Method for simultaneously detecting giardia and cryptosporidium in one tube

Abstract

Provided is a method for simultaneously detecting Giardia and Cryptosporidium in one tube. The nucleic acid sequence of a primer comprises sequences as shown in SEQ ID NO. 1 to SEQ ID NO. 4, and the nucleic acid sequence of a fluorescent probe comprises sequences as shown in SEQ ID NO. 5 and SEQ ID NO. 6. The method achieves high-sensitivity specific amplification, allows for effective detection of Giardia and Cryptosporidium in drinking water currently supplied in China, and is easy to operate, efficient, cost-effective, and suitable for on-site rapid detection platforms.

Description

A method for simultaneous detection of Giardia lamblia and Cryptosporidium in a single tube Technical Field

[0001] This application belongs to the field of pathogen detection technology and relates to a method for simultaneously detecting Giardia lamblia and Cryptosporidium in one tube. Background Technology

[0002] Cryptosporidiosis is a zoonotic infectious disease caused by Cryptosporidium infection, with diarrhea as the main clinical manifestation. It is a newly emerging infectious disease and is listed by the World Health Organization as one of the six most common diarrheal diseases worldwide. This parasite primarily parasitizes within the brush-like vacuoles of the small intestinal epithelial cells, with the proximal jejunum being the site of the highest parasitic population. In severe cases, it can spread throughout the entire digestive tract. Giardiasis is a zoonotic parasitic disease caused by Giardia lamblia infection, with diarrhea and indigestion as the main symptoms. Its pathogenic mechanism is not fully understood, but it may be related to the mechanical and chemical effects of the parasite on the host, leading to non-specific and specific host responses.

[0003] Currently, most surveys on "two parasites" (referring to mites and parasites) in my country focus on outpatient diarrhea patients, while data on environmental and drinking water pollution are scarce. A major reason for this is the limitation of quantitative detection methods for these parasites. my country's 2007 "Standards for Drinking Water Quality" stipulated a new hygienic limit for "two parasites" of <1 per 10L, with a spiked recovery rate of ≥10%. The immunomagnetic separation fluorescent antibody method is the standard method for detecting "two parasites" in my country's "Standard Methods for Drinking Water Quality." This method involves numerous steps, including filtration, washing, immunomagnetic separation, fluorescent staining, and microscopic examination. It is time-consuming and cumbersome, requires highly skilled personnel, and is prone to missed detections during microscopic examination. Furthermore, the instruments and reagents used are all imported, resulting in high detection costs that limit its widespread application.

[0004] With the development of molecular biology detection technologies, nucleic acid amplification-based detection platforms have gradually entered the field of application. These platforms employ technologies such as conventional PCR, quantitative real-time PCR, and nested PCR. While these methods offer advantages in high sensitivity and specificity, they also require specialized equipment, have long processing times, and demand highly skilled personnel, thus limiting their widespread application in field testing. In recent years, isothermal amplification techniques have emerged, offering advantages such as a single reaction temperature, independence from thermal cycling, and significantly shorter reaction times. These advantages better meet the needs of rapid and convenient field testing and are gradually becoming the best alternative to PCR. Currently, loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) are widely used. LAMP has been applied to the detection of Escherichia coli, Salmonella, Listeria, and Vibrio parahaemolyticus, but it is difficult to distinguish non-specific amplifications, and its complex primer design, susceptibility to contamination, and high requirements for the operating environment and personnel are significant drawbacks. Meanwhile, RPA technology utilizes the activity of T4 recombinase, enabling DNA denaturation at 37–42°C and rapid amplification of the target fragment within 15–30 minutes. However, this method is entirely dependent on imported supplies, which are unstable and expensive, thus limiting its widespread application.

[0005] Therefore, there is an urgent need to provide a primer probe and method for detecting Giardia lamblia and Cryptosporidium, to achieve highly sensitive and specific amplification, and to effectively detect Giardia lamblia and Cryptosporidium in drinking water in my country at present. Summary of the Invention

[0006] This application provides a method for simultaneously detecting Giardia lamblia and Cryptosporidium in a single tube, achieving highly sensitive specific amplification. It can effectively detect Giardia lamblia and Cryptosporidium in drinking water in my country at present. The method is simple to operate, efficient, low in cost, and suitable for rapid on-site detection platforms.

[0007] In a first aspect, this application provides primers and probes for the simultaneous detection of Giardia lamblia and Cryptosporidium in one tube, wherein the nucleic acid sequences of the primers include the sequences shown in SEQ ID NO.1-SEQ ID NO.4; and the nucleic acid sequences of the probes include the sequences shown in SEQ ID NO.5-SEQ ID NO.6.

[0008] SEQ ID NO.1: CTCAGGAAGGAGGCCCTCAAGAGCCTGAACGA;

[0009] SEQ ID NO.2: TCTCGCGGGCGATCGTCTCCTTCTCGATSGC;

[0010] SEQ ID NO.3: TGAGAAACGGCTACCACATCTAAGGAAGGC;

[0011] SEQ ID NO.4: CTCCAATTGATACTYGTWAAGGGGTTTATAC;

[0012] SEQ ID NO.5:

[0013] 5'-TYGCCACGGAGAACGCMGARAGGAAGAAGA / i6FAMdT / / idSpacer / / iBHQ1dT / AYGACCAGCTCAACG-3'C3spacer;

[0014] SEQ ID NO.6:

[0015] 5'-CGCAAATTACCCAATCCTRAYACAGGGAGG / iHEXdT / A / idSpacer / / iBHQ1dT / GACAAGAAATAACAAT-3'C3spacer;

[0016] Specifically, the meanings of degenerate bases are: Y represents C+T, W represents A+T, M represents A+C, and R represents A+G.

[0017] FAM and HEX are fluorescent reporter groups, and BHQ1 is a quencher group; the structure of dSpacer is as follows: C3spacer is a blocking group with the following structure:

[0018] It is understood that the fluorescent group modified by the probe in this application can be any suitable fluorescent group in the art, and the quenching group can be any suitable quenching group in the art.

[0019] This application achieves highly sensitive specific amplification, which can effectively detect Giardia lamblia and Cryptosporidium in drinking water in my country at present. It is simple to operate, efficient, low in cost, and suitable for rapid on-site detection platforms.

[0020] Preferably, the 5' end of the probe is 25-30 bp away from the fluorescent reporter group, and the 3' end is 15-20 bp away from the quencher group.

[0021] The specific bit values ​​in the above 25-30bp range can be 25bp, 26bp, 27bp, 28bp, 29bp, 30bp, etc.

[0022] The specific bit values ​​in the 15-20bp range mentioned above can be 15bp, 16bp, 17bp, 18bp, 19bp, 20bp, etc.

[0023] Preferably, the fluorescent group includes any one or a combination of at least two of FAM, HEX, or ROX.

[0024] Preferably, the quenching group includes any one or a combination of at least two of BHQ1, BHQ2, or MGB.

[0025] Secondly, this application provides the application of the primers and probes described in the first aspect for the simultaneous detection of Giardia lamblia and Cryptosporidium in one tube in the preparation of products for the detection of Giardia lamblia and Cryptosporidium.

[0026] Thirdly, this application provides a kit for simultaneously detecting Giardia lamblia and Cryptosporidium in one tube, the kit comprising the primers and probes described in the first aspect for detecting Giardia lamblia and Cryptosporidium.

[0027] Fourthly, this application provides the application of the primers and probes described in the first aspect for the simultaneous detection of Giardia lamblia and Cryptosporidium in one tube in the detection of Giardia lamblia and Cryptosporidium.

[0028] Fifthly, this application provides a method for detecting Giardia lamblia and Cryptosporidium for purposes other than disease diagnosis and / or treatment, the method comprising:

[0029] DNA is extracted from the sample to be tested as a template, and recombinase-mediated isothermal nucleic acid amplification is performed using the primers and probes described in the first aspect for simultaneous detection of Giardia lamblia and Cryptosporidium in one tube. The result is judged based on the slope of the fluorescence value after isothermal nucleic acid amplification.

[0030] Preferably, the criteria for judgment are: when the fluorescence value slope is ≥20, the sample is judged as positive; when the fluorescence value slope is <20, the sample is judged as negative.

[0031] Preferably, the primers comprise primers purified by HPLC.

[0032] Preferably, the isothermal nucleic acid amplification reaction system includes the primers and probes for simultaneous detection of Giardia lamblia and Cryptosporidium as described in the first aspect, betaine, Tris buffer, magnesium acetate, potassium acetate, polyethylene glycol, dithiothreitol, creatine phosphate, ATP, dNTPs, single-stranded binding protein, recombinase, UvsY protein, DNA polymerase, Cryptosporidium genome and Giardia lamblia genome, with a total reaction volume of 40-60 μL.

[0033] The specific point values ​​in the above 40-60μL range can be selected as 40μL, 41μL, 42μL, 45μL, 50μL, 55μL, 58μL, 60μL, etc.

[0034] Preferably, the primer concentration for detecting Giardia lamblia and the probe concentration for detecting Cryptosporidium are 400-450 nmol / L, and the probe concentration for detecting Giardia lamblia is 100-150 nmol / L.

[0035] Preferably, the primer concentration for detecting Cryptosporidium is 400-450 nmol / L, and the probe concentration for detecting Cryptosporidium is 100-150 nmol / L.

[0036] The specific point values ​​in the 400-450 nmol / L range can be selected as 400 nmol / L, 401 nmol / L, 402 nmol / L, 410 nmol / L, 420 nmol / L, 430 nmol / L, 440 nmol / L, 445 nmol / L, 450 nmol / L, etc.

[0037] The specific point values ​​in the above 100-150 nmol / L range can be selected as 100 nmol / L, 101 nmol / L, 102 nmol / L, 110 nmol / L, 120 nmol / L, 130 nmol / L, 140 nmol / L, 145 nmol / L, 150 nmol / L, etc.

[0038] Preferably, the concentration of betaine is 4-10 M.

[0039] The specific point values ​​in the above 4-10M range can be selected as 4M, 5M, 6M, 7M, 8M, 9M, 10M, etc.

[0040] Preferably, the sample to be tested includes drinking water and / or source water.

[0041] As a preferred technical solution, the method for detecting Giardia lamblia and Cryptosporidium in this application specifically includes the following steps:

[0042] (1) Nucleic acid sample processing and collection from drinking water

[0043] The number of cysts / cysts in drinking water samples (from water treatment plants or source water) is very low, therefore a larger volume of concentrated water sample is required. The sampling volume depends on the type of water sample: 20L for source water and 100L for drinking water. Specialized equipment and filter membranes are used to concentrate the water and extract nucleic acid samples. Nucleic acid extraction from the sample can be performed using a commercially available genomic DNA extraction kit. After determining the concentration and purity of the extracted genomic DNA, 5μL is used for subsequent nucleic acid testing, or stored at -20℃ for later use.

[0044] (2) Reaction system

[0045] The 50 μL reaction system includes 25 μL reaction buffer (25-75 nmol / L), magnesium acetate (5-15 nmol / L), potassium acetate (25-75 mmol / L), polyethylene glycol (5%-10%), dithiothreitol (2-10 mmol / L), creatine phosphate (25-50 mmol / L), creatine kinase (2.7-4.3 μg / U), SSB protein (800 ng / μL), ATP (5-10 mmol / L), dNTPs (1-2 mmol / L), RecQ protein (10 ng / μL), and UV. sY protein (50 ng / μL), UvsX protein (60 ng / μL), DNA polymerase (50 ng / μL), recombinase, 12.7 μL double-distilled water, 2.1 μL forward primer (420 nmol / L), 2.1 μL reverse primer (420 nmol / L), and 0.6 μL probe (120 nmol / L) were mixed by hand, briefly centrifuged, and 2.5 μL of 280 mmol / L magnesium acetate solution was added to the inner wall of the reaction unit cap. Then, 5 μL of Giardia lamblia and Cryptosporidium genomes were added to the reaction unit, respectively, and mixed thoroughly.

[0046] (3) After thorough mixing in a RAA-B6108 constant temperature oscillator, the mixture is placed in a RAA-F1620 fluorescence detector for amplification. The reaction conditions are 39℃ and 20min. Fluorescence signal values ​​are collected every 20s and a real-time RAA fluorescence amplification curve is plotted. The detection result is determined according to the slope value of the fluorescence amplification curve. When the fluorescence slope value K≥20, it is judged as positive, and when K<20, it is judged as negative.

[0047] (4) Quality Control

[0048] A positive control sample test result is considered positive; a negative control sample test result is considered negative. If the test result does not meet the requirements for positive or negative, the experiment is considered invalid, and the deviation of instruments, reagents, etc. should be checked. After confirming that there are no errors, the test should be repeated.

[0049] Compared with the prior art, this application has the following beneficial effects:

[0050] This application achieves highly sensitive specific amplification, which can effectively detect Giardia lamblia and Cryptosporidium in drinking water in my country at present. It is simple to operate, efficient, low in cost, and suitable for rapid on-site detection platforms. Attached Figure Description

[0051] Figure 1 shows the detection results in the reaction system without the addition of betaine.

[0052] Figure 2 shows the detection results when the amount of betaine in the reaction system is 1.5 μL.

[0053] Figure 3 shows the detection results when the amount of betaine in the reaction system is 2.5 μL.

[0054] Figure 4 shows the detection results when the amount of betaine in the reaction system is 3.5 μL.

[0055] Figure 5 shows the detection results when the amount of betaine in the reaction system is 5 μL.

[0056] Figure 6 shows the specific results of the Giardia lamblia and Cryptosporidium dual-channel reaction system.

[0057] Figure 7 shows the sensitivity detection results.

[0058] Figure 8 shows the results of the competitive reaction detection.

[0059] Figure 9 shows the verification results of Giardia lamblia and Cryptosporidium samples.

[0060] Figure 10 shows the results of the sample verification in simulated tap water (20L source water).

[0061] Figure 11 shows the results of the simulated tap water sample verification (100L drinking water). Detailed Implementation

[0062] To further illustrate the technical means and effects adopted in this application, the following description, in conjunction with embodiments and accompanying drawings, will provide further details. It is understood that the specific embodiments described herein are merely for explaining this application and not for limiting it.

[0063] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0064] Example 1

[0065] Primer and probe screening.

[0066] (1) The primer and probe sequences for detecting Giardia lamblia are shown in Table 1, and the primer and probe sequences for detecting Cryptosporidium are shown in Table 2. Prepare the reaction systems according to Table 3, and dispense 42.5 μL of the mixture into the RAA reaction unit. Add 2.5 μL of magnesium acetate to the tube cap; add 5 μL of purified water to the reaction unit and label it N; add 5 μL of solution A to the reaction unit, repeat 3 times and label it A; add 5 μL of solution B to the reaction unit, repeat 3 times and label it B; add 5 μL of solution C to the reaction unit, repeat 5 times and label it C; cap the tube, place it in the sample pretreatment system B6108 for 4 min, and run the isothermal nucleic acid amplification analyzer F1620 for 20 min.

[0067] Table 1

[0068] Table 2

[0069] Table 3

[0070] (2) Compare the two primer pairs selected for detecting Giardia lamblia to determine the primer with the best amplification effect. Compare the three primer pairs selected for detecting Cryptosporidium to determine the primer with the best amplification effect.

[0071] (3) Use the best primer combination for sensitivity and low copy repeatability detection.

[0072] For detecting Giardia lamblia, upstream primers GIA-F001, GIA-F002, and GIA-F003 were combined with downstream primers GIA-R001, GIA-R002, and GIA-R003, respectively. Two superior combinations, GIA-F001 / R001 and GIA-F002 / R001, were selected, and the amplification results are shown in Table 4. Similarly, for detecting Cryptosporidium, upstream primers CRY-F001, CRY-F002, and CRY-F003 were combined with downstream primers CRY-R001, CRY-R002, and CRY-R003, respectively. Three superior combinations, CRY-F002 / R001, CRY-F003 / R001, and CRY-F003 / R002, were selected, and the primer amplification results are shown in Table 5. The two primer pairs selected for Giardia lamblia detection were confirmed, and the best amplification result was determined to be GIA-F002 / R001. The sensitivity of the optimal primer pair for Giardia lamblia detection was also tested, and the results are shown in Table 6. The three primer pairs selected for Cryptosporidium detection were confirmed, and the best amplification result was determined to be CRY-F003 / R001. The sensitivity of the optimal primer pair for Cryptosporidium detection was also tested, and the results are shown in Table 7. The low copy repeatability results of the primer pair GIA-F002 / R001 for Giardia lamblia detection are shown in Table 8. Amplification was weak at 10 copies, while amplification was better at 100 copies, with a detection limit of 100 copies / μL. The low copy repeatability results of the primer combination CRY-F003 / R001 for detecting Cryptosporidium are shown in Table 9. The amplification was weak at 10 copies and better at 100 copies. The limit of detection was 100 copies / μL.

[0073] Table 4

[0074] Table 5

[0075] Table 6

[0076] Table 7

[0077] Table 8

[0078] Table 9

[0079] Example 2

[0080] Single-tube integration experiment of Cryptosporidium and Giardia lamblia.

[0081] To achieve simultaneous detection of Giardia lamblia and Cryptosporidium, optimized primers and probes were integrated into a single tube for the reaction. The amount of primers and probes used in the double-pass reaction system was investigated. The experimental setup was as follows:

[0082] (1) The Giardia primer dosage in the double-pass reaction system was set in gradients of 2.1 μL, 1.8 μL, 1.25 μL, and 1 μL, and the Giardia probe dosage was set in gradients of 0.6 μL, 0.4 μL, 0.3 μL, and 0.2 μL.

[0083] (2) The amounts of Cryptosporidium primers in the double-pass reaction system were set in gradients of 2.1 μL, 1.8 μL, 1.25 μL, and 1.2 μL, and the amounts of Cryptosporidium probes were set in gradients of 0.6 μL, 0.45 μL, 0.35 μL, and 0.25 μL.

[0084] (3) The test results are shown in Table 10, and the optimal reaction system is shown in Table 11 below.

[0085] Table 10

[0086] Table 11

[0087] Example 3

[0088] Study on the amount of betaine used in the reaction system.

[0089] To improve the detection rate of low-concentration Giardia lamblia samples in the two-channel reaction system, and to analyze the characteristics of the detection target, namely high GC content, betaine was added to the reaction system. A series of gradients were set for the amount of betaine in the system: 5 μL, 3.5 μL, 2.5 μL, 1.5 μL, and 0 μL.

[0090] The detection results are shown in Figures 1-5. When the amount of betaine in the two-channel system was 5 μL, both Giardia lamblia and Cryptosporidium samples showed amplification, with earlier peak times and higher fluorescence values. Therefore, the amount of betaine in the system was set at 5 μL. The reaction system after adding betaine is shown in Table 12 below.

[0091] Table 12

[0092] Example 4

[0093] Validation of the specificity of the reaction system.

[0094] Specificity tests were performed on the detection system established in Example 3. Eggs of Giardia lamblia, Cryptosporidium, Schistosoma japonicum, Clonorchis sinensis, Cryptosporidium microsporidium, and Ascaris lumbricoides were provided by the Key Laboratory of Parasitic Diseases Prevention and Control Technology of the National Health Commission. Shigella and Salmonella were provided by the laboratory of Jiangsu Qitian Gene Biotechnology Co., Ltd. Nucleic acid extraction was performed using a commercially available tissue nucleic acid extraction kit (Tiangen Biotech Co., Ltd.).

[0095] The detection results are shown in Figure 6. Except for Giardia and Cryptosporidium, which showed nucleic acid amplification, the nucleic acids of other insects did not amplify. Therefore, the single-tube double-pass reaction system established using Giardia and Cryptosporidium primers and probes has good specificity and can be used for the simultaneous detection of Giardia and Cryptosporidium.

[0096] Example 5

[0097] Sensitivity verification of the reaction system.

[0098] The sensitivity of the detection system established in Example 3 was studied using Giardia lamblia and Cryptosporidium plasmids at concentrations of 10 copies / μL, 100 copies / μL, and 1000 copies / μL.

[0099] As shown in Figure 7, the detection sensitivity for both Giardia lamblia and Cryptosporidium reached 100 copies / test.

[0100] Example 6

[0101] Verification of competitive reactions in the reaction system.

[0102] Giardia and Cryptosporidium plasmids were prepared into a mixed sample for a competitive study against the detection system established in Example 3. The concentrations of the mixed sample are shown in Table 13 below.

[0103] Table 13

[0104] The test results are shown in Figure 8. As can be seen from the figure, when the Cryptosporidium plasmid concentration is 10... 5During copy / testing, the detection sensitivity of Giardia lamblia can reach 100 copies / test; the Giardia lamblia plasmid concentration is 10. 5 During the copy / test, the detection sensitivity of Cryptosporidium can reach 100 copies / test, indicating that Giardia lamblia and Cryptosporidium do not compete for a response in this detection system.

[0105] Example 7

[0106] Validation of Giardia lamblia and Cryptosporidium samples.

[0107] Nucleic acid was extracted from Cryptosporidium oocysts and Giardia lamblia trophozoites to validate the detection system in Example 3.

[0108] As shown in Figure 9, the nucleic acids of both parasites were simultaneously amplified in the detection system.

[0109] Example 8

[0110] Verification using samples from simulated tap water.

[0111] (1) Sample preparation: 20L of source water was collected, and 1, 5, 10 and 20 Cryptosporidium oocysts / Giardia cysts (provided by Jiangsu Provincial Institute of Parasitic Diseases) were added respectively; 100L of drinking water was collected, and 10, 20, 40 and 50 Cryptosporidium oocysts / Giardia cysts (provided by Jiangsu Provincial Institute of Parasitic Diseases) were added respectively.

[0112] (2) Filtration and enrichment: Use special equipment and filter membranes to concentrate water.

[0113] (3) Nucleic acid extraction: Nucleic acid extraction was performed according to the tissue nucleic acid extraction kit (Tiangen Biotech Co., Ltd.).

[0114] (4) Nucleic acid detection: The extracted nucleic acid was detected using the detection system in Example 3.

[0115] The test results are shown in Figures 10 and 11. Five Giardia and Cryptosporidium were detected in 20L of source water; ten Giardia and Cryptosporidium were detected in 100L of drinking water.

[0116] In summary, this application achieves highly sensitive specific amplification, which can effectively detect Giardia lamblia and Cryptosporidium in drinking water in my country at present. It is simple to operate, efficient, low in cost, and suitable for rapid on-site detection platforms.

[0117] The applicant declares that this application illustrates the detailed method of this application through the above embodiments, but this application is not limited to the above detailed method, that is, it does not mean that this application must rely on the above detailed method to be implemented. Those skilled in the art should understand that any improvements to this application, equivalent substitutions of the raw materials of this application's product, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of this application.

Claims

1. Primers and probes for simultaneous detection of Giardia and Cryptosporidium in a tube, wherein, The nucleic acid sequence of the primer comprises the sequence shown in SEQ ID NO. 1-4; the nucleic acid sequence of the probe comprises the sequence shown in SEQ ID NO. 5-6.

2. The primers and probes according to claim 1, wherein, The 5' end of the probe is 25-30 bp away from the fluorescent reporter group, and the 3' end is 15-20 bp away from the quencher group.

3. The primers and probes according to claim 1, wherein, The fluorescent group comprises any one or a combination of at least two of FAM, HEX or ROX; Preferably, the quencher group comprises any one or a combination of at least two of BHQ1, BHQ2 or MGB.

4. Use of the primer and probe for simultaneous detection of Giardia and Cryptosporidium in a tube according to any one of claims 1-3 in the preparation of a product for detecting Giardia and Cryptosporidium.

5. A kit for detecting Giardia and Cryptosporidium, comprising the primer and probe for simultaneous detection of Giardia and Cryptosporidium in a tube according to any one of claims 1-3.

6. Use of the primer and probe for simultaneous detection of Giardia and Cryptosporidium in a tube according to any one of claims 1-3 in the detection of Giardia and Cryptosporidium.

7. A method for detecting Giardia and Cryptosporidium for non-disease diagnosis and / or treatment purposes, comprising: extracting DNA from a sample to be tested as a template, and performing recombinase-mediated isothermal nucleic acid amplification using the primer and probe for simultaneous detection of Giardia and Cryptosporidium in a tube according to any one of claims 1-3, and judging according to the fluorescence value slope after isothermal nucleic acid amplification.

8. The method of claim 7, wherein, The criterion for judging is that when the fluorescence value slope is ≥20, the sample to be tested is determined to be positive; when the fluorescence value slope is <20, the sample to be tested is determined to be negative.

9. The method of claim 7 or 8, wherein, The primer comprises an HPLC purified primer.

10. The method of any one of claims 7-9, wherein, The reaction system of the isothermal nucleic acid amplification comprises the primer and probe for simultaneous detection of Giardia and Cryptosporidium in a tube according to any one of claims 1-3, betaine, Tris buffer, magnesium acetate, potassium acetate, polyethylene glycol, dithiothreitol, creatine phosphate, ATP, dNTPs, single-strand binding protein, recombinase, UvsY protein, DNA polymerase, Cryptosporidium genome and Giardia genome, and the total reaction system is 40-60 μL; Preferably, the concentration of the primer for detecting Giardia in the primer and probe for detecting Giardia and Cryptosporidium is 400-450 nmol / L, and the concentration of the probe for detecting Giardia is 100-150 nmol / L; Preferably, the concentration of the primer for detecting Cryptosporidium in the primer and probe for detecting Giardia and Cryptosporidium is 400-450 nmol / L, and the concentration of the probe for detecting Cryptosporidium is 100-150 nmol / L; Preferably, the concentration of the betaine is 4-10 M.

11. The method of any one of claims 7-10, wherein, The sample to be tested comprises drinking water and / or source water.

Images