Pyrrolysyl-trna synthetase mutant and use thereof

Abstract

Provided are a pyrrolysyl-tRNA synthetase mutant and the use thereof. The pyrrolysyl-tRNA synthetase mutant provided by the present invention has a higher recognition and catalytic efficiency for unnatural amino acids, such that the expression efficiency of a recombinant protein is increased by 230-380%, which is beneficial for reducing the production cost of the recombinant protein and realizing large-scale production of the recombinant protein.

Description

Pyrrolysine aminoacyl-tRNA synthetase mutants and uses thereof TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a pyrrolysine aminoacyl-tRNA synthetase mutant, a corresponding expression vector and uses, and a method for preparing a recombinant protein containing unnatural amino acids. BACKGROUND

[0002] Genetic code expansion (GCE) has made remarkable achievements in the past two decades and is increasingly widely used in the field of biotechnology. The basic applications of GCE include protein structure and function analysis, interaction ligand discovery, post-translational modification simulation, enzyme activity regulation, protein function regulation, and live cell imaging, etc. In drug research, GCE is applied in the development of antibody conjugate drugs (ADC), bispecific antibodies (BsAb), chimeric antigen receptor T cells (CAR-T), vaccines, and long-acting protein drugs. Among them, ADC drugs using GCE technology have more uniform and stable physicochemical properties, and ADC projects targeting HER2, PSMA, CD70, FolRα, etc. have entered the clinical research stage. It can be seen that introducing unnatural amino acids into protein drugs using GCE technology has very important and broad application potential.

[0003] A non-natural amino acid NPAK is disclosed in a Chinese patent (CN113582881B), and its structural formula is shown as formula (I):

[0004] In the patent, the pyrrolysine aminoacyl tRNA synthetase of Methanosarcina barkeri (abbreviated as MbPylRS) is used to realize the site-directed introduction of NPAK in recombinant human growth hormone. However, in practical application, there are still disadvantages such as limited activity of MbPylRS in recognizing NPAK and low yield of target protein, high cost in commercial large-scale production, and difficulty in controlling product quality.

[0005] Therefore, it is necessary to develop an aminoacyl tRNA synthetase mutant that can efficiently recognize NPAK. SUMMARY

[0006] The purpose of the present application is to provide a pyrrolysine aminoacyl-tRNA synthetase mutant that can efficiently recognize NPAK, its encoding nucleic acid molecule, a corresponding expression vector and uses, so as to solve the problem of low activity of natural aminoacyl-tRNA synthetase in recognizing NPAK in the prior art.

[0007] The pyrrolysine aminoacyl-tRNA synthetase mutant provided by the present application is a mutant of the wild-type pyrrolysine aminoacyl-tRNA synthetase of Methanomethylophilus alvus (MaPylRS, the amino acid sequence of which is shown as SEQ ID NO: 1, and the Sequence ID in NCBI is WP_015505008.1), which is obtained by mutating an amino acid residue in the wild-type pyrrolysine aminoacyl-tRNA synthetase of Methanomethylophilus alvus.

[0008] Specifically, in the first aspect, the present application provides a pyrrolysine aminoacyl-tRNA synthetase mutant, which is a mutant of the pyrrolysine aminoacyl-tRNA synthetase shown in SEQ ID NO: 1, obtained by replacing the amino acid residues at positions 126 and / or 129 in the amino acid sequence of the pyrrolysine aminoacyl-tRNA synthetase with the following amino acids:

[0009] the tyrosine at position 126 is replaced with alanine;

[0010] the methionine at position 129 is replaced with leucine.

[0011] In some embodiments, the pyrrolysine aminoacyl-tRNA synthetase mutant is a mutant obtained by replacing the tyrosine at position 126 in the amino acid sequence of the pyrrolysine aminoacyl-tRNA synthetase shown in SEQ ID NO: 1 with alanine.

[0012] In some embodiments, the pyrrolysine aminoacyl-tRNA synthetase mutant is a mutant obtained by replacing the methionine at position 129 in the amino acid sequence of the pyrrolysine aminoacyl-tRNA synthetase shown in SEQ ID NO: 1 with leucine.

[0013] In some embodiments, the pyrrolysine aminoacyl-tRNA synthetase mutant is a mutant obtained by replacing the tyrosine at position 126 in the amino acid sequence of the pyrrolysine aminoacyl-tRNA synthetase shown in SEQ ID NO: 1 with alanine, and the methionine at position 129 is replaced with leucine.

[0014] In some embodiments, the amino acid substitution further comprises one, two, three, four, five, six, seven, eight, or nine amino acid residue substitutions in the amino acid sequence of the pyrrolysine aminoacyl-tRNA synthetase set forth in SEQ ID NO: 1 at positions 168, 227, 228, 229, 230, 233, 235, 239, and 241, in addition to the amino acid substitution at position 126 and / or position 129 described above.

[0015] In some preferred embodiments, the amino acid substitution further comprises one, two, three, four, five, six, seven, eight, or nine amino acid residue substitutions in the amino acid sequence of the pyrrolysine aminoacyl-tRNA synthetase set forth in SEQ ID NO: 1 at positions 168, 227, 228, 229, 230, 233, 235, 239, and 241, in addition to the amino acid substitution at position 126 and / or position 129 described above, which are:

[0016] a valine at position 168 to an arginine, a methionine, an alanine, a threonine, a glycine, or a cysteine;

[0017] a histidine at position 227 to an asparagine, a tyrosine, a phenylalanine, or a threonine;

[0018] a tyrosine at position 228 to a phenylalanine, a proline, or a tryptophan;

[0019] a leucine at position 229 to a glycine, an alanine, a valine, or an isoleucine;

[0020] an aspartic acid at position 230 to a tyrosine or a phenylalanine;

[0021] a histidine at position 233 to a glycine, a valine, a leucine, or an isoleucine;

[0022] a valine at position 235 to a lysine, a glutamine, a threonine, a leucine, a glycine, or an isoleucine;

[0023] a tryptophan at position 239 to a proline, a phenylalanine, or an arginine;

[0024] a glycine at position 241 to a serine, a cysteine, or a leucine.

[0025] In some embodiments, the pyrrolysine aminoacyl-tRNA synthetase mutant comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 2 to SEQ ID NO: 26.

[0026] In a second aspect, the present application provides a nucleic acid molecule encoding the pyrolysyl aminoacyl-tRNA synthetase mutant.

[0027] In some embodiments, the nucleic acid molecule comprises or consists of a sequence as set forth in SEQ ID NO: 48 to SEQ ID NO: 72.

[0028] In a third aspect, the present application provides an expression vector comprising the nucleic acid molecule of the present application, which is capable of producing the pyrolysyl aminoacyl-tRNA synthetase mutant of the present application in a host cell into which the expression vector is introduced.

[0029] In a fourth aspect, the present application provides a host cell transformed with the expression vector of the present application.

[0030] In some embodiments, the host cell is a prokaryotic cell or a eukaryotic cell. The prokaryotic cell can be, for example, Escherichia coli, Bacillus subtilis, Pseudomonas putida, etc. The eukaryotic cell can be, for example, Saccharomyces cerevisiae, Schizosaccharomyces pombe, etc. of the yeast class, and COS cell, CHO cell, HEK293 cell, BHK cell, etc. of the mammalian cell. The transformation method can be performed by, for example, a known method such as a method using calcium ions, DEAE dextran method, electroporation method, etc.

[0031] In a fifth aspect, the present application provides use of the pyrolysyl aminoacyl-tRNA synthetase mutant of the present application in the production of a recombinant protein comprising an unnatural amino acid.

[0032] In some embodiments, the pyrolysyl aminoacyl-tRNA synthetase mutant introduces an unnatural amino acid into a protein to obtain a recombinant protein comprising an unnatural amino acid.

[0033] In some preferred embodiments, the pyrolysyl aminoacyl-tRNA synthetase mutant introduces an unnatural amino acid into a specific site of a protein.

[0034] In some preferred embodiments, the pyrolysyl aminoacyl-tRNA synthetase mutant specifically introduces an unnatural amino acid NPAK into a specific site of a protein, the structural formula of which is shown as formula (I):

[0035] In some embodiments, the recombinant protein is a recombinant human IL-2, the amino acid sequence of which is shown as SEQ ID NO: 32, comprising an unnatural amino acid NPAK at the 45th site; preferably, the cysteine at the 125th site of the recombinant human IL-2 is replaced with serine.

[0036] In a sixth aspect, the present application provides a method for preparing a recombinant protein comprising an unnatural amino acid, which comprises: expressing a gene encoding a protein in a cell or a cell extract in the presence of the pyrrolysine aminoacyl-tRNA synthetase mutant and the MatRNA, to obtain the recombinant protein comprising the unnatural amino acid.

[0037] In some preferred embodiments, the recombinant protein incorporates the unnatural amino acid at a specific site, and a codon corresponding to the specific site in the gene encoding the protein is replaced by an amber codon.

[0038] In some preferred embodiments, the sequence of the MatRNA is shown in SEQ ID NO: 28.

[0039] In some preferred embodiments, the recombinant protein incorporates NPAK at a specific site, and a codon corresponding to the specific site in the gene encoding the protein is replaced by an amber codon; the structural formula of the NPAK is shown in formula (I):

[0040] In some embodiments, the recombinant protein is a protein capable of being used as a drug.

[0041] In some embodiments, the recombinant protein is recombinant human IL-2, the amino acid sequence of which is shown in SEQ ID NO: 32, and the recombinant human IL-2 comprises an unnatural amino acid NPAK at the 45th site; preferably, the cysteine at the 125th site of the recombinant human IL-2 is replaced by a serine.

[0042] The present application designs and constructs a MaPylRS mutant molecule library of 100 million by simulating and calculating the molecular structure of MaPylRS and NPAK, and obtains multiple pyrrolysine aminoacyl-tRNA synthetase mutants specific for NPAK through high-throughput multi-step screening. The pyrrolysine aminoacyl-tRNA synthetase mutant provided by the present application has a more efficient recognition and catalytic efficiency for unnatural amino acids, especially NPAK, compared with the existing wild-type pyrrolysine aminoacyl-tRNA synthetase (MbPylRS), so that the host cell (such as E. coli or mammalian cell) expressing the mutant can express the recombinant protein with NPAK at a high level, and the expression efficiency is increased by 230% to 380%, which plays an important role in reducing the production cost of recombinant proteins and realizing large-scale commercial production of recombinant proteins. BRIEF DESCRIPTION OF DRAWINGS

[0043] Figure 1 is a map of the methylotrophic methanobacterium pyrrolysine aminoacyl-tRNA synthetase (MaPylRS) expression vector in Example 1 of the present application;

[0044] Figure 2 is a schematic diagram of MaPylRS mutant and MbPylRS activity verification report plasmids pQ4-EGFP150*-MatRNA and pQ4-EGFP150*-MbtRNA in Example 3 of the present application;

[0045] Figure 3 shows the relative fluorescence intensity of prokaryotic cells with MaPylRS mutants and MbPylRS in Example 3 of the present application;

[0046] Figure 4 is a SDS-PAGE electrophoresis map of the fermentation product obtained after adding non-natural amino acid (NPAK) to the rhIL-2 expression strain in Example 4 of the present application;

[0047] Figure 5 is a mass spectrum of rhIL-2 protein with NPAK introduced at position 45 in Example 4 of the present application;

[0048] Figure 6 is a fluorescence map of eukaryotic cells with MaPylRS mutants and MbPylRS in Example 5 of the present application. DETAILED DESCRIPTION

[0049] The present application is further described below through specific examples, and the examples described in the present application are only used to illustrate the present application and do not limit the scope of the present application.

[0050] The present application obtains a high-efficiency pyrrolysine aminoacyl-tRNA synthetase mutant for NPAK through rational design and high-throughput screening, and realizes high-efficiency insertion of NPAK at a specified position of a protein in mammalian cells and Escherichia coli using the mutant. The present application is further described below through specific experimental operations.

[0051] In a first step, at least one or a plurality of amino acid residues in the 126th, 129th, 168th, 227th, 228th, 229th, 230th, 233rd, 235th, 239th, and 241st amino acid sequences of the wild-type methylotrophic methanobacterium pyrrolysine aminoacyl-tRNA synthetase (MaPylRS, SEQ ID NO: 1) are selected as mutation sites, and a mutation library is constructed based on the mutation sites.

[0052] The mutation sites are selected from the amino acid residues in the wild-type MaPylRS amino acid sequence that interact with the substrate pyrrolysine Pyl.

[0053] Second step, screening MaPylRS mutant library using unnatural amino acid NPAK and obtaining specific and efficient mutant MaPylRS;

[0054] Third step, expressing target protein containing unnatural amino acid NPAK in E. coli and mammalian cells using mutant MaPylRS and corresponding MatRNA.

[0055] Example 1: Construction of aminoacyl-tRNA synthetase mutant library

[0056] (1) Construction of plasmid pQ3-MaPylRS containing wild-type methanopyrus sulfurimus pyrrolysine aminoacyl-tRNA synthetase (MaPylRS):

[0057] The nucleotide sequence encoding MaPylRS is shown in SEQ ID NO: 27. The gene sequence was synthesized by Suzhou Jinyuzhi Biotechnology Co., Ltd. and cloned by PCR, and inserted into the pBK-JYRS plasmid backbone (Proc Natl Acad Sci USA. 2002 Aug 20; 99(17): 11020-4) using NdeI / PstI enzyme to construct plasmid pQ3-MaPylRS. The plasmid map is shown in Figure 1. The plasmid mainly consists of GlnRS promoter, MaPylRS, GlnRS terminator, ColE1 replication initiation site, and kanamycin (Kan) resistance gene.

[0058] The cloning primers are as follows:

[0059] Ma1-F: gtttacgctttgaggaatcccatatgactgtaaaatatac (SEQ ID NO: 34)

[0060] Ma1-R: tttagcgtttgaaactgcagttagttgatcttcgcgccgt (SEQ ID NO: 35)

[0061] (2) Construction of MaPylRS mutant library

[0062] The mutant library was constructed using the pQ3-MaPylRS plasmid as the template and the degenerate primer NNK. In the first round, the library fragment containing the first site-saturation mutation was amplified by PCR, and then the library fragment was used to replace the wild-type MaPylRS fragment in the template plasmid by enzyme digestion and ligation. In the second round, the mutant plasmid from the previous round was used as the template for amplification and replacement. After 5 rounds (5 mutation sites were 168, 126+129, 227+228+229+230, 233+235, 239+241), the library mutation position gradually increased, and finally a library containing all the designed mutation positions (MaPylRS positions 126, 129, 168, 227, 228, 229, 230, 233, 235, 239, 241) was prepared. In theory, each mutation position contains 32 possible codes. 1000 clones were randomly selected from the library and verified by sequencing, and the MaPylRS mutant sequences of all clones were different, thus determining that the library diversity was qualified. The final library plasmid containing all MaPylRS mutants was named pMa. (Library construction method see ChemBioChem. 2013 Nov 4; 14(16): 2100-5).

[0063] Example 2: Screening of pyrrolysine aminoacyl-tRNA synthetase mutants with site-directed introduction of NPAK

[0064] In this example, the MaPylRS random saturation mutant library plasmid pMa constructed in Example 1 was respectively co-transformed with the positive screening plasmid pREP-MatRNA Pyl into E. coli DH10B for positive screening, and then co-transformed with the negative screening plasmid pYOBB2-MatRNA Pyl into E. coli DH10B for negative screening (see ACS Chem Biol. 2022 Dec 16; 17(12): 3458-3469 for material and method principles), and the specific steps are as follows:

[0065] (1) Construction of E. coli DH10B positive screening competent cells containing screening plasmid pREP-MatRNA Pyl (with tetracycline (Tet) resistance gene, MatRNA gene, chloramphenicol resistance gene (CAT) containing amber stop codon (TAG), and green fluorescent protein gene (GFP) containing amber stop codon (TAG)), and the screening plasmid pREP-MatRNA PylTransform into DH10B chemically competent cells, coat on 12.5 μg / ml Tet resistance plate 37℃ incubator culture overnight, inoculate into 50 mL 12.5 μg / mL Tet resistance LB culture medium, place 37℃ / 220 rpm constant temperature shaker culture overnight. The next day, 1:10 expansion culture to 1L 2xYT 37℃ / 220 rpm shaking culture OD600 reaches about 0.5, 4000xg, 4℃, centrifugal 10 min discard supernatant. Add 500 mL 4℃ pre-cooled 10% glycerol solution to fully blow suspension, 4000xg, 4℃, centrifugal 10 min discard supernatant, repeat the process once. Finally, the cells are divided into 100 μL / portion, liquid nitrogen quick frozen and stored at -80℃, which is pREP-MatRNA Pyl -DH10B electrocompetent cells.

[0066] (2) MaPylRS mutant screening, the constructed pMa library plasmid is electroporated into pREP-MatRNA Pyl -DH10B electrocompetent cells, all the bacterial liquid is transferred to coat on Kan (kanamycin, 50 μg / mL), Tet (tetracycline, 25 μg / mL), Cm (chloramphenicol, 50 μg / mL), NPAK (1 mM), L-arabinose (0.2%) LB solid medium plate, 37℃ constant temperature incubator upside down culture for 48h, collect bacterial cells (with MaPylRS mutant recognizing NPAK and natural amino acids, can read CAT gene with TAG, produce chloramphenicol resistance) to extract plasmid.

[0067] (3) Construct pYOBB2-MatRNA Pyl (contains chloramphenicol (Cm) resistance gene, MatRNA gene, and barnase toxic protein gene containing amber stop codon (TAG)) E. coli DH10B negative screening competent cells, after one round of positive screening pMa library plasmid is electroporated into pYOBB2-MatRNA Pyl -DH10B electrocompetent cells, coat on 25 μg / mL Cm, 50 μgμg / mL Kan and 0.2% arabinose LB solid medium plate, 37℃ constant temperature incubator upside down culture overnight, collect bacterial cells (with MaPylRS mutant only recognizing NPAK, otherwise it will read barnase toxic protein gene, bacteria death), extract plasmid.

[0068] The pMa library plasmid was repeatedly subjected to multiple rounds of positive-negative alternating screening, and finally 65 candidate clones were selected on the positive screening plate, and all were subjected to sequencing analysis. Sequencing primer Ma6-F: gacggcggctttgttgaata (SEQ ID NO: 36); Ma6-R: cgaagcggaattaattcgcg (SEQ ID NO: 37). Based on the sequencing results, 25 different aminoacyl tRNA synthetase mutants that can specifically recognize NPAK were obtained, which were named RA1-RA25, and the amino acid sequences thereof are shown in SEQ ID NO: 2 to SEQ ID NO: 26, respectively.

[0069] Example 3: Test the efficiency of MaPylRS mutants in a prokaryotic expression system

[0070] In this example, enhanced green fluorescent protein (EGFP) was used as a reporter gene, and the ratio of the fluorescence value of EGFP with NPAK to the cell concentration OD600 in E. coli DH10B was detected to reflect the improvement of the recognition activity of MaPylRS mutants compared to MbPylRS for NPAK in prokaryotic cells.

[0071] (1) Construction of verification plasmids pQ4-EGFP150*-MatRNA and pQ4-EGFP150*-MbtRNA

[0072] The plasmids pQ4-EGFP150*-MatRNA and pQ4-EGFP150*-MbtRNA are shown in FIG. 2 and mainly include an EGFP150* gene driven by an arabinose promoter (araBAD promoter), a MatRNA (SEQ ID NO: 28) or MbtRNA (SEQ ID NO: 29) gene driven by a proK promoter, and a chloramphenicol resistance gene. The amino acid sequence of the EGFP150* gene is shown in SEQ ID NO: 30, and the codon of the 150th amino acid (non-natural amino acid NPAK introduction site, represented by X) is replaced with an amber codon (TAG). The EGFP150* gene fragment was synthesized by Suzhou Genewiz Biotechnology Co., Ltd., PCR amplified using primers EG-F / EG-R, BglII / SalI digested, and T4 ligated to the pEVOL-pAzF plasmid backbone (Addgene, Cat#31186) to obtain the plasmid pQ4-EGFP150*. The pQ4-EGFP150* plasmid was used as a template, and primers Mat-s / Mat-as and Mbt-s / Mbt-as were used to PCR amplify the pQ4-EGFP150*-MatRNA and pQ4-EGFP150*-MbtRNA gene fragments, respectively, and q5 site-directed mutation kits (NEB, Cat#E0554) were used to obtain the plasmids pQ4-EGFP150*-MatRNA and pQ4-EGFP150*-MbtRNA.

[0073] The primers are as follows:

[0074] EG-F: ggaattaaccatggtgagcaaaggcgaagaactg (SEQ ID NO: 38)

[0075] EG-R: caaaacagccaagcttttaatgatgatgatgatgatgtttgtacagttcatc (SEQ ID NO: 39)

[0076] Mat-s: ctagccagcggggttcgacgccccggtctctcgccaaattcgaaaagcctgctcaac (SEQ ID NO: 73)

[0077] Mat-as: gttttagagacccgctggtcgccggaccgtcccccaatgcggggcgcatc (SEQ ID NO: 74)

[0078] Mbt-s: atttagagtccattcgatctacatgatcaggtttccaattcgaaaagcctgctcaac (SEQ ID NO: 75)

[0079] Mbt-aS: ccgttcagccgggttagattcccggggtttccgccaaatgcggggcgcatc (SEQ ID NO: 76)

[0080] (2) MaPylRS mutant and MbPylRS recognition of unnatural amino acid NPAK activity comparison

[0081] MaPylRS mutants RA1-RA25 and pQ4-EGFP150*-MatRNA were co-transfected into E. coli DH10B, and MbPylRS and pQ4-EGFP150*-MbtRNA were co-transfected into E. coli DH10B in Example 2. 100 μl of each was plated on 50 μg / mL Kan, 25 μg / mL Cm resistant LB solid medium plate, and placed in a 37°C constant temperature incubator upside down and cultured overnight. The next day, the co-transfected strains were picked and inoculated into 3 mL of 50 μg / mL Kan, 25 μg / mL Cm resistant LB medium, and placed in a 37°C / 220 rpm constant temperature shaker for overnight culture. On the third day, 1:100 was expanded into 2 mL of 50 μg / mL Kan, 25 μg / mL Cm resistant LB medium and cultured to OD600≈0.5, and then arabinose inducer and unnatural amino acid NPAK were added, wherein the experimental group: Kan (50 μg / mL), Cm (25 μg / mL), NPAK (1 mM), L-arabinose (0.15%); the blank group: Kan (50 μg / mL), Cm (25 μg / mL), L-arabinose (0.15%), and placed in a 37°C / 220 rpm constant temperature shaker for 16 h. Finally, the bacterial cells in each group were washed with PBS three times, resuspended in equal volume, and 200 μl was taken to measure the fluorescence value (excitation wavelength 488 nm, emission wavelength 502 nm) using a microplate reader. At the same time, each bacterial cell was diluted 1:10 with PBS, and the OD600 of the corresponding bacterial solution was measured using a Nanodrop 2000. The fluorescence value was divided by the OD600 to obtain the relative fluorescence ratio (as shown in Figure 3).

[0082] The results show that the MaPylRS mutants RA1-RA25 have 2.3-3.8 times higher recognition activity of unnatural amino acid NPAK than the original MbPylRS used in the prior art in terms of EGFP fluorescence ratio. Therefore, it can be seen that the MaPylRS mutants screened in the present application have significantly improved recognition activity of NPAK in E. coli.

[0083] Example 4: Test the orthogonality and specificity of MaPylRS mutants

[0084] In this example, recombinant human IL-2 containing NPAK was expressed in E. coli DH10B with recombinant human IL-2 as a reporter gene and purified, and mass spectrometry identification was used to verify that MaPylRS mutants specifically introduced NPAK in medicinal proteins.

[0085] The mature amino acid sequence of human interleukin 2 (as shown in SEQ ID NO: 31) was obtained from the National Center for Biotechnology Information database, the codon of tyrosine (Y) at position 45 of the amino acid sequence was mutated to amber codon (TAG) for insertion of unnatural amino acid, and the codon of cysteine at position 125 was mutated to serine codon (the cysteine at position 125 does not participate in the formation of disulfide bond, but will interfere with the formation of normal disulfide bond in the refolding process of recombinant human IL-2 protein inclusion body, after mutation, the efficiency of refolding can be improved without significantly affecting its activity), in order to express recombinant protein in E. coli, methionine Met was added at the N-terminus of the protein sequence to initiate protein translation, and finally the amino acid sequence of recombinant human IL-2 (SEQ ID NO: 32, X represents an unnatural amino acid) was obtained. The complete DNA sequence of the gene sequence IL2-45* (SEQ ID NO: 33) of recombinant human IL-2 was synthesized by whole gene synthesis.

[0086] (1) In this example, RA2 mutant was selected as a representative, and primer RA2-F / RA2-R was used for PCR amplification to obtain RA2 linear gene fragment, and BglII / SalI was used for cloning into helper plasmid pEVOL-pAcFRS.2.t1 (Addgene, Cat#73544), and finally plasmid pEVOL-RA2 was obtained.

[0087] The cloning primers are as follows:

[0088] RA2-F: aggaggaattagatctatgactgtaaaatatacagatgc (SEQ ID NO: 40)

[0089] RA2-R: ttaaacgtcgacttagttgatcttcgcgc (SEQ ID NO: 41)

[0090] In this embodiment, pBad-IL2-45* is used to express IL2 with NPAK. Construction of pBad-IL2-45*: pBad / HisA (Invitrogen, item number V430-01) vector is double-enzymatically cut by NcoI / HindIII, and the linearized vector pBad-NcoI-HindII is obtained after gel recovery. The IL2-45* gene fragment amplified by PCR using primers IL2-F / IL2-R is double-enzymatically cut by NcoI / HindIII and T4 ligated to pBad-NcoI-HindII to obtain the target plasmid pBad-IL2-45*.

[0091] The cloning primers are as follows:

[0092] IL2-F: ggaattaaccatggcgcctacatccagctcga (SEQ ID NO: 42)

[0093] IL2-R: aacagccaagcttttaggtcagcgtgctaataatg (SEQ ID NO: 43)

[0094] (2) Co-transform pEVOL-RA2 and pBad-IL2-45* plasmid into E. coli DH10B chemically competent cells, and plate on 100 μg / mL Amp, 25 μg / mL Cm resistant LB solid medium plates and place in a 37°C incubator overnight. Pick the co-transformed strain, inoculate 3 mL of 100 μg / mL Amp, 25 μg / mL Cm resistant LB medium, and place in a 37°C / 220 rpm incubator overnight. The next day, preserve and name the strain IL2(NPAK)-10B.

[0095] Inoculate IL2(NPAK)-10B expression strain into 1 L of 100 μg / mL Amp, 25 μg / mL Cm resistant 2xYT medium, and culture at 37°C / 220 rpm until the OD600 of the bacterial solution is 0.8. Add 0.2% arabinose and 1 mM NAPK to the experimental group to a final concentration, and set up a negative group with only 0.2% arabinose added to a final concentration. Culture at 37°C / 220 rpm for 8 hours to induce expression.

[0096] Take 1 mL of each of the above bacterial solutions, centrifuge at 10,000 rpm for 1 min, resuspend in PBS to an OD600 of 10, and take each bacterial suspension for SDS-PAGE electrophoresis. The SDS-PAGE electrophoresis map of the strain is shown in FIG. 4. The results in FIG. 4 show that the expression strain can only express full-length target protein when non-natural amino acid NPAK is added.

[0097] The collected bacteria were resuspended with resuspension buffer (25 mM Tris, 6 mM EDTA, 1 mM DTT, pH 8.0), 1% DNase (1 mg / mL), and 0.5% PMSF, and mixed uniformly. The mixture was homogenized at a pressure of 50-80 MPa for 3 times using an ultrahigh pressure homogenizer. The homogenate was centrifuged at 10,000 rpm for 20 min, and the lower inclusion body crude was collected. The obtained inclusion body crude was washed twice with washing buffer (20 mM Tris-HCl, 100 mM NaCl, 2% Triton X-100, pH 8.0), and once with ultrapure water to obtain purified inclusion bodies. The purified inclusion bodies were dissolved with denaturing buffer (20 mM Tris-HCl, 100 mM NaCl, 6 M guanidine hydrochloride, 1 mM DTT, pH 8.0), and centrifuged at 10,000 rpm after 30 min to collect the supernatant as a denatured protein solution. Four times the volume of refolding buffer (20 mM Tris-HCl, 100 mM NaCl, pH 8.0) was added to the collected denatured protein solution, which was stirred thoroughly and then left to stand for 12 h. The supernatant was collected by centrifugation at 10,000 rpm to obtain a refolded protein solution. The refolded protein solution was concentrated to 1 / 4 of the original volume using an ultrafiltration membrane (Millipore, Biomax-5) with a molecular weight cut-off of 5 kDa. The solution was replaced with displacement buffer (20 mM citric acid-sodium citrate buffer, pH 4.0), and further concentrated to a protein concentration of about 2.0 mg / mL. The supernatant was collected by centrifugation at 10,000 rpm, and 1 mL was aliquoted and stored at -80°C to obtain rhIL2-NPAK. The rhIL2-NPAK sample was sent for liquid chromatography-mass spectrometry identification. The theoretical molecular weight of methionine-containing rhIL2-NPAK was 15656.09, and the theoretical molecular weight of methionine-free rhIL2-NPAK was 15524.82. The main components identified by RP-HPLC liquid chromatography-mass spectrometry had molecular weights of 15656.25 and 15524.75, respectively, which were consistent with the theoretical molecular weights of methionine-containing rhIL2-NPAK and methionine-free rhIL2-NPAK (as shown in FIG. 5).

[0098] As can be seen from FIG. 5, the RA2 mutant can specifically introduce the unnatural amino acid NPAK into the specified position of the target protein, and cannot introduce the natural amino acid into the target protein, and has good orthogonality.

[0099] Correspondingly, the RA1, RA3-RA25 mutants were respectively verified in a manner similar to the present embodiment, and the results showed that these mutants can specifically introduce the unnatural amino acid NPAK into the specified position of the target protein, and cannot introduce the natural amino acid into the target protein, and have good orthogonality.

[0100] Example 5: Testing MaPylRS mutants in a eukaryotic expression system

[0101] This embodiment takes EGFP as a reporter gene, and the expression level of NPAK-EGFP in eukaryotic cells is reflected by detecting the fluorescence intensity. The catalytic efficiency of MaPylRS mutants in recognizing NPAK in eukaryotic cells is compared and verified to be improved compared with the original MbPylRS.

[0102] (1) In this embodiment, the RA2 mutant is selected, the RA2 linear gene fragment is obtained by PCR amplification using primers RA2-F1 / RA2-R1, and the homologous recombination (Novagen C112 kit) is used to clone into the helper plasmid pCMV-MbPylRS (Addgene, item #91706), to obtain the plasmid pCMV-RA2.

[0103] The cloning primers are as follows:

[0104] RA2-F1: aactgcacggaagcttgccaccatgactgtaaaatatacagat (SEQ ID NO: 44)

[0105] RA2-R1: agtcgaggctgatcagcgggtttagttgatcttcgcgccgtt (SEQ ID NO: 45)

[0106] The construction process of the expression plasmid pCDNA-EGFP150* is as follows: the pCDNA3.1(+) (GeneBank number #37680) vector is double enzyme cut using NotI and XhoI, and the linearized vector pCDNA3.1-NotI-XhoI is obtained after gel recovery. The EGFP150* gene fragment is PCR amplified using primers EG-F1 / EG-R1 (the EGFP150* amino acid sequence is shown in SEQ ID NO: 30, and the 150th amino acid (NPAK introduction site) is replaced with amber codon (TAG), represented by X), and is enzyme cut by NotI / XhoI, and is T4 ligated to pCDNA3.1-BamHI-EcoRI to obtain the plasmid pCDNA3.1-EGFP150*.

[0107] The cloning primers are as follows:

[0108] EG-F1: cacagtggcggccgccaccatggtgagctagggcgaagaactg (SEQ ID NO: 46)

[0109] EG-R1: tctagactcgagttatttgtacagttcatccataccga (SEQ ID NO: 47)

[0110] Chinese hamster ovary cells CHO-K1 (Cat. # CCL-61-ATC) were purchased from the American Type Culture Collection (ATCC) and adherently cultured using RPMI1640 medium containing 10% fetal bovine serum. The helper plasmids pCMV-MbPylRS and pCMV-RA2 from the above step were extracted using a endotoxin-free plasmid extraction kit, then mixed with a green fluorescent protein expression plasmid pCDNA3.1-EGFP150* respectively, and transiently co-transfected according to the instructions using lipo2000 transfection reagent (Invitrogen, Cat. # 12566014) (cells were seeded at a density of 50000 cells / well in a 24-well plate, and transfected 24h after seeding, 500ng plasmid per well), and 2h after transfection, 1mM NPAK was added to the experimental group, and no unnatural amino acid was added to the negative control group. After 48h of incubation in a carbon dioxide incubator, the cells were observed and photographed under a fluorescence microscope, and the results showed that the green fluorescence of the cells transfected with the RA2 plasmid was significantly stronger than that of the cells transfected with the MbPylRS plasmid (as shown in Figure 6). Thus, it can be seen that the MaPylRS mutant has significantly improved NPAK recognition activity in eukaryotic cells compared to MbPylRS.

[0111] Accordingly, the RA1, RA3-RA25 mutants were respectively verified in a similar manner as in the present embodiment, and the results showed that these mutants have significantly improved NPAK recognition activity in eukaryotic cells compared to MbPylRS.

[0112] Obviously, the above embodiments are merely examples for the purpose of clarity, and are not intended to limit the embodiments. Based on the above description, other different forms of changes or variations can also be made by those of ordinary skill in the art. Here, it is not necessary and impossible to exhaust all embodiments. The obvious changes or variations derived therefrom are still within the protection scope of the present application.

[0113] Sequence information:

[0114] Wild-type M. mazei pyrrolysyl aminoacyl-tRNA synthetase (SEQ ID NO: 1)

[0115] RA1 mutant (SEQ ID NO: 2)

[0116] RA2 mutant (SEQ ID NO: 3)

[0117] RA3 mutant (SEQ ID NO: 4)

[0118] RA4 mutant (SEQ ID NO: 5)

[0119] RA5 mutant (SEQ ID NO: 6)

[0120] RA6 mutant (SEQ ID NO: 7)

[0121] RA7 mutant (SEQ ID NO: 8)

[0122] RA8 mutant (SEQ ID NO: 9)

[0123] RA9 mutant (SEQ ID NO: 10)

[0124] RA10 mutant (SEQ ID NO: 11)

[0125] RA11 mutant (SEQ ID NO: 12)

[0126] RA12 mutant (SEQ ID NO: 13)

[0127] RA13 mutant (SEQ ID NO: 14)

[0128] RA14 mutant (SEQ ID NO: 15)

[0129] RA15 mutant (SEQ ID NO: 16)

[0130] RA16 mutant (SEQ ID NO: 17)

[0131] RA17 mutant (SEQ ID NO: 18)

[0132] RA18 mutant (SEQ ID NO: 19)

[0133] RA19 mutant (SEQ ID NO: 20)

[0134] RA20 mutant (SEQ ID NO: 21)

[0135] RA21 mutant (SEQ ID NO: 22)

[0136] RA22 mutant (SEQ ID NO: 23)

[0137] RA23 mutant (SEQ ID NO: 24)

[0138] RA24 mutant (SEQ ID NO: 25)

[0139] RA25 mutant (SEQ ID NO: 26)

[0140] Nucleotide sequence encoding MaPylRS (SEQ ID NO: 27)

[0141] MatRNA (SEQ ID NO: 28)

[0142] MbtRNA (SEQ ID NO: 29)

[0143] EGFP150* (SEQ ID NO: 30)

[0144] Homo sapiens mature IL-2 (SEQ ID NO: 31)

[0145] Recombinant human IL-2 (SEQ ID NO: 32)

[0146] Gene sequence of recombinant human IL-2 (SEQ ID NO: 33)

[0147] Nucleotide sequence encoding RA1 (SEQ ID NO: 48)

[0148] Nucleotide sequence encoding RA2 (SEQ ID NO: 49)

[0149] Nucleotide sequence encoding RA3 (SEQ ID NO: 50)

[0150] Nucleotide sequence encoding RA4 (SEQ ID NO: 51)

[0151] Nucleotide sequence encoding RA5 (SEQ ID NO: 52)

[0152] Nucleotide sequence encoding RA6 (SEQ ID NO: 53)

[0153] Nucleotide sequence encoding RA7 (SEQ ID NO: 54)

[0154] Nucleotide sequence encoding RA8 (SEQ ID NO: 55)

[0155] Nucleotide sequence encoding RA9 (SEQ ID NO: 56)

[0156] Nucleotide sequence encoding RA10 (SEQ ID NO: 57)

[0157] Nucleotide sequence encoding RA11 (SEQ ID NO: 58)

[0158] Nucleotide sequence encoding RA12 (SEQ ID NO: 59)

[0159] Nucleotide sequence encoding RA13 (SEQ ID NO: 60)

[0160] Nucleotide sequence encoding RA14 (SEQ ID NO: 61)

[0161] Nucleotide sequence encoding RA15 (SEQ ID NO: 62)

[0162] Nucleotide sequence encoding RA16 (SEQ ID NO: 63)

[0163] Nucleotide sequence encoding RA17 (SEQ ID NO: 64)

[0164] Nucleotide sequence encoding RA18 (SEQ ID NO: 65)

[0165] Nucleotide sequence encoding RA19 (SEQ ID NO: 66)

[0166] Nucleotide sequence encoding RA20 (SEQ ID NO: 67)

[0167] Nucleotide sequence encoding RA21 (SEQ ID NO: 68)

[0168] Nucleotide sequence encoding RA22 (SEQ ID NO: 69)

[0169] Nucleotide sequence encoding RA23 (SEQ ID NO: 70)

[0170] Nucleotide sequence encoding RA24 (SEQ ID NO: 71)

[0171] Nucleotide sequence encoding RA25 (SEQ ID NO: 72)

Claims

1. A pyrolysyl aminoacyl-tRNA synthetase mutant, which is a mutant of the enzyme obtained by amino acid substitution of the amino acid residue at position 126 and / or 129 in the amino acid sequence of the pyrolysyl aminoacyl-tRNA synthetase shown in SEQ ID NO: 1, the amino acid substitution being: substitution of tyrosine at position 126 with alanine; substitution of methionine at position 129 with leucine. Also included is amino acid substitution of one, two, three, four, five, six, seven, eight or nine of the amino acid residues at positions 168, 227, 228, 229, 230, 233, 235, 239 and 241 in the amino acid sequence of the pyrolysyl aminoacyl-tRNA synthetase shown in SEQ ID NO: 1; 2. The pyrrolysine aminoacyl-tRNA synthetase mutant of claim 1, wherein, Preferably, the amino acid substitution is: substitution of valine at position 168 with arginine, methionine, alanine, threonine, glycine or cysteine; substitution of histidine at position 227 with asparagine, tyrosine, phenylalanine or threonine; substitution of tyrosine at position 228 with phenylalanine, proline or tryptophan; substitution of leucine at position 229 with glycine, alanine, valine or isoleucine; substitution of aspartic acid at position 230 with tyrosine or phenylalanine; substitution of histidine at position 233 with glycine, valine, leucine or isoleucine; substitution of valine at position 235 with lysine, glutamine, threonine, leucine, glycine or isoleucine; substitution of tryptophan at position 239 with proline, phenylalanine or arginine; substitution of glycine at position 241 with serine, cysteine or leucine. The pyrolysyl aminoacyl-tRNA synthetase mutant comprises or consists of an amino acid sequence as shown in SEQ ID NO: 2 to SEQ ID NO:

26.

4. A nucleic acid molecule encoding a pyrolysyl aminoacyl-tRNA synthetase mutant; Preferably, the nucleic acid molecule comprises or consists of a sequence as shown in SEQ ID NO: 48 to SEQ ID NO:

72.

5. An expression vector comprising the nucleic acid molecule of claim 4, which is capable of producing the pyrolysyl aminoacyl-tRNA synthetase mutant of any one of claims 1 to 3 in a host cell into which the expression vector is introduced.

6. A host cell transformed with the expression vector of claim 5; Preferably, the host cell is a prokaryotic cell or a eukaryotic cell.

7. Use of the pyrolysyl aminoacyl-tRNA synthetase mutant of any one of claims 1 to 3 in the preparation of a recombinant protein comprising an unnatural amino acid. The pyrolysyl aminoacyl-tRNA synthetase mutant introduces an unnatural amino acid into a protein to obtain a recombinant protein comprising an unnatural amino acid; Preferably, the pyrolysyl aminoacyl-tRNA synthetase mutant introduces an unnatural amino acid into a specific site of a protein.

3. The pyrrolysine aminoacyl-tRNA synthetase mutant of claim 1 or 2, wherein, ​ ​ ​ ​ ​ ​ ​ 8. Use according to claim 7, characterized in that, ​ ​ More preferably, the unnatural amino acid is NPAK, which has the structural formula as shown in formula (I):

9. A method of making a recombinant protein comprising a non-natural amino acid, comprising: In the presence of the pyrrolysine aminoacyl-tRNA synthetase mutant and the MatRNA according to any one of claims 1-3, a gene encoding a protein is expressed in a cell or a cell extract, to obtain a recombinant protein comprising an unnatural amino acid; Preferably, the recombinant protein has the unnatural amino acid introduced at a specific site, and a codon corresponding to the specific site in the gene encoding the protein is replaced by an amber codon; Preferably, the sequence of the MatRNA is shown in SEQ ID NO: 28; More preferably, the recombinant protein is a protein capable of being used as a drug.

10. The method of claim 9, wherein, The unnatural amino acid is NPAK, which has the structural formula as shown in formula (I):

Images