tiru, Z. (2022). Soil Application of Plant Growth Promoting Fungi for Sustainable Agriculture in the New Decade. In Plant Stress: Challenges and Management in the New Decade (pp.321-330). Springer, Cham. Mantzoukas, S., Kitsiou, F., Natsiopoulos, D., & Eliopoulos, P. A. (2022). Entomopathogenic Fungi: Interactions and Applications. Encyclopedia, 2(2), 646-656. Marini, A. M., Vissers, S., Urrestarazu, A., & Andre, B. (1994). Cloning and expression of the MEP1 gene encoding an ammonium transporter in Saccharomyces cerevisiae. The EMBO journal, 13(15), 3456-3463. Massengo-Tiassé, R. P., & Cronan, J. E. (2009). Diversity in enoyl-acyl carrier protein reductases. Cellular and molecular life sciences, 66(9), 1507-1517. Attorney Docket No. LOAM-F005-01WO Mayer M., Krause, H-M., Fliessbach, A., Mader, P., Steffens, M. (2022) Fertilizer quality and labile soil organic matter fractions are vital for organic carbon sequestration in temperate arable soils within a long-term trial in Switzerland. Geoderma, 426, 116080. McGee P, Mukasa Mugerwa T. Melanised endophytic fungi may increase stores of organic carbon in soil.2013 Apr 1;EGU2013-2136. Medema MH, Blin K, Cimermancic P, de Jager V, Zakrzewski P, Fischbach MA, et al. antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Res. 2011 Jul 1;39(suppl_2):W339–46. Mendes, FK, et al., CAFE 5 models variation in evolutionary rates among gene families, Bioinformatics, Volume 36, Issue 22-23, December 2020, Pages 5516–5518. Merino C, Godoy R, Matus F. Soil enzymes and biological activity at different levels of organic matter stability. Journal of Soil Science and Plant Nutrition.2016;(16):14–30. Messerschmidt, A., & Huber, R. (1990). The blue oxidases, ascorbate oxidase, laccase and ceruloplasmin Modelling and structural relationships. European journal of Biochemistry, 187(2), 341-352. Minoru Kanehisa, Susumu Goto, (2000) KEGG: Kyoto Encyclopedia of Genes and Genomes, Nucleic Acids Research, 28(1): 27–30. Mistry, J. et al., Pfam: The protein families database in 2021, Nucleic Acids Research, Volume 49, Issue D1, 8 January 2021, Pages D412–D419. Moghaddam, M. S. H., Safaie, N., Tedersoo, L., & Hagh-Doust, N. (2021). Diversity, community composition, and bioactivity of cultivable fungal endophytes in saline and dry soils in deserts. Fungal Ecology, 49, 101019. Mugerwa, M.T.T., McGee, P.A. (2017) Potential effect of melanised endophytic fungi on levels of organic carbon within an Alfisol. Soil Research 55, 245-252. Naik, B. S., Shashikala, J., & Krishnamurthy, Y. L. (2009). Study on the diversity of endophytic communities from rice (Oryza sativa L.) and their antagonistic activities in vitro. Microbiological Research, 164(3), 290-296. Nelson, D. W., & Sommers, L. E. (1996). Total carbon, organic carbon, and organic matter. In Methods of Soil Analysis Part 3—Chemical Methods (pp.961-1010). Soil Science Society of America. Nguyen, TM., Shafi, A., Nguyen, T. et al. Identifying significantly impacted pathways: a comprehensive review and assessment. Genome Biol 20, 203 (2019). Attorney Docket No. LOAM-F005-01WO Nicoletti, A., Wong, D. J., Kawase, K., Gibson, L. H., Yang-Feng, T. L., Richards, J. E., & Thompson, D. A. (1995). Molecular characterization of the human gene encoding an abundant 61 kDa protein specific to the retinal pigment epithelium. Human molecular genetics, 4(4), 641-649. Padda, K. P., et al. "Riboflavin: A key player in microbial interactions." Trends in Microbiology 29.8 (2021): 732-744. Poeplau, C., Don, A., Six, J., Kaiser, M., Benbi, D., Chenu, C., Cotrufo, M.F., Derrien, D., Gioacchini, P., Grand, S., Gregorich, E., Griepentrog, M., Gunina, A., Haddix, M., Kuzyakov, Y., Kuhnel, A., Macdonald, L.M., Soong, J., Trigalet, S., Vermeire, M-L., Rovira, P., van Wesemael, B., Wiesmeier, M., Yeasmin, S., Yevdokimov, I., Nieder, R. (2018) Isolating organic carbon fractions with varying turnover rates in temperate agricultural soils – A comprehensive method comparison. Soil Biology and Biochemistry, 125, 10-26. Potshangbam, M., Devi, S. I., Sahoo, D., & Strobel, G. A. (2017). Functional characterization of endophytic fungal community associated with Oryza sativa L. and Zea mays L. Frontiers in microbiology, 8, 325. Quevillon E, Silventoinen V, Pillai S, Harte N, Mulder N, Apweiler R, Lopez R. InterProScan: protein domains identifier. Nucleic Acids Res. 2005 Jul 1;33(Web Server issue):W116-20. Raja, H., Miller A., Pearce C., Oberlies N., (2017). Fungal Identification Using Molecular Tools: A Primer for the Natural Products Research Community. Journal of Natural Products, 80(3), 756-770 Robinson, O. et al., Phylo.io : Interactive Viewing and Comparison of Large Phylogenetic Trees on the Web , Molecular Biology and Evolution, Volume 33, Issue 8, August 2016, Pages 2163–2166. Rocci, K.S., Lavallee, J.M., Stewart C.E., Cotrufo, M.F. (2021) Soil organic carbon response to global environmental change depends on its distribution between mineral- associated and particulate organic matter. Science of the Total Environment, 793, 148569. Rodrigues, L.A.T., Giacomini, S.J., Diecknow, J., Cherubin, R., Ottonelli, A.S., Bayer, C. (2022) Carbon saturation deficit and litter quality drive the stabilization of litter-derived C in mineral-associated organic matter in long-term no-till soil. Catena, 219, 106590. Salam LB. Detection of carbohydrate-active enzymes and genes in a spent engine oil- perturbed agricultural soil. Bull Natl Res Cent.2018 Dec;42(1):10. Attorney Docket No. LOAM-F005-01WO Sanderman, J., Hengl, T., Fiske, G.J. (2017) Soil carbon debt of 12,000 years of human land use. Proceedings of the National Academy of Sciences, 114, 9575-9580. Sarr, P. S., Tibiri, E. B., Fukuda, M., Zongo, A. N., Compaore, E., & Nakamura, S. (2020). Phosphate-solubilizing fungi and alkaline phosphatase trigger the P solubilization during the co-composting of sorghum straw residues with Burkina Faso phosphate rock. Frontiers in Environmental Science, 8, 559195. Schweizer, S.A., Mueller, C.W., Hoschen, C., Ivanov, P., Kogel-Knabner, I. (2021) The role of clay content and mineral surface area for soil organic carbon storage in an arable toposequence. Biogeochemistry, 156, 401-420. Sharma, S. B., Sayyed, R. Z., Trivedi, M. H., & Gobi, T. A. (2013). Phosphate solubilizing microbes: sustainable approach for managing phosphorus deficiency in agricultural soils. SpringerPlus, 2(1), 1-14. Six, J. (1999). Recycling of sodium polytungstate used in soil organic matter studies. Soil Biology and Biochemistry, 31 (8), 1193–1196. Sperschneider J, Dodds PN. EffectorP 3.0: Prediction of Apoplastic and Cytoplasmic Effectors in Fungi and Oomycetes. Mol Plant-Microbe Interactions®.2022 Feb;35(2):146–56. Stanke M, Keller O, Gunduz I, Hayes A, Waack S, Morgenstern B. AUGUSTUS: ab initio prediction of alternative transcripts. Nucleic Acids Res. 2006 Jul 1;34(Web Server):W435–9. Sun, J. et al., OrthoVenn3: an integrated platform for exploring and visualizing orthologous data across genomes, Nucleic Acids Research, Volume 51, Issue W1, 5 July 2023, Pages W397–W403. Tamayo, E., Gómez-Gallego, T., Azcón-Aguilar, C., & Ferrol, N. (2014). Genome- wide analysis of copper, iron and zinc transporters in the arbuscular mycorrhizal fungus Rhizophagus irregularis. Frontiers in Plant Science, 5, 547. Ter-Hovhannisyan V, Lomsadze A, Chernoff YO, Borodovsky M. Gene prediction in novel fungal genomes using an ab initio algorithm with unsupervised training. Genome Res. 2008 Dec;18(12):1979–90. Urban M, Cuzick A, Seager J, Wood V, Rutherford K, Venkatesh SY, et al. PHI-base: the pathogen–host interactions database. Nucleic Acids Res.2019 Nov 16;gkz904. Versaw, W. K., & Metzenberg, R. L. (1995). Repressible cation-phosphate symporters in Neurospora crassa. Proceedings of the National Academy of Sciences, 92(9), 3884-3887. Attorney Docket No. LOAM-F005-01WO Vu D, Groenewald M, de Vries M, Gehrmann T, Stielow B, Eberhardt U, Al-Hatmi A, Groenewald JZ, Cardinali G, Houbraken J, Boekhout T, Crous PW, Robert V, Verkley GJM. Large-scale generation and analysis of filamentous fungal DNA barcodes boosts coverage for kingdom fungi and reveals thresholds for fungal species and higher taxon delimitation. Stud Mycol.2019 Mar;92:135-154. Walkley, A., & Black, I. A. (1934). An examination of the Degtjareff method for determining soil organic matter, and a proposed modification of the chromic acid titration method. Soil Science, 37(1), 29-38. Xu L, Dong Z, Fang L, Luo Y, Wei Z, Guo H, et al. OrthoVenn2: a web server for whole-genome comparison and annotation of orthologous clusters across multiple species. Nucleic Acids Res.2019 Jul 2;47(W1):W52–8. Yaish, M. W., Al-Harrasi, I., Alansari, A. S., Al-Yahyai, R., & Glick, B. R. (2016). The use of high throughput DNA sequence analysis to assess the endophytic microbiome of date palm roots grown under different levels of salt stress. Int. Microbiol, 19(3), 143-155. Yan Z, Kang E, Zhang K, Hao Y, Wang X, Li Y, et al. Asynchronous responses of microbial CAZymes genes and the net CO2 exchange in alpine peatland following 5 years of continuous extreme drought events. ISME Commun.2022 Nov 16;2(1):115. Zumft, W. G. "Cell biology and molecular basis of denitrification." Microbiology and Molecular Biology Reviews 61.4 (1997): 533-616.

Claims

1. Attorney Docket No. LOAM-F005-01WO CLAIMS What is claimed is:

1. A method of increasing stable organic carbon in an agricultural soil, the method comprising: heterologously disposing one or more fungal strains to treat a plant element, wherein the one or more fungal strains comprises a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3; and the one or more fungal strains are heterologously disposed in an effective amount to increase stable organic carbon in the agricultural soil supporting a plant derived from the treated plant element relative to agricultural soil supporting a reference plant derived from a reference plant element.

2. A method of increasing stable organic carbon in an agricultural soil, the method comprising: mechanically inoculating an agricultural soil with a synthetic combination of one or more heterologously disposed fungal strains, wherein the one or more fungal strains comprises a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3; and the one or more fungal strains are in an effective amount to increase organic carbon in the inoculated agricultural soil relative to a reference agricultural soil.

3. The method of Claim 1 or 2, wherein the one or more fungal strains further comprises: (i) a TUB2 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 4-6; (ii) a TEF1 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 7-9; (iii) an RPB1 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 10-12; (iv) an RPB2 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 13-15; orAttorney Docket No. LOAM-F005-01WO (v) any combination (i) to (iv).

4. The method of any one of Claims 1 to 3, wherein the one or more fungal strains belong to the species Humicola fuscoatra.

5. The method of Claim 4, wherein the one or more fungal strains are selected from the group consisting of: Humicola fuscoatra US-856 (ATCC Accession No. PTA- 127645), Humicola fuscoatra US-735 (ATCC Accession No. PTA-127783), Humicola fuscoatra US-946 (ATCC Accession No. PTA-127784), and a mutant thereof having all identifying characteristics of the respective strain.

6. The method of any one of Claims 1 to 5, wherein the one or more fungal strains are capable of enhancing microbial activity, facilitating breakdown and synthesis of organic materials, and contributing to nutrient cycling to improve soil health and increase stable soil organic carbon content via alpha amylase, nitrite reduction, riboflavin biosynthesis, and mixed acid: lactate pathways.

7. The method of any one of Claims 1 to 6, further comprising an initial step of identifying the agricultural soil as having a soil organic carbon (SOC) below a threshold level.

8. The method of Claim 7, wherein the threshold level is an SOC (% wt / wt) below 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%.

9. The method of any one of Claims 1 to 8, wherein the agricultural soil and / or plant element are non-native to the one or more fungal strains.

10. The method of Claim 9, wherein the non-native plant element is from a plant selected from the group consisting of wheat, rice, corn (maize), canola, rye, oats, barley, sorghum, millet, flax, hemp, jute, cotton, sugar cane, sugar beet, sunflower, soybeans, alfalfa, clover, Desmanthus, peanuts, lentils, lupins, peas, and chickpea.

11. The method of Claim 9, wherein the non-native plant element is from a plant selected from the group consisting of lucerne, arrow leaf clover, balansa clover, chicory, plantain, phalaris, cocksfoot, fescue, prairie grass, Warrego summer grass, Italian rye grass,Attorney Docket No. LOAM-F005-01WO perennial rye grass, biserrula, serradella, gland clover, bladder clover, switchgrass, radish, medic, buckwheat, cow pea, lablab, sunn hemp, sunflower, tillage radish, and subterranean clover.

12. The method of any one of Claims 1 to 11, wherein the stable organic carbon in the agricultural soil is increased in the forms of aggregate carbon fraction (AggC), aggregate occluded particulate organic carbon (oPOC), and / or mineral-associated organic carbon (MAOC).

13. A method for sequestering atmospheric carbon for storage as stable organic carbon in an agricultural soil, the method comprising: heterologously disposing one or more fungal strains to treat a plant element, wherein the one or more fungal strains comprises a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3; and the one or more fungal strains are in an effective amount to increase sequestered atmospheric carbon in agricultural soil supporting a plant derived from the treated plant element relative to agricultural soil supporting a reference plant derived from a reference plant element.

14. A method for sequestering atmospheric carbon for storage as stable organic carbon in an agricultural soil, the method comprising: mechanically inoculating an agricultural soil with a synthetic combination of one or more heterologously disposed fungal strains, wherein the one or more fungal strains comprises a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3; and the one or more fungal strains are in an effective amount to increase sequestered atmospheric carbon in the inoculated agricultural soil relative to a reference agricultural soil.

15. The method of Claim 13 or 14, wherein the one or more fungal strains further comprises: (i) a TUB2 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 4-6;Attorney Docket No. LOAM-F005-01WO (ii) a TEF1 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 7-9; (iii) an RPB1 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 10-12; (iv) an RPB2 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 13-15; or (v) any combination (i) to (iv).

16. The method of any one of Claims 13 to 15, wherein the one or more fungal strains belong to the species Humicola fuscoatra.

17. The method of Claim 16, wherein the one or more fungal strains are selected from the group consisting of: Humicola fuscoatra US-856 (ATCC Accession No. PTA- 127645), Humicola fuscoatra US-735 (ATCC Accession No. PTA-127783), Humicola fuscoatra US-946 (ATCC Accession No. PTA-127784), and a mutant thereof having all identifying characteristics of the respective strain.

18. The method of any one of Claims 13 to 17, wherein the agricultural soil and / or plant element are non-native to the one or more fungal strains.

19. The method of Claim 18, wherein the non-native plant element is from a plant selected from the group consisting of wheat, rice, corn (maize), canola, rye, oats, barley, sorghum, millet, flax, hemp, jute, cotton, sugar cane, sugar beet, sunflower, soybeans, alfalfa, clover, Desmanthus, peanuts, lentils, lupins, peas, and chickpea.

20. The method of Claim 18, wherein the non-native plant element is from a plant selected from the group consisting of lucerne, arrow leaf clover, balansa clover, chicory, plantain, phalaris, cocksfoot, fescue, prairie grass, Warrego summer grass, Italian rye grass, perennial rye grass, biserrula, serradella, gland clover, bladder clover, switchgrass, radish, medic, buckwheat, cow pea, lablab, sunn hemp, sunflower, tillage radish, and subterranean clover.

21. The method of any one of Claims 13 to 20, wherein the stable organic carbon in the agricultural soil is increased in the forms of aggregate carbon fraction (AggC), aggregateAttorney Docket No. LOAM-F005-01WO occluded particulate organic carbon (oPOC), and / or mineral-associated organic carbon (MAOC).

22. A method of increasing soil aggregation or soil aggregate stability in an agricultural soil, the method comprising: heterologously disposing one or more fungal strains to treat a plant element, wherein the one or more fungal strains comprises a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3; and the one or more fungal strains are in an effective amount to increase soil aggregation or soil aggregate stability in the agricultural soil supporting a plant derived from the treated plant element relative to agricultural soil supporting a reference plant derived from a reference plant element.

23. A method increasing soil aggregation or soil aggregate stability in an agricultural soil, the method comprising: mechanically inoculating the agricultural soil with a synthetic combination of one or more heterologously disposed fungal strains, wherein the one or more fungal strains comprises a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3; and the one or more fungal strains are in an effective amount to increase soil aggregation or soil aggregate stability in the inoculated agricultural soil relative to a reference agricultural soil.

24. The method of Claim 22 or 23, wherein the one or more fungal strains further comprises: (i) a TUB2 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 4-6; (ii) a TEF1 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 7-9; (iii) an RPB1 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 10-12; (iv) an RPB2 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 13-15; orAttorney Docket No. LOAM-F005-01WO (v) any combination (i) to (iv).

25. The method of any one of Claims 22 to 24, wherein the one or more fungal strains belong to the species Humicola fuscoatra.

26. The method of Claim 25, wherein the one or more fungal strains are selected from the group consisting of: Humicola fuscoatra US-856 (ATCC Accession No. PTA- 127645), Humicola fuscoatra US-735 (ATCC Accession No. PTA-127783), Humicola fuscoatra US-946 (ATCC Accession No. PTA-127784), and a mutant thereof having all identifying characteristics of the respective strain.

27. The method of any one of Claims 22 to 26, wherein the agricultural soil and / or plant element are non-native to the one or more fungal strains.

28. The method of any one of Claims 22 to 27, wherein the increase in soil aggregate stability is indicated by an increase in soil mean weight diameter (MWD), geometric mean diameter (GMD), fractal dimension (D), or water-stable aggregates stability rate (WSAR); or the increase in soil aggregate stability is indicated by a decrease in percentage of aggregates destruction (PAD).

29. The method of any one of Claims 22 to 28, wherein increased soil aggregation or soil aggregate stability improves water retention and porosity in agricultural soil inoculated or treated with the one or more fungal strains compared to a reference agricultural soil.

30. A method of enhancing plant growth, the method comprising: heterologously disposing one or more fungal strains to treat a plant element, wherein the one or more fungal strains comprises a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3; and the one or more fungal strains are in an effective amount to enhance the growth of a plant derived from the treated plant element relative to a reference plant derived from a reference plant element.Attorney Docket No. LOAM-F005-01WO 31. The method of Claim 30, wherein the one or more fungal strains further comprises: (i) a TUB2 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 4-6; (ii) a TEF1 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 7-9; (iii) an RPB1 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 10-12; (iv) an RPB2 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 13-15; or (v) any combination (i) to (iv).

32. The method of Claim 30 or 31, wherein the one or more fungal strains belong to the species Humicola fuscoatra.

33. The method of Claim 32, wherein the one or more fungal strains are selected from the group consisting of: Humicola fuscoatra US-856 (ATCC Accession No. PTA- 127645), Humicola fuscoatra US-735 (ATCC Accession No. PTA-127783), Humicola fuscoatra US-946 (ATCC Accession No. PTA-127784), and a mutant thereof having all identifying characteristics of the respective strain.

34. The method of any one of Claim 30 to 33, wherein the plant exhibits at least one of increased root number, increased root length, increased root mass, increased root volume, increased leaf area, increased leaf number, increased pod number, increased plant height, increased shoot mass, increased chlorophyll content, increased nodulation, and increased yield, as compared to the reference plant.

35. The method of any one of Claim 30 to 34, wherein the plant element is non- native to the one or more fungal strains.

36. The method of Claim 35, wherein the non-native plant element is from a plant selected from the group consisting of wheat, rice, corn (maize), canola, rye, oats, barley, sorghum, millet, flax, hemp, jute, cotton, sugar cane, sugar beet, sunflower, soybeans, alfalfa, clover, Desmanthus, peanuts, lentils, lupins, peas, and chickpea.Attorney Docket No. LOAM-F005-01WO 37. The method of Claim 35, wherein the non-native plant element is from a plant selected from the group consisting of lucerne, arrow leaf clover, balansa clover, chicory, plantain, phalaris, cocksfoot, fescue, prairie grass, Warrego summer grass, Italian rye grass, perennial rye grass, biserrula, serradella, gland clover, bladder clover, switchgrass, radish, medic, buckwheat, cow pea, lablab, sunn hemp, sunflower, tillage radish, and subterranean clover.

38. A synthetic combination comprising a purified population of one or more fungal strains heterologously disposed to a plant element, wherein the one or more fungal strains are heterologous to the plant element and comprise a nuclear ribosomal internal transcribed spacer (ITS) sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 1-3; and an agriculturally acceptable carrier; wherein the one or more fungal strains are present in an effective amount to increase stable organic carbon in an agricultural soil supporting a plant derived from the plant element in the synthetic combination relative to agricultural soil supporting a reference plant derived from a reference plant element.

39. The synthetic combination of Claim 38, wherein the one or more fungal strains further comprises: (i) a TUB2 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 4-6; (ii) a TEF1 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 7-9; (iii) an RPB1 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 10-12; (iv) an RPB2 sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 13-15; or (v) any combination (i) to (iv).

40. The synthetic combination of Claim 38 or 39, wherein the one or more fungal strains belong to the species Humicola fuscoatra.Attorney Docket No. LOAM-F005-01WO 41. The synthetic combination of Claim 40, wherein the one or more fungal strains are selected from the group consisting of: Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645), Humicola fuscoatra US-735 (ATCC Accession No. PTA-127783), Humicola fuscoatra US-946 (ATCC Accession No. PTA-127784), and a mutant thereof having all identifying characteristics of the respective strain.

42. The synthetic combination of any one of Claims 38 to 41, wherein the plant element is non-native to the one or more fungal strains.

43. The synthetic combination of Claim 42, wherein the non-native plant element is from a plant selected from the group consisting of wheat, rice, corn (maize), canola, rye, oats, barley, sorghum, millet, flax, hemp, jute, cotton, sugar cane, sugar beet, sunflower, soybeans, alfalfa, clover, Desmanthus, peanuts, lentils, lupins, peas, and chickpea.

44. The synthetic combination of Claim 42, wherein the non-native plant element is from a pasture crop or cover crop selected from the group consisting of lucerne, arrow leaf clover, balansa clover, chicory, plantain, phalaris, cocksfoot, fescue, prairie grass, Warrego summer grass, Italian rye grass, perennial rye grass, biserrula, serradella, gland clover, bladder clover, switchgrass, radish, medic, buckwheat, cow pea, lablab, sunn hemp, sunflower, tillage radish, and subterranean clover.

45. The synthetic combination of any one of Claims 38 to 44, wherein (a) the combination is formulated as a solid, liquid or gel; (b) the combination is formulated as a powder, pellet or granules; or (c) the combination is formulated as an emulsion, colloid, suspension or solution.

46. The synthetic combination of any one of Claims 38 to 45, wherein the one or more fungal strains are present in the combination at a concentration of at least 103colony forming units (CFU) per milliliter or gram.

47. The method or synthetic combination of any one of Claims 1 to 46, wherein the plant element is a whole plant, seedling, meristematic tissue, ground tissue, vascular tissue, dermal tissue, seed, leaf, root, shoot, stem, flower, fruit, stolon, bulb, tuber, corm, keikis, shoot, or bud.Attorney Docket No. LOAM-F005-01WO 48. A plant grown from the synthetic combination of any one of Claims 38 to 46, wherein agricultural soil supporting the plant exhibits increased stable organic carbon relative to agricultural soil supporting a reference plant.

49. A bag or container comprising the synthetic combination of any one of Claims 38 to 46.

50. A kit comprising the synthetic combination according to of any one of Claims 38 to 46.

51. A cell or a biologically pure culture of one or more fungal strains selected from the group consisting of Humicola fuscoatra US-856 (ATCC Accession No. PTA-127645), Humicola fuscoatra US-735 (ATCC Accession No. PTA-127783), Humicola fuscoatra US- 946 (ATCC Accession No. PTA-127784), and a mutant thereof having all identifying characteristics of the respective strain.

52. An agricultural composition comprising the cell or a biologically pure culture of Claim 51 and, optionally, an agriculturally acceptable carrier.

53. The agricultural composition of Claim 52, wherein the agricultural composition is heterologously disposed on at least a portion of an outer surface of a plant, plant part or plant seed.

54. A bioorganic soil conditioner comprising the cell or a biologically pure culture of Claim 51 and, optionally, an agriculturally acceptable carrier.

55. The agricultural composition or bioorganic soil conditioner of any one of Claims 52 to 54, wherein the agriculturally acceptable carrier comprises one or more of talc, an oil, kaolin clay, a dispersant, a surfactant, and a nutrient.

Citation Information

Patent Citations

  • Novel Humicola sp. JS-0112 strain and Antimicrobial Composition comprising the same

    KR102199005B1

  • IN PLANTA RNAi CONTROL OF FUNGI

    US20110061128A1

  • Methods for carbon capture and increasing yield of plants

    US20240150253A1