Production of p-aminobenzoic acid by a recombinant microorganism
A recombinant microorganism with inactivated anthranilate phosphoribosyltransferase and enhanced aminodeoxychorismate synthase activity produces PABA at higher yields, addressing the industrial production challenge.
Patent Information
- Application Number
- PCT/EP2025/070169
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-15
- Filing Date
- 2025-07-15
- Publication Date
- 2026-01-22
AI Technical Summary
Existing microorganisms are not capable of producing p-aminobenzoic acid (PABA) at yields compatible with industrial requirements, despite previous modifications to overexpress aminodeoxychorismate synthase and 4-amino-4-deoxychorismate lyase.
A recombinant microorganism is developed by inactivating anthranilate phosphoribosyltransferase activity through deletion of the trpD gene and optionally anthranilate synthase activity, and expressing genes encoding aminodeoxychorismate synthase components and 4-amino-4-deoxychorismate lyase to enhance PABA production.
Significantly increases PABA production, achieving higher yields than previous methods, making it suitable for industrial applications.
Smart Images

Figure IMGF000016_0001 
Figure IMGF000040_0001 
Figure IMGF000042_0001
Abstract
Description
[0001] PRODUCTION OF P-AMINOBENZOIC ACID BY A RECOMBINATING MICROORGANISM
[0002] FIELD OF INVENTION
[0003] The present invention relates to a recombinant microorganism exhibiting improved p-aminobenzoic acid production and its use for the production of p-aminobenzoic acid.
[0004] TECHNOLOGICAL BACKGROUND
[0005] p-Aminobenzoic acid (PABA) is a compound used in dyes, food additives, pharmaceuticals, and as a crosslinking agent for polyurethanes. To date, industrially used PABA is chemically synthesized from fossil fuels. However, many organisms, including Escherichia coli, are capable of synthesizing it as an intermediate in folic acid synthesis. PABA is synthesized from chorismate via a two-step reaction. The first step is catalyzed by components I and II of an aminodeoxychorismate synthase, which produce 4-amino-4-deoxychorismate from chorismate. The second step is carried out by a 4-amino-4-deoxychorismate lyase, which catalyzes the cleavage and aromatization of 4-amino-4-deoxychorismate to produce PABA and pyruvate.
[0006] Several microorganisms have been used to produce PABA. One strain of Saccharomyces cerevisiae was modified to overexpress an aminodeoxychorismate synthase. This strain also included a deletion of the ARO7 gene encoding chorismate mutase and the trp3 gene encoding anthranilate synthase (Krômer et al. J. Biotechnol. 2013;163: 184-193). Similarly, a strain of E. coli and a strain of Corynebacterium glutamicum were modified to overexpress the genes encoding aminodeoxychorismate synthase and 4-amino-4-deoxychorismate lyase, thereby increasing their PABA production (Koma et al. Bioscience, Biotechnology, and Biochemistry, 78(2), 350-357; Kubota et al. Metab Eng. 2016 Nov;38:322-330; EP3421599). However, these attempts did not achieve yields compatible with the industrial production of PABA using microorganisms.
[0007] Therefore, there remains a need to develop new strains of microorganisms with an improved capacity to produce p-aminobenzoic acid.
[0008] SUMMARY OF THE INVENTION
[0009] According to a first aspect, the present invention relates to the use of a recombinant microorganism for the production of p-aminobenzoic acid, wherein said recombinant microorganism is capable of producing p-aminobenzoic acid from chorismate and wherein the anthranilate phosphoribosyltransferase activity is inactivated.
[0010] Preferably, anthranilate phosphoribosyltransferase activity is inactivated in said recombinant microorganism by total or partial deletion of the endogenous trpD gene, in particular by total or partial deletion of the region of the endogenous trpD gene encoding the anthranilate phosphoribosyltransferase TrpD activity.
[0011] Preferably, in said recombinant microorganism, anthranilate synthase activity is also inactivated. In particular, anthranilate synthase activity can be inactivated by total or partial deletion of the trpE gene and / or by total or partial deletion of the endogenous trpG gene and / or by total or partial deletion of the region of the endogenous trpD gene encoding the TrpG glutamine amidotransferase activity. More particularly preferred, especially when the microorganism comprises a bifunctional TrpGD protein, anthranilate synthase activity can be inactivated by total or partial deletion of the trpE gene and / or by total or partial deletion of the region of the endogenous trpD gene encoding the TrpG glutamine amidotransferase activity.
[0012] In a more particularly preferred manner, in said recombinant microorganism, the anthranilate phosphoribosyltransferase activity is inactivated by total deletion of the endogenous trpD gene or by total or partial deletion of the region of the endogenous trpD gene encoding the anthranilate phosphoribosyltransferase activity TrpD, and the anthranilate synthase activity is inactivated by total or partial deletion of the trpE gene and / or by total or partial deletion of the region of the endogenous trpD gene encoding the glutamine amidotransferase activity TrpG.
[0013] The recombinant microorganism may include
[0014] - a heterologous gene encoding component I of an aminodeoxychorismate synthase (PabB),
[0015] - a heterologous gene encoding component II of an aminodeoxychorismate synthase (PabA),
[0016] - a heterologous gene encoding an enzyme having component I activity of an aminodeoxychorismate synthase and component II activity of an aminodeoxychorismate synthase (PabAB),
[0017] - a heterologous gene encoding a 4-amino-4-deoxychorismate lyase (PabC), and / or
[0018] - - a heterologous gene encoding an enzyme having component I activity of an aminodeoxychorismate synthase and 4-amino-4-deoxychorismate lyase (PabBC) activity.
[0019] Preferably, it includes
[0020] - a heterologous gene encoding an enzyme having component I activity of an aminodeoxychorismate synthase and component II activity of an aminodeoxychorismate synthase (PabAB), and
[0021] - a heterologous gene encoding a 4-amino-4-deoxychorismate lyase (PabC).
[0022] Especially,
[0023] - the pabAB gene can code for an enzyme comprising, or consisting of, an amino acid sequence selected from the group consisting of SEQ ID NO: 54 to 59, and polypeptides having at least 70% sequence identity with any of the SEQ ID NO: 54 to 59 and exhibiting PabAB activity, preferably an amino acid sequence selected from the group consisting of SEQ ID NO: 54, and polypeptides having at least 70% sequence identity with SEQ ID NO: 54 and exhibiting PabAB activity;and / or -the pabC gene may code for an enzyme comprising, or consisting of, an amino acid sequence selected from the group consisting of SEQ ID NO: 45 to 53, and polypeptides having at least 70% sequence identity with any of the SEQ ID NO: 45 to 53 and exhibiting PabC activity, preferably an amino acid sequence selected from the group consisting of SEQ ID NO: 51, and polypeptides having at least 70% sequence identity with SEQ ID NO: 51 and exhibiting PabC activity.;
[0024] The microorganism can be genetically modified to overexpress an endogenous gene encoding a 3-deoxy-D-arabino-heptulosonate-7-phosphate (DAHP) synthase and / or express a heterologous gene encoding a DAHP synthase. Specifically, it may include a heterologous gene encoding a feedback-resistant 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase.
[0025] It can also overexpress an endogenous gene encoding a transketolase and / or include a heterologous gene encoding a transketolase.
[0026] Preferably, the microorganism is a bacterium, and more particularly preferably a bacterium of the species E. coli.
[0027] According to a second aspect, the present invention relates to a microorganism as described above.
[0028] In another aspect, the present invention relates to a process for producing p-aminobenzoic acid comprising culturing a recombinant microorganism according to the invention and optionally recovering the p-aminobenzoic acid produced. The recombinant microorganism is preferably cultured in a culture medium comprising glucose.
[0029] According to another aspect, the present invention also relates to a method for increasing the production of p-aminobenzoic acid by a microorganism capable of producing p-aminobenzoic acid from chorismate, said method comprising genetically modifying said microorganism so as to inactivate endogenous anthranilate phosphoribosyltransferase activity. DESCRIPTION OF FIGURES
[0030] Figure 1: Schematic representation of the biosynthesis of PABA and aromatic amino acids.
[0031] Figure 2: Residual concentration in mg / L of tyrosine (black) phenylalanine (white) anthranilate (dark grey) and PABA (light grey) analyzed in the supernatants of cultures of strains SI, S2, S3 and S4 under erlenmeyer conditions after 48h.
[0032] Figure 3: PABA production kinetics (g / L) in the S4-p2 strain in a 2L bioreactor in M9-2 medium.
[0033] Figure 4: PABA production kinetics (g / L) in strain S5 in 2L bioreactor in M9-2 medium.
[0034] DETAILED DESCRIPTION OF THE INVENTION
[0035] The inventors genetically modified a strain of E. coli to produce p-aminobenzoic acid (PABA). This strain expresses components I and II of an aminodeoxychorismate synthase (PabB and PabA) as well as a 4-amino-4-deoxychorismate lyase (PabC). As illustrated in Figure 1, these three enzymes enable the synthesis of PABA from chorismate.
[0036] Chorismate is an intermediate metabolite in the aromatic amino acid biosynthesis pathway, particularly that of tryptophan. To increase the amount of chorismate available for PABA production, the inventors deleted the gene encoding the anthranilate synthase TrpE, which is involved in the first reaction of the tryptophan biosynthesis pathway, namely the synthesis of anthranilate from chorismate. However, this deletion had no effect on PABA production (see Figure 2).
[0037] The inventors tested PABA production in a strain where the trpD gene had been partially deleted to inactivate the TrpD domain of the bifunctional protein encoded by trpD—that is, the domain responsible for anthranilate phosphoribosyltransferase activity. TrpD is involved in the second step of tryptophan synthesis and uses anthranilate as a substrate. In this strain, anthranilate synthase activity is maintained. Surprisingly, the inventors observed that simply inactivating TrpD significantly increased PABA production. This result is entirely counterintuitive. Indeed, in this strain, some of the chorismate required for PABA production is used to produce anthranilate, which should normally limit PABA production.
[0038] Similarly, the inventors tested PABA production in a strain where the trpE gene was deleted and the trpD gene was partially deleted to inactivate the TrpD domain of the bifunctional protein encoded by trpD. Contrary to expectations, this strain exhibited significantly higher PABA production than the strain in which only anthranilate synthase (TrpE) was inactivated. This result is also highly surprising given that the trpD deletion should not provide any additional effect compared to the trpE deletion.
[0039] These results therefore illustrate a new method to increase PABA production from a recombinant microorganism, namely the inactivation of TrpD, optionally in combination with the inactivation of Tanthranilate synthase.
[0040] Definitions
[0041] As used here, the term "recombinant microorganism" refers to a microorganism not found in nature that contains a modified genome resulting from the insertion, modification, or deletion of one or more genetic elements, i.e., that includes recombinant nucleic acid. This term also includes any offspring of said microorganism that are not identical to the parent microorganism due to mutations occurring during replication. The microorganism may be a bacterium, a filamentous fungus, or a yeast, preferably a bacterium or a yeast, and more preferably a bacterium.
[0042] The term "recombinant nucleic acid" refers to a nucleic acid that has been modified and does not exist in a naturally occurring microorganism. For example, this term can refer to a coding sequence or gene that is operationally linked to a promoter that is not the natural promoter. For genes comprising exons and introns, it can also refer to a coding sequence in which the introns have been deleted. "Heterologous" means that the gene has been introduced into the recombinant microorganism through genetic engineering. It may be present in episomal or chromosomal form. The origin of the gene may be different from the cell into which it is introduced. However, the gene may also originate from the same species as the cell into which it is introduced but is considered heterologous because of its non-natural environment.For example, a gene or nucleic acid sequence is heterologous because it is under the control of a promoter other than its natural promoter, or it is introduced at a different location than its natural one. The recombinant microorganism may contain a copy of the endogenous gene prior to the introduction of the heterologous gene, or it may not contain an endogenous copy. Furthermore, the nucleic acid sequence can be heterologous in the sense that the coding sequence has been optimized for expression in the microorganism. Preferably, in this document, a heterologous nucleic acid sequence codes for a protein that is heterologous to the microorganism, that is, one that is not naturally present in the microorganism.
[0043] As used here, the term "native" or "endogenous", in relation to the recombinant microorganism, refers to a genetic element or protein naturally present in said microorganism.
[0044] The term "gene" refers to any nucleic acid that codes for a protein. The term encompasses DNA, such as cDNA or gDNA, as well as RNA. A gene can first be prepared using recombinant, enzymatic, and / or chemical techniques and then replicated in a host cell or in vitro system. A gene typically comprises an open reading frame that codes for a desired protein. A gene may also contain additional sequences such as a transcription terminator or a signal peptide. Due to the degeneracy of the genetic code, several nucleic acids can code for a particular polypeptide. Thus, the codons in the coding sequence for a given polypeptide can be modified to achieve optimal expression in a specific microorganism, for example, by using codon translation tables appropriate for that microorganism.Nucleic acids can also be optimized for a preferred GC content for the specific microorganism and / or to reduce the number of repetitive sequences. In some embodiments, heterologous nucleic acids have been optimized codon-wise for expression in the microorganism of interest. Codon optimization can be performed using routine methods known in the field (see, for example, Welch, M., et al. (2011), Methods in Enzymology 498: 43-66).
[0045] The terms "peptide", "oligopeptide", "polypeptide" and "protein" are used interchangeably and refer to a chain of amino acids linked by peptide bonds, regardless of the number of amino acids forming said chain.
[0046] The term "operationally linked" refers to a configuration in which a control sequence is placed in an appropriate position relative to a coding sequence, such that the control sequence directs the expression of the coding sequence.
[0047] The term "control sequences" refers to the nucleic acid sequences required for gene expression. Control sequences can be native or heterologous. Control sequences that are well-known and currently used by those skilled in the art are preferred. Such control sequences include, but are not limited to, a leader, a polyadenylation sequence, a promoter, a signal peptide sequence, a ribosome-binding site, and a transcription terminator. Preferably, control sequences include both a promoter and a transcription terminator.
[0048] The term "expression cassette" refers to a nucleic acid construct comprising a coding region, i.e. a gene, and a regulatory region, i.e., comprising one or more control sequences, linked in an operational manner.
[0049] As used here, the term "expression vector" refers to a DNA or RNA molecule that includes an expression cassette. Preferably, the expression vector is a linear or circular double-stranded DNA molecule. The vector may further include an origin of replication, a selection marker, etc.
[0050] The term "percentage of identity" between two nucleic acid or amino acid sequences, as used in the present invention, refers to the percentage of identical nucleotides or amino acid residues between the two sequences being compared, obtained after best-fit alignment. This percentage is purely statistical, and the differences between the two sequences are randomly distributed along their entire length. The best or optimal alignment is the alignment for which the percentage of identity between the two sequences being compared, as calculated below, is the highest. Sequence comparisons between two nucleic acid or amino acid sequences are traditionally performed by comparing these sequences after optimal alignment. This comparison is carried out segment by segment or comparison window to identify and compare local regions of sequence similarity.Alignment for determining the percentage identity of amino acid sequences can be performed in various ways that are well known in the field, for example, using computer software available on the internet such as http: / / blast.ncbi.nlm.nih.gov / or http: / / www.ebi.ac.uk / Tools / emboss / . A person skilled in the art can determine the appropriate parameters for measuring alignment, including any algorithm necessary to achieve maximum alignment over the entire length of the compared sequences.For the purposes of the present invention, the amino acid sequence identity percentage values preferably refer to values generated using the EMBOSS Needle pair sequence alignment program, which creates an optimal global alignment of two sequences using the Needleman-Wunsch algorithm, in which all search parameters are defined by default (Scoring Matrix = BLOSUM62, Open Gap = 10, Extension Gap = 0.5, End Gap Penalty = false, Open End Gap = 10, and Extension End Gap = 0.5). In some embodiments, all the identity percentages mentioned in this application may be set to at least 60%, at least 70%, at least 80%, at least 85%, preferably at least 90% identity, and more preferably at least 95% identity.In particular, embodiments in which all enzyme sequence identity percentages are at least 80% or at least 85%, preferably at least 90% or at least 95%, are considered to be described. In an embodiment, the polypeptides may have 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additions, substitutions, or deletions relative to the sequences described in the SEQ ID Nos. In particular, these additions, substitutions, or deletions are introduced at the N-terminus, C-terminus, or both ends.
[0051] In the various embodiments described in this document, the term "comprising" may be replaced by "consisting of" or "consisting essentially of". By "consisting essentially of" is understood that the sequence may have 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 additions, substitutions or deletions compared to the sequences described in the SEQ ID Nos.
[0052] The term "variant", as used here, refers to a polypeptide derived from a wild-type protein and containing an alteration, i.e. a substitution, an insertion and / or a deletion, at one or more positions.
[0053] The term "deletion", used in relation to a position or an amino acid, means that the amino acid in the particular position has been deleted or is absent.
[0054] The term "insertion", used in relation to a position or amino acid, means that one or more amino acids have been inserted or are present next to and immediately after the amino acid occupying the particular position.
[0055] The term "substitution" refers to the replacement of one amino acid residue with another residue chosen from among the 20 natural standard amino acid residues, the natural rare amino acid residues (e.g., hydroxyproline, hydroxylysine, allohydroxylysine, 6-N-methylysine, N-ethylglycine, N-methylglycine, N-ethylasparagine, allo-isoleucine, N-methylisoleucine, N-methylvaline, pyroglutamine, aminobutyric acid, ornithine), and non-natural amino acids, often synthetically manufactured, (e.g., norleucine, norvaline, and cyclohexylalanine).Preferably, this term refers to the replacement of one amino acid residue with another chosen from among the 20 natural standard amino acid residues (A: alanine (Ala); C: cysteine (Cys); D: aspartic acid (Asp); E: glutamic acid (Glu); F: phenylalanine (Phe); G: glycine (Gly); H: histidine (His); I: isoleucine (Ile); K: lysine (Lys); L: leucine (Leu); M: methionine (Met); N: asparagine (Asn); P: proline (Pro); Q: glutamine (Gin); R: arginine (Arg); S: serine (Ser); T: threonine (Thr); V: valine (Val); W: tryptophan (Trp); and Y: tyrosine (Tyr)). The variant can be obtained by various techniques well known in art. In particular, examples of techniques for altering the DNA sequence encoding the wild-type protein include, but are not limited to, site-directed mutagenesis, random mutagenesis, and the construction of synthetic oligonucleotides.
[0056] The terms "overexpression" and "increased expression," as used herein, are used interchangeably and mean that the expression of a gene or enzyme is increased compared to an unmodified microorganism, for example, compared to a wild-type microorganism. "Wild-type" is understood to mean an unmodified microorganism found in nature. Increased enzyme expression is usually achieved by increasing the expression level of the gene encoding that enzyme. In embodiments in which the gene or enzyme is not naturally present in the microorganism of the invention—that is, a heterologous gene or enzyme—the terms "overexpression" and "expression" may be used interchangeably.To increase gene expression, those skilled in the art can use all known techniques, such as increasing the number of gene copies in the microorganism, using a strong promoter that induces high gene expression, using elements that stabilize the corresponding messenger RNA, or modifying the RB5 (ribosome-binding site) sequences. In particular, overexpression can be achieved by increasing the number of gene copies in the microorganism. One or more copies of the gene can be introduced into the genome by recombination methods known to those skilled in the art. Preferably, an expression cassette containing the gene is integrated into the genome. Alternatively, the gene can be carried by an expression vector, preferably a plasmid, containing an expression cassette with the gene of interest. The expression vector can be present in the microorganism in one or more copies.Overexpression of the gene can also be achieved by using a promoter that induces a high level of gene expression. For example, the promoter of an endogenous gene can be replaced with a stronger promoter, i.e., one that induces a higher level of expression. Suitable promoters for use in the present invention are known to those skilled in the art and can be constitutive or inducible. The level of gene expression can be determined by various techniques. In particular, the level of expression can be determined by measuring the amount of the corresponding polypeptide or mRNA. Preferably, the level of expression is determined by measuring the amount of the corresponding mRNA. Methods for determining the amount of mRNA are well known in the art. For example, the nucleic acid contained in the microorganism is first extracted using standard methods.The extracted mRNA is then detected by hybridization (e.g., Northern blot) and / or amplification (e.g., RT-PCR). Preferably, the mRNA corresponding to the gene is detected and quantified by quantitative or semi-quantitative RT-PCR. Real-time quantitative or semi-quantitative RT-PCR is particularly advantageous. The term "anthranilate phosphoribosyltransferase" or "TrpD" designates a polypeptide exhibiting anthranilate phosphoribosyltransferase activity (EC: 2.4.2.18), that is, a polypeptide that catalyzes the transfer of a phosphoribosyl group from 5-phosphorylribose-1-pyrophosphate to 1'-anthranilate, forming N-(5'-phosphoribosyl)-anthranilate. Anthranilate phosphoribosyltransferase activity can be determined by any method known to those skilled in the art.For example, this activity can be assessed by fluorometric assay at 25°C by measuring the anthranilate consumption rate (excitation wavelength, 310 nm; emission, 400 nm) in a spectrophotofluorimeter. The reaction can be carried out in 0.1 M Tris-HCl buffer (pH 7.8) containing 1 mM EDTA and 2 mM MgCE in the presence of 10 nmol of anthranilate and 1000 nmol of PRPP (phosphoribosylpyrophosphate), an enzymatic unit being defined as the amount that catalyzes the utilization of 1 nmol of anthranilate / min (cf. Gonzalez, JE, and RL Somerville. 1986. Biochemistry and Cell Biology 64(7): 681-91).
[0057] The term "glutamine amidotransferase TrpG" or "TrpG" refers to a polypeptide exhibiting glutamine amidotransferase activity that generates ammonia, which is used as a substrate with chorismate by TrpE to produce anthranilate. TrpG glutamine amidotransferase activity can be determined by any method known to those skilled in the art. For example, this activity can be assessed at 22°C by monitoring the formation of β-nitroanilide from β-glutamyl-p-nitroanilide at 384 nm using a spectrophotometer. In routine assays, β-glutamyl-p-nitroanilide can be used at a concentration of 1.5 mM. To calculate conversion rates, a molar extinction coefficient of 16,000 can be used for p-nitroaniline (cf. Gonzalez, JE, and RL Somerville. 1986. Biochemistry and Cell Biology 64(7): 681-91.).
[0058] The term "anthranilate synthase" or "TrpE" refers to a polypeptide exhibiting anthranilate synthase activity (EC: 4.1.3.27), that is, a polypeptide that catalyzes the conversion of chorismate and glutamine to anthranilate, glutamate, and pyruvate. In vivo, ammonia is produced by TrpG, and anthranilate synthase activity requires not only TrpE but also TrpG activity. Anthranilate synthase activity can be determined by any method known to those skilled in the art. For example, this activity can be assessed by monitoring the formation of anthranilate from chorismate by tracking the increase in fluorescence (excitation wavelength, 310 nm; emission wavelength, 400 nm) in a spectrophotofluorimeter. The reaction can be carried out at 37°C in Tris buffer (pH 7.5), containing 16.5 pmoles of EDTA, 0.66 pmoles of magnesium chloride, 4.0 pmoles of chorismate, 0.2 pmoles of glutamine and 10.0 pmoles of enzyme.One unit of activity represents the formation of 1.0 pmole of anthranilate in 20 min. Specific activity is the unit of activity per mg of protein (cf. Crawford, I P. 1966. “Partial Colp Purification.” Journal of Biological Chemistry (23)).
[0059] The term "aminodeoxychorismate synthase" refers to a two-component enzyme, component I and component II, that catalyzes the two-step synthesis of 4-amino-4-deoxy chorismate from chorismate and glutamine. In the first step, component II of aminodeoxychorismate synthase, which possesses glutamine amidotransferase activity, generates ammonia. This ammonia is used as a substrate with chorismate in the second step, catalyzed by component I of aminodeoxychorismate synthase, to produce 4-amino-4-deoxychorismate.
[0060] The term "component II of an aminodeoxychorismate synthase" or "PabA" refers to a polypeptide exhibiting glutamine amidotransferase activity that generates glutamic acid and ammonia from glutamine in the presence of PabB. The glutamine amidotransferase activity of PabA can be determined by any method known to those skilled in the art. For example, this activity can be evaluated by thin-layer chromatography (TLC) by following the transformation of the [ 14 C] glutamine in [ 14 C] glutamic acid (cf. Roux, Bruno, and Christopher T. Walsh. 1992. Biochemistry 31(30): 6904-10.).
[0061] The term "component I of an aminodeoxychorismate synthase" or "PabB" refers to a polypeptide exhibiting aminodeoxychorismate synthase activity, meaning that it uses chorismate and ammonia as substrates to produce 4-amino-4-deoxychorismate. In vivo, ammonia is produced by PabA. The aminodeoxychorismate synthase activity of PabB can be determined by any method known to those skilled in the art. For example, this activity can be assessed by monitoring PABA formation through PABA fluorescence detection (excitation at 290 nm, emission at 340 nm). The reaction can be carried out at 25°C in a 100 mM bicine buffer, pH 8.5, containing 20 mM glutamine, 5 mM MgCh, 20 pM pyridoxal 5'-phosphate (PLP), 13 pM PabC and equimolar amounts of PabB and PabA (cf. Ye et al. 1990. Proceedings of the National Academy of Sciences of the United States of America 87(23): 9391-95).
[0062] The term "4-amino-4-deoxychorismate lyase" or "PabC" refers to a polypeptide exhibiting 4-amino-4-deoxychorismate lyase activity, meaning that it catalyzes the cleavage and aromatization of 4-amino-4-deoxychorismate to produce PABA and pyruvate. The 4-amino-4-deoxychorismate lyase activity of PabC can be determined by any method known to those skilled in the art. For example, this activity can be assessed by monitoring PABA formation through PABA fluorescence detection (excitation at 290 nm, emission at 340 nm). The reaction can be carried out at 25°C in a 100 mM bicine buffer, pH 8.5, containing 20 mM glutamine, 5 mM MgCh, 20 pM PLP, 13 pM PabC and equimolar amounts of PabB and PabA (cf. Ye et al. 1990. Proceedings of the National Academy of Sciences of the United States of America 87(23): 9391-95).
[0063] The term "PabAB" refers to a polypeptide exhibiting both PabA activity, meaning glutamine amidotransferase activity that generates glutamic acid and ammonia from glutamine, and PabB activity, meaning aminodeoxychorismate synthase activity, using chorismate and ammonia as substrates to produce 4-amino-4-deoxychorismate. PabAB activity can be determined by any method known to those skilled in the art. For example, this activity can be assessed by monitoring PABA formation through PABA fluorescence detection (excitation at 290 nm, emission at 340 nm). The reaction can be carried out at 25°C in a 100 mM bicine buffer, pH 8.5, containing 20 mM glutamine, 5 mM MgCh, 20 pM PLP, 13 pM PabC and equimolar amounts of PabAB.
[0064] The term "PabBC" refers to a polypeptide exhibiting both PabB activity, i.e., aminodeoxychorismate synthase activity, meaning it uses chorismate and ammonia as substrates to produce 4-amino-4-deoxychorismate, and PabC activity, i.e., 4-amino-4-deoxychorismate lyase activity, meaning it catalyzes the cleavage and aromatization of 4-amino-4-deoxychorismate to produce PABA and pyruvate. PabBC activity can be determined by any method known to those skilled in the art. For example, this activity can be assessed by monitoring PABA formation through PABA fluorescence detection (excitation at 290 nm, emission at 340 nm). The reaction can be carried out at 25°C in a 100 mM bicine buffer, pH 8.5, containing 20 mM glutamine, 5 mM MgCh, 20 pM PLP, 13 pM PabBC and equimolar amounts of PabA.
[0065] Depending on the organism, the nomenclature of the enzymes and coding genes identified above may vary. However, for clarity, in this document, these terms are used regardless of the origin of the enzymes or genes.
[0066] As used here, the terms "p-aminobenzoic acid", "para-aminobenzoic acid" and "PABA" may be used interchangeably and refer to an aromatic acid corresponding to the following formula (I)
[0067] Recombinant microorganisms according to the invention
[0068] According to a first aspect, the present invention relates to a recombinant microorganism capable of producing p-aminobenzoic acid from chorismate and in which the anthranilate phosphoribosyltransferase activity is inactivated.
[0069] The recombinant microorganism can be a bacterium, a yeast, or a filamentous fungus. Preferably, the recombinant microorganism is a bacterium or a yeast.
[0070] In one embodiment, the recombinant microorganism is a yeast. Examples of suitable yeasts include, but are not limited to, yeasts of the genera Saccharomyces, Yarrowia, Rhodoturula, Schizosaccharomyces, Kluyveromyces, Pichia, Lipomyces, Debaryomyces, or Candida. Preferably, the yeast is selected from among Saccharomyces cerevisiae, Saccharomyces carlsbergensis, Saccharomyces diaslaliciis, Saccharomyces douglasii, Saccharomyces khiyveri, Saccharomyces norbensis, Saccharomyces oviformis, Yarrowia lipolylica, Rhodotorula glutinis, Schizosaccharomyces pombe, and Kluyveromyces laclis. Kluyveromyces marxianus, Pichia pastoris, Lipomyces starkeyi, Debaryomyces hansenii, Candida albicans and Candida tropicalis. Preferably, the yeast is a yeast of the genus Saccharomyces, preferably chosen from Saccharomyces cerevisiae, Saccharomyces carlsbergensis, Saccharomyces diaslaliciis.Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis and Saccharomyces oviformis, and more particularly preferred a yeast of the species Saccharomyces cerevisiae.
[0071] In another embodiment, the recombinant microorganism is a filamentous fungus. Filamentous fungi include all filamentous forms of the subdivisions Eumycota and Oomycota (as defined by Hawksworth et al., in Ainsworth and Bisby's Dictionary of the Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK). Filamentous fungi are generally characterized by a mycelial cell wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Suitable examples of filamentous fungi include, but are not limited to, fungi of the genus Acremonium.Aspergillus, Aliireobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriohis, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes or Trichoderma. Preferably, the fungus is selected from fungi of the genus Aspergillus.
[0072] In preferred embodiments, the recombinant microorganism is a bacterium. In particular, the recombinant microorganism may be a Gram-positive or Gram-negative bacterium.Examples of suitable bacteria include, but are not limited to, bacteria of the genera Escherichia, Corynebacterium, Pseudomonas, Brevibacterium, Arthrobacter, Mycobacterium, or Micrococcus. Preferably, the recombinant microorganism of the invention is selected from bacteria of the genera Escherichia, Corynebacterium, Pseudomonas, Brevibacterium, Arthrobacter, Mycobacterium, and Micrococcus, in particular from bacteria of the species Escherichia coli, Corynebacterium glutamicum, Corynebacterium efficiens, Corynebacterium ammoniagenes, Corynebacterium halotolerance, Corynebacterium alkanolyticum, Pseudomonas putida, Pseudomonas aeruginosa, Pseudomonas fluorescens, Pseudomonas stutzeri, Pseudomonas alcaligenes, and Pseudomonas mendocina. Brevibacterium ammoniagenes, Arthrobacter globiformis, Mycobacterium bovis, Micrococcus freudenreichii, Micrococcus leuteus, Micrococcus ureae and Micrococcus roseus.In a particularly preferred manner, the recombinant microorganism may be selected from bacteria of the genera Escherichia, Pseudomonas and Corynebacterium, such as Escherichia coli, Pseudomonas putida, Pseudomonas aeruginosa, Pseudomonas fluorescens, Pseudomonas stutzeri, Pseudomonas alcaligenes, Pseudomonas mendocina, Corynebacterium glutamicum, Corynebacterium efficiens, Corynebacterium ammoniagenes, Corynebacterium halotolerance and Corynebacterium alkanolyticum, preferably from bacteria of the species Escherichia coli, Pseudomonas putida and Corynebacterium glutamicum.
[0073] In a more particularly preferred manner, the recombinant microorganism of the invention is a bacterium of the species Escherichia coli.
[0074] Route for the production of p-aminobenzoic acid from chorismate
[0075] The recombinant microorganism according to the invention is capable of producing p-aminobenzoic acid from chorismate. It therefore comprises one or more genes encoding aminodeoxychorismate synthase activity and one or more genes encoding 4-amino-4-deoxychorismate lyase activity. These genes may be endogenous and / or heterologous.
[0076] An aminodeoxychorismate synthase is a two-component enzyme, consisting of component I and component II, that catalyzes the two-step synthesis of 4-amino-4-deoxychorismate from chorismate and glutamine. These two components can be encoded by separate genes (pabA and pabB) or by a single gene (pabA B). Thus, the microorganism according to the invention comprises one or more genes that encode aminodeoxychorismate synthase activity.
[0077] In particular, the recombinant microorganism according to the invention may comprise i) at least one gene encoding component I of an aminodeoxychorismate synthase (PabB) and at least one gene encoding component II of an aminodeoxychorismate synthase (PabA), and / or ii) at least one gene encoding a two-component aminodeoxychorismate synthase (PabAB). The recombinant microorganism according to the invention also comprises at least one gene encoding 4-amino-4-deoxychorismate lyase activity. This gene may be a gene encoding 4-amino-4-deoxychorismate lyase (PabC) or a two-component enzyme (PabBC) having the activity of component I of an aminodeoxychorismate synthase and the activity of 4-amino-4-deoxychorismate lyase.
[0078] Thus, the recombinant microorganism according to the invention may comprise i) at least one gene encoding a 4-amino-4-deoxychorismate lyase (PabC), and / or ii) at least one gene encoding a two-component enzyme (PabBC).
[0079] According to one embodiment, the microorganism comprises
[0080] - an endogenous gene encoding PabA and / or a heterologous gene encoding PabA, an endogenous gene encoding PabB and / or a heterologous gene encoding PabB, and an endogenous gene encoding PabC and / or a heterologous gene encoding PabC; or
[0081] - an endogenous gene encoding PabAB and / or a heterologous gene encoding PabAB, and an endogenous gene encoding PabC and / or a heterologous gene encoding PabC; or
[0082] - an endogenous gene encoding PabA and / or a heterologous gene encoding PabA, an endogenous gene encoding PabBC and / or a heterologous gene encoding PabBC; or
[0083] - an endogenous gene encoding PabAB and / or a heterologous gene encoding PabAB and an endogenous gene encoding PabBC and / or a heterologous gene encoding PabBC.
[0084] In particular, the microorganism may include
[0085] - a heterologous gene encoding PabA, an endogenous gene encoding PabB and an endogenous gene encoding PabC, or
[0086] - an endogenous gene coding for PabA, a heterologous gene coding for PabB and an endogenous gene coding for PabC, or
[0087] - an endogenous gene coding for PabA, an endogenous gene coding for PabB and a heterologous gene coding for PabC, or
[0088] - a heterologous gene encoding PabA, a heterologous gene encoding PabB and an endogenous gene encoding PabC, or - a heterologous gene encoding PabA, an endogenous gene encoding PabB and a heterologous gene encoding PabC, or
[0089] - an endogenous gene coding for PabA, a heterologous gene coding for PabB and a heterologous gene coding for PabC, or
[0090] - an endogenous gene coding for PabAB and a heterologous gene coding for PabC, or
[0091] - a heterologous gene encoding PabAB and an endogenous gene encoding PabC, or
[0092] - a heterologous gene coding for PabAB and a heterologous gene coding for PabC, or
[0093] - an endogenous gene coding for PabA and a heterologous gene coding for PabBC, or
[0094] - a heterologous gene encoding PabA and an endogenous gene encoding PabBC, or
[0095] - a heterologous gene coding for PabA and a heterologous gene coding for PabBC, or
[0096] - an endogenous gene coding for PabAB and a heterologous gene coding for PabBC, or
[0097] - a heterologous gene encoding PabAB and an endogenous gene encoding PabBC, or
[0098] - a heterologous gene coding for PabAB and a heterologous gene coding for PabBC.
[0099] In one embodiment, the microorganism comprises endogenous genes encoding aminodeoxychorismate synthase activity and 4-amino-4-deoxychorismate lyase activity. Optionally, it may also comprise one or more heterologous genes encoding aminodeoxychorismate synthase and / or 4-amino-4-deoxychorismate lyase activity.
[0100] According to a preferred embodiment, the microorganism comprises one or more heterologous genes that encode aminodeoxychorismate synthase activity and / or 4-amino-4-deoxychorismate lyase activity.
[0101] According to preferred embodiments, the microorganism according to the invention comprises
[0102] - a heterologous gene coding for PabB,
[0103] - a heterologous gene coding for PabA,
[0104] - a heterologous gene coding for PabAB,
[0105] - a heterologous gene encoding PabC, and / or - - a heterologous gene encoding PabBC.
[0106] Preferably, the microorganism includes
[0107] (i) a heterologous gene encoding Pab A, a heterologous gene encoding Pab B and a heterologous gene encoding Pab C or
[0108] (ii) a heterologous gene encoding Pab AB and a heterologous gene encoding PabC.
[0109] Preferably, the microorganism comprises a heterologous gene encoding PabAB and a heterologous gene encoding PabC. Optionally, it may further comprise an endogenous gene encoding PabA and / or an endogenous gene encoding PabB and / or an endogenous gene encoding PabAB and / or an endogenous gene encoding PabC and / or an endogenous gene encoding PabBC, preferably an endogenous gene encoding PabA, an endogenous gene encoding PabB and an endogenous gene encoding PabC.
[0110] In embodiments where the microorganism includes one or more endogenous genes that encode aminodeoxychorismate synthase activity and / or 4-amino-4-deoxychorismate lyase activity, said endogenous gene(s) may be overexpressed relative to the wild-type strain of the microorganism.
[0111] In embodiments where the microorganism includes a gene encoding component I of an aminodeoxychorismate synthase (PabB), whether endogenous, possibly overexpressed, or heterologous, the gene may encode a PabB protein selected from the group of PabB proteins of bacteria, in particular of the genera Corynebacterium (e.g., Corynebacterium kroppenstedtii (SEQ ID NO: 1), Corynebacterium resistens (SEQ ID NO: 2)), Bacillus (e.g., Bacillus subtilis (SEQ ID NO: 3), Bacillus amyloliquefaciens (SEQ ID NO: 4), Bacillus thuringiensis (SEQ ID NO: 5)), Escherichia (e.g., Escherichia coli (SEQ ID NO: 6), Escherichia fergusonii (SEQ ID NO: 7)), Streptomyces (e.g., Streptomyces lividans (SEQ ID NO: 7)) NO: 8)), Salmonella (for example Salmonella enterica (SEQ ID NO: 9), Salmonella typhimurium (SEQ ID NO: 10)), Pseudomonas (for example Pseudomonas aeruginosa (SEQ ID NO: 11), Pseudomonas putida (SEQ ID NO: 12),Pseudomonas fluorescens (SEQ ID NO : 13)), Yersinia (par exemple Yersinia pestis (SEQ ID NO : 14), Yersinia pseudotuberculosis (SEQ ID NO : 15)), Enterobacter (par exemple Enterobacter cloacae (SEQ ID NO : 16)), Mycobacterium (par exemple Mycobacterium smegmatis (SEQ ID NO : 17)), Klebsiella (for example Klebsiella pneumoniae (SEQ ID NO : 18)), Azotobacter (for example Azotobacter vinelandii (SEQ ID NO: 22)), Acinetobacter (for example Acinetobacter baumannii (SEQ ID NO: 23)), or Clostridium (for example Clostridium perfringens (SEQ ID NO: 24)), also the variants of these proteins are usually 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of identity with the same content of these proteins and presentation of a PabB activity.,
[0112] Preferably, the PabB protein is a protein comprising, or consisting of, an amino acid sequence selected from the group consisting of SEQ ID NO: 1 to 24, and variants thereof having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with any of these proteins and exhibiting PabB activity.
[0113] In embodiments where the microorganism includes a gene encoding component II of an aminodeoxychorismate synthase (PabA), whether endogenous, possibly overexpressed, or heterologous, the gene may encode a PabA protein selected from the group of PabA proteins of bacteria, in particular of the genus Escherichia (e.g., Escherichia coli (SEQ ID NO: 25), Escherichia fergusonii (SEQ ID NO: 26) / Salmonella (e.g., Salmonella enterica (SEQ ID NO: 27), Salmonella typhimurium (SEQ ID NO: 28) / Yersinia (e.g., Yersinia enterocolitica (SEQ ID NO: 29) / Enterobacter (e.g., Enterobacter cloacae (SEQ ID NO: 30) / Klebsiella (e.g., Klebsiella pneumoniae (SEQ ID NO: 31)), Xenorhabdus (for exampleBacillus thuringiensis (SEQ ID NO: 35) / Lactococcus (for example Lactococcus lactis subsp. lactis (SEQ ID NO: 36) / Corynebacterium (for example Corynebacterium urogenitale (SEQ ID NO: 37), Corynebacterium variabile (SEQ ID NO: 38), / Rhodococcus (for example Rhodococcus ruber (SEQ ID NO: 39) / Streptomyces (for example Streptomyces rubrolavendulae (SEQ ID NO: 40)), Arthrobacter (for example Arthrobacter ulcer isalmonis (SEQ ID NO: 41) / Bifidobacterium (for example Bifidobacterium catenulatum (SEQ ID NO: 42)), Synechococcus sp. (SEQ ID NO: 43), or Pantoea (for example Pantoea agglomerons (Enterobacter agglomerates) (SEQ ID NO: 44) / as well as variants of these proteins having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with any of these proteins and exhibiting PaA activity.
[0114] Preferably, the PabA protein is a protein comprising, or consisting of, an amino acid sequence selected from the group consisting of SEQ ID NO: 25 to 44, and variants thereof having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with any of these proteins and exhibiting PabA activity.
[0115] In embodiments where the microorganism includes a gene encoding a 4-amino-4-deoxychorismate lyase (PabC), whether endogenous, possibly overexpressed, or heterologous, the gene may encode a PabC protein chosen from the group consisting of PabC proteins from bacteria, in particular of the genera Escherichia (e.g., Escherichia coli (SEQ ID NO: 45), Escherichia fergusonii (SEQ ID NO: 46) / Shewanella (e.g., Shewanella violacea (SEQ ID NO: 47) / Pseudomonas (e.g., Pseudomonas putida (SEQ ID NO: 48) / Azotobacter (e.g., Azotobacter vinelandii (SEQ ID NO: 49) / Clostridium (e.g., Clostridium butyricum (SEQ ID NO: 50)) / Xenorhabdus (e.g., Xenorhabdus bovienii (SEQ ID NO: 51) / Bacillus (for example Bacillus subtilis (SEQ ID NO: 52) / or Ferrimonas (for example Ferrimonas balearica (SEQ ID NO: 53) / as well as variants of these proteins having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%,98% or 99% sequence identity with any of these proteins and exhibiting PabC activity.
[0116] Preferably, the PabC protein is a protein comprising, or consisting of, an amino acid sequence selected from the group consisting of SEQ ID NO: 45 to 53, and variants thereof having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with any of these proteins and exhibiting PabC activity. More particularly preferred, the PabC protein is a protein comprising, or consisting of, the amino acid sequence SEQ ID NO: 51, and variants thereof having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with this protein and exhibiting PabC activity.
[0117] In embodiments where the microorganism includes a gene encoding a two-component aminodeoxychorismate synthase (PabAB), whether endogenous, possibly overexpressed, or heterologous, the gene may encode a PabAB protein selected from the group of PabAB proteins of bacteria, in particular of the genus Corynebacterium (e.g., Corynebacterium callunae (SEQ ID NO: 54), Corynebacterium variabile (SEQ ID NO: 55), Corynebacterium deserti (SEQ ID NO: 56), Corynebacterium glutamicum (SEQ ID NO: 57)) or Rhodococcus (e.g., Rhodococcus opacus (SEQ ID NO: 58), Rhodococcus erythropolis (SEQ ID NO: 59)) as well as variants of these proteins having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with any of these proteins and exhibiting PabAB activity.
[0118] Preferably, the PabAB protein is a protein comprising, or consisting of, an amino acid sequence selected from the group consisting of SEQ ID NO: 54 to 59, and variants thereof having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with any of these proteins and exhibiting PabAB activity.
[0119] More particularly preferred, the PabAB protein is a protein comprising, or consisting of, the amino acid sequence SEQ ID NO: 54, and variants thereof having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with this protein and exhibiting PabAB activity.
[0120] In embodiments where the microorganism includes a gene encoding a PabBC protein, whether endogenous, possibly overexpressed, or heterologous, the gene may encode a PabBC protein selected from the group of PabBC proteins of bacteria, in particular of the genera Streptococcus (e.g., Streptococcus salivarius (SEQ ID NO: 60)), Helicobacter (e.g., Helicobacter pylori (SEQ ID NO: 61), Campylobacter (e.g., Campylobacter lari (SEQ ID NO: 62)), or Caldimonas (e.g., Caldimonas brevitalea (SEQ ID NO: 63)), as well as variants of these proteins having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with any one of these proteins and exhibiting PabBC activity.
[0121] Preferably, the PabBC protein is a protein comprising, or consisting of, an amino acid sequence selected from the group consisting of SEQ ID NO: 60 to 63, and variants thereof having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with any of these proteins and exhibiting PabBC activity.
[0122] According to one embodiment, the microorganism according to the invention comprises
[0123] - a heterologous gene encoding PabB, preferably encoding a protein comprising, or consisting of, an amino acid sequence selected from the group consisting of SEQ ID NO: 1 to 24, and variants thereof having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with any of these proteins and exhibiting PabB activity,
[0124] - a heterologous gene encoding PabA, preferably encoding a protein comprising, or consisting of, an amino acid sequence selected from the group consisting of SEQ ID NO: 25 to 44, and variants thereof having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with any of these proteins and exhibiting PabA activity,
[0125] - a heterologous gene encoding PabAB, preferably encoding a protein comprising, or consisting of, an amino acid sequence selected from the group consisting of SEQ ID NO: 54 to 59, and variants thereof having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with any of these proteins and exhibiting PabAB activity,
[0126] - a heterologous gene encoding PabC, preferably encoding a protein comprising, or consisting of, an amino acid sequence selected from the group consisting of SEQ ID NO: 45 to 53, and variants thereof having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with any of these proteins and exhibiting PabC activity, and / or
[0127] - - a heterologous gene encoding PabBC, preferably encoding a protein comprising, or consisting of, an amino acid sequence selected from the group consisting of SEQ ID NO: 60 to 63, and variants thereof having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with any of these proteins and exhibiting PabBC activity.
[0128] Preferably, the microorganism includes
[0129] (i) - a heterologous gene encoding PabB, preferably encoding a protein comprising, or consisting of, an amino acid sequence selected from the group consisting of SEQ ID NO: 1 to 24, and variants thereof having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with any of these proteins and exhibiting PabB activity, and
[0130] - a heterologous gene encoding PabA, preferably encoding a protein comprising, or consisting of, an amino acid sequence selected from the group consisting of SEQ ID NO: 25 to 44, and variants thereof having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with any of these proteins and exhibiting PabA activity, and
[0131] - a heterologous gene encoding PabC, preferably encoding a protein comprising, or consisting of, an amino acid sequence selected from the group consisting of SEQ ID NO: 45 to 53, and variants thereof having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with any of these proteins and exhibiting PabC activity, or
[0132] (ii) - a heterologous gene encoding PabAB, preferably encoding a protein comprising, or consisting of, an amino acid sequence selected from the group consisting of SEQ ID NO: 54 to 59, and variants thereof having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with any of these proteins and exhibiting PabAB activity, and - a heterologous gene encoding PabC, preferably encoding a protein comprising, or consisting of, an amino acid sequence selected from the group consisting of SEQ ID NO: 45 to 53, and variants thereof having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with any one of these proteins and exhibiting PabC activity.
[0133] More specifically, the microorganism includes
[0134] (i) a heterologous gene encoding PabAB, preferably encoding a protein comprising, or consisting of, an amino acid sequence selected from the group consisting of SEQ ID NO: 54 to 59, and variants thereof having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with any of these proteins and exhibiting PabAB activity, and
[0135] (ii) a heterologous gene encoding PabC, preferably encoding a protein comprising, or consisting of, an amino acid sequence selected from the group consisting of SEQ ID NO: 45 to 53, and variants thereof having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with any of these proteins and exhibiting PabC activity.
[0136] According to a particularly preferred embodiment, the microorganism, preferably a bacterium, and more particularly preferred E. coli, comprises
[0137] (i) a heterologous gene encoding a PabAB protein comprising, or consisting of, the amino acid sequence SEQ ID NO: 54, and variants thereof having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with that protein and exhibiting PabAB activity, and
[0138] (ii) a heterologous gene encoding PabC, preferably encoding a protein comprising, or consisting of, the amino acid sequence SEQ ID NO: 51, and variants thereof having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with that protein and exhibiting PabC activity.
[0139] The polypeptides responsible for the aminodeoxychorismate synthase and 4-amino-4-deoxychorismate lyase activities used in the present invention can be used in the form of hybrid or fusion polypeptides in which the polypeptide exhibiting the activity of interest (PabA, PabB, PabAB, PabC, or PabBC) is fused at its N-terminus and / or C-terminus to another polypeptide. Techniques for producing fusion polypeptides are well known to those skilled in the art. The region added to the polypeptide of interest can be selected, for example, to improve enzyme stability, to promote secretion (such as an N-terminal hydrophobic signal peptide), or to aid in its purification.
[0140] In embodiments in which the recombinant microorganism naturally expresses one or more of the enzymes responsible for aminodeoxychorismate synthase and 4-amino-4-deoxychorismate lyase activities (PabA, PabB, PabAB, PabC and / or PabBC), the endogenous gene(s) may be overexpressed.
[0141] The nucleic acid sequences encoding heterologous polypeptides can be deduced from the polypeptide sequence, and the use of codons can be adapted depending on the recombinant microorganism in which the nucleic acids are to be transcribed. This step can be carried out using methods well known to those skilled in the art.
[0142] Heterologous genes encoding the enzymes responsible for aminodeoxychorismate synthase and 4-amino-4-deoxychorismate lyase activities (PabA, PabB, PabAB, PabC and / or PabBC) may be included in one or more recombinant expression cassettes.
[0143] In particular, the recombinant microorganism according to the invention may comprise a recombinant expression cassette comprising
[0144] - a heterologous gene coding for PabB,
[0145] - a heterologous gene coding for PabA,
[0146] - a heterologous gene coding for PabAB,
[0147] - a heterologous gene coding for PabC,
[0148] - a heterologous gene coding for PabBC,
[0149] - a heterologous gene coding for PabB and a heterologous gene coding for PabA,
[0150] - a heterologous gene coding for PabB and a heterologous gene coding for PabAB,
[0151] - a heterologous gene coding for PabB and a heterologous gene coding for PabC, - a heterologous gene coding for PabB and a heterologous gene coding for PabBC,
[0152] - a heterologous gene coding for PabA and a heterologous gene coding for PabAB,
[0153] - a heterologous gene coding for PabA and a heterologous gene coding for PabC,
[0154] - a heterologous gene coding for PabA and a heterologous gene coding for PabBC,
[0155] - a heterologous gene coding for PabAB and a heterologous gene coding for PabC,
[0156] - a heterologous gene coding for PabAB and a heterologous gene coding for PabBC,
[0157] - a heterologous gene coding for PabC and a heterologous gene coding for PabBC,
[0158] - a heterologous gene coding for PabB, a heterologous gene coding for PabA and a heterologous gene coding for PabAB,
[0159] - a heterologous gene coding for PabB, a heterologous gene coding for PabA and a heterologous gene coding for PabC,
[0160] - a heterologous gene coding for PabB, a heterologous gene coding for PabA and a heterologous gene coding for PabBC,
[0161] - a heterologous gene coding for PabB, a heterologous gene coding for PabAB and a heterologous gene coding for PabC,
[0162] - a heterologous gene coding for PabB, a heterologous gene coding for PabAB and a heterologous gene coding for PabBC,
[0163] - a heterologous gene coding for PabB, a heterologous gene coding for PabC and a heterologous gene coding for PabBC,
[0164] - a heterologous gene coding for PabA, a heterologous gene coding for PabAB and a heterologous gene coding for PabC,
[0165] - a heterologous gene coding for PabA, a heterologous gene coding for PabAB and a heterologous gene coding for PabBC,
[0166] - a heterologous gene encoding PabA, a heterologous gene encoding PabC and a heterologous gene encoding PabBC, or
[0167] - a heterologous gene encoding PabAB, a heterologous gene encoding PabC, and a heterologous gene encoding PabBC. Preferably, the recombinant microorganism according to the invention comprises a recombinant expression cassette comprising
[0168] - a heterologous gene coding for PabB, a heterologous gene coding for PabA and a heterologous gene coding for PabC,
[0169] - a heterologous gene coding for PabB, a heterologous gene coding for PabA and a heterologous gene coding for PabBC,
[0170] - a heterologous gene coding for PabAB and a heterologous gene coding for PabC or
[0171] - a heterologous gene coding for PabAB and a heterologous gene coding for PabBC.
[0172] According to a preferred embodiment, the recombinant microorganism according to the invention comprises a recombinant expression cassette including a heterologous gene encoding PabAB and a heterologous gene encoding PabC.
[0173] In order to increase the level of expression of a gene of interest, the cassette may include several copies, for example 2 copies, of the gene of interest.
[0174] In embodiments where the recombinant expression cassette comprises multiple genes, these genes may be expressed under the control of one or more promoters. In particular, each gene may be expressed under the control of a separate promoter. In preferred embodiments, each gene in the cassette is placed under the control of a separate promoter. The promoters in the cassette may be identical or different. Preferably, each gene in the cassette is placed under the control of a separate promoter, and the different promoters in the cassette are identical.
[0175] The promoter(s) used to control gene expression in the expression cassette(s) as used in the present invention can be easily chosen by a person skilled in the art according to the microorganism used as the host cell.
[0176] Examples of suitable promoters in a bacterial host cell include, but are not limited to, the T7 promoter and its variants (Rong et al. Proceedings of the National Academy of Sciences. 95(2):515-519; Komura et al. PLoS ONE. 13(5):e0196905), the tac promoter obtained from the lac operon of E. coli (DeBoer et al., 1983, Proc. Natl. Acad. Sci. USA 80: 21-25), the trc promoter of E. coli (Egon et al., 1988, Gene 69: 301-315), the promoter of the prokaryotic beta-lactamase gene (Villa-Kamaroff et al., 1978, Proc. Natl. Acad. Sci. USA 75: 3727-3731), the promoter of the L-arabinose operon of E. coli (Guzman et al., 1995, J Bacteriol. 1995 Jul; 177(14)), the constitutively active E. coli recA promoter lacking the LexA binding site (Brent and Ptashne, 1981, Proc Natl Acad Sci US A. 1981 Jul;78(7)), the promoters described in the publication by Lu, et al. 2012 (Appl Microbiol Biotechnol.2012 Mar;93(6):2455-62) including the Ml-46 and Ml-93 promoters and their variants. Other promoters are described in "Useful proteins from recombinant bacteria" in Gilbert et al, 1980, Scientific American 242: 74-94, and in Sambrook et al, 2001, Molecular cloning: a laboratory manual, Third Edition Cold Spring Harbor.
[0177] Examples of suitable promoters in a filamentous fungal host cell include, but are not limited to, promoters obtained from the genes of acetamidase in Aspergillus nidulans, neutral alpha-amylase in Aspergillus niger, stable acid alpha-amylase in Aspergillus niger, glucoamylase (glaA) in Aspergillus niger or Aspergillus ctw amori. TAKA amylase from Aspergillus oryzae, alkaline protease from Aspergillus oryzae, triose phosphate isomerase from Aspergillus oryzae, trypsin-like protease from Fusarium oxysporum (W096 / 00787), Tamyloglucosidase from Fusarium venenatum (WO 00 / 56900), lipase or aspartic proteinase from Rhizomucor miehei, beta-glucosidase, cellobiohydrolases I and II, endoglucanases I, II, III, IV and V, xylanases I and II or beta-xylosidase from Trichoderma reesei, and variants thereof.
[0178] Examples of suitable promoters in a yeast host cell include, but are not limited to, promoters derived from the Saccharomyces cerevisiae fenolase (ENO-1), Saccharomyces cerevisiae galactokinase (GALI), Saccharomyces cerevisiae alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2 / GAP), Saccharomyces cerevisiae triose phosphate isomerase (TPI), Saccharomyces cerevisiae metallothionein (CUP1), and Saccharomyces cerevisiae 3-phosphoglycerate kinase, and variants thereof. Other promoters useful for yeast host cells are described in Romanos et al., 1992, Yeast 8: 423–488.
[0179] The recombinant expression cassette(s) may be integrated into the microorganism's genome or maintained in episomal form within an expression vector. In embodiments where the expression cassette(s) are maintained in episomal form, the expression vector may be present in the microorganism in one or more copies, depending on the nature of the origin of replication. Preferably, the recombinant expression cassette(s) are integrated into the microorganism's genome. One or more copies of the genes may be introduced into the genome by recombination methods known to those skilled in the art.
[0180] Inactivation of anthranilate phosphoribosyltransferase activity
[0181] The microorganism according to the invention is a recombinant microorganism in which the anthranilate phosphoribosyltransferase activity is inactivated. The microorganism is therefore unable to produce N-(5'-phosphoribosyl)-anthranilate from anthranilate. It is auxotrophic for tryptophan.
[0182] Preferably, anthranilate phosphoribosyltransferase activity is inactivated by suppressing the expression of the polypeptide or polypeptide domain responsible for this activity. Indeed, depending on the microorganism, anthranilate phosphoribosyltransferase activity may be carried out either by a TrpD protein or by the trpD domain of a bifunctional TrpGD protein (for example, in the case of the bacterium Escherichia coli). In cases where TrpD activity is carried out by a bifunctional TrpGD protein, only the expression of the TrpD domain can be suppressed. The microorganism can therefore still express the TrpG domain of the bifunctional protein. Alternatively, the expression of the functional TrpGD protein can be suppressed.
[0183] As used here, the term "polypeptide expression suppression" or "polypeptide domain expression suppression" refers to the suppression of the expression of an active polypeptide or domain; that is, the suppression of the expression of a polypeptide or domain exhibiting the enzymatic activity that Ton seeks to suppress. This does not preclude the possibility of expressing an inactive polypeptide or domain, i.e., one that no longer exhibits the enzymatic activity to be suppressed. In particular, this inactive polypeptide or domain may be a truncated or mutated polypeptide or domain compared to the wild-type version.The expression of a polypeptide or polypeptide domain can be suppressed by any method known to those skilled in the art, for example by deleting all or part of the nucleic acid sequence encoding said polypeptide or domain, by introducing a stop codon or a frameshift mutation, or by inserting an expression gene or cassette.
[0184] Preferably, anthranilate phosphoribosyltransferase activity is inactivated in the microorganism according to the invention by total or partial deletion of the endogenous trpD gene, in particular by total or partial deletion of the region of the endogenous trpD gene encoding the anthranilate phosphoribosyltransferase activity TrpD.
[0185] According to some embodiments, the microorganism may still exhibit TrpG activity. Thus, in the microorganism according to the invention, the anthranilate phosphoribosyltransferase activity may be inactivated by total or partial deletion of the endogenous trpD gene, in particular by total or partial deletion of the region of the endogenous trpD gene encoding the anthranilate phosphoribosyltransferase activity TrpD, while the microorganism still expresses a TrpG protein or the TrpG domain of the bifunctional protein TrpGD.
[0186] The trpD gene of the recombinant microorganism can be readily identified by a person skilled in the art using online databases or by sequence homology with the trpD genes listed below or with other known and identified trpD genes. For example, the NCBI Gene IDs for the trpD genes of E. coli, Corynebacterium glutamicum, Pseudomonas putida, and Saccharomyces cerevisiae are 945109, 69623300, 45521977, and 851956, respectively.
[0187] Inactivation of anthranilate synthase activity
[0188] According to preferred embodiments, the microorganism according to the invention is a recombinant microorganism in which the anthranilate synthase activity is inactivated. In this case, the microorganism is no longer able to produce anthranilate from chorismate.
[0189] Anthranilate synthase is an enzymatic activity involving two components, namely (i) Tanthranilate synthase TrpE which catalyzes the conversion of chorismate and glutamine into anthranilate, glutamate and pyruvate, and (ii) glutamine amidotransferase TrpG generates ammonia which is used as a substrate with chorismate by TrpE to produce anthranilate.
[0190] Anthranilate synthase activity can be inactivated by suppressing the expression of the TrpE polypeptide (encoded by a trpE gene), the TrpG polypeptide (encoded by a trpG gene), or the TrpG polypeptide domain of a bifunctional TrpGD protein (encoded by a trpD gene). Indeed, depending on the microorganism, TrpG activity may be carried out either by a TrpG protein or by the TrpG domain of a bifunctional TrpGD protein (for example, in the case of the bacterium Escherichia coli).
[0191] The expression of the polypeptide of interest can be suppressed by any method known to those skilled in the art, in particular a method such as is indicated above.
[0192] Preferably, anthranilate synthase activity is inactivated.
[0193] - by total or partial deletion of the trpE gene and / or
[0194] - by total or partial deletion of the gene encoding the glutamine amidotransferase activity TrpG gene, namely by total or partial deletion of an endogenous trpG gene or by total or partial deletion of an endogenous trpD gene, in particular by total or partial deletion of the region of an endogenous trpD gene encoding the glutamine amidotransferase activity TrpG.
[0195] In a particularly preferred manner, in the microorganism according to the invention,
[0196] - Anthranilate phosphoribosyltransferase activity is inactivated by total or partial deletion of the endogenous trpD gene, in particular by total or partial deletion of the region of the endogenous trpD gene encoding the anthranilate phosphoribosyltransferase activity TrpD, and
[0197] - anthranilate synthase activity is inactivated by total or partial deletion of the trpE gene and / or by total or partial deletion of the gene encoding glutamine amidotransferase activity, the TrpG gene, namely by total or partial deletion of an endogenous trpG gene or by total or partial deletion of an endogenous trpD gene, in particular by total or partial deletion of the region of an endogenous trpD gene encoding glutamine amidotransferase activity, TrpG.
[0198] According to a preferred embodiment, in the microorganism according to the invention - the anthranilate phosphoribosyltransferase activity is inactivated by total or partial deletion of the endogenous trpD gene, in particular by total or partial deletion of the region of the endogenous trpD gene encoding the anthranilate phosphoribosyltransferase activity TrpD, and
[0199] - anthranilate synthase activity is inactivated by total or partial deletion of the trpE gene and by total or partial deletion of the gene encoding glutamine amidotransferase activity, the TrpG gene, namely by total or partial deletion of an endogenous trpG gene or by total or partial deletion of an endogenous trpD gene, in particular by total or partial deletion of the region of an endogenous trpD gene encoding glutamine amidotransferase activity, TrpG.
[0200] The trpE gene of the recombinant microorganism can be easily identified by a person skilled in the art using online databases or by sequence homology with the trpE genes listed below or with other known and identified trpE genes. For example, the NCBI Gene IDs for the trpE genes of E. coli, Corynebacterium glutamicum, Pseudomonas putida, and Saccharomyces cerevisiae are 945846, 69623298, 45521974, and 856824, respectively.
[0201] The trpG gene of the recombinant microorganism can be easily identified by a person skilled in the art using online databases or by sequence homology with the trpG genes listed below or with other known and identified trpG genes. For example, the NCBI Gene IDs for the trpG genes of Corynebacterium glutamicum and Pseudomonas putida are 69623299 and 45521976, respectively.
[0202] DAHP synthase activity improvement
[0203] The microorganism according to the invention preferably exhibits increased 3-deoxy-D-arabino-heptulosonate-7-phosphate (DAHP) synthase activity compared to the wild-type strain. DAHP synthase (EC 4.1.2.15) catalyzes the condensation of phospho(enol)pyruvate (PEP) and erythrose-4-phosphate (E4P) into DAHP and inorganic phosphate. This reaction is the first step in the biosynthesis of aromatic compounds in microorganisms. Escherichia coli, for example, possesses three DAHP synthase isoenzymes, each of which is regulated by feedback from one of the aromatic amino acids: tyrosine, phenylalanine, and tryptophan.
[0204] In particular, the microorganism can be genetically modified to overexpress an endogenous gene encoding a DAHP synthase and / or express a heterologous gene encoding a DAHP synthase.
[0205] Preferably, the microorganism includes a heterologous gene encoding a feedback-resistant DAHP synthase. In this document, the term "feedback-resistant 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase" refers to a DAHP synthase that is not negatively regulated by a product of the shikimate pathway, i.e., a DAHP synthase insensitive to tyrosine, phenylalanine, and / or tryptophan. The feedback-resistant DAHP synthase can be any feedback-resistant DAHP synthase known to those skilled in the art, preferably a feedback-resistant bacterial DAHP synthase. Examples of feedback-resistant DAHP synthases include, but are not limited to, the AroF enzyme of E. coli with the N8K substitution (Jossek et al. FEMS Microbiol Lett, 2001 Aug 7;202(l): 145-8), the AroG enzyme of E. coli with the D146N substitution (Kikuchi et al. Appl Environ Microbiol. 1997 Feb;63(2):761-2), the AroH enzyme of E.coli with the substitution P18K V147M, G149D, G149C or A177Y (Ray et al. Journal of Bacteriology, 1988 Dec 170(12) 5500-5506).
[0206] Improvement in transketolase activity
[0207] The microorganism according to the invention preferably exhibits increased transketolase activity compared to the wild-type strain. Transketolase (EC 2.2.1.1) catalyzes the reversible transfer of a ketol group between several donor and acceptor substrates. This enzyme provides a reversible link between glycolysis and the pentose phosphate pathway. The enzyme is involved in the catabolism of pentose sugars and the supply of erythrose-4-phosphate (E4P), a precursor of aromatic amino acids. E. coli, for example, contains two transketolase isozymes, TktA and TktB. Preferably, the microorganism according to the invention is genetically modified to overexpress an endogenous gene encoding a transketolase. In particular, the microorganism can be genetically modified to overexpress an endogenous gene encoding a transketolase and / or to express a heterologous gene encoding a transketolase.
[0208] Production of p-aminobenzoic acid
[0209] In another aspect, the present invention relates to the use of a recombinant microorganism according to the invention for the production of p-aminobenzoic acid. It also relates to a process for producing p-aminobenzoic acid comprising culturing a recombinant microorganism according to the invention, and optionally recovering the p-aminobenzoic acid produced.
[0210] All embodiments described above for the recombinant microorganism of the invention are also considered in this aspect.
[0211] The process may further include the isolation or purification of p-aminobenzoic acid. p-Aminobenzoic acid may be isolated or purified using any method known to those skilled in the art, such as liquid-liquid extraction in a suitable solvent.
[0212] The appropriate conditions for producing p-aminobenzoic acid can be readily determined by those skilled in the art, depending on the recombinant microorganism used. In particular, those skilled in the art can easily select a suitable culture medium and growth conditions based on the microorganism.
[0213] The microorganism is cultivated in a suitable culture medium. The term "suitable culture medium" generally refers to a culture medium providing the essential or beneficial nutrients for the maintenance and / or growth of said microorganism, such as carbon sources; nitrogen sources such as ammonium sulfate; phosphorus sources, for example, monobasic potassium phosphate; trace elements, for example, copper, iodide, iron, magnesium, zinc, or molybdate salts; vitamins; and other growth factors such as amino acids or other growth promoters. An antifoaming agent may be added as needed. According to the invention, this suitable culture medium may be chemically defined or complex. The culture medium may thus have the same or a similar composition to a synthetic or commercially available medium.Specifically, the culture medium may include a simple carbon source. Glucose is a preferred carbon source, but other sugars metabolized into glucose can also be used. These sugars include oligosaccharides and polysaccharides that have a glucose unit. Examples of such sugars include monosaccharides such as fructose, mannose, arabinose, xylose, and galactose; disaccharides such as cellobiose, sucrose, lactose, maltose, trehalose, and xylobiose; and polysaccharides such as dextrin and soluble starch. The pH of the culture medium is also easily adjusted according to the nature of the microorganism and is generally between 5 and 9.
[0214] The microorganism according to the invention is auxotrophic for tryptophan. The culture medium must therefore include a source of tryptophan usable by the microorganism, such as tryptophan, yeast extract, or hydrolyzed casein.
[0215] The culture conditions are easily adapted according to the nature of the microorganism of the invention used. In particular, any culture method allowing the industrial-scale production of p-aminobenzoic acid can be considered. Advantageously, the culture is carried out in bioreactors, notably in batch, fed-batch, chemostat, and / or continuous culture modes. The culture is generally conducted in bioreactors, with possible solid and / or liquid preculture steps in Erlenmeyer flasks, using an appropriate culture medium. Generally speaking, the culture conditions are easily adaptable by those skilled in the art, depending on the recombinant microorganism used.
[0216] Method for increasing p-aminobenzoic acid production
[0217] According to another aspect, the present invention also relates to a method for increasing the production of p-aminobenzoic acid by a microorganism capable of producing p-aminobenzoic acid from chorismate, said method comprising genetic modification of said microorganism so as to inactivate endogenous anthranilate phosphoribosyltransferase activity.
[0218] Inactivation of endogenous anthranilate phosphoribosyltransferase activity can be carried out as detailed above. All embodiments described above for the recombinant microorganism of the invention are also considered in this respect.
[0219] The microorganism thus obtained exhibits an increased capacity for producing p-aminobenzoic acid. It can be used in a method for producing p-aminobenzoic acid as described above.
[0220] Other aspects and advantages of the present invention will be described in the following examples, which should be considered illustrative and not limiting.
[0221] EXAMPLES
[0222] Materials and Methods
[0223] Stump construction
[0224] The native promoters of the tktA and aroG genes were replaced by the p4 promoter (TTATCTCTGGCGGTGTTGACAAGAGATAACAACGTTGATATAATTGA GCCTCTCGCCCCACCAATTCG (SEQ ID NO: 64)) in an MG1655 E. coli strain (CGSC No. 6300). The amino acid sequence of the aroG gene was then mutated (D146N, Kikuchi et al. Appl Environ Microbiol. 1997 Feb;63(2):761-2) to obtain AroG ftr The strain thus obtained is the SL strain.
[0225] The S2 strain was constructed from the SI strain in which the trpE gene was deleted.
[0226] Strain S3 was constructed from strain SI in which the trpD gene was partially deleted to remove the TrpD domain of the bifunctional protein. This was achieved by introducing a G613T mutation (position in reference to the SEQ ID NO: 65) which replaces the GAA codon with a stop codon (TAA) and by deleting the entire coding sequence following the stop codon. The resulting S3 strain expresses the TrpG domain of the bifunctional protein.
[0227] Strain S4 was constructed from strain S3 by deletion of the trpE gene.
[0228] To construct the S5 strain, the cassette containing the pabAB gene of
[0229] Corynebacterium callunae (C. callunae) which codes for the SEQ ID NO: 54 protein and the pabC gene of Xenorhabdus bovienii (X bovienii) which codes for the SEQ ID NO: 51 protein, under the control of the constitutive promoter p4, was integrated into the S4 strain genome at the rcsB / C locus.
[0230] Plasmid construction
[0231] The list of plasmids can be found in Table 1 below.
[0232] Table 1: List of plasmids and description
[0233] To construct the pl plasmid, the pabAB gene from Corynebacterium callunae (C. callunae) which codes for the SEQ ID NO: 54 protein and the pabC gene from Xenorhabdus bovienii (X bovienii) which codes for the SEQ ID NO: 51 protein were synthesized by the company Twist Bioscience. These genes were amplified by PCR with the primers TAGTAGAATTCTTAGGGGAACTCGACGCCAAACAA (SEQ ID NO: 66) / TACTATCTAGATTTGTTTAACTTTAAGAAGGAGAATCGATATGCGAGTCCTT ATAG (SEQ ID NO: 67) and TAGTACTCGAGTTAAAGACGGAGACACCCT (SEQ ID NO: 68) / TACTACCATGGTTTGTTTAACTTTAAGAAGGAGAATCGA TATGTCTGAGGT (SEQ ID NO: 69) and then cloned into the pBR322 plasmid by digestion / ligation (Xbal / EcoRI) and (Ncol / Xhol) respectively under the control of the inducible constitutive promoter T7 (TAATACGACTCACTATAGG, SEQ ID NO: 70). A second copy of the Corynebacterium callunae (C.callunae) was then added by PCR amplification with the primers TAGACGGCCGTTAGGGGAACTCGACGCCAAACAAT (SEQ ID NO: 71) and TAGAGGCGCGCCTTTGTTTAACTTTAAGAAGGAGAATCGATATGCGAGTC (SEQ ID NO: 72) followed by digestion / ligation (AscI / EagI). In the pBAC-LacZ plasmid (addgene #13422), the / acZ gene was removed by a double Sali digestion, thus obtaining the pBAC-AÆ / cZ plasmid. The pTAC promoter and the rrnB Tl terminator were then added to the pBAC-AZacZ plasmid by a digestion / ligation method (Sall / Hpal and Sall / Zral). The pabAB gene from Corynebacterium callunae (C. callunae), which encodes the SEQ ID NO: 54 protein, and the pabC gene from Xenorhabdus bovienii (X. bovienii), which encodes the SEQ ID NO: 51 protein, were synthesized by Twist Bioscience. These genes were amplified by PCR with primers.
[0234] TACTAAAGCTTTTTGTTTAACTTTAAGAAGGAGAATCGATATGCGAGTCCTT ATAG (SEQ ID NO: 73) / TAGTAGCTAGCTTAGGGGAACTCGACGCCAAACAA (SEQ ID NO: 74) and ACAAATGGATCCTTACGCCGG (SEQ ID NO: 75) / GAATTGGTCGACATTTGTCCTACTCAGG (SEQ ID NO: 76) then cloned into the plasmid by digestion / ligation (Nhel / HindlII) and (BamHI / SalI) respectively and under the control of the constitutive promoter p4, thus obtaining the plasmid p2.
[0235] Growing conditions in Erlenmeyer flask
[0236] The strains were cultured in 5 ml of LB medium (with antibiotic for plasmid-encoded strains) for 8 h (preculture 1, PCI). 100 µl of PCI were inoculated overnight into 10 ml of M9-1 mineral medium (Table 2) (preculture 2, PC2). 100 µl of PC2 were used to inoculate 25 ml of M9-1 mineral medium under the same conditions as the preculture. The strains were then cultured for 48 h at 30°C. For auxotrophic strains (with trpE and / or trpD deletion), 30 mg / L of tryptophan was added to both PC2 and the culture.
[0237] Table 2: Composition of mineral medium M9-1
[0238] Culture conditions in a bioreactor
[0239] The strains were cultured in 10 mL of LB medium from 100 mL of cryotube (2 µDO₅₀Nm 20% glycerol) for 6 h at 37°C (PCI). PCI was used to inoculate 200 mL of M9-2 mineral medium (Table 3), (containing 50 mg / L of tryptophan for auxotrophic strains) at a DO₅₀Nm of 0.025, for 17 h at 30°C (PC2). 2 L bioreactors were then inoculated at a DC₁₀Nm of 0.3–0.4 with PC2. The fed-batch culture conditions were as follows: M9-2 medium with glucose feeding (600 g / L glucose solution), T°=30°C, pH 7.2, and maintenance of a dissolved oxygen percentage around 30% by adjusting the agitation and then the aeration rate. For tryptophan auxotrophic strains, the residual tryptophan concentration is maintained above zero through tryptophan feeding. Table 3: Composition of medium M9-2 Measurement of PABA concentration
[0240] The amount of PABA in the cultures was measured by the LC-UV method. The HPLC instrument was equipped with a column (Luna Omega 3pm Polar Cl 8 100 A, (100*2.1 mm)) and coupled to a UV detector: [190-400 nm]. The FEO / Methanol solution was used as the mobile phase at 30 °C at a flow rate of 0.5 mL / min. An acetonitrile elution gradient was applied for 13 min, and the quantification of PABA (detected at a wavelength of 215 nm) was performed using a standard curve.
[0241] Results
[0242] Impact of trpD gene deletion
[0243] PABA production was tested in 4 different chassis, namely SI, S2, S3 and S4. For PABA production, the 4 strains were transformed with the pl plasmid and cultured in Erlenmeyer flasks in M9-1 medium (Figure 2).
[0244] The Sl-pl and S2-pl strains have equivalent production of tyrosine (6 mg / L), phenylalanine (18-38 mg / L), and PABA (126-136 mg / L). Therefore, deletion of the trpE gene encoding F anthranilate synthase does not impact the production of these metabolites.
[0245] In contrast, the S3-pl and S4-pl strains have a significantly higher production for the 3 metabolites, namely 127-129 mg / L of tyrosine, 321-329 mg / L of phenylalanine and 291-248 mg / L of PABA.
[0246] These results show that, surprisingly, inactivation of the TrpD domain of the protein encoded by the trpD gene has a very positive impact on PABA production, unlike deletion of the trpE gene alone.
[0247] Furthermore, deletion of trpE, in addition to inactivation of the TrpD domain of the protein encoded by the trpD gene, not only significantly increases PABA production but also suppresses anthranilate production. Bioreactor culture
[0248] Strain S4 was transformed with the p2 plasmid to obtain strain S4-p2. Strain S4-p2 was then cultured in a 2L bioreactor. This strain produced 15.6 g / L of PABA after 72 h of culture (Figure 3). Strain S5, in which the pabAB and pabC genes were integrated into the genome, produced 20.6 g / L of PABA in 52 h of culture (Figure 4).
[0249] Strains S4-p2 and S5 produce 15.6 and 20.6 g / L of PABA respectively with a yield on glucose (gPABA / ggiucose) of 0.05 and 0.066 and a productivity of 0.22 and 0.37 g / L / h (Table 4).
[0250] Table 4: Performance of strains S4-p2 and S5
Claims
DEMANDS 1. Use of a recombinant microorganism, which is a bacterium, a filamentous fungus or a yeast, for the production of p-aminobenzoic acid, wherein said recombinant microorganism is capable of producing p-aminobenzoic acid from chorismate and wherein the anthranilate phosphoribosyltransferase activity is inactivated.
2. Use according to claim 1, wherein the anthranilate phosphoribosyltransferase activity is inactivated in said recombinant microorganism by total or partial deletion of the endogenous trpD gene, in particular by total or partial deletion of the region of the endogenous trpD gene encoding the anthranilate phosphoribosyltransferase TrpD activity.
3. Use according to claim 1 or 2, wherein, in said recombinant microorganism, the anthranilate synthase activity is inactivated.
4. Use according to claim 3, wherein the anthranilate synthase activity is inactivated in said recombinant microorganism by total or partial deletion of the trpE gene.
5. Use according to claim 3 or 4, wherein the anthranilate synthase activity is inactivated in said recombinant microorganism by total or partial deletion of the endogenous trpG gene or by total or partial deletion of the region of the endogenous trpD gene encoding the TrpG glutamine amidotransferase activity.
6. Use according to any one of claims 1 to 5, wherein, in said recombinant microorganism, the anthranilate phosphoribosyltransferase activity is inactivated by total deletion of the endogenous trpD gene or by total or partial deletion of the region of the endogenous trpD gene encoding the anthranilate phosphoribosyltransferase activity TrpD, and the anthranilate synthase activity is inactivated by total or partial deletion of the trpE gene and / or by total or partial deletion of the endogenous trpG gene and / or by total or partial deletion of the region of the endogenous trpD gene encoding the glutamine amidotransferase activity TrpG.
7. Use according to any one of claims 1 to 6, wherein said recombinant microorganism comprises - a heterologous gene encoding component I of an aminodeoxychorismate synthase (PabB), - a heterologous gene encoding component II of an aminodeoxychorismate synthase (PabA), - a heterologous gene encoding an enzyme having component I activity of an aminodeoxychorismate synthase and component II activity of an aminodeoxychorismate synthase (PabAB), - a heterologous gene encoding a 4-amino-4-deoxychorismate lyase (PabC), and / or - - a heterologous gene encoding an enzyme having component I activity of an aminodeoxychorismate synthase and 4-amino-4-deoxychorismate lyase (PabBC) activity.
8. Use according to any one of claims 1 to 7, wherein said recombinant microorganism comprises - a heterologous gene encoding an enzyme having component I activity of an aminodeoxychorismate synthase and component II activity of an aminodeoxychorismate synthase (PabAB), and - a heterologous gene encoding a 4-amino-4-deoxychorismate lyase (PabC).
9. Use according to claim 8, wherein the pabAB gene codes for an enzyme comprising, or consisting of, an amino acid sequence selected from the group consisting of SEQ ID NO: 54 to 59, and polypeptides having at least 70% sequence identity with any of the SEQ ID NO: 54 to 59 and exhibiting PabAB activity, preferably an amino acid sequence selected from the group consisting of SEQ ID NO: 54, and polypeptides having at least 70% sequence identity with SEQ ID NO: 54 and exhibiting PabAB activity.
10. Use according to claim 8 or 9, wherein the pabC gene encodes an enzyme comprising, or consisting of, an amino acid sequence selected from the group consisting of SEQ ID NO: 45 to 53, and polypeptides having at least 70% sequence identity with any of the SEQ ID NO: 45 to 53 and exhibiting PabC activity, preferably an amino acid sequence selected from the group consisting of SEQ ID NO: 51, and polypeptides having at least 70% sequence identity with SEQ ID NO: 51 and exhibiting PabC activity.
11. Use according to any one of claims 1 to 10, wherein said microorganism is genetically modified to overexpress an endogenous gene encoding a 3-deoxy-D-arabino-heptulosonate-7-phosphate (DAHP) synthase and / or express a heterologous gene encoding a DAHP synthase.
12. Use according to any one of claims 1 to 11, wherein said microorganism overexpresses an endogenous gene encoding a transketolase and / or comprises a heterologous gene encoding a transketolase.
13. Use according to any one of claims 1 to 12, wherein said microorganism is a bacterium.
14. Use according to any one of claims 1 to 12, wherein said microorganism is a bacterium of the species E. coli.
15. Recombinant microorganism as defined in any one of claims 1 to 14.
16. A process for the production of p-aminobenzoic acid comprising the culture of a recombinant microorganism according to claim 15 and optionally the recovery of the p-aminobenzoic acid produced.
17. A method for increasing the production of p-aminobenzoic acid by a microorganism capable of producing p-aminobenzoic acid from chorismate, said method comprising genetic modification of said microorganism so as to inactivate endogenous anthranilate phosphoribosyltransferase activity, and said microorganism being a bacterium, a filamentous fungus or a yeast.
Citation Information
Patent Citations
Coryneform bacterial transformant and method for producing 4-aminobenzoic acid or salt thereof using same
EP3421599A1
Non-toxic, non-toxigenic, non-pathogenic fusarium expression system and promoters and terminators for use therein
WO1996000787A1
Promoters for expressing genes in a fungal cell
WO2000056900A2
Biological syntheisis of p-aminobenzoic acid, p-aminophenol, n-(4-hydroxyphenyl)ethanamide and derivatives thereof
WO2013103894A1
Process for recovering aminobenzoic acid from an aqueous mother liquor
WO2023117756A1