Method for representing target biomolecule

Abstract

Provided are a method for representing a target biomolecule, a ligation method or a preparation method for a sequencing library, an activation linker, a method for preparing the activation linker, a kit for nanopore sequencing, and a use of the activation linker in nanopore sequencing.

Description

Methods for characterizing target biomolecules

[0001] Cross-referencing

[0002] This application incorporates Chinese Patent Application No. 2024109772966, filed on July 19, 2024, entitled “Method for characterizing target biomolecules,” which is incorporated herein by reference in its entirety. Technical Field

[0003] This invention belongs to the field of sequencing, and specifically relates to methods for characterizing target biomolecules, ligation methods or methods for preparing sequencing libraries, activated adapters, methods for preparing activated adapters, kits for nanopore sequencing, and the use of activated adapters in nanopore sequencing. Background Technology

[0004] With the rapid development of life sciences, high-throughput sequencing technology has matured and is playing an increasingly important role in scientific research, medicine, and disease control. Compared with traditional Sanger sequencing, second-generation sequencing (NGS) and third-generation sequencing based on single-molecule technology have significant advantages in sequencing throughput, cost, and reaction time, and are gradually becoming the market mainstream. In the library construction process of NGS and third-generation sequencing, specific nucleic acid adapters need to be ligated into the target biomolecule to facilitate subsequent bridging amplification (Illumina NGS) or guiding nucleic acids through nanopores (nanopore sequencing). Therefore, library construction is a crucial step affecting sequencing quality and throughput.

[0005] Traditional library construction relies on DNA ligases (e.g., T4 DNA ligase, T7 DNA ligase, Taq DNA ligase, etc.) to ligate sequencing adapters or sequencing adapter precursors to the blunt or sticky ends of the target nucleic acid. After the reaction is terminated, excess enzyme and unreacted adapters are removed through purification, making the target biomolecule ready for amplification or direct sequencing. However, DNA ligase-based library construction techniques have several drawbacks: 1) This method requires phosphorylation at the 5' end and adenosine protrusion at the 3' end of the target nucleic acid, increasing the difficulty and complexity of library preparation; 2) While the addition of polyethylene glycol can significantly improve the ligation speed and efficiency of DNA ligase, it also increases the probability of adapter and target product self-ligation, leading to a decrease in detection throughput and accuracy; 3) After the reaction, the DNA ligase needs to be inactivated by heat denaturation, and a purification step is required to remove free ligase and adapters, increasing the operational difficulty and time.

[0006] The existing technical solution's main workflow is as follows: 1) End repair-phosphorylation-3' end addition of A reaction to the test sample (1 hour); 2) Purification and recovery of nucleic acid fragments using magnetic beads (30 minutes); 3) Ligation of adapters using DNA ligase (10 minutes); 4) Purification and recovery of the nucleic acid library using magnetic beads (30 minutes). The library preparation time exceeding 2 hours cannot meet users' needs for rapid library preparation.

[0007] Compared to DNA ligases, topoisomerases have significant advantages in reaction speed and ligation efficiency. Theoretically, topoisomerases can be used to ligate sequencing adapters to the ends of nucleic acid molecules to complete sequencing library construction. However, the difficulty lies in the fact that adapters with sticky 5' ends cannot be directly ligated to samples with blunt ends or 3' A-added, which greatly limits their practicality in the field of library construction. In addition, the 40-minute library construction time (10 minutes for adapter ligation and 30 minutes for magnetic bead purification) still cannot meet users' needs for rapid library construction.

[0008] Therefore, there is a continued need in the art to provide a method for characterizing target biomolecules that can overcome one or more of the aforementioned deficiencies. Summary of the Invention

[0009] To address the aforementioned technical problems, the inventors, through long-term exploration and continuous experimentation, have creatively designed a method for characterizing target biomolecules. Compared with directly purifying ligation products, this method results in shorter sequencing library preparation time, simpler operation, and reduced loss of ligation products. Compared with not purifying ligation products and not performing solidification, it can also improve the efficiency of nanopore sequencing of target biomolecules.

[0010] In a first aspect of this disclosure, a method for characterizing a target biomolecule may be provided, comprising:

[0011] Provide the conditions for using topoisomerases to ligate target biomolecules and linkers to obtain the first liquid-phase product.

[0012] By immobilizing the topoisomerase, the free topoisomerase, and / or the linker bound to the topoisomerase, and / or the target biomolecule bound to the topoisomerase, in the first liquid product, a second liquid product is obtained.

[0013] The second liquid product or its purified third product containing the target biomolecule is brought into contact with a pore, allowing the target biomolecule to pass through and move relative to the pore, thereby obtaining one or more measurements representing one or more characteristics of the target biomolecule.

[0014] In a second aspect of this disclosure, a ligation method or a method for preparing a sequencing library may be provided, comprising:

[0015] Provide the conditions for using topoisomerases to ligate target biomolecules and linkers to obtain the first liquid-phase product.

[0016] By immobilizing the topoisomerase, the free topoisomerase and / or the linker of the topoisomerase or the target biomolecule bound to the topoisomerase in the first liquid product are removed to obtain the second liquid product.

[0017] In a third aspect of this disclosure, an activating adapter may be provided, comprising a first segment and a second segment, wherein the 3' end of the first segment includes the topoisomerase recognition sequence, the topoisomerase recognition sequence being covalently coupled to the topoisomerase, and the 5' end of the second segment includes at least a portion of the anticomplementary sequence of the topoisomerase recognition sequence and optional additional sequences, wherein the topoisomerase recognition sequence and at least a portion of the anticomplementary sequence of the topoisomerase recognition sequence are annealed to form a first double-stranded structure.

[0018] The topoisomerase described therein has the activity of linking a target biomolecule to the 3' end of the first segment, wherein the target biomolecule contains a hydroxyl group at the 5' end.

[0019] In a fourth aspect of this disclosure, a method for preparing the activated adapter described in the third aspect of this disclosure may be provided, the method comprising: reacting a topoisomerase with a first double strand, wherein the first double strand comprises a topoisomerase recognition sequence and an inverse complementary sequence thereof, wherein the topoisomerase recognition sequence and the inverse complementary sequence thereof are annealed to form a second double strand structure.

[0020] In a fifth aspect of this disclosure, a kit for nanopore sequencing may be provided, comprising the activated adapters described in the third aspect of this disclosure or the activated adapters prepared in the fourth aspect.

[0021] In a sixth aspect of this disclosure, the use of the activated adapters described in the third aspect or the activated adapters prepared in the fourth aspect of this disclosure in nanopore sequencing can be provided. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in this disclosure, the accompanying drawings used in the description of the specific embodiments will be briefly introduced below.

[0023] Figure 1 illustrates a schematic diagram of a method for preparing a sequencing library according to some embodiments of the present disclosure.

[0024] Figure 2 shows a schematic diagram of a method for preparing an activated connector according to some embodiments of the present disclosure.

[0025] Figure 3 shows the efficiency test results of the preparation of the activated connector in Example 1.

[0026] Figure 4 shows the relationship between the amount of PNK added and the efficiency of activated adapter preparation. A. The pre-activated adapter (or "pre-activated adapter"), the activated adapter, and the activation process used in this experiment. B. Different amounts of PNK (0-40U) were added to the adapter activation system. After the reaction, the bands were separated by denaturing polyacrylamide gel electrophoresis to detect the adapter activation efficiency. C. The activation efficiency was quantitatively analyzed by calculating the grayscale image of the product. The horizontal axis represents the amount of PNK added, and the vertical axis represents the adapter activation efficiency.

[0027] Figure 5 shows a schematic diagram of the preparation of a flat-end activated connector and a 3' end T-protruding viscous end activated connector according to some embodiments of the present disclosure.

[0028] Figure 6 shows a schematic diagram of the preparation results of flat-end and sticky-end activated joints according to some embodiments of the present disclosure.

[0029] Figure 7 shows a schematic diagram of the connection between the activated adapter and the DNA to be tested according to some embodiments of the present disclosure.

[0030] Figure 8 shows the ligation results of the sticky-end activated adapter with the DNA to be tested according to some embodiments of the present disclosure.

[0031] Figure 9 shows the ligation results of blunt-end activated adapters with DNA to be tested according to some embodiments of the present disclosure.

[0032] Figure 10 shows a schematic diagram of the second adapter-activated adapter-DNA ligation reaction according to some embodiments of the present disclosure.

[0033] Figure 11 shows a schematic diagram of an activated adapter-DNA ligation reaction according to some embodiments of the present disclosure.

[0034] Figure 12 illustrates the process differences between the traditional database construction method and the database construction method of this disclosure.

[0035] Figure 13 shows a schematic diagram of a method for preparing a modified activated sequencing adapter according to some embodiments of the present disclosure.

[0036] Figure 14 shows the results of HPLC purification of modified activated sequencing adapters. A. Purification results of sticky-end products, peak 3 is the target product peak; B. Purification results of blunt-end products, peak 3 is the target product peak.

[0037] Figure 15 shows the purity test results of the products obtained by the ligation method according to some embodiments of the present disclosure. A. Results of ligation and purification of sticky-end products with adapters: Peak 1 represents the free activated adapter, Peak 2 represents the target nucleic acid to be ligated, Peak 3 represents the single-end ligation product, Peak 4 represents the double-end ligation product, Blue represents the product before magnetic bead purification (I), and Red represents the product after magnetic bead purification (II); B. Results of ligation and purification of blunt-end products with adapters: Peak 1 represents the free activated adapter, Peak 2 represents the target nucleic acid to be ligated, Peak 3 represents the single-end ligation product, Peak 4 represents the double-end ligation product, Blue represents the product before magnetic bead purification (I), and Red represents the product after magnetic bead purification (II).

[0038] Figure 16 shows a schematic diagram of a connection method according to some other embodiments of the present disclosure.

[0039] Figure 17 shows the purity test results of the products obtained by the ligation method according to other embodiments of the present disclosure. Peak 1 represents the free activated adapter, peak 2 represents the target nucleic acid to be ligated, peak 3 represents the single-end ligation product, and peak 4 represents the double-end ligation product. A, ligation product of blunt-end nucleic acid and adapter; B, ligation product of sticky-end nucleic acid and adapter. Detailed Implementation

[0040] Unless otherwise stated, all figures used in this specification and claims to represent content, concentration, proportion, mass, volume, time, temperature, technical effect, etc., should in any instance be understood to be modified by the terms “about” or “approximately”. Therefore, unless indicated to the contrary, the numerical parameters listed in the following specification and appended claims are approximate values. They can vary for those skilled in the art depending on the desired properties and effects sought through this disclosure, and each numerical parameter should be interpreted according to the number of significant figures and conventional rounding methods or in a manner understood by those skilled in the art.

[0041] Although the numerical ranges and parameters described in this disclosure are approximate, the values ​​presented in the specific embodiments are provided as precisely as possible. However, any numerical value will inherently contain some errors, which are necessarily caused by the standard deviation found in its corresponding test measurements. Each numerical range given in this specification will include every narrower numerical range falling within that wider range, as if these narrower numerical ranges were explicitly stated herein.

[0042] When used in this article, unless otherwise specified, nucleic acids are written from left to right in a 5' to 3' direction.

[0043] In a first aspect of this disclosure, a method for characterizing a target biomolecule may be provided, comprising:

[0044] Provide the conditions for using topoisomerases to ligate target biomolecules and linkers to obtain the first liquid-phase product.

[0045] By immobilizing the topoisomerase, the free topoisomerase, and / or the linker bound to the topoisomerase, and / or the target biomolecule bound to the topoisomerase, in the first liquid product, a second liquid product is obtained.

[0046] The second liquid product or its purified third product containing the target biomolecule is brought into contact with a pore, allowing the target biomolecule to pass through and move relative to the pore, thereby obtaining one or more measurements representing one or more characteristics of the target biomolecule.

[0047] As used herein, "target biomolecule" can include any biomolecule that needs to be sequenced. In some embodiments of this disclosure, the target biomolecule includes polynucleotides, peptides, polysaccharides, and lipids. In some embodiments, the target biomolecule is DNA or RNA. In some embodiments, the target biomolecule includes fully double-stranded polynucleotides, partially double-stranded polynucleotides, or single-stranded polynucleotides.

[0048] Ligation can be performed under any conditions, as long as the linker is allowed to connect with the target biomolecule via the action of a topoisomerase. In some embodiments of this disclosure, the ligation reaction is carried out under conditions where the topoisomerase is active. In some embodiments of this disclosure, the conditions for carrying out the ligation reaction, such as temperatures, include 0°C-50°C, 0°C-45°C, 0°C-40°C, 4°C-40°C, 4°C-39°C, 4°C-38°C, 4°C-37°C, 10°C-40°C, 15°C-40°C, 20°C-40°C, 25°C-40°C, 30°C-40°C, 35°C-40°C, 35°C-40°C, 37°C-40°C, 10°C-39°C, 15°C-39°C, and 20°C-39°C. 25℃-39℃, 30℃-39℃, 35℃-39℃, 36℃-39℃, 37℃-39℃, 10℃-38℃, 15℃-38℃, 20℃-38℃, 25℃-38℃, 30℃-38℃, 35℃-38℃, 36℃-38℃, 37℃-38℃, 10℃-37℃, 15℃-37℃, 20℃-37℃, 25℃-37℃, 30℃-37℃, 35℃-37℃, 36℃-37℃ or approximately 37℃.

[0049] Under appropriate conditions, the adapter is attached to the end of the target biomolecule by the action of a topoisomerase coupled to the topoisomerase recognition sequence in the adapter, while the topoisomerase is released.

[0050] In some embodiments of this disclosure, the connector is attached to both ends of the target biomolecule. In some embodiments of this disclosure, the connector is attached to only one end of the target biomolecule.

[0051] In some embodiments of this disclosure, the molar ratio of the adapter to the target biomolecule is 1:100 to 100:1, 1:50 to 50:1, 1:20 to 20:1, 1:10 to 10:1, 1:10 to 5:1, 1:10 to 4:1, 1:10 to 3:1, 1:10 to 2:1, 1:10 to 1:1, 1:5 to 10:1, 1:5 to 5:1, 1:5 to 4:1, or 1:5 to 3:1. 1:5 to 2:1, 1:5 to 1:1, 2:5 to 10:1, 2:5 to 5:1, 2:5 to 4:1, 2:5 to 3:1, 2:5 to 2:1, 2:5 to 1:1, 4:5 to 10:1, 4:5 to 5:1, 4:5 to 4:1, 4:5 to 3:1, 4:5 to 2:1, 4:5 to 1:1, 8:5 to 10:1, 8:5 to 5:1, 8:5 to 4:1, 8:5 to 3:1, 8 5 to 2:1, 8:5 to 1:1, 1:4 to 10:1, 1:4 to 5:1, 1:4 to 4:1, 1:4 to 3:1, 1:4 to 2:1, 1:4 to 1:1, 1:3 to 10:1, 1:3 to 5:1, 1:3 to 4:1, 1:3 to 3:1, 1:3 to 2:1, 1:3 to 1:1, 1:2 to 10:1, 1:2 to 5:1, 1:2 to 4:1, 1:2 to 3:1, 1 :2 to 2:1, 1:2 to 1:1, 1:1 to 10:1, 1:1 to 5:1, 1:1 to 4:1, 1:1 to 3:1, 1:1 to 2:1, 1:1 to 1:1, 2:1 to 10:1, 2:1 to 5:1, 2:1 to 4:1, 2:1 to 3:1, 3:1 to 10:1, 3:1 to 5:1, 3:1 to 4:1, 4:1 to 10:1, 4:1 to 5:1 or 5:1 to 10:1.

[0052] In some embodiments of this disclosure, both the connector and the target biomolecule have sticky ends. In some embodiments of this disclosure, both the connector and the target biomolecule have blunt ends.

[0053] In some embodiments of this disclosure, the molar ratio of the connector with viscous ends to the target biomolecule with viscous ends is 1:1 to 3:1. In some embodiments of this disclosure, the molar ratio of the connector with viscous ends to the target biomolecule with viscous ends is 2:1.

[0054] In some embodiments of this disclosure, the molar ratio of the blunt-ended connector to the blunt-ended target biomolecule is 3:1 to 5:1. In some embodiments of this disclosure, the molar ratio of the blunt-ended connector to the blunt-ended target biomolecule is 4:1.

[0055] The connection of the adapter to the DNA to be tested according to some embodiments of the present disclosure is shown in FIG7, including the connection of the adapter with a sticky end to the target biomolecule with a sticky end, and the connection of the adapter with a blunt end to the target biomolecule with a blunt end.

[0056] In some embodiments of this disclosure, the topoisomerase is bound to the surface of a solid material.

[0057] In some embodiments of this disclosure, the solid material includes, but is not limited to, magnetic beads, silicon dioxide, silicates, and organic materials.

[0058] In some embodiments of this disclosure, the solid material includes magnetic beads, and the interaction between the magnetic beads and a magnetic field is used to achieve solid-liquid phase separation (solid material removal).

[0059] In some embodiments of this disclosure, separation (removal of solid material) is achieved by means of a gravity field or filtration.

[0060] In some embodiments of this disclosure, the throughput and / or duration of characterizing the target biomolecule are increased.

[0061] In some embodiments of this disclosure, the pores are nanopores, and / or biological pores, solid pores, or pores that are a hybrid of biological and solid components.

[0062] In some embodiments of this disclosure, the biopores are preferably derived from autolysin, leukocytoxin, CsgG, Mycobacterium smegmatis porin A (MspA), porin B, porin C, porin D, outer membrane porin F, outer membrane porin G, outer membrane phospholipase A, Neisseria spp. autotransporter lipoprotein, and WZA.

[0063] In some embodiments of this disclosure, the solid pores are preferably derived from graphene nanopores, MoS2 nanopores, BN nanopores, or PA63 nanopores.

[0064] In some embodiments of this disclosure, the topoisomerase is immobilized by conjugating a free topoisomerase in the first liquid product, and / or a topoisomerase-binding linker, and / or a topoisomerase-binding target biomolecule to the surface of a solid material (e.g., a solid support).

[0065] Preferably, the method of immobilizing the topoisomerase further includes: removing the solid material obtained after binding, and / or the method of binding the topoisomerase to the surface of the solid material includes an incubation step.

[0066] Preferably, the topoisomerase is bound to the surface of the solid material by at least one of the following methods:

[0067] (1) Through the binding of a first molecule linked to the topoisomerase and a second molecule linked to the solid material;

[0068] (2) By means of an anti-toposome antibody disposed on the surface of the solid material.

[0069] The first and second molecules can be any molecular pair capable of specific binding, including but not limited to biotin / avidin (e.g., biotin / streptavidin, biotin / neutrophil), antibody / antigen, antibody / hapten, DNA / complementary DNA or RNA, enzyme / substrate, enzyme / inhibitor, enzyme / cofactor, receptor / ligand (e.g., hormone / hormone receptor, folic acid / folic acid receptor), lectin / sugar, Staphylococcus A protein / IgG, cation / anion, spy-tag / spy-catcher, strep-tag (and its mutants) / streptavidin (and its mutants).

[0070] In some embodiments of this disclosure, the first molecule and the second molecule are biotin / avidin, biotin / biotin antibody, digoxigenin / digoxigenin antibody, or FAM / FAM antibody.

[0071] When used in this article, "the first molecule and the second molecule are biotin / avidin" encompasses both cases where "the first molecule is biotin and the second molecule is avidin" and "the first molecule is avidin and the second molecule is biotin." Similar expressions are interpreted in the same way and will not be elaborated further.

[0072] In some embodiments of this disclosure, conditions are provided for using a topoisomerase to ligate a target biomolecule and a linker, wherein:

[0073] Prior to ligation, i) at least one end of the target biomolecule or adapter contains a recognition sequence and / or recognition structure for a topoisomerase, and / or ii) the topoisomerase binds to at least one end of the target biomolecule or adapter and forms an activated molecule or activated adapter, which is capable of ligating to the adapter or the activated adapter is capable of ligating to the target biomolecule.

[0074] Optionally, in i) and / or ii), the topoisomerase is modified for binding to the surface of a solid material while maintaining its activity in forming the linkage.

[0075] After ligation, a covalent link between the end of the target biomolecule and the end of the adapter is formed, either a single-stranded nucleic acid link or a double-stranded nucleic acid link.

[0076] Preferably, the ligation does not involve the addition of DNA ligase.

[0077] When used herein, the term "activated adapter" or "activated molecule" refers to an adapter or molecule in which the 3' end of one strand contains a topoisomerase recognition sequence covalently coupled to a topoisomerase, thereby enabling the activated adapter to directly connect to a target biomolecule containing a hydroxyl group at its 5' end without the aid of a DNA ligase.

[0078] In some embodiments of this disclosure, the topoisomerase includes type I topoisomerase and / or type II topoisomerase. Preferably, the type I topoisomerase includes type IB topoisomerase. More preferably, the type IB topoisomerase includes vaccinia virus topoisomerase I. Preferably, the modification of the topoisomerase to target the binding site to the solid material surface is a thiol group.

[0079] Surprisingly, the inventors of this application discovered that thiol modification has the least impact on the ligation activity of topoisomerases such as vaccinia virus topoisomerase.

[0080] In some embodiments of this disclosure, the activating linker or activating molecule described in ii) comprises a first segment and a second segment, the 3' end of the first segment comprising the topoisomerase recognition sequence covalently coupled to the topoisomerase, and the 5' end of the second segment comprising at least a portion of the anticomplementary sequence of the topoisomerase recognition sequence and optional additional sequences, wherein the topoisomerase recognition sequence and at least a portion of the anticomplementary sequence of the topoisomerase recognition sequence are annealed to form a first double-stranded structure.

[0081] The topoisomerase described herein has the activity of linking a target biomolecule or linker to the 3' end of the first segment, wherein the target biomolecule or linker contains a hydroxyl group at the 5' end.

[0082] Preferably, in the activated linker or activated molecule, the 3' end of the first segment protrudes or is missing one or more nucleotides compared to the 5' end of the second segment (i.e., the ligation product obtained by sticky end ligation).

[0083] Unexpectedly, the inventors of this application discovered that topoisomerases are more efficient at ligating sticky ends, as demonstrated by the results of Example 4 of this application; and the throughput, total number of reads, and effective wells of nanopore sequencing are significantly higher for sticky end ligation products, which is more conducive to improving the throughput of nanopore sequencing, as demonstrated by the results of Example 7 of this application.

[0084] As used in this article, the term "reverse complementarity" refers to the pairing of purine and pyrimidine bases on opposite, parallel polynucleotide chains around a helical axis through hydrogen bonds, in accordance with the principle of base complementarity. Specifically, adenine (A) on one chain forms a hydrogen bond with thymine (T) or uracil (U) on the other chain; while guanine (G) forms a hydrogen bond with cytosine (C).

[0085] When used in this paper, the statement "the 3' end of segment X contains sequence A" means that sequence A is located closest to the 3' end of segment X, and all other sequences in segment X are located at the 5' end of sequence A.

[0086] When used in this paper, the statement "the 5' end of segment Y contains the B sequence" means that the B sequence is located closest to the 5' end of segment Y, and all other sequences in segment Y are located at the 3' end of the B sequence.

[0087] In some embodiments of this disclosure, in nanopore sequencing, the activated adapter is attached to both ends of the target biomolecule. In some embodiments of this disclosure, in nanopore sequencing, the activated adapter is attached to only one end of the target biomolecule.

[0088] In some embodiments of this disclosure, the 5' end of the first segment in the activated adapter includes a loading region for a motor protein used to control the permeation rate of the target biomolecule.

[0089] In some embodiments of this disclosure, the motor protein includes a polynucleotide-binding protein or a protein translocase.

[0090] In some embodiments of this disclosure, the polynucleotide-binding protein includes at least one of DNA polymerase, RNA polymerase, helicase, endonuclease, exonuclease, DNA protease, topoisomerase, nuclease, nickase, or any fusion protein thereof.

[0091] In some embodiments of this disclosure, the protein translocase is a unfolding enzyme, preferably an NTP-driven unfolding enzyme, more preferably an AAA+ enzyme, and most preferably a ClpX unfolding enzyme, VAT unfolding enzyme, PAN unfolding enzyme, AMA unfolding enzyme, MBA unfolding enzyme, SAMP unfolding enzyme, ClpA unfolding enzyme, ClpC unfolding enzyme or ClpE unfolding enzyme, or functional mutants thereof.

[0092] In a second aspect of this disclosure, a ligation method or a method for preparing a sequencing library may be provided, comprising:

[0093] Provide the conditions for using topoisomerases to ligate target biomolecules and linkers to obtain the first liquid-phase product.

[0094] By immobilizing the topoisomerase, the free topoisomerase and / or the linker of the topoisomerase or the target biomolecule bound to the topoisomerase in the first liquid product are removed to obtain the second liquid product.

[0095] In some embodiments of this disclosure, the ligation method or the method for preparing the sequencing library further includes the method described in the first aspect of this disclosure.

[0096] By using a solid-phase material and a combination of the first and second molecules, or a combination of topoisomerase and anti-topoisomerase antibody (to bind non-target biomolecules to the surface of the solid-phase material) in the ligation method, excess (free unreacted) linkers, free topoisomerase after the ligation reaction, and byproducts can be removed rapidly and conveniently. This purifies the ligation product of the activated linker and the target biomolecule. After separation and removal, the supernatant containing the target biomolecule can be directly aspirated for subsequent reactions, completing the purification process in approximately 2 minutes. In contrast, existing methods purify the target product by adsorbing it onto a solid-phase material, followed by rinsing, drying, and elution, taking approximately 30 minutes in total. Therefore, the method disclosed herein meets users' needs for rapid library construction.

[0097] In some embodiments of this disclosure, the 5' end of the first segment or the 3' end of the second segment is modified with TCO (trans-cyclooctene).

[0098] In some embodiments of this disclosure, the method further includes adding a second double-stranded polymer (or second connector), wherein the 3' end of one chain of the second connector is modified with TZ (tetraazine). In some embodiments of this disclosure, the joining method further includes joining the activated connector and the second connector together via a click chemistry reaction.

[0099] In some embodiments of this disclosure, the second adapter-activated adapter-test DNA ligation reaction is shown in Figure 10. The activated adapter, modified with TCO (shown as a sphere in the figure), is ligated to the end of the test DNA via its coupled topoisomerase, and subsequently ligated to the second adapter, modified with TZ (shown as an arc in the figure), via a click chemistry reaction.

[0100] In some embodiments of this disclosure, the activation adapter is linked to a rate-controlling enzyme (including but not limited to helicase).

[0101] In some embodiments of this disclosure, the activated adapter-DNA ligation reaction is shown in Figure 11. An activated adapter containing both helicase (elliptical) and topoisomerase (square-round) is constructed. This adapter ligates to the target blunt-end or sticky-end DNA under the mediation of the topoisomerase, followed by nanopore sequencing under the rate-controlled action of the helicase.

[0102] Traditional library preparation methods are based on the principle of forward purification: target molecules are bound to the surface of magnetic beads or other materials, while non-target molecules remain free in the solution. The solid-phase material is then separated, and finally, the target product on the material surface is eluted to obtain the purified product. The forward purification process includes steps such as magnetic bead binding, rinsing, drying, and elution, which is relatively cumbersome and takes more than 30 minutes. In contrast, the method disclosed in this paper is based on negative screening: non-target molecules are bound to the surface of magnetic beads or other solid-phase materials, and after separation and removal, the supernatant containing the target nucleic acid is directly aspirated for subsequent reactions. This approach is simple and rapid, completing the purification process in approximately 2 minutes. The differences in the procedures between the traditional library preparation method and the library preparation method disclosed in this paper are shown in Figure 12.

[0103] Figure 1 shows a method for preparing sequencing libraries according to some embodiments of this disclosure. The library construction process based on topoisomerase consists of four steps: 1) Activated adapter preparation. The topoisomerase recognizes and cleaves the C / TCCTT site on the adapter and covalently binds to the 3' phosphate group of the cleavage site via its own tyrosine hydroxyl group, forming an activated adapter; 2) Sample processing. The DNA to be tested undergoes end repair-dephosphorylation treatment to form blunt-ended double-stranded DNA with a 5' hydroxyl group; 3) Adapter ligation. The 5' hydroxyl group of the DNA to be tested attacks the phosphate group at the 3' end of the activated adapter, forming a stable phosphodiester bond, and the topoisomerase detaches from the activated adapter; 4) The TCO group at the 3' end of the second adapter reacts with the TZ group at the 5' end of the activated adapter through a click chemistry reaction to form a stable covalent link. This product, after purification, can be directly used for nanopore sequencing.

[0104] Preparation and use of biotin-modified activated linkers according to some embodiments of this disclosure, wherein:

[0105] A. React topoisomerase with NHS-PGE12-biotin molecules, and use the principle of NHS reacting with free primary amines of proteins to couple the biotin group to the surface of the topoisomerase protein.

[0106] B. An activated sequencing adapter is prepared using a modified topoisomerase, which is then linked to the DNA to be tested, releasing the free topoisomerase.

[0107] C. The ligation reaction system is incubated with magnetic beads containing streptavidin, in which free topoisomerase and unreacted activated sequencing adapters are adsorbed onto the magnetic beads. The supernatant solution after magnetic adsorption can be directly used for sequencing reaction.

[0108] A method for preparing a sequencing library according to a specific embodiment of this disclosure, wherein:

[0109] A. Modify the surface of topoisomerases with biotin groups based on the principle of the reaction between NHS and primary protein amines;

[0110] B. Activated linkers were prepared using biotin-modified topoisomerase and bound to magnetic beads modified with streptavidin;

[0111] C. Ligate the DNA to be tested with magnetic beads containing activated adapters. Free magnetic beads and unreacted adapters are adsorbed and precipitated using a magnetic field; the supernatant is then used directly for subsequent sequencing reactions.

[0112] In a third aspect of this disclosure, an activating adapter may be provided, comprising a first segment and a second segment, wherein the 3' end of the first segment includes the topoisomerase recognition sequence, the topoisomerase recognition sequence being covalently coupled to the topoisomerase, and the 5' end of the second segment includes at least a portion of the anticomplementary sequence of the topoisomerase recognition sequence and optional additional sequences, wherein the topoisomerase recognition sequence and at least a portion of the anticomplementary sequence of the topoisomerase recognition sequence are annealed to form a first double-stranded structure.

[0113] The topoisomerase described therein has the activity of linking a target biomolecule to the 3' end of the first segment, wherein the target biomolecule contains a hydroxyl group at the 5' end.

[0114] In some embodiments of this disclosure, the topoisomerase is bound to the surface of a solid material.

[0115] In some embodiments of this disclosure, the topoisomerase is bound to the surface of the solid material by at least one of the following methods:

[0116] (1) Through the binding of a first molecule linked to the topoisomerase and a second molecule linked to the solid material;

[0117] (2) By means of an anti-toposome antibody disposed on the surface of the solid material.

[0118] In some embodiments of this disclosure, the type I topoisomerase includes type IB topoisomerase, more preferably, the type IB topoisomerase includes vaccinia virus topoisomerase I, and even more preferably, the target site for linking the first molecule in the topoisomerase is a thiol group.

[0119] And / or, the 5' end of the first segment contains a loading region for a motor protein;

[0120] And / or, in the activated linker, the 3' end of the first segment protrudes or is missing one or more nucleotides compared to the 5' end of the second segment (i.e., the ligation product obtained by sticky end ligation).

[0121] In a fourth aspect of this disclosure, a method for preparing the activated adapter described in the third aspect of this disclosure may be provided, the method comprising: reacting a topoisomerase with a first double strand, wherein the first double strand comprises a topoisomerase recognition sequence and an inverse complementary sequence thereof, wherein the topoisomerase recognition sequence and the inverse complementary sequence thereof are annealed to form a second double strand structure.

[0122] As used herein, the term "double-stranded product" refers to a product formed between two nucleic acid strands or between two parts of a nucleic acid strand through reverse complementarity of sequences. In addition to reverse complementary regions, double-stranded products can also contain non-reverse complementary regions; that is, double-stranded products can contain both double-stranded and single-stranded regions.

[0123] In some embodiments of this disclosure, the method includes: (1) annealing a first single-stranded DNA, a second single-stranded DNA, and a third single-stranded DNA to form a complex, wherein the 5' end of the second single-stranded DNA is anticomplementary to the first single-stranded DNA, and the 3' end of the third single-stranded DNA is anticomplementary to the first single-stranded DNA.

[0124] In the first single-stranded DNA, the sequence anticomplementing the 5' end of the second single-stranded DNA and the sequence anticomplementing the 3' end of the third single-stranded DNA are either consecutive or separated by one or more nucleotides.

[0125] The first single-stranded DNA contains a topoisomerase recognition sequence, and the 5' end of the second single-stranded DNA and the 3' end of the third single-stranded DNA together contain the inverse complementary sequence of the topoisomerase recognition sequence; and

[0126] (2) React the topoisomerase with the complex to obtain the activated linker.

[0127] The activated connector comprises a first segment and a second segment, which form a double chain. The 3' end of the first segment and the 5' end of the second segment are oppositely complementary.

[0128] The 3' end of the first segment is flush with the 5' end of the second segment, or the 3' end of the first segment protrudes or is missing one or more nucleotides compared to the 5' end of the second segment.

[0129] The 3' end of the first segment contains a topoisomerase recognition sequence, wherein the topoisomerase recognition sequence is covalently coupled to the topoisomerase.

[0130] In some embodiments of this disclosure, the sequence in the first single-stranded DNA that is anticomplementary to the 3' end of the third single-stranded DNA and the topoisomerase recognition sequence are continuous or at least partially overlapping, preferably with one nucleotide overlap. In some embodiments of this disclosure, the sequence in the first single-stranded DNA that is anticomplementary to the 3' end of the third single-stranded DNA and the topoisomerase recognition sequence have one, two, three, four, or five nucleotide overlaps.

[0131] Figure 2 shows a method for preparing activated adapters according to some embodiments of this disclosure. A 56 bp single-stranded DNA fragment (44 bp before the cleavage site and 12 bp after the cleavage site) with FAM and TET fluorescent modifications at both ends is annealed with complementary DNA of different lengths (extending 0-12 bp from the corresponding cleavage site). A topoisomerase recognizes the above structure (T / CCCTT) and cleaves it, simultaneously covalently binding to the 3' phosphate group at the cleavage site to form an activated adapter. The reaction product is separated by denaturing polyacrylamide gel electrophoresis, forming four independent bands: 1) unactivated single-stranded DNA (with both FAM and TET fluorescent modifications); 2) single-stranded DNA coupled with topoisomerase (with only FAM fluorescent modification); 3) the cleaved fragment (with TET modification); and 4) the complementary DNA single strand (without fluorescent modification). The preparation efficiency of the activated adapter can be determined by the changes in the content of each band.

[0132] Figure 13 shows a method for preparing a modified activated sequencing adapter according to some embodiments of this disclosure. First, an active adapter is prepared by reacting a pre-activated adapter with a topoisomerase. Then, biotin is covalently bound to the surface of the topoisomerase using the reaction properties of maleimide with thiol groups. Finally, a motor protein is locked in the pore-forming single-stranded region of the activated adapter to prepare a modified activated sequencing adapter.

[0133] In some embodiments of this disclosure, the anti-complementary sequence at the 3' end of the first single-stranded DNA and the topoisomerase recognition sequence are contiguous. For example, in the first single-stranded DNA, the topoisomerase recognition sequence is located at positions 50-55, and the anti-complementary sequence at the 3' end of the third single-stranded DNA is located at positions 56-66; in this case, the anti-complementary sequence at the 3' end of the first single-stranded DNA and the topoisomerase recognition sequence are considered contiguous. In some embodiments of this disclosure, the 5' end of the second single-stranded DNA contains the anti-complementary sequence of the topoisomerase recognition sequence. In some embodiments of this disclosure, after a cleavage reaction, the 3' end of the first strand is flush with the 5' end of the second strand. In some embodiments of this disclosure, the activated adapter has blunt ends. As used herein, "blunt ends" refers to the double-stranded DNA ending without any additional nucleotide sequence, but directly with a base pair.

[0134] In some embodiments of this disclosure, the sequence in the first single-stranded DNA that is anticomplementary to the 3' end of the third single-stranded DNA and the topoisomerase recognition sequence at least partially overlap. For example, in the first single-stranded DNA, the topoisomerase recognition sequence is located at positions 50-55, and the sequence in the first single-stranded DNA that is anticomplementary to the 3' end of the third single-stranded DNA is located at positions 50-63, 51-63, 52-63, 53-63, 54-63, or 55-63. In this case, the sequence in the first single-stranded DNA that is anticomplementary to the 3' end of the third single-stranded DNA and the topoisomerase recognition sequence are considered to at least partially overlap. In some embodiments of this disclosure, after the cleavage reaction, the 3' end of the first strand protrudes or is missing one or more nucleotides compared to the 5' end of the second strand. In some embodiments of this disclosure, the activated adapter has a sticky end. In some embodiments of this disclosure, the activated adapter has a sticky end that protrudes or is missing at the 3' end. When used in this article, "sticky ends" refers to the ends of double-stranded DNA molecules that have a certain length of single-stranded DNA sequence that can pair with the sticky ends of another DNA molecule to form a link.

[0135] In some embodiments of this disclosure, the sequence in the first single-stranded DNA that is anticomplementary to the 3' end of the third single-stranded DNA overlaps with the topoisomerase recognition sequence by one nucleotide. For example, in the first single-stranded DNA, the topoisomerase recognition sequence is located at positions 50-55, and the sequence anticomplementary to the 3' end of the third single-stranded DNA is located at positions 55-63. In this case, it is considered that the sequence in the first single-stranded DNA that is anticomplementary to the 3' end of the third single-stranded DNA overlaps with the topoisomerase recognition sequence by one nucleotide. In some embodiments of this disclosure, after the topoisomerase-mediated cleavage reaction, the 3' end of the first strand protrudes or is missing one nucleotide compared to the 5' end of the second strand.

[0136] In some embodiments of this disclosure, the sequence in the first single-stranded DNA that is reverse complementary to the 3' end of the third single-stranded DNA and the topoisomerase recognition sequence are disconnected, for example, by a gap of 1, 2, 3, 4 or 5 nucleotides.

[0137] The preparation of the flat-end activated connector and the 3' end T-protruding sticky-end activated connector according to some embodiments of this disclosure is shown in Figure 5, wherein:

[0138] A. Schematic diagram of blunt-end activated adapter preparation. Before activation, the adapter is formed by annealing three single-stranded DNA segments to create a double-stranded DNA product with a notch, which corresponds to the cleavage site. Topoisomerase recognizes a specific sequence and performs a cleavage-ligation reaction to form an activated adapter with blunt ends.

[0139] B. Schematic diagram of the preparation of an activated adapter with a 3' T-protruding sticky end. Before activation, the adapter is formed by three-stage annealing to create a double-stranded DNA product with a nick located one base downstream of the complementary strand of the cleavage site. After a topoisomerase recognizes a specific sequence and performs a cleavage-ligation reaction, an activated adapter with a 3' T-protruding sticky end is formed.

[0140] Topoisomerases are enzymes that modify the topological state of DNA through the breaking and rejoining of DNA strands. Topoisomerases are classified into type I topoisomerases, which cleave a single strand of a double-stranded nucleic acid molecule, including types IA and IB, and type II topoisomerases (gyrases), which cleave both strands of a nucleic acid molecule. As disclosed herein, type I and type II topoisomerases, along with their catalytic domains and mutant forms, can be used to generate the activated adaptors provided herein.

[0141] Type IA and Type IB topoisomerases cleave one strand of a double-stranded nucleic acid molecule. Cleavage of a double-stranded nucleic acid molecule by a Type IA topoisomerase produces a 5' phosphate and a 3' hydroxyl group at the cleavage site, and the Type IA topoisomerase is covalently bound to the 5' end of the cleaved strand. In contrast, cleavage of a double-stranded nucleic acid molecule by a Type IB topoisomerase produces a 3' phosphate and a 5' hydroxyl group at the cleavage site, and the Type IB topoisomerase is covalently bound to the 3' end of the cleaved strand. Type IA topoisomerases include, for example, E. coli topoisomerase I and topoisomerase III, eukaryotic topoisomerase II, and Archaeoptera reverse gyrase.

[0142] Type IB topoisomerases include nuclear type I topoisomerases present in all eukaryotic cells and enzymes encoded by vaccinia and other cell poxviruses. Eukaryotic type IB topoisomerases are exemplified by enzymes expressed in yeast, fruit fly, and mammalian cells, including human cells. Viral type IB topoisomerases are exemplified by enzymes produced by vertebrate poxviruses (vaccinia, schop fibroma virus, ORF virus, fowlpox virus, and molluscum contagiosum virus) and insect poxviruses (moth poxvirus).

[0143] Type II topoisomerases include, for example, bacterial gyrases, bacterial DNA topoisomerase IV, eukaryotic DNA topoisomerase II, and T-peptide phage-encoded DNA topoisomerases. Like type IB topoisomerases, type II topoisomerases possess both cleavage and ligation activities. Furthermore, like type IB topoisomerases, substrate double-stranded nucleic acid molecules can be prepared such that the type II topoisomerase can form a covalent bond with one strand at the cleavage site. For example, calf thymus type II topoisomerase cleaves substrate double-stranded nucleic acid molecules containing a 5'-depression topoisomerase recognition site located three nucleotides from the 5' end, causing the three nucleic acid molecules at the 5' cleavage site to dissociate and the topoisomerase to covalently bind to the 5' end of the double-stranded nucleic acid molecule. Additionally, after such double-stranded nucleic acid molecules loaded with type II topoisomerase come into contact with a second nucleic acid molecule containing a 3' hydroxyl group, the type II topoisomerase can ligate the sequences together and then release them from the recombinant nucleic acid molecule.

[0144] In some embodiments of this disclosure, the topoisomerase includes type I topoisomerase and / or type II topoisomerase. Preferably, the type I topoisomerase includes type IB topoisomerase. More preferably, the type IB topoisomerase includes vaccinia virus topoisomerase I. Even more preferably, the modification of the topoisomerase to target the binding site for the solid material surface is a thiol group.

[0145] In some embodiments of this disclosure, the length of the third single-stranded DNA is ≥5 nt. In some embodiments of this disclosure, the length of the third single-stranded DNA is ≥6 nt, ≥7 nt, ≥8 nt, ≥9 nt, ≥10 nt, ≥11 nt, or ≥12 nt. In some embodiments of this disclosure, the length of the third single-stranded DNA is ≥12 bp.

[0146] In some embodiments of this disclosure, the length of the second single-stranded DNA is 10-140 nt. In some embodiments of this disclosure, the length of the second single-stranded DNA is 20-140 nt, 20-130 nt, 20-120 nt, 20-110 nt, 20-100 nt, 20-90 nt, 20-80 nt, 20-70 nt, 20-60 nt, 20-50 nt, 20-40 nt, 20-30 nt, 30-140 nt, 30-130 nt, 30-120 nt, 30-110 nt, 3... 0-100nt, 30-90nt, 30-80nt, 30-70nt, 30-60nt, 30-50nt, 30-40nt, 40-140nt, 40-130nt, 40-120n t, 40-110nt, 40-100nt, 40-90nt, 40-80nt, 40-70nt, 40-60nt, 40-50nt, 50-140nt, 50-130nt, 50- 120nt, 50-110nt, 50-100nt, 50-90nt, 50-80nt, 50-70nt, 50-60nt, 60-140nt, 60-130nt, 60-120n t, 60-110nt, 60-100nt, 60-90nt, 60-80nt, 60-70nt, 70-140nt, 70-130nt, 70-120nt, 70-110nt, 7 0-100nt, 70-90nt, 70-80nt, 80-140nt, 80-130nt, 80-120nt, 80-110nt, 80-100nt, 80-90nt, 90-140nt, 90-130nt, 90-120nt, 90-110nt, 90-100nt, 100-140nt, 100-130nt, 100-120nt or 100-110nt.

[0147] In some embodiments of this disclosure, the method further includes adding a reagent capable of phosphorylating the 5'-terminal hydroxyl group to a 5'-terminal phosphate group. Reagents capable of phosphorylating the 5'-terminal hydroxyl group to a 5'-terminal phosphate group include, but are not limited to, polynucleotide kinases (PNK).

[0148] In some embodiments of this disclosure, the first single-stranded DNA and the second single-stranded DNA are located on two different strands. In some embodiments of this disclosure, the first single-stranded DNA and the second single-stranded DNA are located on the same strand, that is, the first single-stranded DNA and the second single-stranded DNA are two segments on the same strand.

[0149] In some embodiments of this disclosure, the first single-stranded DNA and the third single-stranded DNA are located on two different strands. In some embodiments of this disclosure, the first single-stranded DNA and the third single-stranded DNA are located on the same strand, that is, the first single-stranded DNA and the third single-stranded DNA are two fragments on one strand.

[0150] In some embodiments of this disclosure, the second single-stranded DNA and the third single-stranded DNA are located on two different strands.

[0151] In some embodiments of this disclosure, the first chain segment and the second chain segment are located on two different chains. In some embodiments of this disclosure, the first chain segment and the second chain segment are located on the same chain, that is, the first chain segment and the second chain segment are two segments on the same chain.

[0152] In a fifth aspect of this disclosure, a kit for nanopore sequencing may be provided, comprising the activated adapters described in the third aspect of this disclosure or the activated adapters prepared in the fourth aspect.

[0153] In a sixth aspect of this disclosure, the use of the activated adapters described in the third aspect or the activated adapters prepared in the fourth aspect of this disclosure in nanopore sequencing can be provided.

[0154] The various embodiments and preferences described above can be combined with each other (as long as they are not inherently contradictory), and all embodiments formed by such combinations are considered part of the disclosure of this application.

[0155] The technical solutions of this disclosure will be illustrated more clearly and explicitly below with reference to embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of protection of this disclosure. The scope of protection of this disclosure is defined only by the claims.

[0156] Example

[0157] Unless otherwise stated or clearly contradicted by the context, all percentages in the examples are mass percentages.

[0158] Example 1: Preparation of activated linkers for coupled topoisomerases

[0159] 1. Preparation of the pre-activation connector

[0160] 1) Synthesize the activated pre-connector DNA fragments, with the names and sequences shown below:

[0161] Adaptor F: FAM-ATCTTCGCGTTCTAGGCACTTCACTTTCGTCTTCCACCCCCCTTATTCCGATAGTG(SEQ ID NO.1)-TET

[0162] Adaptor R-0:

[0163] Adaptor R-1:

[0164] Adaptor R-2:

[0165] Adaptor R-5:

[0166] Adaptor R-9:

[0167] Adaptor R-12:

[0168] Adapter nick:CACTATCGGAAT(SEQ ID NO.8)

[0169] 2) Anneal the connector according to List 1 below. The 1x annealing buffer composition is: 0.1M Tris-HCl, 0.1M NaCl, 0.05M EDTA. The annealing conditions are: heat at 95°C for 2 minutes, then decrease the temperature by 0.1°C every 5 seconds until reaching 25°C. The structure of the connector after annealing is shown in Figure 2.

[0170] Table 1. Nucleic acid components in each experimental group

[0171] 2. Prepare the activation adapter preparation system, the main components of which are: 2 μL of 10X topoisomerase reaction buffer (Tris-acetic acid 500 Mm, pH 7.5, sodium chloride 1 M, magnesium chloride 25 MmM, EDTA 1 MmM), 4 pmol of adapter before activation, 1 U of vaccinia virus topoisomerase I (D6952, Beyotime), and add deionized water to a volume of 20 μL. The negative control group (NC) uses double-stranded nucleic acid labeled 0 bp in Table 1, and the topoisomerase in the system is replaced with deionized water, while other components are the same as the experimental group. The above reaction system is heated in a metal bath at 37 °C for 30 minutes. 2 μL of the activation product is taken and separated into fragments by urea-polyacrylamide gel, and the adapter activation efficiency is detected by gel imaging.

[0172] 3. Experimental results are shown in Figure 3. The activated adapter covalently binds to topoisomerase. Its 5' FAM group is excited by blue light and, after denaturation, is located in the gel wells, at the top of the image. The unactivated adapter is a 56 bp DNA fragment, containing both FAM and TET groups, which are excited by blue and green light respectively, appearing cyan in the center of the image. The 12 bp fragment cut off during activation contains a TET group and is excited by green fluorescence, appearing at the bottom of the image. The structural type of the adapter before activation is marked above each band's gel well. It is evident that the adapter activation efficiency first increases and then decreases with the length of the second single-stranded DNA. The maximum activation efficiency occurs in the "12 bp nick" group, i.e., the activated adapter formed by three single-stranded DNA strands. This structure significantly improves the activation efficiency and yields blunt-ended activated adapters.

[0173] Example 2: PNK improves the efficiency of activated connector preparation

[0174] 1. Adapter preparation before activation. Anneal the adapter DNA fragments before activation in a 1:1:1 ratio. The 1x annealing buffer consisted of 0.1M Tris-HCl, 0.1M NaCl, and 0.05M EDTA. The annealing conditions were: heating at 95°C for 2 minutes, decreasing the temperature by 0.1°C every 5 seconds until reaching 25°C. The names and sequences of the three fragments are shown below:

[0175] Adaptor F':

[0176] CGGCCAAGCAGAAGACGGCATACGAGATCCCTTGATAGCACGTAG(SEQ ID NO.9)-FAM

[0177] Adaptor R': AAGGGATCTCGTATGCCGTCTTTCTGCTTG (SEQ ID NO.10)-Cy5

[0178] Adapter 12bp:CTACGTGCTATC(SEQ ID NO.11)

[0179] 2. Prepare the activation adapter preparation system, with the following main components: 2 μL of 10X reaction buffer (Tris-acetic acid 500 Mm, pH 7.5, sodium chloride 1 M, magnesium chloride 25 MmM, EDTA 1 MmM), 4 pmol of pre-activation adapter, 1 U of vaccinia virus topoisomerase I (D6952, Beyotime), 0.5 mM ATP, and 0 U, 1 U, 2 U, 5 U, 10 U, 20 U, and 40 U of PNK (MO201, NEB), with deionized water added to a final volume of 20 μL. The negative control group does not contain topoisomerase or PNK; all other components remain unchanged.

[0180] 3. React at 37℃ for 30 minutes, take 2ul of the reaction sample and perform urea denaturing polyacrylamide gel electrophoresis separation, and detect the position and fluorescence intensity of each band under a gel imaging system.

[0181] 4. The experimental results are shown in Figure 4. Subplot A illustrates the activation process: the 3' end of the 56 bp fragment is modified with FAM, and the 5' end of the 43 bp fragment is labeled with Cy5. The gel image is unstained, therefore all bands shown are excited by the labeled fluorescent molecules. The top band represents the unactivated adapter, containing FAM fluorescent molecules. After adapter activation, the 12 bp 3' end is cleaved, and the FAM molecules fall off; therefore, the activated product does not fluoresce and is not displayed on the gel image. The middle band represents the 43 bp fragment containing Cy5, and its content remains unchanged throughout the process. The cleaved 12 bp fragment carries FAM fluorescence and is located at the bottom. Because a denaturing gel containing urea was used, the DNA double strand unwinds and exists in a single-stranded state in the gel. In subplots B and C, the concentrations of PNK in each sample were 0 U, 1 U, 2 U, 5 U, 10 U, 20 U, and 40 U, ​​respectively. The results showed that as the amount of PNK added to the reaction system increased, the content of unactivated adapters gradually decreased after the reaction, while the number of small fragments cleaved during the activation process gradually increased. This indicates that the addition of PNK further improved the adapter activation efficiency, and the adapter activation efficiency increased with the increase of PNK content.

[0182] Example 3: Preparation of a viscous end-activated connector with a 3' end T-protrusion and a blunt end-activated connector

[0183] The preparation process of the viscous end and blunt end activated joint is shown in Figure 5, and the specific steps are as follows:

[0184] 1. Preparation of pre-activation adapters. Pre-activation adapters were annealed at a 1:1:1 ratio to prepare blunt-end and sticky-end pre-activation adapters. The 1x annealing buffer consisted of 0.1M Tris-HCl, 0.1M NaCl, and 0.05M EDTA. Annealing conditions were: heating at 95°C for 2 minutes, decreasing the temperature by 0.1°C every 5 seconds until reaching 25°C. The DNA fragments used in the experiment and their names are shown below:

[0185] 1) Activated connector before viscous end:

[0186] Adapter F-sticky:FAM-ATCTTCGCGTTCTAGGCACTTCACTTTCGTCTTCCACCCCCCTTATTCCGATAGTG(SEQ ID NO.1)-TET

[0187] Adaptor R-sticky:

[0188] Adaptor 13bp:CACTATCGGAATA(SEQ ID NO.13)

[0189] 2) Flat-end pre-activated connector:

[0190] Adapter F-blunt: FAM-ATCTTCGCGTTCTAGGCACTTCACTTTCGTCTTCCACCCCCCTTATTCCGATAGTG(SEQ ID NO.1)-TET

[0191] Adaptor R-blunt:

[0192] Adapter 12bp:CACTATCGGAAT(SEQ ID NO.8)

[0193] 2. Prepare the activated adapter preparation system, with the following main components: 2 μL of 10X reaction buffer (500 M Tris-acetic acid, pH 7.5, 1 M sodium chloride, 25 mM magnesium chloride, 1 mM EDTA), 4 pmol of pre-activated adapter (the experimental group with blunt-end adapters is marked "blunt" in Figure 6, and the experimental group with sticky-end adapters is marked "3'-T" in Figure 6), 1 U vaccinia virus topoisomerase I (D6952, Beyotime), 0.5 mM ATP, 0 U PNK (labeled "-" in Figure 6) or 5 U (labeled "+" in Figure 6), and deionized water to a final volume of 20 μL. The NC group does not contain topoisomerase or PNK; other components remain unchanged.

[0194] 3. React at 37℃ for 30 minutes, take 2ul of the reaction sample and perform urea denaturing polyacrylamide gel electrophoresis separation, and detect the position and fluorescence intensity of each band under a gel imaging system.

[0195] 4. The experimental results are shown in Figure 6. PNK improved the activation efficiency of the viscous end connector, and the activation efficiency of the viscous end connector and the flat end connector were similar.

[0196] Example 4: Determination of the ligation efficiency between activated adapters and the DNA to be tested

[0197] 1. Preparation of nucleic acid samples for testing. The blunt-end and sticky-end nucleic acid fragments to be tested were annealed separately at a 1:1 ratio. The annealing conditions were: heating at 95°C for 2 minutes, decreasing the temperature by 0.1°C every 5 seconds until reaching 25°C. The required nucleic acid names and sequences are as follows:

[0198] Target-sticky F:CTGCTCATTCGGTCCTGCTGACTTTAAGAGCTGTGCGCCGTA(SEQ ID NO.14)

[0199] Target-sticky R: ACGGCGCACAGCTCTTAAAGTCAGCAGGACCGAATGAGCAGA (SEQ ID NO.15)

[0200] Target-blunt F:TCTGCTCATTCGGTCCTGCTGACTTTAAGAGCTGTGCGCCGT(SEQ ID NO.16)

[0201] Target-blunt R:ACGGCGCACAGCTCTTAAAGTCAGCAGGACCGAATGAGCAGA(SEQ ID NO.15)

[0202] 2. Prepare the blunt-end ligation system, the main components of which are: 10X reaction buffer (Tris-acetic acid 500Mm pH7.5, sodium chloride 1M, magnesium chloride 25mM, EDTA 1mM) 1ul, blunt-end nucleic acid to be tested 0-0.5pmol, blunt-end activation adapter 0-2.0pmol, and deionized water to make up to 10ul.

[0203] 3. Prepare the sticky end ligation system, the main components of which are: 1ul of 10X reaction buffer, 0-0.5pmol of sticky end nucleic acid to be tested, 0-1pmol of sticky end activation adapter, and deionized water to make up to 10ul.

[0204] 4. Incubate the above reaction system in a metal bath at 37°C for 10 minutes. Take 2 μL of sample and perform 4-12% non-deformable polyacrylamide gel electrophoresis for separation. After SYBR-gold staining, analyze the band position and gray value.

[0205] 5. The connection diagram is shown in Figure 7, and the experimental results are shown in Figures 8 and 9. As the amount of activated adapter added increases, the proportion of target biomolecules that complete the connection reaction gradually increases. The connection efficiency of the target biomolecules with viscous ends was calculated to be 82.3% (activated adapter: target biomolecule = 2:1) based on grayscale values, and the connection efficiency of the target biomolecules with blunt ends was 74.6% (activated adapter: target biomolecule = 4:1).

[0206] Example 5: Sequencing library construction and sequencing of amplicon samples

[0207] 1. Preparation of blunt-end amplicon samples. PCR amplification was performed using Pfu DNA polymerase with pUC57 DNA plasmid as a template. The reaction system was as follows: 1X Pfu reaction buffer (20mM Tris-HCl (pH 8.8 at 25℃), 10mM (NH4)2SO4, 2mM MgSO4, 10mM KCl, 0.1% (v / v) Triton X-100, 0.1mg / ml BSA), 0.4μM forward amplification primer, 0.4μM reverse amplification primer, 0.1ng / ul template DNA, 0.2mM dNTPs, and 0.025U / ul Pfu DNA polymerase (D7216, Beyotime). The amplification reaction program was as follows: pre-denaturation: 94℃ for 3 minutes; denaturation: 94℃ for 30 seconds; annealing: 55℃ for 30 seconds; extension: 72℃ for 2 minutes; cycle number: 30; final extension: 72℃ for 10 minutes. After the amplification reaction was completed, band detection was performed using agarose gel electrophoresis, and the target product was recovered using a PCR product recovery kit (D0033, Beyotime) (Figure 10, the black part on the right side of the upper figure of Figure 11).

[0208] 2. Preparation of sticky-end amplicon samples. PCR amplification was performed using Taq DNA polymerase with pUC57 DNA plasmid as a template. The reaction system consisted of: 1X Taq reaction buffer (20mM Tris-HCl (pH 8.8 at 25℃), 10mM (NH4)2SO4, 2mM MgSO4, 10mM KCl, 0.1% (v / v) Triton X-100, 0.1mg / ml BSA), 0.4μM forward primer, 0.4μM reverse primer, 0.1ng / ul template DNA, 0.2mM dNTPs, and 0.025U / ul Pfu DNA polymerase (D7205, Beyotime). The amplification program was as follows: pre-denaturation: 94℃ for 3 minutes; denaturation: 94℃ for 30 seconds; annealing: 55℃ for 30 seconds; extension: 72℃ for 2 minutes; cycle number: 30; final extension: 72℃ for 10 minutes. After the amplification reaction was completed, band detection was performed using agarose gel electrophoresis, and the target product was recovered using a PCR product recovery kit (D0033, Beyotime).

[0209] 3. Activated Adapter Ligation. The two types of amplicon products were ligated using either a TZ-modified blunt-end activated adapter or a TZ-modified sticky-end activated adapter (gray area in the middle of Figure 10, upper part). The reaction system was as follows: 1 μL of 10x reaction buffer (Tris-acetic acid 500 Mm, pH 7.5, sodium chloride 1 M, magnesium chloride 25 Mm, EDTA 1 Mm), 2 pmol of activated adapter, 0.5 pmol of amplicon product, and deionized water to a final volume of 10 μL. The mixture was incubated at 37°C for 10 minutes. The ligation products were purified and recovered using 0.4X magnetic beads (N411, Novizan) to remove excess activated adapters.

[0210] 4. Sequencing adapter ligation (as shown in Figure 10). Take the TCO-modified sequencing adapter (the black part on the left side of the upper figure in Figure 10) and ligate it with the above ligation product at a ratio of 2:1. Incubate at room temperature for 1 minute.

[0211] 5. Sequencing was performed using the Qnome3841 nanopore sequencer from QiCarbon Technology Co., Ltd., along with its accompanying reagents, following the instructions for use. The same applies below.

[0212] 6. The sequencing results are shown in Tables 2 and 3.

[0213] Table 2 Sequencing results of sticky-terminated amplification products

[0214] Table 3 Sequencing results of blunt-end amplification products

[0215] The data in Tables 2 and 3 show that both sticky-end and blunt-end amplification products achieved the same total throughput, MAP throughput, and Q7 throughput as conventional library preparation and sequencing when used for nanopore sequencing. Furthermore, compared to blunt-end amplification products, sticky-end amplification products resulted in higher total throughput, Q7 throughput, MAP throughput, total read count, and effective well time for nanopore sequencing.

[0216] The definitions of the relevant terms are as follows:

[0217] The term "total throughput" refers to the amount of analytes, such as bases, that pass through a nanopore within a given time period.

[0218] The term "Q7 flux" refers to the number of bases with an accuracy of 80% or higher in the total flux.

[0219] The term "Map flux" refers to the number of bases in the total flux that align to the correct position in the reference sequence.

[0220] The term "total number of reads" refers to the number of read segments that pass through a nanopore within a certain period of time.

[0221] The term "Reads length N50" refers to the length of the shortest read among the 50% of the relatively long reads that pass through the nanopore within a given time.

[0222] The term "effective well time" refers to the total sequencing time of the wells that are effectively sequenced.

[0223] Example 6: Construction and sequencing of E. coli genomic DNA sequencing library

[0224] 1. Pretreatment of *E. coli* genomic DNA samples. The extracted *E. coli* genomic DNA was dephosphorylated using the following reaction mixture: 50 mM potassium acetate, 20 mM Tris-acetic acid (pH 7.9), 10 mM magnesium acetate, 100 μg / ml recombinant albumin, 1 μg *E. coli* genomic DNA, 1 U shrimp alkaline phosphatase (rSAP), and deionized water to a final volume of 20 μL. The reaction mixture was incubated at 37°C for 10 minutes, followed by inactivation at 80°C for 2 minutes. Then, dNTPs (final concentration 1 mM), 1 U T4 DNA polymerase (M0203, NEB), 1 U Klenow DNA polymerase large fragment (M0210, NEB), and 1 U Taq DNA polymerase (M0320, NEB) were added. The reaction program was 37°C for 10 minutes, followed by 65°C for 10 minutes. After the reaction, the DNA product was purified using 0.4X magnetic beads (N411, Novizan).

[0225] 2. Take the above DNA sample and ligate it with activated sticky-end adapters modified with TZ groups. The reaction system is as follows: 50 mM tris-acetic acid (pH 7.5), 100 mM NaCl, 2.5 mM MgCl2, 1 mM EDTA, 100 ng of treated genomic DNA, 2 pmol of activated sticky-end adapters modified with TZ, and deionized water to make up to 10 μL. Incubate at room temperature for 1 minute. Then purify with 0.4X magnetic beads to remove excess activated adapters.

[0226] 3. Ligate sequencing adapters. Add 2 pmol of sequencing adapters containing TCO groups to the above reaction system, incubate at room temperature for 1 minute, and then proceed with sequencing.

[0227] 4. The sequencing results are shown in Table 4.

[0228] Table 4. Escherichia coli genome sequencing results

[0229] The data in Table 4 show that the total throughput, MAP throughput, Q7 throughput, and other parameters all reach the level of conventional library preparation and sequencing.

[0230] Example 7: Preparation and sequencing of activated sequencing adapters

[0231] This embodiment prepares a topoisomerase-coupled activated sequencing adapter through a reaction between a topoisomerase and a pre-sequencing adapter. As shown in Figure 11, the activated sequencing adapter can be directly linked to the target biomolecule to complete library construction. The main construction steps of the activated sequencing structure are as follows:

[0232] 1. Synthesize the adapter DNA strand before activation and sequence it. The name and sequence are as follows:

[0233] 1) Sequencing adapter DNA strands before sticky end activation:

[0234] Adaptor I: 5'-(C3 spacer)30-ATCCTTTTTAGAATTTTAGAGATTTTTTTTTTT(SEQ ID NO.17)-(iSp18)4-AGAGATTCAGAGATCCCTTGATAGCACGTAG(SEQ ID NO.18)-3'

[0235] Adaptor II: 5'-ATCTCTAAAATTCTAAAAAG(SEQ ID NO.19)-3'

[0236] Adaptor III: 5'-AGGGATCTCTGAATCTCTGAATCTCTAGTCCAGCACCGACC(SEQ ID NO.20)-3'

[0237] Adaptor IV: 5'-CTACGTGCTATCA(SEQ ID NO.21)-3'

[0238] 2) Pre-activation sequencing of adapter DNA strands with blunt ends:

[0239] Adaptor I: 5'-(C3 spacer)30-ATCCTTTTTAGAATTTTAGAGATTTTTTTTTTT(SEQ ID NO.17)-(iSp18)4-AGAGATTCAGAGATCCCTTGATAGCACGTAG(SEQ ID NO.18)-3'

[0240] Adaptor II: 5'-ATCTCTAAAATTCTAAAAAG(SEQ ID NO.19)-3'

[0241] Adaptor III: 5'-AAGGGATCTCTGAATCTCTGAATCTCTAGTCCAGCACCGACC(SEQ ID NO.22)-3'

[0242] Adaptor IV: 5'-CTACGTGCTATC(SEQ ID NO.11)-3'

[0243] 2. Anneal the DNA strands used to prepare blunt-end and sticky-end activated sequencing adapters at a ratio of 1:1:1:1. The 1x annealing buffer consisted of 0.1M Tris-HCl, 0.1M NaCl, and 0.05M EDTA. The annealing conditions were: heating at 95°C for 2 minutes, decreasing the temperature by 0.1°C every 5 seconds until reaching 25°C.

[0244] 3. Prepare the activation adapter preparation system, the main components of which are: 2 μL of 10X topoisomerase reaction buffer (Tris-acetic acid 500 Mm pH 7.5, sodium chloride 1 M, magnesium chloride 25 MmM, EDTA 1 MmM), 4 pmol of pre-activation adapter, 1 U of vaccinia virus topoisomerase I (D6952, Beyotime), and make up the volume to 20 μL with deionized water. Heat the above reaction system in a 37°C metal bath for 30 minutes.

[0245] 4. Load helicase and purify to obtain blunt-end activated sequencing adapters and sticky-end activated sequencing adapters.

[0246] 5. The preparation of the sample to be tested is described in Example 5 of this invention.

[0247] 6. Ligate the blunt-end and sticky-end amplicon products using blunt-end and sticky-end activation sequencing adapters, respectively. The reaction system was as follows: 1 μL of 10x reaction buffer (500 M Tris-acetic acid, pH 7.5, 1 M sodium chloride, 25 mM magnesium chloride, 1 mM EDTA), 2 pmol of activation sequencing adapter, 0.5 pmol of amplicon product, and deionized water to a final volume of 10 μL. Incubate at room temperature for 1 minute. Purify and recover the ligation products using 0.4X magnetic beads (N411, Novizan) to remove excess activation adapters.

[0248] 7. Sequencing.

[0249] 8. The sequencing results are shown in Table 5.

[0250] Table 5. Results of activated sequencing adapter amplicon sequencing.

[0251] Table 5 shows that the total throughput, MAP throughput, and Q7 throughput all reach the levels of conventional library preparation and sequencing. Furthermore, the throughput, total reads, and effective well time for nanopore sequencing using products with sticky end ligation are significantly higher, indicating that it is more conducive to improving the throughput of nanopore sequencing.

[0252] Example 8: Preparation of Modified Activated Sequencing Adapters

[0253] In this embodiment, maleimide-PEG11-biotin was used to biotinylate-modify topoisomerase. The modification site involves the covalent linkage of maleimide and the thiol group on the topoisomerase. Subsequently, a modified activated adapter was prepared by binding the biotinylated topoisomerase to the adapter to form an activated adapter. Finally, the motor protein was locked into the single-stranded region at the pore end of the adapter, and the modified activated sequencing adapter was obtained after HPLC purification. The overall reaction flow is shown in Figure 13. The specific implementation steps are as follows:

[0254] 1. Synthesize the pre-activated sequencing adapter DNA strand, as in step 1 of Example 7.

[0255] 2. Same as step 2 in Example 7.

[0256] 3. Biotin modification

[0257] The above reaction system was desalted using a desalting column (89883, Thermo) and then replaced with PBS buffer. Subsequently, 800 pmol maleimide-PEG-biotin reagent (21911, Thermo) was added to the reaction system, and the reaction was carried out at room temperature for 1 hour, after which the solution was desalted and replaced with PBS solution.

[0258] 4. Prepare the activation adapter preparation system, the main components of which are: 2 μL of 10X topoisomerase reaction buffer (Tris-HCl 500 Mm pH 7.5, NaCl 1 M, MgCl2 25 mM, EDTA 1 mM), 40 pmol of pre-activation adapter, 10 U of vaccinia virus topoisomerase I (D6952, Beyotime), 40 U of T4 polynucleotide kinase (M0201, NEB), and deionized water to bring the volume to 200 μL. Heat the above reaction system in a 37°C metal bath for 30 minutes.

[0259] 5. Motor protein incubation and enzyme locking

[0260] Prepare motor protein M2 (SEQ ID NO.23; 20 μM) desalted to PBS buffer. The M2 incubation system consists of: 40 pmol of biotin-modified sticky or blunt-ended activated linker, 400 pmol of M2, 1% PEG8000, and 100 μM TMAD, with the volume adjusted to 400 μL using PBS buffer. Heat the reaction system in a 30°C metal bath for 30 minutes.

[0261] 6. HPLC purification of the modified sticky-end or blunt-end activated linker products.

[0262] Mobile phase A was prepared with the following main components: CHES 20mM pH 8.6, PEG 8000 1%, EDTA 100mM pH 8.0, and Glycerol 50%, with the volume brought to 500mL with deionized water. Mobile phase B was prepared with the following main components: CHES 20mM pH 8.6, PEG 8000 1%, EDTA 100mM pH 8.0, NaCl 1M, and Glycerol 50%, with the volume brought to 500mL with deionized water. The above-mentioned locked enzyme and modified activated linker were purified using a strong anion exchange column (5F53416, Sepax) in conjunction with a liquid chromatograph (e2695, Water), and the target peak was collected. The purification program was as follows: 65% mobile phase A and 35% mobile phase B were incubated for 5 minutes, 30% mobile phase A and 70% mobile phase B were incubated for 25 minutes, and 100% mobile phase B was incubated for 5 minutes.

[0263] The HPLC purification results of the sticky-end activated linker are shown in Figure 14A, with a total of 6 elution peaks (E1-E6). Gel electrophoresis and activity testing confirmed that E3 is the target product peak. The HPLC purification results of the blunt-end activated linker are shown in Figure 14B, with a total of 6 elution peaks (E1-E6). Gel electrophoresis and activity testing confirmed that E3 is the target product peak.

[0264] Example 9: Preparation and purification of sequencing libraries for amplified products

[0265] 1. Preparation of amplification products

[0266] Taq DNA polymerase and Q5 DNA polymerase were used to amplify λ phage DNA as a template, respectively, yielding 2098 bp DNA products with sticky ends and blunt ends. The primers and reaction procedure required for the PCR reaction are as follows:

[0267] Primer-2k-F:GGGAACTACAGGCTGACAGT(SEQ ID NO.24)

[0268] Primer-2k-R:ACTGCCATATTCACCCCACA(SEQ ID NO.25)

[0269] Table 6. PCR reaction procedure

[0270] After the reaction, the amplification product was purified and recovered by magnetic beads. The product was dissolved in elution buffer (10 mM tris-HCl, 1 mM EDTA), and the nucleic acid concentration was determined by Qubit.

[0271] 2. Connector connection

[0272] Prepare the adapter ligation system according to the following components: 1 μL 10X ligation buffer (Tris-HCl 500 Mm pH 7.5, NaCl 1 M, MgCl2 25 MmM, EDTA 1 MmM), 10 ng of the sticky-end or blunt-end modified activated sequencing adapter from Example 8, 30-100 fmol of sticky-end or blunt-end amplification product, and deionized water to bring the volume to 10 μL. After mixing thoroughly, react at room temperature for 4 minutes, and use Qsep to detect adapter ligation efficiency.

[0273] 3. Purification and sequencing

[0274] Take 20 μL of streptavidin magnetic beads (65601, Thermo) and place them on a magnetic rack. Remove the supernatant and wash three times with PBS, removing the supernatant again. Add the above ligation system to the magnetic beads, mix well, and incubate at room temperature for 1 minute. Then place it on a magnetic rack and wait for the magnetic beads to be completely adsorbed (1-2 min). Aspirate the supernatant solution and determine the sample purity using QSEP. The detection results of the sticky-end ligation product are shown in Figure A of Figure 15. The blue curve peaks represent the components in the system before purification, and the red curves represent the content of each component in the system after purification. Peaks 1-4 represent: 1. Activated sequencing adapter; 2. 2 kb DNA fragment; 3. Single-end adapter ligation product; 4. Double-end adapter ligation product. The detection results of the blunt-end ligation product are shown in Figure B of Figure 15. The blue curve peaks represent the components in the system before purification, and the red curves represent the content of each component in the system after purification. Peaks 1-4 represent: 1. Activated sequencing adapter; 2. 2 kb DNA fragment; 3. Single-end adapter ligation product; 4. Double-end adapter ligation product.

[0275] 4. Nanopore sequencing

[0276] The above-mentioned libraries were sequenced for 16 hours using the nanopore sequencer 3841 from Qitan Technology Co., Ltd., and the sequencing results were compared and analyzed. The sequencing results of sticky-end and blunt-end modified activated sequencing adapters are shown in Table 7. The total throughput, map throughput, Q7 throughput and other parameters all reached the level of conventional library preparation and sequencing. Moreover, the sequencing effect of the sticky-end ligation product was significantly better than that of the blunt-end ligation product in terms of throughput and effective well time.

[0277] Table 7. Amplicon sequencing results of modified activated sequencing adapters.

[0278] Example 10: Preparation of solid-phase activated sequencing adapters

[0279] This embodiment prepares a solid-phase activated sequencing adapter by fixing the activated sequencing adapter onto a magnetic bead. The main steps are as follows: Follow steps 1-6 of Example 8, and then perform the following steps:

[0280] 7. Place streptavidin magnetic beads (65601, Thermo) on a magnetic rack. After complete adsorption, remove the supernatant and wash the beads three times with PBS buffer. Mix the two in PBS solution at a ratio of 50 μg of magnetic beads per ng of modified sticky-end or blunt-end activated sequencing adapters, and incubate at room temperature for 1 minute. Place the above system on a magnetic rack. After complete adsorption, discard the supernatant and wash the beads three times with PBS solution.

[0281] Example 11: Preparation and purification of sequencing libraries using solid-phase adapters

[0282] In this embodiment, the solid-phase activated sequencing adapter prepared in Example 10 was used to prepare a sequencing library, which was then subjected to sequencing. The library preparation process is shown in Figure 16, and the main steps are as follows:

[0283] Preparation of amplification products

[0284] Taq DNA polymerase and Q5 DNA polymerase were used to amplify λ phage DNA as a template, respectively, to obtain 500 bp DNA products with sticky ends and blunt ends. The primers and reaction procedure required for the PCR reaction are as follows:

[0285] Primer-2k-F:GGGAACTACAGGCTGACAGT(SEQ ID NO.24)

[0286] Primer-500bp-R:CTACAGCGTGAGCTATGAGA(SEQ ID NO.26)

[0287] After the reaction, the amplification product was purified and recovered by magnetic beads. The product was dissolved in elution buffer (10 mM tris-HCl, 1 mM EDTA), and the nucleic acid concentration was determined by Qubit.

[0288] 1. Connector connection

[0289] Prepare the adapter ligation system according to the following components: 1 μL 10X ligation buffer (Tris-HCl 500 Mm pH 7.5, NaCl 1 M, MgCl2 25 MmM, EDTA 1 MmM), 500 μg sticky or blunt-end amplification products for immobilization, 30-100 fmol sticky or blunt-end amplification products, and deionized water to bring the volume to 10 μL. Mix thoroughly and react at room temperature for 4 minutes.

[0290] 2. Library purification

[0291] The above reaction system was placed on a magnetic rack. After the magnetic beads were completely adsorbed (1-2 min), the supernatant was aspirated and the subsequent sequencing process was performed directly. The ligation products were analyzed using Qseq to detect adapter ligation. The results for sticky-end ligation products are shown in Figure B of Figure 17, where peaks 1-4 represent: 1. activated sequencing adapter; 2. 500 bp DNA fragment; 3. single-end adapter ligation product; 4. paired-end adapter ligation product. The results for blunt-end ligation products are shown in Figure A of Figure 17, where peaks 1-4 represent: 1. activated sequencing adapter; 2. 500 bp DNA fragment; 3. single-end adapter ligation product; 4. paired-end adapter ligation product.

[0292] 3. Sequencing

[0293] The above-mentioned library was sequenced for 16 hours using the nanopore sequencer 3841 from Qitan Technology Co., Ltd., and the sequencing results were compared and analyzed. The sequencing results are shown in Table 8. The total throughput, MAP throughput, Q7 throughput and other parameters all reached the level of conventional library preparation and sequencing. Moreover, the sequencing effect of the sticky end ligation product was significantly better than that of the blunt end ligation product in terms of throughput and effective well time.

[0294] Table 8. Results of solid-phase activated sequencing adapter amplicon sequencing.

Claims

1. A method of characterizing a target biomolecule, comprising: providing conditions for using a topoisomerase to link a target biomolecule and a linker, obtaining a first liquid phase product, removing free topoisomerase, and / or topoisomerase-bound linker, and / or topoisomerase-bound target biomolecule in the first liquid phase product by immobilizing the topoisomerase, obtaining a second liquid phase product, contacting the second liquid phase product or a third product containing the target biomolecule after purification thereof with a pore, allowing the target biomolecule to pass through and move relative to the pore, and obtaining one or more measurement values representing one or more characteristics of the target biomolecule.

2. The method of claim 1, wherein, the throughput and / or the time length of the method of characterizing a target biomolecule is increased; and / or, the pore is a nanopore, and / or a biological pore, a solid pore, or a hybrid of a biological and a solid pore.

3. The method of claim 1 or 2, wherein, the way of immobilizing the topoisomerase comprises: binding the topoisomerase in free topoisomerase, and / or topoisomerase-bound linker, and / or topoisomerase-bound target biomolecule in the first liquid phase product to the surface of a solid phase material, preferably, further comprising removing the solid phase material after the binding, and / or the way of binding the topoisomerase to the surface of a solid phase material comprises a step of incubation, preferably, the topoisomerase is bound to the surface of the solid phase material by at least one of the following ways: (1) by binding of a first molecule linked to the topoisomerase and a second molecule linked to the solid phase material; preferably, the first molecule and the second molecule are biotin and streptavidin; (2) by an anti-topoisomerase antibody provided on the surface of the solid phase material.

4. The method of any one of claims 1-3, wherein, providing conditions for using a topoisomerase to link a target biomolecule and a linker, wherein: before the linking, i) at least one end of the target biomolecule or the linker comprises a recognition sequence and / or a recognition structure of the topoisomerase, and / or ii) the topoisomerase binds to at least one end of the target biomolecule or the linker and forms an activated molecule capable of linking with the linker or an activated linker capable of linking with the target biomolecule, optionally, in i) and / or ii), the topoisomerase is modified for binding to the surface of a solid phase material and retains the activity of forming the linkage, after the linking, a covalent linkage of a single-stranded nucleic acid or a covalent linkage of a double-stranded nucleic acid is formed between the end of the target biomolecule and the end of the linker, preferably, the linking is performed without adding a DNA ligase.

5. The method of any one of claims 1-4, wherein, the topoisomerase comprises a type I topoisomerase and / or a type II topoisomerase, preferably, the type I topoisomerase comprises a type IB topoisomerase, more preferably, the type IB topoisomerase comprises a vaccinia virus topoisomerase I, preferably, the target of the modification of the topoisomerase for binding to the surface of a solid phase material is a thiol group.

6. The method of claim 4 or 5, wherein, ii) the activated linker or activated molecule comprises a first segment and a second segment, the 3' end of the first segment comprises the topoisomerase recognition sequence, the topoisomerase recognition sequence is covalently coupled to the topoisomerase, the 5' end of the second segment comprises at least a portion of the reverse complement of the topoisomerase recognition sequence and optionally additional sequences, the topoisomerase recognition sequence and the at least a portion of the reverse complement of the topoisomerase recognition sequence anneal to form a first double-stranded structure, wherein the topoisomerase has an activity to link a target biomolecule or a linker to the 3' end of the first segment, the target biomolecule or the linker comprises a hydroxyl group at the 5' end, Preferably, the 3' end of the first segment in the activated linker or activated molecule is overhanging or missing one or more nucleotides compared to the 5' end of the second segment.

7. The method of claim 6, wherein, The 5' end of the first segment in the activated linker comprises a loading region of a motor protein, the motor protein is used to control the speed of the target biomolecule through the pore.

8. A method of linking or a method of preparing a sequencing library, comprising: providing conditions to use a topoisomerase to link a target biomolecule and a linker, obtaining a first liquid phase product, removing free topoisomerase, and / or topoisomerase-bound linker or topoisomerase-bound target biomolecule in the first liquid phase product by solid phase topoisomerase, obtaining a second liquid phase product.

9. The method of claim 8, wherein further comprising the method of any one of claims 3-7.

10. An activated linker, comprising a first segment and a second segment, the 3' end of the first segment comprises the topoisomerase recognition sequence, the topoisomerase recognition sequence is covalently coupled to the topoisomerase, the 5' end of the second segment comprises at least a portion of the reverse complement of the topoisomerase recognition sequence and optionally additional sequences, the topoisomerase recognition sequence and the at least a portion of the reverse complement of the topoisomerase recognition sequence anneal to form a first double-stranded structure, wherein the topoisomerase has an activity to link a target biomolecule to the 3' end of the first segment, the target biomolecule comprises a hydroxyl group at the 5' end.

11. The activated linker of claim 10, wherein the topoisomerase is bound to the surface of a solid phase material.

12. The activated linker of claim 11, wherein the topoisomerase is bound to the surface of the solid phase material by at least one of: (1) binding of a first molecule linked to the topoisomerase and a second molecule linked to the solid phase material; (2) an anti-topoisomerase antibody provided on the surface of the solid phase material.

13. The activated linker of any one of claims 10-12, wherein, The topoisomerase comprises a type I topoisomerase and / or a type II topoisomerase, Preferably, the type I topoisomerase comprises a type IB topoisomerase, more preferably, the type IB topoisomerase comprises a vaccinia virus topoisomerase I, more preferably, the target of the first molecule linked to the topoisomerase is a thiol group; and / or, the 5' end of the first segment comprises a loading region of a motor protein.

13. A method of preparing a sequencing library, comprising: providing conditions to use a topoisomerase to link a target biomolecule and a linker, obtaining a first liquid phase product, removing free topoisomerase, and / or topoisomerase-bound linker or topoisomerase-bound target biomolecule in the first liquid phase product by solid phase topoisomerase, obtaining a second liquid phase product.

14. The method of claim 13, wherein further comprising the method of any one of claims 3-7. and / or, the 3' end of the first segment in the activated linker is overhanging or missing one or more nucleotides compared to the 5' end of the second segment.

14. A method of making the activated linker of any one of claims 10-13, the method comprising: reacting a topoisomerase with the first duplex, wherein the first duplex comprises a topoisomerase recognition sequence and a reverse complement of the topoisomerase recognition sequence, the topoisomerase recognition sequence and the reverse complement of the topoisomerase recognition sequence anneal to form a second duplex structure.

15. The method of claim 14, comprising: (1) annealing a first single-stranded DNA, a second single-stranded DNA, a third single-stranded DNA to form a complex, wherein the 5' end of the second single-stranded DNA is reverse complementary to the first single-stranded DNA, the 3' end of the third single-stranded DNA is reverse complementary to the first single-stranded DNA, the sequence in the first single-stranded DNA that is reverse complementary to the 5' end of the second single-stranded DNA and the sequence in the first single-stranded DNA that is reverse complementary to the 3' end of the third single-stranded DNA are contiguous or separated by one or more nucleotides, the first single-stranded DNA comprises a topoisomerase recognition sequence, the 5' end of the second single-stranded DNA and the 3' end of the third single-stranded DNA together comprise a reverse complement of the topoisomerase recognition sequence; and (2) reacting a topoisomerase with the complex to obtain the activated linker, the activated linker comprises a first segment and a second segment, the first segment and the second segment form a duplex, the 3' end of the first segment is reverse complementary to the 5' end of the second segment, the 3' end of the first segment is flush with the 5' end of the second segment, or the 3' end of the first segment is overhanging or missing one or more nucleotides compared to the 5' end of the second segment, the 3' end of the first segment comprises a topoisomerase recognition sequence, wherein the topoisomerase recognition sequence is covalently coupled to a topoisomerase.

16. The method of claim 15, wherein the sequence in the first single-stranded DNA that is reverse complementary to the 3' end of the third single-stranded DNA and the topoisomerase recognition sequence are contiguous, or at least partially overlapping, preferably with 1 nucleotide overlap.

17. The method of any one of claims 14-16, wherein the topoisomerase comprises a type I topoisomerase and / or a type II topoisomerase, preferably the type I topoisomerase comprises a type IB topoisomerase, more preferably the type IB topoisomerase comprises a vaccinia virus topoisomerase I, more preferably the target for the modification in the topoisomerase for binding to the surface of the solid phase material is a thiol group.

18. The method of any one of claims 15-17, wherein the third single-stranded DNA has a length of > 5 nt.

19. The method of any one of claims 15-17, wherein the second single-stranded DNA has a length of 10-140 nt.

20. The method of any one of claims 14-19, wherein the method further comprises: adding a reagent capable of phosphorylating the 5' end hydroxyl group to a 5' end phosphate group.

21. A kit for nanopore sequencing, comprising the activated linker of any one of claims 10-13 or the activated linker prepared by the method of any one of claims 14-20.

22. Use of the activated linker of any one of claims 10-13 or the activated linker produced by the method of any one of claims 14-20 in nanopore sequencing.

Images