Biomarker to predict response to PARP inhibitor

Abstract

The present invention discloses a method of determining a subject as having a PARP inhibitor sensitive cancer comprising determining the level of nuclear localization of IMPDH2 in a sample comprising cancer cells from said subject; identifying the subject as having a PARP inhibitor sensitive cancer by, wherein the nuclear localization level of IMPDH2 is higher than a reference value said subject has a PARP inhibitor sensitive cancer, a pharmaceutical composition and a kit to perform the aforementioned method.

Description

[0001] BIOMARKER TO PREDICT RESPONSE TO PARP INHIBITOR

[0002] Technical Field

[0003] The present invention relates generally to the field of molecular biology and oncology. Particularly, it concerns methods for identifying PARP inhibitor-sensitive cancers.

[0004] Background

[0005] Currently, PARP inhibitors (PARPi) have been approved to treat cancers harbouring BRCA1 / 2 mutations or other markers of homologous recombination deficiency (HRD). PARPi are also used to treat patients with specific cancer types that had previously responded to platinum-based therapy, regardless of the presence of genomic variants.

[0006] However, only about 50% of these patients initially respond to treatment and 40-70% of the responders develop resistance. Thus, there is a need for finding novel biomarkers to predict potential response to PARPi more accurately for such patients as well as for the subset of potential responders with non-BRCA mutants and HRD cancers, and for identifying novel therapeutical uses for this type of inhibitors.

[0007] The patent document EP3071972B1 discloses a Method for in vitro diagnosing and prognosing of triple negative breast cancer recurrence, comprising detecting at least the biomarker Desmoplakin. This document also suggests the use of PARP inhibitors. However, it is silent about the role of IMPDH2.

[0008] The patent document WO2023224488A1 discloses a 7 gene signature to predicta breast cancer sensitiveness to PARP inhibitors. However, this document is silent about IMPDH2.

[0009] The patent document US11447830B2 discloses a gene signature to predict drug response in cancer against a PARP inhibitor, the gene signature is at least composed by ZNF880, CAPN13, LYAR, and NPM3. IMPDH2 is only disclosed as an optional gene to add to said signature among a list of additional 147 genes.

[0010] Description

[0011] A first object of the invention relates to a method of determining a subject as having a PARP inhibitor sensitive cancer comprising:

[0012] (a) determining the level of nuclear IMPDH2 in cancer cells from a sample obtained from said subject;

[0013] (b) establishing the statistical significance of the level of nuclear IMPDH2 In order to establish the statistical significance, the nuclear level of IMPDH2 is inputted into a statistical and / or mathematical methodology to produce an output value that correlates with the chances that the patient has a PARP inhibitor sensitive cancer. Preferably, the statistical and / or mathematical methodology used can be linear regression, logistic regression, decision trees, support vector machines, neural networks, random forest or another machine-learning algorithm. The performance of the results of the applied statistical methods used in accordance with the present invention can be best described by their receiver operating characteristics (ROC). The ROC curve addresses both the sensitivity (the number of true positives) and the specificity (the number of true negatives) of the test.

[0014] A suitable statistical classification model, such as linear regression, logistic regression, can be extended to include other (clinical) variables such as age and gender of the patient as well. In the same manner as described before, the ROC curve can be used to access the performance of the discrimination between patients and controls by the logistic regression model. Therefore, the logistic regression equation can be used apart or combined with other clinical characteristics to aid clinical decision making. Although a logistic regression equation is a common statistical procedure used in such cases and is preferred in the context of the current invention, other mathematical / statistical, decision trees or machine learning procedures can also be used.

[0015] The inventors surprisingly identified that the de novo purine synthesis enzyme Inosine monophosphate dehydrogenase 2 (IMPDH2) is enriched in the nucleus of cancer cells, particularly on the chromatin of cancer cells, which are often prone to DNA damage accumulation, as it will be shown later in the examples.

[0016] Downregulation, depletion, or inhibition of IMPDH2 leads to the accumulation of DNA damage. On chromatin, IMPDH2 interacts with Poly [ADP-ribose] polymerase 1 (PARP1). In the nucleus, the enzymatic function of IMPDH2, which consumes NAD+, hinders PARP1 activity, thereby controlling the DNA damage response. Based on these surprising findings, the inventors have demonstrated a novel biomarker of PARP inhibitors sensitive cancer as cells with high IMPDH2 in the nucleus are more sensitive to PARP1 inhibitors. The nuclear presence of IMPDH2, particularly on chromatin, in cancer cells, fine-tunes the activity of PARP1, therefore, cancer cells with nuclear IMPDH2 presence, will be sensitive to PARP1 inhibitors. If IMPDH2 is not present in the nucleus, particularly on chromatin, PARP1 is hyperactivated and, therefore, higher concentrations of PARP1 inhibitors will be needed to inhibit PARP1 activity and those cancer cells will be less sensitive to the treatment. The effect may be due to the activity of nuclear IMPDH2 inhibits excessive PARP1 response by consuming its substrate (NAD+) which is the same cofactor for PARP1 activity, thus the activity of IMPDH2 and PARP1 compete for the availability of a common nuclear NAD+ pool.

[0017] IMPDH2 is P12268, Swiss- Prot / TrEM BL release number 2024_03 / 2024_03, released on 29-May-2024

[0018] PARP1 is P09874, Swiss-Prot / TrEMBL release number 2024_03 / 2024_03, released on 29-May-2024.

[0019] Another advantage of the method of the invention is that it can determine a subject having a PARP inhibitor sensitive cancer independently of how the level of nuclear IMPDH2 became above a certain threshold. For instance, it can happen during normal cancer progression.

[0020] As will be shown later, the inventors have developed a predictive model to determine whether a sample comprising cancer cells is sensitive to PARP1; The following linear regression models can be applied to breast and lung cancer respectively:

[0021] Breast cancer: y = 14.9 + 0.124x

[0022] Lung cancer: y = 14.9 + 0.278x

[0023] Wherein “y” is the sensitivity to a PARPi and “x” is the chromatin nuclear level of IMPDH2 wherein a value of y= or more than 14.3 indicates that cells are sensitive to a PARPi treatment in both models

[0024] In a particular embodiment, the method of the invention comprises determining a subject as having a PARP inhibitor sensitive cancer by:

[0025] (a) determining the level of nuclear IMPDH2 in cancer cells from a sample obtained from said subject;

[0026] (b) identifying the subject as having a PARP inhibitor sensitive cancer if the nuclear level of IMPDH2 is higher than a reference value.

[0027] The statistical significance is determined by comparing the level of nuclear IMPDH2 with a reference value. A subject is identified as having a PARP inhibitor sensitive cancer when the level of nuclear IMPDH2 in cancer cells is equal or higher than a reference value.

[0028] In a particular embodiment, the reference value of IMPDH2 is the level of IMPDH2 in the nucleus of a cancer cell that determines the sensitivity of a subject to a PARP inhibitor, therefore the reference value may be considered as a threshold or a minimum value.

[0029] The statistical significance of the comparison between the level of nuclear IMPDH2 with a reference value can be obtained in the form of a ratio, wherein a ratio equal or above 1 when comparing the level of IMPDH2 in the nucleus of a cancer cell with a reference value identifies a subject as having a PARP inhibitor sensitive cancer.

[0030] In the present invention, the reference value is obtained from a control. The control is the level of IMPDH2 that can be obtained from:

[0031] 1. noncancerous cells of the same subject said noncancerous cells obtained from the same sample of cancer cells said noncancerous cells from the same tissue as the cancer cells said noncancerous cells from adjacent tissue said noncancerous cells from Blood sample

[0032] Any of said noncancerous cells can be obtained at the same time the cancer cells are obtained or at a different time point.

[0033] 2. non-cancerous cells obtained from known databases in the field or from healthy subjects

[0034] 3. cancer cells obtained from at least one other sample from the same subject in a different time point

[0035] 4. level of IMPDH2 in the cytoplasm of the cells of the same subject

[0036] Said cells can be cancer cells or non-cancerous cells, said cancer cells being the same or different cancer cells than the cells where nuclear IMPDH2 is measured said cells obtained from the same sample of cancer cells or at a different time point.

[0037] Said noncancerous cells from the same tissue as the cancer cells.

[0038] In a particular embodiment, the level of IMPDH2 in the nucleus is determined by its accumulation on chromatin, preferably by nuclei-localized IMPDH2 staining display.

[0039] In an embodiment, the statistical significance is obtained as the ratio of nuclear level of IMPDH2 in cancers cells to the level of IMPDH2 in control cells, the second value acting as reference value, wherein a ratio nuclear IMPDH2 level in cancer cells / IMDPH2 in control cells higher than 1 indicates a PARP inhibitor sensitive cancer. In a particular embodiment the ratio nuclear IMPDH2 cancer cells / control is at least 1.1. preferably at least 1.2, even more preferably at least 1.3, even more preferably at least, 1.4 and even more preferably at least 1.5.

[0040] In a particular embodiment, the statistical significance is achieved when the nuclear IMPDH2 levels of cancer cells is at least 1%, 2%, 3%, 4% or 5% higher than the control value, for example, the level of IMPDH2 in the control cells, preferably at least 10% higher, or at least 15% higher, or at least 20% higher, or at least 25% higher, or at least 30% higher, or at least 40% higher, or at least 50% higher, or at least 60% higher, or at least 70% higher, or at least 80% higher, or at least 90% higher, or at least 100% higher than in the control cells.

[0041] In an embodiment, the statistical significance is obtained as the ratio of nuclear level of IMPDH2 in cancers cells to the nuclear level of IMPDH2 in noncancerous cells, the second value acting as reference value, wherein a ratio nuclear IMPDH2 cancer cells / noncancerous cells higher than 1 indicates a PARP inhibitor sensitive cancer.

[0042] In a particular embodiment the ratio nuclear IMPDH2 cancer cells / noncancerous is at least 1.1. preferably at least 1.2, even more preferably at least 1.3, even more preferably at least, 1.4 and even more preferably at least 1.5.

[0043] In a particular embodiment, the statistical significance is achieved when the nuclear IMPDH2 levels of cancer cells is at least 1 %, 2%, 3%, 4% or 5% higher than the reference value, for example, the level of IMPDH2 in the nucleus of in noncancerous cells, preferably at least 10% higher, or at least 15% higher, or at least 20% higher, or at least 25% higher, or at least 30% higher, or at least 40% higher, or at least 50% higher, or at least 60% higher, or at least 70% higher, or at least 80% higher, or at least 90% higher, or at least 100% higher than in the control cells.

[0044] In another particular embodiment, the noncancerous cells are from the same tissue of origin as the cancer cells.

[0045] In another particular embodiment, the noncancerous cells are from the same sample of cancer cells or from a sample obtained at a different time point.

[0046] In another particular embodiment, the noncancerous cells are from the same tissue of origin than the cancer cells and are obtained at the same time point.

[0047] In another particular embodiment, the noncancerous cells are from the same tissue of origin than the cancer cells and are obtained at a different time point.

[0048] In another particular embodiment, the noncancerous cells are not from the same tissue of origin than the cancer cells and are obtained at the same time point. In another particular embodiment, the noncancerous cells are from a different tissue of origin than the cancer cells and are obtained at the same time point.

[0049] In another particular embodiment, the noncancerous cells are not from the same tissue of origin than the cancer cells and are obtained at a different time point.

[0050] In another particular embodiment, the noncancerous cells are from a different tissue of origin than the cancer cells and are obtained at a different time point.

[0051] In another particular embodiment, the noncancerous cells can be obtained from the peripheral blood sample.

[0052] In another particular embodiment, the noncancerous cells are from adjacent noncancerous tissue of the same sample.

[0053] Adjacent tissue is the non-cancerous tissue obtained from the same or different sample, this is, biopsy of the tumor sample, preferably from the same sample (biopsy of the tumor sample).

[0054] In embodiments, the control samples are collected at the same time as cancer cell sample. In other embodiments, the control samples are collected at a different time point than the cancer cell sample. In other embodiments, control samples collected at the same time point as the cancer samples, at a different time point than the cancer samples or combination of both are used to define the reference value.

[0055] In an embodiment, the statistical significance is obtained as the ratio of nuclear level of IMPDH2 in cancers cells to the nuclear level of IMPDH2 in noncancerous cells, the second value acting as reference value, wherein a ratio nuclear IMPDH2 cancer cells / noncancerous cells higher than 1 indicates a PARP inhibitor sensitive cancer, being the cancer cell and the non-cancerous cell from the same tissue of origin and, the reference value is the value of nuclear level IMPDH2 of non-cancerous cells obtained from either known databases in the field or healthy subjects such as UniProt KB, Expression Atlas, The Human Protein Atlas, Bgee and Genevisible, disclosed as the median level of IMPDH2, or from healthy subjects.

[0056] In a particular embodiment, the statistical significance is achieved when the ratio nuclear IMPDH2 cancer cells / noncancerous is at least 1.1. preferably at least 1.2, even more preferably at least 1.3, even more preferably at least, 1.4 and even more preferably at least 1.5.

[0057] In a particular embodiment, the statistical significance is achieved when the nuclear IMPDH2 levels of cancer cells is at least 1 %, 2%, 3%, 4% or 5% higher than the reference value, for example, the value of IMPDH2 in the nucleus of in noncancerous cells obtained from known databases in the field or from healthy subjects, preferably at least 10% higher, or at least 15% higher, or at least 20% higher, or at least 25% higher, or at least 30% higher, or at least 40% higher, or at least 50% higher, or at least 60% higher, or at least 70% higher, or at least 80% higher, or at least 90% higher, or at least 100% higher than in the control cells which are cells obtained from known databases in the field or from healthy subjects.

[0058] In an embodiment, the statistical significance is obtained as the ratio of nuclear level of IMPDH2 in cancers cells to the nuclear level of IMPDH2 in cancer cells obtained at a different time point, the second value acting as reference value, being both cancers cells obtained from different samples from different time points from the same subject. A subject has a PARP inhibitor sensitive cancer when the ratio nuclear level of IMPDH2 in cancers cells obtained from a sample to the level of nuclear IMPDH2 in cancer cells obtained from at least another sample from the same subject in a different time point is higher than 1. Preferably, the nuclear level of IMPDH2 in cancer cells obtained from the earlier sample is the reference value.

[0059] The advantage of comparing at least two sample biopsies obtained from the same subject at different time points is that the skilled person can determine whether the cancer has evolved in such a manner that the subject will respond or not to a PARP inhibitor treatment. This is the cancer is still a PARP inhibitor sensitive cancer, or has become PARP inhibitor sensitive or remained or become a PARP inhibitor resistant cancer.

[0060] The time range between both samples can be from 1 week to 5 years, preferably 1-year difference.

[0061] In a particular embodiment, more than two biopsies at a different time points are obtained.

[0062] In a particular embodiment the ratio nuclear IMPDH2 cancer cells from one sample I cancer cells from another sample obtained at a different time point than the one sample is at least 1 , or 1.1. preferably at least 1.2, even more preferably at least 1.3, even more preferably at least, 1.4 and even more preferably at least 1.5.

[0063] In a particular embodiment, the statistical significance is achieved when the nuclear IMPDH2 levels of cancer cells of one sample is at least 1%, 2%, 3%, 4% or 5% higher than the reference value, for example, the value of nuclear IMPDH2 in cancers cells of the sample obtained at a different time point than the one sample, preferably at least 10% higher, or at least 15% higher, or at least 20% higher, or at least 25% higher, or at least 30% higher, or at least 40% higher, or at least 50% higher, or at least 60% higher, or at least 70% higher, or at least 80% higher, or at least 90% higher, or at least 100% higher than in the control cells.

[0064] In an embodiment, the statistical significance is obtained as the ratio of nuclear level of IMPDH2 in cancers cells to the cytoplasmic level of IMPDH2, the second value acting as reference value. A subject has a PARP inhibitor sensitive cancer when the ratio nuclear level of IMPDH2 in cancers cells obtained from a sample to the value of cytoplasmic IMPDH2 is higher than 1.

[0065] In a particular embodiment, the statistical significance is obtained as the ratio of the nuclear IMPDH2 levels and cytoplasmic IMPDH2 levels from the same cancer cells. In embodiments, the cytoplasmic level of IMPDH2 and the nuclear level of IMPDH2 are measured in the same cancer cells. In other embodiments, the cytoplasmic level of IMPDH2 and the nuclear level of IMPDH2 are measured in different cancer cells, wherein the cells can be from the same tissue, the same sample, the same biopsy from the same subject.

[0066] In another particular embodiment, the statistical significance is obtained as the ratio of the nuclear IMPDH2 levels from cancer cells and cytoplasmic IMPDH2 levels from noncancerous cells. Said noncancerous cells can be from the same tissue of origin as the cancer cells.

[0067] In another particular embodiment, the cells from which the cytoplasmic IMPDH2 levels are determined are from the same sample than the cancer cells from which nuclear IMPDH2 levels are determined or from a sample obtained at a different time point.

[0068] In another particular embodiment, the noncancerous cells from which the cytoplasmic IMPDH2 levels are determined are from the same tissue of origin than the cancer cells and are obtained at the same time point.

[0069] In another particular embodiment, the noncancerous cells from which the cytoplasmic IMPDH2 levels are determined are from the same tissue of origin than the cancer cells and are obtained at a different time point.

[0070] In another particular embodiment, the noncancerous cells from which the cytoplasmic IMPDH2 levels are determined are not from the same tissue of origin than the cancer cells and are obtained at the same time point.

[0071] In another particular embodiment, the noncancerous cells from which the cytoplasmic IMPDH2 levels are determined are not from the same tissue of origin than the cancer cells and are obtained at a different time point. In another particular embodiment, the noncancerous cells from which the cytoplasmic IMPDH2 levels are determined are from adjacent non-cancerous tissue of the same sample.

[0072] In an embodiment, the statistical significance is obtained as the ratio of nuclear level of IMPDH2 in cancers cells to the cytoplasmic level of IMPDH2 in noncancerous cells, being the cancer cell and the non-cancerous cell from the same tissue of origin and, the reference value is the value of nuclear level IMPDH2 of non-cancerous cells obtained from either known databases in the field or healthy subjects such as UniProt KB, Expression Atlas, The Human Protein Atlas, Bgee and Genevisible, disclosed as the median level of IMPDH2, or from healthy subjects

[0073] In a particular embodiment the ratio nuclear IMPDH2 cancer cells / cytoplasmic level is at least 1, or 1.1. preferably at least 1.2, even more preferably at least 1.3, even more preferably at least, 1.4 and even more preferably at least 1.5.

[0074] In a particular embodiment, the statistical significance is achieved when the nuclear IMPDH2 levels of cancer cells of one sample is at least 1%, 2%, 3%, 4% or 5% higher than the reference value, for example, the cytoplasmic level of IMPDH2, preferably at least 10% higher, or at least 15% higher, or at least 20% higher, or at least 25% higher, or at least 30% higher, or at least 40% higher, or at least 50% higher, or at least 60% higher, or at least 70% higher, or at least 80% higher, or at least 90% higher, or at least 100% higher than in the control cells.

[0075] In a particular embodiment, the statistical significance is obtained as the ratio of the nuclear IMPDH2 levels from cancer cells and cytoplasmic IMPDH2 levels from noncancerous cells.

[0076] In the present specification the term “sample”, refers to any sample that can be completely or partly obtained from a subject by various means including, for example, biopsy such as needle biopsy and surgery. The term comprises any sample comprising cancer cells from a subject, or suspected to comprise cancer cells from a subject, such as a tumor or liquid biopsy. Preferably, at least 5% of the sample consists of cancer cells. More preferably at least 10%, 20% or 30% of the sample consists of cancer cells The other cells of the sample are noncancerous cells.

[0077] In the present specification, the terms “sample”, “biopsy” and “sample biopsy” are synonyms and can be used interchangeably.

[0078] In a particular embodiment, the number of cancer cells analyzed does not necessarily be the same number as noncancerous cells. A skilled person would understand that the measurements of nuclear level of IMPDH2 in different cancer and / or noncancerous cells from the same sample need to be normalized, for example by calculating the average. A skilled person would understand that the more cells are analyzed the more confident the determination of whether a subject has a PARP inhibitor sensitive cancer will be.

[0079] The step of determining the reference value of nuclear IMPDH2 in cancers cells preferably further comprises a substep of normalizing the value of nuclear IMPDH2. The method for normalizing expression level can be selected based upon the method used for measuring expression level. For example, if a Western-blot is performed, the value of nuclear I PDH2 in cancers cells in a biological sample may be normalized by assessing in parallel in said sample the expression level of a protein which is usually constitutively expressed in the nucleus of any cell of a living organism, preferably at the same expression level whether the cell is healthy or not (e.g. cancerous or not). An example of a constitutively expressed protein is a housekeeping protein such as H3 for nuclear extracts or Vinculin for whole cell extracts. Alternatively, if an ELISA or Immunofluorescence are performed, involving for example a colorimetric detection method, protein expression level can be normalized by total cell number. Yet, still alternatively. For a detailed review of normalization methods of protein expression level in an antibody microarray, one skilled in the art may refer to Hamelinck et al. (2005).

[0080] All these methods for measuring and normalizing protein expression level are well-known to the skilled person, and thus do need not to be further detailed herein. Should the skilled person wish to use any of the above methods involving the use of an antibody to measure the protein expression of nuclear IMPDH2 in cancers cells, one may use any appropriate commercial antibody specific for said protein. Alternatively, based on the knowledge of the amino-acid sequence of a IMPDH2, it is easy for the skilled person to design suitable reagent(s) to measure expression level in any biological sample. For example, an antibody directed against IMPDH2 may be prepared by any conventional method, e.g. by immunizing an animal, such as a mouse, with an immunogenic form of said biomarker which elicits an antibody response in said animal. Methods for producing polyclonal and monoclonal antibodies are well described in the literature, and therefore need not be further detailed herein.

[0081] The comparison of a determined or tested expression value of nuclear IMPDH2 in cancers cells with a value of nuclear IMPDH2 in noncancerous cells, that can be the same tissue or of origin, noncancerous cells that can be from adjacent tissue, or cancer cell from a sample obtained at a different time point or a reference value from healthy subjects or databases can be done by merely calculating the ratio between the value of nuclear IMPDH2 in cancers cells in the tested biological sample and in at least one sample (said one sample being, the same sample, a sample obtained at a different time point or a reference value), preferably after normalization as described above. Accordingly, a ratio above 1 is indicative that the IMPDH2 is overexpressed, while a ratio below 1 is indicative that IMPDH2 is underexpressed (i.e. downregulated). Therefore, determining if a subject has a PARP inhibitor sensitive cancer or not.

[0082] In a particular embodiment, the nuclear localization of IMPDH2 is detected by Immunofluorescence, immunohistochemistry, chromatin- IP, flowcytometry, Western Blot, subcellular fractionation coupled to mass spectrometry (MS), ELISA assays in purified nuclei of the cells, Enzyme-linked immunospot (ELISPOT), radioimmunoassay (RIA), immunohistochemistry, immunoprecipitation, fluorescence activated cell sorting (FACS), microscopy, flow cytometry, microcytometry, protein binding assay, ligand binding assay, microarray, polyacrylamide gel electrophoresis such as SDS-PAGE, surface plasmon resonance (SPR), Forster resonance energy transfer (FRET), Bioluminescence resonance energy transfer (BRET), chemiluminescence, fluorescent polarization, phosphorescence, mass spectrometry, magnetic resonance imaging (MRI), and any combination thereof, some of these application may require a previous step purification of the nucleus of the cells in order to determine I PDH2 levels. A skilled person would know which methods require said step. The preferred methods are immunofluorescence, chromatin- IP, flow cytometry, Western Blot of chromatin or nuclear extracts, subcellular fractionation coupled to mass spectrometry (MS), particularly, MS of chromatin.

[0083] In a particular embodiment, when the measurement of IMPDH2 nuclear localization is done by immunofluorescence, it is done in cancer cells from the sample being in the G2 phase of the cell cycle.

[0084] In another particular embodiment, the method of the invention comprises determining the amount of DNA damage within the cell nucleus.

[0085] In another particular embodiment, the method of the invention comprises measuring PARP1 expression levels.

[0086] In the present specification, a PARP inhibitor-sensitive cancer refers to a cancer that, when exposed to a PARP inhibitor agent, exhibits a therapeutic response.

[0087] In the present specification, a PARP inhibitor sensitive cancer is a cancer that when exposed to a PARP inhibitor agent is capable of negatively affecting a cancer cell / tumor in a subject, for example, by promoting killing of cancer cells, inducing apoptosis in cancer cells, reducing the growth rate of cancer cells, reducing the incidence or number of metastases, reducing tumor size, inhibiting tumor growth, reducing the blood supply to a tumor or cancer cells, promoting an immune response against cancer cells or a tumor, preventing or inhibiting the progression of cancer, or increasing the lifespan of a subject with cancer.

[0088] In a particular embodiment of the invention the cancer is selected from solid or liquid tumors, preferably solid cancers. The cancer can be either primary cancer or metastatic cancer.

[0089] In a particular embodiment of the invention the cancer is selected from breast cancer, e.g. ductal carcinoma in situ (DCIS), invasive ductal carcinoma (I DC), invasive lobular carcinoma (ILC), inflammatory breast cancer, triple-negative breast cancer, HER2- positive breast cancer; lung cancer, e.g. non-small cell lung cancer (NSCLC), small cell lung cancer (SCLC), adenocarcinoma, squamous cell carcinoma, large cell carcinoma, carcinoid tumor; brain cancer, e.g. glioblastoma multiforme, astrocytoma, oligodendroglioma, ependymoma, medulloblastoma, meningioma; lymphoblastic leukemia, e.g. acute lymphoblastic leukemia (ALL), B-cell lymphoblastic leukemia, T-cell lymphoblastic leukemia, Philadelphia chromosome-positive (Ph+) ALL, hypodiploid ALL, early T-cell precursor (ETP) ALL; acute myeloblastic leukemia, e.g. acute promyelocytic leukemia (APL), acute myelomonocytic leukemia (AMML), acute megakaryoblastic leukemia (AMKL), acute erythroid leukemia (AEL), acute monocytic leukemia (AML-M5), acute basophilic leukemia (ABL); Hodgkin lymphoma, e.g. nodular sclerosis Hodgkin lymphoma (NSHL), mixed cellularity Hodgkin lymphoma (MCHL), lymphocyte-rich Hodgkin lymphoma (LRHL), lymphocyte-depleted Hodgkin lymphoma (LDHL), nodular lymphocyte-predominant Hodgkin lymphoma (NLPHL); non-Hodgkin lymphoma (NHL), e.g. diffuse large B-cell lymphoma (DLBCL), follicular lymphoma (FL), mantle cell lymphoma (MCL), marginal zone lymphoma (MZL), Burkitt lymphoma (BL), Waldenstrom macroglobulinemia (WM), T-cell lymphomas (TCL); metastatic breast cancer, e.g. invasive ductal carcinoma (IDC), invasive lobular carcinoma (ILC), triple-negative breast cancer (TNBC), HER2-positive breast cancer, inflammatory breast cancer, male breast cancer; metastatic Wilms' tumor; metastatic neuroblastoma; metastatic soft tissue sarcoma, e.g. liposarcoma, leiomyosarcoma, synovial sarcoma, gastrointestinal stromal tumor (GIST), rhabdomyosarcoma, Ewing sarcoma; metastatic bone sarcoma, e.g. osteosarcoma, chondrosarcoma, Ewing sarcoma, giant cell tumor of bone, adamantinoma, fibrosarcoma; metastatic ovarian carcinoma, e.g. high-grade serous carcinoma, endometrioid carcinoma; clear cell carcinoma, mucinous carcinoma, Brenner tumor; metastatic transitional cell, e.g. urothelial carcinoma of the bladder, ureteral carcinoma; renal pelvis carcinoma, squamous cell carcinoma of the bladder (which is a rare subtype of TCC); bladder carcinoma, e.g. urothelial carcinoma (also known as transitional cell carcinoma), squamous cell carcinoma, adenocarcinoma, small cell carcinoma (which is a rare subtype of bladder cancer); metastatic thyroid carcinoma, e.g. papillary thyroid carcinoma, follicular thyroid carcinoma, medullary thyroid carcinoma, anaplastic thyroid carcinoma; metastatic gastric carcinoma, e.g. adenocarcinoma, signet ring cell carcinoma, lymphoma, gastrointestinal stromal tumor (GIST), carcinoid tumor; metastatic bronchogenic carcinoma, e.g. small cell lung cancer (SCLC), non-small cell lung cancer (NSCLC); cervical cancer, pancreatic adenocarcinoma or combinations thereof, preferably breast cancer, cervical cancer, lung cancer, pancreatic cancer and / or brain cancer.

[0090] In another particular embodiment, the cancer is a Homologous Recombination (HR) deficiency cancer, for example ovarian, pancreatic, prostate, or breast HR-deficiency cancers.

[0091] In another particular embodiment the cancer is a BRCA1 / 2 mutant.

[0092] In another particular embodiment the cancer presents one or more mutations in the following genes BRCA1 / 2 BARD1 , RAD51 B, RAD51C, RAD51D, BRIP1 , PALB2, EMSY, CHEK1 , CHEK2, ATM, ATR, ATX, BAP1 , CDK12, CHEK1 , CHEK2, FANCA, FANCC, FANCD2, FANCE, FANCF, PALB2, NBS1, WRN, MRE11A, BLM.

[0093] In a preferred embodiment, the cancer is breast cancer selected from the group consisting of Estrogen Receptor positive (ER+), Progesterone Receptor positive (PR+), Her2 positive (Her2+) or Triple Negative Breast Cancer, (TNBC).

[0094] In a particular embodiment the PARP inhibitor sensitive cancer displays nuclei-localized IMPDH2 staining, preferably the PARP inhibitor sensitive cancer being breast cancer, cervical cancer, lung cancer and / or pancreatic cancer.

[0095] PARP inhibition is, nowadays, the only targeted therapy approved for TNBC, the most aggressive subtype of breast cancer for which treatment options have been limited to chemotherapy, which can be as well an HR deficient cancer.

[0096] As used herein, “subject” includes all human beings. The term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be covered. A patient refers to a subject afflicted with a disease or disorder that is in need of alleviation or amelioration from a recognized medical condition. The subject may be an animal. Thus other animals, including mammals such as rodents (including mice, rats, hamsters and guinea pigs), cats, dogs, rabbits, farm animals including cows, horses, goats, sheep, pigs, etc., and primates (including monkeys, chimpanzees, orangutans and gorillas) are included within the definition of subject.

[0097] Another object of the invention relates to a pharmaceutical composition comprising a PARP inhibitor for use in treatment of a cancer, wherein the cancer is a PARP inhibitor sensitive cancer characterized by a nuclear level of IMPDH2 higher than a reference value, wherein the reference value can be any of the values described above.

[0098] Another object of the invention relates to a method of treating a PARP inhibitor sensitive cancer in a subject comprising:

[0099] (a) determining the level of nuclear IMPDH2 in cancer cells from a sample obtained from said subject;

[0100] (b) identifying the subject as having a PARP inhibitor sensitive cancer if the nuclear level of IMPDH2 is higher than a reference value and

[0101] (c) administering an effective amount of a PARP inhibitor to said subject identified to have a PARP inhibitor sensitive cancer.

[0102] In a particular embodiment, the PARP inhibitor can inhibit PARP1, and / or other PARP family members. In particular embodiments, the PARP inhibitor inhibits PARP1. In another particular embodiment, the PARP inhibitor inhibits PARP2. In another embodiment, the PARP inhibitor inhibits both PARP1 and PARP2. Preferably the PRP inhibitor inhibits all the members of the PARP family, even though PARP1 is the main and most targeted member because of its role in DNA damage repair. In a particular embodiment, the PARP inhibitor is selected from a PARP1 inhibitor, a PARP2 inhibitor and / or a combination thereof.

[0103] The PARP inhibitor selected is Olaparib (Lynparza®, CAS No. 763113-22-0). In certain embodiments, the PARP inhibitor is Rucaparib (Rubraca®, CAS No. 283173-50-2). In certain embodiments, the PARP inhibitor is Talazoparib (Talzenna®, CAS No CAS No. 1207456-01-6). In certain embodiments, the PARP inhibitor is Veliparib (ABT-888; CAS No 912444-00-9). In certain embodiments, the PARP inhibitor is Niraparib (Zejula®, CAS No 1038915-60-4). In certain embodiments, the PARP inhibitor is Pamiparib ( CAS No.: 1446261-44-4 ). In certain embodiments, the PARP inhibitor is CEP-9722 (11-methoxy- 2-((4-methylpiperazin-1-yl)methyl)-4,5,6,7-tetrahydro-1 Hcyclopenta[a]pyrrolo[3,4- c]carbazole-1 ,3(2H)-dione; CAS#: 916574-83-9 ).

[0104] In embodiments, PARP inhibitor can be used in a combination therapy to positively effect the therapy response. Another object of the invention relates to a kit to perform the aforementioned method, this is, to determine the nuclear level of IMPDH2 in a sample comprising cancer cells from said subject; wherein the level nuclear localization is determined by its accumulation on chromatin of said cancer cells

[0105] The value / amount of IMPDH2 in the nucleus of a cancer cell determines the sensitivity of the subject to a PARP inhibitor when comparing said value / amount of IMPDH2 to a reference value.

[0106] The kit provided herein comprises: a) at least a reagent capable of specifically determining the nuclear level of IMPDH2 in a sample comprising cancer cells from a subject; and / or b) instructions for performing said method, described herein.

[0107] In a particular embodiment, the kit comprises a least a reagent capable of specifically determining the reference level of IMPDH2 as described above. This is, the cytoplasmic or nuclear IMDH2 level, in cancer or noncancerous cells.

[0108] The term "reagent capable of specifically determining the nuclear level of IMPDH2 designates a reagent or a set of reagents which specifically recognizes given biomarker and allows for the quantification for the expression level of said biomarker. These reagents can be for example antibodies, aptamers or affibodies specifically recognizing a biomarker. In the present context, such a reagent is said to be "specific" for its target (i.e. biomarker) or "recognizes specifically" its target if it 1) exhibits a threshold level of binding activity, and / or 2) does not significantly cross- react with target molecules known to be related to the biomarker of interest. The binding affinity of such a reagent can be easily determined by one skilled in the art, for example, by Scatchard analysis. Crossreactivity of a reagent can also be easily determined by one skilled in the art, and thus need not be further detailed herein. Examples of reagents capable of specifically determining the expression level of a biomarker include, without limitation, antibodies.

[0109] The term "instructions" refers to a publication, a recording, a diagram, or any other medium which can be used to communicate how to perform a method described herein. Said instructions can, for example, be affixed to a container which contains said kit.

[0110] The kit further includes instructions and the required plastic were to perform the method of the invention.

[0111] Components of the subject kit may be present in separate containers, or multiple components may be present in a single container. A suitable container includes a single tube (e.g., vial), one or more wells of a plate (e.g., a 96-well plate, a 384-well plate, etc.), or the like. Another object of the invention relates to the use of a kit to perform the aforementioned method.

[0112] The invention further relates to the following clauses:

[0113] 1. A method of determining a subject as having a PARP inhibitor sensitive cancer comprising:

[0114] (a) determining the level of nuclear IMPDH2 in cancer cells from a sample obtained from said subject;

[0115] (b) establishing the statistical significance of the level of nuclear IMPDH2.

[0116] 2. The method according to the preceding clause, wherein the level of nuclear IMPDH2 in cancer cells is inputted into a statistical and / or mathematical methodology to produce an output value that indicates whether the patient has a PARP inhibitor sensitive cancer.

[0117] 3. The method of clause 2 wherein the statistical and / or mathematical methodology used is linear regression.

[0118] 4. The method according to any of the preceding clauses 2 or 3, wherein the statistical significance is established if the nuclear level of IMPDH2 higher than a reference value.

[0119] 5. The method according to any of the preceding clauses, wherein the reference value is the nuclear level of IMPDH2 in noncancerous cells from the same subject, wherein the noncancerous cells are the noncancerous counterparts of the cancer cells of the same tissue.

[0120] 6. The method according to preceding clauses, wherein the noncancerous cells are obtained from the same sample as the cancer cells or from a different sample.

[0121] 7. The method according to any of the preceding clauses 5 to 6, wherein the noncancerous cells are obtained from a peripheral blood sample.

[0122] 8. The method according to any of the preceding clauses 5 to 6, wherein the noncancerous cells are obtained from an adjacent tissue obtained from the same sample as the cancer cells.

[0123] 9. The method according to any of the preceding clauses 1 to 4, wherein the reference value is the nuclear level IMPDH2 in noncancerous cells, being the cancer cell and the non-cancerous cell from the same origin, being the nuclear value of IMPDH2 of a noncancerous cell obtained from known databases or healthy subjects.

[0124] 10. The method according to any of the preceding clauses 1 to 4, wherein the reference value is the nuclear levels of IMPDH2 in cancer cells obtained from at least another sample from the same subject in at least one different time point. 11. The method according to any of the preceding clauses 1 to 4, wherein the reference value is the cytoplasmic levels of IMPDH2 in cells from the same subject.

[0125] 12. The method according to the preceding clause, wherein the cytoplasmic levels of IMPDH2 are determined from the cancer or noncancerous cells from the same sample.

[0126] 13. The method according to clause 12, wherein the cancer cells can be either the same cells in which the nuclear levels of IMPDH2 are measured or different cancer cells from those in which the nuclear levels of IMPDH2 are measured.

[0127] 14. The method according to the clause 11, wherein the cytoplasmic levels of IMPDH2 are determined from cells obtained from at least another sample from the same subject in at least one-time point.

[0128] 15. The method according to the clause 11, wherein the cytoplasmic levels of IMPDH2 are determined from the same cancer cells as the nuclear level of IMPDH2 is determined.

[0129] 16. The method according to any of the preceding clauses 4 to 15, wherein a ratio nuclear IMPDH2 level cancer cells / reference value higher than 1 indicates a PARP inhibitor sensitive cancer.

[0130] 17. The method according to the preceding clause, wherein the ratio nuclear IMPDH2 cancer cells / reference value is at least 1.1, preferably at least 1.2, more preferably at least, 1.4 and even more preferably at least 1.5.

[0131] 18. The method according to any of the preceding clauses, wherein the nuclear localization of IMPDH2 in cancer cells is determined by its accumulation on chromatin.

[0132] 19. The method according to any of the preceding clauses, wherein the nuclear localization of IMPDH2 in cancer cells is determined by Immunofluorescence, immunohistochemistry, chromatin- IP, flowcytometry, Western Blot, subcellular fractionation coupled to mass spectrometry (MS), ELISA assays in purified nuclei of the cells, Enzyme-linked immunospot (ELISPOT), radioimmunoassay (RIA), immunohistochemistry, immunoprecipitation, fluorescence activated cell sorting (FACS), microscopy, flow cytometry, microcytometry, protein binding assay, ligand binding assay, microarray, polyacrylamide gel electrophoresis such as SDS-PAGE, surface plasmon resonance (SPR), Forster resonance energy transfer (FRET), Bioluminescence resonance energy transfer (BRET), chemiluminescence, fluorescent polarization, phosphorescence, mass spectrometry, magnetic resonance imaging (MRI), or any combination thereof, preferably by Immunofluorescence, immunohistochemistry, chromatin- IP, flowcytometry, Western Blot, subcellular fractionation coupled to mass spectrometry (MS), ELISA assays in purified nuclei of the cells, preferably immunofluorescence, chromatin- IP, flowcytometry, Western Blot of chromatin or nuclear extracts, subcellular fractionation coupled to mass spectrometry (MS), particularly, MS of chromatin.

[0133] 20. The method according to any of the preceding clauses, wherein the cancer is selected from solid or liquid tumors, preferably solid cancers.

[0134] 21. The method according to any of the preceding clauses, wherein the cancer is selected from breast cancer, ovarian cancer, prostate cancer, pancreatic cancer, lung cancer, colon cancer, glioblastoma, leukemia and lymphoma, preferably breast cancer or lung cancer.

[0135] 22. The method according to the preceding clause, wherein the breast cancer is selected from the group consisting of ER+, Her2+, PR +, or TNBC, preferably TNBC.

[0136] 23. The method according to any of the preceding clauses, wherein the PARP inhibitor sensitive cancer displays nuclei-localized IMPDH2 staining, preferably the PARP inhibitor sensitive cancer being breast cancer.

[0137] 24. The method according to any of the preceding clauses, wherein the PARP inhibitor is selected from a PARP1 inhibitor, a PARP2 inhibitor and / or a combination thereof.

[0138] 25. A kit for performing the method described in any of the clauses 1 to 24.

[0139] 26. The kit according to the preceding clause, that comprises at least a reagent capable of specifically determining the nuclear level of IMPDH2 in a sample comprising cells from a subject.

[0140] 27. Use of a kit as described in any of the preceding clauses 25 to 26 to perform the method as described in any of the clauses 1 to 24.

[0141] Each of the terms “comprising,” “consisting essentially of,” and “consisting of” may be replaced with either of the other two terms. The term “a” or “an” can refer to one of or a plurality of the elements it modifies (e.g., “a reagent” can mean one or more reagents) unless it is contextually clear either one of the elements or more than one of the elements is described. The term “about” as used herein refers to a value within 10% of the underlying parameter (i.e., plus or minus 10%; e.g., a weight of “about 100 grams” can include a weight between 90 grams and 110 grams). Use of the term “about” at the beginning of a listing of values modifies each of the values (e.g., “about 1, 2 and 3” refers to "about 1 , about 2 and about 3"). When a listing of values is described the listing includes all intermediate values and all fractional values thereof (e.g. , the listing of values "80%, 85% or 90%" includes the intermediate value 86% and the fractional value 86.4%). When a listing of values is followed by the term "or more," the term "or more" applies to each of the values listed (e.g., the listing of "80%, 90%, 95%, or more" or "80%, 90%, 95% or more" or "80%, 90%, or 95% or more" refers to "80% or more, 90% or more, or 95% or more"). When a listing of values is described, the listing includes all ranges between any two of the values listed (e.g., the listing of "80%, 90% or 95%" includes ranges of "80% to 90%", "80% to 95%" and "90% to 95%"). Certain implementations of the technology are set forth in examples below.

[0142] Brief description of the drawings

[0143] Fig. 1. IMPDH2 is a chromatin-associated metabolic enzyme. Representative pictures (a) and quantification (b) of yH2AXfoci (yH2AX orange, DAPI blue; scale bar 15 pm) in breast cancer cell lines representing the different subtypes of breast cancer (MCF7, n = 1282; T47D, n = 1169; MDA-MB-231, n = 748; unpaired two-tailed Wilcoxon test), c, Schematic overview of the breast cancer cell lines representing the different subtypes of breast cancer, d, Volcano plots of changes in protein abundance on chromatin in MDA-MB-231 vs MCF7 (left panel) and linear regression coefficient of protein chromatin intensity against cell line aggressiveness (right panel); IMPDH2 highlighted in red, purine synthesis and metabolic pathways colored in orange and yellow, respectively, e, Western blot detection of IMPDH2 protein on cytosolic and chromatin fractions of breast cancer cell lines representing the different subtypes of breast cancer, (f), Schematic representation (top) of the generation of hormone insensitive cells (HI) from parental (P) MCF7 cells and western blot detection (bottom) of IMPDH2 protein on cytosolic and chromatin fractions of MCF7 P and HI cells, (g), Quantification of IMPDH2 nuclear positive cells (left panel), and IMPDH2 nuclear signal (right panel) detected by immunohistochemistry in breast cancer tissue microarray (grade 1 , n = 7; grade 2, n = 53; grade 3, n = 40; unpaired two-tailed Wilcoxon test).

[0144] Figure 2 Normalized IMPDH2 chromatin abundance in (a) normal and breast cancer cell lines and (b) normal and lung cancer cell lines determined by subcellular fractionation coupled to mass spectrometry (MS) analysis.

[0145] Figure 3. Combined inhibition of IMPDH2 and PARP1 leads to an antagonistic effect. Sinergy matrixes showing cell viability measured with crystal violet assay. MDA- MB-231 cells were treated with MPA and Olaparib (n=2) (a) or MPA and Carboplatin (b) alone or in combination at the indicated concentrations for 96h (n=3). SC indicates the synergy score. (A synergy score lower than -10 indicates that the effect of both drugs is likely to be antagonistic, and from -10 to 10: the interaction between the two drugs is likely to be additive) The synergy score was calculated using the Synergy Finder 3.066.

[0146] Figure 4. Correlation between veliparib sensitivity and IMPDH2 chromatin abundance in (a) breast and (b) lung cancer cell lines

[0147] Figure 5. Viability test to increasing concentrations of Olaparib (0, 1, 2.5, 5, 10, 20, 40 and 80 uM) after 96 hours of treatment in MDA-MB-231 , Pane 04.03, MiaPaca-2 and A549 transfected with either a vector with IMPDH2 tagged with 3xnls (nuclear localization signal) expressing nuclear IMPDH2 or "empty" vector which is the control vector from the lentiviral and not expressing IMPDH2. Three replicates were performed. Error bars represent SD. P-values were calculated using the t-test were ns: not significant (P>0.005), *P<0.05, **P<0.01, ***P<0.001.

[0148] Examples

[0149] Materials and Methods

[0150] Cell culture

[0151] MCF7 (ATCC #HTB-22), T47D (ATCC #HTB-133), BT-474 (ATCC #HTB-20), SK-BR-3 (ATCC #HTB-30), Hs 578T (ATCC #HTB-126), BT-549 (ATCC #HTB-122), MDA-MB- 231 (ATCC #HTB-26), CAL-51 (DSMZ #ACC 302), MDA-MB-468 (ATCC #HTB-132), A549 (ATCC #CCL-185), EBC-1, and Pane 04.03 (ATCC; #CRL-2555) were cultured in DMEM media (Gibco; #11966025) supplemented with 10% Fetal Bovine Serum (FBS, Gibco; #10270106) and 1% penicillin / streptomycin (Gibco; #15140122) at 37°C and 5% CO2. H1437, H522, H1975, H1395, HCC-44, H23, H358 and H 460 were cultured in in RPMI 1640 Medium, GlutaMAX™ Supplement (Gibco™ #61-870-036). For MCF 10A (ATCC #CRL-10317), DMEM / F12 media (Gibco; #11320-033) was used supplemented with 5% Horse Serum, 20 ng / ml EGF, 0.5g / ml hydrocortisone, 10g / ml insulin, 10Ong / pl cholera toxin and 1% penicillin / streptomycin. To obtain the MCF7 hormone-insensitive cell line, MCF7 cells were cultured in hormone-deprived media for at least 4 weeks. Specifically, were cultured in phenol-red free media (Opti-MEM™ I Reduced Serum Medium, no phenol red, Thermo Scientific, #11058021) and charcoal FBS (FBS, Charcoal Stripped, sterile-filtered, suitable for cell culture, Sigma-Aldrich, #F6765- 500m L).

[0152] Cells were trypsinized using Trypsin-EDTA (Trypsin-EDTA (0.25%), phenol red, Thermo Scientific, #25200072). Cells used in these experiments arise from the CRG-PRBB cell line collection and have been previously authenticated.

[0153] Compounds Mycophenolic acid (MPA, MedChem Express #HY-B0421), etoposide (ETO, MedChem Express #HY-13629), and Olaparib (MedChemExpress #HY-10162) were dissolved in DMSO, Carboplatin (MedChemExpress # HY-17393) was dissolved in H2O.

[0154] Whole Cell Extracts

[0155] Whole-cell extracts were obtained by lysing with 2%SDS lysis buffer (2%SDS, 50mM Tris-HCI pH 7.4, 10% glycerol) and boiling at 95°C for 5 min, followed by quantification in a NanoDrop spectrophotometer using the Protein A280 mode.

[0156] Immunofluorescence

[0157] Immunofluorescence was performed in a 96-well plate format using black / clear bottom plates (PhenoPlate, PerkinElmer #6055508). At the desired experimental point, plates were washed with PBS and fixed with 4% formaldehyde in PBS [Formaldehyde 16% (w / v) methanol-free, Pierce™ # 28908] during 15 min / RT. Plates were then washed twice with PBS and the permeabilization step was performed by the addition of 0.2% T riton X- 100 in PBS during 20 min / RT. After two PBS washes, the blocking step was performed with 5% bovine serum albumin (BSA) in PBS for 1 hour / RT, followed by incubation with primary antibodies diluted in 0.5% BSA in PBS for 2 hours / RT. Plates were then rinsed with 0.05% Tween 20 in PBS, washed with PBS and incubated with secondary antibodies [Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488, (Invitrogen #A-21206); Goat anti-Mouse IgG (H+L) Highly Cross- Adsorbed Secondary Antibody, Alexa Fluor 555 (Invitrogen #A-21424), Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 (Thermo Scientific #A- 21244)] diluted 1:1000 in 0.5% BSA in PBS for 1 hour / RT in the dark.

[0158] Plates were then rinsed with 0.05% Tween 20 in PBS, washed with PBS, and incubated with DAPI at 1 pg / ml (4',6-diamidino-2-phenylindole, Sigma-Aldrich #MBD0015) or Hoechst 33342 (Life Technologies, # H3570) for 7 min / RT, followed by two PBS washes. Images were acquired with an Operetta High Content Screening System (PerkinElmer) and analyzed using the Harmony software (version 4.9).

[0159] The primary antibody used was phospho-Histone H2A.X (Ser139) mouse monoclonal antibody, clone JBW301 (Millipore #05-636-1; 1:500),.

[0160] Immunohistochemistry

[0161] Tumor microarray (TMA) BR1141a (TissueArray.Com) was used for immunohistochemical detection of IMPDH2 protein. The slide was placed in the oven at 65°C / ON, deparaffinized, and rehydrated. The antigen retrieval step was performed by boiling sodium citrate buffer (pH = 6.0) in a pressure cooker, followed by incubation in 3% H2O2 in PBS for 15 min for inactivation of endogenous peroxidase. Blocking and permeabilization step was performed with 1%BSA, and 0.3% Triton-X100 in PBS during 1 hour / RT, followed by incubation with Anti-IMPDH2 rabbit monoclonal antibody [EPR8364(B)] (Abeam #ab131158) diluted 1 :250 in 1 %BSA in PBS ON / 4°C. Following PBS washes, TMA was incubated with ImmPRESS (Peroxidase) Polymer Anti-Rabbit IgG Reagent (Vector Laboratories #MP-7451) for 2 hours / RT, PBS washed and stained with 3,3-diaminobenzidine (DAB, Agilent Dako #K346711-2) for 1 min. Other IMPDH2 antibodies that can be used are Anti-IMPDH2 antibody [EPR8365(B)] monoclonal, and abeam HPA001400-100UL sigma polyclonal. Although any antibody anti-IMPDH2 suitable for IHC should work. The slide was then counterstained with hematoxylin 20% for 2 min, dehydrated, and mounted. Images were obtained with a VENTANA DP 200 slide scanner and analyzed with QuPath software.

[0162] Chromatome fractionation

[0163] Cells were lysed in 1.5% CHAPS (3-cholamidopropyl dimethylammonium 1-propane sulfonate) in PBS for 20 minutes to break the cytosolic membrane and centrifuged for 5 min at 720g at 4°C. The supernatant was harvested as the cytosolic fraction. The nuclear pellet was resuspended in Cytoplasmic Lysis Buffer (IGEPAL 0.1%, NaC1 150 mlVI, Tris- HC1 10 mlVI pH 7 in H2O), placed on the top of a Sucrose Gradient Buffer (NaC1 150 mM, sucrose 25%, Tris-HCI 10 mM pH 7 in H2O) and centrifuged for 5 min at 1200g at 4°C. Purified nuclei were then washed 3 times by resuspending in Nuclei Washing Buffer (EDTA 1 mM, IGEPAL 0.1% in PBS) and centrifuged for 5 min at 1200g at 4°C. Then, the washed nuclear pellet was resuspended in Nuclei Resuspension Buffer (EDTA 1 mM, NaCI 75 mM, 50% sucrose, Tris-HCI 20 mM pH 8 in H2O) and the nuclear membrane was lysed by adding Nuclei Lysis Buffer (EDTA 0.2 mM, HEPES 20 mM pH 7.5, IGEPAL 0.1%, NaCI 300 mM in H2O), vortexing and incubating for 2 min. After centrifugation for 2 min at 16000g at 4°C, the resulting chromatin was resuspended in Benzonase Digestion Buffer (15 mM HEPES pH 7.5, 0.1% IGEPAL, TPCK 5pg / mL) and sonicated on a Bioruptor Pico (Diagenode) for 15 cycles 30 sec ON / 30 sec OFF in 1.5 mL Diagenode tubes (Diagenode; #C30010016). Finally, sonicated chromatin was digested with benzonase enzyme (VWR; #706643; 2.5U) for 30 min at room temperature, and the resulting sample was harvested as chromatome fraction. All the steps were performed on ice and all buffers were supplemented with proteinase inhibitors (Roche; #4693132001). Cytosolic and chromatome extracts were quantified with Pierce BCA Protein Assay Kit (Thermo Scientific; #PIER23225).

[0164] IMPDH2 Pull-down Protein A Dynabeads (Thermo Scientific; #10001 D) were incubated for 4 hours on a rotating wheel at 4°C with primary antibodies IMPDH2 (Proteintech; # 12948-1-AP; 5pg) or negative control IgG (Sigma-Aldrich; #15006; 5pg). Then, antibody-bound beads were incubated with 2 mg chromatome extracts overnight on a rotating wheel at 4°C. The complexes were then washed three times with Nuclei Wash Buffer (EDTA 1 mM, IGEPAL 0.1% in PBS).

[0165] Western Blot

[0166] Protein samples were separated by standard sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) method and transferred to a 0.45pm nitrocellulose membrane (AmershamTM #10600002) for immunoblotting. Membranes were blocked with 5% non-fat milk in TBS-Tween 0.05% and blotted with primary antibodies. Fluorescence-conjugated secondary antibodies Alexa Fluor Plus 800 goat anti-rabbit IgG (Thermo Fisher Scientific #A32735; 1 :10000) and Alexa Fluor™ 680 goat antimouse IgG (Thermo Fisher Scientific #A21058; 1:10000) were used for signal detection with Odyssey CLx Imaging System (LI-COR Biosciences).

[0167] Primary antibodies use were Anti-IMPDH2 rabbit monoclonal antibody [EPR8364(B)] (Abeam #ab131158; 1:1000), Vinculin (E1 E9V) XP® rabbit monoclonal antibody (Cell Signaling Technology #13901 ; 1 :1000), FDX1 rabbit polyclonal antibody (Thermo Fisher Scientific #PA5-59653; 1:1000), Histone H3 (1 B1 B2) mouse monoclonal antibody (Cell Signaling Technology #14269; 1:10000).

[0168] Mass Spectrometry (MS)-based analysis of chromatin-associated proteome

[0169] Chromatome extraction

[0170] The cellular pellet was resuspended in 1 mL of SB buffer (HEPES 10mM, KCI 10mM, MgCI2 1.5mM, sucrose 0.1 %, and proteinase inhibitor cocktail (Sigma 4693159001). After a 30 min incubation at 4°C, the tubes were centrifuged for 3 min at 2000g at 4°C. The supernatant was stored for further analysis as it comprises the cytoplasmic fraction of cells and was used as a control. The pellet containing the nuclei of the cells was resuspended in 0.5mL of SB buffer and then ultracentrifuged on a sucrose gradient over SC buffer (HEPES 10mM, KCL 10mM, MgCI2 1.5mM, Sucrose 2.1 M and Proteinase Inhibitors. Ultracentrifugation was performed at 53000rpm for 3h at 4°C with reduced acceleration and deceleration of 5 out of 10 in a TLA100.3 rotor and an Optima TableTop Ultracentrifuge (Beckman Coulter). After the ultracentrifugation, the supernatant containing the nuclear proteins was discarded while the pellet containing the chromatin and its associated proteins was resuspended on 0.5ml_ of buffer SB and later centrifuged at 20000g for 45 min at 4°C to remove the rest of the sucrose gradient. Two washing steps were then performed by using a buffer composed of HEPES 10mMM and proteinase inhibitors (Sigma 4693159001). The pellet contains chromatin and its associated proteins. To release the chromatin-associated proteins, a sonication procedure was performed followed by a DNA digestion step. For the sonication, the chromatin pellet was resuspended in 0.25mL of Benzonaze digestion buffer (HEPES 15mM, EDTA 1mM, EGTA 1mM, 5mg / mL TPCK, 1% of NP40 and Proteinase inhibitors (Sigma 4693159001)). We used a BioRuptor Pico sonication device from Diagenode, specially designed for chromatin, DNA, and RNA shearing. Chromatin was sheared through 15 cycles of 30 seg of sonication followed by 45 seg of pause. DNA was then degraded through the enzymatic action of 1uL of Benzonaze (Millipore 70664) and RNA was removed with the addition of the RNAse A at a 1:1000 dilution (Thermo EN0531). DNA and RNA digestions were performed during 30-40 min incubation at 4°C in a rotary wheel. At this point, proteins associated with chromatin were released into the solution. The final chromatome sample from 40 million cells (253.5uL) was then split into three equal samples. Sample 1 was kept in its native state and immediately stored at -80°C for further use. Samples 2 and 3 were treated to denature proteins either with 6M urea or with SDS 2%. Both samples were also stored at -80°C until used.

[0171] Sample preparation for MS

[0172] Samples (20pg) were reduced with dithiothreitol (100mM, 37°C, 60min) and alkylated in the dark with iodoacetamide (5pmol, 25°C, 20min). The resulting protein extract was washed with 2M urea with 100 mM TRIS-HCL and then with 50mM ammonium bicarbonate for digestion with endoproteinase LysC (1 :10 w:w, 37°C, o / n, Wako, cat #129-02541) and then for trypsin digestion (1 :10 w:w, 37°C, 8h, Promega cat #V5113) following Wisniewski et al53 FASP procedure. After digestion, the peptide mix was acidified with formic acid and desalted with a MicroSpin C18 column (The Nest Group, Inc.) before LC-MS / MS analysis.

[0173] Chromatographic and mass spectrometric analysis

[0174] Samples were analyzed using an Orbitrap Eclipse mass spectrometer (Thermo Fisher Scientific, San Jose, CA, USA) coupled with an EASY-nLC 1200 (Thermo Fisher Scientific, San Jose, CA, USA). Peptides were loaded directly onto the analytical column and were separated in a water-acetonitrile 90-min gradient by reversed-phase chromatography using a 50-cm column with an inner diameter of 75pm, packed with 2pm C18 particles spectrometer (Thermo Scientific, San Jose, CA, USA). The mass spectrometer was operated in data-dependent acquisition (DDA) mode and full MS scans with 1 micro scan at a resolution of 120,000 were used over a mass range of m / z 350-1500 with detection in the Orbitrap mass analyzer. Auto gain control MS1 was set to 1 E5 and charge state filtering disqualifying singly charged peptides was activated. In each cycle of data-dependent acquisition analysis, following each survey scan, the most intense ions above a threshold ion count of 10000 were selected for fragmentation. The number of selected precursor ions for fragmentation was determined by the “Top Speed” acquisition algorithm and a dynamic exclusion of 60 s. Fragment ion spectra were produced via high-energy collision dissociation (HCD) at a normalized collision energy of 28% and they were acquired in the ion trap mass analyzer. AGC MS2 was set to 1 E4, and an isolation window of 1.6 m / z and a maximum injection time of 200 ms were used. All data were acquired with Xcalibur software v4.1 .31 .9. Digested bovine serum albumin (New England Biolabs cat #P8108S) was analyzed between each sample to avoid sample carryover and to assure the stability of the instrument and QCIoud has been used to control instrument longitudinal performance during the project. Acquired spectra were analyzed using the Proteome Discoverer software suite (v2.4, Thermo Fisher Scientific) and the Mascot search engine (v2.6, Matrix Science). The data were searched against a Swiss-Prot human database (April 2019) plus a list of common contaminants and all the corresponding decoy entries. For peptide identification a precursor ion mass tolerance of 7 ppm was used for the MS1 level, trypsin was chosen as the enzyme, and up to three missed cleavages were allowed. The fragment ion mass tolerance was set to 0.5 Da for MS2 spectra. Oxidation of methionine and N-terminal protein acetylation were used as variable modifications whereas carbamidomethylation on cysteines was set as a fixed modification. False discovery rate (FDR) in peptide identification was set to a maximum of 5%. Peptide quantification data were retrieved from the “Precursor ions quantifier” node from Proteome Discoverer (v2.4) using 2 ppm mass tolerance for the peptide extracted ion current (XIC). The obtained values were used to calculate protein fold changes and their corresponding adjusted p-values.

[0175] Bioinformatic analysis

[0176] For the comparison of the protein lists retrieved by mass spectrometry among the samples, we used the Panther Classification System (http: / / pantherdb.org / ) following the protocol described in Thomas el. al 2019. Protein lists were classified according to their molecular function, biological process, and metabolic pathways among other criteria. Classifications were visualized by pie charts generated also through the Panther Classification System.

[0177] Data processing Chromatin data were normalized using the normalize_vsn and median_normalisation functions from the DEP and proDA packages, respectively. The rest of the pipeline was followed according to the DEP package, with the inclusion of impute. mi function for protein-imputation from the imp4p package. Q-value FDR control was implemented through the qvalue R package. Known subcellular localizations for proteins were obtained from the pRoloc R package, and the normalization of proteins to their expected whole-cell extract (WCE) levels for untreated breast cancer cell lines was performed through the ProteomicRuler in Perseus. The WCE protein expression was obtained from the CCLE proteomics dataset. Analysis was facilitated by the tidyverse64 collection of packages. Chromatin protein abundance association of cancer cell line aggressiveness was performed using the Im function.

[0178] Drug Sensitivity correlation analysis

[0179] Pre-processed cell line drug sensitivity data, quantified as Area Under the Curve (AUC), were downloaded from https: / / ctd2- data.nci.nih.gov / Public / Broad / Broad_2018_CTRPv3 / (downloaded on 14 / 08 / 2023). Cell lines with higher AUC values, are expected to be more sensitive to drug treatment. IMPDH2 chromatin abundance values were obtained from https: / / www.biorxiv.Org / content / 10.1101 / 2023.12.06.570368v1 , as reported in the study. Breast and Lung cell lines which were present in both studies and had both reported Veliparib and IMPDH2 quantitation were used to plot a linear regression using the ggplot2 R package and the geom_smooth function using the 'Im' method and level parameter set at 0.9.

[0180] Plasmids generation

[0181] To obtain the lentiviral plasmids containing the 3xNLS-IMPDH2 gene and the control lentiviral plasmid without IMPDH2 (EMPTY), different strategies were followed. NLS stands for nuclear localization signal. For the 3xNLS-IMPDH2 version, two oligos containing the 3xHA (Primers 12, 13) with T4 Polynucleotide Kinase (PNK) (New England Biolab; #M0201) were annealed, amplified with Primers 14 and 15 using the Phusion High-Fidelity DNA Polymerase (ThermoFisher Scientific; #F530) and purified with QIAquick PCR & Gel Cleanup Kit (Qiagen; #28506). A geneblock (custom designed and synthesized DNA fragment) corresponding to wild-type IMPDH2 was ordered from Integrated DNA technologies (WT-IMPDH2-GB; SEQ ID NO:28) and was cloned via Gibson assembly with the 3xHA PCR product in GO-HYG plasmid (adapted from Addgene# 83841) prior cut with Nhel (New England Biolabs; # R3131S) and Pmel (New England Biolabs; # R0560S) for 3 h at 50 °C, followed by DH5a E. coli cells transformation. Single clones were Sanger sequenced (Primers 16—18). For the NLS introduction, a geneblock to introduce the 3xNLS: cctgctgctaagagagtgaaactggat (SEQ ID NO:1 ), Nucleoplasmin NLS: aagcggcccgctgctactaagaaggctggtcaggctaagaagaagaag (SEQ ID NO: 2), SV40 NLS: gatccgaagaagaagcgaaaggtc (SEQ ID NO:3)) was ordered(SEQ ID :NO 29). This geneblock was amplified with Primers 19 and 20 using the Phusion High-Fidelity DNA Polymerase (ThermoFisher Scientific; #F530). The WT- IMPDH2 vector was cut with Asci (New England Biolabs; # R0558S) and Nhel. Both products were cleaned with QIAquick PCR & Gel Cleanup Kit and ligated via Gibson reaction for 3 h at 50 °C followed by DH5a E. coli cells transformation. Single clones were Sanger sequenced (Primer 16). The excision of the IMPDH2 gene from the previous plasmid gave rise to the version named as EMPTY vector as a control. The sv40PR-puro fragment was amplified using Primers 21 and 22 using the Phusion High-Fidelity DNA Polymerase (ThermoFisher Scientific; #F530) and the resulting purified fragment was cloned via ligation into KO-WT and KO-NLS with T4 DNA ligase (New England Biolab; #M0202). The ligated fragments were transformed into DH5a E. coli competent cells

[0182] (Thermo Fisher Scientific; #18265017) and single colonies were analyzed with Sanger sequencing to select positive clones (Primers 23 and 24). The following table discloses the primers used

[0183] Table 1. List of primers used

[0184] SEQ ID NO:28 WT-IMPDH2-GB (IMPDH2 coding sequence)

[0185] GCCGACTACCTGATTAGTGGGGGCACGTCCTACGTGCCAGACGACGGACTCACA

[0186] GCACAGCAGCTCTTCAACTGCGGAGACGGCCTCACCTACAATGACTTTCTCATTC TCCCTGGGTACATCGACTTCACTGCAGACCAGGTGGACCTGACTTCTGCTCTGAC

[0187] CAAGAAAATCACTCTTAAGACCCCACTGGTTTCCTCTCCCATGGACACAGTCACAG

[0188] AGGCTGGGATGGCCATAGCAATGGCGCTTACAGGCGGTATTGGCTTCATCCACC

[0189] ACAACTGTACACCTGAATTCCAGGCCAATGAAGTTCGGAAAGTGAAGAAATATGAA

[0190] CAGGGATTCATCACAGACCCTGTGGTCCTCAGCCCCAAGGATCGCGTGCGGGAT GTTTTTGAGGCCAAGGCCCGGCATGGTTTCTGCGGTATCCCAATCACAGACACAG

[0191] GCCGGATGGGGAGCCGCTTGGTGGGCATCATCTCCTCCAGGGACATTGATTTTCT

[0192] CAAAGAGGAGGAACATGACTGTTTCTTGGAAGAGATAATGACAAAGAGGGAAGAC

[0193] TTGGTGGTAGCCCCTGCAGGCATCACACTGAAGGAGGCAAATGAAATTCTGCAGC

[0194] GCAGCAAGAAGGGAAAGTTGCCCATTGTAAATGAAGATGATGAGCTTGTGGCCAT CATTGCCCGGACAGACCTGAAGAAGAATCGGGACTACCCACTAGCCTCCAAAGAT

[0195] GCCAAGAAACAGCTGCTGTGTGGGGCAGCCATTGGCACTCATGAGGATGACAAG TATAGGCTGGACTTGCTCGCCCAGGCTGGTGTGGATGTAGTGGTTTTGGACTCTT CCCAGGGAAATTCCATCTTCCAGATCAATATGATCAAGTACATCAAAGACAAATAC CCTAATCTCCAAGTCATTGGAGGCAATGTGGTCACTGCTGCCCAGGCCAAGAACC TCATTGATGCAGGTGTGGATGCCCTGCGGGTGGGCATGGGAAGTGGCTCCATCT GCATTACGCAGGAAGTGCTGGCCTGTGGGCGGCCCCAAGCAACAGCAGTGTACA AGGTGTCAGAGTATGCACGGCGCTTTGGTGTTCCGGTCATTGCTGATGGAGGAAT CCAAAATGTGGGTCATATTGCGAAAGCCTTGGCCCTTGGGGCCTCCACAGTCATG ATGGGCTCTCTCCTGGCTGCCACCACTGAGGCCCCTGGTGAATACTTCTTTTCCG ATGGGATCCGGCTAAAGAAATATCGCGGTATGGGTTCTCTCGATGCCATGGACAA GCACCTCAGCAGCCAGAACAGATATTTCAGTGAAGCTGACAAAATCAAAGTGGCC CAGGGAGTGTCTGGTGCTGTGCAGGACAAAGGGTCAATCCACAAATTTGTCCCTT ACCTGATTGCTGGCATCCAACACTCATGCCAGGACATTGGTGCCAAGAGCTTGAC CCAAGTCCGAGCCATGATGTACTCTGGGGAGCTTAAGTTTGAGAAGAGAACGTCC TCAGCCCAGGTGGAAGGTGGCGTCCATAGCCTCCATTCGTATGAGAAGCGGCTTT TCTGAAAACGAATTCGTCGAGGGACCTA

[0196] SEQ ID NO:29 (geneblock)

[0197] GAGCTGGTTTAGTGAACCGTCAGATCCGCTAGCGCCACCATGCCTGCTGCTAAGA GAGTGAAACTGGATAAGCGGCCCGCTGCTACTAAGAAGGCTGGTCAGGCTAAGA AGAAGAAGGATCCGAAGAAGAAGCGAAAGGTCGGGCAACAAGGATACCCGTATG ATGTTCCGGATTACGCTGGCTACCCATACGACGTCCC

[0198] Lentiviral production

[0199] Lentiviral particles were produced in HEK293T cells seeded in 150 mm plates using a standard Polyethylenimine (PEI)-mediated transfection method (Polysciences; #23966- 1). In brief, 5.5 pg of pCMV-dR8_91 and 4.2 pg of pVSV-G packaging plasmids were mixed with 8.4 pg of plasmid of interest in 1 ml of Opti-MEM (Gibco; #11058021). In parallel, 54.61 of PEI (1 mg / mL) were mixed with 900 pL of Opti-MEM. After 5 min, the two mixtures were combined, incubated for 20 min to allow complex formation, and added dropwise to the cells in serum-free media. After 6 h, the media was changed to regular media. Virus-containing supernatant was collected 48 h after and lentiviral transduction was performed in a 6-well plate format using 1 mL virus-containing supernatant per well in the presence of polybrene (10 pg / mL). Transduced cells were selected with puromycin 2 pg / mL.

[0200] Nuclei counting for viability assay A549, Pane 04.03, MDA-MB-231 transduced cells with the 3XNLS-WT and EMPTY vectors were seeded in a 96-well plate format using black / clear bottom plates (PhenoPlate, PerkinElmer #6055508) in 3 different replicates per vector and treated with increasing concentrations of Olaparib (MedChemExpress #HY-10162) as it follows: 0, 1 , 2.5, 5, 10, 20, 40 and 80 uM. After 96 hours the plates were washed with PBS and fixed with 4% formaldehyde in PBS [Formaldehyde 16% (w / v) methanol-free, Pierce™ # 28908] during 15 min / RT. Plates were then washed twice with PBS and incubated with DAPI (62248, Thermo Fisher) for 10 minutes. The plates were washed twice with PBS and images were acquired with an Operetta High Content Screening System (PerkinElmer) and analyzed using the Harmony software (version 4.9) for nuclei counting with DAPI.

[0201] The ICso was calculated using the GraphPad with a log(inhibitor) vs. response -- Variable slope (four parameters) method where ns: not significant (P> 0.05), *P< 0.05, **P< 0.01 ,

[0202] ***p< 0.001, ****P< 0.0001.

[0203] Results

[0204] IMPDH2 chromatin localization increases in triple-negative breast cancer

[0205] Triple-negative breast cancer (TNBC) cells are more prone to accumulate DNA damage than other breast cancer cells. To verify whether this could also be observed in breast cancer cell lines, we compared endogenous DNA damage levels in MCF7, T47D, and MDA-MB-231 cells, which are commonly used as either Estrogen Receptor positive breast cancer (ER+; MCF7 and T47D) orTNBC (MDA-MB-231) models. High-throughput immunofluorescence (HT-IF) revealed that MDA-MB-231 cells had significantly higher levels of yH2AX, a common DNA damage marker, than MCF7 and T47D cells, confirming that the TNBC model had increased levels of endogenous DNA damage (Fig. 1a, b).

[0206] We next wondered whether the differences in endogenous DNA damage observed in different breast cancer cells might be associated with changes in chromatin-bound metabolic activities. We extracted the proteins associated with the chromatin (hereafter, the chromatome) from five breast cancer cell lines belonging to the four major molecular subtypes, which are MCF7 and T47D (ER+), BT-474 [ER+ and human epidermal growth factor receptor 2 positive (HER2+)], SK-BR-3 (HER2+), and MDA-MB-231 (TNBC) (Fig. 1c). Chromatome extract purity was first checked by western blot using Histone 3 (H3) as a chromatin marker and Vinculin as a cytoplasmic marker. Following signal normalization, we conducted a compartment enrichment analysis and observed that the chromatome fraction was enriched in chromatin and nuclear proteins, while depleted of proteins belonging to other compartments, confirming that our performed subcellular fractionation worked correctly. Gene Ontology (GO) analysis on the identified proteins revealed terms related to the nuclear environment, further confirming the quality of our dataset. Mass spectrometry (MS) analysis of the chromatomes showed good separation between the different cell lines and proper clustering of the replicates and indicated that the MDA-MB-231 and T47D cells had a distinct composition of chromatin-associated proteins compared to MCF7, BT-474 and SK-BR-3, which clustered closer together. We, therefore, compared the chromatome of the TNBC cell line MDA-MB-231 with those of the other breast cancer cell lines. We observed that the enzyme Inosine Monophosphate Dehydrogenase 2 (IMPDH2), which regulates the balance between adenosine monophosphate (ATP) and guanosine monophosphate (GTP), was enriched on chromatin in MDA-MB-231 cells when compared to MCF7 (Fig. 1 d, left panel), BT-474, T47D and SK-BR-3 cells (Extended Data Fig. 1 f-), suggesting a higher requirement for its chromatin localization in the TNBC cells. Breast cancer aggressiveness usually increases from ER+ to TNBC (Fig. 1c). To identify proteins with increased chromatin abundance along with breast cancer aggressiveness, we performed a regression analysis across the cell lines. This analysis indicated that IMPDH2 chromatin abundance correlates with breast cancer cell aggressiveness (Fig. 1 d, right panel and Source Data 3). Chromatome western blot analysis of several breast cancer cell lines confirmed that IMPDH2 was more abundant on chromatin in cell lines belonging to the TNBC subtype (Hs 578T, BT-549, MDA-MB-231 , CAL-51 , MDA-MB-468) (Fig. 1e).

[0207] ER+ breast cancer cells can transform into TNBC-like cells by bypassing ER signaling dependency for growth. By culturing MCF7 cells without estrogen until they began to proliferate in an ER-independent manner, we mimicked this TNBC-like status. Also in this system, we observed an increased amount of IMPDH2 in the chromatin compartment (Fig. 1f). Furthermore, we performed immunohistochemistry using a commercial tissue microarray (TMA) containing 114 human samples of different breast cancer subtypes and grades obtained from patients. When analyzing the results based on tumor grade, we observed that the nuclear localization of IMPDH2, as well as its nuclear signal intensity, were significantly higher in grades 2 and 3 than in grade 1 , confirming the correlation with IMPDH2 nuclear localization and tumor aggressiveness (Fig. 1g). When comparing TNBC samples with the rest of the breast cancer subtypes, we observed higher IMPDH2 nuclear signal in TNBC cells, corroborating our mass spectrometry analysis. The finding that IMPDH2 nuclear levels correlate with cancer aggressiveness were also observed in other tumor types such as lung cancer. Fig. 2 (a, b)

[0208] Overall, our results indicate that IMPDH2 is increased on chromatin in TNBC cell lines and TNBC patient-derived samples. Given the fact that TNBC cells are usually prone to accumulate high levels of DNA damage, we hypothesize that the chromatin-associated function of IMPDH2 may be related to the regulation of the DNA damage response.

[0209] We hypothesized that the binding of IMPDH2 to PARP1 on chromatin might create a local NAD+-deprived environment that stops PARP1 activity preventing cellular energy deprivation. We reasoned that if IMPDH2 limits PARP1 activity, IMPDH2 inhibition may expand the activation capacity of PARP1 , thus decreasing cell sensitivity to PARP1 inhibitors. Thus, we treated MDA-MB-231 cells with MPA an IMPDH2 inhibitor - to MDA- MB-231 cells for 72 hours, using concentrations of 2.5, 7.5, or 15pM) and Olaparib (PARP1 inhibitor) either alone or in combination. We observed that MPA and Olaparib behaved antagonistically, being cells more resistant to Olaparib treatment when MPA was used as cotreatment (Fig. 3a), corroborating our hypothesis. Importantly, Carboplatin, a DNA damage agent that does not directly target PARP1 , did not show the same effect (Fig. 3b). We can conclude than IMPDH2 inhibition renders breast cancer cells less sensitive to PARP1 inhibitors, but not to other DNA damage inducers.

[0210] Finally, by stratifying breast cancer cell lines by IMPDH2 chromatin abundance and correlating this data with PARPi sensitivity, we found that the more IMPDH2 cells have on chromatin, the more sensitive they are to PARPIi (Veliparib) (Fig. 4a), a trend that was also maintained in lung cancer cells (Fig. 4b).

[0211] Cell lines sensitivity data to Veliparib, quantified as Area Under the Curve (AUC), were downloaded from https: / / ctd2-data.nci.nih.gov / Public / Broad / Broad_2018_CTRPv3 / (downloaded on 14 / 08 / 2023). Cell lines with higher AUC values, are expected to be more sensitive to drug treatment. IMPDH2 chromatin abundance values were obtained from Comprehensive chromatome profiling identifies metabolic enzymes on chromatin in healthy and cancer cells. S Kourtis, M Guirola, N Pardo- Lorente, R Ghose, M Garcia- Cao, A Ganez-Zapater, S Haynes, F Fontaine, A Muller, S Sdelci. bioRxiv 2023.12.06.570368; doi: https: / / doi.org / 10.1101 / 2023.12.06.570368, as reported in the study, breast and Lung cell lines which were present in both studies and had both reported Veliparib and IMPDH2 quantitation were used to plot a linear regression using the ggplot2 R package and the geom_smooth function using the 'Im' method and level parameter set at 0.9. Based on these results we have generated a linear regression predictive model that will allow to predict whether a sample comprising cancer cells is sensitive to PARP1 ; The following linear regression models where obtained from the data of Fig. 4a and Fig. 4b respectively:

[0212] Breast cancer: y = 14.9 + 0.124x

[0213] Lung cancer: y = 14.9 + 0.278x

[0214] Wherein “y” is the sensitivity to a Veliparib and “x” is the chromatin nuclear level of IMPDH2.

[0215] Determination of PARP inhibitor sensitive cancer using a PDX mouse model and validation in biopsies of cancer patients

[0216] We next validated the results obtained in cancer cell lines to in vivo models. Our first step was to validate the results in a set of patient-derived xenograft (PDX) samples in nude mice that originate from triple-negative breast cancer samples and have been classified into Olaparib sensitive and resistant. We followed the same approach that was disclosed in the materials and methods section of Serra V, Wang AT, Castroviejo-Bermejo M, et al. Identification of a Molecularly-Defined Subset of Breast and Ovarian Cancer Models that Respond to WEE1 or ATR Inhibition, Overcoming PARP Inhibitor Resistance. Clin Cancer Res. 2022;28(20):4536-4550. doi:10.1158 / 1078-0432. CCR-22-0568. Concretely section Patient-derived tumor xenografts and in vivo experiments

[0217] With these samples, an immunohistochemistry (IHC) was performed to evaluate the percentage of IMPDH2 positive nuclei, the absolute IMPDH2 nuclear intensity and its nuclear / cytoplasmic ratio with at least 1 antibody, preferably 3 different antibodies.

[0218] The results demonstrate that that those PDX sensitive to Olaparib have a nuclear level of IMPDH2 in cancer cells higher than the nuclear and / or cytoplasmic level of IMPDH2 in the noncancerous cells present in the same sample biopsy. Moreover, the nuclear level of IMPDH2 in cancer cells of sensitive PDX was higher than the nuclear and / or cytoplasmic level of IMPDH2 in the cancer cells from resistant PDX.

[0219] We next wondered whether these results could be extrapolated to other tumor types. For this we tried gastrointestinal, cholangiocarcinoma, and pancreatic organoids. The Operetta high content screening microscope (Perkin Elmer) was used for image acquisition and analysis as it has an adaptor for IHC and immunofluorescent slides. We followed the same approach that was disclosed in the materials and methods section of Serra-Camprubi Q, Verdaguer H, Oliveros W, et al. Human Metastatic Cholangiocarcinoma Patient-Derived Xenografts and Tumoroids for Preclinical Drug Evaluation. Clin Cancer Res. 2023;29(2):432-445. doi:10.1158 / 1078-0432.CCR-22-

[0220] 2551

[0221] As with the case with PDX triple-negative breast cancer, the nuclear level of IMPDH2 in PARP inhibitor sensitive organoids was higher than the nuclear and / or cytoplasmic level of IMPDH2 in the PARP inhibitor resistant organoids. The PARP inhibitor used was Olaparib.

[0222] Validation of the results in biopsy samples from patients

[0223] Finally, the role of IMPDH2 in determining a PARP inhibitor sensitive cancer was validated in biopsy samples from patients diagnosed with triple negative breast cancer prior to PARPIi treatment. Patients were followed throughout treatment and disease progression, and information on treatment outcome (PARP1 sensitivity, relapse vs no relapse) is available. Therefore, treatment outcome was correlated with IMPDH2 staining as performed in the previous experiment with PDX. Medical standard procedures and protocols routinely used in the field were used.

[0224] Biopsy material was divided into two groups of at least 50 samples each for independent validation and we will use the Operetta for image acquisition and analysis was used.

[0225] The results obtained in the biopsies from patients demonstrate the role of IMPDH2 in determining PARP inhibitor sensitive cancer.

[0226] IMPDH2 overexpression in cell lines

[0227] A gain of function experiment was designed in order to confirm the findings of the role of IMPDH2 in predicting response to PARP inhibitors. With this aim, a lentiviral vector expressing the human version of IMPDH2 with 3 Nuclear Localization Signals were designed as explained in the material and methods section. When cancer cell lines were transduced with this construct, their sensitivity to the PARP1 inhibitor Olaparib increases compared to the cells transduced with a lentiviral vector not expressing IMPDH2. Fig. 5 shows these findings in cell lines of breast cancer, pancreatic cancer, lung cancer and cervical cancer. In all these cell lines the IC5o value decreased. In the A549 cell line, the baseline IC50 is already significantly lower than in MDA-MB-231 and Pane cells. As a result, the dynamic range for further sensitization to PARP1 inhibition is narrower, making the potentiation effect less pronounced. Nevertheless, a measurable reduction in IC50 is still observed, indicating that sensitivity is enhanced — albeit to a lesser extent — corresponding to a 3 fold decrease.

Claims

CLAIMS1. A method of determining a subject as having a PARP inhibitor sensitive cancer comprising:(a) determining the level of nuclear IMPDH2 in cancer cells from a sample obtained from said subject;(b) establishing the statistical significance of the level of nuclear IMPDH2.

2. The method according to the preceding claim, wherein the level of nuclear IMPDH2 in cancer cells is inputted into a statistical and / or mathematical methodology to produce an output value that indicates whether the patient has a PARP inhibitor sensitive cancer, the statistical and / or mathematical methodology being preferably linear regression.

3. The method according to any of the preceding claims 1 or 2, wherein the statistical significance is established if the nuclear level of IMPDH2 higher than a reference value and a ratio nuclear IMPDH2 level cancer cells / reference value higher than 1 indicates a PARP inhibitor sensitive cancer.

4. The method according to any of the preceding claims, wherein the reference value is the nuclear level of IMPDH2 in noncancerous cells from the same subject, wherein the noncancerous cells are the noncancerous counterparts of the cancer cells of the same tissue.

5. The method according to preceding claims, wherein the noncancerous cells are obtained from the same sample as the cancer cells or from a different sample, preferably the noncancerous cells are obtained from a peripheral blood sample.

6. The method according to any of the preceding claims 1 to 3, wherein the reference value is the nuclear level IMPDH2 in noncancerous cells, being the cancer cell and the non-cancerous cell from the same origin, being the nuclear value of IMPDH2 of a noncancerous cell obtained from known databases or healthy subjects.

7. The method according to any of the preceding claims 1 to 3, wherein the reference value is the nuclear levels of IMPDH2 in cancer cells obtained from at least another sample from the same subject in at least one different time point.

8. The method according to any of the preceding claims 1 to 3, wherein the reference value is the cytoplasmic levels of IMPDH2 in cells from the same subject, preferably, the cytoplasmic levels of IMPDH2 are determined from the cancer or noncancerous cells from the same sample.

9. The method according to claim 8, wherein the cancer cells can be either the same cells in which the nuclear levels of IMPDH2 are measured or different cancer cells from those in which the nuclear levels of IMPDH2 are measured.

10. The method according to the claim 8, wherein the cytoplasmic levels of IMPDH2 are determined from cells obtained from at least another sample from the same subject in at least one-time point.

11. The method according to any of the preceding claims, wherein the nuclear localization of IMPDH2 in cancer cells is accumulation of IMPDH2 on chromatin.

12. The method according to any of the preceding claims, wherein the cancer is selected from breast cancer, ovarian cancer, prostate cancer, pancreatic cancer, lung cancer, colon cancer, glioblastoma, leukemia and lymphoma, cervical cancer, preferably breast cancer, pancreatic cancer, cervical cancer and / or lung cancer.

13. The method according to any of the preceding claims, wherein the PARP inhibitor sensitive cancer displays nuclei-localized IMPDH2 staining, preferably the PARP inhibitor sensitive cancer being breast cancer, pancreatic cancer, cervical cancer and / or lung cancer.

14. The method according to any of the preceding claims, wherein the PARP inhibitor is selected from a PARP1 inhibitor, a PARP2 inhibitor and / or a combination thereof.

15. A kit for performing the method described in any of the claims 1 to 14, that comprises at least a reagent capable of specifically determining the nuclear level of IMPDH2 in a sample comprising cells from a subject.

Images