Photosensitive protein and use thereof

Abstract

The present invention provides a recombinant photosensitive protein, which is a mutant of a wild-type cOpsm opsin having an amino acid sequence as shown in SEQ ID NO:1. The recombinant photosensitive protein in the present invention can be activated within a broad spectral range of 365-640 nm, and has high sensitivity. Under white or yellow light illumination, the recombinant photosensitive protein can restore the light avoidance response in MNU-induced retinal-degeneration mice more effectively than the wild-type cOpsm opsin, thereby providing new ideas for visual restoration and related therapeutic applications.

Description

A light-sensitive protein and its use TECHNICAL FIELD

[0001] The present invention belongs to the field of biological medicine, and in particular to a light-sensitive protein for restoring the sensitivity of retinal cells to light by activating G q signaling. BACKGROUND

[0002] G protein-coupled receptors (GPCRs) modulate many intracellular signaling pathways and represent some of the most intensively studied drug targets. Upon ligand binding, GPCRs undergo a conformational change and transmit it to a heterotrimeric G protein, which is a multi-subunit complex containing a G α and tightly associated G βγ subunits. G q proteins, a subfamily of heterotrimeric G α proteins, couple to a class of GPCRs and mediate cellular responses to neurotransmitters, sensory stimuli, and hormones throughout the body. Their main downstream signaling targets include the phospholipase C beta (PLC-b) enzyme, which catalyzes the hydrolysis of the phospholipid phosphatidylinositol bisphosphate (PIP2) into inositol trisphosphate (IP3) and diacylglycerol (DAG). IP3 triggers the release of intracellular stored Ca 2+ into the cytoplasm, and Ca 2+ along with DAG activates protein kinase C (PKC). Several tools including chemical genetics and optically activatable small molecules have been developed to study the signaling mechanisms and physiological functions of G q coupled GPCRs and intracellular Ca 2+ release.

[0003] Optogenetics utilizes light-responsive proteins to achieve optical control of cellular activities with genetic specificity and high spatiotemporal precision. Most animals use GPCR-based photoreceptors to detect light, where the photoreceptors contain a protein fraction (opsin) and a vitamin A derivative (retinal) that acts both as a ligand and a chromophore. Several thousand opsins have been identified so far.

[0004] The spectral distribution of sunlight is relatively uniform in the visible range, but with slight differences. In general, the energy of the green and yellow parts is higher, which is a result of the combined action of the surface temperature of the sun and the transmission properties of the atmosphere. Therefore, it can be said that in the visible range, the abundance of green and yellow light is relatively high. Because the human retina is most sensitive to yellow-green light at 550 nm, it is perceived as the brightest. The spectral width of a light-sensitive protein determines the range of wavelengths of light to which it can respond, and a wider spectrum means that the light-sensitive protein can react to more different wavelengths of light. There is still a need for ideal optogenetic tools in order to restore visual function in blind patients. SUMMARY

[0005] The present disclosure provides an Opsin light-sensitive protein that can be activated over a wide spectral range of 360 nm-700 nm with high sensitivity, providing new possibilities for vision restoration and other therapeutic applications. Compared with existing light-sensitive proteins, the light-sensitive protein of the present disclosure has a wider spectral response range, overcoming the limitations of prior art in clinical applications.

[0006] According to one aspect of the present disclosure, a light-sensitive protein is provided, corresponding to a wild-type opsin having an amino acid sequence shown in SEQ ID NO: 1, the light-sensitive protein having one or more mutations in amino acids at positions 85, 112, 117, 121, 177, 180, 186, 187, 204, 205, 209, 264, 272, 274 and 295.

[0007] In some embodiments, the light-sensitive protein has one or more mutations in amino acids at positions 85, 112, 121, 204 and 264.

[0008] In some embodiments, the light-sensitive protein has one or more mutations of I85C, I85A, I85Y, I85P, I85G, Y112A, Y112T, Y112V, Y112I, C121I, Y112E, Y112L, Y112H, L204I and F264Y.

[0009] In some embodiments, the light-sensitive protein has I85C and C121I mutations.

[0010] In some embodiments, the light-sensitive protein has Y112A and C121I mutations.

[0011] In some embodiments, the light-sensitive protein has Y112T and C121I mutations.

[0012] In some embodiments, the light-sensitive protein has Y112V and C121I mutations.

[0013] In some embodiments, the light-sensitive protein has Y112I and C121I mutations.

[0014] In some embodiments, the light-sensitive protein has an amino acid sequence set forth in one or more of SEQ ID NOs: 15-27, or an amino acid sequence that is one or more additions, deletions, substitutions, or modifications of an amino acid sequence set forth in one or more of SEQ ID NOs: 15-27, or an amino acid sequence that has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100% sequence identity thereto.

[0015] In some embodiments, the light-sensitive protein is derived from a vertebrate.

[0016] In some embodiments, the vertebrate comprises one or more of a bird, a reptile, a fish, an amphibian, and a mammal.

[0017] In some embodiments, the vertebrate is a bird, including but not limited to one or more of a chicken, a duck, a goose, an ostrich, an emu, a rhea, a crane, a cassowary, a turkey, a quail, a chicken, a falcon, an eagle, a sparrowhawk, a pigeon, a budgerigar, a parakeet, a parrot, a passerine (e.g., a songbird), a jay, a blackbird, a finch, a warbler, and a sparrow.

[0018] In some embodiments, the vertebrate is a reptile, including but not limited to one or more of a lizard, a snake, an alligator, a turtle, a crocodile, and a terrapin.

[0019] In some embodiments, the vertebrate is a fish, including but not limited to one or more of a catfish, an eel, a shark, and a swordfish.

[0020] In some embodiments, the vertebrate is an amphibian, including but not limited to one or more of a toad, a frog, a newt, and a salamander.

[0021] In some embodiments, the light-sensitive protein restores the sensitivity of a retinal cell to light by activating Gq signaling.

[0022] In some embodiments, the light has a wavelength of 360 nm to 700 nm, preferably 365 nm to 640 nm, more preferably 380 nm to 640 nm, further preferably 480 nm to 640 nm.

[0023] In some embodiments, the retinal cell comprises a photoreceptor cell, a rod cell, a cone cell, a retinal ganglion cell, a bipolar cell, a ganglion cell, a horizontal cell, a multipolar neuron, a Muller cell, or an amacrine cell.

[0024] The light-sensitive proteins described in the present disclosure can be used as a convenient optogenetic tool to precisely activate Gq signaling within a cell in a retinal cell.q signaling.

[0025] According to another aspect of the disclosure, there is provided an isolated nucleic acid encoding a light-sensitive protein as described herein.

[0026] In some embodiments, the isolated nucleic acid encodes a light-sensitive protein, a homolog thereof, an ortholog thereof, a paralog thereof, a fragment thereof, or a variant thereof in an organism, which has an activity of restoring the sensitivity of retinal cells to light by activating Gq signaling.

[0027] According to yet another aspect of the disclosure, there is provided a chimeric gene comprising an isolated nucleic acid sequence as described herein operably linked to suitable regulatory sequences.

[0028] In some embodiments, the chimeric gene further comprises a gene encoding a marker, such as a fluorescent protein.

[0029] According to yet another aspect of the disclosure, there is provided a vector comprising an isolated nucleic acid as described herein or a chimeric gene as described herein.

[0030] In some embodiments, the vector is selected from a eukaryotic vector, a prokaryotic expression vector, a viral vector, or a yeast vector.

[0031] In some embodiments, the vector is selected from a herpes simplex virus vector, a vaccinia virus vector, an adenovirus vector, an adeno-associated virus vector, a lentivirus vector, a retrovirus vector, or an insect vector.

[0032] In some embodiments, the vector is selected from a recombinant AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAVrh10, Anc80, and variants thereof.

[0033] In some embodiments, the vector is an expression vector or a gene therapy vector.

[0034] According to yet another aspect of the disclosure, there is provided an isolated cell or cell culture comprising an isolated nucleic acid as described herein, a chimeric gene as described herein, or a vector as described herein.

[0035] In some embodiments, expression of the light-sensitive protein of the disclosure in HEK 293T cells robustly mediates blue light-triggered release of G q dependent Ca 2+ increase.

[0036] According to yet another aspect of the present disclosure, there is provided use of the light-sensitive protein, the isolated nucleic acid, the chimeric gene, the vector, or the isolated cell or cell culture of the present disclosure for treating or preventing a disease or condition mediated by, or involving, loss of sensitivity to light by retinal cells, by activating Gq signaling.

[0037] In some embodiments, the disease or condition comprises, but is not limited to, a disease or condition that benefits from restoring sensitivity to light by retinal cells by activating Gq signaling.

[0038] In some embodiments, the disease or condition comprises, but is not limited to, a disease or condition that benefits from activating retinal cells. Preferably, the retinal cells comprise, but are not limited to, photoreceptor cells, rod cells, cone cells, retinal ganglion cells, bipolar cells, ganglion cells, horizontal cells, multipolar neurons, Muller cells, or amacrine cells.

[0039] In some embodiments, the disease or condition comprises, but is not limited to, damage to the outer layers of the retina, loss or degeneration of photoreceptors, retinal degenerative diseases, loss of sensitivity to light or loss of light perception, vision loss caused by insufficient light perception or sensitivity, and / or blindness.

[0040] In some embodiments, the disease or condition comprises, but is not limited to, a disease associated with degeneration and / or death of retinal photoreceptor cells, such as rod and cone cells, or their associated cells, such as the pigment epithelium. Preferably, the disease or condition comprises inherited retinal degeneration (IRD), macular degeneration, age-related macular degeneration (AMD).

[0041] In some embodiments, the light-sensitive protein of the present disclosure can be administered to retinal cells, and the retinal cells expressing the light-sensitive protein can be activated by light.

[0042] According to yet another aspect of the present disclosure, there is provided a method of treating or preventing a disease or condition mediated by, or involving, loss of sensitivity to light by retinal cells, in a subject, by activating Gq signaling, the method comprising administering to a subject in need thereof an effective amount of the light-sensitive protein, the isolated nucleic acid, the chimeric gene, the vector, or the isolated cell or cell culture of the present disclosure.

[0043] In some embodiments, the disease or condition comprises, but is not limited to, a disease or condition that benefits from restoring sensitivity to light by retinal cells by activating Gq signaling.

[0044] In some embodiments, the disease or condition comprises, but is not limited to, a disease or condition that benefits from activation of retinal cells. Preferably, the retinal cells comprise, but are not limited to, photoreceptor cells, rod cells, cone cells, retinal ganglion cells, bipolar cells, ganglion cells, horizontal cells, multipolar neurons, Muller cells, or amacrine cells.

[0045] In some embodiments, the disease or condition comprises, but is not limited to, damage to the outer layers of the retina, loss or degeneration of photoreceptors, retinal degenerative diseases, loss of sensitivity to light or loss of light perception, loss of vision caused by insufficient light perception or sensitivity, and / or blindness.

[0046] In some embodiments, the light-sensitive protein of the present disclosure can be used to restore the sensitivity of retinal cells to light, as long as the retinal ganglion cells are not completely dead.

[0047] In some embodiments, the disease or condition comprises a disease associated with degeneration and / or death of retinal photoreceptor cells or cells related thereto.

[0048] In some embodiments, the retinal photoreceptor cells comprise rod cells and / or cone cells.

[0049] In some embodiments, the disease or condition comprises, but is not limited to, inherited retinal degeneration (IRD), macular degeneration, age-related macular degeneration (AMD).

[0050] In some embodiments, the method comprises, but is not limited to, subretinal or intravitreal injection, intracameral injection, subconjunctival, suprachoroidal, or subchoroidal administration of an AAV vector expressing the light-sensitive protein to a subject in need thereof.

[0051] In some embodiments, the method further comprises applying light with a wavelength ranging from 360 nm to 700 nm, preferably from 365 nm to 640 nm, more preferably from 380 nm to 640 nm, and further preferably from 480 nm to 640 nm.

[0052] The present disclosure provides a new light-sensitive photoprotein that is specially designed and engineered to be effectively activated across a wide spectral range of 360 nm-700 nm. This characteristic of wide spectral response enables the photoprotein to function in a variety of therapeutic scenarios, including but not limited to vision restoration therapy. In addition, the photoprotein also exhibits high sensitivity, ensuring effective activation under low light conditions, further expanding its range of applications. BRIEF DESCRIPTION OF DRAWINGS

[0053] Figure 1 shows the sensitivity of wild-type cOpn5 and C121I (A), L204I (B), and F264Y (C) mutants to 488 nm wavelength light.

[0054] Figure 2 shows the sensitivity of wild type and C121I (A), L204I (B) and F264Y (C) mutants of cOpn5 to 560 nm wavelength light.

[0055] Figure 3 shows the flow test results of the saturation mutation at site 85 based on the C121I mutant.

[0056] Figure 4 shows the flow test results of the I85C / C121I combination mutant.

[0057] Figure 5 shows the flow test results of the saturation mutation at site 112 based on the C121I mutant.

[0058] Figure 6 shows the flow test results of the Y112I / C121I combination mutant.

[0059] Figure 7 shows the flow test results of the Y112A / C121I combination mutant.

[0060] Figure 8 shows the flow test results of the Y112V / C121I combination mutant.

[0061] Figure 9 shows the flow test results of the Y112T / C121I combination mutant.

[0062] Figure 10 shows the sensitivity and reaction speed results of different mutants to 488 nm light.

[0063] Figure 11 shows the sensitivity and reaction speed results of different mutants to 560 nm light.

[0064] Figure 12 shows the sensitivity and reaction speed results of different mutants to 640 nm light.

[0065] Figure 13 shows the efficacy of different mutants in restoring the light avoidance response of MNU retinal degeneration mice under yellow light illumination.

[0066] Figure 14 shows the efficacy of different mutants in restoring the light avoidance response of MNU retinal degeneration mice under white light illumination. DETAILED DESCRIPTION

[0067] To make the objectives, technical solutions and advantages of the present application clearer, further detailed description will be given below in combination with the drawings and examples. The specific examples described herein are only used to explain the present application and do not constitute any limitation to the present application. In addition, in the following description, the description of well-known structures and technologies is omitted to avoid unnecessary confusion of the concept of the present disclosure. Such structures and technologies are also described in many publications.

[0068] The photosensitive proteins provided by the present disclosure are a series of mutants corresponding to chicken Opsin visual protein (cOpsin), and those skilled in the art can understand that corresponding mutation sites also have corresponding photosensitive activity in organisms other than chickens. In some embodiments, the organism is an animal. In some embodiments, the animal is a vertebrate. In some embodiments, the animal is a bird, a reptile, or a fish, an amphibian, or a mammal. In certain embodiments, the animal is a bird, including but not limited to chicken, duck, goose, ostrich, emu, rhea, crane, cassowary, turkey, quail, chicken, falcon, hawk, sparrowhawk, pigeon, parakeet, parrot, passerine (e.g., songbird), jay, blackbird, sparrow, warbler, and sparrow. In certain embodiments, the animal is a reptile, including but not limited to lizard, snake, alligator, turtle, crocodile, and land tortoise. In certain embodiments, the animal is a fish, including but not limited to squid, catfish, eel, shark, and swordfish. In certain embodiments, the animal is an amphibian, including but not limited to toad, frog, newt, and salamander.

[0069] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The following definitions are applied to the descriptions of the present application and throughout this document, and apply equally, where appropriate, to singular as well as plural references. For purposes of interpreting this specification, the following definitions will apply and whenever appropriate, terms used in the singular will include the plural and vice versa.

[0070] Unless the context clearly indicates otherwise, as used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly indicates otherwise. For example, reference to "a cell" includes a plurality of such cells, and equivalents thereof known to those skilled in the art, and so forth.

[0071] As used herein, the term "about" means a range of ±20% of the value that follows. In some embodiments, the term "about" means a range of ±10% of the value that follows. In some embodiments, the term "about" means a range of ±5% of the value that follows.

[0072] As used herein, the term "mutant" refers to an individual in which the coding gene of the target protein has been mutated compared to the wild type.

[0073] As used herein, the term "saturated mutant library" is a combination of mutants in which the amino acid at the target site is replaced by the other 19 amino acids by modifying the coding gene of the target protein.

[0074] The "percentage (%) sequence identity" relative to a reference amino acid sequence refers to the percentage of amino acid residues in the candidate sequence that are identical to those in the reference amino acid sequence after sequence alignment and (if necessary) introducing gaps to obtain the maximum percentage sequence identity, without considering any conserved substitutions as part of the sequence identity. To determine the percentage of amino acid sequence identity, alignment can be performed in various ways within the art, such as using BLAST, ALIGN, or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for sequence alignment, including any algorithms required to achieve maximum alignment across the full length of the compared sequences.

[0075] The photosensitive protein disclosed herein can be obtained by substituting, adding, or deleting one or more amino acids, thereby achieving at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the photosensitive protein in terms of amino acid sequence, while retaining equivalent activity.

[0076] In some embodiments, the substitution of a conserved amino acid can mean replacing an amino acid residue with a biologically similar residue. Particularly preferred substitutions are generally conserved in nature, i.e., those that occur within an amino acid family. For example, amino acids are generally classified into four families: (1) acidic – aspartic acid and glutamic acid; (2) basic – lysine, arginine, histidine; (3) nonpolar – alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; (4) uncharged polar – glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids. Examples of conserved changes include replacing one hydrophobic residue, such as isoleucine, valine, leucine, or methionine, with another hydrophobic residue; or replacing one polar residue, such as replacing lysine with arginine, aspartic acid with glutamic acid, or asparagine with glutamine; or similar conserved substitutions of amino acids with structurally related amino acids, which do not significantly affect biological activity. Therefore, proteins having a substantially identical amino acid sequence to the reference molecule but with a few amino acid substitutions that substantially do not affect the protein's immunogenicity fall within the definition of the reference polypeptide.

[0077] As used in this article, "Inherited Retinal Diseases (IRDs)" refers to a group of eye diseases caused by dysfunction or degeneration of retinal photoreceptor cells (such as rods and cones) or related cells (such as pigment epithelial cells). These diseases are usually caused by genetic factors (such as gene mutations) and can present with a variety of different clinical symptoms and courses, typically leading to a gradual decline in vision and potentially blindness.

[0078] There are many types of IRD, including but not limited to the following: retinitis pigmentosa, Leber congenital amaurosis, Stargardt disease, cone-rod dystrophy, and congenital stationary night blindness.

[0079] Retinitis Pigmentosa (RP): one of the most common IRDs, characterized by night blindness, progressive narrowing of the visual field, and progressive degeneration of rod and cone cells.

[0080] Leber congenital amaurosis (LCA): a severe visual impairment that is present from birth or infancy.

[0081] Stargardt disease: a hereditary macular degeneration that typically manifests in late childhood or early adolescence and affects central vision.

[0082] Cone-rod dystrophy: In this type of disease, cone cells are affected first, leading to loss of central and color vision, and then rod cells gradually degenerate as well.

[0083] Congenital stationary night blindness (CSNB): Patients are born with night blindness, but their vision usually does not worsen over time.

[0084] As used in this article, the term "effective dose" refers to the effective dose and time period required to achieve the desired therapeutic or preventative effect.

[0085] The following embodiments and accompanying drawings are provided to aid in understanding the present invention. However, it should be understood that these embodiments and drawings are for illustrative purposes only and do not constitute any limitation. The actual scope of protection of the present invention is set forth in the claims. It should be understood that any modifications and changes can be made without departing from the spirit of the present invention.

[0086] Example

[0087] Example 1.

[0088] The protein structure of cOpsin5 (chicken opsin, SEQ ID NO:1, also referred to as cOpn5 in the following examples) was predicted using 3AYM (crystal structure of squid rhodopsin intermediate), 2Z73 (crystal structure of squid rhodopsin), and 4WW3 (crystal structure of squid rhodopsin luminescent intermediate). Molecular docking was then performed between retinaldehyde and the predicted cOpsin5 protein structure to determine that the spatial distance between cOpsin5 and retinaldehyde was less than [value missing]. The 22 amino acid sites are: 85 / 112 / 113 / 116 / 117 / 120 / 121 / 124 / 177 / 180 / 185 / 186 / 187 / 188 / 204 / 205 / 209 / 264 / 268 / 272 / 274 / 295.

[0089] Further sequence alignment of Opsin family proteins from different sources at different sensitive wavelengths was performed to analyze the degree of sequence conservation of the retinaldehyde binding site of cOpsin with other Opsin proteins in other wavelength ranges. Table 1 below is a partial list of cOpsin orthologs from the subphylum Vertebrata tested in this invention.

[0090] The results showed that the conserved opsin sites were 113, 120, 124, 185, 188, and 268, while the mutation sites were 85, 112, 116, 117, 121, 177, 180, 186, 187, 204, 205, 209, 264, 272, 274, and 295.

[0091] Table 1

[0092] Example 2. Single-point mutation or combination mutation of the mutant sequence.

[0093] Taking pLJM1-CMV-cOpn5 (85aa site mutation)-cPPT as an example, the restriction sites are EcoRI and NheI. Single-point mutation was performed using the QuikChange II-E Site-Directed Mutagenesis Kit.

[0094] 1) Primers

[0095] Standard primers:

[0096] Gibson-CMV-cOpn5-F:ggtttagtgaaccgtcagatccgctagcatgagtgggatggcatcggact(SEQ ID NO:3)

[0097] Gibson-cOpn5-cPPT-R: ctgccatttgtctcgaggtcgagaattcttagacttccagttgggttccg (SEQ ID NO: 4)

[0098] The primers involved in the 85aa site mutation are as follows:

[0099] 85aa-R:gcccagatcacacaccgcta(SEQ ID NO:5)

[0100] 85aa-F: gcggtgtgtgatctgggcNNNtcagttgtaggaaaaccc (SEQ ID NO:6, where N is a random base)

[0101] 2) Fragment synthesis and vector digestion

[0102] Fragment 1: Template cOpn5-WT encoding nucleic acid sequence (SEQ ID NO:2), primers Gibson-CMV-cOpn5-F, 85aa-R

[0103] Fragment 2: Template cOpn5-WT encoding nucleic acid sequence (SEQ ID NO:2), primer 85aa-F, Gibson-cOpn5-cPPT-R

[0104] DNA fragments were recovered by gel extraction after PCR.

[0105] When constructing a combined mutant saturated library, it is necessary to add mutant primers for other sites to the primers for fragment two, and change the primers for fragment one to the F primer with the smallest number of sites.

[0106] The primers involved in the 112aa site mutation are as follows:

[0107] 112aa-R:gcggcagcccatcca(SEQ ID NO:7)

[0108] 112aa-F: tggatgggctgccgctggNNNggatgggctggcttcttc (SEQ ID NO:8, where N is a random base)

[0109] The primers involved in the 121aa site mutation are as follows:

[0110] 121aa-R:aaagaagaagccagc(SEQ ID NO:9)

[0111] 121aa-F: gctggcttcttctttggcNNNgggagccttattaccatg (SEQ ID NO:10, where N is a random base)

[0112] The primers involved in the 204aa site mutation are as follows:

[0113] 204aa-R:aaaagcctgcccagc(SEQ ID NO:11)

[0114] 204aa-F: gctgggcaggcttttgttNNNagcattcttttcttttgc (SEQ ID NO:12, where N is a random base)

[0115] The primers involved in the 264aa site mutation are as follows:

[0116] 264aa-R:ggcacagatcagcat(SEQ ID NO:13)

[0117] 264aa-F: atgctgatctgtgccggaNNNctcattgcttggatcccc (SEQ ID NO:14, where N is a random base)

[0118] 3) Carrier synthesis

[0119] Plasmid template pLJM1-EGFP (Addgene#19319).

[0120] 4) Vector enzyme digestion

[0121] pLJM1-EGFP and the recovered DNA fragments were digested using EcoRI and NheI.

[0122] 5) Gibson assembly

[0123] The enzyme-digested DNA fragments were mixed with the vector and then assembled using Gibson.

[0124] 6) DNA recycling

[0125] The Gibson product was recovered using a Clean-UP kit and dissolved in water.

[0126] 7) Remove other DNA fragments that are not plasmids.

[0127] Plasmid-Safe TMThe ATP-Dependent DNase kit removes non-circular DNA fragments, and the final product is a saturated mutant library.

[0128] Example 3. Screening for single-point mutants

[0129] Mutants that are more sensitive to long-wavelength light and react faster were screened using calcium imaging.

[0130] The specific method is as follows:

[0131] (1) Cell culture: Hek 293T cells were cultured in a 37°C incubator containing 5% CO2. The complete culture medium was DMEM + 10% FBS + 1% PS. The cells were passaged every 2-3 days to ensure a good growth environment for the cells.

[0132] (2) Cells in the logarithmic growth phase were digested with 0.25% trypsin and resuspended, and seeded at a density of 3 million cells / dish in 10 cm⁻¹ plates. 2 Incubate in a petri dish for 24 hours.

[0133] (3) Lentiviral Packaging: pMD2.G (Addgene, #12259), psPAX2 (Addgene, #12260), and the mutant library synthesized in Example 2 were co-transfected into HEK 293T cells using PEIMAX (purchased from Polysciences) transfection reagent to obtain lentiviral libraries with different mutants. Thirty-six hours after transfection, the culture supernatant was collected and filtered through a 0.4 μM filter membrane. One mL of the filtered lentiviral stock solution was mixed with 1 mL of complete culture medium (DMEM + 10% FBS + 1% PS) and cultured in HeK 293T cells for 24 hours.

[0134] (4) Remove the supernatant of the culture medium containing lentivirus and add complete culture medium containing 10 mg / mL puromycin for pressure screening.

[0135] (5) After successfully screened cells are digested with 0.25% trypsin, they are seeded at a density of 30,000 cells / well in a 35mm confocal dish or a 96-well plate for real-time fluorescence detection and analysis technology of FLIPR.

[0136] (6) After 24 hours, remove the culture medium and replace it with HBSS buffer containing Flou8-AM calcium ion fluorescent dye and incubate for 45 minutes.

[0137] (7) Remove the HBSS buffer containing Flou8-AM calcium ion fluorescent dye and replace it with fresh HBSS buffer to remove excess dye. Then equilibrate the cells for 30 minutes.

[0138] (8) Baseline recording: Before starting the experiment, record the baseline fluorescence signal for 2 minutes.

[0139] (9) Then, the fluorescence intensity changes were recorded by using light of the same intensity but different wavelengths (488nm, 560nm).

[0140] The results are shown in Figure 1-2.

[0141] The results in Figure 1 show that at 488 nm and 32 μW / mm 2 Under 50ms illumination, the C-to-I mutation at position 121 of cOpn5 can increase the reaction rate and intensity of cOpn5 at a wavelength of 488nm, the L-to-I mutation at position 204 can increase the reaction intensity of cOpn5 at a wavelength of 488nm, and the F-to-Y mutation at position 264 of cOpn5 can increase the reaction intensity of cOpn5 at a wavelength of 488nm.

[0142] The results in Figure 2 show that at 560 nm and 32 μW / mm 2 Wild-type cOpn5 does not respond under 50ms illumination. Mutations at position 121 (C to I), position 204 (L to I), and position 264 (F to Y) can increase the sensitivity of cOpn5 to 560nm light.

[0143] Example 4: Screening of Combined Mutants

[0144] Flow cytometry sorting was performed using a Wolf nanocellect microfluidic cell sorting device, with an Amber external light source (parameters shown in Table 2 below) added 2 cm upstream of the sorting tube as the stimulation light. Cell sorting began after sample loading, and flow cytometry data were recorded for 5 minutes each during light-off and light-on periods. If the percentage difference between the number of P3-gland cells in the light-on and light-off periods was greater than or equal to 1%, the library was considered to contain the target photosensitive protein.

[0145] Table 2

[0146] Based on the C121I mutant with a CI mutation at cOpn5 site 121, saturation mutations were performed on each of the retinaldehyde binding sites identified in Example 1 to obtain a saturated mutant library. HEK 293T cells were infected with the saturated mutant library via lentivirus. Successfully infected cells were then treated with Flou4-AM calcium ion fluorescent dye, and calcium signal flow cytometry analysis was performed using Nanocellect WOLF to screen for cOpn5 cells sensitive to Amber LED beads.

[0147] The specific flow cytometry experimental method is as follows:

[0148] (1) Cell culture: HEK 293T cells were cultured in a 37°C incubator containing 5% CO2. The complete culture medium was DMEM + 10% FBS + 1% PS. The cells were passaged every 2-3 days to ensure a good growth environment for the cells.

[0149] (2) Cells in the logarithmic growth phase were digested with 0.25% trypsin and resuspended, and seeded at a density of 3 million cells / dish in 10 cm⁻¹ plates. 2 Incubate in a petri dish for 24 hours.

[0150] (3) Lentiviral Packaging: pMD2.G (Addgene, #12259), psPAX2 (Addgene, #12260), and the mutant library obtained in Example 4 were co-transfected into HEK 293T cells using PEIMAX (purchased from Polysciences) transfection reagent to obtain lentiviral libraries with different mutants. Thirty-six hours after transfection, the culture supernatant was collected and filtered through a 0.4 μM filter membrane. One mL of the filtered lentiviral stock solution was mixed with 1 mL of complete culture medium (DMEM + 10% FBS + 1% PS) and cultured in Hek 293T cells for 24 hours.

[0151] (4) Remove the supernatant of the culture medium containing lentivirus and add complete culture medium containing 10 mg / mL puromycin for pressure screening.

[0152] (5) After successfully screened cells were digested with 0.25% trypsin, they were resuspended with HBSS and incubated with Flou4-AM calcium ion fluorescent dye for 45 min before being sorted by flow cytometry.

[0153] The results are shown below:

[0154] (1) I85C / C121I combined mutation

[0155] Based on the mutant (C121I) with CI mutation at cOpn5 121, a saturation mutation was performed at position 85. The results in Figure 3 show that the percentage difference of R3 phylum cells between Light-On and Light-Off is greater than 0.5%, so the target light-sensitive protein is present in this library.

[0156] Therefore, further mutations were performed on site 85 one by one. The results are shown in Table 3. Based on the CI mutation at cOpn5 121, mutations at site 85 (IA, IC, IY, IP, and IG) all enhanced the protein's light sensitivity at 594 nm. Figure 4 shows that, based on the CI mutation at cOpn5 121, the IC mutation at site 85 significantly enhanced the protein's light sensitivity at 594 nm.

[0157] Table 3

[0158] (2) Combined mutations of Y112I / C121I, Y112A / C121I, Y112V / C121I, and Y112T / C121I.

[0159] Based on the CI mutation at cOpn5 site 121 (C121I), a saturation mutation was performed at site 112. The results in Figure 5 show that the percentage difference in R3 phylum cells between Light-On and Light-Off is greater than 0.5%, indicating that the target photosensitizing protein is present in this library.

[0160] Therefore, further mutations were performed on site 112, and the results are shown in Table 4. Based on the CI mutation at cOpn5 site 121, mutations at site 112 (YI, YE, YA, YV, YT, YL, and YH) all enhanced the protein's light sensitivity at 594 nm. Figures 6-9 show that, based on the CI mutation at cOpn5 site 121, mutations at site 112 (YI, YA, YV, and YT) significantly enhanced the protein's light sensitivity at 594 nm.

[0161] Table 4

[0162] Example 5

[0163] The sensitivity and reaction speed of the mutant to different wavelengths of light were detected using the same method as in Example 3.

[0164] (1) The sensitivity and response rate of the mutant to different wavelengths of light were detected by FLIPR (488nm).

[0165] As shown in Figure 10, it was found that under 488nm illumination, the I85C / C121I combined mutation (cOpn 85C 121I) significantly increased the reaction rate of cOpn5.

[0166] (2) The sensitivity and response speed of the mutant to different wavelengths of light were detected by a spinning dish confocal microscope (560nm).

[0167] The results, as shown in Figure 11, revealed that light at a wavelength of 560 nm could not activate wild-type cOpsin5; however, the mutants all responded to light at a wavelength of 560 nm.

[0168] The Y112A / C121I and Y112T / C121I combination mutants have similar fastest response rates at 560 nm; the Y112V / C121I combination mutant, Y112I / C121I combination mutant, and I85C / C121I combination mutant have slightly slower response rates than the first two mutants.

[0169] The Y112A / C121I, Y112T / C121I, and Y112V / C121I combination mutants showed the strongest response to 560 nm, while the Y112I / C121I and I85C / C121I combination mutants showed slightly weaker response than the first two mutants.

[0170] (3) The sensitivity and response speed of the mutant to different wavelengths of light were detected by a spinning dish confocal (640nm) instrument.

[0171] As shown in Figure 12, it was found that light with a wavelength of 640 nm could not activate wild-type cOpn5, while the mutant could respond to light with a wavelength of 640 nm.

[0172] Example 6. Application of photosensitive proteins in restoring photosensitivity

[0173] Overview of the basic steps of the light avoidance experiment based on black and white boxes:

[0174] (1) Animal preparation: Eight-week-old C57BL / 6J mice were weighed and injected intraperitoneally with MNU solution at 80 mg / kg to establish an MNU retinal degeneration model (hereinafter referred to as the MNU model).

[0175] (2) Construction of AAV vector: Using pAAV-CAG-GFP as template (Addgene#37825), the fragment was synthesized by Wisconsin and the plasmid pAAV-msncg-cOpsin5 WT-T2A-EGFP-WPRE-pA(WT) was constructed. After amplification with staple3 competent cells, the plasmid was extracted and used for adeno-associated virus packaging.

[0176] (3) Using XbaI and EcoRI to treat pAAV-msncg-cOpsin5 WT-T2A-EGFP-WPRE-pA was digested with enzymes, and the mutant fragment obtained in Example 3 was inserted with Gibson to obtain pAAV-msncg-cOpsin5I85C / C121I-T2A-EGFP-WPRE-pA(I85C / C121I), pAAV-msncg-cOpsin5Y112A / C121I-T2A-EGFP-WPRE-pA(Y112A / C121I), pAAV-msncg-cOpsin5Y112I / C121I-T2A-EGFP-WPRE-pA(Y112I / C121I), and pAAV-msncg-cOpsin5Y112T / C121I-T2A-EGFP-WPRE-pA(Y112T / C121I).

[0177] (4) Adeno-associated virus packaging: The target gene was packaged with AAV7M8, and three plasmids, namely 2 / 7M8 (Addgene#64839), helper (Addgene#112867) and one of the plasmids in step (2), were simultaneously transfected into HEK293T cells. After 72 hours of transfection, the cells were harvested, and lysis buffer was added to repeatedly freeze and thaw the cells to lyse them. The virus was purified by density gradient centrifugation with iodixanol to obtain AAV viruses with different mutations.

[0178] (5) Ten days after MNU injection, after anesthesia (250 mg / kg of Avertin intraperitoneal injection), adeno-associated virus (AAV) was injected intravitreally at a titer of 5E12 vg / mL, 2 μL, to express photosensitive protein on its optic ganglion cells.

[0179] (6) Adaptation: Mice were subjected to black and white box experiments 60 days after viral expression. The day before the experiment, mice were pre-acclimatized by adjusting the lighting conditions of the black and white boxes, with both boxes being in a dark environment (<10 lux). The mice were gently placed in the dark box facing the wall, and the middle door was opened, allowing the mice to explore freely for 10 minutes. After 10 minutes, the mice were returned to their cages.

[0180] (7) Preparation for the black and white box test: Check the equipment, wipe the black and white box with 75% ethanol to ensure the box is clean and odorless, and ensure the middle door opens and closes smoothly. Use white light (wavelength range of 360nm~700nm) or yellow light (wavelength range of 560nm~600nm) and place the light intensity meter at the bottom of the bright box to check the light intensity. The light intensity should be 200-300 lux for the bright box and <10 lux for the dark box. The light conditions should be kept constant during the experiment. Move the mice to the experimental room in advance on the day of the experiment and allow them to adapt to the environment for 1 hour.

[0181] (8) Black and white box test: Gently place the mouse facing the wall of the box into the dark box, close the middle door, and allow the mouse to adapt for 1 minute. Open the middle door and allow the mouse to freely explore the bright box and the dark box for 10 minutes. Record the mouse's activity time in the bright box within 10 minutes using a timer.

[0182] (9) After 10 minutes, close the middle door and put the mouse back into the feeding cage.

[0183] (10) Equipment cleaning: After each mouse test, wipe the platform surface with 75% ethanol and ventilate and dry for ≥5 minutes to eliminate odor interference.

[0184] (11) Data Collection: The time (in seconds) the mice spent in the open box was recorded. The open box time ratio was calculated as (open box time / total experimental time × 100%). Statistical analysis was performed using GraphPad Prism. The results are shown in Figures 13 and 14.

[0185] The results show that:

[0186] 1) As shown in Figure 13, under white light illumination, the efficacy of different mutants in restoring the light avoidance response in MNU retinal degeneration mice was: Y112A / C121I combination mutant > Y112T / C121I combination mutant > wild-type cOpsin5 (WT opsin). However, the Y112I / C121I combination mutant showed a larger intragroup error, with little difference in efficacy compared to wild-type cOpsin5. The I85C / C121I combination mutant also showed little difference in efficacy compared to wild-type cOpsin5.

[0187] 2) As shown in Figure 14, under yellow light irradiation, the efficacy of different mutants in restoring the light avoidance response in MNU retinal degeneration mice was: Y112A / C121I combination mutant > Y112I / C121I combination mutant > Y112T / C121I combination mutant > wild-type cOpsin5 (WT opsin). The efficacy of I85C / C121I combination mutant was not significantly different from that of wild-type cOpsin5.

[0188] The technical solutions of the present invention are not limited to the specific embodiments described above. Any technical modifications made in accordance with the technical solutions of the present invention fall within the protection scope of the present invention.

Claims

1. A light-sensitive protein, characterized in that, corresponding to a wild-type cOpsin opsin protein having the amino acid sequence of SEQ ID NO: 1, said light-sensitive protein having one or more mutations in amino acids at positions 85, 112, 117, 121, 177, 180, 186, 187, 204, 205, 209, 264, 272, 274 and 295.

2. The light-sensitive protein according to claim 1, characterized in that, said light-sensitive protein having one or more mutations in amino acids at positions 85, 112, 121, 204 and 264; preferably, said light-sensitive protein has one or more mutations of I85C, I85A, I85Y, I85P, I85G, Y112A, Y112T, Y112V, Y112I, Y112E, Y112L, Y112H, C121 I, L204I and F264Y; preferably, said light-sensitive protein has I85C and C121 I mutations; preferably, said light-sensitive protein has Y112A and C121 I mutations; preferably, said light-sensitive protein has Y112T and C121 I mutations; preferably, said light-sensitive protein has Y112V and C121 I mutations; preferably, said light-sensitive protein has Y112I and C121 I mutations; preferably, said light-sensitive protein is derived from a vertebrate; more preferably, said vertebrate comprises one or more of a bird, a reptile, a fish, an amphibian and a mammal, further preferably, said bird animal comprises one or more of a chicken, a duck, a goose, an ostrich, an emu, a rhea, a crane, a cassowary, a turkey, a quail, a chicken, a falcon, an eagle, a sparrowhawk, a pigeon, a budgerigar, a parakeet, a macaw, a parrot, a passerine, a jay, a blackbird, a finch, a warbler and a sparrow; further preferably, said reptile animal comprises one or more of a lizard, a snake, an alligator, a turtle, a crocodile and a terrapin; further preferably, said fish animal comprises one or more of a catfish, an eel, a shark and a swordfish; further preferably, said amphibian animal comprises one or more of a toad, a frog, a newt and a salamander.

3. The light-sensitive protein according to claim 1 or 2, characterized in that said light-sensitive protein restores the sensitivity of retinal cells to light by activating Gq signalling; preferably, said light has a wavelength of 360 nm to 700 nm, preferably 365 nm to 640 nm; preferably, said retinal cells comprise photoreceptor cells, rod cells, cone cells, retinal ganglion cells, bipolar cells, ganglion cells, horizontal cells, multipolar neurons, Muller cells or amacrine cells.

4. An isolated nucleic acid encoding the light-sensitive protein of any one of claims 1 to 3.

5. A chimeric gene comprising the isolated nucleic acid sequence of claim 4 operably linked to suitable regulatory sequences; preferably, said chimeric gene further comprises a gene encoding a marker, such as a fluorescent protein.

6. A vector comprising the isolated nucleic acid of claim 4 or the chimeric gene of claim 5. Preferably, the vector is selected from a eukaryotic vector, a prokaryotic expression vector, a viral vector or a yeast vector; More preferably, the vector is selected from a herpes simplex virus vector, a vaccinia virus vector, an adenovirus vector, an adeno-associated virus vector, a lentivirus vector, a retrovirus vector or an insect vector; Further preferably, the vector is selected from a recombinant AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAVrh10, Anc80 and variants thereof; Further preferably, the vector is an expression vector or a gene therapy vector.

7. An isolated cell or cell culture comprising the isolated nucleic acid of claim 4, the chimeric gene of claim 5 or the vector of claim 6.

8. Use of the light-sensitive protein of any one of claims 1-3, the isolated nucleic acid of claim 4, the chimeric gene of claim 5, the vector of claim 6 or the isolated cell or cell culture of claim 7 for treating or preventing a disease or condition mediated by, or involving, a loss of sensitivity to light by retinal cells, by activating Gq signaling.

9. A method of treating or preventing a disease or condition mediated by, or involving, a loss of sensitivity to light by retinal cells, by activating Gq signaling in a subject, the method comprising administering to a subject in need thereof an effective amount of the light-sensitive protein of any one of claims 1-3, the isolated nucleic acid of claim 4, the chimeric gene of claim 5, the vector of claim 6 or the isolated cell or cell culture of claim 7.

10. Use according to claim 8 or method according to claim 9, characterized in that, The disease or condition includes a disease or condition that benefits from restoring sensitivity to light by retinal cells by activating Gq signaling.

11. Use according to claim 8 or method according to claim 9, characterized in that, The disease or condition includes a disease or condition that benefits from activating retinal cells, Preferably, the retinal cells include photoreceptor cells, rod cells, cone cells, retinal ganglion cells, bipolar cells, ganglion cells, horizontal cells, multipolar neurons, Muller cells or amacrine cells.

12. Use according to claim 8 or method according to claim 9, characterized in that, The disease or condition includes damage to the outer layers of the retina, loss or degeneration of photoreceptors, retinal degenerative diseases, loss of sensitivity to light or loss of light perception, loss of vision caused by insufficient light perception or sensitivity, and / or blindness.

13. Use according to claim 8 or method according to claim 9, characterized in that, The disease or condition includes a disease associated with degeneration and / or death of retinal photoreceptor cells or cells related thereto; Preferably, the retinal photoreceptor cells include rod cells and / or cone cells; Preferably, the related cells include pigment epithelial cells; Preferably, the disease or condition includes inherited retinal degeneration (IRD), macular degeneration and age-related macular degeneration (AMD).

14. The method according to any one of claims 9 to 13, characterized in that, The method includes administering an AAV vector expressing the light-sensitive protein subretinally, intravitreally, in the anterior chamber, subconjunctivally, suprachoroidally or subchoroidally to a subject in need thereof; Preferably, the method further comprises applying light having a wavelength in the range of 360 nm to 700 nm, preferably 365 nm to 640 nm. Preferably, the method further comprises applying light having a wavelength in the range of 360 nm to 700 nm, preferably 365 nm to 640

Images