Pharmaceutical composition for treating tuberculosis, comprising fusion peptide derived from toxoplasma gondii macrophage migration inhibitory factor

The TgMIF fusion peptide addresses the inadequacies of current tuberculosis treatments by restoring mitochondrial function and promoting effective immune responses, effectively targeting drug-resistant strains with minimal side effects.

WO2026019058A1PCT designated stage Publication Date: 2026-01-22IND UNIV COOP FOUND HANYANG UNIV ERICA CAMPUS
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/007273
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-18
Filing Date
2025-05-28
Publication Date
2026-01-22

AI Technical Summary

Technical Problem

Current treatments for tuberculosis, particularly multidrug-resistant strains, are inadequate and often lead to significant health and economic burdens due to drug resistance, with a need for more effective and less toxic therapies that can restore macrophage function and immune response.

Method used

A fusion peptide derived from Toxoplasma gondii macrophage migration inhibitory factor (TgMIF) interacts with CD74, AZIN1, and STAT1 to regulate mitochondrial function and macrophage polarity, enhancing the immune response against Mycobacterium tuberculosis infection.

Benefits of technology

The TgMIF peptide restores mitochondrial function, promotes M1 macrophage polarization, and inhibits drug-resistant tuberculosis bacteria, offering a promising therapeutic approach with minimal side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025007273_22012026_PF_FP_ABST
    Figure KR2025007273_22012026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a fusion polypeptide derived from Toxoplasma gondii. The fusion polypeptide can be used as a pharmaceutical composition for treating tuberculosis. In particular, the fusion polypeptide according to the present invention acts specifically on the lungs infected with Mycobacterium tuberculosis and has therapeutic efficacy even against tuberculosis having resistance to isoniazid (INH), pyrazinamide (PZA), rifampin (RFP), and / or streptomycin (SM).
Need to check novelty before this filing date? Find Prior Art

Description

Pharmaceutical composition for treating tuberculosis comprising a fusion peptide derived from Toxoplasma gondii macrophage migration inhibitory factor

[0001] The present invention relates to a pharmaceutical composition for treating tuberculosis comprising a fusion peptide derived from a Toxoplasma gondii macrophage migration inhibitory factor.

[0002] Tuberculosis (TB) has been known to humans since ancient times. In the early 20th century, the introduction of effective anti-tuberculosis drugs such as isoniazid (isonicotinylhydrazine; INH) and rifampicin (RIF) led to the recognition of TB as a preventable and generally treatable disease. However, more than 10 million people still contract TB each year. Early in the 2020 coronavirus disease (COVID-19) pandemic, TB incidence rates significantly decreased. Despite some recovery in 2021, incidence rates remained lower than those observed in the pre-pandemic period until recently, when TB incidence rates have recently returned to pre-pandemic levels.

[0003] Mycobacterium tuberculosis (MTB) is a pathogenic bacterial species in the Mycobacteriaceae family that causes tuberculosis. MTB spreads to various sites through the respiratory tract, typically affecting the lungs. Alveolar macrophages (AMs) are the first line of defense, activating immune mechanisms such as phagocytosis, cytokine expression (e.g., hepatitis-γ), autophagy, apoptosis, pyroptosis, and the secretion of cytotoxic substances (NO, iNOS, and ROS). However, these innate defense mechanisms against MTB are extensively manipulated by various strategies of MTB, primarily for successful intracellular infection. Furthermore, engineered macrophages transform from enemies to primary hosts, fostering an environment conducive to MTB's intracellular survival and replication. Therefore, understanding the mechanisms of altered macrophages following MTB infection and restoring their function could provide insights into novel TB treatment strategies by modulating their immunobiological functions.

[0004] Recently, biological drugs derived from microbiomes or parasites have been used to treat various diseases, reduce side effects, and improve treatment outcomes. Toxoplasma gondii (T. gondii), a protozoan parasite that causes toxoplasmosis, infects approximately one-third of the world's population. While T. gondii infection may generally be asymptomatic, it can cause central nervous system disorders and birth defects in immunocompromised individuals. T. gondii infection triggers innate immunity. However, T. gondii has evolved to manipulate the host immune response through the activities of several parasite-specific proteins.

[0005] Macrophage migration inhibitory factor (MIF) is a pleiotropic cytokine produced by the pituitary gland and various cell types. MIF plays a crucial role in inducing signaling pathways and inflammatory responses through the MIF-CD74 axis. MIF is located on human chromosome 22 (22q11.2) and encodes a 114-amino acid non-glycosylated protein with approximately 90% homology across mammals. Furthermore, several parasites, including Entamoeba histolytica, Plasmodium fasciparum, Leishmania, Trichomonas valinalis, and T. gondii, contain proteins similar to MIF and modulate host immune responses. Although Toxoplasma gondii MIF (TgMIF) shares close structural, biochemical, and immunological properties with mammalian MIF, the mechanisms by which TgMIF regulates immune responses remain unclear.

[0006]

[0007] The present invention aims to provide a polypeptide having therapeutic properties against tuberculosis.

[0008]

[0009] The present invention provides a polypeptide comprising at least one amino acid sequence selected from the group consisting of an amino acid sequence represented by SEQ ID NO: 1 or an amino acid sequence having 90% or more homology thereto, an amino acid sequence represented by SEQ ID NO: 2 or an amino acid sequence having 90% or more homology thereto, and an amino acid sequence represented by SEQ ID NO: 3 or an amino acid sequence having 90% or more homology thereto. In one embodiment of the present invention, the polypeptide includes all of the amino acid sequence represented by SEQ ID NO: 1 or an amino acid sequence having 90% or more homology thereto, the amino acid sequence represented by SEQ ID NO: 2 or an amino acid sequence having 90% or more homology thereto, and the amino acid sequence represented by SEQ ID NO: 3 or an amino acid sequence having 90% or more homology thereto, and in another embodiment of the present invention, the amino acid sequence having 90% or more homology with the amino acid sequence represented by SEQ ID NO: 2 includes a conservative amino acid substitution at the 5th Arg of SEQ ID NO: 2, and in yet another embodiment of the present invention, the sequence having 90% or more homology with the amino acid sequence represented by SEQ ID NO: 2 and including a conservative amino acid substitution at the 5th Arg of SEQ ID NO: 2 is SEQ ID NO: 4.In one embodiment of the present invention, the amino acid sequence having 90% or more homology with the amino acid sequence represented by SEQ ID NO: 3 includes a conservative amino acid substitution of the second Lys of SEQ ID NO: 3, and in another embodiment of the present invention, the sequence having 90% or more homology with the amino acid sequence represented by SEQ ID NO: 3 and including a conservative amino acid substitution of the second Lys of SEQ ID NO: 3 is SEQ ID NO: 5, and in another embodiment of the present invention, the amino acid sequence represented by SEQ ID NO: 1 or an amino acid sequence having 90% or more homology thereto, the amino acid sequence represented by SEQ ID NO: 2 or an amino acid sequence having 90% or more homology thereto, and the amino acid sequence represented by SEQ ID NO: 3 or an amino acid sequence having 90% or more homology thereto are connected by a linker.

[0010] The present invention provides a pharmaceutical composition for preventing or treating tuberculosis, comprising the polypeptide described above. In one embodiment of the present invention, the tuberculosis is resistant to at least one selected from the group consisting of isoniazid (INH), pyrazinamide (PZA), rifampicin (RFP), and streptomycin (SM).

[0011] The present invention provides a nucleic acid molecule encoding the above polypeptide.

[0012] The present invention provides an expression vector comprising the above nucleic acid molecule.

[0013] The present invention provides a recombinant cell expressing the above polypeptide.

[0014] The present invention provides a pharmaceutical composition for preventing or treating tuberculosis, comprising a nucleic acid molecule encoding the above polypeptide or a recombinant cell expressing the above polypeptide. In one embodiment of the present invention, the tuberculosis is tuberculosis resistant to at least one selected from the group consisting of isoniazid (INH), pyrazinamide (PZA), rifampicin (RFP), and streptomycin (SM).

[0015] The present invention provides a method for preventing or treating tuberculosis, comprising administering to a subject in need thereof a pharmaceutically effective amount of a polypeptide comprising at least one amino acid sequence selected from the group consisting of the amino acid sequence represented by SEQ ID NO: 1 or an amino acid sequence having at least 90% homology thereto, the amino acid sequence represented by SEQ ID NO: 2 or an amino acid sequence having at least 90% homology thereto, and the amino acid sequence represented by SEQ ID NO: 3 or an amino acid sequence having at least 90% homology thereto. The properties of the polypeptide are as described above, and description of repetitive parts is omitted to avoid complexity of explanation. In one embodiment of the present invention, the administration may be oral (enteral) administration, parenteral (by injection), rectal administration, transdermal administration, intradermal administration, intrathecal administration, subcutaneous (SC) administration, intravenous (IV) administration, intramuscular (IM) administration, and / or intranasal administration.

[0016]

[0017] The peptide according to the present invention not only possesses therapeutic properties against tuberculosis, but also inhibits drug resistance in multidrug-resistant tuberculosis bacteria. Furthermore, due to its high specificity for tissues infected with tuberculosis bacteria, it is expected to have minimal side effects.

[0018]

[0019] Figure 1. TgMIF interacts with CD74, STAT1, and AZIN1. (A) Validation of 6xHis-TgMIF purified from Escherichia coli by Coomassie blue staining (left) or Western blot analysis with αHis (right). (B) Expression of pro-inflammatory cytokines (TNF-α, IL-6, and IL-12p40) and anti-inflammatory cytokines (IL-10, TGF-β, and IL-4) in BMDMs treated with rTgMIF (5 μg / mL). Data shown are the mean ± SD of five experiments. (C) Mass spectrometry analysis of STAT1, AZIN1, and CD74 in THP-1 cells expressing TgMIF or vector. (D) Identification of binding partners for rTgMIF using a protein microarray. A = affinity; S = specificity. (E) Interactions with CD74, STAT1, and AZIN1 in BMDMs or THP1 stimulated with rTgMIF (5 μg / mL). (F) Western blot analysis and interaction of STAT1 and AZIN1 in nuclear and cytoplasmic fractions of Raw264.7 cells. (G) Schematic representation of the interactions of TgMIF with CD74, STAT1, and AZIN1. The data are representative of four independent experiments with similar results (E and F).

[0020] Figure 2. Establishment and validation of TgMIF in BMDM. (A) Validation of bacterially purified 6xHis-TgMIF by silver staining. (B) Evaluation of cytotoxicity induced by pTgMIF in BMDM. Data shown are the mean ± standard deviation of five experiments. (C) Specificity of TgMIF interaction with endogenous CD74, STAT1, or AZIN1 in transfected BMDM. Data shown are representative of four independent experiments with similar results.

[0021] Figure 3. Mapping of TgMIF binding sites. (A) Identification of the CD74 binding site of TgMIF using GST-vector or GST-TgMIF and corresponding truncated constructs. (B) Identification of the TgMIF binding site of CD74 using GST-vector or GST-CD74 and corresponding truncated constructs. (C) Identification of the TgMIF binding site of STAT1 or TgMIF using GST-vector, GST-TgMIF, or GST-STAT1 and corresponding truncated constructs. (D) Identification of the TgMIF binding site of AZIN1 or TgMIF using GST-vector, GST-TgMIF, or GST-AZIN1 and corresponding truncated constructs. The data are representative of four independent experiments with similar results (A-D).

[0022] Figure 4. Endocytosis pathway of TgMIF and its interaction with CD74. (A) Effect of endocytosis inhibitors (10 mM methyl-β-cyclodextrin, a cholesterol binder; 1 μM amiroride, a Na+ / H+ exchange inhibitor; and 10 μM cytochalasin D, an actin polymerization inhibitor) in BMDMs. (B) Inhibition of TgMIF expression by shCD74 treatment in BMDMs. (C) Binding specificity of TgMIF peptide (1 μM) to CD74. (D) Inflammatory response to TgMIF peptide (1 μM) in BMDMs. These data are representative of four independent experiments with similar results (B and C). Statistical significance was determined by Student's t-test with Bonferroni adjustment (*P <0.05; **P <0.01; ***P <0.001).

[0023] Figure 5. TgMIF regulates mitochondrial fusion and fission through AZIN1. (A) Regulation of mitochondrial dynamics by TgMIF through binding to AZIN1 revealed by DGE analysis. (B-D) Expression levels of genes involved in mitochondrial fission (DRP1, FIS1, MEF) and fusion (MFN1, MFN2, OPA1) in rTgMIF-treated BMDM. Data shown are from four independent experiments with similar results (C and D). (E) AZIN1-dependent regulation of mitochondrial mass by TgMIF in MTB-infected macrophages. Statistical significance was determined by Student's t-test with Bonferroni correction (*P <0.05; **P <0.01; ***P <0.001).

[0024] Figure 6. TgMIF regulates mitochondrial dynamics and metabolism through AZIN1. (A-C) AZIN1-dependent regulation of mitochondrial fission and fusion gene expression by TgMIF (1, 5, and 10 μM). (D and E) AZIN1-dependent regulation of ATP synthase-related gene expression by TgMIF. (F) Intracellular ATP production in MTB-infected BMDMs is dependent on TgMIF and AZIN1. (G) Mitochondrial aerobic and extracellular oxidation changes are restored by TgMIF and AZIN1. (H) Measurement of mtDNA leakage and mitochondrial complex V activity in MTB-infected macrophages. (I) Number of colony-forming units (CFU) of MTB. Statistical significance was determined by Student's t-test with Bonferroni adjustment (*P < 0.05; **P < 0.01; ***P < 0.001).

[0025] Figure 7. TgMIF regulates mitochondrial complex V activity through AZIN1. (A) Analysis of differentially expressed genes (DEGs) related to mitochondrial complexes affected by TgMIF and AZIN1. (B and C) Regulation of genes related to mitochondrial ATP synthase by AZIN1 in rTgMIF-treated BMDM. Data shown are representative of four independent experiments with similar results. (D) ROS regulation in TgMIF-treated MTB-infected macrophages is due to AZIN1 expression. (E) Specific regulation of mitochondrial complex V activity by TgMIF affected by AZIN1. (F) Metabolic regulation through changes in NAD+ and intracellular lactate secretion levels by TgMIF in an AZIN1-dependent manner. Data shown are the mean ± standard deviation of five experiments.

[0026] Figure 8. TgMIF-induced STAT1-dependent macrophage polarization enhances host defense. (A) Differential expression of macrophage polarization markers in TgMIF-treated BMDMs. (B) Changes in the phosphorylation levels of STAT1, STAT3, and STAT6 in BMDMs treated with rTgMIF (5 μg / mL). (C) Changes in the expression of M1 macrophage polarization markers and STAT1 in response to various concentrations of TgMIF peptide (1, 5, and 10 μM). (D) Changes in the expression of macrophage polarization markers in response to various concentrations of TgMIF (1, 5, and 10 μM). (E) TgMIF-dependent regulation of STAT1-dependent M1 and M2 macrophage polarization. (F) Proinflammatory cytokine production in MTB-infected BMDMs is dependent on TgMIF and STAT1. (G) Colony-forming unit (CFU) counts of MTB. Statistical significance was determined by Student's t-test with Bonferroni adjustment (*P <0.05; **P <0.01; ***P <0.001).

[0027] Figure 9. Effect of TgMIF on the response of macrophages to conjugated bacterial infection. (A) Differential expression patterns of candidate genes in response to TgMIF treatment. (B) Changes in macrophage polarization markers in M. tuberculosis-infected macrophages following TgMIF treatment. (C) STAT1-dependent effect of TgMIF on macrophage polarization in M. tuberculosis-infected macrophages. (D) Effect of TgMIF on inflammatory cytokine production in M. tuberculosis-infected macrophages. (E) STAT1-dependent inhibition of M. tuberculosis growth by TgMIF at the indicated doses and MOIs. Statistical significance was determined by Student's t-test with Bonferroni correction (*P <0.05; **P <0.01; ***P <0.001).

[0028] Figure 10. Experimental characterization of TgMIF peptide mutants. (A) Design of TgMIF peptide mutants targeting CD74 and STAT1. (B) Evaluation of peptide stability, CYP enzyme metabolism, and PK parameters. (C) Design of an optimal timetable for the inhibition of Yersinia jaundice using TgMIF. (D) Effect of TgMIF on mitochondrial function in Yersinia-infected mice. (E) Specific modulation of STAT1 phosphorylation by TgMIF. (F) Biodistribution analysis of TgMIFwt-Cy5.5 by IVIS imaging at various times after MTB infection. Statistical significance was determined by Student's t-test with Bonferroni correction (*P <0.05; **P <0.01; ***P <0.001).

[0029] Figure 11. Therapeutic effects of TgMIF on lung injury and immune responses in MTB-induced mice. (A and B) Therapeutic effects of TgMIF peptide and its mutants, TgMIF MT1 (CD74-binding mutant) and TgMIF MT2 (STAT1-binding mutant), on lung injury in MTB-induced mice (n=25). (C) Effect of TgMIF peptide on mitochondrial function in the lungs of MTB-infected mice. (D) Changes in mitochondrial function and extracellular oxidation rate in respiration following TgMIF treatment. (E) Changes in macrophage polarization marker expression in MTB-infected mice treated with TgMIF peptide. (F) Production of inflammatory cytokines in the lungs of MTB-infected mice following TgMIF treatment. Statistical significance was determined by Student's t-test with Bonferroni adjustment (*P <0.05; **P <0.01; ***P <0.001).

[0030] Figure 12. Changes in the number of immune cells and modulation of inflammatory cytokines in the lungs of MTB-infected mice. (A) Changes in the number of immune cells in the lungs of MTB-infected mice. (B) Changes in inflammatory cytokine production in the lungs of MTB-infected mice by TgMIF. Statistical significance was determined by Student's t-test with Bonferroni correction (*P <0.05; **P <0.01; ***P <0.001).

[0031] Figure 13. Effect of TgMIF treatment on TB survival after MTB infection. The effect of TgMIF on MTB-induced mortality was dependent on STAT1 and AZIN1 (n=35). Statistical significance was determined using the log-rank test compared to control mice.

[0032] Figure 14. Therapeutic interactions of TgMIF with TB drugs. (A) Effect of TgMIF in combination with INH (0.05, 0.1, 0.5 μg / ml), PZA (5, 10, 20 μg / ml), and RFP (0.025, 0.1, 0.5 μg / ml) on MTB growth inhibition in human MDM. (B) Inhibitory effect of INH (15 mg / kg) and TgMIF (10 μg) in the lungs of MTB-infected mice (n=35). (C and D) Reduction in bacterial colony counts of drug-resistant TB strains by TgMIF. (E and F) Recovery of mitochondrial function in MDR-TB-infected lungs after TgMIF treatment. (G) Regulation of macrophage polarization markers by TgMIF in MDR-infected lungs. (H) TgMIF-induced inflammatory cytokine production in MTB-infected macrophages. Statistical significance was determined by Student's t-test with Bonferroni correction (*P <0.05; **P <0.01; ***P <0.001).

[0033] Figure 15. Effect of TgMIF on immune cell infiltration and lung damage in resistant tuberculosis. Posttreatment with TgMIF reduced immune cell infiltration and lung damage induced by resistant tuberculosis. Statistical significance was determined by Student's t-test with Bonferroni correction (*P <0.05; **P <0.01; ***P <0.001).

[0034]

[0035] Hereinafter, the present invention will be described in detail with reference to the attached drawings and embodiments thereof. However, the following embodiments are provided as examples of the present invention. If a detailed description of a technology or configuration well known to those skilled in the art is judged to unnecessarily obscure the gist of the present invention, such detailed description may be omitted, and the present invention is not limited thereby. The present invention is capable of various modifications and applications within the scope of the following claims and equivalents interpreted therefrom.

[0036] Additionally, the terminology used in this specification is intended to appropriately express preferred embodiments of the present invention, and may vary depending on the intent of the user or operator, or the customs of the field to which the present invention pertains. Therefore, the definitions of these terms should be determined based on the contents throughout this specification. Throughout this specification, when a part is said to "include" a certain component, unless specifically stated otherwise, this does not mean that other components are excluded, but rather that other components may be included.

[0037] Unless otherwise defined, all technical terms used in this invention have the same meaning as commonly understood by those skilled in the art. While preferred methods and samples are described herein, similar or equivalent methods are also included within the scope of the present invention. The contents of all publications cited herein as references are incorporated herein by reference.

[0038] The present invention aimed to determine the role of Toxoplasma gondii macrophage migration inhibitory factor (TgMIF) in regulating the immune response during Mycobacterium tuberculosis (MTB) infection. The researchers identified the interaction of TgMIF with novel binding proteins (CD74, AZIN1, and STAT1) and their contribution to anti-MTB activity. In the present invention, the potential therapeutic effect of TgMIF against tuberculosis (TB) was confirmed through restoration of mitochondrial function and regulation of macrophage polarity.

[0039] The approval of 17 new compounds for clinical trials, either independently or in combination with nine existing anti-TB drugs, represents a significant advance over previous years (Boshoff, HIM, Warner, DF, and Gold, B. (2023). Editorial: Drug-resistant Mycobacterium tuberculosis. Frontiers in Cellular and Infection Microbiology13.; Edwards, BD, and Field, SK (2022). The Struggle to End a Millennia-Long Pandemic: Novel Candidate and Repurposed Drugs for the Treatment of Tuberculosis. Drugs82, 1695-1715; Fernandes, GFS, Thompson, AM, Castagnolo, D., Denny, WA, and Dos Santos, JL (2022). Tuberculosis Drug Discovery: Challenges and New Horizons. J Med Chem65, 7489-7531). However, MTB has developed resistance to drugs currently used in clinical practice. MDR-TB, particularly resistant to the anti-tuberculosis drugs INH (isoniazid) and RIF (rifampicin), poses a significant global health and economic burden. Therefore, new treatments, such as more effective and less toxic drugs (probiotics and polyphenols) and biological products (antimicrobial peptides [AMPs]), are being studied to overcome MTB antibiotic resistance.

[0040] Toxoplasma gondii infects various organs and tissues during acute infection, particularly targeting the brain during chronic infection. One of the most notable immunological features of T. gondii infection is the robust and sustained cell-mediated immune response. These immunoregulatory mechanisms play a crucial role in preventing persistent pathological processes during T. gondii infection. These immunoregulatory mechanisms observed during T. gondii infection have provided a basis for exploring their potential applications in the treatment of other immune-related diseases. Consequently, T. gondii-derived proteins have emerged as promising candidates for therapeutic intervention in challenging and refractory conditions.

[0041] MIF is involved in innate and adaptive immune responses, and among key physiological processes, it exhibits inflammatory responses, including activation of the extracellular signal-regulated kinase (ERK) pathway induced by MIF-CD74 interaction. Furthermore, the ERK signaling pathway is promoted by MIF and TgMIF. Several studies have suggested that TgMIF can induce ERK signaling through its interaction with CD74. Our results demonstrate that TgMIF binds to CD74 and promotes the production of cytokines, including TNF-α, IL-6, and IL-10. Therefore, TgMIF may exhibit similar biological functions to MIF due to their shared structural similarity, particularly by regulating immune responses through the activation of specific signaling pathways.

[0042] Previous studies have reported that MIF is involved in the innate immune response to MTB in humans, inducing the secretion of early inflammatory cytokines such as TNF-α and IL-1β (Oddo, M., Calandra, T., Bucala, R., and Meylan, P.R. (2005). Macrophage migration inhibitory factor reduces the growth of virulent Mycobacterium tuberculosis in human macrophages. Infect Immun73, 3783-3786. Orme, I.M., and Cooper, A.M. (1999). Cytokine / chemokine cascades in immunity to tuberculosis. Immunol Today20, 307-312). Furthermore, MIF-deficient mice showed increased lung pathology and suppressed production of innate cytokines, including TNF-α, IL-12, and IL-10, when infected with MTB. Furthermore, MTB utilizes host mitochondria and modulates host immune signaling, playing crucial roles in successful infection. MTB infection induces distinct changes in mitochondrial dynamics, including mitochondrial assembly and fission, which are crucial for maintaining mitochondrial function and ATP production. These mitochondrial changes play a crucial role in the immune metabolism of the host cell.

[0043] In macrophages infected with MTB, the expression of mitochondrial fission proteins, such as Drp1 and p-MFF, was increased. Another study reported that MTB infection increases the expression of Mfn1, thereby inducing mitochondrial assembly. This is consistent with previous results showing that MTB promotes the expression of fission and assembly proteins. However, in response to AZIN1 expression, TgMIF significantly inhibited the fission protein Drp1 and promoted the assembly protein Mfn1. Furthermore, a previous study reported a decrease in mitochondrial ATP production in Mtb-infected BMDM. Consistent with these results, we confirmed that despite the decrease in ATP production induced by MTB, TgMIF treatment increased ATP production in an AZIN1-dependent manner. Overall, TgMIF may influence the host immune response by regulating mitochondrial assembly and ATP production in MTB-infected cells.

[0044] In the present invention, we demonstrated that TgMIF interacts with STAT1 in macrophages and identified a specific binding domain for this interaction. The specificity of TgMIF's interaction with STAT1 may be due to the unique structural and functional properties of each STAT protein. STAT1, STAT3, and STAT6 all belong to the STAT family and have distinct functions in cell signaling pathways. STAT1, STAT3, and STAT6 possess a CCD domain, which has been reported to be important for protein interaction and plays a crucial role in regulating STAT dimer formation. The balance between STAT1 and STAT3 / STAT6 activity regulates macrophage polarity and function. Furthermore, STAT1 activity leads to M1 macrophage polarization, which induces cytotoxicity and inflammatory responses. In contrast, activation of STAT3 and STAT6 through IL-4 / IL-13 and IL-10 signaling promotes M2 macrophage polarization, which is associated with activated tolerance and tissue repair. In an example according to the present invention, we demonstrate that ATP production, which is reduced by MTB, increases under the influence of AZIN1 after TgMIF treatment. TgMIF interacts with STAT1 to promote the expression of M1 macrophage markers cd80, cd86, and inos, and increases the inflammatory cytokines TNF-α and IL-6, while decreasing the anti-inflammatory cytokine IL-10. These results demonstrate that TgMIF regulates macrophage polarity and function through STAT1 activation, thereby influencing the host immune response to pathogens such as MTB.

[0045] Mutations and genetic factors play a crucial role in the evolution of persistent antibiotic-resistant MTB cells. These factors are all crucial for the development and maintenance of MTB antibiotic resistance. In the present invention, we demonstrate the therapeutic effects of TgMIF in the lungs of mice infected with drug-resistant MTB by improving mitochondrial function and inducing M1 macrophage polarization. Through the present invention, we demonstrate the potential of TgMIF as a promising therapeutic agent for drug-resistant MTB by targeting mitochondrial function and promoting M1 macrophage polarization.

[0046] In summary, the present invention discloses the promising therapeutic potential of TgMIF against MTB infection by modulating immune responses, restoring mitochondrial function, and enhancing the effects of traditional TB drugs.

[0047] The peptide or fusion peptide of the present invention is a TgMIF-derived protein that interacts with CD74, anti-polyamino acid kinase inhibitor 1 (AZIN1), and signal transducer and activator of transcription 1 (STAT1), thereby regulating endocytosis, restoring mitochondrial function, and regulating macrophage polarity. The fusion peptide according to the present invention includes a polypeptide consisting of an amino acid sequence represented by SEQ ID NO: 1, a polypeptide consisting of an amino acid sequence represented by SEQ ID NO: 2, and / or a polypeptide consisting of an amino acid sequence represented by SEQ ID NO: 3.

[0048] The fusion peptide according to the present invention may be in a form in which the three polypeptides described above are fused regardless of the order. For example, they may be linked in the order of (SEQ ID NO: 1)-(SEQ ID NO: 2)-(SEQ ID NO: 3), or may be linked in the order of (SEQ ID NO: 1)-(SEQ ID NO: 3)-(SEQ ID NO: 2), (SEQ ID NO: 2)-(SEQ ID NO: 1)-(SEQ ID NO: 3), (SEQ ID NO: 2)-(SEQ ID NO: 3)-(SEQ ID NO: 1), (SEQ ID NO: 3)-(SEQ ID NO: 2)-(SEQ ID NO: 1), or (SEQ ID NO: 3)-(SEQ ID NO: 1)-(SEQ ID NO: 2). When linked in the above manner, they may be linked by a direct peptide bond, or may be linked via a linker.

[0049] The linker can increase the flexibility of the fusion protein without interfering with the structure of each component within the fusion protein. In some embodiments, the linker moiety is a peptide linker having a length of 2 to 100 amino acids. Exemplary linkers include Gly-Gly, Gly-Ala-Gly, Gly-Pro-Ala, and Gly (G). n and a linear peptide having at least two amino acid residues, such as a Gly-Ser (GS) linker. The GS linker described herein comprises (GS) n , (GSGSG) n , (G2S) n , G2S2G, (G2SG) n , (G3S) n , (G4S) n , (GGSGG) n G n , GSG4SG4SG and (GGGGS) n including but not limited to, where n is 1 or greater. (G) n An example of a linker includes the G9 linker, (GGGGS) nExamples of linkers include GGGGS or (GGGGS)3 linkers. Suitable linear peptides include polyglycine, polyserine, polyproline, polyalanine, and oligopeptides composed of alanyl and / or serine and / or proline and / or glycyl amino acid residues. Linker residues can be used to connect the components of the fusion proteins disclosed herein.

[0050] In relation to an amino acid sequence (peptide or protein), "fragment" means a part of the amino acid sequence, i.e. a sequence representing an amino acid sequence that is shortened at the N-terminus and / or C-terminus. A fragment shortened at the C-terminus (N-terminal fragment) can be obtained, for example, by translating a truncated open reading frame that lacks the 3'-end of the open reading frame. A fragment shortened at the N-terminus (C-terminal fragment) can be obtained, for example, by translating a truncated open reading frame that lacks the 5'-end of the open reading frame, as long as the truncated open reading frame includes an initiation codon that serves to initiate translation. A fragment of an amino acid sequence comprises, for example, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the amino acid residues from the amino acid sequence. The fragment of the amino acid sequence preferably comprises at least 6, in particular at least 8, at least 12, at least 13, at least 14, at least 15, at least 20, at least 30, at least 50 or at least 100 consecutive amino acids from the amino acid sequence.

[0051] A "variant," "variant," "variant protein," or "variant polypeptide" of a polypeptide or protein refers to any analog, fragment, derivative, or mutant derived from the polypeptide or protein and retaining at least one biological property of the polypeptide or protein. Different variants of the polypeptide or protein may exist in nature. These variants may be allelic mutations characterized by differences in the nucleotide sequence of the structural gene encoding the protein, or may include differential splicing or post-translational modifications. One skilled in the art can generate variants having one or more amino acid substitutions, deletions, additions, or replacements. These variants may include, among others: (a) variants in which one or more amino acid residues are substituted with conservative or non-conservative amino acids, (b) variants in which one or more amino acids are added to the polypeptide or protein, (c) variants in which one or more of the amino acids comprises a substituent, and (d) variants in which the polypeptide or protein is fused to another polypeptide, such as serum albumin.

[0052] Conservative variants also refer to amino acid sequences with sequence changes that do not adversely affect the biological function of the protein. A substitution, insertion, or deletion is described as having an adverse effect on the protein if the altered sequence disrupts or destroys the biological function associated with the protein. For example, the overall charge, structure, or hydrophobic-hydrophilic properties of a protein can be altered without adversely affecting its biological activity. Thus, for example, an amino acid sequence can be altered to render a peptide more hydrophobic or more hydrophilic without adversely affecting the protein's biological activity. Techniques for obtaining such variants, including genetic (suppression, deletion, mutation, etc.), chemical, and enzymatic techniques, are known to those skilled in the art.

[0053] As used herein, "parent polypeptide," "parent protein," "precursor polypeptide," or "precursor protein" refers to an unmodified polypeptide that is later modified to form a variant. The parent polypeptide may be a wild-type polypeptide, or a variant or engineered version of a wild-type polypeptide.

[0054] As used herein, "wild type" or "WT" or "native" refers to an amino acid sequence found in nature, including allelic variants. A wild type protein or polypeptide has an amino acid sequence that has not been intentionally modified.

[0055] For the purposes of this specification, a "variant" of an amino acid sequence (peptide, protein or polypeptide) includes amino acid insertion variants, amino acid addition variants, amino acid deletion variants and / or amino acid substitution variants. The term "variant" includes all splice variants, post-translationally modified variants, conformations, isoforms and species homologs, particularly those naturally expressed by a cell. The term "variant" particularly includes fragments of an amino acid sequence.

[0056] Amino acid insertion variants comprise the insertion of one or more amino acids into a specific amino acid sequence. For amino acid sequence variants with insertions, one or more amino acid residues are inserted at specific sites in the amino acid sequence, although random insertions using appropriate screening of the resulting products are also possible. Amino acid addition variants comprise amino- and / or carboxy-terminal fusions of one or more amino acids, such as 1, 2, 3, 5, 10, 20, 30, 50, or more amino acids. Amino acid deletion variants are characterized by the deletion of one or more amino acids from the sequence, such as the deletion of 1, 2, 3, 5, 10, 20, 30, 50, or more amino acids. The deletions can be at any position in the protein. Amino acid deletion variants containing deletions at the N-terminus and / or C-terminus of a protein are also referred to as N-terminal and / or C-terminal truncation variants. Amino acid substitution variants are characterized by the deletion of one or more residues in the sequence and the insertion of another residue in its place. Preference is given to variants located in amino acid sequences that are not conserved between homologous proteins or peptides and / or to substitute amino acids with other amino acids having similar properties.

[0057] In particular, the polypeptide according to the present invention may include conservative substitutions at positions other than the 2nd, 7th, 10th, and 13th amino acids of SEQ ID NO: 1. For example, a variant encompassed by the present invention is a protein comprising an amino acid sequence having 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence represented by SEQ ID NO: 1 or 2, which maintains functional identity with a protein comprised of the amino acid sequence represented by SEQ ID NO: 1 or 2.

[0058] A "conservative amino acid substitution" is one in which one amino acid residue is replaced by another amino acid residue having a similar side chain. Families of amino acid residues having similar side chains are defined in the art and include basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., glutamic acid, aspartic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). For example, a substitution between tyrosine and phenylalanine is a conservative substitution, and a substitution between lysine and arginine is a conservative substitution. Methods for identifying conservative nucleotide and amino acid substitutions that do not eliminate antigen binding are well known in the art (see, e.g., Brummell et al., Biochem. 32: 1180-1 187 (1993); Kobayashi et al., Protein Eng. 12(10):879-884 (1999); and Burks et al., Proc. Natl. Acad. Sci. USA 94:412-417 (1997)). In one embodiment, a conservative amino acid substitution comprises a substitution within the following group:

[0059] Glycine, Alanine;

[0060] valine, isoleucine, leucine;

[0061] Aspartate, glutamate;

[0062] Asparagine, glutamine;

[0063] Serine, threonine;

[0064] Lysine, arginine; and

[0065] Phenylalanine, tyrosine.

[0066] In the present invention, the 5th amino acid Arg of sequence number 2 may be substituted with Lys, and / or the 2nd amino acid Lys of sequence number 3 may be substituted with Arg.

[0067] The term “acidic amino acid residue” preferably relates to glutamic acid (glutamate, Glu) or aspartic acid (aspartate, Asp), particularly glutamic acid. The term “basic amino acid residue” relates to lysine (Lys) or arginine (Arg), particularly lysine.

[0068] Preferably, the degree of similarity, preferably identity, between a given amino acid sequence and an amino acid sequence that is a variant of said given amino acid sequence will be at least about 60%, 65%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. The degree of similarity or identity is preferably provided for an amino acid region that is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% of the full length of the reference amino acid sequence. For example, if the reference amino acid sequence consists of 200 amino acids, the degree of similarity or identity is preferably provided for at least about 20, at least about 40, at least about 60, at least about 80, at least about 100, at least about 120, at least about 140, at least about 160, at least about 180 or about 200 amino acids, preferably contiguous amino acids. In a preferred embodiment, the degree of similarity or identity is provided for the full length of the reference amino acid sequence. Alignment for determining sequence similarity, preferably sequence identity, can be performed using tools known in the art, preferably using a best sequence alignment, such as Align, under standard settings, preferably EMBOSS::needle, Matrix: Blosum62, Gap Open 10.0, Gap Extend 0.5.

[0069] "Sequence similarity" refers to the percentage of amino acids that are identical or exhibit conservative amino acid substitutions. "Sequence identity" between two amino acid sequences refers to the percentage of amino acids that are identical between the sequences.

[0070] The term "% identity" is intended to refer to the percentage of identical amino acid residues between two sequences being compared, obtained by optimal alignment; this percentage is purely statistical, as the differences between the two sequences are distributed randomly and over their entire length. Sequence comparisons between two amino acid sequences are typically performed by optimally aligning them and then comparing them, with segments or "comparison windows" being used to identify and compare local regions of sequence similarity. Optimal alignment of sequences for comparison can be performed manually or by means of the local homology algorithm of Smith and Waterman, 1981, Ads App. Math. 2, 482, or by means of the local homology algorithm of Neddleman and Wunsch, 1970, J. Mol. Biol. 48, 443, or by means of the local homology algorithm of Pearson and Lipman, 1988, Proc. Natl Acad. Sci. By means of the similarity search methods of USA 85, 2444, or by using computer programs that utilize these algorithms (GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA of the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis.).

[0071] % Identity is calculated by determining the number of identical positions between the two sequences being compared, dividing this number by the number of positions compared, and then multiplying the result by 100.

[0072] Homologous amino acid sequences according to the present disclosure exhibit at least 40%, particularly at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, and preferably at least 95%, at least 98% or at least 99% identity with respect to amino acid residues.

[0073] The amino acid sequence variants described herein can be readily prepared by those skilled in the art, for example, by recombinant DNA manipulation. Manipulation of DNA sequences to produce peptides or proteins with substitutions, additions, insertions, or deletions is described in detail, for example, in Sambrook et al. (1989). Furthermore, the peptides and amino acid variants described herein can be readily prepared using known peptide synthesis techniques, such as solid-phase synthesis and similar methods.

[0074] In one embodiment, the fragment or variant of an amino acid sequence (peptide or protein) is preferably a "functional fragment" or "functional variant." The term "functional fragment" or "functional variant" of an amino acid sequence relates to any fragment or variant that exhibits one or more functional properties identical or similar to the amino acid sequence from which it is derived, i.e., is a functional equivalent.

[0075] The term “functional fragment” or “functional variant,” as used herein, refers to a variant molecule or sequence that comprises an amino acid sequence in which one or more amino acids have been altered, particularly compared to the amino acid sequence of a parent molecule or sequence, and which is still capable of performing one or more functions of the parent molecule or sequence, e.g., binding to a target molecule or contributing to binding to a target molecule. In one embodiment, the alteration in the amino acid sequence of the parent molecule or sequence does not significantly affect or alter the binding characteristics of the molecule or sequence. In other embodiments, the binding of the functional fragment or functional variant may be reduced but still significantly present, e.g., the binding of the functional variant may be at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of that of the parent molecule or sequence. However, in other embodiments, the binding of the functional fragment or functional variant may be increased compared to the parent molecule or sequence.

[0076] An amino acid sequence (peptide, protein or polypeptide) "derived from" a specified amino acid sequence (peptide, protein or polypeptide) means the origin of the first amino acid sequence. Preferably, an amino acid sequence derived from a particular amino acid sequence has an amino acid sequence that is identical, essentially identical or homologous to that particular sequence or a fragment thereof. An amino acid sequence derived from a particular amino acid sequence may be a variant of that particular sequence or a fragment thereof. For example, a person skilled in the art will appreciate that Rv0747 / PE_PGRS10 suitable for use herein may be modified in sequence from a naturally occurring or native sequence derived therefrom, but which retains the desired activity of the native sequence.

[0077] "Isolated" means altered or removed from its natural state. For example, a nucleic acid or peptide naturally occurring in a living animal is not "isolated," but the same nucleic acid or peptide partially or completely separated from its natural coexisting materials is "isolated." An isolated nucleic acid or protein may exist in a substantially purified form, or it may exist in a non-natural environment, such as a host cell.

[0078] In the context of the present invention, the term "recombinant" means "created through genetic manipulation." Preferably, a "recombinant subject," such as a recombinant cell, in the context of the present invention does not occur naturally.

[0079] As used herein, the term “naturally occurring” means that a subject can be found in nature. For example, a peptide or nucleic acid that exists within an organism (including a virus), can be isolated from a source in nature, and has not been intentionally modified by humans in a laboratory is naturally occurring.

[0080] The term "genetic modification" encompasses transfecting a cell with a nucleic acid. The term "transfection" relates to the introduction of a nucleic acid, particularly RNA, into a cell. For all purposes of the present invention, the term "transfection" also encompasses the introduction of a nucleic acid into a cell or the uptake of a nucleic acid by such a cell. For some applications of transfection, it is sufficient if the transfected genetic material is only transiently expressed. RNA can be transfected into a cell and cause it to transiently express its encoded protein. Because the nucleic acid introduced during transfection is generally not integrated into the nuclear genome, the foreign nucleic acid will be diluted or degraded through mitosis. Cells capable of episomal amplification of nucleic acid significantly reduce the dilution rate. If the transfected nucleic acid is to persist in the cell and its progenitor cells, stable transfection must occur. Such stable transfection can be achieved using a virus-based or transposon-based transfection system. Typically, cells that are genetically modified to express a receptor polypeptide and / or an antigen receptor are stably transfected with a nucleic acid encoding the receptor polypeptide and / or a nucleic acid encoding the antigen receptor, whereas typically, a nucleic acid encoding a ligand polypeptide and / or a nucleic acid encoding an antigen are transiently transfected into the cell.

[0081] The terms "nucleic acid", "nucleic acid molecule", "oligonucleotide" and "polynucleotide" are used interchangeably and refer to a polymer of the phosphate esters of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecule") or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymine or deoxycytidine; "DNA molecule"), either in single-stranded or double-stranded helix form, or any of their phosphate ester analogs such as phosphorothioates and thioesters. Double-stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The term nucleic acid molecule, and in particular DNA or RNA molecule, refers only to the primary and secondary structures of said molecules and is not limited to any particular tertiary configuration. Accordingly, the term encompasses, among others, linear or circular DNA molecules (e.g., restriction fragments), plasmids, supercoiled DNA, and double-stranded DNA found in chromosomes. When discussing the structure of a particular double-stranded DNA molecule, the sequence may be described herein according to the general convention of presenting the sequence only in the 5' to 3' direction along the non-transcribed DNA strand (i.e., the strand having the sequence matching the mRNA). A "recombinant DNA molecule" is a DNA molecule that has undergone molecular biological manipulation. DNA includes, but is not limited to, cDNA, genomic DNA, plasmid DNA, synthetic DNA, and semi-synthetic DNA.

[0082] The nucleic acid may be contained within a vector. The term “vector,” as used herein, includes any vector known to those skilled in the art, including plasmid vectors, cosmid vectors, phage vectors such as lambda phage, viral vectors such as retrovirus, adenovirus, or baculovirus vectors, or artificial chromosome vectors such as bacterial artificial chromosomes (BAC), yeast artificial chromosomes (YAC), or P1 artificial chromosomes (PAC). Such vectors include expression as well as cloning vectors. Expression vectors include plasmids as well as viral vectors, and generally contain the desired coding sequence and appropriate DNA sequences necessary for the expression of the coding sequence operably linked thereto in a particular host organism (e.g., bacteria, yeast, plants, insects, or mammals) or in vitro expression system. Cloning vectors are generally used to manipulate and amplify a particular desired DNA fragment and may lack functional sequences necessary for the expression of the desired DNA fragment.

[0083] Viral vectors have been used in a wide range of gene transfer applications in living animals as well as cells. Viral vectors that may be used include, but are not limited to, adenovirus, retrovirus, vaccinia virus, poxvirus, adeno-associated virus, herpes simplex virus, lentivirus, baculovirus, sendai virus, measles virus, simian virus 40, and Epstein-Barr virus vectors. Non-viral vectors include plasmids, lipoplexes (cationic liposome-DNA complexes), polyplexes (cationic polymer-DNA complexes), and protein-DNA complexes. In addition to the nucleic acid, the vector may include one or more regulatory regions and / or selectable markers that are useful for selecting, measuring, and monitoring the outcome of the nucleic acid delivery (e.g., delivery to tissues, persistence of expression, etc.).

[0084] The term "expression vector" refers to a vector, plasmid, or vehicle designed to transform a host cell after expressing an inserted nucleic acid sequence. The cloned gene, i.e., the inserted nucleic acid sequence, is typically placed under the control of regulatory elements such as a promoter, a minimal promoter, an enhancer, and the like. Numerous initiation regulatory regions or promoters useful for directing expression of nucleic acids in a desired host cell are well known to those skilled in the art. Virtually any promoter capable of directing expression of these genes includes, but is not limited to, viral promoters, bacterial promoters, animal promoters, mammalian promoters, synthetic promoters, constitutive promoters, tissue-specific promoters, pathogenesis- or disease-related promoters, developmental-specific promoters, inducible promoters, and lightly regulated promoters;SV40 early (SV40) promoter region, promoter contained in the 3' long terminal repeat (LTR) of Rous sarcoma virus (RSV), E1A or major late promoter (MLP) of adenovirus (Ad), human cytomegalovirus (HCMV) immediate early promoter, herpes simplex virus (HSV) thymidine kinase (TK) promoter, baculovirus IE1 promoter, elongation factor 1 alpha (EF1) promoter, glyceraldehyde-3-phosphate dehydrogenase (GSPDH) promoter, phosphoglycerate kinase (PGK) promoter, ubiquitin C (Ubc) promoter, albumin promoter, mouse metallothionein-L Regulatory sequences of promoters and transcriptional regulatory regions, ubiquitous promoters (HPRT, vimentin, β-actin, tubulin, etc.), intermediate filaments (desmin, neurofilament, keratin, GFAP, etc.), promoters of therapeutic genes (MDR, CFTR, or factor VIII form, etc.), pathogenesis- or disease-related promoters, and promoters that exhibit tissue specificity and have been used in transgenic animals, such as the elastase I gene regulatory region active in pancreatic acinar cells; the insulin gene regulatory region active in pancreatic beta cells, the immunoglobulin gene regulatory region active in lymphoid cells, the mouse mammary carcinoma virus regulatory region active in testicular, breast, lymphoid, and macrophage cells;Including, but not limited to, the albumin gene active in the liver, the Apo AI and Apo AII regulatory regions, the alpha-fetoprotein gene regulatory region active in the liver, the alpha1-antitrypsin gene regulatory region active in the liver, the beta-globin gene regulatory region active in bone marrow cells, the myelin basic protein regulatory region active in oligodendrocyte cells in the brain, the myosin light chain-2 gene regulatory region active in skeletal muscle, and the gonadotropic releasing hormone, pyruvate kinase promoter, villin promoter, fatty acid-binding intestinal protein promoter, and smooth muscle cell β-actin promoter active in the hypothalamus;

[0085] Vectors can be transfected by methods known in the art, such as injection, transfection, electroporation, microinjection, transduction, cell fusion, lipofection, calcium phosphate precipitation (Graham, FL et al., Virology, 52:456(1973); and Chen and Okayama, Mol. Cell. Biol. 7:2745-2752(1987)), liposome-mediated transfection (Wong, TK et al., Gene, 10:87(1980); Nicolau and Sene, Biochim. Biophys. Acta, 721:185-190(1982); and Nicolau et al., Methods Enzymol., 149:157-176(1987)), DEAE-dextran treatment (Gopal, Mol. Cell Biol., 5:1188-1190 (1985)), gene bombardment (Yang et al., Proc. Natl. Acad. Sci., 87:9568-9572 (1990)), use of a gene gun, or DNA vector transporters (e.g., Wu et al., J. Biol. Chem. 267:963 (1992); Wu et al., J. Biol. Chem. 263:14621 (1988); and Hartmut et al., Canadian Patent Application No. 2,012,311, see).

[0086] Polynucleotides according to the present invention can be introduced in vivo by lipofection. Over the past several decades, the use of liposomes for in vitro nucleic acid encapsulation and transfection has increased. Synthetic cationic lipids, designed to limit the difficulties and risks encountered with liposome-mediated transfection, can be used to prepare liposomes for in vivo gene transfection (Felgner et al., Proc. Natl. Acad. Sci. USA. 84:7413 (1987); Mackey et al., Proc. Natl. Acad. Sci. USA 85:8027 (1988); and Ulmer et al., Science 259:1745 (1993)). The use of cationic lipids can facilitate the encapsulation of negatively charged nucleic acids and also promote fusion with negatively charged cell membranes (Felgner et al., Science 337:387 (1989)). Particularly useful lipid compounds and compositions for nucleic acid delivery are described in WO95 / 18863, WO96 / 17823, and US 5,459,127. The use of lipofection to introduce exogenous genes into specific tissues in vivo offers several practical advantages. Molecular targeting of liposomes to specific cells offers one area of ​​advantage. Direct transfection into specific cell types would clearly be particularly desirable in tissues with cellular heterogeneity, such as the pancreas, liver, kidney, and brain. Lipids can be chemically linked to other molecules for targeting purposes (Mackey et al. 1988). Targeted peptides, such as hormones or neurotransmitters, and proteins, such as antibodies, or non-peptide molecules can be chemically bound to liposomes.

[0087] Other molecules, such as cationic oligopeptides (e.g., WO95 / 21931), peptides derived from DNA binding proteins (e.g., WO96 / 25508), or cationic polymers (e.g., WO95 / 21931), are also useful for facilitating transfection of nucleic acids in vivo.

[0088] It is also possible to introduce vectors in vivo as naked DNA plasmids (see U.S. Patent Nos. 5,693,622, 5,589,466, and 5,580,859). Receptor-mediated DNA transfer may also be used (Curiel et al., Hum. Gene Ther. 3:147 (1992); and Wu et al., J. Biol. Chem. 262:4429 (1987)).

[0089] The nucleic acids described herein may be recombinant and / or isolated molecules.

[0090] In the context of this specification, the term "transcription" refers to the process by which the genetic code in a DNA sequence is transcribed into RNA. The RNA can then be translated into peptides or proteins.

[0091] “Encoding” refers to the inherent property of a specific sequence of nucleotides in a polynucleotide, such as a gene, cDNA, or mRNA, to serve as a template for the synthesis of other polymers and macromolecules in biological processes, having a defined sequence of nucleotides (i.e., rRNA, tRNA, and mRNA) or a defined sequence of amino acids and the biological properties derived therefrom. Thus, a gene encodes a protein if the transcription and translation of the mRNA corresponding to that gene produces a protein in a cell or other biological system. Both the coding strand, which is identical to the mRNA sequence and is usually provided as a sequence listing, and the non-coding strand, which serves as a template for transcription of the gene or cDNA, may be said to encode a protein or other product of that gene or cDNA.

[0092] The present invention provides a host cell comprising the vector of the present invention. The host cell includes prokaryotic (e.g., bacterial) and eukaryotic (e.g., fungal, yeast, animal, insect, plant) cells and may be any cell suitable for expression of a polypeptide according to the present invention. Suitable prokaryotic host cells include, but are not limited to, Escherichia coli (e.g., strains DH5, HB101, JM109, or W3110), Bacillus, Streptomyces, Salmonella, Serratia, and Pseudomonas species. Suitable eukaryotic host cells include, but are not limited to, COS, CHO, HepG-2, CV-1, LLCMK2, 3T3, HeLa, RPMI8226, 293, BHK-21, Sf9, Saccharomyces, Pichia, Hansenula, Kluyveromyces, Aspergillus or Trichoderma species.

[0093] As used herein, “endogenous” means any substance derived from or produced within an organism, cell, tissue, or system.

[0094] As used herein, “exogenous” means any substance derived from or produced outside an organism, cell, tissue, or system.

[0095] As used herein, the term “expression” refers to the biological production of a product encoded by a coding sequence, and can be defined as the transcription and / or translation of a specific nucleotide sequence. In most cases, a DNA sequence comprising a coding sequence is transcribed to form messenger RNA (mRNA). This messenger RNA is then translated to form a polypeptide product having the relevant biological activity. The expression process may also include additional processing steps for the RNA transcript product (e.g., splicing to remove introns) and / or post-translational processing of the polypeptide product.

[0096] As used herein, the terms "linked," "fused," or "fusion" are used interchangeably. These terms refer to the joining together of two or more elements, components, or domains.

[0097] The peptides, proteins, polypeptides, RNAs, RNA particles and additional agents, e.g., immune checkpoint inhibitors, described herein can be administered as pharmaceutical compositions or medicaments for therapeutic or prophylactic treatment, and can be administered in the form of any suitable pharmaceutical composition, which can include a pharmaceutically acceptable carrier and optionally can include one or more adjuvants, stabilizers, etc. In one embodiment, the pharmaceutical composition is for use in therapeutic or prophylactic treatment, e.g., treating or preventing an antigen-associated disease, such as cancer diseases, as described herein.

[0098] The term "pharmaceutical composition" relates to a formulation comprising a therapeutically effective substance, preferably together with a pharmaceutically acceptable carrier, diluent, and / or excipient. The pharmaceutical composition is useful for reducing the severity of, preventing, or treating a disease or disorder by administering the pharmaceutical composition to a subject. Pharmaceutical compositions are also known in the art as pharmaceutical dosage forms. In the context of the present invention, a pharmaceutical composition comprises a peptide, protein, polypeptide, RNA, RNA particle, immune effector cell, and / or additional substance as described herein.

[0099] The pharmaceutical compositions of the present disclosure may include one or more adjuvants or may be administered together with one or more adjuvants. The term "adjuvant" refers to a compound that prolongs, enhances, or accelerates an immune response. Adjuvants include heterogeneous compounds such as oil emulsions (e.g., Freund's adjuvant), mineral compounds (e.g., alum), bacterial products (e.g., pertussis toxin), or immune-stimulating complexes. Examples of adjuvants include, but are not limited to, LPS, GP96, CpG oligodeoxynucleotides, growth factors, and cytokines such as monokines, lymphokines, interleukins, and chemokines. Cytokines may be IL1, IL2, IL3, IL4, IL5, IL6, IL7, IL8, IL9, IL10, IL12, IFNα, IFNγ, GM-CSF, or LT-a. Additionally known adjuvants include aluminum hydroxide, Freund's adjuvant, or oils such as Montanide®ISA51. Other suitable adjuvants for use herein include lipopeptides such as Pam3Cys.

[0100] Pharmaceutical compositions according to the present specification are generally applied as “pharmaceutically effective amounts” and “pharmaceutically acceptable formulations.”

[0101] The term "pharmaceutically acceptable" means the non-toxicity of a substance that does not interact with the action of the active ingredient of the pharmaceutical composition.

[0102] The term "pharmaceutically effective amount" or "therapeutically effective amount" refers to an amount that, alone or in combination with additional administration, achieves the desired response or effect. In the treatment of a specific disease, the desired response preferably means inhibition of the progression of the disease. This includes slowing the progression of the disease, and particularly includes stopping or reversing the progression of the disease. In the treatment of a disease, the desired response may also be delaying the onset or preventing the onset of the disease or condition. The effective amount of the compositions described herein will be determined based on the condition being treated, the severity of the disease, the individual characteristics of the patient, including age, physical condition, height, and weight, the duration of treatment, the type of concomitant therapy (if any), the specific route of administration, and similar factors. Accordingly, the dosage of the compositions described herein can be determined based on these various characteristics. If the patient does not respond sufficiently with the first dose, a higher dose (or a higher dose achieved effectively by another, more localized route of administration) may be used.

[0103] The pharmaceutical compositions of the present disclosure may include salts, buffers, preservatives, and optionally other therapeutic agents. In one embodiment, the pharmaceutical compositions of the present disclosure include one or more pharmaceutically acceptable carriers, diluents, and / or excipients.

[0104] Preservatives suitable for use in the pharmaceutical compositions of the present disclosure include, but are not limited to, benzalkonium chloride, chlorobutanol, parabens and thimerosal.

[0105] As used herein, the term "excipient" refers to a substance that may be present in a pharmaceutical composition of the present disclosure but is not an active ingredient. Examples of excipients include, but are not limited to, carriers, binders, diluents, lubricants, thickeners, surfactants, preservatives, stabilizers, emulsifiers, buffers, flavoring agents, or coloring agents.

[0106] The term "diluent" refers to a substance that dilutes and / or thins. Furthermore, the term "diluent" encompasses any one or more of a fluid, liquid, or solid suspension, and / or mixed medium. Examples of suitable diluents include ethanol, glycerol, and water.

[0107] The term "carrier" refers to a component which may be natural, synthetic, organic, or inorganic that is combined with an active ingredient to facilitate, enhance, or enable administration of the pharmaceutical composition. As used herein, a carrier may be one or more compatible solid or liquid fillers, diluents, or encapsulating materials suitable for administration to a subject. Suitable carriers include, but are not limited to, sterile water, Ringer's, Ringer's lactate, sterile sodium chloride solution, isotonic saline, polyalkylene glycols, hydrogenated naphthalenes, and, in particular, biocompatible lactide polymers, lactide / glycolide copolymers, or polyoxyethylene / polyoxy-propylene copolymers. In one embodiment, the pharmaceutical compositions herein comprise isotonic saline.

[0108] Pharmaceutically acceptable carriers, excipients or diluents for therapeutic use are well known in the art of pharmacy and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R Gennaro edited. 1985).

[0109] Pharmaceutical carriers, excipients or diluents may be selected depending on the intended route of administration and standard pharmaceutical practice.

[0110] In one embodiment, the pharmaceutical compositions described herein can be administered intravenously, intraarterially, subcutaneously, intradermally, or intramuscularly. In certain embodiments, the pharmaceutical compositions are formulated for topical or systemic administration. Systemic administration can include enteral administration involving absorption through the gastrointestinal tract or parenteral administration. As used herein, "parenteral administration" means administration by any means other than through the gastrointestinal tract, such as intravenous injection. In a preferred embodiment, the pharmaceutical compositions are formulated for systemic administration. In another preferred embodiment, systemic administration is by intravenous administration. In one embodiment of all aspects of the invention, the polypeptides described herein, or variants thereof, or nucleic acid molecules encoding them, are administered systemically.

[0111] The pharmaceutical compositions provided herein can be administered by various routes, including, but not limited to, oral (enteral) administration, parenteral (by injection), rectal administration, transdermal administration, intradermal administration, intrathecal administration, subcutaneous (SC) administration, intravenous (IV) administration, intramuscular (IM) administration, and intranasal administration.

[0112] As used herein, the term "co-administration" refers to the administration of multiple compounds or compositions (e.g., immune effector cells, a polypeptide described herein or a variant thereof or a nucleic acid molecule encoding the same, and optionally an RNA encoding a vaccine antigen) to the same patient. The multiple compounds or compositions may be administered simultaneously, essentially simultaneously, or sequentially.

[0113] The materials, compositions, and methods described herein can be used to treat individuals with a disease, for example, a disease characterized by the presence of cells expressing the antigen. A particularly preferred disease is cancer. For example, if the antigen is derived from a virus, the materials, compositions, and methods may be useful for treating a viral disease caused by the virus. If the antigen is a tumor antigen, the materials, compositions, and methods may be useful for treating a cancer, wherein cancer cells express the tumor antigen.

[0114] The materials, compositions, and methods described herein can be used in the therapeutic or prophylactic treatment of a variety of diseases, wherein support of immune effector cells and / or activation of immune effector cells as described herein is beneficial to patients, such as those with cancer and infectious diseases. In one embodiment, the materials, compositions, and methods described herein are useful for the prophylactic and / or therapeutic treatment of diseases associated with antigens.

[0115] The term "disease" refers to an abnormal condition affecting an individual's body. A disease is often interpreted as a medical condition associated with specific symptoms and signs. A disease may be caused by an agent originating from an external source, such as an infectious disease, or by an internal dysfunction, such as an autoimmune disease. In humans, "disease" is used in a broader sense to refer to any condition that, upon contact with the individual, causes pain, dysfunction, distress, social problems, death, or similar problems to the affected individual. In a broader sense, it sometimes includes injuries, disabilities, disorders, syndromes, infections, isolated symptoms, deviant behaviors, and structural and functional atypical alterations, which, in different contexts and for different purposes, can be considered distinct categories. Disease typically affects individuals not only physically but also emotionally, as living with various diseases can alter an individual's outlook on life and personality.

[0116] In this context, the term "treatment", "treating" or "therapeutic intervention" means the care and management of a subject for the purpose of combating a condition, such as a disease or disorder. The term is intended to encompass the full range of treatments for a given condition from which a subject is suffering, such as the administration of a therapeutically effective compound to alleviate symptoms or complications, delay the progression of the disease, disorder or condition, relieve or alleviate symptoms and complications, and / or cure or eliminate the disease, disorder or condition, as well as prevent the condition, where prevention will be understood as the care and management of a subject for the purpose of combating the disease, condition or disorder, and includes the administration of an active compound to prevent the onset of symptoms or complications.

[0117] The term "therapeutic treatment" means any treatment that improves the health status of a subject and / or prolongs (increases) the lifespan of a subject. Such treatment may result in the elimination of a disease in a subject, the arrest or slowing of the progression of a disease in a subject, the inhibition or slowing of the progression of a disease in a subject, the reduction in the frequency or severity of symptoms in a subject, and / or the reduction in recurrence in a subject currently suffering from or previously suffering from a disease.

[0118] The term "prophylactic treatment" or "preventive treatment" refers to any treatment intended to prevent the development of a disease in a subject. The terms "prophylactic treatment" and "preventive treatment" are used interchangeably herein.

[0119] The terms "individual" and "subject" are used interchangeably herein. These terms refer to a human or other mammal (e.g., a mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate) that may be susceptible to or may be afflicted with a disease or disorder (e.g., cancer), but may or may not have afflicted with the disease or disorder. In many embodiments, the subject is a human. Unless otherwise specified, the terms "individual" and "subject" do not imply a particular age, and thus encompass adults, elderly people, children, and newborns. In embodiments herein, an "individual" or "individual" is a "patient."

[0120] The term "patient" means an individual or entity in need of treatment, specifically an individual or entity suffering from a disease.

[0121] In one embodiment of the present disclosure, the goal is to provide an immune response against cells with a disease that expresses an antigen, such as a cancer cell expressing a tumor antigen, and to treat a disease, such as a cancer disease, involving cells expressing an antigen, such as a tumor antigen.

[0122] As used herein, “immune response” refers to a coordinated body response to an antigen or cells expressing an antigen, and refers to a cellular immune response and / or a humoral immune response.

[0123] The terms “cell-mediated immunity”, “cellular immunity”, “cellular immune response”, or similar terms are meant to include cellular responses directed against cells characterized by the expression of antigens, particularly by presentation of antigens with class I or class II MHC molecules. The cellular response involves cells called T cells or T lymphocytes that function either as “helper” or “killer” cells. Helper T cells (also called CD4+ T cells) play a central role by regulating the immune response, while killer cells (cytotoxic T cells, cytolytic T cells, CD8 + T cells (also called CTLs or T cells) kill diseased cells, such as cancer cells, thereby preventing the development of more diseased cells.

[0124] This specification contemplates immune responses that may be protective, prophylactic, prophylactic, and / or therapeutic. As used herein, "inducing [or inducing] an immune response" may mean the absence of an immune response to a particular antigen prior to induction, or it may mean that an immune response to a particular antigen exists at a baseline level prior to induction and is enhanced following induction. Thus, "inducing [or inducing] an immune response" includes "enhancing [or enhancing] an immune response."

[0125] The term "immunotherapy" refers to the treatment of a disease or condition by inducing or enhancing an immune response. The term "immunotherapy" includes antigen immunization or antigen vaccination.

[0126] The term "immunization" or "vaccination" refers to the process of administering an antigen to an individual for the purpose of inducing an immune response, for example, for therapeutic or prophylactic reasons.

[0127] The term "macrophage" refers to a subset of phagocytes produced by the differentiation of monocytes. Activated by inflammation, immune cytokines, or microbial products, macrophages nonspecifically engulf pathogens and degrade them by killing them through hydrolytic and oxidative attack. Peptides derived from the degraded proteins are presented on the cell surface of the macrophage, which can be recognized by T cells and interact directly with antibodies on the surface of B cells, activating T and B cells and further stimulating the immune response. Macrophages belong to the class of antigen-presenting cells. In one embodiment, the macrophages are splenic macrophages.

[0128] The term "dendritic cell" (DC) refers to a subtype of phagocyte belonging to the antigen-presenting cell class. In one embodiment, dendritic cells are derived from hematopoietic bone marrow progenitor cells. These progenitor cells first transform into immature dendritic cells. These immature cells are characterized by high phagocytic activity and low T-cell activation potential. Immature dendritic cells continuously sample their surroundings for pathogens such as viruses and bacteria. Once they encounter a presentable antigen, they are activated into mature dendritic cells and begin migrating to the spleen or lymph nodes. Immature dendritic cells phagocytose pathogens, degrade their proteins into small fragments, and upon maturation, present these fragments on their surface using MHC molecules. Simultaneously, these cells upregulate cell-surface receptors, such as CD80, CD86, and CD40, which act as co-receptors in T-cell activation, significantly enhancing their T-cell activation capacity. They also upregulate CCR7, a chemotactic receptor that induces dendritic cells to migrate to the spleen via the bloodstream or to lymph nodes via the lymphatic system. Here, they act as antigen-presenting cells, activating B cells by antigen presentation, as well as helper T cells and killer T cells, in conjunction with non-antigen-specific co-stimulatory signals. Thus, dendritic cells can actively induce T- or B-cell-mediated immune responses. In one embodiment, the dendritic cells are splenic dendritic cells.

[0129] The term "antigen-presenting cell" (APC) refers to a variety of cells capable of displaying, acquiring, and / or presenting at least one antigen or antigen fragment on (or at) their surface. Antigen-presenting cells can be divided into professional antigen-presenting cells and non-professional antigen-presenting cells.

[0130] The term "infectious disease" refers to any disease that can be transmitted from one individual to another or from organism to organism and is caused by a microbial agent (e.g., M. tuberculosis). Infectious diseases are known in the art and include, for example, viral, bacterial, or parasitic diseases caused by viruses, bacteria, and parasites, respectively. In this regard, infectious diseases can be, for example, hepatitis, sexually transmitted diseases (e.g., chlamydia or gonorrhea), tuberculosis, HIV / acquired immunodeficiency syndrome (AIDS), diphtheria, hepatitis B, hepatitis C, cholera, severe acute respiratory syndrome (SARS), avian influenza, and influenza.

[0131] References to the literature and research cited herein are not intended to be an admission that any of the aforementioned content is related to the prior art. All references to the contents of these documents are based on information available to the applicant and do not constitute any admission as to the accuracy of the contents of these documents.

[0132]

[0133] Example 1. Materials and Methods

[0134] 1.1 Mice and cell culture

[0135] Wild-type C57BL / 6 mice were purchased from Samtako Bio in Gyeonggi-do. AZIN1- / - (C57BL / 6Smoc-Azin1em1Smoc) mice were produced at the Shanghai Model Organism Center, and STAT1- / - (B6.129S(Cg)-Stat1tm1Dlv / J) mice were purchased from the Jackson Laboratory in Maine, USA. STAT1- / - mice were crossed with AZIN1- / - mice, and all offspring were on the C57BL6 / J genetic background. Primary bone marrow-derived cells (BMDM) were cultured in Dulbecco's modified essential medium (DMEM) containing M-CSF (R&D Systems, 416-ML) for 3–5 days. The mouse experimental design and protocol were approved by the Research Ethics Committee of the Institute of Microbiology, Chinese Academy of Sciences (IMCAS) (Permit No. SQIMCAS2020013) and the Animal Experiment Ethics Committee of Hanyang University (Protocol 2020-075). HEK293T (ATCC-11268; American Tumor-Derived Cell Culture Collection) and Raw264.7 (ATCC TIB-71) cells were cultured in DMEM (Gibco) containing 10% fetal bovine serum (FBS) (Gibco), sodium pyruvate, nonessential amino acids, penicillin G (100 IU / mL), and streptomycin (100 μg / mL). Human monocyte THP-1 (ATCC TIB-202) cells were treated with 20 nM PMA (Sigma-Aldrich) for 24 h, and then washed three times with PBS.

[0136]

[0137] 1.2 Reagents and Antibodies

[0138] Methyl-β-cyclodextrin (C4555), amiloride chloride (PHR1839), and cytochalasin D (C8273) were purchased from Sigma-Aldrich. Antibodies specific for CD74 (AB245693) and AZIN1 (PA5-97491) were purchased from Abcam (Cambridge, UK) and Thermo Fisher Scientific (Waltham, MA, USA). Antibodies against STAT1 (9172), STAT3 (9139), STAT6 (9362), P-Drp-1 (S637) (4867), Drp-1 (8570), ATP5A1 (18023), P-STAT1 (Y701) (9167), P-STAT3 (Y705) (9145), and P-STAT6 (Y641) (9361) were purchased from Cell Signaling Technology (Danvers, MA, USA). Antibodies against His (H-3), FLAG (D-8), GST (B-14), actin (I-19), lamin B1 (B-10), tubulin (5F131), MFN1 (D-10), and MFN2 (F-5) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA).

[0139]

[0140] 1.3 Plasmid production

[0141] FLAG-tagged CD74, STAT1, and AZIN1 plasmids were purchased from Addgene (Cambridge, UK). Plasmids containing various TgMIF regions (8-116, 13-43, 44-69, and 70-102) were identified using human protein microarrays, and each experiment was repeated three times.

[0142]

[0143] 1.4 Identification of rTgMIF-binding proteins using HuProt™ microarray

[0144] A human protein microarray (CDI Labs, USA) containing over 20,000 full-length recombinant human proteins was used to identify rTgMIF-binding proteins. Briefly, the protein microarray was treated with blocking buffer (2% BSA with 0.1% Tween 20 in PBS) for 2 h, and 3 μg of biotinylated protein was added to the array for 8 h at 4°C to increase biological specificity. The array was then treated with 1 μg of streptavidin-conjugated Alexa Fluor 532 for 1 h at 4°C. Microarray data were acquired using a GenePix 4100A microarray laser scanner (Molecular Devices, USA).

[0145]

[0146] 1.5 GST pulldown, Western blot, and immunoprecipitation assays

[0147] THP-1, 293T, and BMDM were processed according to the specified method and analyzed by GST pulldown, Western blotting, and co-immunoprecipitation. For GST pulldown, 293T cells were lysed in NP-40 buffer containing a complete protease inhibitor cocktail from Roche (Basel, Switzerland). The supernatant was then centrifuged and pre-cleaned with protein A / G beads for 2 h at 4°C. The pre-cleaned supernatant was mixed with a 50% slurry of droplet-shaped copper-conjugated Sepharose beads (Amersham Biosciences, Amersham, UK) and incubated in binding buffer for 4 h at 4°C. The precipitate was thoroughly washed with lysis buffer. The proteins bound to the droplet-shaped copper-conjugated Sepharose beads were boiled for 5 min and dissolved in SDS loading buffer. For immunoprecipitation, cells were lysed in NP-40 buffer containing a complete protease inhibitor cocktail from Roche (Basel, Switzerland), pre-cleaned with protein A / G agarose beads, and incubated for 1 h at 4°C. Whole cell lysates were used for immunoprecipitation with the indicated antibodies. Typically, 1–4 μg of antibody was added to 1 mL of cell lysate and incubated for 8–12 h at 4°C. After 6 h, protein A / G agarose beads were added, and the precipitate was thoroughly washed with lysis buffer and lysed by boiling in SDS loading buffer for 5 min. For Western blot (WB), polyproteins were separated by SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride (PVDF) membranes (Bio-Rad, Hercules, CA, USA). Immunodetection was performed with specific antibodies. Antibody binding was visualized by electroluminescence (ECL; Millipore, Burlington, MA, USA) and detected using a Vilber chemiluminescence spectrometer (Fusion SL 3; Vilber Lourmat).

[0148]

[0149] 1.6 Enzyme-linked immunosorbent assay (ELISA)

[0150] Cell culture supernatants and mouse serum were assayed for cytokine content of TNF-α, IL-6, IL-10, TGF-β, and IFN-γ using BD OptEIA ELISA kits (BD Pharmingen; Franklin Lakes, NJ, USA). All experiments were performed according to the manufacturer's instructions.

[0151]

[0152] 1.7 PCR array

[0153] PCR array is StepOnePlus TM Real-time PCR was performed using the Mouse RT2 Profiler PCR Array Kit (Qiagen; Hilden, Germany) or the Mouse AccuPower®qPCR Array System: Immune qPCR Panel Kit (Bioneer, S-6042-PM2, Daejeon, South Korea) on an ABI real-time PCR system. RT2 SYBR green ROX qPCR master mix (Qiagen, 330502) was used. The array kit included five reference genes: RPLP0, HPRT1, ACTB, B2M, and GAPDH. The data were analyzed using the Norm-Finder algorithm. Based on the results, the optimal number of control genes was determined to be one, and GAPDH was evaluated as the optimal gene for normalization. It was then used for qPCR analysis. In this study, the expression of 84 genes contributing to female infertility was estimated using the 2ΔΔCt formula, using GAPDH levels as the normalization standard. Each experiment was repeated three times.

[0154]

[0155] 1.8 Peptide

[0156] The 9R-conjugated TgMIF peptide was synthesized professionally by Peptron in Seoul, Korea, and purified in acetate salt form to avoid abnormal cellular responses. The amino acid sequences of the peptides used in this study are shown in Figures 4, 6, 8, and 10. The endotoxin content measured using the Limulus amoeba cytotoxicity kit (BioWhittaker; Walkersville, MD, USA) at the concentrations of the peptides used in the experiments was less than 3-5 pg / mL.

[0157]

[0158] 1.9 Measuring ATP production

[0159] ATP levels were measured using the leucine / luciferase method using the ATP Bioluminescence Assay Kit (PerkinElmer; Shelton, CT, USA, 6016943) according to the manufacturer's instructions. Approximately 2 × 10 5 BMDM were infected with MTB and washed with PBS. Then, an ATP-releasing solution was added to the cell culture. Next, leucine and luciferase (final volume of 50 μL) were mixed separately, and 50 μL of cell culture lysate (single ATP) was added. Luminescence was analyzed using a FluoroScan luminometer (Labsystems, Helsinki, Finland) after a 30-second delay. An ATP standard curve prepared at the same time according to the manufacturer's instructions was used to calculate the ATP concentration in each sample.

[0160]

[0161] 1.10 Mitochondrial DNA Measurement

[0162] As previously reported, the mitochondrial (mt) to nucleotide (n) DNA ratio was determined by measuring the amount of DNA to measure the mtDNA amount. Pyruvate kinase (Pklr) was used as a marker for nDNA, and NADH dehydrogenase subunit 1 (mt-Nd1) was used as a marker for mtDNA. Real-time PCR reactions were performed according to the manufacturer's instructions, and thermal conversion reactions were performed in QuantStudio™3 (ABI). mtDNA content was normalized to nucleic acid content. The primer pairs used in PCR were as follows: mND1 (197 bp): Sense: ggcccattcgcgttattctt, Antisense: tcgtaacggaagcgtggata. mPKLR (191 bp): Sense: atctacattgacgacgggct, Antisense: acattatgctccaccccgaa.

[0163]

[0164] 1.11 Measurement of mitochondrial membrane potential

[0165] Mitochondrial membrane potential (ΔΨ) was measured according to a previously described technique. Cells were washed with PBS and trypsinized. The protein concentration of cells was adjusted to 0.2 mg / mL in DMEM (Life Technologies, Invitrogen) without phenol red (Life Technologies, Invitrogen), FBS, or antibiotics. Tetramethylrhodamine ethyl ester (200 nM; Molecular Probes-Invitrogen, T669) was added to the cell supernatant. Cells were incubated at 37°C in the dark for 30 min. ΔΨ was measured using a flow cytometer, and data were analyzed using FlowJo software. TMRE fluorescence was measured using the FL2 channel (582 nm).

[0166]

[0167] 1.12 OXPHOS complex enzyme activity analysis

[0168] Oxidative phosphorylation (OXPHOS) complex activities were determined using the MitoTox Complex I, II-III, IV, and V OXPHOS Activity Microplate Assay kits from Abcam (Cambridge, MA, ab109903, ab109904, ab109905, ab109907) according to the manufacturer's instructions. Complex activities were measured by monitoring absorbance changes at 340 nm for 1 h at 30°C. Oligomycin (O4876; Sigma) was used as a positive control.

[0169]

[0170] 1.13 Metabolic activity analysis

[0171] Lactate levels in the medium were determined using the Lactate Assay Kit (Sigma, MAK064) according to the manufacturer's instructions. More specifically, cells were infected with MTB and cultured in the presence or absence of 9R-TgMIF, after which the supernatants were collected and stored at -80°C to inactivate lactate dehydrogenase. The reaction mixture was added to the samples and subsequently analyzed using a microreader (OD570). The NAD+ / NADH ratio in whole cell lysates was measured using the NAD+ / NADH Quantification Colorimetric Kit (Sigma, MAK037) according to the manufacturer's instructions. For real-time analysis of extracellular oxygen consumption rate (ECAR) and oxygen consumption rate (OCR), BMDM were analyzed using the XF-24 Extracellular Flux Analyzer (Seahorse Bioscience; Santa Clara, CA, USA). Briefly, BMDMs were plated in XF-24 cell culture microplates (2 × 105 cells / well in 200 μL), then infected with MTB and cultured in the presence or absence of 9R-TgMIF. After the indicated time, the medium was removed, and the cells were washed and analyzed according to the manufacturer's instructions. When real-time values ​​of OCR and ECAR were required, ECAR and / or OCR were analyzed in response to 2 μg / mL oligomycin, 0.3 μM FCCP, 2 μM rotenone, 1 mM antimycin, glucose (10 mM), and 2-DG (100 mM), purchased from Sigma-Aldrich.

[0172]

[0173] 1.14 Preparation of tuberculosis strains

[0174] Mycobacterium tuberculosis strain H37Rv was obtained from the American Type Culture Collection (ATCC, Rockville, MD, USA). MDR-TB (KMRC 00116-00250), INH-resistant TB (KMRC 00120-00137), pyrazinamide-resistant TB (KMRC 00130-00064), rifampicin-resistant TB (KMRC 00121-00341), and streptomycin-resistant TB (KMRC 00122-00123) were purchased from the Korean Tuberculosis Resource Center. The tuberculosis strains used in this study were prepared according to a previously described method. More specifically, Middlebrook 7H9 medium (Difco; Sparks, MD, USA, 271310) was supplemented with 10% oleic acid albumin dextrose catalase (OADC; BD Biosciences, San Diego, CA, 212240), 0.5% glycerol, and 0.05% Tween-80 (7H9-OADC) and cultured at 37°C in a shaker (140 rpm) until the OD600 reached 0.4–0.6. All bacterial procedures were reviewed and approved by the Institutional Biosafety Committee of Hanyang University (HY-IBC-2022-03).

[0175]

[0176] 1.15 Intracellular and extracellular MTB infection

[0177] In intracellular experiments, cells were infected with MTB for 2–4 hours. The cells were then washed with PBS to remove external bacteria, resuspended in fresh medium, and incubated at 37°C for the indicated time. In vivo experiments involved female SPF C57BL / 6 mice, 6–8 weeks old and matched for age and sex for each experiment. No additional randomization or blinding was performed to assign experimental groups. Mice were intranasally inoculated with MTB (1 × 104 CFU / mouse). Five weeks later, the mice were sacrificed, and their lungs, spleen, and liver were extracted. The mice were maintained in a biosafety level 3 laboratory facility. All animal experiments were approved by the Biomedical Research Ethics Committee of the Institute of Microbiology, Chinese Academy of Sciences (Beijing, China).

[0178]

[0179] 1.16 Colony forming unit (CFU) analysis

[0180] To analyze bacterial survival within mouse macrophages, MTB-infected cells (MOI: 1 or 10) were cultured for 4 hours and washed with DPBS to remove extraneous bacteria. The infected cells were cultured in fresh medium for the indicated periods. The cells were then lysed in distilled water for 40 minutes, and intracellular bacteria were collected. The cell lysate was diluted with DPBS and inoculated onto Middlebrook 7H10 agar containing 10% OADC. Colonies were counted 2–3 weeks later to assess intracellular bacterial survival.

[0181]

[0182] 1.17 Histology

[0183] For immunohistochemical analysis of tissue sections, rat lungs were fixed in 10% formalin and embedded in wax. Wax sections (4 μm) were stained with hematoxylin and eosin (H&E). Histopathological scoring was based on the number and distribution of inflammatory cells in the tissue and the severity of inflammation within the tissue. A certified pathologist (Dr. Min-Kyung Kim, Kim Min-Kyung Pathology Clinic, Seoul, Korea), who evaluated each organ section without prior knowledge of the treatment group, assigned a histological score on a scale of 0 to 4 for each sample.

[0184]

[0185] 1.18 Statistical Analysis

[0186] All data were analyzed using Student's t-test with Bonferroni correction or ANOVA for multiple comparisons, and data are expressed as mean ± SD. Statistical analyses were performed using SPSS (version 12.0) statistical software (SPSS, Chicago, IL, USA). Differences were considered statistically significant at P < 0.05. For survival, the Kaplan-Meier product limit method was used to analyze survival rates, and the log-rank (Mantel-Cox) test was used for comparisons using GraphPad Prism (version 5.0, La Jolla, CA, USA).

[0187]

[0188] Example 2. Results

[0189] 2.1 TgMIF regulates inflammatory responses through interactions with CD74, STAT1, and AZIN1.

[0190] To investigate the functional recovery of MTB-infected macrophages by TgMIF, we selected a His-tagged TgMIF protein purified from bacteria. Purified rTgMIF (13 kDa) was verified using SDS-polyacrylamide gel electrophoresis and Western blotting (Figs. 1A and 2A). Subsequently, we tested rTgMIF-induced cytotoxicity by assessing cell viability in bone marrow-derived macrophages (BMDM). No significant difference in cytotoxicity was observed between rTgMIF and rVehicle in BMDM (Fig. 2B).

[0191] The expression of inflammatory cytokines induced by rTgMIF was recorded over time. Consistent with previous reports, TgMIF induced the expression of proinflammatory cytokines such as tumor necrosis factor (TNF)-α, interleukin (IL)-6, and IL-12p40, a member of the IL-12 family, as well as anti-inflammatory cytokines such as IL-10, transforming growth factor (TGF)-β, and IL-4 (Fig. 1B).

[0192] To explore potential novel binding proteins and mechanisms involved in the inflammatory response to TgMIF, co-immunoprecipitation / mass spectrometry coupled with mass spectrometry (co-IP / MS) was performed. This analysis identified binding partners STAT1, AZIN1, and CD74 ( Fig. 1C ). Furthermore, human proteome microarray identified 89 proteins exhibiting high binding affinity for rTgMIF, of which 6 (TBX5, CDCA3, C6orf106, URM1, POLR2H, and AZIN1) exhibited high binding affinity to rTgMIF ( Fig. 1D ).

[0193] Furthermore, we investigated the interaction between TgMIF and endogenous CD74, STAT1, or AZIN1. As a result, significant interaction was observed between rTgMIF-induced BMDMs and THP-1 cells, while no binding was observed between STAT3 and STAT6 (Figures 1E and 2C). Cytoplasmic and nuclear fractionation experiments demonstrated interactions between TgMIF and STAT1 and AZIN1 within the nucleus (Figure 1F). In summary, these results indicate that TgMIF interacts with CD74, STAT1, and AZIN1 in macrophages (Figure 1G).

[0194]

[0195] 2.2 TgMIF binding mapping: CD74, STAT1, AZIN

[0196] To clarify the domain regions of TgMIF for interactions with CD74, AZIN1, and STAT1, we engineered GST-TgMIF fusion proteins containing the N-protein (aa 13-43), middle (aa 44-69), and C-protein regions (aa 70-102). In 293T cells, GST-TgMIF wild-type (WT) and GST-TgMIF middle region fusion proteins successfully bound to Flag-CD74, indicating a specific interaction between the middle region of TgMIF and CD74 ( Figure 3A ). Further mapping of the TgMIF binding domain of CD74 was performed using a GST pull-down assay using truncated mutants of CD74, showing that TgMIF binds to the extracellular domain (aa 72-296) of CD74 ( Figure 3B ). In addition, we investigated the interaction domains of TgMIF, STAT1, and AZIN1. The GST-TgMIF C-protein and N-protein regions successfully pulled down Flag-STAT1 and Flag-AZIN1, respectively, revealing their respective interaction sites (Figures 3C and 3D). Subsequently, mapping studies using truncated mutants of GST-STAT1 and Flag-TgMIF in 293T cells confirmed that the loop-loop domain (CCD) (aa 135-317) of STAT1 plays a critical role in the interaction with TgMIF (Figure 3C). Furthermore, mapping studies revealed that the AZIN1 N-protein (aa 45-275) is required for the interaction with TgMIF (Figure 3D).

[0197] In summary, the above results demonstrate that TgMIF possesses N-protein (aa 13-43), middle (aa 44-69), and C-protein (aa 70-102) regions that interact with AZIN1, CD74, and STAT1, respectively. To further confirm this, we used the PROFbval method to design specific amino acid fragments (TgMIF-58-65, TgMIF-15-27, and TgMIF-75-84) representing the minimal peptide sequences that interact with CD74, AZIN1, and STAT1, respectively.

[0198]

[0199] 2.3 TgMIF-induced inflammatory response: CD74-mediated endocytosis

[0200] To determine the endocytosis pathway of TgMIF, three different endocytosis inhibitors were applied: methyl-β-cyclodextrin (inhibitor of caveolin-mediated endocytosis), amirolide (inhibitor of macropinocytosis), and cytochalasin D (inhibitor of phagocytosis / macrophinocytosis). Cytochalasin D treatment significantly reduced TgMIF expression compared to untreated control BMDM (Fig. 4A).

[0201] Next, we investigated the role of CD74 in TgMIF endocytosis. To this end, we assessed TgMIF expression in BMDMs treated with CD74 short hairpin RNA (shRNA) oligomers (shCD74). Similar to cytochalasin D treatment, shCD74 treatment significantly suppressed TgMIF expression (Figure 4B). These results suggest that the middle domain of TgMIF is important for its interaction with CD74 (Figures 3A and 3B). We then examined the binding specificity of TgMIF-58-65 to CD74 in 293T cells. As shown in Figure 4C, the wild-type TgMIF-58-65 competitively inhibited the interaction between TgMIF and CD74. We confirmed that the R62 amino acid of TgMIF-58-65 is essential for its interaction with CD74. TgMIF-58-65, R62D, and R62E did not interfere with the interaction between TgMIF and CD74. In contrast, TgMIF-58-65 R62K competitively inhibited the interaction between TgMIF and CD74 (Fig. 4C). Furthermore, TgMIF-58-65 R62K competitively inhibited the binding of rTgMIF to BMDMs, indicating its interaction with endogenous CD74 (Fig. 4C). Measurement of CD74 protein expression indicated that TgMIF-58-65 R62K played a crucial role in the binding of TgMIF to CD74 (Fig. 4C).

[0202] Finally, we evaluated the effect of the CD74-interacting peptide of TgMIF on inflammatory responses. rTgMIF increased inflammatory cytokines such as TNF-α, IL-6, and IL-10, whereas TgMIF-58-65 R62K treatment significantly suppressed cytokine production in BMDM (Fig. 4D). In summary, these results demonstrate that the R62 amino acid of the TgMIF-58-65 fragment plays a critical role in the interaction with CD74, and that CD74 is essential for TgMIF-induced inflammatory responses.

[0203]

[0204] 2.4 TgMIF regulates mitochondrial dynamics and metabolism through AZIN1.

[0205] To identify the genes and mechanisms affected by AZIN1 interacting with TgMIF, we performed differential gene expression (DGE) analysis of BMDMs treated with rTgMIF and shNC or shAZIN1 based on RNA-seq data. RNA-seq results showed altered DGE patterns related to mitochondria when comparing shAZIN1 with shNS ( Fig. 5A ). The expression of genes involved in mitochondrial fission (DRP1, FIS1, and MEF) and fusion (MFN1, MFN2, and OPA1) induced by rTgMIF was regulated by AZIN1 ( Fig. 6A ). Drp1, Fis1, and MEF, which were upregulated by rTgMIF, showed a significant increase in shAZIN1 treatment compared to shNC. In contrast, Mfn1, Mfn2, and Opa1, which were upregulated by TgMIF, were downregulated in shAZIN1-treated macrophages ( Fig. 5B ). Additionally, the TgMIF mutant 9R-TgMIF (15-27) significantly increased mitochondrial fission gene expression even in the absence of AZIN1, whereas mitochondrial fusion gene expression was significantly reduced by AZIN1 (Fig. 6B).

[0206] To evaluate the AZIN1-dependent effect of TgMIF on MTB-induced mitochondrial function restoration, we measured Drp1 and Mfn1 expression. Drp1 expression was significantly increased after MTB infection, and 9R-TgMIF (15-27) treatment suppressed Drp1 expression in an AZIN1-dependent manner. In contrast, 9R-TgMIF (15-27) significantly increased Mfn1 expression in MTB-infected macrophages together with AZIN1 (Fig. 6C). Western blotting revealed that TgMIF suppressed MTB-infected P-Drp1 and Drp-1 expression in a AZIN1-dependent manner (Fig. 5C). MFN1 and MFN2 expression were upregulated by TgMIF and increased together with AZIN1 expression in MTB-infected macrophages (Fig. 5D). Additionally, increased mitochondrial mass associated with fusion was increased by 9R-TgMIF (15-27) in MTB-infected macrophages and decreased by AZIN1 (Fig. 5E).

[0207] RNA-seq results indicated that TgMIF participates in mitochondrial complexes, particularly the fifth mitochondrial complex (ATP synthase) (Figs. 6D and 7A). For example, mitochondrial ATP synthase-related genes, such as Atp5a1 and Atp5d, were upregulated by 9R-TgMIF (15-27) treatment, but were suppressed by AZIN1 inhibition (Figs. 6E and 7B). Atp5A1 protein expression, which was upregulated by MTB infection and TgMIF treatment, was reduced by AZIN1 inhibition (Fig. 7C). Furthermore, 9R-TgMIF (15-27) treatment increased cellular ATP production in MTB-infected BMDMs (Fig. 6F).

[0208] Next, we measured OCR and ECAR to investigate the mitochondrial function and metabolic characteristics of the cells. In BMDM, substrate oxidation was compared. Treatment with TgMIF (15-27) significantly increased basal respiration, ATP-coupled responses, and maximal respiration, which were decreased by MTB infection. However, in AZIN1-deficient murine macrophages, TgMIF treatment did not increase basal respiration, ATP-coupled responses, or maximal respiration (Fig. 6G). ECAR results showed that MTB infection induced a significant rapid response in BMDM, which was then reduced by TgMIF (15-27) treatment. However, such a decrease was not observed in AZIN1-deficient murine macrophages (Fig. 6G).

[0209] ROS can induce mitochondrial DNA mutations and impair the mitochondrial respiratory chain, and TgMIF treatment decreased mitochondrial DNA export and mitochondrial complex V activity in a AZIN1-dependent manner (Fig. 7D). Furthermore, TgMIF increased mtDNA export and mitochondrial complex V activity in MTB-infected macrophages, but decreased this activity in shAZIN1-treated macrophages (Fig. 6H). There was no change in the activities of complexes I, II-III, or IV following TgMIF and AZIN1 treatment (Fig. 7E).

[0210] To restore mitochondrial dysfunction, we evaluated whether TgMIF increases NAD+ and lactate secretion levels. TgMIF increased endogenous NAD+ levels and decreased lactate secretion in MTB-infected macrophages (Fig. 7F). Furthermore, AZIN1-mediated mitochondrial functional restoration by TgMIF reduced MTB CFU (Fig. 6I).

[0211] In summary, these results demonstrate that TgMIF plays a crucial role in enhancing mitochondrial function in response to MTB infection by regulating mitochondrial fission and fusion, ATP synthesis, and metabolism in an AZIN1-dependent manner.

[0212]

[0213] 2.5 TgMIF-induced STAT1-dependent macrophage polarization enhances host defense.

[0214] We identified candidate genes that showed different expression patterns over time in response to TgMIF (Figures 8A and 9A). After 6 h of TgMIF treatment, M1 macrophage markers such as cd80, cd86, and inos were transiently increased, while M2 macrophage markers including cd163, cd206, and Arg1 did not change significantly. Furthermore, TgMIF transiently increased STAT1 phosphorylation at 30 and 60 min (Figure 8B). This suggests that the K76 amino acid of TgMIF-75-84 plays a critical role in its interaction with STAT1. TgMIF-75-84 K76D and K76E did not increase cd80, cd86, and inos expression, whereas TgMIF-75-84 K76 and TgMIF-75-84 K76R significantly increased their expression. Additionally, TgMIF-75-84 WT and TgMIF-75-84 K76R transiently increased p-STAT1 expression at 30 and 60 min (Fig. 8C).

[0215] To investigate whether TgMIF regulates macrophage polarization markers in MTB-infected macrophages, we compared TgMIF wild-type and TgMIF K76D and observed a dose-dependent increase in cd80, cd86, and inos expression. In contrast, cd163, cd206, and Arg1 expression were decreased in TgMIF wild-type cells, while TgMIF K76D did not change (Figs. 8D and 9B). Furthermore, TgMIF WT increased the proinflammatory cytokines TNF-α and IL-6, while TgMIF K76D decreased the anti-inflammatory cytokine IL-10 (Fig. 9D).

[0216] Next, we investigated the effect of STAT1 on macrophage polarization induced by TgMIF in MTB-infected macrophages. The increase in M1 macrophage markers (cd80, cd86, and inos) induced by TgMIF was suppressed by STAT1 blockade, while the decrease in M2 macrophage markers (cd163, cd206, and Arg1) was suppressed by STAT1 blockade (Figs. 8E and 9C). Furthermore, the effect of STAT1 on TgMIF-induced cytokine production showed a decrease in proinflammatory cytokines (TNF-α and IL-6) and an increase in anti-inflammatory IL-10 by STAT1 inhibition (Fig. 8F).

[0217] STAT1-dependent TgMIF-induced M1 macrophage polarization suppressed MTB growth in a tgMIF dose-dependent manner (Figures 8G and 9E). In summary, these results highlight the role of STAT1 in TgMIF-induced macrophage polarization and its subsequent impact on MTB growth.

[0218]

[0219] 2.6 TgMIF rescues TB lung damage and death through STAT1 and AZIN1.

[0220] To evaluate the therapeutic efficacy of TgMIF in MTB-infected mice, we designed the TgMIF peptide and its mutants, TgMIF MT1 (CD74-binding mutant) and TgMIF MT2 (STAT1-binding mutant) (Fig. 10A). To assess the bioavailability, metabolic rate, and adverse effects of the peptides, we measured their stability, CYP enzyme activity, and PK parameters (Fig. 10B).

[0221] In a timeline designed for a TB mouse model, post-treatment with TgMIF WT and TgMIF MT2 resulted in a dose-dependent reduction in Mtb CFU (Fig. 11A). However, pre- and co-treatment with TgMIF did not completely inhibit Mtb, with reductions observed only at high concentrations (Fig. 10C). Furthermore, reduced immune cell infiltration and reduced lung damage were observed in mice infected with the Mtb H37Rv strain. However, these effects were not observed in TgMIF MT1 cells (Fig. 11B).

[0222] To further investigate the effects of TgMIF on mitochondrial function in MTB-infected mice, we treated the lungs with TgMIF WT and TgMIF MT2, which suppressed Drp1 and Fis1 expression and increased Mfn1 and Opa1 expression. In contrast, TgMIF MT1 did not modulate the expression of mitochondrial fission or fusion genes (Fig. 11C). Furthermore, TgMIF improved mitochondrial function by restoring mitochondrial respiration, suppressing extracellular oxidation, increasing ATP production and ATP synthase activity, and reducing mtROS levels (Figs. 11D and 10D).

[0223] The interaction between TgMIF and STAT1 in BMDMs induces M1 macrophage polarization (Fig. 8). Consistent with these results, TgMIF increased the expression of P-STAT1, CD80, and CD86 in the lungs of MTB-infected mice. However, no changes in CD163 or CD206 were observed in TgMIF MT1 and MT2 cells (Figs. 10E and 11E).

[0224] To precisely elucidate the intracellular distribution of TgMIF, its biodistribution was examined at each time point using in vivo imaging system (IVIS) imaging. As a result, relatively high-contrast images of TgMIF-Cy5.5 were observed 1–6 hours after intranasal administration, demonstrating that it was primarily distributed in the lungs (Fig. 10F).

[0225] Changes in immune cell populations and inflammatory cytokine production were observed in the lungs of MTB-infected mice. Innate immune cells were increased, while CD4 helper T cells, CD8 cytotoxic T cells, and FOXP3+ regulatory T cells remained unchanged (Fig. 12A). TgMIF increased the expression of TNFα and IL-6, decreased IL-10 and TGF-β, and did not change IFN-γ (Fig. 11F and 12B). The posttreatment efficacy of WT TgMIF against killing by the MTB H37Rv strain was dependent on STAT1 and AZIN1, demonstrating significant STAT1- and AZIN1-dependent protection (Fig. 13).

[0226] In summary, TgMIF exhibited therapeutic efficacy against MTB-induced lung injury and death through various mechanisms including immune modulation, enhancement of mitochondrial function, and STAT1 and AZIN1 pathway-dependent mechanisms.

[0227]

[0228] 2.7 TgMIF acts in cooperation with drugs against drug-resistant bacteria.

[0229] To enhance antibacterial activity against MTB in human monocyte-derived macrophages, the effect of TgMIF in combination with the first-line TB treatment drugs isoniazid (INH), pyrazinamide (PZA), and rifampicin (RFP) was investigated. In human MDM, MTB inhibition was observed in a dose-dependent manner with TgMIF, INH, PZA, and RFP. The combination of INH and TgMIF significantly inhibited MTB growth in a dose-dependent manner. Furthermore, combining TgMIF with INH, PZA, and RFP enhanced the CFU inhibition efficiency, particularly when combined with INH (Fig. 14A). This synergistic effect was extended to the inhibition of MTB growth in the lungs of MTB-infected mice by the combination of INH and TgMIF (Fig. 14B).

[0230] The therapeutic efficacy of TgMIF was evaluated against TB strains resistant to INH, PZA, RFP, streptomycin (SM), and multidrug-resistant (MDR) tuberculosis. TgMIF significantly reduced bacterial colony counts in human MDM and lungs in all drug-resistant TB strains (Figures 14C and 14D). This effect was accompanied by a reduction in immune cell infiltration and lung damage (Figure 15).

[0231] In lungs infected with MDR-TB, TgMIF treatment exerted a modulatory effect on mitochondrial function. TgMIF suppressed Drp1 and Fis1 expression and increased Mfn1 and Opa1 expression in lung lysates from MDR infection (Fig. 14E). Furthermore, TgMIF enhanced the decreased OCR and attenuated the increased ECAR caused by MDR infection (Fig. 14F).

[0232] In MDR infection, TgMIF exerted a regulatory effect on macrophage polarization markers. cd80 and cd86 were increased, while cd163 and cd206 were decreased by TgMIF in the lungs of MDR-infected mice (Fig. 14G). TgMIF also induced the production of inflammatory cytokines in MTB-infected macrophages, with significantly increased TNF-α and IL-6 and decreased IL-10 and TGF-β in the lungs of MDR-infected mice (Fig. 14H).

[0233] In summary, TgMIF, when combined with drugs, exhibited significant efficacy against MTB and drug-resistant TB strains. This combination treatment resulted in a reduction in bacterial colony counts, immune modulation, alleviation of lung damage, and restoration of mitochondrial function. These results highlight the potential of TgMIF as a key component in the treatment of drug-resistant TB.

[0234]

[0235] The sequences used in the present invention are as shown in Table 1 below.

[0236] SEQ ID NO: 1AQQDALLKDAEKA2CAFIRVAS3CKIAAALSAA4CAFIKVAS5CRIAAALSAA6AQQDALLKDAEKAGGCAFIRVASGGCKIAAALSAA7AQQDALLKDAEKAGGCAFIDVASGGCKIAAALSAA8AQQDALLKDAEKAGGCAFIRVASGGCCDIAAALSAA

[0237] For example, for purposes of claim construction, the claims set forth below should not be construed narrowly beyond their literal language, and thus, exemplary embodiments from the specification should not be construed as claims. Therefore, it should be understood that the present invention has been described by way of example only, and not as a limitation on the scope of the claims. Accordingly, the present invention is limited only by the claims below. All publications, issued patents, patent applications, books, and journal articles cited in this application are hereby incorporated by reference in their entirety.

[0238]

[0239] Sequence number 1: AQQDALLKDAEKA

[0240] Sequence number 2: CAFIRVAS

[0241] Sequence number 3: CKIAAALSAA

[0242] Sequence number 4: CAFIKVAS

[0243] Sequence number 5: CRIAAALSAA

[0244] Sequence number 6: AQQDALLKDAEKAGGCAFIRVASGGCKIAAALSAA

[0245] Sequence number 7: AQQDALLKDAEKAGGCAFIDVASGGCKIAAALSAA

[0246] Sequence number 8: AQQDALLKDAEKAGGCAFIRVASGGCDIAAALSAA

Claims

1. A polypeptide comprising at least one amino acid sequence selected from the group consisting of an amino acid sequence represented by SEQ ID NO: 1 or an amino acid sequence having 90% or more homology thereto, an amino acid sequence represented by SEQ ID NO: 2 or an amino acid sequence having 90% or more homology thereto, and an amino acid sequence represented by SEQ ID NO: 3 or an amino acid sequence having 90% or more homology thereto.

2. A polypeptide comprising all of the amino acid sequence represented by SEQ ID NO: 1 or an amino acid sequence having 90% or more homology thereto, the amino acid sequence represented by SEQ ID NO: 2 or an amino acid sequence having 90% or more homology thereto, and the amino acid sequence represented by SEQ ID NO: 3 or an amino acid sequence having 90% or more homology thereto, in accordance with paragraph 1.

3. In the first paragraph, a polypeptide having an amino acid sequence having 90% or more homology with the amino acid sequence represented by the sequence number 2, which comprises a conservative amino acid substitution of the 5th Arg of the sequence number 2.

4. A polypeptide having a homology of 90% or more with the amino acid sequence represented by SEQ ID NO: 2 in the third paragraph, and including a conservative amino acid substitution of the 5th Arg of SEQ ID NO: 2, which is SEQ ID NO:

4.

5. In the first paragraph, a polypeptide having an amino acid sequence having 90% or more homology with the amino acid sequence represented by SEQ ID NO: 3, which includes a conservative amino acid substitution of the second Lys of SEQ ID NO:

3.

6. A polypeptide having a homology of 90% or more with the amino acid sequence represented by SEQ ID NO: 3 in paragraph 5, and including a conservative amino acid substitution of the second Lys of SEQ ID NO: 3, wherein the sequence is SEQ ID NO:

5.

7. In the second paragraph, a polypeptide in which the amino acid sequence represented by SEQ ID NO. 1 or an amino acid sequence having 90% or more homology thereto, the amino acid sequence represented by SEQ ID NO. 2 or an amino acid sequence having 90% or more homology thereto, and the amino acid sequence represented by SEQ ID NO. 3 or an amino acid sequence having 90% or more homology thereto are connected by a linker.

8. A pharmaceutical composition for preventing or treating tuberculosis, comprising a polypeptide according to any one of claims 1 to 7.

9. A pharmaceutical composition for preventing or treating tuberculosis having resistance to at least one selected from the group consisting of isoniazid (INH), pyrazinamide (PZA), rifampicin (RFP), and streptomycin (SM), according to claim 8.

10. A nucleic acid molecule encoding a polypeptide of any one of claims 1 to 7.

11. An expression vector comprising the nucleic acid molecule of paragraph 9.

12. A recombinant cell expressing the polypeptide of any one of claims 1 to 7.

13. A pharmaceutical composition for preventing or treating tuberculosis, comprising a nucleic acid molecule encoding a polypeptide of any one of claims 1 to 7 or a recombinant cell expressing a polypeptide of any one of claims 1 to 7.

14. A pharmaceutical composition for preventing or treating tuberculosis resistant to at least one selected from the group consisting of isoniazid (INH), pyrazinamide (PZA), rifampicin (RFP), and streptomycin (SM), according to claim 13.

15. A method for preventing or treating tuberculosis, comprising administering to a subject in need thereof a pharmaceutically effective amount of a polypeptide comprising at least one amino acid sequence selected from the group consisting of an amino acid sequence represented by SEQ ID NO: 1 or an amino acid sequence having at least 90% homology thereto, an amino acid sequence represented by SEQ ID NO: 2 or an amino acid sequence having at least 90% homology thereto, and an amino acid sequence represented by SEQ ID NO: 3 or an amino acid sequence having at least 90% homology thereto.

Citation Information

Patent Citations

  • Immunogenic composition for immune system modulation and use thereof, method for treating and preventing diseases, method for inducing cell regeneration and method for restoring immune response

    KR1020140027162A

  • Rip current analysis system using automatic current survey drone

    KR102130763B1

  • KR20220160070A