1h-pyrazol-4-YL-acetamide derivatives for use in cullin-ring ubiquitin ligase (CRL) conjugates comprising the compound-linker and a targeting moiety for the treatment of e.g. cancer

Abstract

The present invention relates to a compound of formula (I), a compound-linker construct comprising the compound, and a conjugate comprising the compound-linker and a targeting moiety. The compound of the present invention has the ability to stimulate and / or induce, particularly induce degradation of a target protein. Such a target protein may be a protein involved in diseases, like cancer, metabolic disorder, infectious disease and / or neurological disorder, namely in particular cyclin K (CCNK) and / or CDK12 and / or CDK13. The present invention also relates to the compound, the compound-linker construct and the conjugate for use as medicament, preferably for use in treating specific diseases as disclosed herein.

Description

[0001] 1 H-PYRAZ0L-4-YL-ACETAMIDE DERIVATIVES FOR USE IN CULLIN-RING UBIQUITIN LIGASE (CRL) CONJUGATES

[0002] COMPRISING THE COMPOUND-LINKER AND A TARGETING MOIETY FOR THE TREATMENT OF E.G. CANCER

[0003] FIELD OF THE INVENTION

[0004] The present invention relates to a compound with the ability to stimulate and / or induce, particularly induce ubiquitination of a target protein, wherein the compound can furthermore be covalently conjugated to a second moiety, in particular to a linker. The compound of the present invention stimulates and / or induces degradation of the target protein most likely via ubiquitination of the target protein by the cullin-RING ubiquitin ligase complex (CRL), wherein the target protein is in particular cyclin K (CCNK) and / or CDK12 and / or CDK13. Further, the present invention relates to a covalently conjugated compound, namely a compound-linker construct comprising a linker and the compound of the invention and a conjugate comprising a targeting moiety and the compound-linker construct of the invention, wherein the conjugate is preferably an antibody-drug conjugate (ADC). Still further, the present invention relates to the compound, the compound-linker construct and the conjugate for use as medicament, in particular for treating a cancer, a metabolic disorder, an infectious disease and / or a neurological disorder.

[0005] BACKGROUND OF THE INVENTION

[0006] Molecular glue degraders and their discovery e.g. via scalable chemical profiling are known in the field, see e.g. Mayor-Ruiz et al., Nat Chem Biol. 2020 Nov; 16(11):1199-1207.

[0007] On the one hand, there is a constant need to provide novel molecular glue degraders, which exhibit e.g. improved characteristics compared to known molecular glue degraders or which target a protein implicated in a disease, which protein has not yet been targeted by any of the known molecular glue degraders.

[0008] On the other hand, there is a constant need to deliver a molecular glue degrader to a specific cell, such as e.g. a tumor cell. In other words, the targeting of a cell, such as e.g. a tumor cell, plays an important role in providing an effective molecular glue degrader while at the same time minimizing side effects due to unspecific delivery to any cell.

[0009] An established way of targeting a cell is the use of a targeting moiety, in particular an antibody directed to an extracellular surface protein of the cell of interest, and to covalently link this targeting moiety to the compound to be delivered to this cell. Such a conjugate comprising the targeting moiety and the compound to be delivered is typically a conjugate comprising the targeting moiety covalently bound to a linker, which linker is in turn covalently bound to the compound to be delivered. Once such a conjugate is internalized by the targeted cell, intracellular proteases or other factors will act on the conjugate and, by using a linker with at least one cleavage site for an intracellular protease or susceptible to other factors that result in cleavage, the compound to be delivered will be cleaved off from the rest of the conjugate, thus resulting in the intracellular delivery of the compound of interest, which will now be effective inside the cell.

[0010] A well-established conjugate is in particular an ADC, which combines the specificity of the antibody as targeting moiety with the efficacy of the compound of interest (which can e.g. have a cytotoxic effect when aiming for cancer treatment). For this targeting strategy, it is mandatory that the compound of interest can be conjugated, in particular to the afore-mentioned linker, which is in turn conjugated to the targeting moiety. Because the conjugate has to be stable outside of the targeted cell, the conjugation of the moieties is typically achieved via covalent bonds.

[0011] Thus, there is a need for providing a compound that fulfills the above needs, i.e. a compound that is a molecular glue degrader and that can be covalently conjugated to a further moiety. SUMMARY OF THE INVENTION

[0012] The present invention solves the afore-mentioned needs in that it provides a novel compound as disclosed and claimed herein, which in particular stimulates and / or induces degradation of CCNK and / or CDK12 and / or CDK13 (thus acting as molecular glue degrader), and which can be conjugated to a linker in order to provide a compound-linker construct and to provide a conjugate comprising the compound-linker construct and a targeting moiety. Accordingly, further objectives of the present invention are to provide a compound-linker construct comprising the compound and a linker, and a conjugate comprising a targeting moiety and the compound-linker construct. Yet another objective relates to the medical use of such a compound, compound-linker construct and conjugate, in particular for the treatment of a disease linked to (overexpressed) CCNK and / or CDK12 and / or CDK13.

[0013] In a first aspect, the present invention relates to a compound of the following formula (I) or a stereoisomer, tautomer, pharmaceutically acceptable salt, or hydrate thereof: wherein

[0014] A is a 5-membered heteroaryl group, which comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the heteroaryl group is independently unsubstituted or substituted with one or more, same or different substituents RA, provided that at least one substituent RAis present at the heteroaryl group A; wherein

[0015] RAis halogen, CN, C-i-Ce-alkyl, C-i-Ce-haloalkyl, or 3- to 10-membered saturated or partially unsaturated carbocyclyl, carbocyclyl-Ci-C2-alkyl, carbobicyclyl, carbobicyclyl-Ci-C2-alkyl, heterocyclyl, heterocyclyl-Ci-C2-alkyl, heterobicyclyl, or heterobicyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic or heterobicyclic rings comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RY; wherein

[0016] RYis Cl, F, or Ci-C4-alkyl;

[0017] B is any one of the following groups wherein the wavy line in each case marks the connection to the remainder of the molecule; and wherein RB1is H;

[0018] RB2is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4- hydroxyalkyl, Ci-C4-alkyl-S-, Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN);

[0019] RB3is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN);

[0020] RB4is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN); and

[0021] RB5is H; provided that at least one of RB2, RB3, and RB4is OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, or -Ci-C4-alkyl-NH(RN);

[0022] X1is N or CRB6;

[0023] Y1is N or CRB7;

[0024] Z1is N or CRB8; provided that one, but not more than one of X1, Y1, and Z1is N;

[0025] RB6is H;

[0026] RB7is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN);

[0027] RB8is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN);

[0028] RB9is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN); and

[0029] RB1° is H; provided that at least one of RB7, RB8, and RB9being present is OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-c4- hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, or -Ci-C4-alkyl-NH(RN);

[0030] RB11is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN); and

[0031] RB12is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN); provided that at least one of RB11and RB12is OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, or -Ci-C4-alkyl-NH(RN);

[0032] RB13is OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4- aminoalkyl, or -Ci-C4-alkyl-NH(RN);

[0033] RB14is OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4- aminoalkyl, or -Ci-C4-alkyl-NH(RN);

[0034] RB15is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN); and

[0035] RB16is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN); provided that at least one of RB15and RB16being present is OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-c4- hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, or -Ci-C4-alkyl-NH(RN); RB17is OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4- aminoalkyl, or -Ci-C4-alkyl-NH(RN);

[0036] RNis Ci-C4-alkyl; and

[0037] R1is H or Ci-C4-alkyl.

[0038] In a preferred embodiment,

[0039] A is the following heteroaryl group wherein

[0040] X2is N or NH;

[0041] Y2is CH, CRA2, N, NH, or S;

[0042] Z2is CH, CRA4, N, NH, or S; provided that at least one of Y2and Z2is different from CH, CRA2or CRA4; and wherein the wavy line marks the connection to the remainder of the molecule; and wherein the dashed lines within the 5-membered ring indicate the presence of double bonds, such that an aromatic ring system is formed; and wherein RA2, RA3, and RA4represent the one or more, same or different substituents RAat the heteroaryl group A as defined above for formula (I).

[0043] In another preferred embodiment,

[0044] A is any one of the following heteroaryl groups: wherein the wavy line in each case marks the connection to the remainder of the molecule; and wherein

[0045] RA3is Ci-Ce-alkyl, C-i-Ce-haloalkyl, or 3- to 10-membered saturated or partially unsaturated carbocyclyl, carbocyclyl-Ci-C2-alkyl, carbobicyclyl, carbobicyclyl-Ci-C2-alkyl, heterocyclyl, heterocyclyl-Ci-C2-alkyl, heterobicyclyl, or heterobicyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic or heterobicyclic rings comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RY; wherein

[0046] RYis Cl, F, or Ci-C2-alkyl.

[0047] In another preferred embodiment,

[0048] A is any one of the following heteroaryl groups wherein the wavy line in each case marks the connection to the remainder of the molecule; and wherein

[0049] RA3is Ci-Ce-alkyl, C-i-Ce-haloalkyl, or 3- to 10-membered saturated carbocyclyl, carbocyclyl-Ci-C2- alkyl, carbobicyclyl, carbobicyclyl-Ci-C2-alkyl, heterocyclyl, heterocyclyl-Ci-C2-alkyl, heterobicyclyl, or heterobicyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic or heterobicyclic rings comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RY; wherein

[0050] RYis Cl, F, or Ci-C2-alkyl.

[0051] In another preferred embodiment,

[0052] A is the following heteroaryl group: wherein the wavy line marks the connection to the remainder of the molecule; and wherein

[0053] RA3is Ci-Ce-alkyl, C-i-Ce-haloalkyl, or 3- to 10-membered saturated carbocyclyl, carbocyclyl-Ci-C2- alkyl, carbobicyclyl, carbobicyclyl-Ci-C2-alkyl, heterocyclyl, heterocyclyl-Ci-C2-alkyl, heterobicyclyl, or heterobicyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic or heterobicyclic rings comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RY; wherein

[0054] RYis Cl, F, or Ci-C2-alkyl.

[0055] In another preferred embodiment,

[0056] RA3is any one of the following groups

[0057] CH3, CH2CH3, CH2CH2CH3, CH(CH3)2, C(CH3)3, CF3, wherein the wavy line in each case marks the connection to the A group.

[0058] In another preferred embodiment,

[0059] RA3is wherein the wavy line marks the connection to the A group.

[0060] In another preferred embodiment, B is wherein the wavy line marks the connection to the remainder of the molecule; and wherein

[0061] RB1is H;

[0062] RB2is H, Cl, F, CN, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;

[0063] RB3is H, Cl, F, CN, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;

[0064] RB4is H, Cl, F, CN, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2; and

[0065] RB5is H; provided that at least one of RB2, RB3, and RB4is OH, NH2, SH, CH2OH, CH(CH3)OH, C(CH3)2OH,

[0066] CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2; and wherein preferably

[0067] RB1is H;

[0068] RB2is OH, NH2, SH, CH2SH, CH2OH, CH(CH3)OH, C(CH3)2OH, or CH2NH2;

[0069] RB3is H;

[0070] RB4is H; and

[0071] RB5is H.

[0072] In another preferred embodiment, wherein the wavy line marks the connection to the remainder of the molecule; and wherein

[0073] RB7is H, Cl, F, CN, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;

[0074] RB8is H, Cl, F, CN, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;

[0075] RB9is H, Cl, F, CN, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2; and

[0076] RB1° is H; provided that at least one of RB7, RB8, and RB9is OH, NH2, SH, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2.

[0077] In another preferred embodiment,

[0078] A is any one of the following heteroaryl groups: wherein the wavy line in each case marks the connection to the remainder of the molecule;

[0079] RA3 preferably wherein the wavy line marks the connection to the A group;

[0080] B is wherein the wavy line marks the connection to the remainder of the molecule; and wherein RB1is H;

[0081] RB2is OH, NH2, CH2OH, or CH2NH2;

[0082] RB3is H;

[0083] RB4is H or Cl; and

[0084] RB5is H.

[0085] In another preferred embodiment,

[0086] R1is H

[0087] In another preferred embodiment, R1is Ci-C4-alkyl, preferably CH3.

[0088] In another preferred embodiment, the compound is a compound of formula (IA)

[0089] In another preferred embodiment, the compound is a compound of formula (IB)

[0090] In another preferred embodiment, the compound is selected from the group consisting of:

[0091] N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-(3-(2-hydroxypropan-2-yl)phenyl)-1 H-pyrazol-4- yl)acetamide,

[0092] N-(3-cyclopropyl-1 H-pyrazol-5-yl)-2-(1-(3-(2-hydroxypropan-2-yl)phenyl)-1 H-pyrazol-4- yl)acetamide,

[0093] 2-(1-(3-aminophenyl)-1 H-pyrazol-4-yl)-N-(5-cyclopropyl-1 H-pyrazol-3-yl)acetamide,

[0094] 2-(1-(3-aminophenyl)-1 H-pyrazol-4-yl)-N-(3-cyclopropyl-1 H-pyrazol-5-yl)acetamide,

[0095] 2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-(trifluoromethyl)thiazol-2-yl)acetamide,

[0096] 2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-isopropyl-1 H-pyrazol-3-yl)acetamide,

[0097] 2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(3-isopropyl-1 H-pyrazol-5-yl)acetamide,

[0098] N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-(3-hydroxyphenyl)-1 H-pyrazol-4-yl)acetamide, N-(3-cyclopropyl-1 H-pyrazol-5-yl)-2-(1-(3-hydroxyphenyl)-1 H-pyrazol-4-yl)acetamide, 2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-isopropylthiazol-2-yl)acetamide, N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)acetamide, N-(3-cyclopropyl-1 H-pyrazol-5-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)acetamide, and N-(5-cyclopropyl-1 ,3-thiazol-2-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)acetamide.

[0099] In another preferred embodiment, the compound is selected from the group consisting of: (S)-N-(5-cyclopropylthiazol-2-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanamide,

[0100] (R)-N-(5-cyclopropylthiazol-2-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanamide, N-(5-cyclopropylthiazol-2-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)pro panamide,

[0101] (S)-N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4- yl)propanamide,

[0102] (R)-N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4- yl)propanamide,

[0103] N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanamide,

[0104] (S)-N-(3-cyclopropyl-1 H-pyrazol-5-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4- yl)propanamide,

[0105] (R)-N-(3-cyclopropyl-1 H-pyrazol-5-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4- yl)propanamide,

[0106] N-(3-cyclopropyl-1 H-pyrazol-5-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanamide,

[0107] (S)-2-(1-(3-chloro-5-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-cyclopropylthiazol-2- yl)propanamide,

[0108] (R)-2-(1-(3-chloro-5-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-cyclopropylthiazol-2- yl)propanamide,

[0109] 2-(1-(3-chloro-5-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-cyclopropylthiazol-2- yl)propanamide,

[0110] 2-(1-(3-chloro-5-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-cyclopropyl-1 H-pyrazol-3- yl)propanamide, and

[0111] 2-(1 -(3-chloro-5-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(3-cyclopropyl-1 H-pyrazol-5- yl)propanamide.

[0112] In a second aspect, the present invention relates to a compound-linker construct comprising

[0113] (i) a compound of formula (I) as defined in the first aspect; and

[0114] (ii) a linker L, wherein the linker L is preferably a cleavable linker.

[0115] In a third aspect, the present invention relates to a conjugate comprising

[0116] (i) a compound-linker construct as defined in the second aspect; and

[0117] (ii) a targeting moiety T, wherein the targeting moiety T is preferably selected from the group consisting of an antibody, an antigen-binding fragment thereof, a nucleic acid based molecule, a carbohydrate, a peptide, or a modified peptide.

[0118] In a fourth aspect, the present invention relates to a pharmaceutical composition comprising a pharmaceutically acceptable amount of the compound of formula (I) as defined in the first aspect, or the compound-linker construct as defined in the second aspect, or the conjugate as defined in the third aspect, and optionally a pharmaceutically acceptable carrier, diluent or excipient.

[0119] In a fifth aspect, the present invention relates to a compound of formula (I) as defined in the first aspect, or a compound-linker construct as defined in the second aspect, or a conjugate as defined in the third aspect, or a pharmaceutical composition as defined in the fourth aspect for use in medicine. In a sixth aspect, the present invention relates to a compound of formula (I) as defined in the first aspect, or a compound-linker construct as defined in the second aspect, or a conjugate as defined in the third aspect, or a pharmaceutical composition as defined in the fourth aspect for use in treating or preventing cancer, a metabolic disorder, a neurologic disorder or an infectious disease.

[0120] DETAILED DESCRIPTION OF THE INVENTION

[0121] 1 . Detailed description of the aspects of the present invention

[0122] The aspects summarized above are described in more detail in the following.

[0123] The first aspect

[0124] A compound of the present invention acts as molecular glue degrader inside a cell of interest, thereby inducing the degradation of CCNK and / or CDK12 and / or CDK13, which can be taken from example 2 of the present application. Furthermore, a compound of the present invention is conjugatable to a further moiety, in particular to a linker, via a covalent bond.

[0125] As indicated above, the compound of the first aspect of the present invention is a compound of formula (I):

[0126] With regard to ring A in the compounds of formula (I) and the substituents RAthereon, the following preferred embodiments are relevant.

[0127] As indicated above, in the compounds of formula (I),

[0128] A is a 5-membered heteroaryl group, which comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or nonoxidized, and wherein each substitutable carbon or heteroatom in the heteroaryl group is independently unsubstituted or substituted with one or more, same or different substituents RA, provided that at least one substituent RAis present at the heteroaryl group A; wherein

[0129] RAis halogen, CN, C-i-Ce-alkyl, C-i-Ce-haloalkyl, or 3- to 10-membered saturated or partially unsaturated carbocyclyl, carbocyclyl-Ci-C2-alkyl, carbobicyclyl, carbobicyclyl-Ci-C2-alkyl, heterocyclyl, heterocyclyl-Ci-C2-alkyl, heterobicyclyl, or heterobicyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic or heterobicyclic rings comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RY; wherein

[0130] RYis Cl, F, or Ci-C4-alkyl.

[0131] In a preferred embodiment, A is a 5-membered heteroaryl group, which comprises one or more, preferably one, two, or three, more preferably two or three, even more preferably two, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or nonoxidized, and wherein the heteroaryl group is substituted with one or more, preferably one or two, more preferably one, same or different substituents RA.

[0132] In a more preferred embodiment,

[0133] A is a 5-membered heteroaryl group selected from the group consisting of imidazolyl, pyrazolyl, triazolyl, oxazolyl, isoxazolyl, isothiazolyl, and thiazolyl, preferably pyrazolyl, oxazolyl, and thiazolyl, more preferably pyrazolyl and thiazolyl, wherein the aforementioned heteroaryl groups are independently substituted with one or more, preferably one or two, more preferably one, same or different substituents RA.

[0134] In a particularly preferred embodiment,

[0135] A is pyrazolyl, wherein the pyrazolyl is substituted with one or more, preferably one or two, more preferably one, same or different substituents RA.

[0136] In another particularly preferred embodiment,

[0137] A is thiazolyl, wherein the thiazolyl is substituted with one or more, preferably one or two, more preferably one, same or different substituents RA.

[0138] Further, it is preferred that the heteroaryl group A is attached to the amide moiety of the remainder of the molecule via a carbon atom. Further, it is preferred that the heteroaryl group A comprises more than one heteroatom, preferably two or three heteroatoms, particularly preferably two heteroatoms.

[0139] Accordingly, in a preferred embodiment,

[0140] A is the following heteroaryl group A* wherein

[0141] X2is N or NH;

[0142] Y2is CH, CRA2, N, NH, O, or S;

[0143] Z2is CH, CRA4, N, NH, O, or S; provided that at least one of Y2and Z2is different from CH, CRA2or CRA4; and wherein the wavy line marks the connection to the remainder of the molecule; and wherein the dashed lines within the 5-membered ring indicate the presence of double bonds, such that an aromatic ring system is formed; and wherein RA2, RA3, and RA4represent the one or more, same or different substituents RAat the heteroaryl group A as defined for the compound of formula (I); so that

[0144] RA2, RA3, and RA4are each independently selected from the group consisting of halogen, CN, C-i-Ce-alkyl, C-i-Ce-haloalkyl, or 3- to 10-membered saturated or partially unsaturated carbocyclyl, carbocyclyl-Ci-C2-alkyl, carbobicyclyl, carbobicyclyl-Ci-C2-alkyl, heterocyclyl, heterocyclyl-Ci-C2-alkyl, heterobicyclyl, and heterobicyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic or heterobicyclic rings comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RY; wherein

[0145] RYis Cl, F, or Ci-C4-alkyl.

[0146] In the context of said heteroaryl group A*, preferably, X2is N or NH;

[0147] Y2is CH, CRA2, N, NH, or S;

[0148] Z2is CH, CRA4, N, NH, or S; more preferably, X2is N or NH;

[0149] Y2is CH, CRA2, N, or NH;

[0150] Z2is CH, CRA4, N, NH, or S; even more preferably,

[0151] X2is N or NH;

[0152] Y2is CH, CRA2, N, or NH;

[0153] Z2is CH, CRA4, or S; even more preferably,

[0154] X2is N or NH;

[0155] Y2is N or NH;

[0156] Z2is CH or CRA4, preferably CH; or

[0157] X2is N;

[0158] Y2is CH or CRA2, preferably CH;

[0159] Z2is S, particularly preferably,

[0160] X2is N or NH;

[0161] Y2is N or NH;

[0162] Z2is CH or CRA4, preferably CH.

[0163] As indicated above, in a particularly preferred embodiment, the heteroaryl group A comprises two heteroatoms. Accordingly, in the heteroaryl group A*, it is particularly preferred that one of Y2and Z2is different from CH, CRA2or CRA4and one of Y2and Z2is CH, CRA2or CRA4, preferably CH.

[0164] Further, it is to be understood that whether a nitrogen atom in the heteroaryl group A or A* is N or NH results from the aromatic ring system in the heteroaryl group A or A* and the possible tautomers formed thereby. In particular, the skilled person is aware that if only one of X2, Y2, and Z2in the heteroaryl group A* is a nitrogen atom and the remaining heteroatom(s) are O or S, then said one nitrogen atom is present as N. If more than one of X2, Y2, and Z2in the heteroaryl group A* is a nitrogen atom, then one of said nitrogen atoms is present as NH and the remaining one(s) as N. Accordingly, in the heteroaryl group A*, at most one of X2, Y2, and Z2is NH.

[0165] Further, if more than one nitrogen atom is present in the heteroaryl group A or A* (e.g. pyrazolyl), two different tautomers are formed, which will typically be present in chemical equilibrium in solution with the thermodynamically more stable tautomer being present in an excess and the two tautomers readily interconverting. Therefore, whenever only one of the two possible tautomers of the heteroaryl group A or A* (e.g. in the case of pyrazolyl) of the compound of formula (I) is depicted, it is intended to be referred to the other tautomer as well. For illustration, the two possible tautomers for the heteroaryl group A or A* in the case of pyrazolyl are shown below:

[0166] Thus, when the heteroaryl group A or A* of the compound of formula (I) is depicted herein as only one tautomeric form (e.g. as A1-T1 or A1-T2), it is also referred to the heteroaryl group A or A* of the compound of formula (I) in the respective other tautomeric form, as well as mixtures thereof. Further, when for clarity reasons the heteroaryl group A or A* of the compound of formula (I) is depicted herein in the different tautomeric forms (e.g. as A1-T1 and A1-T2), it is also referred to mixtures thereof.

[0167] Similarly, if the compounds of formula (I) are depicted herein comprising one tautomeric form of the heteroaryl group A or A* (e.g. Ia-T1 or la-T2), it is also referred to the compounds of formula (I) comprising the respective other tautomeric form of the heteroaryl group A or A*, as well as mixtures thereof. If compounds of formula (I) with different tautomeric forms of the heteroaryl group A or A* are depicted herein (e.g. Ia-T1 and la-T2), it is also referred to mixtures thereof.

[0168] In view of the above, in a preferred embodiment,

[0169] A is any one of the following heteroaryl groups: wherein the wavy line in each case marks the connection to the remainder of the molecule; and wherein RA2, RA3, and RA4represent the one or more, same or different substituents RAat the heteroaryl group A as defined for the compound of formula (I); so that

[0170] RA2, RA3, and RA4are each independently selected from the group consisting of halogen, CN, C-i-Ce-alkyl, C-i-Ce-haloalkyl, or 3- to 10-membered saturated or partially unsaturated carbocyclyl, carbocyclyl-Ci-C2-alkyl, carbobicyclyl, carbobicyclyl-Ci-C2-alkyl, heterocyclyl, heterocyclyl-Ci-C2-alkyl, heterobicyclyl, and heterobicyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic or heterobicyclic rings comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RY; wherein

[0171] RYis Cl, F, or Ci-C4-alkyl; preferably wherein RA2, if present, is Ci-C2-alkyl or 3- to 10-membered saturated or partially unsaturated carbocyclyl;

[0172] RA4, if present, is halogen, CN, Ci-C2-alkyl, or 3- to 10-membered saturated or partially unsaturated carbocyclyl; and

[0173] RA3is halogen, CN, C-i-Ce-alkyl, C-i-Ce-haloalkyl, or 3- to 10-membered saturated or partially unsaturated carbocyclyl, carbocyclyl-Ci-C2-alkyl, carbobicyclyl, carbobicyclyl-Ci-C2-alkyl, heterocyclyl, heterocyclyl-Ci-C2-alkyl, heterobicyclyl, and heterobicyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic or heterobicyclic rings comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RY; wherein

[0174] RYis Cl, F, or Ci-C4-alkyl.

[0175] In a particularly preferred embodiment, RA3is the only substituent RAat the heteroaryl group A or A* of the compounds of formula (I).

[0176] Accordingly, in a more preferred embodiment, A is any one of the following heteroaryl groups: wherein the wavy line in each case marks the connection to the remainder of the molecule and wherein RA3is as defined above or in the preferred embodiments defined below.

[0177] In an even more preferred embodiment,

[0178] A is any one of the following heteroaryl groups: wherein the wavy line in each case marks the connection to the remainder of the molecule and wherein RA3is as defined above or in the preferred embodiments defined below.

[0179] In an even more preferred embodiment,

[0180] A is any one of the following heteroaryl groups: wherein the wavy line in each case marks the connection to the remainder of the molecule and wherein RA3is as defined above or in the preferred embodiments defined below.

[0181] In an even more preferred embodiment, A is wherein the wavy line in each case marks the connection to the remainder of the molecule and wherein RA3is as defined above or in the preferred embodiments defined below.

[0182] In another even more preferred embodiment,

[0183] A is wherein the wavy line marks the connection to the remainder of the molecule and wherein RA3is as defined above or in the preferred embodiments defined below.

[0184] In one particularly preferred embodiment,

[0185] A is wherein the wavy line marks the connection to the remainder of the molecule and wherein RA3is as defined above or in the preferred embodiments defined below.

[0186] In another particularly preferred embodiment,

[0187] A is wherein the wavy line marks the connection to the remainder of the molecule and wherein RA3is as defined above or in the preferred embodiments defined below.

[0188] In a preferred embodiment, the compound of formula (I) is thus a compound of formula (la-T1), (la-

[0189] In one embodiment, the compound of formula (I) is a compound of formula (la-T1) or (la-T2):

[0190] In another embodiment, the compound of formula (I) is a compound of formula (lb):

[0191] Particularly preferred compounds of formula (I) are compounds of formula (la-T1) or its tautomer (la-T2). In one particularly preferred embodiment, the compound of formula (I) is a compound of formula (la-T1). In another particularly preferred embodiment, the compound of formula (I) is a compound of formula (la-T2).

[0192] In connection with the compounds of formula (I), in particular the compounds of formula (la-T1), (la- 72), and (lb), as well as in connection with the preferred embodiments regarding the heteroaryl group A or A* defined above, in particular (A1-T1), (A1-T2), (A2-T1), (A2-T2), (A3), (A4), (A5), (A6), (A7), (A8), (A9), or (A10), preferably (A1-T1), (A1-T2), (A5), (A6), (A9), or (A10), more preferably (A1-T1), (A1-T2), or (A10), particularly preferably (A1-T1) or (A1-T2), the following preferences regarding the substituents RA, RA2, RA3, and RA4, if present, are relevant.

[0193] As indicated above, at least one substituent RAis present at the heteroaryl group A of the compounds of formula (I). In a preferred embodiment, the heteroaryl group A is substituted with one, two, or three substituents RA. In a more preferred embodiment, the heteroaryl group A is substituted with one or two substituents RA. In an even more preferred embodiment, the heteroaryl group A is substituted with only one substituent RA.

[0194] In another preferred embodiment, the heteroaryl group A is at least substituted with a substituent RArepresented by substituent RA3. In a more preferred embodiment, the heteroaryl group A is substituted with a substituent RArepresented by RA3and two further substituents RArepresented by RA2and RA4, more preferably the heteroaryl group A is substituted with a substituent RArepresented by RA3and one further substituent RArepresented by RA2or RA4. In a particularly preferred embodiment, the heteroaryl group A is substituted with only one substituent RArepresented by RA3. Accordingly, in one embodiment, the heteroaryl group A is a heteroaryl group A* substituted with RA3and two further substituents RA2and RA4. In a preferred embodiment, the heteroaryl group A is a heteroaryl group A* substituted with RA3and one further substituent RA2or RA4. In a particularly preferred embodiment, the heteroaryl group is a heteroaryl group A* substituted only with RA3so that RA2and RA4are absent.

[0195] As indicated above,

[0196] RAis halogen, CN, C-i-Ce-alkyl, C-i-Ce-haloalkyl, or 3- to 10-membered saturated or partially unsaturated carbocyclyl, carbocyclyl-Ci-C2-alkyl, carbobicyclyl, carbobicyclyl-Ci-C2-alkyl, heterocyclyl, heterocyclyl-Ci-C2-alkyl, heterobicyclyl, or heterobicyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic or heterobicyclic rings comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RY; wherein

[0197] RYis Cl, F, or Ci-C4-alkyl.

[0198] In a preferred embodiment,

[0199] RAis Ci-C4-alkyl, Ci-C4-haloalkyl, or 3- to 10-membered saturated carbocyclyl, carbocyclyl-Ci-C2- alkyl, carbobicyclyl, carbobicyclyl-Ci-C2-alkyl, heterocyclyl, heterocyclyl-Ci-C2-alkyl, heterobicyclyl, or heterobicyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic or heterobicyclic rings comprise one or more, preferably one or two, more preferably one, same or different heteroatoms selected from O, N, or S, preferably O or N, wherein said N- and / or S- atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RY; wherein

[0200] RYis Cl, F, or Ci-C4-alkyl; preferably

[0201] RYis Cl, F, or Ci-C2-alkyl; more preferably

[0202] RYis F or CH3; even more preferably

[0203] RYis F.

[0204] In a more preferred embodiment,

[0205] RAis Ci-C4-alkyl, Ci-C4-haloalkyl, 3- to 7-membered saturated carbocyclyl or carbocyclyl-Ci-C2- alkyl, 6- to 8-membered saturated spiro-carbobicyclyl or carbobicyclyl-Ci-C2-alkyl, 3- to 7- membered saturated heterocyclyl or heterocyclyl-Ci-C2-alkyl, or 6- to 8-membered saturated spiro-heterobicyclyl, or heterobicyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic or heterobicyclic rings comprise one or more, preferably one or two, more preferably one, same or different heteroatoms selected from O, N, or S, preferably O or N, wherein said N- and / or S- atoms are independently oxidized or non-oxidized, and wherein each of the aforementioned rings is independently unsubstituted or substituted with one or more, preferably one or two, same or different substituents RY; wherein

[0206] RYis Cl, F, or Ci-C4-alkyl; preferably

[0207] RYis Cl, F, or Ci-C2-alkyl; more preferably

[0208] RYis F or CH3; even more preferably

[0209] RYis F.

[0210] In an even more preferred embodiment,

[0211] RAis Ci-C4-alkyl, Ci-C2-haloalkyl, 3- to 6-membered saturated carbocyclyl or carbocyclyl-Ci-C2- alkyl, 3- to 6-membered saturated heterocyclyl or heterocyclyl-Ci-C2-alkyl, or 7-membered saturated spiro-heterobicyclyl, wherein the aforementioned heterocyclic or heterobicyclic rings comprise one or more, preferably one or two, more preferably one, same or different heteroatoms selected from O, N, or S, preferably O or N, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each of the aforementioned rings is independently unsubstituted or substituted with one or more, preferably one or two, same or different substituents RY; wherein

[0212] RYis Cl, F, or Ci-C4-alkyl; preferably

[0213] RYis Cl, F, or Ci-C2-alkyl; more preferably

[0214] RYis F or CH3; even more preferably

[0215] RYis F.

[0216] In an even more preferred embodiment,

[0217] RAis CH3, CH2CH3, CH2CH2CH3, CH(CH3)2, C(CH3)3, CF3, cyclopropyl, cyclobutyl, oxetanyl, 3- to 6-membered saturated carbocyclyl-Ci-alkyl, or a 7-membered saturated spiro-heterobicyclyl, wherein the aforementioned spiro-heterobicyclic ring comprises one heteroatom selected from O, N, or S, preferably O or N, more preferably O, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each of the aforementioned rings is independently unsubstituted or substituted with one or more, preferably one or two, same or different substituents RY; wherein

[0218] RYis Cl, F, or Ci-C4-alkyl; preferably

[0219] RYis Cl, F, or Ci-C2-alkyl; more preferably

[0220] RYis F or CH3; even more preferably

[0221] RYis F.

[0222] In an even more preferred embodiment,

[0223] RAis any one of the following groups:

[0224] CH3, CH2CH3, CH2CH2CH3, CH(CH3)2, C(CH3)3, CF3, wherein the wavy line in each case marks the connection to the A group. In an even more preferred embodiment, RAis any one of the following groups:

[0225] CH(CH3)2, CF3, wherein the wavy line in each case marks the connection to the A group.

[0226] In an even more preferred embodiment,

[0227] RAis any one of the following groups:

[0228] CH(CH3)2, CF3, or wherein the wavy line marks the connection to the A group.

[0229] In an even more preferred embodiment,

[0230] RAis CH(CH3)2or wherein the wavy line marks the connection to the A group.

[0231] In a particularly preferred embodiment,

[0232] RAis wherein the wavy line marks the connection to the A group.

[0233] The same embodiments defined above for RAalso apply for RA2, RA3, and RA4representing different substituents RAat the heteroaryl group A.

[0234] In particular as regards RA3, the same preferences as described above for RAare relevant.

[0235] Thus, in a preferred embodiment,

[0236] RA3is Ci-C4-alkyl, Ci-C4-haloalkyl, or 3- to 10-membered saturated carbocyclyl, carbocyclyl-Ci-C2- alkyl, carbobicyclyl, carbobicyclyl-Ci-C2-alkyl, heterocyclyl, heterocyclyl-Ci-C2-alkyl, heterobicyclyl, or heterobicyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic or heterobicyclic rings comprise one or more, preferably one or two, more preferably one, same or different heteroatoms selected from O, N, or S, preferably O or N, wherein said N- and / or S- atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RY; wherein

[0237] RYis Cl, F, or Ci-C4-alkyl; preferably RYis Cl, F, or Ci-C2-alkyl; more preferably RYis F or CH3; even more preferably RYis F.

[0238] In a more preferred embodiment,

[0239] RA3is Ci-C4-alkyl, Ci-C4-haloalkyl, 3- to 7-membered saturated carbocyclyl or carbocyclyl-Ci-C2- alkyl, 6- to 8-membered saturated spiro-carbobicyclyl or carbobicyclyl-Ci-C2-alkyl, 3- to 7- membered saturated heterocyclyl or heterocyclyl-Ci-C2-alkyl, or 6- to 8-membered saturated spiro-heterobicyclyl, or heterobicyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic or heterobicyclic rings comprise one or more, preferably one or two, more preferably one, same or different heteroatoms selected from O, N, or S, preferably O or N, wherein said N- and / or S- atoms are independently oxidized or non-oxidized, and wherein each of the aforementioned rings is independently unsubstituted or substituted with one or more, preferably one or two, same or different substituents RY; wherein

[0240] RYis Cl, F, or Ci-C4-alkyl; preferably

[0241] RYis Cl, F, or Ci-C2-alkyl; more preferably RYis F or CH3; even more preferably RYis F.

[0242] In an even more preferred embodiment,

[0243] RA3is Ci-C4-alkyl, Ci-C2-haloalkyl, 3- to 6-membered saturated carbocyclyl or carbocyclyl-Ci-C2- alkyl, 3- to 6-membered saturated heterocyclyl or heterocyclyl-Ci-C2-alkyl, or 7-membered saturated spiro-heterobicyclyl, wherein the aforementioned heterocyclic or heterobicyclic rings comprise one or more, preferably one or two, more preferably one, same or different heteroatoms selected from O, N, or S, preferably O or N, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each of the aforementioned rings is independently unsubstituted or substituted with one or more, preferably one or two, same or different substituents RY; wherein

[0244] RYis Cl, F, or Ci-C4-alkyl; preferably

[0245] RYis Cl, F, or Ci-C2-alkyl; more preferably RYis F or CH3; even more preferably RYis F.

[0246] In an even more preferred embodiment,

[0247] RA3is CH3, CH2CH3, CH2CH2CH3, CH(CH3)2, C(CH3)3, CF3, cyclopropyl, cyclobutyl, oxetanyl, 3- to 6-membered saturated carbocyclyl-Ci-alkyl, or a 7-membered saturated spiro-heterobicyclyl, wherein the aforementioned spiro-heterobicyclic ring comprises one heteroatom selected from O, N, or S, preferably O or N, more preferably O, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each of the aforementioned rings is independently unsubstituted or substituted with one or more, preferably one or two, same or different substituents RY; wherein RYis Cl, F, or Ci-C4-alkyl; preferably

[0248] RYis Cl, F, or Ci-C2-alkyl; more preferably

[0249] RYis F or CH3; even more preferably

[0250] RYis F.

[0251] In an even more preferred embodiment,

[0252] RA3is any one of the following groups:

[0253] CH3, CH2CH3, CH2CH2CH3, CH(CH3)2, C(CH3)3, CF3, wherein the wavy line in each case marks the connection to the A group. In an even more preferred embodiment, RA3is any one of the following groups:

[0254] CH(CH3)2, CF3, wherein the wavy line in each case marks the connection to the A group.

[0255] In an even more preferred embodiment,

[0256] RA3is any one of the following groups:

[0257] CH(CH3)2, CF3, or wherein the wavy line marks the connection to the A group. In an even more preferred embodiment,

[0258] RA3is CH(CH3)2or wherein the wavy line marks the connection to the A group.

[0259] In a particularly preferred embodiment,

[0260] RA3is wherein the wavy line marks the connection to the A group.

[0261] Thus, in one preferred embodiment, RA, in particular RA3, is cyclopropyl, wherein the cyclopropyl ring is unsubstituted or substituted with one or more, preferably one or two, same or different substituents RY, wherein RYis F or CH3, preferably F. In this context, preferably, RA, in particular RA3, is selected from the group consisting of (RA3-1), (RA3-5), (RA3-6), (RA3-6a), (RA3-6b), (RA3-7), (RA3- 7a), (RA3-7b), (RA3-7c), and (RA3-7d).

[0262] In one embodiment, RA, in particular RA3, is unsubstituted cyclopropyl (RA3-1). In another embodiment, RA, in particular RA3, is cyclopropyl substituted with one or more, preferably one or two, same or different substituents RY, wherein RYis F or CH3, preferably F. In this context, RA, in particular RA3, is preferably selected from the group consisting of (RA3-5), (RA3-6), (RA3-6a), (RA3-6b), (RA3-7), (RA3-7a), (RA3-7b), (RA3-7c), and (RA3-7d).

[0263] In another preferred embodiment, RA, in particular RA3, is CH(CH3)2.

[0264] In another preferred embodiment, RA, in particular RA3, is CF3.

[0265] In a more preferred embodiment, RA, in particular RA3, is cyclopropyl, wherein the cyclopropyl ring is unsubstituted or substituted with one or more, preferably one or two, same or different substituents RY, wherein RYis F or CH3, preferably F.

[0266] In a particularly preferred embodiment, RA, in particular RA3, is unsubstituted cyclopropyl, so that RA, in particular RA3, is the following group RA3-1

[0267] Y^ (RA3.-I), wherein the wavy line marks the connection to the A group.

[0268] As regards RA2, if present, the following preferences are further relevant.

[0269] In a preferred embodiment,

[0270] RA2is halogen, CN, Ci-C2-alkyl, or 3- to 10-membered saturated or partially unsaturated carbocyclyl.

[0271] In a more preferred embodiment,

[0272] RA2is Ci-C2-alkyl or 3- to 10-membered saturated or partially unsaturated carbocyclyl.

[0273] In an even more preferred embodiment, RA2is Ci-C2-alkyl.

[0274] In a particularly preferred embodiment, RA2is CH3. As indicated above, it is preferred in connection with the compounds of the present invention that a substituent RA2is not present at the heteroaryl group A or A*.

[0275] As regards RA4, if present, the following preferences are further relevant.

[0276] In a preferred embodiment,

[0277] RA4is halogen, CN, Ci-C2-alkyl, or 3- to 10-membered saturated or partially unsaturated carbocyclyl.

[0278] In a more preferred emodiment,

[0279] RA4is Ci-C2-alkyl or 3- to 10-membered saturated or partially unsaturated carbocyclyl.

[0280] In an even more preferred embodiment,

[0281] RA4is Ci-C2-alkyl.

[0282] In a particularly preferred embodiment,

[0283] RA4is CH3.

[0284] As indicated above, it is preferred in connection with the compounds of the present invention that a substituent RA4is not present at the heteroaryl group A or A*.

[0285] In view of the above, the following meanings for the heteroaryl group A including the respective substituent RA3thereon according to embodiments C-1 to C-6 are preferred.

[0286] Table C

[0287] 20

[0288] Of particular relevance are embodiments C-3 and C-6, in particular C-3.

[0289] Thus, in a preferred embodiment of the invention,

[0290] A is any one of the following heteroaryl groups: wherein the wavy line in each case marks the connection to the remainder of the molecule.

[0291] Thus, in a preferred embodiment, the compound of formula (I) is a compound of formula (la-T1*),

[0292] In one embodiment, the compound of formula (I) is a compound of formula (la-T1*) or (la-T2*):

[0293] In another embodiment, the compound of formula (I) is a compound of formula (lb*):

[0294] Particularly preferred compounds of formula (I) are compounds of formula (la-T1*) or its tautomer (la-T2*). In one particularly preferred embodiment, the compound of formula (I) is a compound of formula (la-T1*). In another particularly preferred embodiment, the compound of formula (I) is a compound of formula (la-T2*).

[0295] In connection with the compounds of formula (I) and the compounds of formula (la-T1), (la-T2), (lb), (la-T1*), (la-T2*), (lb*), preferably the compounds of formula (la-T1), (la-T2), (la-T1*), and (la- 72*), in particular (la-T1*) and (la-T2*), as well as in connection with the preferred embodiments regarding the heteroaryl group A or A* defined above, in particular A1-T1 , A1-T2, A2-T1 , A2-T2, A3, A4, A5, A6, A7, A8, A9, or A10, preferably A 1-T1 , A1-T2, or A10, especially in connection with any of the embodiments C1 to C6 of Table C, in particular A1-T1*, A1-T2*, or A10*, the following preferred embodiments regarding B and the substituents RB1to RB17thereon are relevant.

[0296] As indicated above, in the compounds of formula (I), B is any one of the following groups wherein the wavy line in each case marks the connection to the remainder of the molecule; and wherein each of RB1, RB5, RB6, and RB1° is H; each of RB2to RB4, each of RB7to RB9, each of RB11and RB12, and each of RB15and RB16is independently H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3- C4-cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci- C4-hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci- C4-dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN); provided that at least one of RB2to RB4, one of RB7to RB9, one of RB11and RB12being present, and one of RB15and RB16being present is independently OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, or -Ci-C4-alkyl-NH(RN); and each of RB13, RB14, and RB17is independently OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, C1-C4- hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, or -Ci-C4-alkyl-NH(RN);

[0297] X1is N or CRB6; preferably N;

[0298] Y1is N or CRB7; preferably CRB7;

[0299] Z1is N or CRB8; preferably CRB8; provided that one, but not more than one of X1, Y1, and Z1is N; and

[0300] RNis Ci-C4-alkyl.

[0301] In a more preferred embodiment, B is any one of the following groups wherein the wavy line in each case marks the connection to the remainder of the molecule; and wherein X1, Y1, and Z1and each of RB1to RB14is as defined above or in the preferred embodiments defined below.

[0302] In a more preferred embodiment, B is any one of the following groups wherein the wavy line in each case marks the connection to the remainder of the molecule; and wherein X1, Y1, and Z1and each of RB1to RB14is as defined above or in the preferred embodiments defined below.

[0303] In an even more preferred embodiment, B is any one of the following groups wherein the wavy line in each case marks the connection to the remainder of the molecule; and wherein X1, Y1, and Z1and each of RB1to RB1° is as defined above or in the preferred embodiments defined below.

[0304] In one particularly preferred embodiment, B is wherein the wavy line in each case marks the connection to the remainder of the molecule; and wherein each of RB1to RB5is as defined above or in the preferred embodiments defined below.

[0305] In another particularly preferred embodiment,

[0306] B is wherein the wavy line in each case marks the connection to the remainder of the molecule; and wherein X1, Y1, and Z1and each of RB6to RB1° is as defined above or in the preferred embodiments defined below. Thus, in a preferred embodiment of the invention, the compound of formula (I) is a compound of formula (Ic) or (Id): wherein R1, RB2to RB4, RB7to RB9, and A are as described above for formula (I). Preferably, R1, RB2to RB4, and / or RB7to RB9are as defined in the preferred embodiments below and A is as defined in the preferred embodiments above. In a more preferred embodiment, A is A1 -T1 , A1-T2, or A10, preferably, A1 -T1 or A1 -T2. In a particularly preferred embodiment, A is A1 -T1*, A1-T2*, or A10*, preferably, A1 -T1 * or A1 -T2*.

[0307] In a particularly preferred embodiment, the compound of formula (I) is a compound of formula (Ic).

[0308] In connection with ring B of the compounds of formula (I), in particular in connection with the preferred embodiments for ring B described above, as well as in connection with the compounds of formula (Ic) and (Id), the following preferences regarding the substituents RB2to RB4, RB7to RB9, and RB11to RB17, if present, are relevant.

[0309] As indicated above, each of RB2to RB4, each of RB7to RB9, each of RB11and RB12, and each of RB15and RB16is independently H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3- C4-cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci- C4-hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci- C4-dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN); provided that at least one of RB2to RB4, one of RB7to RB9, one of RB11and RB12being present, and one of RB15and RB16being present is independently OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, or -Ci-C4-alkyl-NH(RN); and each of RB13, RB14, and RB17is independently OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, C1-C4- hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, or -Ci-C4-alkyl-NH(RN).

[0310] In a preferred embodiment, each of RB2to RB4, each of RB7to RB9, each of RB11and RB12, and each of RB15and RB16is independently H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, C(=O)NH2, C(=O)NH(RN), S(O)2OH, S(O)2NH2, S(O)2NH(RN), Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4-hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, C1-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN); provided that at least one of RB2to RB4, one of RB7to RB9, one of RB11and RB12being present, and one of RB15and RB16being present is independently OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, C(=O)NH2, C(=O)NH(RN), S(O)2OH, S(O)2NH2, S(O)2NH(RN), Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, or -Ci-C4-alkyl-NH(RN); and each of RB13, RB14, and RB17is independently OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, C(=O)NH2, C(=O)NH(RN), S(O)2OH, S(O)2NH2, S(O)2NH(RN), Ci-C4-hydroxyalkyl, HS-C1-C4- alkyl-, Ci-C4-aminoalkyl, or -Ci-C4-alkyl-NH(RN).

[0311] In a more preferred embodiment, each of RB2to RB4, each of RB7to RB9, each of RB11and RB12, and each of RB15and RB16, if present, is independently H, Cl, F, CN, N(CH3)2, OH, SH, NH2, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2N(CH3)2, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2or, C(CH3)2NH2; provided that at least one of RB2to RB4, one of RB7to RB9, one of RB11and RB12, and one of RB15and RB16being present is independently OH, SH, NH2, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2or, C(CH3)2NH2; and each of RB13, RB14, and RB17being present is independently OH, SH, NH2, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2or, C(CH3)2NH2.

[0312] In an even more preferred embodiment, each of RB2to RB4, each of RB7to RB9, each of RB11and RB12, and each of RB15and RB16, if present, is independently H, Cl, F, CN, N(CH3)2, OH, NH2, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, or CH2NH2; provided that at least one of RB2to RB4, one of RB7to RB9, one of RB11and RB12, and one of RB15and RB16being present is independently OH, NH2, CH2OH, CH(CH3)OH, C(CH3)2OH, or CH2NH2; and each of RB13, RB14, and RB17being present is independently OH, NH2, CH2OH, CH(CH3)OH, C(CH3)2OH, or CH2NH2.

[0313] Accordingly, each substructure B1 to B1 1 defined for ring B, and thus ring B, is substituted with at least one substituent selected from the group consisting of OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, C1-C4- hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, and -Ci-C4-alkyl-NH(RN); preferably, each substructure B1 to B1 1 defined for ring B, and thus ring B, is substituted with at least one substituent selected from the group consisting of OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, C(=O)NH2, C(=O)NH(RN), S(O)2OH, S(O)2NH2, S(O)2NH(RN), Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, and -Ci-C4-alkyl-NH(RN); more preferably, each substructure B1 to B1 1 defined for ring B, and thus ring B, is substituted with at least one substituent selected from the group consisting of OH, SH, NH2, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, and C(CH3)2NH2; even more preferably, each substructure B1 to B1 1 defined for ring B, and thus ring B, is substituted with at least one substituent selected from the group consisting of OH, NH2, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2NH2, and C(CH3)2NH2. even more preferably, each substructure B1 to B1 1 defined for ring B, and thus ring B, is substituted with at least one substituent selected from the group consisting of OH, NH2, CH2OH, and CH2NH2.

[0314] Further, in connection with RB2to RB4, RB7to RB9, and RB11to RB17, the following preferences regarding RNare relevant.

[0315] As indicated above, RNis Ci-C4-alkyl. In a preferred embodiment,

[0316] RNis Ci-C2-alkyl.

[0317] In a particularly preferred embodiment,

[0318] RNis CH3.

[0319] As regards RB2, RB3, and RB4of B1 , in particular in the preferred embodiments for ring B of the compounds of formula (I) defined above, as well as the compounds of formula (Ic), the following preferences are particularly relevant.

[0320] In a preferred embodiment,

[0321] RB2is H, Cl, F, CN, N(CH3)2, OH, SH, NH2, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2SH, C(CH3)2SH, CH2N(CH3)2, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2NH2, or C(CH3)2NH2;

[0322] RB3is H, Cl, F, CN, N(CH3)2, OH, SH, NH2, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2SH, C(CH3)2SH, CH2N(CH3)2, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2NH2, or C(CH3)2NH2;

[0323] RB4is H, Cl, F, CN, N(CH3)2, OH, SH, NH2, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2SH, C(CH3)2SH, CH2N(CH3)2, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2NH2, or C(CH3)2NH2; provided that at least one of RB2, RB3, and RB4is OH, SH, NH2, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2.

[0324] In a more preferred embodiment,

[0325] RB2is H, Cl, F, CN, OH, SH, NH2, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;

[0326] RB3is H, Cl, F, CN, OH, SH, NH2, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;

[0327] RB4is H, Cl, F, CN, OH, SH, NH2, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2; provided that at least one of RB2, RB3, and RB4is OH, SH, NH2, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2.

[0328] In an even more preferred embodiment,

[0329] RB2is H, Cl, F, CN, OH, SH, NH2, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH2SH, or CH2NH2;

[0330] RB3is H, Cl, F, CN, OH, SH, NH2, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH2SH, or CH2NH2;

[0331] RB4is H, Cl, F, CN, OH, SH, NH2, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH2SH, or CH2NH2; provided that at least one of RB2, RB3, and RB4is OH, SH, NH2, CH2OH, CH2SH, or CH2NH2.

[0332] In another even more preferred embodiment,

[0333] RB2is OH, NH2, SH, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or

[0334] C(CH3)2NH2;

[0335] RB3is H;

[0336] RB4is H or Cl.

[0337] In an even more preferred embodiment,

[0338] RB2is OH, NH2, CH2OH or CH2NH2;

[0339] RB3is H;

[0340] RB4is H or Cl.

[0341] In one particularly preferred embodiment,

[0342] RB2is OH.

[0343] In another particularly preferred embodiment,

[0344] RB2is NH2.

[0345] In another particularly preferred embodiment,

[0346] RB2is CH2OH.

[0347] In another particularly preferred embodiment,

[0348] RB2is C(CH3)2OH. Preferably, if B is B1 , in particular in the preferred embodiments for B defined above, B1 is any one of the following groups wherein the wavy line in each case marks the connection to the remainder of the molecule; and wherein

[0349] RB2, if present, is Cl, F, CN, N(CH3)2, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2N(CH3)2, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;

[0350] RB3, if present, is Cl, F, CN, N(CH3)2, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2N(CH3)2, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;

[0351] RB4, if present, is Cl, F, CN, N(CH3)2, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2N(CH3)2, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2; provided that at least one of RB2, RB3, and RB4being present is OH, NH2, SH, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2; preferably,

[0352] RB2, if present, is Cl, F, CN, OH, NH2, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, or CH2NH2;

[0353] RB3, if present, is Cl, F, CN, OH, NH2, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, or CH2NH2;

[0354] RB4, if present, is Cl, F, CN, OH, NH2, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, or CH2NH2; provided that at least one of RB2, RB3, and RB4being present is OH, NH2, CH2OH, or CH2NH2; more preferably,

[0355] RB2, if present, is OH, NH2, CH2OH, or CH2NH2;

[0356] RB3, if present, is Cl, F, CN, OH, NH2, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, or CH2NH2;

[0357] RB4, if present, is Cl; provided that at least one of RB2, RB3, and RB4being present is OH, NH2, CH2OH, or CH2NH2.

[0358] In a particularly preferred embodiment, B1 is B1 -a. In another particularly preferred embodiment B1 is B1 -c.

[0359] In one preferred embodiment of the invention, B is thus a group B1 -a wherein the wavy line marks the connection to the remainder of the molecule; and wherein RB2is OH, NH2, NH(RN), SH, C(=O)OH, C(=O)NH2, C(=O)NH(RN), S(O)2OH, S(O)2NH2, S(O)2NH(RN), Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, or -Ci-C4-alkyl-NH(RN); and

[0360] RB4is Cl, F, CN, N(CH3)2, CH3, CHF2, CF3, OCH3, CH2OCH3, or CH2N(CH3)2; preferably RB2is OH, NH2, SH, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2; and

[0361] RB4is Cl, F, CN, N(CH3)2, CH3, CHF2, CF3, OCH3, CH2OCH3, or CH2N(CH3)2; more preferably

[0362] RB2is OH, NH2, CH2OH, or CH2NH2; and

[0363] RB4is Cl.

[0364] In one particularly preferred embodiment, B is the following group wherein the wavy line marks the connection to the remainder of the molecule.

[0365] In another preferred embodiment of the invention, B is thus a group B1-c wherein the wavy line marks the connection to the remainder of the molecule; and wherein

[0366] RB2is OH, NH2, NH(RN), SH, C(=O)OH, C(=O)NH2, C(=O)NH(RN), S(O)2OH, S(O)2NH2,

[0367] S(O)2NH(RN), Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, or -Ci-C4-alkyl-NH(RN); preferably

[0368] RB2is OH, NH2, SH, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or

[0369] C(CH3)2NH2; more preferably

[0370] RB2is OH, NH2, CH2OH, or CH2NH2.

[0371] In one particularly preferred embodiment, B is the following group wherein the wavy line marks the connection to the remainder of the molecule.

[0372] In another particularly preferred embodiment, B is the following group wherein the wavy line marks the connection to the remainder of the molecule. In another particularly preferred embodiment, B is the following group wherein the wavy line marks the connection to the remainder of the molecule.

[0373] In another particularly preferred embodiment, B is the following groupNH2 (B1-C-4), wherein the wavy line marks the connection to the remainder of the molecule.

[0374] As regards X1, Y1, Z1and RB7, RB8, and RB9of the pyridinyl group B2 as ring B, in particular in any of the preferred embodiments of ring B defined above, as well as of the compounds of formula (Id), the following preferences are particularly relevant.

[0375] As indicated above, it is preferred in connection with B, in particular B2, that X1is N. Accordingly, preferably Y1is CRB7and Z1is CRB8and the pyridinyl group B2 is preferably the pyridinyl group B2*: wherein the wavy line marks the connection to the remainder of the molecule.

[0376] As regards the substituents RB7, RB8, and RB9of B2 and B2*, as well as of the compounds of formula (Id), it is preferred that

[0377] RB7is H, Cl, F, CN, N(CH3)2, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2N(CH3)2, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;

[0378] RB8is H, Cl, F, CN, N(CH3)2, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2N(CH3)2, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;

[0379] RB9is H, Cl, F, CN, N(CH3)2, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2N(CH3)2,

[0380] CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2; provided that at least one of RB7, RB8, and RB9is OH, NH2, SH, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2.

[0381] In a more preferred embodiment,

[0382] RB7is H, CN, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;

[0383] RB8is H, CN, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;

[0384] RB9is H, CN, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2; provided that at least one of RB7, RB8, and RB9is OH, NH2, SH, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2.

[0385] In an even more preferred embodiment,

[0386] RB7is H, OH, NH2, CH3, OCH3, CH2OH, or CH2NH2;

[0387] RB8is H, OH, NH2, CH3, OCH3, CH2OH, or CH2NH2;

[0388] RB9is H, OH, NH2, CH3, OCH3, CH2OH, or CH2NH2; provided that at least one of RB7, RB8, and RB9is OH, NH2, CH2OH, or CH2NH2.

[0389] Preferably, if B is B2 or B2*, in particular in any of the preferred embodiments for B defined above, B2 or B2* is any one of the following groups wherein the wavy line in each case marks the connection to the remainder of the molecule; and wherein

[0390] RB7, if present, is Cl, F, CN, N(CH3)2, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2N(CH3)2, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;

[0391] RB8, if present, is Cl, F, CN, N(CH3)2, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2N(CH3)2, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;

[0392] RB9, if present, is Cl, F, CN, N(CH3)2, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2N(CH3)2, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2; provided that at least one of RB7, RB8, and RB9being present is OH, NH2, SH, CH2OH, CH(CH3)OH,

[0393] C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2; preferably,

[0394] RB7, if present, is CN, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;

[0395] RB8, if present, is CN, OH, SH, NH2, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;

[0396] RB9, if present, is CN, OH, SH, NH2, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2; provided that at least one of RB7, RB8, and RB9being present is OH, NH2, SH, CH2OH, CH(CH3)OH,

[0397] C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2. more preferably,

[0398] RB7, if present, is OH, NH2, CH3, OCH3, CH2OH, or CH2NH2;

[0399] RB8, if present, is OH, NH2, CH3, OCH3, CH2OH, or CH2NH2;

[0400] RB9, if present, is OH, NH2, CH3, OCH3, CH2OH, or CH2NH2; provided that at least one of RB7, RB8, and RB9is OH, NH2, CH2OH, or CH2NH2.

[0401] As regards RB11of the thiazole group B3, the following preferences are relevant.

[0402] In a preferred embodiment,

[0403] RB11is OH, NH2, SH, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2.

[0404] In a more preferred embodiment,

[0405] RB11is OH, NH2, CH2OH, or CH2NH2.

[0406] As regards RB12of the thiazole group B4, the following preferences are relevant.

[0407] In a preferred embodiment, RB12is OH, NH2, SH, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2.

[0408] In a more preferred embodiment,

[0409] RB12is OH, NH2, CH2OH, or CH2NH2.

[0410] As regards RB13of the thiazole group B5, the following preferences are relevant.

[0411] In a preferred embodiment,

[0412] RB13is OH, NH2, SH, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2.

[0413] In a more preferred embodiment,

[0414] RB13is OH, NH2, CH2OH, or CH2NH2.

[0415] As regards RB14of the thiazole group B6, the following preferences are relevant.

[0416] In a preferred embodiment,

[0417] RB14is OH, NH2, SH, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2.

[0418] In a more preferred embodiment,

[0419] RB14is OH, NH2, CH2OH, or CH2NH2.

[0420] As regards RB11and RB12of the thiazole group B10, the following preferences are relevant.

[0421] In a preferred embodiment,

[0422] RB11is H, Cl, F, ON, N(CH3)2, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2N(CH3)2, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;

[0423] RB12is H, Cl, F, CN, N(CH3)2, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2N(CH3)2, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2; provided that at least one of RB11and RB12being present is OH, NH2, SH, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2.

[0424] In a more preferred embodiment,

[0425] RB11is H, Cl, F, CN, OH, NH2, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, or CH2NH2;

[0426] RB12is H, Cl, F, CN, OH, NH2, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, or CH2NH2; provided that at least one of RB11and RB12being present is OH, NH2, CH2OH, or CH2NH2.

[0427] As regards RB15of the thiophene group B7, the following preferences are relevant.

[0428] In a preferred embodiment,

[0429] RB15is OH, NH2, SH, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2.

[0430] In a more preferred embodiment,

[0431] RB15is OH, NH2, CH2OH, or CH2NH2.

[0432] As regards RB16of the thiophene group B8, the following preferences are relevant.

[0433] In a preferred embodiment,

[0434] RB16is OH, NH2, SH, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2.

[0435] In a more preferred embodiment,

[0436] RB16is OH, NH2, CH2OH, or CH2NH2.

[0437] As regards RB17of the thiophene group B9, the following preferences are relevant.

[0438] In a preferred embodiment,

[0439] RB17is OH, NH2, SH, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2.

[0440] In a more preferred embodiment,

[0441] RB17is OH, NH2, CH2OH, or CH2NH2.

[0442] As regards RB15and RB16of the thiophene group B11 , the following preferences are relevant.

[0443] In a preferred embodiment, RB15is H, Cl, F, CN, N(CH3)2, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2N(CH3)2, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;

[0444] RB16is H, Cl, F, CN, N(CH3)2, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2N(CH3)2, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;

[0445] Provided that at least one of RB15and RB16being present is OH, NH2, SH, CH2OH, CH(CH3)OH,

[0446] C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2.

[0447] In a more preferred embodiment,

[0448] RB15is H, Cl, F, CN, OH, NH2, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, or CH2NH2;

[0449] RB16is H, Cl, F, CN, OH, NH2, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, or CH2NH2; provided that at least one of RB15and RB16being present is OH, NH2, CH2OH, or CH2NH2.

[0450] Overall, in a preferred embodiment of the present invention, B is the group B1-a or B1-c wherein the wavy line in each case marks the connection to the remainder of the molecule; and wherein RB2and RB4are as defined above for B1-a and B1-c. In one particularly preferred embodiment of the invention, B is B1-a. In another particularly preferred embodiment of the invention, B is B1-c.

[0451] In a preferred embodiment of the invention, the compound of formula (I) is thus a compound of formula wherein R1, RB2, RB4, and A are as described above for formula (I). Preferably, R1is as defined in the preferred embodiments below and A and / or RB2are as defined in the preferred embodiments above. In a preferred embodiment, A is A1-T1 , A1-T2, orA10, preferably, A1-T1 orA1-T2. In a particularly preferred embodiment, A is A1-T1*, A1-T2*, or A10*, preferably, A1-T1* or A1-T2*. In one particularly preferred embodiment, the compound of formula (I) is a compound of formula (lc-1). In another particularly preferred embodiment, the compound of formula (I) is a compound of formula (lc-2).

[0452] In particularly preferred embodiments,

[0453] B is a moiety selected from the group consisting of wherein the wavy line in each case marks the connection to the remainder of the molecule.

[0454] In connection with the compounds of formula (I) and the compounds of formula (la-T1), (la-T2), (lb), (la-T1*), (la-T2*), (lb*), (Ic), (Id), (lc-1), and (lc-2), in particular the compounds of formula (la-T1*), (la-T2*), and (lc-2), as well as in connection with the preferred embodiments regarding the heteroaryl group A or A* defined above, in particular A1-T1 , A1-T2, A2-T1 , A2-T2, A3, A4, A5, A6, A7, A8, A9, or A10, preferably A1 -T1 , A1 -T2, or A10, especially any one of embodiments C1 to C6 of Table C, in particular A1-T1* and A1-T2*, as well as in connection with the preferred embodiments of B defined above, in particular B1 -a, B1-b, B1-c, B1-d, B2*-a, B2*-b, B2*-c, B2*-d, B2*-e, B2*-f, B2*-g, B3, B4, B5, and B6, in particular B1-a and B1-c, especially B1 -a-1 , B1-C-1 , B1-C-2, B1-C-3, and B1-C-4, the following preferred embodiments regarding the substituents R1are relevant.

[0455] As indicated above, in the compounds of formula (I), R1is H or Ci-C4-alkyl.

[0456] In a preferred embodiment,

[0457] R1is H or Ci-C2-alkyl.

[0458] In a more preferred embodiment,

[0459] R1is H or CH3.

[0460] In one preferred embodiment of the invention, R1is H.

[0461] In another preferred embodiment of the invention, R1is Ci-C4-alkyl.

[0462] In a more preferred embodiment,

[0463] R1is Ci-C2-alkyl.

[0464] In a particularly preferred embodiment,

[0465] R1is CH3.

[0466] If R1is not H, in one embodiment of the invention, the compound of formula (I) is a compound of formula (IA) wherein A and B are as defined above for formula (I), preferably as defined in the preferred embodiments above, and R1is Ci-C4-alkyl, preferably Ci-C2-alkyl, more preferably CH3.

[0467] In one embodiment, it is preferred in connection with the compounds of formula (IA) that A is A1 -T1 , A1-T2, or A10, especially any one of embodiments C1 to C6 of Table C, preferably A1-T1*, A1-T2*, or A10*, in particular A1-T1* or A1-T2*. In another preferred embodiment, it is preferred in connection with the compounds of formula (IA) that B is any one of B1-a, B1-b, B1-c, B1-d, B2*-a, B2*-b, B2*-c, B2*-d, B2*-e, B2*-f, B2*-g, B3, B4, B5, or B6, in particular B1-a or B1-c, especially B1- a-1 , B1-C-1 , B1-C-2, B1-C-3, or B1-c-4.

[0468] In another embodiment of the invention, if R1is not H, the compound of formula (I) is a compound of formula (IB) wherein A and B are as defined above for formula (I), preferably as defined in the preferred embodiments above, and R1is Ci-C4-alkyl, preferably Ci-C2-alkyl, more preferably CH3.

[0469] In one embodiment, it is preferred in connection with the compounds of formula (IB) that A is A1-T1 ,

[0470] A1-T2, or A10, especially any one of embodiments C1 to C6 of Table C, preferably A1-T1*, A1-T2*, or A10*, in particular A1-T1* or A1-T2*. In another preferred embodiment, it is preferred in connection with the compounds of formula (IB) that B is any one of B1-a, B1-b, B1-c, B1-d, B2*-a, B2*-b, B2*-c, B2*-d, B2*-e, B2*-f, B2*-g, B3, B4, B5, or B6, in particular B1-a or B1-c, especially B1- a-1 , B1-C-1 , B1-C-2, B1-C-3, or B1-c-4.

[0471] In a particularly preferred embodiment of the invention, the compound of formula (I) is selected from the group consisting of

[0472] N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-(3-(2-hydroxypropan-2-yl)phenyl)-1 H-pyrazol-4- yl)acetamide,

[0473] N-(3-cyclopropyl-1 H-pyrazol-5-yl)-2-(1-(3-(2-hydroxypropan-2-yl)phenyl)-1 H-pyrazol-4- yl)acetamide,

[0474] 2-(1-(3-aminophenyl)-1 H-pyrazol-4-yl)-N-(5-cyclopropyl-1 H-pyrazol-3-yl)acetamide,

[0475] 2-(1-(3-aminophenyl)-1 H-pyrazol-4-yl)-N-(3-cyclopropyl-1 H-pyrazol-5-yl)acetamide, 2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-(trifluoromethyl)thiazol-2-yl)acetamide, 2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-isopropyl-1 H-pyrazol-3-yl)acetamide, 2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(3-isopropyl-1 H-pyrazol-5-yl)acetamide, N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-(3-hydroxyphenyl)-1 H-pyrazol-4-yl)acetamide, N-(3-cyclopropyl-1 H-pyrazol-5-yl)-2-(1-(3-hydroxyphenyl)-1 H-pyrazol-4-yl)acetamide, 2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-isopropylthiazol-2-yl)acetamide, N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)acetamide, N-(3-cyclopropyl-1 H-pyrazol-5-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)acetamide, and N-(5-cyclopropyl-1 ,3-thiazol-2-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)acetamide.

[0476] In another particularly preferred embodiment of the invention, the compound of formula (I) is selected from the group consisting of

[0477] (S)-N-(5-cyclopropylthiazol-2-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanamide,

[0478] (R)-N-(5-cyclopropylthiazol-2-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanamide, N-(5-cyclopropylthiazol-2-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)pro panamide,

[0479] (S)-N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4- yl)propanamide,

[0480] (R)-N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4- yl)propanamide,

[0481] N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanamide,

[0482] (S)-N-(3-cyclopropyl-1 H-pyrazol-5-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4- yl)propanamide,

[0483] (R)-N-(3-cyclopropyl-1 H-pyrazol-5-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4- yl)propanamide,

[0484] N-(3-cyclopropyl-1 H-pyrazol-5-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanamide,

[0485] (S)-2-(1-(3-chloro-5-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-cyclopropylthiazol-2- yl)propanamide, (R)-2-(1-(3-chloro-5-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-cyclopropylthiazol-2- yl)propanamide,

[0486] 2-(1-(3-chloro-5-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-cyclopropylthiazol-2- yl)propanamide,

[0487] 2-(1-(3-chloro-5-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-cyclopropyl-1 H-pyrazol-3- yl)propanamide, and

[0488] 2-(1-(3-chloro-5-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(3-cyclopropyl-1 H-pyrazol-5- yl)propanamide.

[0489] In a particularly preferred embodiment of the invention, the compound of formula (I) is selected

[0490] In another particularly preferred embodiment of the invention, the compound of formula (I) is selected from the group consisting of

[0491] 1.1. The second aspect

[0492] The compound of the first aspect of the present invention can be covalently conjugated to a further moiety and in particular to a linker, which compound-linker construct is the second aspect of the present invention.

[0493] The covalent attachment of a compound of the present invention to a linker may mask the compound from the host’s immune system (reducing immunogenicity and antigenicity) and increase its hydrodynamic size (the size in solution), which prolongs its circulation time by reducing renal clearance. Additionally, the water solubility of the compound of the present invention may be positively influenced, in particular by the use of a linker with hydrophilic groups. The compound-linker construct may be internalized by a cell, typically via a lysosome, where specific environmental differences compared to the environment outside the lysosome, in particular the redox potential, the presence of an enzyme (in particular a protease), and pH are present, which result in the cleavage of the linker comprised in the conjugate.

[0494] The compound of the present invention can still be effective inside cells because, as outlined below in more detail, it is preferred that the linker is cleavable such that in essence the compound of the present invention is provided after this cleavage and will act as molecular glue degrader inside the cell of interest, thereby inducing the degradation of CCNK and / or CDK12 and / or CDK13.

[0495] Thus, in the second aspect, the present invention relates to a compound-linker construct comprising

[0496] (i) a compound of formula (I) as defined in the first aspect; and

[0497] (ii) a linker L.

[0498] As regards the compound of formula (I), all embodiments outlined above for the first aspect apply for the second aspect as well, in particular the embodiments, wherein ring A, ring B, and R1are as defined in the preferred embodiments of the first aspect.

[0499] The linker L is preferably a cleavable linker. Cleavable linkers include linkers that are cleaved by intracellular metabolism following internalization (in most cases via a lysosome), e.g., cleavage via hydrolysis, reduction, or enzymatic reaction. Preferred cleavable linkers are e.g. acid-labile linkers, hydrolysis-labile linkers, enzymatically cleavable linkers, reduction labile linkers, or self-immolative linkers. It can be especially preferred that such cleavable linkers are traceless cleavable linkers, wherein such traceless cleavable linkers upon cleavage of a compound-linker construct comprising a compound of formula (I) release a compound of formula (I) as defined in the first aspect.

[0500] Preferably, the compound-linker construct according to the invention comprises the compound of formula (I) covalently bonded to the linker L.

[0501] In connection with the compound-linker constructs, it is to be understood that the covalent bond between the compound of formula (I) and the linker L is established by replacing one or more atoms, preferably a hydrogen atom or a leaving group, more preferably a hydrogen atom, of the compound of formula (I) with the linker L. Accordingly, the skilled person will understand that when it is referred to the compound of formula (I) comprised in the compound-linker construct, in particular a compound of formula (I) covalently bonded to a linker L, it is referred to a compound of formula (I) as defined herein in the first aspect but missing one or more atoms, preferably missing a hydrogen atom or a leaving group.

[0502] In a preferred embodiment, the linker L is covalently bonded to ring B of the compound of formula (I). In particular, the linker L may be covalently bonded to ring B of the compound of formula (I) by replacing a hydrogen atom or a leaving group of one or more, preferably one, of RB1to RB17present in the compound of formula (I), with the linker L.

[0503] In a more preferred embodiment, the linker L is covalently bonded to ring B of the compound of formula (I) by replacing a hydrogen atom or a leaving group of one or more, preferably one, of RB2to RB4, RB7to RB9, or RB11to RB17present in the compound of formula (I), with the linker L.

[0504] In an even more preferred embodiment, the linker L is covalently bonded to ring B of the compounds of formula (I) by replacing a hydrogen atom or a leaving group of one or more, preferably one, of RB2to RB4, RB7to RB9, or RB11to RB17present in the compound of formula (I), with the linker L, wherein the one or more, preferably one, of RB2to RB4, RB7to RB9, or RB11to RB17is selected from the group consisting of

[0505] H, OH, NH2, NH(RN), SH, C(=O)OH, C(=O)NH2, C(=O)NH(RN), S(O)2OH, S(O)2NH2, S(O)2NH(RN), Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, and -Ci-C4-alkyl-NH(RN); preferably OH, NH2, Ci-C4-hydroxyalkyl, and Ci-C4-aminoalkyl; more preferably OH, NH2, CH2OH, and CH2NH2.

[0506] Thus, in one preferred embodiment, the compound-linker construct is a compound of formula (I), wherein one or more, preferably one, of RB2to RB4, RB7to RB9, or RB11to RB17present in the compound of formula (I) is independently selected from the group consisting of

[0507] -L, -O-L, -NH-L, -N(RN)-L, -S-L, -C(=O)O-L, -C(=O)NH-L, -C(=O)N(RN)-L, -C(=O)-L, -S(=O)2O-L, - S(=O)2NH-L, -S(=O)2N(RN)-L, -S(=O)2-L, -Ci-C4-alkyl-O-L, -Ci-C4-alkyl-S-L, -Ci-C4-alkyl-NH-L, and -Ci-C4-alkyl-N(RN)-L; preferably -L, -O-L, -NH-L, -Ci-C4-alkyl-O-L, and -Ci-C4-alkyl-NH-L; more preferably -O-L, -NH-L, -CH2O-L, and -CH2NH-L.

[0508] As regards the linker L of the compound-linker construct of the present invention, the following embodiments are applicable.

[0509] In general, the linker L can be any moiety that is covalently bonded to a compound of formula (I), in particular to ring B, preferably to one of RB2to RB4, RB7to RB9, or RB11to RB17, and that preferably comprises a group suitable for forming a covalent bond with a targeting moiety T.

[0510] In one embodiment, the linker L of the compound-linker construct comprises

[0511] (11.1) one or more, preferably one, same or different linking unit(s) L1covalently bonded to ring B of a compound of formula (I) by replacing a hydrogen atom or a leaving group of one or more, preferably one, of RB2to RB4, RB7to RB9, or RB11to RB17present in the compound of formula (I), wherein the one or more, preferably one, of RB2to RB4, RB7to RB9, or RB11to RB17is selected from the group consisting of H, OH, NH2, NH(RN), SH, C(=O)OH, C(=O)NH2, C(=O)NH(RN), S(O)2OH, S(O)2NH2, S(O)2NH(RN), Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, and -Ci-C4-alkyl-NH(RN); preferably OH, NH2, SH, Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, and Ci-C4-aminoalkyl; more preferably OH, NH2, SH, CH2OH, CH2SH, and CH2NH2; even more preferably OH, NH2, CH2OH, and CH2NH2; thereby forming together with said one or more, preferably one, of RB2to RB4, RB7to RB9, or RB11to RB17a connecting unit L1a;

[0512] (11.2) one or more, preferably one, same or different functional group(s) FG1suitable for forming a covalent bond to a targeting moiety T, and

[0513] (11.3) optionally one or more, same or different, spacer units L1bconnecting the one or more, preferably one, same or different connecting units L1aand one or more, preferably one, same or different functional groups FG1.

[0514] In one embodiment, the compound-linker construct may thus be represented by the following formula:

[0515] (l)-L1a-(L1b)n-FG1, wherein

[0516] (I) refers to the compound of formula (I) as defined herein, wherein one or more, preferably one, of RB2to RB4, RB7to RB9, or RB11to RB17present in the compound of formula (I) is replaced by a moiety -L1a-(L1b)n-FG1, which may be the same or different; wherein said one or more, preferably one, of RB2to RB4, RB7to RB9, or RB11to RB17is preferably independently selected from the group consisting of H, OH, NH2, NH(RN), SH, C(=O)OH, C(=O)NH2, C(=O)NH(RN), S(O)2OH, S(O)2NH2, S(O)2NH(RN), Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, and -Ci-C4-alkyl-NH(RN); preferably OH, NH2, SH, C1-C4- hydroxyalkyl, HS-Ci-C4-alkyl-, and Ci-C4-aminoalkyl; more preferably OH, NH2, SH, CH2OH, CH2SH, and CH2NH2; even more preferably OH, NH2, CH2OH, and CH2NH2;

[0517] L1ais a connecting unit L1a,

[0518] L1bis a spacer moiety L1b, wherein, if n is greater than 1 , L1bmay be the same or different in each repeating unit; n is an integer ranging from 0 to 10, and

[0519] FG1is a functional group FG1suitable for forming a covalent bond to a targeting moiety T.

[0520] As regards the connecting unit(s) L1acovalently bonded to a compound of formula (I), in particular to ring B, preferably at the position of one of RB2to RB4, RB7to RB9, or RB11to RB17, it is to be understood that the preferred meaning of said connecting unit(s) L1adepends on the substituent RB2to RB4, RB7to RB9, or RB11to RB17since the connecting unit L1ais established by the reaction of said substituents of the compounds of formula (I) or a precursor thereof with a functional group of a precursor of the linker L, thereby establishing a covalent bonding between the compound of formula (I) and the remainder of the linker L through the connecting moiety L1a.

[0521] In other words, the connecting unit L1acan be considered as a functional moiety established by the reaction of one of RB2to RB4, RB7to RB9, or RB11to RB17, or a precursor thereof with a functional group of the precursor of the linker; wherein said one of RB2to RB4, RB7to RB9, or RB11to RB17is preferably selected from the group consisting of H, OH, NH2, NH(RN), SH, C(=O)OH, C(=O)NH2, C(=O)NH(RN), S(O)2OH, S(O)2NH2, S(O)2NH(RN), Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, and -Ci-C4-alkyl-NH(RN); preferably OH, NH2, SH, Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, and Ci-C4-aminoalkyl; more preferably OH, NH2, SH, CH2OH, CH2SH, and CH2NH2; even more preferably OH, NH2, CH2OH, and CH2NH2.

[0522] In one embodiment, L1ais thus selected from the group consisting of

[0523] -X4-, and

[0524] -Ci-C4-alkyl-X4-, wherein

[0525] X4is -O-, -S-, -NH-, -N(RL)-, -OC(=O)-, -C(=O)O-, -SC(=O)-, -C(=O)S-, -NHC(=O)-, -C(=O)NH-, - N(RL)C(=O)-, -C(=O)N(RL)-, -NHS(=O)2-, -S(=O)2NH-, -N(RL)S(=O)2-, -S(=O)2N(RL)-, -C(=O)-, -S(=O)-, -S(=O)2-, -OC(=O)O-, -NHC(=O)O-, -OC(=O)NH-, -NHC(=O)NH-, -N(RL)C(=O)O-, - OC(=O)N(RL)-, -N(RL)C(=O)NH-, -NHC(=O)N(RL)-, or -N(RL)C(=0)N(RL)-; and

[0526] RLis H or Ci-C4-alkyl, preferably H or Ci-C2-alkyl, more preferably H or CH3.

[0527] Accordingly, in one preferred embodiment, the compound-linker construct is a compound of formula (I), wherein one or more, preferably one, of RB2to RB4, RB7to RB9, or RB11to RB17present in the compound of formula (I) is independently selected from the group consisting of -X4-(L1b)n-FG1, and -Ci-C4-alkyl-X4-(L1b)n-FG1, wherein

[0528] X4is -O-, -S-, -NH-, -N(RL)-, -OC(=O)-, -C(=O)O-, -SC(=O)-, -C(=O)S-, -NHC(=O)-, -C(=O)NH-, - N(RL)C(=O)-, -C(=O)N(RL)-, -NHS(=O)2-, -S(=O)2NH-, -N(RL)S(=O)2-, -S(=O)2N(RL)-, -C(=O)-, -S(=O)-, -S(=O)2-, -OC(=O)O-, -NHC(=O)O-, -OC(=O)NH-, -NHC(=O)NH-, -N(RL)C(=O)O-, - OC(=O)N(RL)-, -N(RL)C(=O)NH-, -NHC(=O)N(RL)-, or -N(RL)C(=G)N(RL)-,

[0529] RLis H or Ci-C4-alkyl, preferably H or Ci-C2-alkyl, more preferably H or CH3, L1bis a spacer moiety L1b, wherein, if n is greater than 1 , L1bmay be the same or different in each repeating unit; n is an integer ranging from 0 to 10, m is an integer ranging from 0 to 5, and

[0530] FG1is a functional group suitable for forming a covalent bond to a targeting moiety T.

[0531] As regards the optional one or more spacer units L1bin the linker L of the compound-linker construct or the conjugate described below, the following embodiments are applicable.

[0532] In one embodiment, the linker L comprises at least one spacer unit L1b. In a preferred embodiment, at least one spacer unit present in the linker is cleavable in the cell.

[0533] The spacer units L1bcan be any unit suitable for connecting the connecting unit L1awith the functional group FG1of the linker L or with the connecting unit L1cbetween the linker L and the targeting moiety T of the conjugates described below.

[0534] In one embodiment, each of L1bis independently selected from the group consisting of polyethylene glycol (PEG) units, Ci-C -alkylene units, amino acids, dipeptides, carbohydrates, glucuronides, hydrazones, valine-citrulline units, para-aminobenzyloxy (PAB) units, and C1-C10- alkylene units, wherein one or more -CH2- units are replaced by a group independently selected from -N(RL)C(=O)O-, -OC(=O)N(RL)-, -C=C-, -C=C-, -O-, -S-, -N(RL)-, -N(RL)C(=O)-, -C(=O)N(RL)-, - N(RL)C(=O)N(RL)-, -OC(=O)-, -OC(=O)O-, -C(=O)O-, -N(RL)S(=O)2-, -S(=O)2N(RL)-, -C(=O)-, -O- CH2-C(=O)N(RL)-, -N(RL)-CH2-C(=O)N(RL)-, -O-CH2-C(=O)O-, -N(RL)-CH2-C(=O)O-, -S(=O)-, - S(=O)2-, or a 4- to 10-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl, or heterocyclyl, wherein the aforementioned heterocyclyl ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized; and wherein each substitutable carbon or heteroatom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents selected from halogen, -OH, -NH2, -NO2, -CN, -C-i-Ce-alkyl, C-i-Ce-alkoxy-, C-i-Ce-alkylamino-, -C1-C4- haloalkyl, -Ci-C4-hydroxyalkyl, -Ci-C4-aminoalkyl, or -Ci-C4-cyanoalkyl; and wherein RLis H or Ci-C4-alkyl, preferably H or Ci-C2-alkyl, more preferably H or CHs.

[0535] As indicated above, the linker L comprises one or more functional groups FG1suitable for forming a covalent bond to a targeting moiety T.

[0536] The preferred substituent meanings for FG1depend on the functional group of the targeting moiety T to which the linker L is intended to be covalently attached, since the covalent bond between the linker L and the targeting moiety T is established by the reaction of a functional group of the targeting moiety T with the functional group FG1of the linker L resulting in the connecting unit L1cof the conjugates of the present invention described further below. The skilled person is aware of how to select a suitable functional group FG1of the linker L to react with a specific functional group of the targeting moiety T.

[0537] For example, the functional group at the targeting moiety T may be a carbonate group, a carbamate group, a carboxylic acid group, or a carboxylic ester group. In this case, the functional group FG1of the linker L preferably comprises an amino or hydroxy group, which reacts with said functional groups of the targeting moiety T under suitable conditions, wherein a hydrogen atom of the amino or hydroxy group of the linker L is replaced by a carbon atom of the targeting moiety T.

[0538] Further, the functional group at the targeting moiety may be a hydroxy group (such as of serine), an amine group (such as of lysine), or a thiol group (such as of cysteine). In this regard, the functional group FG1may be an OH-reactive group or an NH2-reactive group such as a succinimide ester, pentafluorophenyl ester, p-lactam amide, isocyanate, or isothiocyanate; an azide reactive group such as an alkyne or strained alkynes; an SH reactive group such as a maleimide group, a- haloacetamide, pyridyl disulfide, vinyl sulfoxide, aziridine, acryloyl, or a ketone reactive group such as a hydroxylamine, hydrazine or acyl hydrazide.

[0539] Functional groups such as, e.g., NH2, OH, C(=O)OH, or C(=0)NH2, may further be derivatized into activated functional groups such as, e.g., succinimides or maleimides or may be protected with a suitable protecting group.

[0540] In one embodiment, the one or more functional group FG1of the linker L of the compound-linker construct of the present invention is independently selected from the group consisting of NH2, NH(RN), OH, SH, C(=O)OH, C(=O)NH2, C(=O)NH(RN), S(=O)2OH, S(=O)2NH2, S(=O)2NH(RN), carbonates, carbamates, carboxylic esters, ureas, lactams, acyl halides, succinimide esters, pentafluorophenyl esters, p-lactam amides, isocyanates, isothiocyanates, alkynes, azides, strained alkynes, maleimide groups, a-haloacetamides, pyridyl disulfides, vinyl sulfoxides, aziridines, acryloyls, hydroxylamines, hydrazines, and acyl hydrazides.

[0541] In a preferred embodiment, the compound-linker construct has the following formula:

[0542] (l)-L1a-(L1b)n-FG1, wherein

[0543] (I) refers to the compound of formula (I) as defined herein, wherein one of RB2to RB4, RB7to RB9, or RB11to RB17present in the compound of formula (I) is replaced by the moiety -L1a-(L1b)n- FG1; wherein said one of RB2to RB4, RB7to RB9, or RB11to RB17is preferably selected from the group consisting of H, OH, NH2, NH(RL), SH, C(=O)OH, C(=O)NH2, C(=O)NH(RL), S(O)2OH, S(O)2NH2, S(O)2NH(RL), Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, and - Ci-C4-alkyl-NH(RL); preferably OH, NH2, SH, Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, and C1-C4- aminoalkyl; more preferably OH, NH2, SH, CH2OH, CH2SH, and CH2NH2; even more preferably OH, NH2, CH2OH, and CH2NH2;

[0544] L1ais -X4- or -Ci-C4-alkyl-X4-, preferably -X4- or -CH2-X4-, wherein

[0545] X4is -OC(=O)-, -C(=O)O-, -OC(=O)O-, -NHC(=O)O-, -OC(=O)NH-, -NHC(=O)NH-, - OC(=O)N(RL)-, or -NHC(=0)N(RL)-,

[0546] L1bis independently selected from the group consisting of a Ci-C -alkylene unit, wherein one or more -CH2- units are independently replaced by -N(RL)-C(=O)- or -C(=0)-, a paraaminobenzyloxy (PAB) unit, an amino acid, and a valine-citrulline unit;

[0547] RLis H or Ci-C4-alkyl, preferably H or Ci-C2-alkyl, more preferably H or CH3; n is an integer ranging from 1 to 4, and

[0548] FG1is a maleimide group, suitable for forming a covalent bond to a targeting moiety T.

[0549] In one even more preferred embodiment, the compound-linker construct has the following formula:

[0550] (l)-L1a-(L1b)n-FG1, wherein

[0551] (I) refers to the compound of formula (I) as defined herein, wherein one of RB2to RB4, RB7to RB9, or RB11to RB17present in the compound of formula (I) is replaced by the moiety -L1a-(L1b)n- FG1; wherein said one of RB2to RB4, RB7to RB9, or RB11to RB17is preferably selected from the group consisting of H, OH, NH2, NH(RL), SH, C(=O)OH, C(=O)NH2, C(=O)NH(RL), S(O)2OH, S(O)2NH2, S(O)2NH(RL), Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, and - Ci-C4-alkyl-NH(RL); preferably OH, NH2, SH, Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, and C1-C4- aminoalkyl; more preferably OH, NH2, SH, CH2OH, CH2SH, and CH2NH2; even more preferably OH, NH2, CH2OH, and CH2NH2;

[0552] L1ais -CH2-X4-, wherein X4is -OC(=O)-,

[0553] L1bis a Ci-Cio-alkylene unit, preferably a Cs-alkylene unit,

[0554] RLis H or Ci-C4-alkyl, preferably H or Ci-C2-alkyl, more preferably H or CH3, n is 1 , and

[0555] FG1is a maleimide group, suitable for forming a covalent bond to a targeting moiety T.

[0556] In another even more preferred embodiment, the compound-linker construct has the following formula:

[0557] (l)-L1a-(L1b)n-FG1, wherein

[0558] (I) refers to the compound of formula (I) as defined herein, wherein one of RB2to RB4, RB7to RB9, or RB11to RB17present in the compound of formula (I) is replaced by the moiety -L1a-(L1b)n- FG1; wherein said one of RB2to RB4, RB7to RB9, or RB11to RB17is preferably selected from the group consisting of H, OH, NH2, NH(RL), SH, C(=O)OH, C(=O)NH2, C(=O)NH(RL), S(O)2OH, S(O)2NH2, S(O)2NH(RL), Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, and - Ci-C4-alkyl-NH(RL); preferably OH, NH2, SH, Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, and C1-C4- aminoalkyl; more preferably OH, NH2, SH, CH2OH, CH2SH, and CH2NH2; even more preferably OH, NH2, CH2OH, and CH2NH2;

[0559] L1ais -CH2-X4-, wherein X4is -OC(=O)O-,

[0560] L1bis independently selected from the group consisting of a Ci-C -alkylene unit, wherein one or more -CH2- units are replaced by -C(=O)-, a para-aminobenzyloxy (PAB) unit, and a valinecitrulline unit, n is 3, and wherein preferably said 3 units L1bare (in the direction starting from L1a) a para- aminobenzyloxy (PAB) unit, followed by a valine-citrulline unit, followed by a C4-C8-alkylene unit, wherein the -CH2- unit attached to the valine of the valine-citrulline unit is replaced by - C(=O)-,

[0561] RLis H or Ci-C4-alkyl, preferably H or Ci-C2-alkyl, more preferably H or CH3, and FG1is a maleimide group, suitable for forming a covalent bond to a targeting moiety T.

[0562] In another even more preferred embodiment, the compound-linker construct has the following formula:

[0563] (l)-L1a-(L1b)n-FG1, wherein

[0564] (I) refers to the compound of formula (I) as defined herein, wherein one of RB2to RB4, RB7to RB9, or RB11to RB17present in the compound of formula (I) is replaced by the moiety -L1a-(L1b)n- FG1; wherein said one of RB2to RB4, RB7to RB9, or RB11to RB17is preferably selected from the group consisting of H, OH, NH2, NH(RL), SH, C(=O)OH, C(=O)NH2, C(=O)NH(RL), S(O)2OH, S(O)2NH2, S(O)2NH(RL), Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, and - Ci-C4-alkyl-NH(RL); preferably OH, NH2, SH, Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, and C1-C4- aminoalkyl; more preferably OH, NH2, SH, CH2OH, CH2SH, and CH2NH2; even more preferably OH, NH2, CH2OH, and CH2NH2;

[0565] L1ais -CH2-X4-, wherein X4is -OC(=O)N(CH3)-, L1bis independently selected from the group consisting of a Ci-C -alkylene unit, wherein one or more -CH2- units are independently replaced by -N(CH3)-C(=O)- or -C(=0)-; a paraaminobenzyloxy (PAB) unit, and a valine-citrulline unit, n is 4, and wherein preferably said 4 units L1bare (in the direction starting from L1a) a C3- alkylene unit, wherein the -CH2- unit attached to the oxygen of the subsequent paraaminobenzyloxy (PAB) unit is replaced by -N(CH3)-C(=O)-, followed by a paraaminobenzyloxy (PAB) unit, followed by a valine-citrulline unit, followed by a C4-C8-alkylene unit, wherein the -CH2- unit attached to the valine of the valine-citrulline unit is replaced by - C(=O)-,

[0566] RLis H or Ci-C4-alkyl, preferably H or Ci-C2-alkyl, more preferably H or CH3, and FG1is a maleimide group, suitable for forming a covalent bond to a targeting moiety T.

[0567] 1.2. The third aspect

[0568] The compound of the first aspect of the present invention can be covalently conjugated to a further moiety and in particular to a linker, which compound-linker construct is the second aspect of the present invention. This compound-linker construct can further be covalently conjugated to a targeting moiety, herein referred to as conjugate, which is the third aspect of the present invention.

[0569] The covalent attachment of a compound of the present invention to a linker and (via the linker) to a targeting moiety, may mask the compound from the host’s immune system (reducing immunogenicity and antigenicity) and increase its hydrodynamic size (the size in solution), which prolongs its circulation time by reducing renal clearance. Additionally, the water solubility of the compound of the present invention may be positively influenced, in particular by the use of a linker with hydrophilic groups.

[0570] The targeting moiety of the conjugate is the main determinant for the targeting of the conjugate, in particular the targeting to a specific cell, such as a cancer cell. Preferably, the targeting moiety is an antibody or an antigen-binding fragment thereof, wherein this antibody or an antigen-binding fragment thereof binds to a specific protein on the surface of the cell of interest, e.g. the cancer cell, in particular a protein selected from the group consisting of CD22, CD24, CD33, EGFR, GPC2, GPC3, HER2, HER3, LIV1 , mesothelin and Trop-2. The targeting moiety will thus target the conjugate comprising the compound of the present invention to a specific target cell, such as a cancer cell, where the compound of the present invention is intended to become effective. Once the targeting moiety of the conjugate and thus the conjugate is bound to a specific protein on the surface of the cell of interest, this complex is internalized by the cell, typically via a lysosome, where specific environmental differences compared to the environment outside the lysosome, in particular the redox potential, the presence of an enzyme (in particular a protease), and pH are present, which result in the cleavage of at least the linker comprised in the conjugate.

[0571] The compound of the present invention can still be effective inside cells because, as outlined above, it is preferred that the linker is cleavable such that in essence the compound of the present invention is provided after this cleavage and will act as molecular glue inside the cell of interest, thereby inducing the degradation of CCNK and / or CDK12 and / or CDK13.

[0572] Thus, in the third aspect, the present invention relates to a conjugate comprising

[0573] (i) a compound-linker construct as defined in the second aspect; and

[0574] (ii) a targeting moiety T. As regards the compound of formula (I) in the compound linker-construct, all embodiments outlined above for the first aspect apply for the third aspect as well, in particular the embodiments, wherein ring A, ring B, and R1are as defined in the preferred embodiments of the first aspect.

[0575] As regards the compound linker-construct, all embodiments outlined above for the second aspect apply for the third aspect as well.

[0576] Preferably, the targeting moiety T is covalently bonded to the linker L of the compound-linker construct so that the linker L links the compound of formula (I) to the targeting moiety T. Optionally, the targeting moiety T may be linked to one or more, preferably 1 to 30, preferably 2 to 20, more preferably 4 to 8, particularly preferably 8, compounds of formula (I) via a linker L. Thus, the conjugate may be represented by the following formula:

[0577] [(l)-L]a-T wherein

[0578] (I) refers to the compound of formula (I),

[0579] L is the linker L,

[0580] T is the targeting moiety T, and a is an integer of from 1 to 30, preferably 2 to 20, more preferably 4 to 8, particularly preferably

[0581] 8.

[0582] More preferably, the conjugate may be represented by the following formula:

[0583] [(l)-L]a-T wherein

[0584] (I) refers to the compound of formula (I),

[0585] L is the linker L, wherein L is cleavable,

[0586] T is the targeting moiety T, wherein T is an antibody or antigen-binding fragment that binds to an antigen selected from the group consisting of CD22, CD24, CD33, EGFR, GPC2, GPC3, HER2, HER3, LIV1 , mesothelin and Trop-2, and a is an integer of from 2 to 8, most preferably 8.

[0587] In a preferred embodiment, the conjugate may be represented by the following formula [(l)-L1a-(L1b)n-L1c]a-T, wherein

[0588] (I) refers to the compound of formula (I), wherein one of RB2to RB4, RB7to RB9, or RB11to RB17present in the compound of formula (I) is replaced by the moiety -L1a-(L1b)n-L1c-T; wherein said one of RB2to RB4, RB7to RB9, or RB11to RB17is preferably selected from the group consisting of H, OH, NH2, NH(RN), SH, C(=O)OH, C(=O)NH2, C(=O)NH(RN), S(O)2OH, S(O)2NH2, S(O)2NH(RN), Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, and - Ci-C4-alkyl-NH(RN); preferably OH, NH2, SH, Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, and C1-C4- aminoalkyl; more preferably OH, NH2, SH, CH2OH, CH2SH, and CH2NH2; even more preferably OH, NH2, CH2OH, and CH2NH2;

[0589] L1ais a connecting unit L1a,

[0590] L1bis a spacer moiety L1b,

[0591] L1cis a connecting unit L1ccovalently bonded to the targeting moiety T, in particular to a functional group of the targeting moiety T, n is an integer ranging from 0 to 10, a is an integer of from 1 to 30, preferably 2 to 20, more preferably 4 to 8, particularly preferably 8, and

[0592] T is a targeting moiety T ; wherein the compound of formula (I), L1a, and L1bare preferably as defined herein above.

[0593] In another preferred embodiment, the conjugate is a compound of formula (I), wherein one or more, preferably one, of RB2to RB4, RB7to RB9, or RB11to RB17present in the compound of formula (I) is independently selected from the group consisting of -X4-(L1b)n-L1c-T, and -Ci-C4-alkyl-X4-(L1b)n-L1c-T, wherein

[0594] X4is -O-, -S-, -NH-, -N(RL)-, -OC(=O)-, -C(=O)O-, -SC(=O)-, -C(=O)S-, -NHC(=O)-, -C(=O)NH-, - N(RL)C(=O)-, -C(=O)N(RL)-, -NHS(=O)2-, -S(=O)2NH-, -N(RL)S(=O)2-, -S(=O)2N(RL)-, -C(=O)-, -S(=O)-, -S(=O)2-, -OC(=O)O-, -NHC(=O)O-, -OC(=O)NH-, -NHC(=O)NH-, -N(RL)C(=O)O-, - OC(=O)N(RL)-, -N(RL)C(=O)NH-, -NHC(=O)N(RL)-, or -N(RL)C(=0)N(RL)-,

[0595] RLis H or Ci-C4-alkyl, preferably H or Ci-C2-alkyl, more preferably H or CH3,

[0596] L1bis a spacer moiety L1b,

[0597] L1cis a connecting unit L1ccovalently bonded to the targeting moiety T, in particular to a functional group of the targeting moiety T, n is an integer ranging from 0 to 10, and

[0598] T is a targeting moiety T, wherein X4, RL, L1b, and n are preferably as defined herein above.

[0599] As indicated above, the connecting unit L1cis formed by reacting the functional group FG1of the compound-linker constructs with a functional group of the targeting moiety.

[0600] In this regard, it is to be understood that the covalent bond between the functional group FG1of the linker L of the compound-linker construct and the functional group of the targeting moiety T may be established either by condensation reaction, thereby removing a hydrogen atom from one of the two functional groups and a leaving group from the other one of the two functional groups and then connecting the two radicals of the functional groups to form a covalent bond; or by addition reaction, thereby removing a hydrogen atom of a functional group of the targeting moiety T and adding said radical to an unsaturated C-C bond of the functional group FG1such as, e.g., a double bond or triple bond, thereby converting the double bond into a single bond and the triple bond into a double bond; or by a cycloaddition reaction, thereby combining the functional group FG1and the functional group of the targeting moiety to form a heteroaryl group, e.g., reacting an alkyne or strained alkyne with an azide to form a triazole.

[0601] Accordingly, in one embodiment, the connecting unit L1crepresents the functional group FG1, wherein a hydrogen atom or leaving group of the functional group FG1has been replaced by the targeting moiety T, or wherein a C-C double bond or C-C triple bond of the functional group FG1has been transformed into a C-C single bond or C-C double bond by attachment of the targeting moiety T thereto, or a ring moiety has been opened upon reaction with the targeting moiety T, or wherein the functional group FG1and functional group of targeting moiety T have formed a heteroaryl group.

[0602] In one embodiment, the connecting unit L1cbetween the linker L of the compound-linker construct and the targeting moiety T is independently selected from the group consisting of -NH-, - N(RT)-, -O-, -S-, -C(=O)O-, -C(=O)NH-, -C(=O)N(RT)-, -C(=O)S-, -S(=O)2O-, -S(=O)2NH-, - S(=O)2N(RT)-, -C(=O)-, -S(=O)2-, -OC(=O)-, -NHC(=O)-, -SC(=O)-, -N(RT)C(=O)-, -NHC(=O)S-, - N(RT)C(=O)S-, -NHC(=S)-, -N(RT)C(=S)-, -SC(=O)NH-, -SC(=O)N(RT)-, succinimide groups, alkyl groups, alkene groups, and heteroaryl groups; wherein RTis H or Ci-C4-alkyl, preferably H or Ci-C2-alkyl, more preferably H or CH3. Thus, it is to be understood that the conjugates of the present invention comprise one or more, preferably 2 to 20, more preferably 4 to 8, particularly preferably 8, compound-linker constructs of the present invention, but wherein the terminal functional group FG1of the linker is in each case replaced with the connecting unit L1ccovalently connected to the targeting moiety T (-L1c-T). Accordingly, in preferred embodiments, L1a, X4, RL, L1b, and n of the conjugates of the present invention are as defined in the preferred embodiments of the compound-linker constructs above. In particularly preferred embodiments, L1a, X4, RL, L1b, and n of the conjugates of the present invention are as defined in the preferred embodiments of the compound-linker constructs above, and L1cis a succinimide covalently connected to the targeting moiety T.

[0603] As indicated above, the conjugates of the invention also comprise a targeting moiety T. Preferred embodiments in this regard are defined hereinafter.

[0604] In a preferred embodiment, the targeting moiety T is selected from the group consisting of an antibody, an antigen-binding fragment thereof, a nucleic acid based molecule, a carbohydrate, a peptide, and a modified peptide.

[0605] It is preferred that the targeting moiety T binds to an antigen selected from the group consisting of 5E10, 5T4, Axl, B7H3, B7H4, CA9, CD117, CD123, CD127, CD13, CD134, CD137, CD138, CD146, CD147, CD152, CD154, CD174, CD195, CD2, CD20, CD200, CD205, CD21 , CD212, CD223, CD227, CD23, CD253, CD272, CD274, CD276, CD278, CD279, CD3, CD309, CD319, CD326, CD34, CD340, CD37, CD38, CD46, CD5, CD55, CD56, CD59, CD69, CD7, CD70, CD71 , CD74, CD97, CD98, CDH6, CLDN18, Collagen IV, DR6, EDB, Endoplasmin, Ephrin A2, Ephrin A4, Ephrin B2, ETB, G250, Guanylyl cyclase C, HAVCR1 , HER4, IGF1 R, Integrin beta 6, KLK3, Kv1.3, MAGE3, MUC16, Mucin 1 , p-cadherin, Periostin, ROBO4, SC-16, SLC44A4, STEAP1 , STEAP2, Survivin, Tenascin C, TMEFF2, uPA, UPK2, VEGFR2, BCMA, CD19, CD30, CD79b, CEACAM5, ENPP3, FOLR1 , FLT3, GPNMB, Nectin 4, Tissue Factor, PSMA, CD22, CD24, CD33, EGFR, GPC2, GPC3, HER2, HER3, LIV1 , mesothelin and Trop-2. More preferably, the targeting moiety T binds to an antigen selected from the group consisting of BCMA, CD19, CD30, CD79b, CEACAM5, ENPP3, FOLR1 , FLT3, GPNMB, Nectin 4, Tissue Factor and PSMA. Most preferably, the targeting moiety T binds to an antigen selected from the group consisting of CD22, CD24, CD33, EGFR, GPC2, GPC3, HER2, HER3, LIV1 , mesothelin and Trop-2.

[0606] It is preferred that the targeting moiety T is an antibody or an antigen-binding fragment thereof, preferably an antibody or antigen-binding fragment thereof that binds to any of the antigens selected from the above general group, the above preferred group and the above most preferred group.

[0607] 1.3. The fourth aspect

[0608] In the fourth aspect, the present invention relates to a pharmaceutical composition comprising a pharmaceutically acceptable amount of the compound of formula (I) as defined in the first aspect, or the compound-linker construct as defined in the second aspect, or the conjugate as defined in the third aspect, and optionally a pharmaceutically acceptable carrier, diluent or excipient.

[0609] In general, the pharmaceutical composition may comprise one or more pharmaceutically acceptable excipients, such as a carrier, a diluent, a filler, a disintegrant, a lubricating agent, a binder, a colorant, a pigment, a stabilizer, a preservative, an antioxidant, and / or a solubility enhancer. The pharmaceutical composition may comprise one or more solubility enhancers, such as, e.g., polyethylene glycol), including polyethylene glycol) having a molecular weight in the range of about 200 to about 5,000 Da (e.g., PEG 200, PEG 300, PEG 400, or PEG 600), ethylene glycol, propylene glycol, glycerol, a non-ionic surfactant, tyloxapol, polysorbate 80, macrogol-15-hydroxystearate (e.g., Kolliphor® HS 15, CAS 70142-34-6), a phospholipid, lecithin, dimyristoyl phosphatidylcholine, dipalmitoyl phosphatidylcholine, distearoyl phosphatidylcholine, a cyclodextrin, a-cyclodextrin, p- cyclodextrin, y-cyclodextrin, hydroxyethyl-p-cyclodextrin, hydroxypropyl-p-cyclodextrin, hydroxyethyl- y-cyclodextrin, hydroxypropyl-y-cyclodextrin, dihydroxypropyl-p-cyclodextrin, sulfobutylether-p- cyclodextrin, sulfobutylether-y-cyclodextrin, glucosyl-a-cyclodextrin, glucosyl-p-cyclodextrin, diglucosyl-p-cyclodextrin, maltosyl-a-cyclodextrin, maltosyl-p-cyclodextrin, maltosyl-y-cyclodextrin, maltotriosyl-p-cyclodextrin, maltotriosyl-y-cyclodextrin, dimaltosyl-p-cyclodextrin, methyl-p- cyclodextrin, a carboxyalkyl thioether, hydroxypropyl methylcellulose, hydroxypropylcellulose, polyvinylpyrrolidone, a vinyl acetate copolymer, vinyl pyrrolidone, sodium lauryl sulfate, dioctyl sodium sulfosuccinate, or any combination thereof.

[0610] The pharmaceutical composition may also comprise one or more preservatives, particularly one or more antimicrobial preservatives, such as, e.g., benzyl alcohol, chlorobutanol, 2-ethoxyethanol, m-cresol, chlorocresol (e.g., 2-chloro-3-methyl-phenol or 4-chloro-3-methyl-phenol), benzalkonium chloride, benzethonium chloride, benzoic acid (or a pharmaceutically acceptable salt thereof), sorbic acid (or a pharmaceutically acceptable salt thereof), chlorhexidine, thimerosal, or any combination thereof.

[0611] The pharmaceutical composition can be formulated by techniques known to the person skilled in the art, such as the techniques published in “Remington: The Science and Practice of Pharmacy”, Pharmaceutical Press, 22ndedition. The pharmaceutical composition can be formulated as dosage forms for oral, parenteral, intramuscular, intravenous, subcutaneous, intradermal, intraarterial, intracardial, rectal, nasal, topical, aerosol or vaginal administration. Dosage forms for oral administration include coated and uncoated tablets, soft gelatin capsules, hard gelatin capsules, lozenges, troches, solutions, emulsions, suspensions, syrups, elixirs, powders and granules for reconstitution, dispersible powders and granules, medicated gums, chewing tablets and effervescent tablets. Dosage forms for parenteral administration include solutions, emulsions, suspensions, dispersions and powders and granules for reconstitution. Emulsions are a preferred dosage form for parenteral administration. Dosage forms for rectal and vaginal administration include suppositories and ovula. Dosage forms for nasal administration can be administered via inhalation and insufflation, for example by a metered inhaler. Dosage forms for topical administration include creams, gels, ointments, salves, patches and transdermal delivery systems.

[0612] The pharmaceutical composition may be administered to a subject by any convenient route of administration, whether systemically / peripherally or at the site of desired action, including but not limited to one or more of oral (e.g., as a tablet, capsule, or as an ingestible solution), topical (e.g., transdermal, intranasal, ocular, buccal, and sublingual), parenteral (e.g., using injection techniques or infusion techniques, and including, for example, by injection, e.g., subcutaneous, intradermal, intramuscular, intravenous, intraarterial, intracardiac, intrathecal, intraspinal, intracapsular, subcapsular, intraorbital, intraperitoneal, intratracheal, subcuticular, intraarticular, subarachnoid, or intrasternal by, e.g., implant of a depot, for example, subcutaneously or intramuscularly), pulmonary (e.g., by inhalation or insufflation therapy using, e.g., an aerosol, e.g., through mouth or nose), gastrointestinal, intrauterine, intraocular, subcutaneous, ophthalmic (including intravitreal or intracameral), rectal, or vaginal administration.

[0613] If the pharmaceutical composition is administered parenterally, then examples of such administration include one or more of intravenously, intraarterially, intraperitoneally, intrathecally, intraventricularly, intraurethrally, intrasternally, intracardially, intracranially, intramuscularly or subcutaneously administering the pharmaceutical composition, and / or by using infusion techniques. For parenteral administration, a sterile aqueous solution which may contain other substances, for example, enough salts or glucose to make the solution isotonic with blood, may be used. The aqueous solution should be suitably buffered (preferably to a pH of from 3 to 9), if necessary.

[0614] The pharmaceutical composition can also be administered orally in the form of tablets, capsules, ovules, elixirs, solutions or suspensions, which may contain flavoring or coloring agents, for immediate-, delayed-, modified-, sustained-, pulsed- or controlled-release applications.

[0615] A tablet may contain excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine, disintegrants such as starch (preferably corn, potato or tapioca starch), sodium starch glycolate, croscarmellose sodium and certain complex silicates, and granulation binders such as polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC), hydroxypropylcellulose (HPC), sucrose, gelatin and acacia. Additionally, a lubricating agent such as magnesium stearate, stearic acid, glyceryl behenate and talc may be included. A solid composition of a similar type may also be employed as fillers in gelatin capsules. Preferred excipients in this regard include lactose, starch, a cellulose, or high molecular weight polyethylene glycols.

[0616] For oral administration, the pharmaceutical composition is preferably administered by oral ingestion, particularly by swallowing.

[0617] Alternatively, the pharmaceutical composition can be administered in the form of a suppository or pessary, or may be applied topically in the form of a gel, hydrogel, lotion, solution, cream, ointment or dusting powder. The pharmaceutical composition may also be dermally or transdermally administered, for example, by the use of a skin patch.

[0618] The pharmaceutical composition may also be administered by sustained release systems. Suitable examples of sustained-release compositions include semi-permeable polymer matrices in the form of shaped articles, e.g., films, or microcapsules. Sustained-release matrices include, e.g., polylactides, copolymers of L-glutamic acid and gamma-ethyl-L-glutamate, poly(2-hydroxyethyl methacrylate), ethylene vinyl acetate, or poly-D-(-)-3-hydroxybutyric acid. Sustained-release pharmaceutical compositions also include liposomally entrapped compounds.

[0619] The pharmaceutical composition may also be administered by the pulmonary route, rectal route, or the ocular route. For ophthalmic use, the pharmaceutical composition can be formulated as micronized suspension in isotonic, pH adjusted, sterile saline, or, preferably, as solutions in isotonic, pH adjusted, sterile saline, optionally in combination with a preservative such as a benzalkonium chloride. Alternatively, the pharmaceutical composition may be formulated in an ointment such as petrolatum.

[0620] For topical application to the skin, the pharmaceutical composition can be formulated as a suitable ointment containing the compound of formula (I) suspended or dissolved in, for example, a mixture with one or more of the following: mineral oil, liquid petrolatum, white petrolatum, propylene glycol, emulsifying wax and water.

[0621] Typically, a physician will determine the actual dosage of the compound of formula (I) which will be most suitable for an individual subject. The specific dose level and frequency of dosage for any particular individual subject may be varied and will depend upon a variety of factors including the activity of the specific compound employed, the metabolic stability and length of action of that compound, the age, body weight, general health, sex, diet, mode and time of administration, rate of excretion, drug combination, the severity of the particular condition, and the individual subject undergoing therapy.

[0622] A proposed, yet non-limiting dose of the compounds according to the invention for oral administration to a human (of approximately 70 kg body weight) may be 0.05 to 8000 mg, preferably 0.1 mg to 4000 mg, of the active ingredient per unit dose. The unit dose may be administered, e.g., 1 to 3 times per day. The unit dose may also be administered 1 to 7 times per week, e.g., with not more than one administration per day. A further exemplary dose of the compounds of formula (I) for oral administration to a human is 50 to 200 mg / kg bodyweight / day, particularly 100 mg / kg / day. It will be appreciated that it may be necessary to make routine variations to the dosage depending on the age and weight of the patient / subject as well as the severity of the condition to be treated. The precise dose and also the route of administration will ultimately be at the discretion of the attendant physician or veterinarian.

[0623] 1.4. The fifth aspect

[0624] In the fifth aspect, the present invention relates to a compound of formula (I) as defined in the first aspect, or a compound-linker construct as defined in the second aspect, or a conjugate as defined in the third aspect, or a pharmaceutical composition as defined in the fourth aspect for use in medicine.

[0625] This aspect relates to any use in medicine and is not limited as regards the particular indication.

[0626] 1.5. The sixth aspect

[0627] In the sixth aspect, the present invention relates to a compound of formula (I) as defined in the first aspect, or a compound-linker construct as defined in the second aspect, or a conjugate as defined in the third aspect, or a pharmaceutical composition as defined in the fourth aspect for use in treating or preventing a cancer, a metabolic disorder, a neurologic disorder or an infectious disease.

[0628] Indications

[0629] Thus, a protein associated with a cancer, a metabolic disorder, a neurologic disorder or an infectious disease may be downregulated upon degradation of CCNK by the E3 ligase as shown by the proteomics profiling analysis in example 5 of WO 2021 / 074414. As indicated therein, proteins associated with a neurological disorder such as HECTD1 , MBP and FEM1 A are downregulated upon degradation of CCNK. As another example, proteins associated with a metabolic disease such as HMMR, LMNA and TMPO are also downregulated upon degradation of CCNK. As still another example, proteins associated with an infectious disease such as ICAM2, CALCOCO2 and CDC6 are downregulated upon degradation of CCNK. As yet still another example, cancer associated proteins such as BUB1 , BUB1 B, MCM10, CDCA7 and CDC6 are also all downregulated upon degradation of CCNK.

[0630] Degradation of CCNK has been described to induce genomic instability of cancer, such as of prostate cancer (see Wu et al 2018, Cell. 2018 Jun 14; 173(7): 1770-1782) and has been suggested to be effective in cancers associated with mutations in DNA damage response genes such as those described in Table 1 of Lord et al 2016, Nat Rev Cancer. 2016 Feb;16(2):110-20. Further, CCNK degradation has been described to be particularly effective in cancers associated with increased levels of cyclin E1. Thus, a cancer associated with the cell-cycle modulators CDK12, CDK13 and / or CCNK includes, but is not limited, to cancer with an overexpression of cyclin E1 such as breast cancer, ovarian cancer, melanoma, bladder cancer, gastric cancer, stomach adenocarcinoma, lung squamous cancer, lung adenocarcinoma, glioblastoma multiforme and colorectal cancer, see Lei et al.; Nat Commun. 2018 May 14;9(1 ): 1876.

[0631] Further, CDK12, CDK13 and / or CCNK can play a role in proliferation of cancer including but not limited to breast cancer, ovarian cancer, melanoma, bladder cancer, gastric cancer, stomach adenocarcinoma, lung squamous cancer, lung adenocarcinoma, glioblastoma multiforme and colorectal cancer. Further examples include a cancer which can be caused by an abnormal adherent cell, or a cancer which can be caused by an abnormal blood cell (e.g., leukemia, lymphoma, multiple myeloma). In one embodiment, the cancer is a solid tumor cancer. In another embodiment, the cancer is selected from the group consisting of leukemia, particularly acute myeloid leukemia (AML), B-cell acute lymphoblastic leukemia (B-ALL), and a chronic leukemia including chronic myeloid leukemia; lymphoma, particularly Non-Hodgkin Lymphoma and Hodgkin Lymphoma; head and neck cancer; esophageal cancer; adenoid cystic carcinoma; osteosarcoma; ovarian cancer; Ewing’s sarcoma; lung cancer; neuroblastoma; gastrointestinal cancer; endometrial cancer; cervical cancer; medulloblastoma; prostate cancer; esophagus cancer; breast cancer; thyroid cancer; meningioma; liver cancer; colorectal cancer; pancreatic cancer; chondrosarcoma; osteosarcoma; and kidney cancer. In a preferred embodiment, the cancer is selected from the group consisting of lymphoma, liver cancer, breast cancer, neuroblastoma, cervical cancer, Ewing’s sarcoma, and lung cancer, in particular MYCL-overexpressing lung cancer. In a more preferred embodiment, the cancer is selected from liver cancer, particularly hepatocellular carcinoma, breast cancer, particularly HER2- overexpressing breast cancer or triple-negative breast cancer, and neuroblastoma, particularly MYCN-overexpressing neuroblastoma. In another preferred embodiment, the cancer is a cancer in which HER2 overexpression is accompanied by CDK12 overexpression.

[0632] Combinations with further active agents

[0633] The compound of formula (I) as defined herein, the compound-linker construct as defined herein, the conjugate as defined herein, or the pharmaceutical composition as defined herein can be administered in monotherapy (without concomitantly administering any further therapeutic agents).

[0634] However, the compound of formula (I) as defined herein, the compound-linker construct as defined herein, the conjugate as defined herein, or the pharmaceutical composition as defined herein can also be administered in combination with one or more further therapeutic agents.

[0635] If the compound of formula (I) as defined herein, the compound-linker construct as defined herein, or the conjugate as defined herein is used in combination with a second therapeutic agent against the same disease, the dose of each compound may differ from the dose when the corresponding compound is used alone, in particular a lower dose of each compound may be used.

[0636] The combination of the compound of formula (I) as defined herein, the compound-linker construct as defined herein, or the conjugate as defined herein, with one or more further therapeutic agents may comprise the simultaneous / concomitant administration of the compound of formula (I) as defined herein, the compound-linker construct as defined herein, or the conjugate as defined herein, and the one or more further therapeutic agents (either in a single pharmaceutical formulation or in separate pharmaceutical formulations), or the sequential / separate administration of the compound of formula (I) as defined herein, the compound-linker construct as defined herein, or the conjugate as defined herein, and the one or more further therapeutic agents. If administration is sequential, either the compound of formula (I) as defined herein, the compound-linker construct as defined herein, or the conjugate as defined herein, or the one or more further therapeutic agents may be administered first. If administration is simultaneous, the one or more further therapeutic agents may be included in the same pharmaceutical formulation as the compound of formula (I) as defined herein, the compound-linker construct as defined herein, or the conjugate as defined herein, or they may be administered in one or more different (separate) pharmaceutical formulations.

[0637] Preferably, the one or more further therapeutic agents to be administered in combination are anticancer drugs. The anticancer drug(s) to be administered in combination with a compound of formula (I) as defined herein, the compound-linker construct as defined herein, or the conjugate as defined herein, can be selected from a tumor angiogenesis inhibitor; a cytotoxic agent; an antimitotic agent; a platinum coordination complex; an anti-tumor antibiotic; an alkylating agent; an endocrine agent; or a compound that targets an enzyme or receptor that is overexpressed and / or otherwise involved in a specific metabolic pathway that is misregulated in the tumor cell.

[0638] An alkylating agent which can be used as an anticancer drug in combination can be a nitrogen mustard, a nitrosourea, an alkyl sulfonate, an aziridine, a hydrazine, a triazene, or an imidazotetrazine.

[0639] A platinum coordination complex which can be used as an anticancer drug in combination can be cisplatin.

[0640] A cytotoxic drug which can be used as an anticancer drug in combination can be an antimetabolite, , purine analogue antimetabolites, and pyrimidine analogue antimetabolites.

[0641] An antimitotic agent which can be used as an anticancer drug in combination can be a taxane, a Vinca alkaloid, an epothilone or an epothilone B analogue.

[0642] An anti-tumor antibiotic which can be used as an anticancer drug in combination can be an anthracycline, an anthracenedione or an anti-tumor antibiotic isolated from Streptomyces.

[0643] An anticancer drug which can be used in combination can be an immunooncology therapeutic (such as an antibody (e.g., a monoclonal antibody or a polyclonal antibody), an antibody fragment, an antibody construct (e.g., a single-chain construct), or a modified antibody (e.g., a CDR-grafted antibody, a humanized antibody, or a "full humanized" antibody) targeting any one of CTLA-4, PD-1 / PD-L1 , TIM3, LAG3, 0X4, CSF1 R, IDO, PVRIG or CD40.

[0644] The compound of formula (I) as defined herein, the compound-linker construct as defined herein, the conjugate as defined herein, or the pharmaceutical composition as defined herein can also be administered in combination with physical therapy, such as radiotherapy. Radiotherapy may commence before, after, or simultaneously with administration of the compounds of the invention. For example, radiotherapy may commence 1-10 minutes, 1-10 hours or 24-72 hours after administration of the compounds. The subject is exposed to radiation, preferably gamma radiation, whereby the radiation may be provided in a single dose or in multiple doses that are administered over several hours, days and / or weeks. Gamma radiation may be delivered according to standard radiotherapeutic protocols using standard dosages and regimens.

[0645] 2. Definitions

[0646] 2.1. Chemical definitions

[0647] As used herein, the term "halogen" refers to fluoro (- F), chloro (-CI), bromo (— Br), or iodo (-I).

[0648] As used herein, the term "alkyl" refers to a monovalent saturated acyclic (i.e. , non-cyclic) hydrocarbon group which may be linear or branched. Accordingly, an "alkyl" group does not comprise any carbon-to-carbon double bond or any carbon-to-carbon triple bond. The term "alkyl" preferably refers to a "C1-6 alkyl". A "C1-6 alkyl" denotes an alkyl group having 1 to 6 carbon atoms. Preferred exemplary alkyl groups are methyl, ethyl, propyl (e.g., n-propyl or isopropyl), or butyl (e.g., n-butyl, isobutyl, sec-butyl, or tert-butyl). Unless defined otherwise, the term "alkyl" more preferably refers to C1-4 alkyl, more preferably to methyl or ethyl, and even more preferably to methyl. As used herein, the term "alkoxy" refers to "-O-alkyl", wherein "alkyl" is as defined above.

[0649] The term “alkoxyalkyl” as used herein refers to an alkoxy group as defined herein having usually from 1 to 4 carbon atoms, preferably 1 to 2 carbon atoms, more preferably 1 carbon atom, which is bonded via an alkyl group as defined herein having usually from 1 to 4 carbon atoms, preferably 1 to 2 carbon atoms, more preferably 1 carbon atom, to the remainder of the molecule. Thus, it refers to an alkyl group, which is bonded via oxygen to a further alkyl group, which is then bonded to the remainder of the molecule, i.e, "-alkyl-O-alkyl”. Examples of an alkoxyalkyl group are methoxymethyl, methoxyethyl, ethoxymethyl, ethoxyethyl, and the like. The term “dimethylaminoalkyl” as used herein refers to a dimethylamino group (N(CH3)2), which is bonded via an alkyl group as defined herein having usually from 1 to 4 carbon atoms, preferably 1 to 2 carbon atoms, more preferably 1 carbon atom, to the remainder of the molecule, i.e., "-alkyl- N(CH3)2”.

[0650] The term “aminoalkyl” as used herein refers to an amino group (NH2), which is bonded via an alkyl group as defined herein having usually from 1 to 4 carbon atoms, preferably 1 to 2 carbon atoms, more preferably 1 carbon atom, to the remainder of the molecule, i.e., "-alkyl-NH2”. Examples of an aminoalkyl group are aminomethyl, 2-aminopropan-2-yl, and the like.

[0651] The term “hydroxyalkyl” as used herein refers to a hydroxy group (OH), which is bonded via an alkyl group as defined herein having usually from 1 to 4 carbon atoms, preferably 1 to 2 carbon atoms, more preferably 1 carbon atom, to the remainder of the molecule, i.e., "-alkyl-OH”. Examples of an hydroxyalkyl group are hydroxymethyl, 2-hydroxypropan-2-yl, and the like.

[0652] As used herein, the term "haloalkyl" refers to an alkyl group substituted with one or more (preferably 1 to 6, more preferably 1 to 3) halogen atoms which are selected independently from fluoro, chloro, bromo and iodo, and are preferably all fluoro atoms. It will be understood that the maximum number of halogen atoms is limited by the number of available attachment sites and, thus, depends on the number of carbon atoms comprised in the alkyl moiety of the haloalkyl group. "Haloalkyl" may, e.g., refer to -CF3, -CHF2, -CH2F, -CF2-CH3, -CH2-CF3, -CH2-CHF2, -CH2-CF2-CH3, -CH2-CF2-CF3, or -CH(CF3)2. As used herein, the term "haloalkoxy" refers to "-O-haloalkyl", wherein "haloalkyl" is as defined above.

[0653] As used herein, the term "heteroalkyl" refers to an alkyl group in which one or two of the -CH2- groups have been replaced each independently by a group selected from -O-, -S- and -N(Ci. ealkyl)— . A preferred example is an alkoxy group such as methoxy. As used herein, the term "alkenyl" refers to a monovalent unsaturated acyclic hydrocarbon group which may be linear or branched and comprises one or more (e.g., one or two) carbon-to-carbon double bonds while it does not comprise any carbon-to-carbon triple bond. The term "C2.6 alkenyl" denotes an alkenyl group having 2 to 6 carbon atoms. Preferred exemplary alkenyl groups are ethenyl, propenyl (e.g., prop-1- en-1-yl, prop-1 -en-2-yl, or prop-2-en-1-yl), butenyl, butadienyl (e.g., buta-1 ,3-dien-1-yl or buta-1 ,3- dien-2-yl), pentenyl, or pentadienyl (e.g., isoprenyl). Unless defined otherwise, the term "alkenyl" preferably refers to C2.6 alkenyl, more prefarably C2.4 alkenyl.

[0654] As used herein, the term "alkynyl" refers to a monovalent unsaturated acyclic hydrocarbon group which may be linear or branched and comprises one or more (e.g., one or two) carbon-to-carbon triple bonds and optionally one or more carbon-to-carbon double bonds. The term "C2.6 alkynyl" denotes an alkynyl group having 2 to 6 carbon atoms. Preferred exemplary alkynyl groups are ethynyl, propynyl, or butynyl. Unless defined otherwise, the term "alkynyl" preferably refers to C2. 6 alkynyl, more preferably C2.4 alkynyl.

[0655] As used herein, the term "aryl" refers to a monocyclic aromatic hydrocarbon ring group. Unless defined otherwise, an "aryl" preferably has 6 to 14 ring atoms, more preferably 6 to 10 ring atoms, and most preferably refers to phenyl.

[0656] As used herein, the term "bicyclic aryl" refers to an aromatic hydrocarbon ring group, containing two, bridged or fused ring systems containing at least one aromatic ring (e.g., ring systems composed of two fused rings, wherein at least one of these fused rings is aromatic; or bridged ring systems composed of two rings, wherein at least one of these bridged rings is aromatic). "Bicyclic aryl" may, e.g., refer to naphthyl. Unless defined otherwise, an "bicyclic aryl" preferably has 10 ring atoms.

[0657] As used herein, the term "heteroaryl" refers to a monocyclic aromatic ring group, wherein said aromatic ring group comprises one or more (such as, e.g., one, two, three, or four) ring heteroatoms independently selected from O, S and N, and the remaining ring atoms are carbon atoms, wherein one or more S ring atoms (if present) and / or one or more N ring atoms (if present) may optionally be oxidized, and further wherein one or more carbon ring atoms may optionally be oxidized (i.e., to form an oxo group). "Heteroaryl" may, e.g., refer to thienyl (i.e., thiophenyl), furyl (i.e., furanyl), benzofuranyl, isobenzofuranyl, chromenyl, xanthenyl, phenoxathiinyl, pyrrolyl (e.g., 2H-pyrrolyl), imidazolyl, pyrazolyl, pyridyl (i.e., pyridinyl; e.g., 2-pyridyl, 3-pyridyl, or 4-pyridyl), pyrazinyl, pyrimidinyl, pyridazinyl, thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, furazanyl, 1 H-tetrazolyl, or 2H-tetrazolyl. Unless defined otherwise, a "heteroaryl" preferably refers to a 5 to 8 membered; even more preferably, a 5 or 6 membered monocyclic ring comprising one or more (e.g., one, two or three) ring heteroatoms independently selected from O, S and N, wherein one or more S ring atoms (if present) and / or one or more N ring atoms (if present) are optionally oxidized, and wherein one or more carbon ring atoms are optionally oxidized.

[0658] As used herein, the term "bicyclic heteroaryl" refers to an aromatic ring group, containing two, preferably anellated, rings, wherein one or both rings are aromatic. "Bicyclic heteroaryl" may, e.g., refer to benzo[b]thienyl, benzofuranyl, isobenzofuranyl, chromenyl, indolizinyl, isoindolyl, indolyl (e.g., 3H-indolyl), indazolyl, purinyl, isoquinolyl, quinolyl, phthalazinyl, naphthyridinyl, quinoxalinyl, cinnolinyl, 1 ,2-benzoisoxazol-3-yl, benzothiazolyl, benzoxazolyl, benzisoxazolyl, benzimidazolyl, coumarinyl, or chromonyl. Unless defined otherwise, a "bicyclic heteroaryl" preferably has 8 to 12 ring atoms, more preferably 9 or 10 ring atoms.

[0659] It is to be understood that expressions such as "five or six-membered heterocyclic group" indicate a heterocyclic group having 5 or 6 atoms in the ring. Similarly, expressions such as "five to tenmembered heteroaryl group" indicate a heteroaryl group having 5 to 10 atoms in the one or two rings. Thus, "x-membered" in the context of cyclic groups indicates the number x of ring atoms in the one or more rings but does not imply any limitations as to the number of non-ring atoms, such as hydrogens which are typically present as substituents on the ring(s).

[0660] The term “cycloalkyl” as used herein denotes in each case a monocyclic cycloaliphatic radical having usually from 3 to 10 or from 3 to 6 carbon atoms, such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclononyl and cyclodecyl or cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl. Cyclopropyl and cyclobutyl are preferred.

[0661] The term “carbocyclic”, “carbocyclyl”, or “carbocycle” includes, unless otherwise indicated, in general a 3- to 10-membered monocyclic ring, preferably a 4- to 8-membered or a 3- to 6-membered or a 5- to 7-membered monocyclic ring, more preferably a 3-, 4-, 5- or 6-membered monocyclic ring, comprising 3 to 10, preferably 4 to 8 or 3 to 6 or 5 to 7, more preferably 3, 4, 5 or 6 carbon atoms. Unless otherwise indicated, the carbocycle may be saturated, partially or fully unsaturated, or aromatic, wherein saturated means that only single bonds are present, and partially or fully unsaturated means that one or more double bonds may be present in suitable positions, while the Hiickel rule for aromaticity is not fulfilled, whereas aromatic means that the Hiickel (4n + 2) rule is fulfilled. Also “aryls” are covered by the term “carbocycles”. The term “aryl” or “aromatic carbocycle” refers to aromatic carbocyclic rings based on carbon atoms as ring members, preferably 6- membered aromatic carbocyclic rings based on carbon atoms as ring members. A preferred example is phenyl. The term “carbocyclic” or “carbocyclyl”, unless otherwise indicated, may therefore cover inter alia cycloalkyl, cycloalkenyl, as well as phenyl. Preferably, the term “carbocyclic” or “carbocyclyl” covers phenyl and cycloalkyl, for example phenyl, cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl.

[0662] The term "carbobicyclic" or “carbobicyclyl” includes in general 5 to 14-membered, preferably 7- to 12-membered or 6- to 10-membered, more preferably 7- or 10-membered bicyclic rings comprising 5 to 14, preferably 7 to 12 or 6 to 10, more preferably 7 or 10 carbon atoms. The carbobicycle may be saturated, partially or fully unsaturated, or aromatic, wherein saturated means that only single bonds are present, and partially or fully unsaturated means that one or more double bonds may be present in suitable positions, while the Hiickel rule for aromaticity is not fulfilled, whereas aromatic means that the Hiickel (4n + 2) rule is fulfilled. Preferably, the term “aromatic” in connection with the carbobicyclic ring means that both rings of the bicylic moiety are aromatic, so that, e.g., 8 IT electrons are present in case of a 10-membered aromatic carbobicyclic ring. The term “carbobicylce” or “carbobicyclyl”, unless otherwise indicated, may therefore cover inter alia bicycloalkyl, bicycloalkenyl, as well as bicyclic aromatic groups, for example bicyclohexane (decalin), bicycloheptane (such as norbornane), bicyclooctane (such as bicyclo[2.2.2]octane, bicyclo[3.2.1]octane or bicyclo[4.2.0]octane), bicyclononane (such as bicyclo[3.3.1]nonane or bicyclo[4.3.0]nonane ), bicyclodecane (such as bicyclo[4.4.0]decane), bicycloundecane (such as bicyclo[3.3.3]undecane), norbornene, naphthalene and the like. The carbobicyclyl can be a bridged carbobicyclyl, a fused carbobicyclyl or a spiro-carbobicyclyl. Preferably, the carbobicyclyl is a spiro- carbobicyclyl.

[0663] The term “carbocyclylalkyl” as used herein, refers to carbocyclyl as defined herein, which is bonded to the remainder of the molecule via an alkyl group having usually from 1 to 2 carbon atoms, preferably 1 carbon atom. Preferably, the term “carbocyclylalkyl” refers to phenylalkyl or cycloalkylalkyl, which refers to the corresponding groups being bonded to the remainder of the molecule via an alkyl group. Preferred examples of carbocyclylalkyl include benzyl (i.e. phenylmethyl), phenylethyl, cyclo propyl methyl, cyclopropylethyl, cyclobutylmethyl, cyclobutylethyl, cyclopentylmethyl, cyclopentylethyl, cyclohexylmethyl, cyclohexylethyl.

[0664] The term “carbobicyclylalkyl” as used herein, refers to carbobicyclyl as defined herein, which is bonded to the remainder of the molecule via an alkyl group having usually from 1 to 2 carbon atoms, preferably 1 carbon atom.

[0665] As used herein, the term “spiro-carbobicyclyl” or “spiro-carbobicyclic ring” refers, unless otherwise indicated, in general to a 7- to 10-membered, preferably 7- to 9-membered, more preferably 7- or 8- membered bicyclic ring comprising 7 to 10, preferably 7 to 9, more preferably 7 or 8 carbon atoms, wherein the two rings are connected via a single common carbon atom. The spiro-carbocyclic ring may be saturated or partially unsaturated, wherein saturated means that only single bonds are present and partially unsaturated means that one or more double bonds may be present in suitable positions, while the Hiickel rule for aromaticity is not fulfilled. Preferably, the spiro-carbobicyclic ring is saturated.

[0666] The term “heterocyclic” or “heterocyclyl” includes, unless otherwise indicated, in general a 3- to 10- membered, preferably a 4- to 8-membered or 5- to 7-membered, more preferably 5- or 6-membered, in particular 6-membered monocyclic ring. Unless indicated otherwise, the heterocycle may be saturated, partially or fully unsaturated, or aromatic, wherein saturated means that only single bonds are present, and partially or fully unsaturated means that one or more double bonds may be present in suitable positions, while the Hiickel rule for aromaticity is not fulfilled, whereas aromatic means that the Hiickel (4n + 2) rule is fulfilled. The heterocycle typically comprises one or more, e.g. 1 , 2, 3, or 4, preferably 1 , 2, or 3, more preferably 1 or two, even more preferably 1 , heteroatoms selected from N, O and S as ring members, where S-atoms as ring members may be present as S, SO or SO2. The remaining ring members are carbon atoms. In a preferred embodiment, the heterocycle is a saturated heterocycle, preferably a 4- to 6-membered saturated heterocycle comprising one or more, e.g. 1 , 2, or 3, preferably 1 or 2, more preferably 1 , heteroatoms selected from N, O and S as ring members, where S-atoms as ring members may be present as S, SO or SO2. Examples of aromatic heterocycles are provided below in connection with the definition of “hetaryl”. “Hetaryls” or “heteroaryls” are covered by the term “heterocycles”. The saturated or partially or fully unsaturated heterocycles usually comprise 1 , 2, 3, 4 or 5, preferably 1 , 2 or 3 heteroatoms selected from N, O and S as ring members, where S-atoms as ring members may be present as S, SO or SO2. The skilled person is aware that S, SO or SO2 is to be understood as follows:

[0667] Further, a skilled person is aware that resonance structures of the oxidized forms may be possible. Saturated heterocycles include, unless otherwise indicated, in general 3- to 10-membered, preferably 4- to 8-membered or 5- to 7-membered, more preferably 4- to 6-membered monocyclic rings comprising 3 to 10, preferably 4 to 8 or 5 to 7, more preferably 4 to 6 atoms comprising at least one heteroatom, such as oxetane, azetidine, pyrrolidine, tetrahydrothiophene, tetrahydrofuran, piperidine, tetrahydropyran, dioxane, morpholine or piperazine.

[0668] The term “heterobicyclic” or “heterobicyclyl” includes, unless otherwise indicated, in general 6 to 14-membered, preferably 7- to 12-membered or 8- to 10-membered, more preferably 8- or 9- membered bicyclic rings. The heterobicycle may be saturated, partially or fully unsaturated, or aromatic, wherein saturated means that only single bonds are present, and partially or fully unsaturated means that one or more double bonds may be present in suitable positions, while the Hiickel rule for aromaticity is not fulfilled, whereas aromatic means that the Hiickel (4n + 2) rule is fulfilled. For being “aromatic”, it is sufficient if one of the two rings of the bicyclic moieties is aromatic, while the other is non-aromatic. The heterobicycle typically comprises one or more, e.g. 1 , 2, 3, or 4, preferably 1 , 2, or 3 heteroatoms selected from N, O and S as ring members, where S-atoms as ring members may be present as S, SO or SO2. The remaining ring members are carbon atoms. Examples of heterobicycles include benzofuranyl, benzothienyl, indolyl, indazolyl, benzimidazolyl, benzoxathiazolyl, benzoxadiazolyl, benzothiadiazolyl, benzoxazinyl, quinolinyl, isoquinolinyl, purinyl, 1 ,8-naphthyridyl, pteridyl, pyrido[3,2-d]pyrimidyl, pyridoimidazolyl, triethylenediamine or quinuclidine and the like. The heterobicycle may be a fused heterobicyclyl, spiro heterobicyclyl, or bridged heterobicyclyl, preferably a spiro heterobicyclyl.

[0669] The term "hetaryl" or “heteroaryl” or “aromatic heterocycle” or “aromatic heterocyclic ring” includes monocyclic 5- or 6-membered aromatic heterocycles comprising as ring members 1 , 2, 3 or 4 heteroatoms selected from N, O and S, where S-atoms as ring members may be present as S, SO or SO2. Examples of 5- or 6-membered aromatic heterocycles include pyridyl (also referred to as pyridinyl), i.e. 2-, 3-, or 4-pyridyl, pyrimidinyl, i.e. 2-, 4- or 5-pyrimidinyl, pyrazinyl, pyridazinyl, i.e. 3- or 4-pyridazinyl, thienyl, i.e. 2- or 3-thienyl, furyl, i.e. 2-or 3-furyl, pyrrolyl, i.e. 2- or 3-pyrrolyl, oxazolyl, i.e. 2-, 3- or 5-oxazolyl, isoxazolyl, i.e. 3-, 4- or 5-isoxazolyl, thiazolyl, i.e. 2-, 3- or 5- thiazolyl, isothiazolyl, i.e. 3-, 4- or 5-isothiazolyl, pyrazolyl, i.e. 1-, 3-, 4- or 5-pyrazolyl, i.e. 1-, 2-, 4- or 5-imidazolyl, oxadiazolyl, e.g. 2- or 5-[1 ,3,4]oxadiazolyl, 4- or 5-(1 ,2,3-oxadiazol)yl, 3- or 5-(1 ,2,4- oxadiazol)yl, 2- or 5-(1 ,3,4-thiadiazol)yl, thiadiazolyl, e.g. 2- or 5-(1 ,3,4-thiadiazol)yl, 4- or 5-(1 ,2,3-th iadiazol)yl, 3- or 5-(1 ,2 ,4-thiadiazol)yl , triazolyl, e.g. 1 H-, 2H- or 3H-1 ,2 ,3-triazol-4-yl, 2H- triazol-3-yl, 1 H-, 2H-, or 4H-1 ,2,4-triazolyl and tetrazolyl, i.e. 1 H- or 2H-tetrazolyl. Unless otherwise indicated, the term “hetaryl” further covers “aromatic heterobicycles” as defined above.

[0670] The term “heterocyclylalkyl” as used herein, refers to a heterocyclyl as defined herein, which is bonded to the remainder of the molecule via an alkyl group having usually from 1 to 2 carbon atoms, preferably 1 carbon atom. Examples of heterocyclylalkyl include pyridinylmethyl, pyrimidinylmethyl, pyrazolylmethyl, and piperidinylmethyl.

[0671] The term “heterobicyclylalkyl” as used herein, refers to a heterocyclyl as defined herein, which is bonded to the remainder of the molecule via an alkyl group having usually from 1 to 2 carbon atoms, preferably 1 carbon atom. Examples of heterocyclylalkyl include pyridinylmethyl, pyrimidinylmethyl, pyrazolylmethyl, and piperidinylmethyl.

[0672] As used herein, the term “spiro-heterobicyclyl” or “spiro-heterobicyclic ring” refers, unless otherwise indicated, in general to a 7- to 10-membered, preferably 7- to 9-membered, more preferably 7- or 8- membered bicyclic ring, wherein said ring group contains one or more, e.g., 1 , 2, 3, or 4, preferably 1 , 2, or 3, more preferably 1 or 2, even more preferably 1 , ring heteroatoms independently selected from O, S and N, and the remaining ring atoms are carbon atoms, wherein one or more S ring atoms (if present) and / or one or more N ring atoms (if present) may optionally be oxidized. The spiro- heterocyclic ring may be saturated or partially unsaturated, wherein saturated means that only single bonds are present and partially unsaturated means that one or more double bonds may be present in suitable positions, while the Hiickel rule for aromaticity is not fulfilled. Preferably, the spiro- heterobicyclic ring is saturated.

[0673] As used herein, terms such as "binding to at least one member of the E3 ligase complex" do not necessarily imply that the binding has to be directly to a moiety of the E3 ligase. Rather the compound may bind to a protein being part of the E3 ligase complex or a protein which interacts (before or after binding of the compound to the protein, optionally as part of a complex of proteins) with the E3 ligase complex.

[0674] A skilled person will appreciate that the substituent groups comprised in the compounds of the present invention (in particular of formula (I)) may be attached to the remainder of the respective compound via a number of different positions of the corresponding specific substituent group. Unless defined otherwise, the preferred attachment positions for the various specific substituent groups are as illustrated in the examples.

[0675] As used herein, unless explicitly indicated otherwise or contradicted by context, the terms "a", "an" and "the" are used interchangeably with "one or more" and "at least one". Thus, for example, a composition comprising "a" compound of the present invention (in particular of formula (I)) can be interpreted as referring to a composition comprising "one or more" compounds of the present invention.

[0676] As used herein, the term "comprising" (or "comprise", "comprises", "contain", "contains", or "containing"), unless explicitly indicated otherwise or contradicted by context, has the meaning of "containing, inter alia", i.e., "containing, among further optional elements, ...". In addition thereto, this term also includes the narrower meanings of "consisting essentially of" and "consisting of'. For example, the term "A comprising B and C" has the meaning of "A containing, inter alia, B and C", wherein A may contain further optional elements (e.g., "A containing B, C and D" would also be encompassed), but this term also includes the meaning of "A consisting essentially of B and C" and the meaning of "A consisting of B and C" (i.e., no other components than B and C are comprised in A).

[0677] Moreover, unless indicated otherwise, any reference to an industry standard, a pharmacopeia, or a manufacturer’s manual refers to the corresponding latest version that was available at the priority date (i.e., at the earliest filing date) of the present specification.

[0678] The scope of the invention embraces all pharmaceutically acceptable salt forms of the compounds provided herein, particularly the compounds of the present invention (in particular of formula(l)), which may be formed, e.g., by protonation of an atom carrying an electron lone pair which is susceptible to protonation, such as an amino group, with an inorganic or organic acid, or as a salt of an acid group (such as a carboxylic acid group) with a physiologically acceptable cation. Exemplary base addition salts comprise, for example: alkali metal salts such as sodium or potassium salts; alkaline earth metal salts such as calcium or magnesium salts; zinc salts; ammonium salts; aliphatic amine salts such as trimethylamine, triethylamine, dicyclohexylamine, ethanolamine, diethanolamine, triethanolamine, procaine salts, meglumine salts, ethylenediamine salts, or choline salts; aralkyl amine salts such as N,N-dibenzylethylenediamine salts, benzathine salts, benethamine salts; heterocyclic aromatic amine salts such as pyridine salts, picoline salts, quinoline salts or isoquinoline salts; quaternary ammonium salts such as tetramethylammonium salts, tetraethylammonium salts, benzyltrimethylammonium salts, benzyltriethylammonium salts, benzyltributylammonium salts, methyltrioctylammonium salts or tetrabutylammonium salts; and basic amino acid salts such as arginine salts, lysine salts, or histidine salts. Exemplary acid addition salts comprise, for example: mineral acid salts such as hydrochloride, hydrobromide, hydroiodide, sulfate salts (such as, e.g., sulfate or hydrogensulfate salts), nitrate salts, phosphate salts (such as, e.g., phosphate, hydrogenphosphate, or dihydrogenphosphate salts), carbonate salts, hydrogencarbonate salts, perchlorate salts, borate salts, or thiocyanate salts; organic acid salts such as acetate, propionate, butyrate, pentanoate, hexanoate, heptanoate, octanoate, cyclopentanepropionate, decanoate, undecanoate, oleate, stearate, lactate, maleate, oxalate, fumarate, tartrate, malate, citrate, succinate, adipate, gluconate, glycolate, nicotinate, benzoate, salicylate, ascorbate, pamoate (embonate), camphorate, glucoheptanoate, or pivalate salts; sulfonate salts such as methanesulfonate (mesylate), ethanesulfonate (esylate), 2- hydroxyethanesulfonate (isethionate), benzenesulfonate (besylate), p-toluenesulfonate (tosylate), 2-naphthalenesulfonate (napsylate), 3-phenylsulfonate, or camphorsulfonate salts; glycerophosphate salts; and acidic amino acid salts such as aspartate or glutamate salts.

[0679] Moreover, the scope of the invention embraces the compounds provided herein, particularly the compounds of the present invention (in particular of formulae (I) as hydrate. The term “hydrate” in connection with the compounds of formula (I) refers to a compound of formula (I), which contains water or its constituent elements (i.e. H and OH). Preferably, a hydrate of the compounds of formula (I) is a compound of formula (I), which incorporates water molecules in the crystalline structure but does not alter the chemical structure of formula (I). It is to be understood that such hydrates of the compounds provided herein, particularly the compounds of the present invention, also include hydrates of pharmaceutically acceptable salts of the corresponding compounds.

[0680] Furthermore, the compounds provided herein, particularly the compounds of formulae (I), may exist in the form of different isomers, in particular stereoisomers (including, e.g., geometric isomers (or cis / trans isomers), enantiomers and diastereomers) or tautomers. All such isomers of the compounds provided herein are contemplated as being part of the present invention, either in admixture or in pure or substantially pure form. As for stereoisomers, the invention embraces the isolated optical isomers of the compounds according to the invention as well as any mixtures thereof (including, in particular, racemic mixtures / racemates). The racemates can be resolved by physical methods, such as, e.g., fractional crystallization, separation or crystallization of diastereomeric derivatives, or separation by chiral column chromatography. The individual optical isomers can also be obtained from the racemates via salt formation with an optically active acid followed by crystallization. The present invention further encompasses any tautomers of the compounds provided herein.

[0681] The scope of the invention also embraces the compounds provided herein, particularly the compounds of formula (I), in which one or more atoms are replaced by a specific isotope of the corresponding atom. For example, the invention encompasses compounds of formula (I), in which one or more hydrogen atoms (or, e.g., all hydrogen atoms) are replaced by deuterium atoms (i.e.,2H; also referred to as "D"). Accordingly, the invention also embraces compounds of formulae (I), which are enriched in deuterium. Naturally occurring hydrogen is an isotopic mixture comprising about 99.98 mol-% hydrogen-1 (1H) and about 0.0156 mol-% deuterium (2H or D). The content of deuterium in one or more hydrogen positions in the compounds of formula (I), can be increased using deuteration techniques known in the art. For example, a compound of formula (I) or a reactant or precursor to be used in the synthesis of the compound of formula (I) can be subjected to an H / D exchange reaction using, e.g., heavy water (D2O). Further suitable deuteration techniques are described in: Atzrodt J et al., Bioorg Med Chem, 20(18), 5658-5667, 2012; William JS et al., Journal of Labelled Compounds and Radiopharmaceuticals, 53(11-12), 635-644, 2010; or Modvig A et al., J Org Chem, 79, 5861-5868, 2014. The content of deuterium can be determined, e.g., using mass spectrometry or NMR spectroscopy. Unless specifically indicated otherwise, it is preferred that the compound of formula (I), is not enriched in deuterium. Accordingly, unless indicated otherwise, the presence of naturally occurring hydrogen atoms or1H hydrogen atoms in the compounds of formula (I), is preferred. The present invention also embraces the compounds provided herein, particularly the compounds of formula (I), in which one or more atoms are replaced by a positron-emitting isotope of the corresponding atom, such as, e.g.,18F,11C,13N,150,76Br,77Br,120l and / or124l. Such compounds can be used as tracers or imaging probes in positron emission tomography (PET). The invention thus includes (i) compounds of formula (I), in which one or more fluorine atoms (or, e.g., all fluorine atoms) are replaced by18F atoms, (ii) compounds of formula (I), (in which one or more carbon atoms (or, e.g., all carbon atoms) are replaced by11C atoms, (iii) compounds of formula (I), in which one or more nitrogen atoms (or, e.g., all nitrogen atoms) are replaced by13N atoms, (iv) compounds of formula (I), in which one or more oxygen atoms (or, e.g., all oxygen atoms) are replaced by15O atoms, (v) compounds of formula (I), in which one or more bromine atoms (or, e.g., all bromine atoms) are replaced by76Br atoms, (vi) compounds of formula (I), in which one or more bromine atoms (or, e.g., all bromine atoms) are replaced by77Br atoms, (vii) compounds of formula (I), in which one or more iodine atoms (or, e.g., all iodine atoms) are replaced by120l atoms, and (viii) compounds of formula (I), in which one or more iodine atoms (or, e.g., all iodine atoms) are replaced by124l atoms. In general, it is preferred that none of the atoms in the compounds of formula (I), are replaced by specific isotopes.

[0682] 2.2. Further definitions

[0683] As used herein, "disorder," a "disease," or a "condition," as used interchangeably herein, is any condition that would benefit from treatment with a pharmaceutical composition described herein. This includes chronic and acute disorders or diseases including those pathological conditions which predispose the mammal to the disorder in question.

[0684] As used herein, "pharmaceutical composition" or "pharmaceutical formulation" refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the pharmaceutical composition would be administered.

[0685] As used herein, "pharmaceutically acceptable" as used in connection with a composition of the invention refers to molecular entities and other ingredients of such compositions that are physiologically tolerable and do not produce undesired reactions when administered to a mammal (e.g., human). The term "pharmaceutically acceptable" can also mean approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in mammals, and more particularly in humans. A "pharmaceutically acceptable carrier" refers to an ingredient in a pharmaceutical composition or formulation, other than an active ingredient, which is nontoxic to a subject.

[0686] As used herein, "treatment" refers to clinical intervention in an attempt to alter the natural course of a disease in the individual being treated, and can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects of treatment include, but are not limited to, preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis. "Alleviation," "alleviating," or equivalents thereof, refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to ameliorate, prevent, slow down (lessen), decrease or inhibit a disease or condition, e.g., the formation of atherosclerotic plaques. Those in need of treatment include those already with the disease or condition as well as those prone to having the disease or condition or those in whom the disease or condition is to be prevented. As used herein, “solid cancer” is an abnormal mass of tissue that usually does not contain cysts or liquid areas. Solid tumors may be benign (not cancer), or malignant (cancer). Thus, the term “solid cancer” refers to malignant solid tumors. Examples of solid tumor cancers are sarcomas, carcinomas, and lymphomas. Leukemias (cancers of the blood) generally do not form solid tumors.

[0687] As used herein, “linker” refers to a moiety covalently connecting the compound of formula (I) with the targeting moiety T. Preferably, the linker is a short, flexible, rigid, cleavable, hydrophilic or hydrophobic chain. A cleavable linker can in particular be cleaved in response to environmental differences such as redox potential, the presence of an enzyme (in particular a protease), and pH. Accordingly, a cleavable linker is able to release the compound of formula (I) because of an environmental difference, in particular the presence of an enzyme in the lysosome, or a change in the redox potential or the pH in the lysosome.

[0688] As used herein, “targeting moiety” refers to a moiety that has targeting capabilities, in particular in that it specifically targets a specific antigen, preferably a tumor antigen. Targeting in this context means that the moiety specifically binds to or is immunologically reactive towards the specific antigen. Preferred antigens include proteins, preferably proteins that can only be found in or on tumor cells. Suitable targeting moieties include antibodies, an antigen-binding fragment thereof, nucleic acid based molecules, carbohydrates, peptides or modified peptides. A preferred targeting moiety according to the invention is an antibody or an antigen-binding fragment thereof. Thus, a preferred conjugate according to the invention is an antibody-drug conjugate (ADC). The targeting moiety directs the compound of formula (I) of the conjugate specifically to a cell, in particular a tumor cells, in order to deliver the compound of formula (I) in a cell-specific manner.

[0689] As used herein, "patient" or "individual" or "subject" is a mammal. Mammals include, but are not limited to, domesticated animals (e.g. cows, sheep, cats, dogs, and horses), primates (e.g. humans and non-human primates such as monkeys), rabbits, and rodents (e.g. mice and rats). Preferably, the patient, individual, or subject is a human. In one embodiment, the patient may be a "cancer patient”, i.e. a patient who is suffering or at risk for suffering from one or more symptoms of cancer.

[0690] As used herein, “compound-linker construct” refers to a construct comprising a compound of formula (I) as defined herein and a linker L as defined herein, which are covalently bonded to each other as explained in detail herein.

[0691] As used herein, “conjugate” refers to a conjugate comprising a compound of formula (I), a linker L, and a targeting moiety T, wherein the linker L links the compound of formula (I) to the targeting moiety T by covalent bonds. The targeting moiety may have from 1 to 30 compounds of formula (I) attached via a linker L (wherein 8 compounds of formula (I) attached via a linker L are preferred when it comes to ADCs), wherein the linker L may in each case be identical, which is preferred, or different linkers L may be present.

[0692] As used herein, "antibody drug conjugate" ("ADC") refers to conjugate as defined herein, wherein the targeting moiety T is an antibody or an antigen-binding fragment thereof.

[0693] As used herein, “antibody” can refer to an immunoglobulin molecule that specifically binds to, or is immunologically reactive towards, a specific antigen. Antibodies can include, for example, polyclonal, monoclonal, and genetically engineered antibodies. As used herein, “leaving group” refers to an atom or group of atoms that detaches from the main or residual part of a substrate during a reaction or elementary step of a reaction, in particular an atom or group of atoms that departs with a pair of electrons in heterolytic bond cleavage. Examples of a leaving group include OH, SH, NH2, or NH(RA).

[0694] 2.3. A potential mechanism of action

[0695] As shown in the examples herein, the compound of formula (I) degrades one or more target protein(s), in particular CCNK, CD12 and / or CDK13, most likely via interaction with a component of the cullin RING E3 ligase present in several family members of the cullin RING E3 ligase. Particularly, the family members of the cullin RING E3 ligase can be diversified, e.g., by their respective substrate receptors, such as CRBN or DCAF15. The compound of formula (I) binds to components of the cullin RING E3 ligase family and most likely degrade the one or more target protein(s) independent from the substrate receptor. The mechanism of action of a compound of formula (I), which may be described as “molecular glue” resulting in degradation of one or more target protein(s), in particular CDK12, CDK13 and / or cyclin K (CCNK), seems to rely on the ability of a molecular glue to orchestrate protein-protein interactions between a cullin RING E3 ligase complex and one or more target protein(s) to be degraded. This can e.g. be achieved by stabilizing an interaction of CDK12 and / or CDK13 bound to CCNK with the cullin RING E3 ligase complex, particularly one or more components of the cullin RING E3 ligase such as CUL4B and / or DDB1 .

[0696] The "induction of ubiquitination of a target protein" may comprise the conformational change of the target protein that has been induced as a direct consequence of binding / interaction with said compound inducing the ubiquitination of the target protein. For example, binding of a compound as described herein to a target protein may lead to a conformational change of said protein and thereby stabilize an interaction of one or more target protein(s) with one or more component(s) of the E3 ligase complex that results in ubiquitination and degradation of said one or more target protein(s). Particularly, a compound binding to CDK12 / 13:CCNK may prompt interaction with a DDB1 :CUL4B E3 ligase complex, leading to the ubiquitination and degradation of CCNK. Thereby, a target protein such as CCNK may be degraded via a direct or an indirect binding mechanism of a compound as described herein, such as by binding of said compound to a protein associated with a target protein. A compound may bind to CDK12 / 13, which is associated with CCNK, thereby leading to the ubiquitination and degradation of CCNK. In particular, the compound of the present invention may bind to the active site of CDK12 / 13, thereby prompting a change in structural conformation, which promotes the binding of CDK12:CCNK and CDK13:CCNK, respectively, to DDB1 :CUL4B. As such, CDK12 and CDK13 basically serve to present CCNK to the ligase, leading to the degradation of CCNK, followed by a potentially slightly weaker degradation of CDK12 and CDK13.

[0697] 3. Examples

[0698] List of abbreviations: abbreviation Explanation pM Micromolar pmol Micromoles

[0699] DCM Dichloromethane

[0700] DIEA Diisopropylethylamine

[0701] DIPA Diisoproylamine

[0702] DMF N,N-dimethylformamide DMSO dimethyl sulfoxide

[0703] EA ethyl acetate

[0704] ESI I ES electron spray ionization

[0705] FA formic acid h hours

[0706] HATU Hexafluorophosphate Azabenzotriazole Tetramethyl Uranium

[0707] Hex Hexanes

[0708] HPLC high performance liquid chromatography

[0709] IPA Isopropanol

[0710] LC liquid chromatography

[0711] LCMS liquid chromatography coupled mass spectrometry

[0712] LDA lithium diisopropyl amide

[0713] MeCN Acetonitrile

[0714] MeOH Methanol min minutes mM Millimolar mmol Millimoles mg Milligrams mL MilliLiters

[0715] MTBE Methyl tert-Butyl Ether

[0716] MHz MegaHetrz

[0717] NCS N-chlorosuccinimide

[0718] NMR Nuclear Magnetic Resonance

[0719] PE petroleum ether ppm parts per million

[0720] T3P Propanephosphonic acid anhydride

[0721] TEA Triethyl amine

[0722] TFA triflouro acetic acid

[0723] THF Tetrahydrofuran

[0724] EXAMPLE 1 : Synthesis

[0725] Instrument specifications:

[0726] NMR:

[0727] Bruker AVANCE DRX 500

[0728] Varian UNITYplus 400

[0729] Bruker Avance NEO 400 MHz

[0730] Proton nuclear magnetic resonance spectra (NMR) were recorded at 400 MHz or 500 MHz.

[0731] Chemical shifts (5) are given in parts per million (ppm) and are listed upfield with tetramethylsilane as a reference. Peaks are described as singlets (s), doublets (d), triplets (t), quartets (q), quintets (quint) multiplets (m) and broad (br.).

[0732] LCMS:

[0733] Shimadzu LCMS-2020 Series LC / MSD system with PDA SPD-M40 and Shimadzu LCMS-2020 mass-spectrometer

[0734] Shimadzu LCMS-2020 Series LC / MSD system with PDA\ELSD SPD-M40 / LT HI and Shimadzu LCMS-2020 mass-spectrometer. Shimadzu LCMS-2020 Series LC / MSD system with PDA\ELSD SPD-M40 / 3300HP and Shimadzu LCMS-2020 mass-spectrometer.

[0735] Shimadzu LCMS-2020 Series LC / MSD system with PDA SPD-M20A and Shimadzu LCMS-2020 mass-spectrometer.

[0736] Shimadzu LCMS-2020 Series LC / MSD system with PDA\ELSD SPD-M20A / 3300HP and Shimadzu LCMS-2020 mass-spectrometer.

[0737] Method A:

[0738] Column: EVO C18 3.0 x 50 mm, 2.6 pm

[0739] Temperature: 40 °C

[0740] Mobile phase A: water containing 5 mM NH4HCO3

[0741] Mobile phase B: MeCN

[0742] Flow rate: 1 .5 mL / min

[0743] Elution Gradient: 0.01 min - 10% B, 1.20 min - 95% B, 1.70 min: 95% B, 1.75 min: 10% B

[0744] Injection volume: 0.5pl

[0745] Ionization mode: Electrospray ionization (ESI)

[0746] Scan range: m / z 90-900

[0747] PDA: 254 nm, 220 nm, 200 nm

[0748] Method B:

[0749] Column: Express C18 3.0 x 30 mm, 2.6 pm

[0750] Temperature: 40 °C

[0751] Mobile phase A: water containing 0.1% FA

[0752] Mobile phase B: MeCN

[0753] Flow rate: 1 .5 mL / min

[0754] Elution Gradient: 0.01 min - 5% B, 0.80 min - 95% B, 1 .20 min: 95% B, 1 .25 min: 5% B

[0755] Injection volume: 0.5pl

[0756] Ionization mode: Electrospray ionization (ESI)

[0757] Scan range: m / z 50-1500

[0758] PDA: 254 nm, 220 nm, 200 nm

[0759] Method C:

[0760] Column: EVO C18 3.0 x 50 mm, 2.6 pm

[0761] Temperature: 40 °C

[0762] Mobile phase A: water containing 5 mM NH4HCO3

[0763] Mobile phase B: MeCN

[0764] Flow rate: 1 .5 mL / min

[0765] Elution Gradient: 0.01 min - 10% B, 2.00 min - 70% B, 2.20 min - 95% B, 2.60 min: 95% B, 2.75 min: 10% B

[0766] Injection volume: 0.5pl

[0767] Ionization mode: Electrospray ionization (ESI)

[0768] Scan range: m / z 90-900

[0769] PDA: 254 nm, 220 nm, 200 nm

[0770] Method D:

[0771] Column: HALO C18 3.0 x 30 mm, 2.0pm

[0772] Temperature: 40 °C

[0773] Mobile phase A: water containing 0.1% FA

[0774] Mobile phase B: MeCN containing 0.1 % FA Flow rate: 1 .5 mL / min

[0775] Elution Gradient: 0.01 min - 5% B, 1.80 min - 70% B, 2.00 min: 100% B, 2.70 min: 100% B, 2.80 min: 5% B

[0776] Injection volume: 0.5pl

[0777] Ionization mode: Electrospray ionization (ESI)

[0778] Scan range: m / z 90-900

[0779] PDA: 254 nm, 220 nm, 200 nm

[0780] Method E:

[0781] Column: Shim-pack Scepter C18 3.0 x 33 mm, 2.7 pm

[0782] Temperature: 40 °C

[0783] Mobile phase A: water containing 0.1% FA

[0784] Mobile phase B: MeCN containing 0.1 % FA

[0785] Flow rate: 1 .5 mL / min

[0786] Elution Gradient: 0.01 min - 5% B, 1.2 min - 100% B, 1.80 min: 100% B, 1.82 min: 5% B

[0787] Injection volume: 0.5pl

[0788] Ionization mode: Electrospray ionization (ESI)

[0789] Scan range: m / z 90-900

[0790] PDA: 254 nm, 220 nm, 200 nm

[0791] Method F:

[0792] Column: Agilent Poroshell 120 SB-C18 4.6x30mm, 2.7 pm

[0793] Column Temperature: 60°C

[0794] Mobile phase: A - water, B - acetonitrile

[0795] Flow rate: 3 ml / min

[0796] Gradient: 0.01 min -1% B, 1.5 min - 100% B, 1.73 min - 100% B,

[0797] MS Ionization mode: Electrospray ionization (ESI)

[0798] MS Scan range: 83 - 600 m / z

[0799] UV detection: 215 nm, 254nm, 280 nm

[0800] Method G:

[0801] Column: XBridge BEH C18(50 x 2.1 mm) 2.5 pm,

[0802] Column Temperature: 40 °C,

[0803] Mobile phase A: 0.1 % HCOOH in water, Mobile phase B: 0.05% HCOOH in ACN,

[0804] Flow rate: 1 .0 mL / min,

[0805] Elution Gradient: 0.00 min - 5% B, 1.5 min - 100% B, 1.9 min-100% B, 1.91 min-05% B, 2.20- 05%, Injection volume: 0.4 pL,

[0806] Ionization mode: Electrospray ionization (ESI), Scan range: 50-1000 AMU , PDA: 210nm-350nm.

[0807] Method H:

[0808] Column: ACQUITY BEH C8 (50 x 2.1 mm)1 .7 pm,

[0809] Column Temperature: 40 °C,

[0810] Mobile phase A: 5mM Ammonium bicarbonate in water, Mobile phase B: ACN,

[0811] Flow rate: 1 .0 mL / min,

[0812] Elution Gradient: 0.0 min - 5% B, 1.50 min - 100% B, 1.90 min-100% B, 2.0 min- 5% B, 2.20 min- 5 % B,

[0813] Injection volume: 0.2 pL,

[0814] Ionization mode: Electrospray ionization (ESI), Scan range: 50-1000 AMU , PDA: 210nm-350nm.

[0815] SFC:

[0816] Method A:

[0817] Instrument: PIC 100,

[0818] Column: YMC Cellulose C(250*30) mm, 15pm;

[0819] Mobile Phase: CO2 : isopropyl amine in IPA (65:35);

[0820] Total Flow: 70 mL / min; Back pressure: 100 bar;

[0821] Wavelength: 220 nm;

[0822] Cycle time: 11.5 min

[0823] Method B:

[0824] Instrument: PIC 100;

[0825] Column: Chiralpak IA (250 x 20) mm, 5pm;

[0826] Mobile Phase: CO2: MeOH (60:40);

[0827] Total Flow: 50 ml / min; Back pressure: 100 bar;

[0828] Wavelength: 210 nm;

[0829] Cycle time: 5.50 min.

[0830] Synthetic procedures

[0831] PART 1 : Synthesis of compounds that can be conjugated to a linker

[0832] Synthesis of Compound 1

[0833] 2-[3-(4-bromopyrazol-1-yl)phenyl]propan-2-ol To a stirred solution of 2-(3-bromophenyl)propan-2-ol (2 g, 9.298 mmol) and 4-bromopyrazole (1.37 g, 9.298 mmol) in DMSO (40 mL) were added K2CO3 (1 .29 g, 9.298 mmol) and Cui (0.35 g, 1 .860 mmol). The resulting mixture was stirred for 4 h at 120 °C under a nitrogen atmosphere. The mixture was allowed to cool down to room temperature and quenched with saturated NH4CI (aq.) (200 mL). The resulting mixture was extracted with Ethyl acetate (3 x 200 mL). The combined organic extracts were washed with brine (2 x 200 mL) and dried over anhydrous Na2SC>4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with DCM I petroleum ether (5:1) to afford 2-[3-(4-bromopyrazol-1- yl)phenyl]propan-2-ol (450 mg, 17% yield) as a white solid.

[0834] LCMS Retention time (Method A) 1 .100 min; m / z 281 (M+H)

[0835] Tert-butyl 2-{1-[3-(2-hydroxypropan-2-yl)phenyl]pyrazol-4-yl}acetate

[0836] To a stirred solution of 2-[3-(4-bromopyrazol-1-yl)phenyl]propan-2-ol (450 mg, 1.601 mmol) and 2- tert-butoxy-2-oxoethylzinc bromide (833.70 mg, 3.202 mmol) in THF (20 mL) was added PdCl2(Amphos)2 (113.33 mg, 0.160 mmol). The reaction was stirred for 5 h at 65 °C under a nitrogen atmosphere. The mixture was allowed to cool down to room temperature and quenched with water (100 mL). The mixture was extracted with Ethyl acetate (3 x 100 mL). The combined organic extracts were washed with brine (2 x 100 mL) and dried over anhydrous Na2SC>4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with petroleum ether / ethyl acetate (7:1) to afford tert-butyl 2-{1-[3-(2- hydroxypropan-2-yl)phenyl]pyrazol-4-yl}acetate (270 mg, 53% yield) as a yellow oil.

[0837] LCMS Retention time (Method E) 1.444 min; m / z 317 (M+H)

[0838] {1 -[3-(prop-1 -en-2-yl)phenyl]pyrazol-4-yl}acetic acid

[0839] A solution of tert-butyl 2-{1-[3-(2-hydroxypropan-2-yl)phenyl]pyrazol-4-yl}acetate (271 mg, 0.857 mmol) in TFA (3 mL) and DCM (6 mL) was stirred for 1 h at room temperature. The mixture was concentrated under reduced pressure to afford {1-[3-(prop-1-en-2-yl)phenyl]pyrazol-4-yl}acetic acid (180 mg, 87% yield) as a yellow oil.

[0840] LCMS Retention time (Method D) 0.915 min; m / z 243 (M+H)

[0841] Tert-butyl 3-cyclopropyl-5-(2-{1 -[3-(prop-1 -en-2-yl)phenyl]pyrazol-4-yl}acetamido)pyrazole-1 - carboxylate

[0842] To a stirred solution of {1-[3-(prop-1-en-2-yl)phenyl]pyrazol-4-yl}acetic acid (180 mg, 0.743 mmol) and tert-butyl 5-amino-3-cyclopropylpyrazole-1 -carboxylate (165.88 mg, 0.743 mmol) in DCM (10 mL) were added DIEA (576.14 mg, 4.458 mmol) and T3P (472.79 mg, 1 .486 mmol). The reaction was stirred for 3 h at room temperature. The mixture was concentrated under reduced pressure and the residue purified by silica gel column chromatography eluting with petroleum ether / ethyl acetate (1 :1) to afford tert-butyl 3-cyclopropyl-5-(2-{1-[3-(prop-1-en-2-yl)phenyl]pyrazol-4- yl}acetamido)pyrazole-1 -carboxylate (140 mg, 42% yield) as a yellow oil.

[0843] LCMS Retention time (Method A) 1 .402 min; m / z 448 (M+H)

[0844] Tert-butyl 3-cyclopropyl-5-(2-(1 -(3-(2-methyloxiran-2-yl)phenyl)-1 H-pyrazol-4-yl)acetamido)- 1 H-pyrazole-1 -carboxylate

[0845] A mixture of tert-butyl 5-cyclopropyl-3-(2-{1-[3-(prop-1-en-2-yl)phenyl]pyrazol-4- yl}acetamido)pyrazole-1-carboxylate (140 mg, 0.313 mmol) and meta-Chloroperoxybenzoic acid (107.96 mg, 0.626 mmol.) in dichloromethane (5 mL) was stirred for 1 h at room temperature under a nitrogen atmosphere. The reaction was quenched with water and extracted with ethyl acetate (3 x 30 mL). The combined organic extracts were washed with water (3 x 20 mL) and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with petroleum ether / ethyl acetate (12:1) to afford tert-butyl 5-cyclopropyl-3-(2-{1-[3-(2-methyloxiran-2-yl)phenyl]pyrazol-4- yl}acetamido)pyrazole-1 -carboxylate (100 mg, 69% yield) as a yellow solid.

[0846] LCMS Retention time (Method B) 1 .155 min; m / z 464 (M+H)

[0847] N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1 -(3-(2-hydroxypropan-2-yl)phenyl)-1 H-pyrazol-4- yl)acetamide

[0848] A mixture of tert-butyl 5-cyclopropyl-3-(2-{1-[3-(2-methyloxiran-2-yl)phenyl]pyrazol-4- yl}acetamido)pyrazole-1 -carboxylate (100 mg, 0.216 mmol) and UAIH4 (24.56 mg, 0.648 mmol) in THF (5 mL) was stirred for 3 h at room temperature under a nitrogen atmosphere. The reaction was quenched with NH4CI (aq.) at -20 °C and extracted with ethyl acetate (3 x 20 mL). The combined organic extracts were washed with water (3 x 20 mL) and dried over anhydrous Na2SC>4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with petroleum ether / ethyl acetate (12:1) and then Prep-HPLC (Mobile Phase A: Water [10 mmol / L NH4HCO3], Mobile Phase B: MeCN; Gradient: 16% B to 31% B) to afford N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-{1-[3-(2-hydroxypropan-2-yl)phenyl]pyrazol-4- yl}acetamide, compound 1 , (31 .2 mg, 39% yield) as a white solid.

[0849] LCMS Retention time (Method C) 1.499 min; m / z 366 (M+H).

[0850] Synthesis of Compound 2

[0851] Methyl 2-[1 -(3-nitrophenyl)-1 H-pyrazol-4-yl]acetate

[0852] A mixture of methyl 2-(1 H-pyrazol-4-yl)acetate hydrochloride (150.0 mg, 852.1 pmol), 1-iodo-3- nitrobenzene (211.61 mg, 850.08 pmol), potassium carbonate (352.35 mg, 2.55 mmol), copper iodide (8.09 mg, 42.63 pmol) and (1 R,2R)-N1 ,N2-dimethylcyclohexane-1 ,2-diamine (24.18 mg, 170.08 pmol) in degassed anhydrous toluene (6 ml) was heated under argon at 110°C for 16 h. After cooling to room temperature, the solvent was evaporated and the residue was dissolved in ethyl acetate (20 mL). The organic phase was washed with water (3 x 2 mL), dried over Na2SC>4 and evaporated under reduced pressure to afford methyl 2-[1-(3-nitrophenyl)-1 H-pyrazol-4-yl]acetate (120.0 mg, 459.36 pmol, 54.1 % yield). 2-[1 -(3-nitrophenyl)-1 H-pyrazol-4-yl]acetic acid

[0853] To a solution of methyl 2-[1-(3-nitrophenyl)-1 H-pyrazol-4-yl]acetate ( 0.12 g, 0.46 mmol) in a mixture of THF (3 ml) / H2O (1 ml) was added lithium hydroxide hydrate (21 mg, 0.5 mmol) at 0 °C. The mixture was stirred overnight at room temperature and the THF was removed under reduced pressure. The aqueous solution was washed with methyl tert-butyl ether (3 x 1 ml) and concentrated to afford the lithium salt of 2-[1-(3-nitrophenyl)-1 H-pyrazol-4-yl]acetate (0.1 g, 0.4 mmol, 86% yield).

[0854] N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-[1 -(3-nitrophenyl)-1 H-pyrazol-4-yl]acetamide

[0855] To a mixture of the lithium salt of 2-[1-(3-nitrophenyl)-1 H-pyrazol-4-yl]acetate (50 mg, 202 pmol) and 1-[Bis(dimethylamino)methylene]-1 H-1 ,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate (86 mg, 223 pmol) in DMF (1 mL) was added 3-cyclopropyl-1 H-pyrazol-5-amine (49.98 mg, 406.1 pmol) and the mixture was stirred overnight at room temperature. The mixture was purified by HPLC (20-50% 0-5 min H2O / MeCN / 0.1 %FA, flow: 30 ml / min (loading pump 4 ml / min acetonitrile); column: Chromatorex 18 SMB100-5T 100x19 mm 5 pm) to afford N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-[1-(3- nitrophenyl)-1 H-pyrazol-4-yl]acetamide (8.0 mg, 22.7 pmol, 11 % yield).

[0856] 2-[1 -(3-aminophenyl)-1 H-pyrazol-4-yl]-N-(5-cyclopropyl-1 H-pyrazol-3-yl)acetamide

[0857] To a solution of N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-[1-(3-nitrophenyl)-1 H-pyrazol-4-yl]acetamide ( 8 mg, 22 pmol) in ethanol (1 mL) was added Pd / C (5 mg, 10% wt.). The resulting mixture was placed under a hydrogen atmosphere at ambient pressure and ambient temperature overnight. The catalyst was filtered off and the filtrate was concentrated under reduced pressure. The residue was purified by HPLC (20-50% 0-5 min H2O / MeCN / 0.1 %FA, flow: 30 ml / min (loading pump 4 ml / min acetonitrile); column: Chromatorex 18 SMB100-5T 100x19 mm 5 pm) to afford 2-[1-(3-aminophenyl)-1 H-pyrazol- 4-yl]-N-(5-cyclopropyl-1 H-pyrazol-3-yl)acetamide, compound 2, ( 1.3 mg, 4 pmol, 19% yield). LCMS Retention time (Method F) 0.909 min; m / z 323.0 (M+H).

[0858] Synthesis of compound 3

[0859] 2-[1-(3-{[(tert-butyldimethylsilyl)oxy]methyl}phenyl)-1 H-pyrazol-4-yl]-N-[5-(trifluoromethyl)- 1 ,3-thiazol-2-yl]acetamide

[0860] To a stirred solution of 2-[1-(3-[(tert-butyldimethylsilyl)oxy]methylphenyl)-1 H-pyrazol-4-yl]acetic acid (200.0 mg, 577.75 pmol) and 5-(trifluoromethyl)-1 ,3-thiazol-2-amine (97.17 mg, 578.4 pmol) in DMF (2 mL) was added 1-[bis(dimethylamino)methylene]-1 H-1 ,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate (241.71 mg, 635.92 pmol) and 4-methylmorpholine (70.14 mg, 693.92 pmol). The reaction mixture was stirred at room temperature overnight, diluted with water, and extracted with ethyl acetate (10 mL). The organic layer was washed with water (3 x 1 mL), dried over Na2SC>4, and concentrated under reduced pressure to afford 2-[1-(3-[(tert- butyldimethylsilyl)oxy]methylphenyl)-1 H-pyrazol-4-yl]-N-[5-(trifluoromethyl)-1 ,3-thiazol-2- yl]acetamide (200.0 mg, 402.72 pmol, 69.7% yield).

[0861] 2-{1 -[3-(hydroxymethyl)phenyl]-1 H-pyrazol-4-yl}-N-[5-(trifluoromethyl)-1 ,3-thiazol-2- yl]acetamide

[0862] To a solution of 2-[1-(3-[(tert-butyldimethylsilyl)oxy]methylphenyl)-1 H-pyrazol-4-yl]-N-[5- (trifluoromethyl)-1 ,3-thiazol-2-yl]acetamide (200.0 mg, 403.1 pmol) in a mixture of MeOH (2 mL) / H2O (0.5 mL) was added potassium fluoride (117.0 mg, 2.02 mmol). The reaction mixture was stirred at room temperature for 1 h and then purified by HPLC (20-50% 0-5 min f / MeCN, flow: 30 ml / min (loading pump 4 ml / min acetonitrile); column: Chromatorex 18 SMB100-5T 100x19 mm 5 pm) to afford 2-1-[3-(hydroxymethyl)phenyl]-1 H-pyrazol-4-yl-N-[5-(trifluoromethyl)-1 ,3-thiazol-2- yl]acetamide, compound 3, (36.7 mg, 95.98 pmol, 23.8% yield).

[0863] 1H NMR (DMSO-d6, 500 MHz) 5 (ppm): 3.69 (s, 2H), 4.52 (s, 2H), 5.30 (br s, 1 H), 7.19 (d, 1 H), 7.39 (dd, 1 H), 7.60 (m, 2H), 7.73 (s, 1 H), 7.95 (s, 1 H), 8.33 (s, 1 H).

[0864] LCMS Retention time (Method F) 1.067 min; m / z 383.0 (M+H).

[0865] Synthesis of compound 4

[0866] 2-[1-(3-{[(tert-butyldimethylsilyl)oxy]methyl}phenyl)-1 H-pyrazol-4-yl]-N-[5-(propan-2-yl)-1H- pyrazol-3-yl]acetamide

[0867] To a stirred solution of 2-[1-(3-[(tert-butyldimethylsilyl)oxy]methylphenyl)-1 H-pyrazol-4-yl]acetic acid (200.0 mg, 577.75 pmol) and 3-(propan-2-yl)-1 H-pyrazol-5-amine (72.29 mg, 577.89 pmol) in DMF (2 mL) was added 1-[bis(dimethylamino)methylene]-1 H-1 ,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate (241.56 mg, 635.51 pmol) and 4-methylmorpholine (70.1 mg, 693.47 pmol). The reaction mixture was stirred at room temperature overnight, diluted with water, and extracted with ethyl acetate (10 mL). The organic phase was washed with water (3 x 1mL), dried over Na2SC>4, and concentrated under reduced pressure to obtain 2-[1-(3-[(tert- butyldimethylsilyl)oxy]methylphenyl)-1 H-pyrazol-4-yl]-N-[5-(propan-2-yl)-1 H-pyrazol-3-yl]acetamide (210.0 mg, 462.91 pmol, 80.2% yield). 2-{1-[3-(hydroxymethyl)phenyl]-1H-pyrazol-4-yl}-N-[5-(propan-2-yl)-1H-pyrazol-3-yl]acetamide

[0868] To a solution of 2-[1 -(3-[(tert-butyldimethylsilyl)oxy]methylphenyl)-1 H-pyrazol-4-yl]-N-[5-(propan-2- yl)-1 H-pyrazol-3-yl]acetamide ( 0.21 g, 462.91 pmol) in a mixture of MeOH (2 mL) / H2O (0.5 mL) was added potassium fluoride (134 mg, 2.3 mmol). The reaction mixture was stirred at room temperature for 1 h. It was then purified by HPLC (20-50% 0-5 min H2O / MeCN, flow: 30 ml / min (loading pump 4 ml / min acetonitrile); column: Chromatorex 18 SMB100-5T 100x19 mm 5 pm) to afford 2-1 -[3- (hydroxymethyl)phenyl]-1 H-pyrazol-4-yl-N-[5-(propan-2-yl)-1 H-pyrazol-3-yl]acetamide, compound 4, (50.0 mg, 147.32 pmol, 31.8% yield).

[0869] 1H NMR (DMSO-d6, 500 MHz) 5 (ppm): 1.13 (m, 6H), 2.82 (m, 1 H), 3.50 (m, 2H), 4.52 (m, 2H), 5.24 (br s, 1 H), 6.21 (s, 1 H), 7.15 (d, 1 H), 7.38 (dd, 1 H), 7.65 (m, 2H), 7.74 (s, 1 H), 8.29 (s, 1 H), 10.40 (s, 1 H), 12.01 (br s, 1 H).

[0870] LCMS Retention time (Method F) 0.844 min; m / z 340.2 (M+H).

[0871] Synthesis of compound 5

[0872] The synthesis of tert-butyl(3-iodophenoxy)dimethylsilane

[0873] To a mixture of 3-iodophenol (600.0 mg, 2.73 mmol), tert-butyl(chloro)dimethylsilane (493.47 mg, 3.29 mmol) and 1 H-imidazole (222.89 mg, 3.28 mmol) in DCM (6 mL) was added N,N- dimethylpyridin-4-amine (66.66 mg, 546.04 pmol). The mixture was stirred overnight at room temperature and then the precipitate was removed by filtration. The DCM solution was washed with water (3 x 2 mL) dried over Na2SO4 and concentrated in vacuo to yield tert-butyl(3- iodophenoxy)dimethylsilane (620.0 mg, 1.85 mmol, 68% yield). methyl 2-(1-{3-[(tert-butyldimethylsilyl)oxy]phenyl}-1H-pyrazol-4-yl)acetate

[0874] A mixture of tert-butyl(3-iodophenoxy)dimethylsilane (311 .99 mg, 934.02 pmol), methyl 2-(1 H- pyrazol-4-yl)acetate hydrochloride (150.0 mg, 852.1 pmol), potassium carbonate (351.8 mg, 2.55 mmol), copper iodide (8.08 mg, 42.56 pmol) and (1 R,2R)-N1 ,N2-dimethylcyclohexane-1 ,2-diamine (24.14 mg, 169.81 pmol) in degassed anhydrous toluene (5 mL) was heated under argon at 110°C for 16 h. After cooling to room temperature, the solvent was evaporated and the residue dissolved in ethyl acetate (20 mL). The organic phase was washed with water (3 x 2 mL), dried over Na2SC>4 and evaporated under reduced pressure to afford methyl 2-(1-3-[(tert-butyldimethylsilyl)oxy]phenyl-1 H- pyrazol-4-yl)acetate (220.0 mg, 634.93 pmol, 74.8% yield).

[0875] 2-[1 -(3-hydroxyphenyl)-1 H-pyrazol-4-yl]acetic acid

[0876] To a solution of methyl 2-(1-3-[(tert-butyldimethylsilyl)oxy]phenyl-1 H-pyrazol-4-yl)acetate ( 0.22 g, 0.63 mmol) in a mixture of THF (3 ml) / H2O (1 ml) was added lithium hydroxide hydrate (55 mg, 1 .3 mmol) at 0 °C. The reaction mixture was stirred overnight at room temperature and the THF was removed under reduced pressure. The aqueous solution was washed with methyl tert-butyl ether (3 x 1 ml) and concentrated to afford lithium salt of 2-[1-(3-hydroxyphenyl)-1 H-pyrazol-4-yl]acetate( 0.1 g, 0.46 mmol, 73% yield).

[0877] N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-[1 -(3-hydroxyphenyl)-1 H-pyrazol-4-yl]acetamide

[0878] To a mixture of 2-[1-(3-hydroxyphenyl)-1 H-pyrazol-4-yl]acetic acid (100.0 mg, 458.57 pmol) and 3- cyclopropyl-1 H-pyrazol-5-amine (56.37 mg, 457.99 pmol) in DMF (1 mL) was added 1- [Bis(dimethylamino)methylene]-1 H-1 ,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate (191 .44 mg, 503.66 pmol) and the mixture was stirred overnight at room temperature. The mixture was purified by HPLC (20-50% 0-5 min H2O / MeCN / 0.1%FA, flow: 30 ml / min (loading pump 4 ml / min acetonitrile); column: Chromatorex 18 SMB100-5T 100x19 mm 5 pm) to afford N-(5-cyclopropyl-1 H- pyrazol-3-yl)-2-[1-(3-hydroxyphenyl)-1 H-pyrazol-4-yl]acetamide, compound 5, (34.0 mg, 105.15 pmol, 23% yield).

[0879] 1H NMR (DMSO-d6, 500 MHz) 5 (ppm): 0.60 (m, 2H), 0.82 (m, 2H), 1.80 (m, 2H), 3.10 (s, 1 H), .47 (s, 2H), 6.09 (s, 1 H), 6.59 (d, 1 H), 7.07 (m, 3H), 7.52 (s, 1 H), 8.17 (s, 1 H), 9.70 (br s, 1 H), 10.38 (s, 1 H), 12.02 (br s, 1 H).

[0880] LCMS Retention time (Method F) 1.045 min; m / z 323.15 (M).

[0881] Synthesis of compound 6

[0882] 2-[1-(3-{[(tert-butyldimethylsilyl)oxy]methyl}phenyl)-1 H-pyrazol-4-yl]-N-[5-(propan-2-yl)-1,3- thiazol-2-yl]acetamide

[0883] To a stirred solution of 2-[1-(3-[(tert-butyldimethylsilyl)oxy]methylphenyl)-1 H-pyrazol-4-yl]acetic acid (200.0 mg, 577.75 pmol) and 5-(propan-2-yl)-1 ,3-thiazol-2-amine (82.18 mg, 578.53 pmol) in DMF (2 mL) was added 1-[bis(dimethylamino)methylene]-1 H-1 ,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate (241.69 mg, 635.87 pmol) and 4-methylmorpholine (70.14 mg, 693.86 pmol). The reaction mixture was stirred at room temperature overnight, diluted with water, and extracted with ethyl acetate (15 mL). The organic phase was washed with water (3 x 1mL), dried over Na2SC>4, and concentrated under reduced pressure to afford 2-[1-(3-[(tert- butyldimethylsilyl)oxy]methylphenyl)-1 H-pyrazol-4-yl]-N-[5-(propan-2-yl)-1 ,3-thiazol-2-yl]acetamide (200.0 mg, 424.9 pmol, 73.5% yield).

[0884] 2-{1-[3-(hydroxymethyl)phenyl]-1H-pyrazol-4-yl}-N-[5-(propan-2-yl)-1,3-thiazol-2-yl]acetamide

[0885] To a solution of 2-[1 -(3-[(tert-butyldimethylsilyl)oxy]methylphenyl)-1 H-pyrazol-4-yl]-N-[5-(propan-2- yl)-1 ,3-thiazol-2-yl]acetamide (200.0 mg, 425.34 pmol) in a mixture of MeOH (2 mL) / H2O (0.5 mL) was added potassium fluoride (123.06 mg, 2.12 mmol). The reaction mixture was stirred at room temperature for 1 h and then purified by HPLC (20-50% 0-5 min F / MeCN, flow: 30 ml / min (loading pump 4 ml / min acetonitrile); column: Chromatorex 18 SMB100-5T 100x19 mm 5 pm) to afford 2-1- [3-(hydroxymethyl)phenyl]-1 H-pyrazol-4-yl-N-[5-(propan-2-yl)-1 ,3-thiazol-2-yl]acetamide, compound 6, (33.0 mg, 92.58 pmol, 21 .9% yield).

[0886] 1H NMR (DMSO-d6, 500 MHz) 5 (ppm): 1.19 (m, 6H), 3.01 (m, 1 H), 3.62 (s, 2H), 4.51 (s, 2H), 5.23 (m, 1 H), 7.07 (s, 1 H), 7.20 (d, 1 H), 7.38 (dd, 1 H), 7.63 (m, 2H), 7.74 (s, 1 H), 8.31 (s, 1 H), 12.01 (br s, 1 H).

[0887] LCMS Retention time (Method F) 1.171 min; m / z 357.2 (M+H).

[0888] N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1 -[3-(hydroxymethyl)phenyl]-1 H-pyrazol-4-yl)acetamide To a mixture of 2-[1-(3-[(tert-butyldimethylsilyl)oxy]methylphenyl)-1 H-pyrazol-4-yl]acetic acid (10 g, 28.88 mmol), 3-cyclopropyl-1 H-pyrazol-5-amine (3.55 g, 28.88 mmol) and 1 H-1 ,2,3-benzotriazol-l- ol (4.28 g, 31.76 mmol) in DMF (100 ml) was added (3-[(ethylimino)methylidene]aminopropyl)- dimethylamine hydrochloride (6.08 g, 31.84 mmol) and 4-methylmorpholine (6.44 g, 63.56 mmol, 7 ml) The reaction mixture was stirred at room temperature overnight, diluted with water, and extracted with ethyl acetate (600 ml). The organic layer was washed with water (3 x 10 ml), dried over Na2SC>4, and concentrated under reduced pressure and purified by silica-gel flash chromatography (CHCh- MeOH) to afford N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-[3-(hydroxymethyl)phenyl]-1 H-pyrazol-4- yl)acetamide, compound 7, ( 0.72 g, 2.13 mmol, 7.4% yield).

[0889] 1H NMR (DMSO-d6, 400 MHz) 5 (ppm): 0.58 (m, 2H), 0.80 (m, 2H), 1 .72 (m, 1 H), 1 .48 (s, 2H), 4.49 (m, 2H), 5.26 (m, 1 H), 6.06 (s, 1 H), 7.04 (d, 1 H), 7.20 (dd, 1 H), 7.53 (m, 2H), 7.85 (s, 1 H), 8.13 (s, 1 H), 10.20 (s, 1 H), 12.93 (s, 1 H).

[0890] LCMS Retention time (Method Y) 1 .006 min; m / z 338.0 (M+H). Synthesis of compound 8 tert-butyl[(3-iodophenyl)methoxy]dimethylsilane

[0891] To a mixture of (3-iodophenyl)methanol (10.0 g, 42.74 mmol), tert-butyl(chloro)dimethylsilane (8.05 g, 53.64 mmol) and N,N-dimethylpyridin-4-amine (1.04 g, 8.55 mmol) in DCM (100 ml), was added 1 H-imidazole (3.64 g, 53.44 mmol). The mixture was stirred overnight at room temperature. The precipitate was removed by filtration and the DCM solution was washed with water (3 x 10 ml), dried over Na2SC>4 and concentrated in vacuo to yield tert-butyl[(3-iodophenyl)methoxy]dimethylsilane (9.0 g, 25.84 mmol, 60.5% yield). methyl 2-[1-(3-{[(tert-butyldimethylsilyl)oxy]methyl}phenyl)-1H-pyrazol-4-yl]acetate

[0892] A mixture of tert-butyl[(3-iodophenyl)methoxy]dimethylsilane (8.68 g, 24.93 mmol), methyl 2-(1 H- pyrazol-4-yl)acetate hydrochloride (4.0 g, 22.72 mmol), copper iodide (215.69 mg, 1.14 mmol), potassium carbonate (9.39 g, 68.1 mmol) and (1S,2S)-N1 ,N2-dimethylcyclohexane-1 ,2-diamine (644.37 mg, 4.53 mmol) in degassed anhydrous toluene (100 ml) was heated under argon at 110°C for 16 h. After cooling to room temperature, the solvent was evaporated and ethyl acetate (200 mL) was added and then washed with water (3 x 10 mL), dried over Na2SC>4 and evaporated under reduced pressure to afford methyl 2-[1-(3-[(tert-butyldimethylsilyl)oxy]methylphenyl)-1 H-pyrazol-4- yl]acetate (8.0 g, 22.19 mmol, 98% yield).

[0893] 2-{1 -[3-(hydroxymethyl)phenyl]-1 H-pyrazol-4-yl}acetic acid

[0894] To a solution of methyl 2-[1-(3-[(tert-butyldimethylsilyl)oxy]methylphenyl)-1 H-pyrazol-4-yl]acetate (8.0 g, 22.21 mmol) in a mixture of THF (3 ml) / H2O (1 ml) was added lithium hydroxide. hydrate (1.16 g, 27.7 mmol) at 0 °C. The reaction mixture was stirred overnight at room temperature and the THF was distilled off. The aqueous phase was washed with methyl tert-butyl ether (2 x 2 ml), acidified with NaHSC>4 and extracted with ethyl acetate (3 x 5mL). The combined organic phases were dried over Na2SC>4 and concentrated to afford 2-1-[3-(hydroxymethyl)phenyl]-1 H-pyrazol-4-ylacetic acid (4.5 g, 19.38 mmol, 58.5% yield). N-(5-cyclopropyl-1 ,3-thiazol-2-yl)-2-{1 -[3-(hydroxymethyl)phenyl]-1 H-pyrazol-4-yl}acetamide

[0895] To a mixture of 2-1-[3-(hydroxymethyl)phenyl]-1 H-pyrazol-4-ylacetic acid (500.0 mg, 2.15 mmol) and 1-[Bis(dimethylamino)methylene]-1 H-1 ,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate (900.41 mg, 2.37 mmol) in DMF (7 ml) was added diisoproylethyl amine (306.05 mg, 2.37 mmol, 410.0 pl) and it was stirred at -10 °C for 10 min. 5-cyclopropyl-1 ,3-thiazol-2-amine (301.83 mg, 2.16 mmol) was added and the reaction mixture was stirred at room temperature overnight. The reaction mixture was then diluted with water (10 ml) and extracted with ethyl acetate (4 x 25 ml). The combined organic phases were washed with water (2 x 5 ml), dried over Na2SC>4, and concentrated under reduced pressure. The residue was purified by HPLC (20-20-50% 0-1-6 min H2O / MeCN / 0.1%FA, flow: 30 ml / min (loading pump 4 ml / min acetonitrile); column: Chromatorex 18 SMB100-5T 100x19 mm 5 pm) to afford N-(5-cyclopropyl-1 ,3-thiazol-2-yl)-2-(1-[3- (hydroxymethyl)phenyl]-1 H-pyrazol-4-yl)acetamide, compound 8, (370.0 mg, 1.04 mmol, 48.5% yield).

[0896] 1H NMR (DMSO-d6, 500 MHz) 5 (ppm): 0.60 (m, 2H), 0.88 (m, 2H), 1.96 (m, 1 H), 3.61 (s, 2H), 4.52 (s, 2H), 5.14 (m, 1 H), 7.11 (s, 1 H), 7.19 (d, 1 H), 7.39 (dd, 1 H), 7.60 (m, 2H), 7.74 (s, 1 H), 8.33 (s, 1 H), 12.08 (s, 1 H).

[0897] LCMS Retention time (Method F) 0.947 min; m / z 355.2 (M+H).

[0898] 1-((benzyloxy)methyl)-3-bromobenzene To a stirred solution of NaH (1 .069 g, 26.7 mmol) in DMF (50 mL) at 0°C was added benzyl bromide (6.86 g, 40.1 mmol) and stirred at the same temperature for 1 h, then added (3- bromophenyl)methanol (5 g, 26.7 mmol) to it. The reaction mixture was stirred for another 2 h at 0°C. The reaction mixture was quenched with cold water (50 mL) and extracted with ethyl acetate (2 x 100 mL) and washed with brine (50 mL). The separated organic layer was dried over anhydrous Na2SC>4, filtered, and concentrated under reduced pressure to afford the crude product as a brown solid (12 g). The crude residue was subjected to flash chromatography with gradient elution of 0- 30% of EtOAc in petroleum ether. The appropriate fractions were collected and concentrated under reduced pressure to afford 1-((benzyloxy)methyl)-3-bromobenzene (5 g, 16.53 mmol, 62% yield) as pale-yellow gum.

[0899] LCMS (Method G), Retention time: 1.454 min, m / z 279.2 (M+H)

[0900] (1 -(3-((benzyloxy)methyl)phenyl)-1 H-pyrazol-4-yl)methanol

[0901] To a stirred solution of 1-((benzyloxy)methyl)-3-bromobenzene (5 g, 18.04 mmol), K2CO3 (7.48 g, 54.1 mmol), and copper(l) iodide (1.718 g, 9.02 mmol) in DMSO (50 mL) at RT was added (1 H- pyrazol-4-yl)methanol (2.65 g, 27.1 mmol) and the reaction mixture was heated to 120°C for 16 h under sealed condition). The reaction mixture was concentrated and then diluted with ethyl acetate (200 mL), washed with water (2 x 50 mL), and brine (50 mL). The separated organic layer was dried over anhydrous Na2SC>4, filtered, and concentrated under reduced pressure to afford the crude product as a brown gum (8 g). The crude was subjected to flash chromatography with gradient elution of 0-40% of EtOAc in petroleum ether. The appropriate fractions were collected and concentrated under reduced pressure to afford (1-(3-((benzyloxy)methyl)phenyl)-1 H-pyrazol-4- yl)methanol (3 g, 10.13 mmol, 56% yield) as a brown gum.

[0902] LCMS (Method G), Retention time: 1.046 min, m / z 295.2 (M+H)

[0903] 1 -(3-((benzyloxy)methyl)phenyl)-4-(chloromethyl)-1 H-pyrazole

[0904] To a stirred solution of (1-(3-((benzyloxy)methyl)phenyl)-1 H-pyrazol-4-yl)methanol (3 g, 10.19 mmol) in CH2CI2 (15 mL) at 10°C was added SOCI2 (1.819 g, 15.29 mmol) and stirred for 4 h at RT. The reaction mixture was concentrated under reduced pressure to afford the crude product as a brown gum (5 g). The crude was subjected to flash chromatography with gradient elution of 0-30% of EtOAc in petroleum ether. The appropriate fractions were collected and concentrated under reduced pressure to afford 1-(3-((benzyloxy)methyl)phenyl)-4-(chloromethyl)-1 H-pyrazole (2 g, 4.15 mmol, 41 % yield) as a brown gum.

[0905] LCMS (Method G), Retention time: 1.349 min, m / z 313.2 (M+H)

[0906] 2-(1-(3-((benzyloxy)methyl)phenyl)-1H-pyrazol-4-yl)acetonitrile

[0907] To a stirred solution of 1-(3-((benzyloxy)methyl)phenyl)-4-(chloromethyl)-1 H-pyrazole (2 g, 6.39 mmol) in DMSO (20 mL) at RT was added NaCN (1 .253 g, 25.6 mmol) and stirred for 4 h at RT. The reaction mixture was concentrated and then diluted with ethyl acetate (200 mL), washed with water (2 x 50 mL), and brine (50 mL). The separated organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to afford the crude product as brown gum (2.5 g). The crude was subjected to flash chromatography with gradient elution of 0-25% of EtOAc in petroleum ether. The appropriate fractions were collected and concentrated under reduced pressure to afford 2-(1-(3-((benzyloxy)methyl)phenyl)-1 H-pyrazol-4-yl)acetonitrile (1.5 g, 4.94 mmol, 77% yield) as a brown gum.

[0908] LCMS (Method G), Retention time: 1.208 min, m / z 303.2 (M+H)

[0909] 2-(1-(3-((benzyloxy)methyl)phenyl)-1H-pyrazol-4-yl)propanenitrile To a stirred solution of 2-(1-(3-((benzyloxy)methyl)phenyl)-1 H-pyrazol-4-yl)acetonitrile (1.5 g, 4.94 mmol), LDA (2.72 mL, 5.44 mmol) in THF (15 mL) at -78°C was added Mel (0.462 ml, 7.42 mmol) and stirred for 3 h at -78°C. The reaction mixture was diluted with ethyl acetate (200 mL), washed with water (2 x 50 mL), and brine (50 mL). The separated organic layer was dried over anhydrous Na2SC>4, filtered, and concentrated under reduced pressure to afford crude as brown gum (1.4 g). The crude was subjected to flash chromatography with gradient elution of 0-100% of EtOAc in petroleum ether. The appropriate fractions were collected and concentrated under reduced pressure to afford 2-(1-(3-((benzyloxy)methyl)phenyl)-1 H-pyrazol-4-yl)propanenitrile (0.8 g, 2.386 mmol, 48.2% yield) as a pale-yellow gummy liquid.

[0910] LCMS (Method G), Retention time: 1.277 min, m / z 318.2 (M+H)

[0911] 2-(1 -(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanoic acid

[0912] To a stirred solution of 2-(1-(3-((benzyloxy)methyl)phenyl)-1 H-pyrazol-4-yl)propanenitrile (0.8 g, 2.52 mmol) in water (5 mL) was added sulfuric acid (0.742 g, 7.56 mmol) at RT. The reaction mixture was refluxed for 3 h. The mixture was cooled to RT and diluted with ethyl acetate (100 mL), washed with water (2 x 20 mL), and brine (20 mL). The separated organic layer was dried over anhydrous Na2SC>4, filtered, and concentrated under reduced pressure to afford the crude product as brown gum (1 g). The crude residue was subjected to flash chromatography with gradient elution of 0-100% of EtOAc in petroleum ether. The appropriate fractions were collected and concentrated under reduced pressure to afford 2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanoic acid (0.2 g, 0.663 mmol, 26% yield) as a brown solid.

[0913] LCMS (Method G), Retention time: 0.705 min, m / z 247.2 (M+H)

[0914] N-(5-cyclopropylthiazol-2-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanamide

[0915] To a stirred solution of 2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanoic acid (100 mg, 0.41 mmol), 5-cyclopropylthiazol-2-amine (56.9 mg, 0.41 mmol) in acetonitrile (5 mL) at RT was added N-(chloro(dimethylamino)methylene)-N-methylmethanaminium hexafluoro-phosphate(V) (67.9 mg, 0.242 mmol), 1-methyl-1 H-imidazole (33.34 mg, 0.41 mmol) and the mixture was heated 50°C for 3 h. The reaction mixture was cooled to RT and concentrated to a residue, which was diluted with ethyl acetate (50 mL), washed with water (2 x 20 mL), and brine (20 mL). The separated organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to afford the crude product as brown gum (150 mg). The crude was subjected to reverse phase HPLC using Column ATLANTIS T3 (19*250mm 5pL), Mobile phase A: 10 mM Formic acid in milli-Q-water & Mobile phase B: MeCN. The appropriate fractions were collected and lyophilized to afford N-(5- cyclopropylthiazol-2-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanamide (30 mg, 0.085 mmol, 20%) as an off-white solid.

[0916] LCMS (Method G), Retention time: 1.011 min, m / z 369.2 (M+H)

[0917] N-(5-cyclopropylthiazol-2-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanamide Enantiomer 1 and Enantiomer 2

[0918] Chiral separation of N-(5-cyclopropylthiazol-2-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4- yl)propanamide (30 mg in 1.5 ml of MeOH / ACN) using Method A (SFC) afforded the following products as off-white solids:

[0919] • First eluting isomer / Enantiomer 1 , Compound 12 (7.0 mg, 21 % yield)1H-NMR (400 MHz, DMSO-d6): 5 8.38 (s, 1 H), 7.77-7.65 (m, 3H), 7.42 (t, J = 8.00 Hz, 1 H), 7.23 (d, J = 8.00 Hz, 1 H), 7.16 (d, J = 0.80 Hz, 1 H), 5.32 (t, J = 5.60 Hz, 1 H), 4.56 (d, J = 6.00 Hz, 2H), 3.94 (q, J = 7.20 Hz, 1 H), 2.02-1.98 (m, 1 H), 1.46 (d, J = 6.80 Hz, 3H), 0.96-0.92 (m, 2H), 0.91-0.63 (m, 2H).

[0920] SFC (Method A) Retention time: 2.71 min; m / z 369.2 (M+H) LCMS (Method G), Retention time: 1.023 min, m / z 369.2 (M+H)

[0921] • Second eluting isomer / Enantiomer 2, Compound 13 (6.8 mg, 21% yield)1H-NMR (400 MHz, DMSO-d6): 6 8.38 (s, 1 H), 7.77 (s, 1 H), 7.69-7.65 (m, 2H), 7.42 (t, J = 8.00 Hz, 1 H), 7.23 (d, J = 8.00 Hz, 1 H), 7.16-7.15 (m, 1 H), 5.32 (t, J = 5.60 Hz, 1 H), 4.56 (d, J = 6.00 Hz, 2H), 3.95 (q, J = 7.20 Hz, 1 H), 2.01-1.97 (m, 1 H), 1.47 (d, J = 7.20 Hz, 3H), 0.96-0.92 (m,

[0922] 2H), 0.65-0.61 (m, 2H).

[0923] SFC (Method A) Retention time: 2.78 min; m / z 369.2 (M+H)

[0924] LCMS (Method G), Retention time: 1.020 min, m / z 369.2 (M+H) Synthesis of Compound 14 / Compound 15

[0925] 2-(1 -(3-(((tert-butyldimethylsilyl)oxy)methyl)phenyl)-1 H-pyrazol-4-yl)propanoic acid To a stirred solution of 2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanoic acid (0.15 g, 0.609 mmol), imidazole (0.083 g, 1 .218 mmol) in DMF (5 mL) was added TBDMS-CI (0.138 g, 0.914 mmol) and stirred for 6 h at RT. The reaction mixture was quenched with cold water (15 mL) and concentrated under reduced pressure to get a residue. The residue was diluted with ethyl acetate (100 mL), washed with water (2 x 50 mL), and brine (50 mL). The separated organic layer was dried over anhydrous Na2SC>4, filtered, and concentrated under reduced pressure to afford crude residue as a brown gum (1 .4 g). Which was subjected to flash chromatography with gradient elution of 0- 30% of EtOAc in petroleum ether. The appropriate fractions were collected and concentrated under reduced pressure to afford 2-(1-(3-(((tert-butyldimethylsilyl)oxy)methyl)phenyl)-1 H-pyrazol-4- yl)propanoic acid (0.13 g, 0.355 mmol, 58% yield) as brown gum.

[0926] LCMS (Method G), Retention time: 1.449 min, m / z 361.2 (M+H)

[0927] Ethyl 3-(2-(1 -(3-(((tert-butyldimethylsilyl)oxy)methyl)phenyl)-1 H-pyrazol-4-yl)propanamido)-5- cyclopropyl-1 H-pyrazole-1 -carboxylate

[0928] To a stirred solution of 2-(1-(3-(((tert-butyldimethylsilyl)oxy)methyl)phenyl)-1 H-pyrazol-4-yl)propanoic acid (0.15 g, 0.416 mmol) and 1-methyl-1 H-imidazole (0.034 g, 0.416 mmol) in acetonitrile (2 mL) was added N-(chloro(dimethylamino)methylene)-N-methylmethanaminium hexafluorophosphate(V) (0.117 g, 0.416 mmol) and ethyl 3-amino-5-cyclopropyl-1 H-pyrazole-1 -carboxylate (0.049 g, 0.250 mmol) in a 8 mL vial at RT and heated to 60°C for 2 h. The reaction mixture was concentrated to a residue, which was diluted with ethyl acetate (100 mL), washed with water (2 x 50 mL), and brine (50 mL). The separated organic layer was dried over anhydrous Na2SC>4, filtered, and concentrated under reduced pressure to afford crude compound as dark brown gum (0.2 g). Ethyl 3-(2-(1-(3- (((tert-butyldimethylsilyl)oxy)methyl)phenyl)-1 H-pyrazol-4-yl)propanamido)-5-cyclopropyl-1 H- pyrazole-1 -carboxylate (0.2 g, 0.219 mmol, 53% yield) was taken as such for the next step without further purification.

[0929] LCMS (Method G), Retention time: 1.627 min, m / z 538.2 (M+H)

[0930] Ethyl 5-cyclopropyl-3-(2-(1 -(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanamido)-1 H- pyrazole-1 -carboxylate

[0931] To a stirred solution of ethyl 3-(2-(1-(3-(((tert-butyldimethylsilyl)oxy)methyl)phenyl)-1 H-pyrazol-4- yl)propanamido)-5-cyclopropyl-1 H-pyrazole-1 -carboxylate (0.2 g, 0.372 mmol) in CH2CI2 (2 mL) was added TFA (0.086 mL, 1.116 mmol) dropwise and stirred for 2 h at RT. Then reaction mixture was diluted with ethyl acetate (30 mL), washed with water (2 x 10 mL), and brine (20 mL). The separated organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to afford the crude product ethyl 5-cyclopropyl-3-(2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4- yl)propanamido)-1 H-pyrazole-1 -carboxylate (0.1 g, 0.072 mmol, 19.45% yield) as brown gummy liquid which was taken as such for the next step without further purification.

[0932] LCMS (Method G), Retention time: 1.015 min, m / z 424.2 (M+H)

[0933] N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1 -(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4- yl)propanamide

[0934] The crude product ethyl 5-cyclopropyl-3-(2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4- yl)propanamido)-1 H-pyrazole-1 -carboxylate (0.1 g, 0.072 mmol) was taken in Methanol (10 mL) at 10°C, EtsN (0.033 ml, 0.072 mmol) was added, and the reaction mixture was stirred at RT for 3 h. The reaction mixture was concentrated to a residue. The crude residue was directly subjected to reverse phase HPLC Column ATLANTIS T3 (19*250mm 5pL), Mobile phase A: 10 mM Formic acid in milli-Q-water & Mobile phase B: MeCN. The appropriate fractions were collected and lyophilized to afford N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4- yl)propanamide (60 mg, 0.170 mmol) which was subjected to SFC purification. N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1 -(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4- yl)propanamide Enantiomer 1 and Enantiomer 2

[0935] Chiral separation of N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4- yl)propanamide (60 mg in 1.5 ml of MeOH / ACN) using Method A (SFC) afforded the following products as off-white solids:

[0936] • First eluting isomer / Enantiomer 1 , Compound 14 (20 mg, 33% yield)1H-NMR (400 MHz, DMSO-d6): 5 12.05 (s, 1 H), 10.41 (s, 1 H), 8.32 (s, 1 H), 7.77 (s, 1 H), 7.67-7.65 (m, 2H), 7.42 (t, J = 8.00 Hz, 1 H), 7.22 (d, J = 7.60 Hz, 1 H), 6.17 (s, 1 H), 5.32 (t, J = 5.60 Hz, 1 H), 4.56 (d, J = 6.00 Hz, 2H), 3.83 (q, J = 7.20 Hz, 1 H), 1 .86-1 .82 (m, 1 H), 1 .41 (d, J = 6.80 Hz, 3H), 0.91-0.88 (m, 2H), 0.65-0.64 (m, 2H).

[0937] SFC (Method A) Retention time: 3.41 min; m / z 352.2 (M+H)

[0938] LCMS (Method G), Retention time: 0.802 min, m / z 352.2 (M+H)

[0939] • Second eluting isomer / Enantiomer 2, Compound 15 (16 mg, 26% yield)1H-NMR (400 MHz, DMSO-d6): 6 12.04 (s, 1 H), 10.40 (s, 1 H), 8.31 (s, 1 H), 7.77 (s, 1 H), 7.66-7.65 (m, 2H), 7.42 (t, J = 8.00 Hz, 1 H), 7.22 (d, J = 7.60 Hz, 1 H), 6.16 (s, 1 H), 5.31 (t, J = 6.00 Hz, 1 H), 4.56 (d, J = 6.00 Hz, 2H), 3.84-3.82 (m, 1 H), 1 .85-1 .82 (m, 1 H), 1 .41 (d, J = 7.20 Hz, 3H), 0.92-0.87 (m, 2H), 0.65-0.64 (m, 2H).

[0940] SFC (Method A) Retention time: 5.74 min; m / z 352.2 (M+H)

[0941] LCMS (Method G), Retention time: 0.799 min, m / z 352.2 (M+H)

[0942] Synthesis of Compound 16 / Compound 17

[0943]

[0944] 1-((benzyloxy)methyl)-3-bromo-5-chlorobenzene

[0945] To a stirred solution of NaH (0.542 g, 13.55 mmol) in DMF (30 mL) at 0°C was added benzyl bromide (2.413 ml, 20.32 mmol) and stirred at the same temperature for 1 h. Then, (3-bromo-5- chlorophenyl)methanol (3 g, 13.55 mmol) was added, and the reaction mixture was stirred for another 2 h at 0° C. The reaction mixture was quenched with cold water (15 mL) and extracted with ethyl acetate (2 x 100 mL) and washed with brine (50 mL). The separated organic layer was dried over anhydrous Na2SC>4, filtered, and concentrated under reduced pressure to afford the crude product as brown solid (5 g). The crude was subjected to flash chromatography with gradient elution of 0-30% of EtOAc in petroleum ether. The appropriate fractions were collected and concentrated under reduced pressure to afford 1-((benzyloxy)methyl)-3-bromo-5-chlorobenzene (4 g, 12.58 mmol, 93% yield) as pale-yellow gum.

[0946] LCMS (Method H), Retention time: 1 .504-1 .544 min, m / z 312.2 (M+H)

[0947] (1-(3-((benzyloxy)methyl)-5-chlorophenyl)-1H-pyrazol-4-yl)methanol

[0948] To a stirred solution of 1-((benzyloxy)methyl)-3-bromo-5-chlorobenzene (4 g, 12.71 mmol), K2CO3 (5.27 g, 38.1 mmol), and copper(l) iodide (1.210 g, 6.35 mmol) in DMSO (40 mL) was added (1 H- pyrazol-4-yl)methanol (1.870 g, 19.06 mmol) and the mixture was heated to 120°C for 16 h (in sealed condition). The reaction mixture was cooled to RT and then concentrated to a residue, which was diluted with ethyl acetate (100 mL), washed with water (2 x 50 mL), and brine (50 mL). The separated organic layer was dried over anhydrous Na2SO4, filtered, and concentrated to afford the crude product as brown gum (4.5 g). The crude residue was subjected to flash chromatography with gradient elution of 0-40% of EtOAc in petroleum ether. The appropriate fractions were collected and concentrated under reduced pressure to afford (1-(3-((benzyloxy)methyl)-5-chlorophenyl)-1 H- pyrazol-4-yl)methanol (1.3 g, 3.94 mmol, 31 % yield) as brown gum.

[0949] LCMS (Method G), Retention time: 1.173 min, m / z 329.2 (M+H) 1-(3-((benzyloxy)methyl)-5-chlorophenyl)-4-(chloromethyl)-1 H-pyrazole

[0950] To a stirred solution of (1-(3-((benzyloxy)methyl)-5-chlorophenyl)-1 H-pyrazol-4-yl)methanol (2 g, 6.02 mmol) in CH2CI2 (15 mL) at 10°C was added SOCI2 (1 .075 g, 9.03 mmol) and stirred for 4 h at RT. The reaction mixture was concentrated under reduced pressure to afford the crude product as brown gum (2 g). The crude residue was subjected to flash chromatography with gradient elution of 0-50% of EtOAc in petroleum ether. The appropriate fractions were collected and concentrated under reduced pressure to afford 1-(3-((benzyloxy)methyl)-5-chlorophenyl)-4-(chloromethyl)-1 H- pyrazole (1 .5 g, 4.17 mmol, 69% yield) as brown gum.

[0951] LCMS (Method G), Retention time: 1.456 min, m / z 347.2 (M+H)

[0952] 2-(1-(3-((benzyloxy)methyl)-5-chlorophenyl)-1H-pyrazol-4-yl)acetonitrile

[0953] To a stirred solution of 1-(3-((benzyloxy)methyl)-5-chlorophenyl)-4-(chloromethyl)-1 H-pyrazole (1.5 g, 4.32 mmol) in DMSO (10 mL) was added NaCN (0.635 g, 12.96 mmol) and stirred for 4 h at RT. The reaction mixture was concentrated and then diluted with ethyl acetate (200 mL), washed with water (2 x 50mL), and brine (50 mL). The separated organic layer was dried over anhydrous Na2SC>4, filtered, and concentrated under reduced pressure to afford the crude product as brown gum (1 .3 g). The crude residue was subjected to flash chromatography with gradient elution of 0- 100% of EtOAc in petroleum ether. The appropriate fractions were collected and concentrated under reduced pressure to afford 2-(1-(3-((benzyloxy)methyl)-5-chlorophenyl)-1 H-pyrazol-4-yl)acetonitrile (0.9 g, 2.65 mmol, 61 % yield) as brown gum.

[0954] LCMS (Method G), Retention time: 1.326 min, m / z 338.2 (M+H)

[0955] 2-(1-(3-((benzyloxy)methyl)-5-chlorophenyl)-1H-pyrazol-4-yl)propanenitrile

[0956] To a stirred solution of 2-(1-(3-((benzyloxy)methyl)-5-chlorophenyl)-1 H-pyrazol-4-yl)acetonitrile (0.9 g, 2.66 mmol), LDA (1 .465 mL, 2.93 mmol) in THF (10 mL) at -78°C was added Mel (0.567 g, 4.00 mmol) and stirred for 3 h at -78°C. The reaction mixture was diluted with ethyl acetate (100 mL), washed with water (2 x 50mL), and brine (50mL). The separated organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to afford the crude product as brown gum (0.7 g). The crude residue was subjected to flash chromatography with gradient elution of 0-100% of EtOAc in petroleum ether. The appropriate fractions were collected and concentrated under reduced pressure to afford 2-(1-(3-((benzyloxy)methyl)-5-chlorophenyl)-1 H-pyrazol-4- yl)propanenitrile (0.5 g, 1 .399 mmol, 53% yield) as pale-yellow gummy liquid.

[0957] LCMS (Method G), Retention time: 1.386 min, m / z 352.2 (M+H)

[0958] 2-(1 -(3-chloro-5-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanoic acid

[0959] To a stirred solution of 2-(1-(3-((benzyloxy)methyl)-5-chlorophenyl)-1 H-pyrazol-4-yl)propanenitrile (0.5 g, 1.421 mmol) in water (5 mL) was added sulfuric acid (0.418 g, 4.26 mmol) and heated to reflux for 3 h. The reaction mixture was diluted with ethyl acetate (100 mL) and washed with water (2 x 20 mL). The separated organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to afford the crude product as brown gum (0.7 g). The crude residue was subjected to flash chromatography with gradient elution of 0-100% of EtOAc in petroleum ether. The appropriate fractions were collected and concentrated under reduced pressure to afford 2-(1-(3- chloro-5-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanoic acid (0.3 g, 1.000 mmol, 70% yield) as an off-white solid.

[0960] LCMS (Method G), Retention time: 0.834 min, m / z 281.2 (M+H)

[0961] 2-(1-(3-chloro-5-(hydroxymethyl)phenyl)-1H-pyrazol-4-yl)-N-(5-cyclopropylthiazol-2- yljpropanamide To a stirred solution of 2-(1-(3-chloro-5-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanoic acid (70mg, 0.242mmol), N-(chloro(dimethylamino)methylene)-N-methylmethanaminium hexafluorophosphate(V) (67.9 mg, 0.242 mmol), 1-methyl-1 H-imidazole (19.86 mg, 0.242 mmol) in acetonitrile (5 mL) at RT was added 5-cyclopropylthiazol-2-amine (33.9 mg, 0.242 mmol) and heated to 50°C for 2 h. The reaction mixture was concentrated to a residue, which was diluted with ethyl acetate (100 mL), washed with water (2 x 50 mL), and brine (50 mL). The separated organic layer was dried over anhydrous Na2SC>4, filtered, and concentrated under reduced pressure to afford the crude product as dark brown gum (0.2 g), The crude residue was directly subjected to reverse phase HPLC using Column ATLANTIS T3 (19*250mm 5pL), Mobile phase A: 10 mM Formic acid in milli-Q- water & Mobile phase B: MeCN. The appropriate fractions were collected and lyophilized to afford 2- (1-(3-chloro-5-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-cyclopropylthiazol-2-yl)propanamide (15 mg, 0.036 mmol, 15% yield) as brown gum.

[0962] LCMS (Method G), Retention time: 1.067 min, m / z 403.0 (M+H)

[0963] 2-(1-(3-chloro-5-(hydroxymethyl)phenyl)-1H-pyrazol-4-yl)-N-(5-cyclopropylthiazol-2- yl)propanamide Enantiomer 1 and Enantiomer 2

[0964] Chiral separation of N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4- yl)propanamide (15 mg in 1.0 ml of MeOH / ACN using Method B (SFC) afforded the following products as off-white solids:

[0965] • First eluting isomer / Enantiomer 1 , Compound 16 (4 mg, 23% yield)1H-NMR (400 MHz, MeOD): 5 8.25 (s, 1 H), 7.73-7.68 (m, 3H), 7.34 (d, J = 0.80 Hz, 1 H), 7.11 (s, 1 H), 4.68 (s, 2H), 3.96 (q, J = 7.20 Hz, 1 H), 2.05-1 .98 (m, 1 H), 1 .59 (d, J = 7.20 Hz, 3H), 1 .01-0.98 (m, 2H), 0.72-0.70 (m, 2H).

[0966] SFC (Method B) Retention time: 1.44 min; m / z 403.0 (M+H)

[0967] LCMS (Method G), Retention time: 1.06 min, m / z 403 (M+H)

[0968] • Second eluting isomer / Enantiomer 2, Compound 17 (3 mg, 19% yield)1H-NMR (400 MHz, MeOD): 5 8.25 (s, 1 H), 7.73-7.68 (m, 3H), 7.34 (t, J = 0.40 Hz, 1 H), 7.11 (d, J = 0.80 Hz,

[0969] 1 H), 4.68 (s, 2H), 3.96 (q, J = 7.20 Hz, 1 H), 2.04-2.01 (m, 1 H), 1 .59 (d, J = 7.20 Hz, 3H), 1.01-0.99 (m, 2H), 0.98-0.71 (m, 2H).

[0970] SFC (Method B) Retention time: 1.50 min; m / z 403.0 (M+H) LCMS (Method G), Retention time: 1.069 min, m / z 403 (M+H)

[0971] Synthesis of Compound 18

[0972] 2-(1 -(3-(((tert-butyldimethylsilyl)oxy)methyl)-5-chlorophenyl)-1 H-pyrazol-4-yl)propanoic acid

[0973] To a stirred solution of 2-(1-(3-chloro-5-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanoic acid (0.3g, 1.069 mmol), imidazole (0.146 g, 2.137 mmol) in DMF (5 mL) at RT was added TBDMS-CI (0.242 g, 1.603 mmol) and stirred for 6 h at RT. The reaction mixture was quenched with cold water (15 mL) and concentrated under reduced pressure to obtain a residue. The residue was diluted with ethyl acetate (100 mL), washed with water (2 x 50 mL), and brine (50 mL). The separated organic layer was dried over anhydrous Na2SC>4, filtered, and concentrated under reduced pressure to afford the crude product as brown gum (0.5 g). The crude residue was subjected to flash chromatography with gradient elution of 0-30% of EtOAc in petroleum ether. The appropriate fractions were collected and concentrated under reduced pressure to afford 2-(1-(3-(((tert-butyldimethylsilyl)oxy)methyl)-5- chlorophenyl)-1 H-pyrazol-4-yl)-propanoic acid (0.28 g, 0.664 mmol, 62% yield) as brown gum. LCMS (Method G), Retention time: 1.395 min, m / z 395.2 [M+H]+

[0974] Ethyl 3-(2-(1 -(3-(((tert-butyldimethylsilyl)oxy)methyl)-5-chlorophenyl)-1 H-pyrazol-4- yl)propanamido)-5-cyclopropyl-1 H-pyrazole-1 -carboxylate

[0975] To a stirred solution of 2-(1-(3-(((tert-butyldimethylsilyl)oxy)methyl)-5-chlorophenyl)-1 H-pyrazol-4- yl)propanoic acid (0.28 g, 0.709 mmol) and 1-methyl-1 H-imidazole (0.058 g, 0.709 mmol) in acetonitrile (5 mL) was added N-(chloro(dimethylamino)methylene)-N-methylmethanaminium hexafluorophosphate(V) (0.199 g, 0.709 mmol) and ethyl 3-amino-5-cyclopropyl-1 H-pyrazole-1 - carboxylate (0.083 g, 0.425 mmol) in a 8 mL vial at RT and heated to 60°C for 2 h. The reaction mixture was concentrated under reduced pressure to obtain a residue. The residue was diluted with ethyl acetate (100 mL), washed with water (2 x 50 mL), and brine (50 mL). The separated organic layer was dried over anhydrous Na2SC>4, filtered, and concentrated under reduced pressure to afford the crude ethyl 3-(2-(1-(3-(((tert-butyldimethylsilyl)oxy)methyl)-5-chlorophenyl)-1 H-pyrazol-4- yl)propanamido)-5-cyclopropyl-1 H-pyrazole-1 -carboxylate (0.3 g, 0.067 mmol, 9% yield), which was taken as such for the next step without further purification.

[0976] LCMS (Method G), Retention time: 1.465 min, m / z 572.2 (M+H).

[0977] Ethyl 3-(2-(1 -(3-chloro-5-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanamido)-5- cyclopropyl-1 H-pyrazole-1 -carboxylate

[0978] To a stirred solution of ethyl 3-(2-(1-(3-(((tert-butyldimethylsilyl)oxy)methyl)-5-chlorophenyl)-1 H- pyrazol-4-yl)propanamido)-5-cyclopropyl-1 H-pyrazole-1 -carboxylate (0.3 g, 0.524 mmol) in CH2CI2 (2 mL) was added TFA (0.086 mL, 1 .48 mmol) dropwise at RT. Then, the reaction mixture was stirred at RT for 1 h. The reaction mixture was diluted with ethyl acetate (30 mL), washed with water (2 x 10 mL), and brine (20 mL). The separated organic layer was dried over anhydrous Na2SC>4, filtered, and concentrated under reduced pressure to afford crude ethyl 3-(2-(1-(3-chloro-5- (hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanamido)-5-cyclopropyl-1 H-pyrazole-1 -carboxylate (0.25 g, 0.062 mmol, 12% yield) which was taken as such for the next step.

[0979] LCMS (Method G), Retention time: 1.00 min, m / z 458.2 (M+H)

[0980] 2-(1 -(3-chloro-5-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-cyclopropyl-1 H-pyrazol-3- yl)propanamide, Compound 18

[0981] To a stirred solution of ethyl 3-(2-(1-(3-chloro-5-(hydroxymethyl)phenyl)-1 H-pyrazol-4- yl)propanamido)-5-cyclopropyl-1 H-pyrazole-1 -carboxylate (250 mg, 0.060 mmol) in methanol (20 mL) at 10°C was added EtsN (0.042 mL, 0.300 mmol) and the reaction mixture was stirred at RT for 1 h. The reaction mixture was concentrated to a residue. The crude residue was directly subjected to reversed phase HPLC using Column ATLANTIS T3 (30*250mm 5pL), Mobile phase A: 10 mM Formic acid in Milli-Q water & Mobile phase B: MeCN. The appropriate fractions were collected and lyophilized to afford 2-(1-(3-chloro-5-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-cyclopropyl-1 H- pyrazol-3-yl)propanamide (13.0 mg, 0.034 mmol, 56% yield) as an off-white solid.

[0982] LCMS (Method G), Retention time: 0.925 min, m / z 386.4 [M+H]+

[0983] 1H-NMR (400 MHz, DMSO-d6): 5 12.05 (s, 1 H), 10.42 (s, 1 H), 8.43 (s, 1 H), 7.79-7.77 (m, 2H), 7.69 (s, 1 H), 7.27 (d, J = 0.40 Hz, 1 H), 6.16 (s, 1 H), 5.45 (t, J = 6.00 Hz, 1 H), 4.56 (d, J = 5.60 Hz, 2H), 3.82 (dd, J = 7.20, 14.00 Hz, 1 H), 1 .87-1 .80 (m, 1 H), 1 .41 (d, J = 7.20 Hz, 3H), 0.91-0.88 (m, 2H), 0.65-0.61 (m, 2H).

[0984] PART 2: Synthesis of compound-linker constructs

[0985] Synthesis of compound 9

[0986] 3-(4-(2-((5-cyclopropylthiazol-2-yl)amino)-2-oxoethyl)-1H-pyrazol-1-yl)benzyl 6-(2,5-dioxo-2,5- dihydro-1 H-pyrrol-1 -yl)hexanoate

[0987] To a stirred solution of N-(5-cyclopropyl-1 ,3-thiazol-2-yl)-2-(1-[3-(hydroxymethyl)phenyl]-1 H-pyrazol-

[0988] 4-yl)acetamide, compound 8, (35.5 mg) in anhydrous DCM (2 mL) was added triethylamine (41 pL). The solution was cooled to 0 °C and 6-maleimidohexanoyl chloride (27.6 mg) was added in one portion. The resulting reaction mixture was stirred under a nitrogen atmosphere at room temperature. After 19 h, the volatiles were removed in vacuo. The resulting residue was dissolved in DMSO (2.0 mL) and purified by reverse phase C18-column chromatography eluting with buffer A (v / v): water: 5% acetonitrile: 0.05% trifluoroacetic acid and buffer B (v / v): acetonitrile: 0.05% trifluoroacetic acid (100:0 v / v to 0:100 v / v). The organic solvent was removed in vacuo and the aqueous solvent was removed by lyophilisation to afford 3-(4-(2-((5-cyclopropylthiazol-2-yl)amino)-2- oxoethyl)-1 H-pyrazol-1 -yl)benzyl 6-(2,5-dioxo-2,5-dihydro-1 H-pyrrol-1 -yl)hexanoate, compound 9, as an off-white solid (23 mg).

[0989] LCMS Retention time 3.08 min; m / z 549 [M+H]+

[0990] Compound 9 is an example for a compound-linker construct, which is cleavable by an esterase resulting in the cleavage and setting free of compound 8 from the compound-linker construct.

[0991] Synthesis of compound 10

[0992] 3-(4-(2-((5-cyclopropylthiazol-2-yl)amino)-2-oxoethyl)-1H-pyrazol-1-yl)benzyl (4-((S)-2-((S)-2-(6- (2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanamido)-3-methylbutanamido)-5- ureidopentanamido)benzyl) carbonate

[0993] To a stirred solution of N-(5-cyclopropyl-1 ,3-thiazol-2-yl)-2-(1-[3-(hydroxymethyl)phenyl]-1 H-pyrazol-

[0994] 4-yl)acetamide, compound 8 (15 mg) and 4-((S)-2-((S)-2-(6-(2,5-dioxo-2,5-dihydro-1 H-pyrrol-1- yl)hexanamido)-3-methylbutanamido)-5-ureidopentanamido)benzyl (4-nitrophenyl) carbonate (MC- Val-Cit-PAB-PNP) (30 mg) in acetonitrile (3 mL) were added 4-dimethylaminopyridine (5 mg) and N,N-diisopropylethylamine (21 pL) at room temperature. The reaction mixture was stirred for 16 h and purified by reverse phase C18-column chromatography eluting with buffer A (v / v): water: 5% acetonitrile:0.05% formic acid and buffer B (v / v): acetonitrile: 0.05% formic acid (100:0 v / v to 0:100 v / v). The organic solvent was removed in vacuo and the aqueous solvent was removed by lyophilisation to give 3-(4-(2-((5-cyclopropylthiazol-2-yl)amino)-2-oxoethyl)-1 H-pyrazol-1-yl)benzyl (4- ((S)-2-((S)-2-(6-(2,5-dioxo-2,5-dihydro-1 H-pyrrol-1-yl)hexanamido)-3-methylbutanamido)-5- ureidopentanamido)benzyl) carbonate, compound 10 as a white solid (10 mg).

[0995] LCMS Retention time 2.73 min; m / z: [M+H]+= 954, [M+2H]2+= 477 Compound 10 is an example for a compound-linker construct, which is cleavable either by a cathepsine or under acidic conditions resulting in the cleavage and setting free of compound 8 from the compound-linker construct. The linker also comprises a para-aminobenzyloxy (PAB)-moiety, which is a self-immolative moiety (that will also be cleaved off after the cathepsine-cleavage).

[0996] 3-(4-(2-((5-cyclopropylthiazol-2-yl)amino)-2-oxoethyl)-1H-pyrazol-1-yl)benzyl (4-nitrophenyl) carbonate

[0997] To a solution of N-(5-cyclopropyl-1 ,3-thiazol-2-yl)-2-(1-[3-(hydroxymethyl)phenyl]-1 H-pyrazol-4- yl)acetamide, compound 8, (177 mg) in DMF (3 mL) cooled to 0 °C under an argon atmosphere were added bis(4-nitrophenyl) carbonate (190 mg) and N,N-diisopropylethylamine (262 pL). The solution was allowed to warm to room temperature and stirred for 22 h. The volatiles were removed in vacuo and the resulting residue was dissolved in dichloromethane (2 mL) and diethyl ether (15 mL) was added. Solids were collected by filtration to give 3-(4-(2-((5-cyclopropylthiazol-2-yl)amino)-

[0998] 2-oxoethyl)-1 H-pyrazol-1-yl)benzyl (4-nitrophenyl) carbonate as a yellow solid (228 mg) which was used without further purification in next step, m / z: [M+H]+= 520.

[0999] 3-(4-(2-((5-cyclopropylthiazol-2-yl)amino)-2-oxoethyl)-1 H-pyrazol-1 -yl)benzyl methyl(2- (methylamino)ethyl)carbamate

[1000] To a solution of 3-(4-(2-((5-cyclopropylthiazol-2-yl)amino)-2-oxoethyl)-1 H-pyrazol-1 -yl)benzyl (4- nitrophenyl) carbonate (220 mg) in DCM (3 mL) under an argon atmosphere was added N-(tert- butoxycarbonyl)-N-methyl-2-(methylamino)ethylamine (112 mg) and the reaction mixture was stirred for 3h at room temperature. LC-MS analysis of the reaction mixture indicated full consumption of 3- (4-(2-((5-cyclopropylthiazol-2-yl)amino)-2-oxoethyl)-1 H-pyrazol-1 -yl)benzyl (4-nitrophenyl) carbonate. Trifluoroacetic acid (2 mL) was then added, and the mixture was stirred for 2 h at room temperature. The volatiles were removed in vacuo. The resulting residue was dissolved in water and acetonitrile (v / v; 1 / 1 , 1.2 ml), and purified by reverse phase C18-column chromatography eluting with buffer A (v / v): water: 5% acetonitrile: 0.1% trifluoroacetic acid and buffer B (v / v): acetonitrile: 0.1 % trifluoroacetic acid (100:0 v / v to 0:100 v / v). The organic solvent was removed in vacuo and the aqueous solvent removed by lyophilisation to afford 3-(4-(2-((5-cyclopropylthiazol-2-yl)amino)-2- oxoethyl)-1 H-pyrazol-1 -yl)benzyl methyl(2-(methylamino)ethyl)carbamate as_trifluoroacetic acid salt, as a white solid (155 mg), m / z [M+H]+= 469.

[1001] 3-(4-(2-((5-cyclopropylthiazol-2-yl)amino)-2-oxoethyl)-1 H-pyrazol-1 -yl)benzyl (4-((S)-2-((S)-2-(6- (2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanamido)-3-methylbutanamido)-5- ureidopentanamido)benzyl) ethane-1 ,2-diylbis(methylcarbamate)

[1002] To a stirred solution of the trifluoroacetic acid salt of 3-(4-(2-((5-cyclopropylthiazol-2-yl)amino)-2- oxoethyl)-1 H-pyrazol-1 -yl)benzyl methyl(2-(methylamino)ethyl)carbamate (43 mg) and 4-((S)-2-((S)- 2-(6-(2,5-dioxo-2,5-dihydro-1 H-pyrrol-1-yl)hexanamido)-3-methylbutanamido)-5- ureidopentanamido)benzyl (4-nitrophenyl) carbonate (MC-Val-Cit-PAB-PNP), (54 mg)in DMF (1.5 mL) were added hydroxybenzotriazole (10 mg) and N,N-diisopropylethylamine (45 pL) at room temperature. The reaction mixture was stirred for 16 h then purified by reverse phase C18-column chromatography eluting with buffer A (v / v): water: 5% acetonitrile:0.05% formic acid and buffer B (v / v): acetonitrile: 0.05% formic acid (100:0 v / v to 0:100 v / v). The organic solvent was removed in vacuo and the residue was lyophilised to afford 3-(4-(2-((5-cyclopropylthiazol-2-yl)amino)-2- oxoethyl)-1 H-pyrazol-1 -yl)benzyl (4-((S)-2-((S)-2-(6-(2,5-dioxo-2,5-dihydro-1 H-pyrrol-1- yl)hexanamido)-3-methylbutanamido)-5-ureidopentanamido)benzyl) ethane-1 ,2- diylbis(methylcarbamate), compound 11 , (35 mg) as an off-white solid.

[1003] LCMS Retention time 2.82 min m / z: [M+H]+= 1067, [M+2H]2+= 534.

[1004] Compound 11 is an example for a compound-linker construct, which is cleavable by a cathepsine resulting in the cleavage and setting free of compound 8 from the compound-linker construct. The linker also comprises self-immolative moieties including a para-aminobenzyloxy (PAB)-moiety (that will also be cleaved off after the cathepsine-cleavage).

[1005] EXAMPLE 2: Activity

[1006] Nluc-taaaed CCNK HEK293T cell aeneration

[1007] HEK293T_Nluc_CCNK-tagged cells were engineered by integrating a nanoluciferase tag at the N- terminus of the endogenous locus of CCNK using CRISPR-Cas9 technology. Briefly, 5.5 million HEK293T cells were co-transfected by PEI with a 1 :1 ratio of cutting vector (sgRNA (encoding DNA shown in the following): AAGCCTACTTCAATAAATGA SEQ ID 01) and repair template (4 pg total plasmid) as previously described (Brand and Winter, 2019). The repair sequence comprises a cassette of puromycinR-P2A-HA-Nluc-(G4S)3 (P2A: self-cleaving peptide 2A, HA: HA-tag, (648)3: flexible linker), surrounded by 20-nucleotide microhomologies matching the genomic locus. After 3 days of incubation, the recombinant population was selected by puromycin treatment (2 pg / ml, 5-day treatment). A monoclonal population was obtained by limiting dilution and cassette integration validated by Sanger sequencing.

[1008] NIuc degradation assay (DC50)

[1009] HEK293T_Nluc_CCNK-tagged cells were seeded in a white opaque 384-well plate at a density of 5000 cells per well in duplicate, in full medium (Opti-MEM I + 4 % FBS + 1 % penicillin-streptomycin) and left to attach overnight at 37°C, 5% CO2. Next day, cells were treated with compounds in a 10- point titration (range: 0 to 10 pM, 1 :10 dilution). After 4 h of incubation at 37°C, 5% CO2, Nano-Gio substrate (Promega), pre-diluted in serum-free medium (Opti-MEM I), was added to the cells (1 :500 final dilution). The luminescence signal was directly measured using the multimode plate reader EnVision 2105 (Perkin Elmer).

[1010] CTG cell viability assay

[1011] To profile the compounds of the present invention for the desired therapeutic effect, i.e. killing of cancer cells, a Cell Titer Gio (CTG) cell viability assay was performed in two well-established immortalized solid tumor cell lines (BT474 and Hs578T). BT-474 is a cell line that was isolated from a solid, invasive ductal carcinoma from a breast cancer patient and can be used in cancer research. Hs 578T is an epithelial cell line isolated from breast tissue from a female breast cancer patient. Hs-578T cells (Szabo Scandic, Cat# EP-CL-0114) were seeded in a white opaque 384-well plate at a density of 500 cells per well in duplicate, in full medium (DMEM + 10 % FBS + 1 % penicillinstreptomycin) and left to attach overnight at 37°C, 5% CO2. Next day, cells were treated with compounds in a 10-point titration with a dilution factor of 1 :10 (range: 0 to 10 pM). After 120 h of incubation at 37°C, 5% CO2, the cell viability was determined using the CellTiter-Glo® reactant (Promega, G7572). The luminescence signal was measured using the multimode plate reader EnVision 2105 (Perkin Elmer).

[1012] BT-474 cells (ATCC, Cat# HTB-20™) were seeded in a white opaque 384-well plate at a density of 500 cells per well in duplicate, in full medium (RPMI-1640 + 10 % FBS + 1 % penicillin-streptomycin) and left to attach overnight at 37°C, 5% CO2. Next day, cells were treated with compounds in a 10- point titration with a dilution factor of 1 :10 (range: 0 to 10 pM). After 120 h of incubation at 37°C, 5% CO2, the cell viability was determined using the CellTiter-Glo® reactant (Promega, G7572). The luminescence signal was measured using the multimode plate reader EnVision 2105 (Perkin Elmer).

[1013] Results

[1014] The results are summarized in Table Ex-1 below, wherein the following classifications were applied.

[1015] NanoLuc-CCNK degradation assay

[1016] “A” < 10 nM, “B” 10 nM < DC50 < 100 nM, “C” 100 nM < DC50 < 1 pM, “D” 1 pM < DC50 < 100 pM

[1017] Hs-578T CTG EC50 assay data and BT-474 CTG EC50 assay data

[1018] “A” < 10 nM, “B” 10 nM < EC50 < 100 nM, “C” 100 nM < EC50 < 1 pM, “D” 1 pM < EC50 < 100 pM

[1019] Table Ex-1 EXAMPLE 3: Activity

[1020] NIuc degradation assay (DC50)

[1021] Using ECHO liquid handler (Beckmann) compounds were directly spotted into a white opaque 384- well plate. For each compound 10 concentrations were tested in triplicates (range: 1 pM to 0.03 nM, 1 : SqRt(10) dilution). HEK293T_Nluc_CCNK-tagged cells were on top of the pre-spotted compounds in the 384-well plate at a density of 5000 cells per well in full medium (DMEM + 4 % FBS + 1 % penicillin-streptomycin) and incubated at 37°C, 5% CO2. After 4 h of incubation at 37°C, 5% CO2, Nano-Gio® Luciferase Assay Substrate (Promega), pre-diluted 1 :50 in assay buffer was added to the cells (1 :500 final dilution). The luminescence signal was measured 5 min after incubation in the dark at RT using the multimode plate reader EnVision 2105 (Perkin Elmer).

[1022] CTG cell viability assay

[1023] To profile the compounds of the present invention for the desired therapeutic effect, i.e. killing of cancer cells, a CellTiter-Glo® (CTG) cell viability assay was performed in Hs578T, a well-established immortalized solid tumor cell line. Hs 578T is an epithelial cell line isolated from breast tissue from a female breast cancer patient.

[1024] Using ECHO liquid handler (Beckmann) compounds were directly spotted into a white opaque 384- well plate. For each compound 10 concentrations were tested in triplicates (range: 10 pM to 0.03 nM, 1 : SqRt(10) dilution). Hs-578T cells (Szabo Scandic, Cat# EP-CL-0114) were seeded on top of the pre-spotted compounds in the 384-well plate at a density of 500 cells per well in full medium (DMEM + 4 % FBS + 1 % penicillin-streptomycin) and incubated at 37°C, 5% CO2. After 120 h of incubation at 37°C, 5% CO2, the cell viability was determined using the CellTiter-Glo® reactant (Promega, G7572). The luminescence signal was measured after 30min incubation in the dark at RT using the multimode plate reader EnVision 2105 (Perkin Elmer).

[1025] Results

[1026] The results are summarized in Table Ex-2 below, wherein the following classifications were applied.

[1027] NanoLuc-CCNK degradation assay

[1028] “A” < 10 nM, “B” 10 nM < DC50< 100 nM, “C” 100 nM < DC50< 1 pM, “D” 1 pM < DC50< 100 pM

[1029] Hs-578T CTG EC50 assay data and BT-474 CTG EC50 assay data

[1030] “A” < 10 nM, “B” 10 nM < EC50 < 100 nM, “C” 100 nM < EC50 < 1 pM, “D” 1 pM < EC50 < 100 pM

[1031] Table Ex-2 The compounds of the invention are conjugatable compounds, i.e. they can be conjugated to a linker, e.g. any of the linkers shown above in example 1 to arrive at compound-linker constructs of the present invention. Preferably, the linkers used in order to arrive at compound-linker constructs are linkers that are cleaved off inside a cell (i.e. after delivery to such a cell) from such constructs, thus setting free a compound of the invention inside a cell, where it can exhibit its activity. Such linkers may also be designated as “traceless” linkers, and examples for such linkers are given in example 1 above.

[1032] The results show that the tested compounds of the invention generally exhibit a high potency in the NIuc CCNK degradation assay and the Cell Titer Gio (CTG) viability assay, which was performed in two well-established immortalized solid tumor cell lines (BT474 and Hs578T). BT-474 is a cell line that was isolated from a solid, invasive ductal carcinoma from a breast cancer patient. Hs 578T is an epithelial cell line isolated from breast tissue from a female breast cancer patient.

[1033] The results therefore establish that the compounds of the invention, which are conjugatable to cleavable linkers, exhibit the desired activity after they have been cleaved off from the linkers inside cells.

[1034] In one particular embodiment, the present invention relates to the following items:

[1035] 1 . A compound of formula (I) or a stereoisomer, tautomer, pharmaceutically acceptable salt, or hydrate thereof: wherein

[1036] A is a 5-membered heteroaryl group, which comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the heteroaryl group is independently unsubstituted or substituted with one or more, same or different substituents RA, provided that at least one substituent RAis present at the heteroaryl group A; wherein

[1037] RAis halogen, CN, C-i-Ce-alkyl, C-i-Ce-haloalkyl, or 3- to 10-membered saturated or partially unsaturated carbocyclyl, carbocyclyl-Ci-C2-alkyl, carbobicyclyl, carbobicyclyl-Ci-C2-alkyl, heterocyclyl, heterocyclyl-Ci-C2-alkyl, heterobicyclyl, or heterobicyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic or heterobicyclic rings comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RY; wherein

[1038] RYis Cl, F, or Ci-C4-alkyl;

[1039] B is any one of the following groups wherein the wavy line in each case marks the connection to the remainder of the molecule; and wherein RB1is H;

[1040] RB2is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4- hydroxyalkyl, Ci-C4-alkyl-S-, Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN);

[1041] RB3is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN);

[1042] RB4is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN); and

[1043] RB5is H; provided that at least one of RB2, RB3, and RB4is OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, or -Ci-C4-alkyl-NH(RN);

[1044] X1is N or CRB6;

[1045] Y1is N or CRB7;

[1046] Z1is N or CRB8; provided that one, but not more than one of X1, Y1, and Z1is N;

[1047] RB6is H;

[1048] RB7is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, C1-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN);

[1049] RB8is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, C1-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, C1-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN);

[1050] RB9is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, C1-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, C1-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN); and

[1051] RB1° is H; provided that at least one of RB7, RB8, and RB9being present is OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, C1-C4- hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, or -Ci-C4-alkyl-NH(RN);

[1052] RB11is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, C1-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, C1-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN); and

[1053] RB12is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, C1-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, C1-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN); provided that at least one of RB11and RB12is OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, or -Ci-C4-alkyl-NH(RN);

[1054] RB13is OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, C1-C4- aminoalkyl, or -Ci-C4-alkyl-NH(RN);

[1055] RB14is OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, C1-C4- aminoalkyl, or -Ci-C4-alkyl-NH(RN);

[1056] RB15is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, C1-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, C1-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN); and RB16is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN); provided that at least one of RB15and RB16being present is OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-c4- hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, or -Ci-C4-alkyl-NH(RN);

[1057] RB17is OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4- aminoalkyl, or -Ci-C4-alkyl-NH(RN);

[1058] RNis Ci-C4-alkyl; and

[1059] R1is H or Ci-C4-alkyl.

[1060] 2. The compound according to item 1 , wherein A is the following heteroaryl group wherein

[1061] X2is N or NH;

[1062] Y2is CH, CRA2, N, NH, or S;

[1063] Z2is CH, CRA4, N, NH, or S; provided that at least one of Y2and Z2is different from CH, CRA2or CRA4; and wherein the wavy line marks the connection to the remainder of the molecule; and wherein the dashed lines within the 5-membered ring indicate the presence of double bonds, such that an aromatic ring system is formed; and wherein RA2, RA3, and RA4represent the one or more, same or different substituents RAat the heteroaryl group A as defined in claim 1 .

[1064] 3. The compound according to item 1 or 2, wherein A is any one of the following heteroaryl groups: wherein the wavy line in each case marks the connection to the remainder of the molecule; and wherein

[1065] RA3is Ci-Ce-alkyl, C-i-Ce-haloalkyl, or 3- to 10-membered saturated or partially unsaturated carbocyclyl, carbocyclyl-Ci-C2-alkyl, carbobicyclyl, carbobicyclyl-Ci-C2-alkyl, heterocyclyl, heterocyclyl-Ci-C2-alkyl, heterobicyclyl, or heterobicyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic or heterobicyclic rings comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RY; wherein

[1066] RYis Cl, F, or Ci-C2-alkyl.

[1067] 4. The compound according to any one of items 1 to 3, wherein A is wherein the wavy line in each case marks the connection to the remainder of the molecule; and wherein

[1068] RA3is Ci-Ce-alkyl, C-i-Ce-haloalkyl, or 3- to 10-membered saturated carbocyclyl, carbocyclyl-Ci-C2- alkyl, carbobicyclyl, carbobicyclyl-Ci-C2-alkyl, heterocyclyl, heterocyclyl-Ci-C2-alkyl, heterobicyclyl, or heterobicyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic or heterobicyclic rings comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RY; wherein

[1069] RYis Cl, F, or Ci-C2-alkyl.

[1070] 5. The compound according to any one of items 1 to 3, wherein

[1071] A is wherein the wavy line in each case marks the connection to the remainder of the molecule; and wherein

[1072] RA3is Ci-Ce-alkyl, C-i-Ce-haloalkyl, or 3- to 10-membered saturated carbocyclyl, carbocyclyl-Ci-C2- alkyl, carbobicyclyl, carbobicyclyl-Ci-C2-alkyl, heterocyclyl, heterocyclyl-Ci-C2-alkyl, heterobicyclyl, or heterobicyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic or heterobicyclic rings comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RY; wherein

[1073] RYis Cl, F, or Ci-C2-alkyl.

[1074] 6. The compound according to any one of items 2 to 4, wherein RA3is any one of the following groups

[1075] CH3, CH2CH3, CH2CH2CH3, CH(CH3)2, C(CH3)3, CF3, wherein the wavy line in each case marks the connection to the A group.

[1076] 7. The compound according to any one of items 2 to 6, wherein

[1077] RA3is wherein the wavy line marks the connection to the A group.

[1078] 8. The compound according to any one of items 1 to 7, wherein

[1079] B is wherein the wavy line marks the connection to the remainder of the molecule; and wherein

[1080] RB1is H;

[1081] RB2is H, Cl, F, CN, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;

[1082] RB3is H, Cl, F, CN, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;

[1083] RB4is H, Cl, F, CN, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2; and

[1084] RB5is H; provided that at least one of RB2, RB3, and RB4is OH, NH2, SH, CH2OH, CH(CH3)OH, C(CH3)2OH,

[1085] CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2; and wherein preferably

[1086] RB1is H;

[1087] RB2is OH, NH2, SH, CH2SH, CH2OH, C(CH3)2OH, CH(CH3)OHor CH2NH2;

[1088] RB3is H;

[1089] RB4is H; and

[1090] RB5is H. 9. The compound according to any one of items 1 to 8, wherein wherein the wavy line marks the connection to the remainder of the molecule; and wherein

[1091] RB7is H, Cl, F, CN, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;

[1092] RB8is H, Cl, F, CN, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;

[1093] RB9is H, Cl, F, CN, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2; and

[1094] RB1° is H; provided that at least one of RB7, RB8, and RB9is OH, NH2, SH, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2.

[1095] 10. The compound according to any one of items 1 to 9, wherein

[1096] R1is H.

[1097] 11 . The compound according to any one of items 1 to 9, wherein

[1098] R1is Ci-C4-alkyl, preferably CH3.

[1099] 12. The compound according to item 11 , wherein the compound is a compound of formula (IA)

[1100] 13. The compound according to item 11 , wherein the compound is a compound of formula (IB)

[1101] 14. The compound according to any one of items 1 to 10, wherein the compound is selected from the group consisting of:

[1102] N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-(3-(2-hydroxypropan-2-yl)phenyl)-1 H-pyrazol-4- yl)acetamide,

[1103] N-(3-cyclopropyl-1 H-pyrazol-5-yl)-2-(1-(3-(2-hydroxypropan-2-yl)phenyl)-1 H-pyrazol-4- yl)acetamide,

[1104] 2-(1-(3-aminophenyl)-1 H-pyrazol-4-yl)-N-(5-cyclopropyl-1 H-pyrazol-3-yl)acetamide,

[1105] 2-(1-(3-aminophenyl)-1 H-pyrazol-4-yl)-N-(3-cyclopropyl-1 H-pyrazol-5-yl)acetamide,

[1106] 2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-(trifluoromethyl)thiazol-2-yl)acetamide,

[1107] 2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-isopropyl-1 H-pyrazol-3-yl)acetamide, 2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(3-isopropyl-1 H-pyrazol-5-yl)acetamide, N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-(3-hydroxyphenyl)-1 H-pyrazol-4-yl)acetamide, N-(3-cyclopropyl-1 H-pyrazol-5-yl)-2-(1-(3-hydroxyphenyl)-1 H-pyrazol-4-yl)acetamide, 2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-isopropylthiazol-2-yl)acetamide, N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)acetamide, N-(3-cyclopropyl-1 H-pyrazol-5-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)acetamide, and N-(5-cyclopropyl-1 ,3-thiazol-2-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)acetamide.

[1108] 15. A compound-linker construct comprising

[1109] (i) a compound of formula (I) as defined in any one of items 1 to 14; and

[1110] (ii) a linker L, wherein the linker L is preferably a cleavable linker.

[1111] 16. A conjugate comprising

[1112] (i) a compound-linker construct as defined in item 15; and

[1113] (ii) a targeting moiety T, wherein the targeting moiety T is preferably selected from the group consisting of an antibody, an antigen-binding fragment thereof, a nucleic acid-based molecule, a carbohydrate, a peptide, or a modified peptide.

[1114] 17. A pharmaceutical composition comprising a pharmaceutically acceptable amount of the compound according to any one of items 1 to 14, or the compound-linker construct of item 15, or the conjugate of item 16, and optionally a pharmaceutically acceptable carrier, diluent or excipient.

[1115] 18. A compound according to any one of items 1 to 14, or a compound-linker construct of item 15, or a conjugate of item 16, or a pharmaceutical composition according to item 17 for use in medicine.

[1116] 19. A compound according to any one of items 1 to 14, or a compound-linker construct of item 15, or a conjugate of item 16, or a pharmaceutical composition according to item 17 for use in treating or preventing cancer, a metabolic disorder, a neurologic disorder or an infectious disease, preferably for use in treating or preventing cancer, wherein particularly preferably the cancer is selected from the group consisting of leukemia, particularly acute myeloid leukemia (AML), B-cell acute lymphoblastic leukemia (B-ALL), and a chronic leukemia including chronic myeloid leukemia; lymphoma, particularly Non-Hodgkin Lymphoma and Hodgkin Lymphoma; head and neck cancer; esophageal cancer; adenoid cystic carcinoma; osteosarcoma; ovarian cancer; Ewing’s sarcoma; lung cancer; neuroblastoma, gastrointestinal cancer, endometrial cancer, cervical cancer, medulloblastoma, prostate cancer, breast cancer, thyroid cancer, meningioma, liver cancer, colorectal cancer, pancreatic cancer, chondrosarcoma, and kidney cancer.

Claims

Claims1 . A compound of formula (I) or a stereoisomer, tautomer, pharmaceutically acceptable salt, or hydrate thereof:whereinA is a 5-membered heteroaryl group, which comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the heteroaryl group is independently unsubstituted or substituted with one or more, same or different substituents RA, provided that at least one substituent RAis present at the heteroaryl group A; whereinRAis halogen, CN, C-i-Ce-alkyl, C-i-Ce-haloalkyl, or 3- to 10-membered saturated or partially unsaturated carbocyclyl, carbocyclyl-Ci-C2-alkyl, carbobicyclyl, carbobicyclyl-Ci-C2-alkyl, heterocyclyl, heterocyclyl-Ci-C2-alkyl, heterobicyclyl, or heterobicyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic or heterobicyclic rings comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RY; whereinRYis Cl, F, or Ci-C4-alkyl; is any one of the following groupswherein the wavy line in each case marks the connection to the remainder of the molecule; and wherein RB1is H;RB2is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4- hydroxyalkyl, Ci-C4-alkyl-S-, Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN);RB3is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN);RB4is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN); andRB5is H; provided that at least one of RB2, RB3, and RB4is OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, or -Ci-C4-alkyl-NH(RN);X1is N or CRB6;Y1is N or CRB7;Z1is N or CRB8; provided that one, but not more than one of X1, Y1, and Z1is N;RB6is H;RB7is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN);RB8is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN);RB9is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN); andRB1° is H; provided that at least one of RB7, RB8, and RB9being present is OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-c4- hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, or -Ci-C4-alkyl-NH(RN);RB11is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN); andRB12is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN); provided that at least one of RB11and RB12is OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, or -Ci-C4-alkyl-NH(RN);RB13is OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4- aminoalkyl, or -Ci-C4-alkyl-NH(RN);RB14is OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4- aminoalkyl, or -Ci-C4-alkyl-NH(RN);RB15is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, Ci-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, Ci-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN); andRB16is H, halogen, CN, OH, NH2, NH(RN), N(CH3)2, SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, Ci-C4-haloalkoxy, Ci-C2-alkoxy-Ci-C2-alkyl, C1-C4- hydroxyalkyl, Ci-C4-alkyl-S-, or Ci-C4-alkyl-S(O)2-, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, C1-C4- dimethylaminoalkyl, or -Ci-C4-alkyl-NH(RN); provided that at least one of RB15and RB16being present is OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, C1-C4- hydroxyalkyl, HS-Ci-C4-alkyl-, Ci-C4-aminoalkyl, or -Ci-C4-alkyl-NH(RN);RB17is OH, NH2, NH(RN), SH, C(=O)OH, C(=O)ORN, OC(=O)RN, C(=O)NH2, C(=O)NH(RN), C(=O)N(RN)2, NHC(=O)RN, N(RN)C(=O)RN, S(O)2OH, S(O)2ORN, S(O)2NH2, S(O)2NH(RN), S(O)2N(RN)2, NHS(O)2RN, N(RN)S(O)2RN, Ci-C4-hydroxyalkyl, HS-Ci-C4-alkyl-, C1-C4- aminoalkyl, or -Ci-C4-alkyl-NH(RN);RNis Ci-C4-alkyl; andR1is H or Ci-C4-alkyl.

2. The compound according to claim 1 , whereinA is the following heteroaryl groupwhereinX2is N or NH;Y2is CH, CRA2, N, NH, or S;Z2is CH, CRA4, N, NH, or S; provided that at least one of Y2and Z2is different from CH, CRA2or CRA4; and wherein the wavy line marks the connection to the remainder of the molecule; and wherein the dashed lines within the 5-membered ring indicate the presence of double bonds, such that an aromatic ring system is formed; and wherein RA2, RA3, and RA4represent the one or more, same or different substituents RAat the heteroaryl group A as defined in claim 1 .

3. The compound according to claim 1 or 2, wherein A is any one of the following heteroaryl groups:wherein the wavy line in each case marks the connection to the remainder of the molecule; and whereinRA3is Ci-Ce-alkyl, C-i-Ce-haloalkyl, or 3- to 10-membered saturated or partially unsaturated carbocyclyl, carbocyclyl-Ci-C2-alkyl, carbobicyclyl, carbobicyclyl-Ci-C2-alkyl, heterocyclyl, heterocyclyl-Ci-C2-alkyl, heterobicyclyl, or heterobicyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic or heterobicyclic rings comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RY; whereinRYis Cl, F, or Ci-C2-alkyl.

4. The compound according to any one of claims 1 to 3, wherein A iswherein the wavy line in each case marks the connection to the remainder of the molecule; and whereinRA3is Ci-Ce-alkyl, C-i-Ce-haloalkyl, or 3- to 10-membered saturated carbocyclyl, carbocyclyl-Ci-C2- alkyl, carbobicyclyl, carbobicyclyl-Ci-C2-alkyl, heterocyclyl, heterocyclyl-Ci-C2-alkyl, heterobicyclyl, or heterobicyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic or heterobicyclic rings comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RY; whereinRYis Cl, F, or Ci-C2-alkyl.

5. The compound according to any one of claims 1 to 3, whereinA iswherein the wavy line in each case marks the connection to the remainder of the molecule; and whereinRA3is Ci-Ce-alkyl, C-i-Ce-haloalkyl, or 3- to 10-membered saturated carbocyclyl, carbocyclyl-Ci-C2- alkyl, carbobicyclyl, carbobicyclyl-Ci-C2-alkyl, heterocyclyl, heterocyclyl-Ci-C2-alkyl, heterobicyclyl, or heterobicyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic or heterobicyclic rings comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and whereineach substitutable carbon or heteroatom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RY; whereinRYis Cl, F, or Ci-C2-alkyl.

6. The compound according to any one of claims 2 to 4, wherein RA3is any one of the following groupsCH3, CH2CH3, CH2CH2CH3, CH(CH3)2, C(CH3)3, CF3,wherein the wavy line in each case marks the connection to the A group.

7. The compound according to any one of claims 2 to 6, whereinRA3iswherein the wavy line marks the connection to the A group.

8. The compound according to any one of claims 1 to 7, whereinB iswherein the wavy line marks the connection to the remainder of the molecule; and whereinRB1is H;RB2is H, Cl, F, CN, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;RB3is H, Cl, F, CN, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2;RB4is H, Cl, F, CN, OH, NH2, SH, CH3, CHF2, CF3, OCH3, CH2OCH3, CH2OH, CH(CH3)OH, C(CH3)2OH, CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2; andRB5is H; provided that at least one of RB2, RB3, and RB4is OH, NH2, SH, CH2OH, CH(CH3)OH, C(CH3)2OH,CH2SH, C(CH3)2SH, CH2NH2, or C(CH3)2NH2; and wherein preferablyRB1is H;RB2is OH, NH2, SH, CH2SH, CH2OH, C(CH3)2OH, CH(CH3)OH or CH2NH2;RB3is H;RB4is H or Cl; andRB5is H.

9. The compound according to claim 2, 3, 6, and 8, wherein A is any one of the following heteroaryl groups:wherein the wavy line in each case marks the connection to the remainder of the molecule;RA3preferablywherein the wavy line marks the connection to the A group;B iswherein the wavy line marks the connection to the remainder of the molecule; and wherein RB1is H;RB2is OH, NH2, CH2OH, or CH2NH2;RB3is H;RB4is H or Cl; andRB5is H.

10. The compound according to any one of claims 1 to 9, wherein R1is H.11 . The compound according to any one of claims 1 to 9, whereinR1is Ci-C4-alkyl, preferably CH3.

12. The compound according to claim 11 , wherein the compound is a compound of formula (IA)13. The compound according to claim 11 , wherein the compound is a compound of formula (IB)14. The compound according to any one of claims 1 to 10, wherein the compound is selected from the group consisting of:N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-(3-(2-hydroxypropan-2-yl)phenyl)-1 H-pyrazol-4- yl)acetamide,N-(3-cyclopropyl-1 H-pyrazol-5-yl)-2-(1-(3-(2-hydroxypropan-2-yl)phenyl)-1 H-pyrazol-4- yl)acetamide,2-(1-(3-aminophenyl)-1 H-pyrazol-4-yl)-N-(5-cyclopropyl-1 H-pyrazol-3-yl)acetamide,2-(1-(3-aminophenyl)-1 H-pyrazol-4-yl)-N-(3-cyclopropyl-1 H-pyrazol-5-yl)acetamide, 2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-(trifluoromethyl)thiazol-2-yl)acetamide, 2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-isopropyl-1 H-pyrazol-3-yl)acetamide, 2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(3-isopropyl-1 H-pyrazol-5-yl)acetamide, N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-(3-hydroxyphenyl)-1 H-pyrazol-4-yl)acetamide, N-(3-cyclopropyl-1 H-pyrazol-5-yl)-2-(1-(3-hydroxyphenyl)-1 H-pyrazol-4-yl)acetamide, 2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-isopropylthiazol-2-yl)acetamide, N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)acetamide, N-(3-cyclopropyl-1 H-pyrazol-5-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)acetamide, and N-(5-cyclopropyl-1 ,3-thiazol-2-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)acetamide.

15. The compound according to any one of claims 1 to 13, wherein the compound is selected from the group consisting of:(S)-N-(5-cyclopropylthiazol-2-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanamide,(R)-N-(5-cyclopropylthiazol-2-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanamide, N-(5-cyclopropylthiazol-2-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)pro panamide,(S)-N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4- yl)propanamide,(R)-N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4- yl)propanamide,N-(5-cyclopropyl-1 H-pyrazol-3-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanamide,(S)-N-(3-cyclopropyl-1 H-pyrazol-5-yl)-2-(1 -(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4- yl)propanamide,(R)-N-(3-cyclopropyl-1 H-pyrazol-5-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4- yl)propanamide,N-(3-cyclopropyl-1 H-pyrazol-5-yl)-2-(1-(3-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)propanamide,(S)-2-(1-(3-chloro-5-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-cyclopropylthiazol-2- yl)propanamide,(R)-2-(1-(3-chloro-5-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-cyclopropylthiazol-2- yl)propanamide,2-(1-(3-chloro-5-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-cyclopropylthiazol-2- yl)propanamide,2-(1-(3-chloro-5-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(5-cyclopropyl-1 H-pyrazol-3- yl)propanamide, and2-(1 -(3-chloro-5-(hydroxymethyl)phenyl)-1 H-pyrazol-4-yl)-N-(3-cyclopropyl-1 H-pyrazol-5- yl)propanamide.

16. A compound-linker construct comprising(i) a compound of formula (I) as defined in any one of claims 1 to 15; and(ii) a linker L, wherein the linker L is preferably a cleavable linker.

17. A conjugate comprising(i) a compound-linker construct as defined in claim 16; and(ii) a targeting moiety T, wherein the targeting moiety T is preferably selected from the group consisting of an antibody, an antigen-binding fragment thereof, a nucleic acid-based molecule, a carbohydrate, a peptide, or a modified peptide.

18. A pharmaceutical composition comprising a pharmaceutically acceptable amount of the compound according to any one of claims 1 to 15, or the compound-linker construct of claim 16, or the conjugate of claim 17, and optionally a pharmaceutically acceptable carrier, diluent or excipient.

19. A compound according to any one of claims 1 to 15, or a compound-linker construct of claim 16, or a conjugate of claim 17, or a pharmaceutical composition according to claim 18 for use in medicine.

20. A compound according to any one of claims 1 to 15, or a compound-linker construct of claim 16, or a conjugate of claim 17, or a pharmaceutical composition according to claim 18 for use in treating or preventing cancer, a metabolic disorder, a neurologic disorder or an infectious disease, preferably for use in treating or preventing cancer, wherein particularly preferably the cancer is selected from the group consisting of leukemia, particularly acute myeloid leukemia (AML), B-cell acute lymphoblastic leukemia (B-ALL), and a chronic leukemia including chronic myeloid leukemia; lymphoma, particularly Non-Hodgkin Lymphoma and Hodgkin Lymphoma; head and neck cancer; esophageal cancer; adenoid cystic carcinoma; osteosarcoma; ovarian cancer; Ewing’s sarcoma; lung cancer; neuroblastoma, gastrointestinal cancer, endometrial cancer, cervical cancer,medulloblastoma, prostate cancer, breast cancer, thyroid cancer, meningioma, liver cancer, colorectal cancer, pancreatic cancer, chondrosarcoma, and kidney cancer.

Images