Variant of polynucleotide and method for producing l-histidine using same

Abstract

The present disclosure relates to: a novel polynucleotide having promoter activity; and a method for producing L-histidine using same. A microorganism incorporating the novel polynucleotide according to the present disclosure has a significantly increased ability to produce L-histidine, and thus the novel polynucleotide can be effectively used to efficiently produce L-histidine.

Description

Polynucleotide variant and method for producing L-histidine using the same

[0001] This disclosure claims the benefit of priority to Republic of Korea Patent Application No. 10-2024-0093909, filed July 16, 2024, and Republic of Korea Patent Application No. 10-2025-0081888, filed June 20, 2025, the entire contents of which are incorporated herein by reference.

[0002] Numerous papers and patents are referenced and cited throughout this disclosure. The disclosures of these cited papers and patents are incorporated herein by reference in their entirety to provide a clearer understanding of the state of the art and the scope of the present invention.

[0003] The present disclosure relates to a novel promoter and a method for producing L-histidine using the same, and more particularly, to a novel polynucleotide having promoter activity, an expression cassette comprising the polynucleotide and a target gene operably linked thereto, a vector comprising the polynucleotide or the expression cassette, a microorganism comprising the polynucleotide or the expression cassette, and a method for producing L-histidine using the microorganism.

[0004]

[0005] Efforts to utilize microorganisms to produce high-yield target substances, such as amino acids or other useful compounds for various applications, such as feed, pharmaceuticals, and food, through genetic manipulation and / or the introduction of exogenous genes into biosynthetic pathways have been ongoing. One such method involves inducing overexpression of target genes in microorganisms, which requires a highly efficient gene expression system. Since promoters are a key factor in determining the level and regulation of gene expression, developing a useful promoter is essential for developing expression systems.

[0006] Microorganisms of the genus Corynebacterium produce amino acids including L-histidine. However, unlike other industrial microorganisms such as Escherichia coli or Bacillus subtilis, the promoter sequence for gene expression in Corynebacterium microorganisms has not been generally known in its structure. Therefore, promoters have been developed by removing the promoter portion of antibiotic resistance genes such as chloramphenicol, introducing chromosomal DNA isolated from coryneform microorganisms after cutting it with an appropriate restriction enzyme, and then transforming coryneform microorganisms with this promoter and measuring the antibiotic resistance of the resulting strain. In addition, various promoters have been explored to overexpress foreign genes in Bacillus microorganisms, and these promoters are being used to produce enzymes for food, pharmaceutical, and other industrial purposes. Many vector systems using promoters for the expression of alpha-amylase, protease, and lipase genes from various Bacillus genus microorganisms are still being developed to this day (Schumann 2007. Adv. Appl. Microbiol. 153:813-821).

[0007] With the increasing demand for L-histidine, there is a need to overexpress genes related to L-valine in microorganisms of the genus Corynebacterium, and the need for the development of strong promoters remains.

[0008] [Prior Art Literature]

[0009] [Patent Document]

[0010] (Patent Document 1) Republic of Korea Patent No. 10-2801078

[0011] One object of the present disclosure is to provide a novel polynucleotide.

[0012] Another object of the present disclosure is to provide an expression cassette comprising the polynucleotide and a target gene.

[0013] Another object of the present disclosure is to provide a microorganism comprising the polynucleotide or the polynucleotide and a target gene operably linked thereto.

[0014] Another object of the present disclosure is to provide a method for producing L-histidine, which comprises a step of culturing the microorganism in a medium.

[0015] Another object of the present disclosure is to provide a use of the microorganism for producing L-histidine.

[0016]

[0017] This is specifically described as follows. Meanwhile, each description and embodiment disclosed in this disclosure can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this disclosure fall within the scope of this disclosure. Furthermore, the scope of this disclosure is not limited by the specific descriptions set forth below. Furthermore, those skilled in the art will recognize or ascertain, through routine experimentation alone, numerous equivalents to the specific embodiments of the present disclosure described herein. Furthermore, such equivalents are intended to be encompassed by this disclosure.

[0018] Additionally, numerous papers and patents are referenced and cited throughout this disclosure. The disclosures of these cited papers and patents are incorporated by reference into this disclosure in their entirety, thereby providing a clearer understanding of the technical field to which this disclosure pertains and the content of this disclosure.

[0019] One aspect of the present disclosure provides a polynucleotide comprising a nucleotide sequence in which the nucleotide at the 7th position, the nucleotide at the 8th position, the nucleotide at the 11th position, the nucleotide at the 12th position, the nucleotide at the 16th position, the nucleotide at the 46th position, the nucleotide at the 241st position, and the nucleotide at the 258th position in the nucleotide sequence of SEQ ID NO: 311 are replaced with nucleotides different from the original.

[0020] In the present disclosure, the nucleotide sequence of SEQ ID NO: 311 can be confirmed in the known database NCBI Genbank, and the nucleotide sequence of SEQ ID NO: 311 may be derived from Corynebacterium sp., and specifically, may be derived from Corynebacterium glutamicum. The nucleotide sequence of SEQ ID NO: 311 may be an example sequence for specifying a mutation position to be introduced for producing a polynucleotide of the present disclosure, and it is obvious that the mutation introduced into the polynucleotide of the present disclosure may be introduced into any sequence functionally corresponding to the nucleotide sequence of SEQ ID NO: 311. In one example, the functionally equivalent sequence may be, but is not limited to, a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with the sequence of SEQ ID NO: 311; and less than 100% homology or identity, or a nucleotide sequence having the homology or identity but having some sequences added, deleted, or modified.

[0021] Accordingly, in one example, the polynucleotide of the present disclosure has a nucleotide sequence of SEQ ID NO: 311 in which the nucleotide at the 7th position, the nucleotide at the 8th position, the nucleotide at the 11th position, the nucleotide at the 12th position, the nucleotide at the 16th position, the nucleotide at the 46th position, the nucleotide at the 241st position, and the nucleotide at the 258th position are replaced with nucleotides different from the original, and are at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more similar to the nucleotide sequence of SEQ ID NO: 311; And it may be composed of, essentially composed of, or includes a nucleotide sequence having less than 100% homology or identity, or a nucleotide sequence having the homology or identity but having some sequences added, deleted, or modified.

[0022] In the present disclosure, the nucleotide sequence of SEQ ID NO: 311 may be a promoter sequence of a gene encoding glutamate dehydrogenase (NCgl1999 gene, gdh gene) or a part of the promoter sequence.

[0023] In one embodiment, in the nucleotide sequence of SEQ ID NO: 311, the nucleotide at the 7th position may be adenine (A), the nucleotide at the 8th position may be cytosine (C), the nucleotide at the 11th position may be cytosine (C), the nucleotide at the 12th position may be cytosine (C), the nucleotide at the 16th position may be adenine (A), the nucleotide at the 46th position may be cytosine (C), the nucleotide at the 241st position may be adenine (A), and / or the nucleotide at the 258th position may be guanine (G), but is not limited thereto.

[0024] In a specific embodiment, the polynucleotide may be one in which the nucleotide at the 7th position in the nucleotide sequence of SEQ ID NO: 311 is substituted with cytosine (C), guanine (G), or thymine (T), and more specifically, may be substituted with thymine (T), but is not limited thereto.

[0025] In a specific embodiment, the polynucleotide may be one in which the nucleotide at the 8th position in the nucleotide sequence of SEQ ID NO: 311 is substituted with adenine (A), guanine (G), or thymine (T), and more specifically, may be substituted with guanine (G), but is not limited thereto.

[0026] In a specific embodiment, the polynucleotide may be one in which the nucleotide at the 11th position in the nucleotide sequence of SEQ ID NO: 311 is substituted with adenine (A), guanine (G), or thymine (T), and more specifically, may be substituted with guanine (G), but is not limited thereto.

[0027] In a specific embodiment, the polynucleotide may be one in which the nucleotide at the 12th position in the nucleotide sequence of SEQ ID NO: 311 is substituted with adenine (A), guanine (G), or thymine (T), and more specifically, may be substituted with thymine (T), but is not limited thereto.

[0028] In a specific embodiment, the polynucleotide may be one in which the nucleotide at the 16th position in the nucleotide sequence of SEQ ID NO: 311 is substituted with cytosine (C), guanine (G), or thymine (T), and more specifically, may be substituted with cytosine (C), but is not limited thereto.

[0029] In a specific embodiment, the polynucleotide may be one in which the nucleotide at position 46 in the nucleotide sequence of SEQ ID NO: 311 is substituted with adenine (A), guanine (G), or thymine (T), and more specifically, may be substituted with thymine (T), but is not limited thereto.

[0030] In a specific embodiment, the polynucleotide may be one in which the nucleotide at position 241 in the nucleotide sequence of SEQ ID NO: 311 is substituted with cytosine (C), guanine (G), or thymine (T), and more specifically, may be substituted with guanine (G), but is not limited thereto.

[0031] In a specific embodiment, the polynucleotide may be one in which the nucleotide at position 258 in the nucleotide sequence of SEQ ID NO: 311 is substituted with adenine (A), cytosine (C), or thymine (T), and more specifically, may be substituted with adenine (A), but is not limited thereto.

[0032] In one embodiment, the polynucleotide may comprise, consist essentially of, or consist of a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 97.25%, 97.3%, or 97.4%; and less than 100% homology or identity to the nucleotide sequence of SEQ ID NO: 311. More specifically, the polynucleotide is a polynucleotide in which the nucleotide at the 7th position of the nucleotide sequence of SEQ ID NO: 311 is substituted with thymine (T), the nucleotide at the 8th position is substituted with guanine (G), the nucleotide at the 11th position is substituted with guanine (G), the nucleotide at the 12th position is substituted with thymine (T), the nucleotide at the 16th position is substituted with cytosine (C), the nucleotide at the 46th position is substituted with thymine (T), the nucleotide at the 241st position is substituted with guanine (G), and the nucleotide at the 258th position is substituted with adenine (A), and has at least 70%, 80%, 85%, 90%, 95%, It may comprise, consist essentially of, or consist of a nucleotide sequence having at least 96%, 97%, 97.25%, 97.3%, or 97.4%; and less than 100% homology or identity thereto.

[0033]

[0034] In the present disclosure, the polynucleotide may comprise the nucleotide sequence of SEQ ID NO: 110. In another embodiment, the polynucleotide of the present disclosure may consist essentially of the nucleotide sequence of SEQ ID NO: 110. In yet another embodiment, the polynucleotide of the present disclosure may consist of the nucleotide sequence of SEQ ID NO: 110.

[0035] As used herein, the term "polynucleotide" includes 2 or more, 5 or more, 10 or more, 13 or more, 20 or more, or 30 or more nucleotide monomers, wherein the nucleotide monomers may be covalently linked to form a chain.

[0036] The polynucleotide of the present disclosure may have promoter activity and may be used as a universal promoter.

[0037] In one embodiment, the polynucleotide may have promoter activity for expression of a target gene in microorganisms of the Corynebacterium genus.

[0038] A polynucleotide having the above promoter activity may be used interchangeably with a “variant promoter” in the present disclosure.

[0039] According to one embodiment, the polynucleotide of the present disclosure can be utilized as a synthetic promoter having strong expression-inducing activity.

[0040] As used herein, the term "promoter" may refer to a DNA region that includes a binding site for a polymerase and initiates transcription of a downstream target DNA. The promoter may be located upstream of the transcription start site. The promoter may be operably and / or regulatably (enhancing or weakening expression) linked upstream of the target DNA. For example, the promoter may be forwardly linked upstream of a target gene to strengthen (increase) the expression of the gene, or may be reversely linked downstream of the target gene to weaken (decrease) the expression of the gene. When a promoter is introduced in the reverse direction downstream of a target gene, for example, downstream of the stop codon, specifically between the stop codon and the transcription terminator, it may induce transcription in the opposite direction to the normal transcription direction of the gene, thereby causing the RNA polymerase complex to collide with the RNA polymerase complex in the normal direction during the transcription process, thereby weakening the expression of the gene.

[0041] The polymerase may be referred to as RNA polymerase, or DNA-dependent RNA polymerase, and may refer to an enzyme that synthesizes primary transcript RNA from DNA. The polymerase may be a prokaryotic RNA polymerase or a eukaryotic RNA polymerase (e.g., RNA polymerase I, RNA polymerase II, RNA polymerase III, RNA polymerase IV, or RNA polymerase V, etc.). The polynucleotide according to one embodiment may be natural or non-natural, and may be, for example, a non-natural synthesized chemically or recombinantly.

[0042] In this disclosure, the term “variation” means a genetically or non-genetically stable phenotypic change, and may be used interchangeably with “mutation” in this disclosure.

[0043] The polynucleotide (mutant promoter) of the present disclosure may have a promoter activity that is altered (increased or decreased) compared to a polynucleotide that does not contain the mutation (wild type or pre-mutant polynucleotide). The polynucleotide may regulate (increase or decrease) the expression of a target gene operably linked thereto or the expression or activity of a protein encoded by the target gene, and further may regulate the expression of genes other than the target gene.

[0044] The above "target gene" refers to a gene whose expression is to be controlled by the polynucleotide of the present disclosure, and in the case of a protein-coding gene, it may be used interchangeably with "gene encoding the target protein." The protein encoded by the target gene may be expressed as a "target protein," and the gene encoding the "target protein" may be expressed as a "target gene."

[0045] The amino acid coding sequence of the above target gene can be modified in various ways within a range that does not change the protein sequence encoded by the target gene, due to the degeneracy of the codon or in consideration of the codon usage frequency preferred in the organism that is to express the target gene.

[0046] The polynucleotide of the present disclosure may be introduced into a suitable host cell together with an operably linked target gene, and may have an activity that increases the host cell's ability to produce a target substance (production amount), for example, the ability to produce an amino acid (production amount).

[0047] In one embodiment, the polynucleotide may be for increasing the productivity (production amount) of amino acids, and specifically for increasing the productivity (production amount) of L-histidine.

[0048] In addition, the nucleotide sequence of the polynucleotide can be additionally modified by conventionally known mutagenesis methods, such as directed evolution and site-directed mutagenesis, within a range that maintains the corresponding biological activity (promoter activity) and / or the desired activity (e.g., activity of increasing production of a target substance in a host cell).

[0049] Accordingly, the polynucleotide of the present disclosure may be composed of a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with the nucleotide sequence of SEQ ID NO: 110, or may be composed of a sequence having the homology or identity but having some sequences added, deleted, or modified.

[0050] As used herein, the terms "homology" or "identity" refer to the degree of relatedness between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0051] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences are generally capable of hybridizing under moderate or high stringency conditions, typically along at least about 50%, 60%, 70%, 80%, or 90% of the entire sequence or its full length. It should be appreciated that hybridization also encompasses polynucleotides containing common codons or codons considered codon degeneracy in polynucleotides.

[0052] Whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example, as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information Database.

[0053] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information, for example, using a GAP computer program, such as that disclosed in Smith and Waterman, Adv. Appl. Math (1981) 2:482, or, for example, Needleman et al. (1970), J Mol Biol. 48:443. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a comparison matrix as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0054] Additionally, whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined by comparing the sequences by Southern hybridization experiments under defined stringent conditions, and appropriate hybridization conditions are within the skill of the art and can be determined by methods well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F. M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).

[0055] In one example, a polynucleotide comprising a specific nucleotide sequence provided in the present disclosure may be interpreted to include not only the specific nucleotide sequence or a nucleotide sequence substantially equivalent thereto, but also a polynucleotide fragment comprising a nucleotide sequence complementary to the specific nucleotide sequence. Specifically, a polynucleotide having the above complementarity can be identified under the conditions described below: Such conditions are specifically described in known literature. For example, conditions in which genes with high complementarity of 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98% or more, 99.5% or more, or 99.9% or more hybridize, and genes with lower complementarity do not hybridize, or washing conditions of conventional Southern hybridization: 60°C, 1x SSC (saline-sodium citrate buffer), and 0.1% (w / v) SDS (Sodium Dodecyl Sulfate); 60°C, 0.1x SSC, and 0.1% SDS; Or, conditions for washing once, specifically two to three times, at a salt concentration and temperature equivalent to 68°C, 0.1x SSC, and 0.1% SDS can be listed, but are not limited thereto. Hybridization requires that two nucleotides have complementary sequences, but some base mismatches may be tolerated depending on the stringency of hybridization. The term "complementary" can be used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. The stringency of hybridization between polynucleotides depends on the length and degree of complementarity of the polynucleotides, which is well known in the art (Sambrook et al., supra, 9.50-9.51, 11.7-11.8).

[0056] Furthermore, the polynucleotide of the present disclosure may be a gene encoding a target protein, i.e., operably linked to a target gene or operably positioned with a target gene.

[0057] As used herein, the term "operably linked" means that a polynucleotide having promoter activity of the present disclosure is functionally linked to a gene sequence to initiate and mediate transcription of the gene of interest. Operable linkages can be produced using genetic recombination techniques known in the art, and site-specific DNA cleavage and ligation can be produced using, but is not limited to, cleavage and ligation enzymes known in the art.

[0058] When the above polynucleotide is operably linked to a target gene, some nucleotides may be added, deleted, and / or mutated for use with the above cleavage and ligation enzymes.

[0059]

[0060] In one embodiment, the target gene may be, but is not limited to, a gene encoding a protein involved in the production of L-histidine of the present disclosure. The protein involved in the production of L-histidine may be, but is not limited to, a protein involved in at least one process or step of an intracellular production pathway of L-histidine (e.g., biosynthesis, metabolism, bioconversion, etc.), intracellular transport, and / or extracellular excretion pathway, such as enzymes (various synthetases, catabolic enzymes, phosphatases, carboxylases (e.g., pyruvate carboxylase, etc.), reductases, oxidases, decarboxylases, dehydrogenases, dehydratase, transferases, epimerases, etc.), intermediates, transport proteins, membrane proteins (channels, etc.), etc., but is not limited thereto.

[0061] In one embodiment, the target gene may be, but is not limited to, the NCgl1999 gene (gdh gene or gdhA gene). The NCgl1999 gene may be a gene encoding glutamate dehydrogenase (NADP-specific glutamate dehydrogenase). The nucleotide sequence of the NCgl1999 gene can be confirmed in the known database NCBI Genbank, and may be a gene derived from Corynebacterium sp., and specifically, may be a gene derived from Corynebacterium glutamicum.

[0062]

[0063] Another aspect of the present disclosure provides an expression cassette comprising a polynucleotide of the present disclosure and a gene of interest.

[0064] The polynucleotide and target gene are as described above.

[0065] As used herein, the term "expression cassette" refers to a unit cassette that includes a promoter and a target gene operably linked thereto, thereby enabling expression of the target gene downstream of the promoter. Various factors that can facilitate efficient expression of the target gene may be included internally or externally in such a gene expression cassette. The gene expression cassette may typically include, but is not limited to, a transcription termination signal, a ribosome binding site, and a translation termination signal in addition to a promoter operably linked to the target gene.

[0066]

[0067] Another aspect of the present disclosure provides a vector comprising a polynucleotide of the present disclosure; the polynucleotide and a target gene operably linked thereto; or the expression cassette.

[0068] The polynucleotide, target gene, and expression cassette are as described above. The vector may include a target gene operably linked to the polynucleotide.

[0069] As used herein, the term "vector" refers to a DNA construct containing a base sequence of a polynucleotide encoding a target protein operably linked to suitable regulatory sequences so as to enable expression of the target protein in a suitable host. The regulatory sequences may include a promoter capable of initiating transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and / or a sequence regulating the termination of transcription and / or translation. After being transformed into a suitable host cell, the vector may be expressed independently of the genome (genome) of the host cell, or may be integrated into the genome of the host cell.

[0070] The vector usable in the present disclosure is not particularly limited as long as it is replicable in a host cell, and may be selected from all commonly used vectors. Examples of commonly used vectors include plasmids, cosmids, viruses, bacteriophages, etc., in a natural or recombinant state. For example, as the vector, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A, etc., can be used as a phage vector or a cosmid vector, and pDZ series, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series, etc., can be used as a plasmid vector. Specifically, examples include, but are not limited to, pDZ, pDC, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pDCM2, and pDC24 vectors.

[0071] The vector usable in the present disclosure may be an expression vector or a vector for insertion into the host cell chromosome. Insertion of the target DNA into the host cell chromosome using the insertion vector may be accomplished by any method known in the art, such as, but not limited to, homologous recombination or the CRISPR system. The vector may further include a selection marker to determine whether the vector is transformed or further whether the target DNA is inserted into the chromosome. The selection marker may be selected from genes that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of a surface protein. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, thereby allowing the selection of transformed cells.

[0072] As used herein, the term "transformation" refers to the introduction of a target polynucleotide into a host cell. The transformed polynucleotide may be integrated into the host cell's chromosome or located extrachromosomally. Furthermore, the polynucleotide may be DNA and / or RNA, and may be introduced in any form as long as it can be functionally introduced into the host cell. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, a genetic construct containing all elements necessary for autonomous expression, or in the form of a vector containing the same.

[0073] The above transformation method includes all methods for introducing the target polynucleotide into a cell, and can be performed by selecting an appropriate standard technique known in the art depending on the host cell. Examples include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.

[0074]

[0075] Another aspect of the present disclosure provides a microorganism (host cell) comprising a polynucleotide of the present disclosure, the polynucleotide and a target gene operably linked thereto, or the expression cassette.

[0076] The polynucleotide, target gene, or expression cassette is as described above.

[0077] In the above microorganism, the polynucleotide may be operably positioned or operably linked to the target gene, and the form may include a polynucleotide in which the existing sequence on the chromosome of the microorganism is modified or mutated, or a case where it is introduced exogenously. In the case of introduction exogenously, the polynucleotide may be inserted into the target site through homologous recombination, inserted into a non-target site by a non-homologous mechanism, or present in the form of a vector such as a plasmid, but is not limited thereto.

[0078] The polynucleotide, the polynucleotide and the target gene operably linked thereto, or the expression cassette may be introduced into a microorganism by transformation, but is not limited thereto.

[0079] In this disclosure, the term “microorganism” includes both wild-type microorganisms and microorganisms that have undergone genetic modification, either naturally or artificially, and is also a concept that includes microorganisms whose specific mechanisms are weakened or strengthened due to causes such as the insertion of external genes or the strengthening or weakening of the activity of endogenous genes.

[0080] The above microorganism may be a microorganism that naturally expresses a target gene or a microorganism that has the ability to produce a target product, or a microorganism that does not naturally express a target gene or a microorganism that has been given the ability to express a target gene or produce a target product to a parent strain that does not have the ability to produce a target product, but is not limited thereto. In one embodiment, the microorganism may be a microorganism that naturally produces an amino acid, specifically, produces L-histidine.

[0081] In the present disclosure, the term "target product" refers to a biologically active substance to be produced or the production of which is to be controlled (increased or decreased) using a polynucleotide provided in the present disclosure, the polynucleotide and a target gene operably linked thereto, an expression cassette comprising the polynucleotide and the target gene, a vector comprising the same, and / or a microorganism comprising the same, and is a concept that includes not only the biologically active substance to be ultimately produced but also the target protein that the microorganism can produce. For example, it may refer to the target protein itself encoded by the target gene, and / or all biologically active substances produced with the participation of the target protein.The above biologically active substance means all substances produced or derived from an organism (e.g., a cell) or having a certain function in a living body or in a cell, for example, amino acids (glycine, alanine, valine, leucine, isoleucine, threonine, serine, cysteine, glutamine, methionine, aspartic acid, asparagine, glutamic acid, lysine, arginine, histidine, phenylalanine, tyrosine, tryptophan, proline, O-acetyl homoserine, etc.), nucleic acids, vitamins (vitamins A, B (B1, B2, B3, B5, B6, B7, B9, B12, etc.), C, D, E, K, etc.), proteins (the target protein or other proteins, for example, hormones, growth factors, cytokines, immunoglobulins (antibodies), antigen proteins, receptors, ligands, functional fragments thereof (fragments having a target function), fusion proteins in which two or more are fused, etc.). Sugars (e.g., monosaccharides, disaccharides, polysaccharides, sugar alcohols, etc.), fatty acids (myristoleic acid, palitoleic acid, sapienic acid, oleic acid, elaidic acid, vaccenic acid, linoleic acid, linolenic acid, arachidonic acid, eicosapentaenoic acid (EPA), erucic acid, docosahexaenoic acid (DHA), etc.), organic acids (lactic acid, citric acid, oxalic acid, uric acid, butyric acid, stearic acid, propionic acid, etc.), etc., may be included in the target product, but are not limited thereto. In addition, if it is a substance produced by the target protein, in addition to the above substances, metabolites thereof (e.g., polyhydroxyalkanoates (PHAs), precursors thereof, derivatives thereof that maintain biological activity thereof, etc. may also be included in the target product.

[0082] The microorganism of the present disclosure may include, without limitation, any microorganism into which the polynucleotide of the present disclosure is introduced and which can operate as a promoter.

[0083] In one embodiment, the microorganism may be, but is not limited to, a microorganism of the genus Corynebacterium sp., a microorganism of the genus Escherichia sp., or a microorganism of the genus Bacillus sp.

[0084] Specifically, the microorganism may be a microorganism of the genus Corynebacterium, and more specifically, may include, but is not limited to, Corynebacterium glutamicum, Corynebacterium stationis, Corynebacterium thermoaminogenes, Corynebacterium glutamicum, Brevibacterium flavum, Brevibacterium lactofermentum, and strains prepared therefrom. Specifically, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.

[0085] In one embodiment, the microorganism may be, but is not limited to, Corynebacterium glutamicum in which a mutation has been introduced into the promoter of the NCgl1999 gene (gdh gene).

[0086]

[0087] In one embodiment, a microorganism comprising a polynucleotide of the present disclosure and a target gene operably linked thereto may be a microorganism having increased ability to produce amino acids as a target product, and specifically, may be a microorganism having increased ability to produce L-histidine. The microorganism having increased ability to produce L-histidine may be a microorganism having increased ability to produce L-histidine compared to a microorganism that does not include the polynucleotide of the present disclosure or an unmodified microorganism, for example, a microorganism in which expression of the NCgl1999 gene (gdh gene) is regulated by the polynucleotide before introduction of a mutation, but is not limited thereto. The polynucleotide before introduction of the mutation may be a wild-type polynucleotide, and specifically, may be composed of a nucleotide sequence of SEQ ID NO: 311.

[0088] In the present disclosure, the term "unmodified microorganism" does not exclude a strain that contains a mutation that may occur naturally in a microorganism, and may refer to a wild-type strain or a natural strain itself, or a strain before its characteristics are changed by genetic mutation caused by natural or artificial factors. For example, the unmodified microorganism may refer to a strain in which a mutant polynucleotide is not introduced or is introduced before the promoter region of the NCgl1999 gene (gdh gene) described in the present disclosure. The term "unmodified microorganism" may be used interchangeably with "pre-modified strain," "pre-modified microorganism," "unmutated strain," "unmodified microorganism," or "reference microorganism."

[0089] In the present disclosure, the microorganism (unmodified microorganism) as the host cell may be (1) a microorganism that naturally has L-histidine production ability, (2) a microorganism that naturally has no or significantly low L-histidine production ability, and / or (3) a microorganism in which a mutation is introduced (transformed) into the microorganism that naturally has L-histidine production ability or the microorganism that has no or significantly low L-histidine production ability, thereby making it have L-histidine production ability or improved L-histidine production ability. In one specific example, the microorganism as the host cell may be, but is not limited to, CJ-HIS1, CJ-HIS2, CJ-HIS3, CJ-HIS4, CJ-HIS5, or CJ-HIS6.

[0090] In one specific example, the microorganism (mutant microorganism or microorganism as a host cell) may be, but is not limited to, a microorganism whose biosynthetic pathway of L-histidine has been additionally strengthened to increase the production of L-histidine.

[0091] In one specific example, the microorganism (mutant microorganism or microorganism as a host cell) may be one in which the feedback inhibition of HisG is released.

[0092] In the present disclosure, the term 'feedback inhibition release' may mean that the activity of a polypeptide, protein or enzyme is increased or enhanced compared to its intrinsic activity, or that the activity is not inhibited compared to its intrinsic activity.

[0093] The above "HisG" is also called "ATP phosphoribosyltransferase" and refers to an enzyme involved in the histidine synthesis pathway. The histidine synthesis pathway consists of a total of 9 enzymes (HisG-HisE-HisI-HisA-HisH-HisB-HisC-HisN-HisD), and the above HisG constitutes step 1 of them. The amino acid sequence of the above HisG can be obtained from the known database, NCBI's GenBank, or the Republic of Korea Patent No. 10-2028554 (SEQ ID NO. 16 of the above patent).

[0094] More specifically, the release of the feedback inhibition of HisG may be achieved by substituting the 233rd and 235th amino acids of the HisG amino acid sequence represented by SEQ ID NO: 16 of the Korean Patent Registration No. 10-2028554 with histidine (H) and glutamine (Q), respectively, but is not limited thereto.

[0095] In one specific example, the microorganism (mutant microorganism or microorganism as a host cell) may have enhanced activity of the hisE gene present within an operon such as hisG.

[0096] More specifically, the above activity enhancement may be due to, but is not limited to, a substitution of the initiation codon of the hisE gene from GTG to ATG.

[0097] The above hisE gene is a gene encoding HisE, and the HisE is a protein also called "Phosphoribosyl-ATP pyrophosphatase", which means an enzyme involved in the histidine synthesis pathway that synthesizes L-histidine from 5-phospho-alpha-D-ribose 1-diphosphate. The amino acid sequence of the HisE can be obtained from the NCBI's GenBank, a known database.

[0098] In one specific example, the microorganism (mutant microorganism or microorganism as a host cell) may have enhanced activity of one or more genes selected from the group consisting of hisN, hisH, hisD, hisA, and hisB.

[0099] More specifically, the enhancement of the activity may be, but is not limited to, by replacing the wild-type promoter of the gene with a strong promoter (e.g., Pcj7 (US Patent Publication No. US 7662943 B), Pspl13 promoter (Korean Patent No. 10-1783170), etc.).

[0100] The above hisN gene is a gene encoding HisN, and the HisN is a protein also called “histidinol-phosphate phosphatase”, which is an enzyme involved in the histidine synthesis pathway.

[0101] The above hisH gene is a gene encoding HisH, and the HisH is a protein also called “glutaminase subunit of IGP synthase” and is an enzyme involved in the histidine synthesis pathway.

[0102] The above hisD gene is a gene encoding HisD, and the HisD is a protein also called “histidinol dehydrogenase”, which is an enzyme involved in the histidine synthesis pathway.

[0103] The above hisA gene is a gene encoding HisA, and HisA is a protein also called “5′ProFAR isomerase”, which is an enzyme involved in the histidine synthesis pathway.

[0104] The above hisB gene is a gene encoding HisB, and HisB is a protein also called “imidazoleglycerol-phosphate dehydratase”, which is an enzyme involved in the histidine synthesis pathway.

[0105] The sequences of the above hisG, hisE, hisN, hisH, hisD, hisA and hisB genes and the amino acid sequences of the proteins they encode can be obtained from the NCBI's GenBank, a known database.

[0106] In one embodiment, the microorganism with increased L-histidine productivity (production amount) of the present disclosure may have an L-histidine productivity (production amount) increased by about 10% or more, about 25% or more, about 50% or more, about 60% or more, about 70% or more, about 75% or more, about 75.5% or more, about 75.75% or more, about 75.8% or more, or about 75.9% or more (the upper limit is not particularly limited, and may be, for example, about 300% or less, about 200% or less, about 100% or less, about 80% or less, or about 77% or less) compared to the parent strain before mutation or the unmodified microorganism, but is not limited thereto. In another embodiment, the microorganism having increased L-histidine productivity (production amount) of the present disclosure may have an L-histidine productivity (production amount) increased by about 1.1 times or more, about 1.25 times or more, about 1.5 times or more, about 1.6 times or more, about 1.7 times or more, about 1.755 times or more, about 1.7575 times or more, about 1.758 times or more, or about 1.759 times or more (the upper limit is not particularly limited, and may be, for example, about 3 times or less, about 2 times or less, about 1.8 times or less, or about 1.77 times or less), but is not limited thereto.

[0107] The term “about” above includes, but is not limited to, a range including ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, ±0.05, ±0.04, ±0.03, ±0.02, ±0.01, etc., and includes all numerical values ​​in a range equal to or similar to the numerical value following the term “about.”

[0108]

[0109] Another aspect of the present disclosure provides a composition for producing L-histidine, comprising at least one selected from the group consisting of a polynucleotide of the present disclosure, a target gene operably linked thereto, an expression cassette, a vector, and a microorganism. The polynucleotide, target gene, expression cassette, vector, and microorganism are as described above.

[0110] In one example, the composition for producing L-histidine may further comprise any suitable excipient commonly used in compositions for producing L-histidine, such excipients may be, for example, but are not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.

[0111]

[0112] Another aspect of the present disclosure provides a use for producing L-histidine, comprising at least one selected from the group consisting of a polynucleotide of the present disclosure, the polynucleotide and a target gene operably linked thereto, the expression cassette, the vector, and the microorganism. The polynucleotide, the target gene, the expression cassette, the vector, and the microorganism are as described above.

[0113]

[0114] According to another aspect of the present disclosure, there is provided a use for producing a composition for producing L-histidine, comprising at least one selected from the group consisting of a polynucleotide of the present disclosure, the polynucleotide and a target gene operably linked thereto, the expression cassette, the vector, and the microorganism. The polynucleotide, the target gene, the expression cassette, the vector, and the microorganism are as described above.

[0115]

[0116] Another aspect of the present disclosure provides a method for producing a target product, comprising the step of culturing a microorganism comprising a polynucleotide of the present disclosure, the polynucleotide and a target gene operably linked thereto, the expression cassette or the vector in a medium.

[0117] The polynucleotide, target gene, expression cassette, vector, microorganism, and target product are as described above.

[0118] In one embodiment, the target product may be an L-amino acid. Specifically, the target product may be L-histidine.

[0119] The above method may further include, after the culturing step, a step of recovering a target product from the cultured microorganism, the culture, or both.

[0120] The term "cultivation" as used herein refers to growing microorganisms under appropriately artificially controlled environmental conditions. The culturing process of the present disclosure can be performed using any suitable medium and culture conditions known in the art. Such culturing process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culturing process may be batch, continuous, and / or fed-batch, but is not limited thereto. Various such methods are disclosed, for example, in "Biochemical Engineering" (James M. Lee, Prentice-Hall International Editions, pp. 138-176, 1991).

[0121] In the present disclosure, the term “medium” refers to a material containing nutrients as a main component necessary for culturing the microorganisms of the present disclosure, and supplies nutrients and growth factors, including water essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganisms of the present disclosure may be any medium used for culturing general microorganisms without particular limitation, but the microorganisms of the present disclosure may be cultured under aerobic conditions while controlling temperature, pH, etc. in a general medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compounds, amino acids, and / or vitamins. Specifically, culture media for microorganisms can be found in literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981)], etc.

[0122] The culture medium must suitably meet the requirements of the specific strain. For example, culture can be performed under aerobic conditions, controlling temperature, pH, etc., in a conventional medium containing appropriate carbon sources, nitrogen sources, amino acids, vitamins, etc. Carbon sources include carbohydrates such as glucose, fructose, and sucrose, and amino acids such as glutamic acid and cysteine. Specifically, natural organic nutrients such as starch hydrolysate and molasses can be used, and carbohydrates such as glucose, fructose, and sterilized pretreated molasses (i.e., molasses converted to reducing sugar) can be used. Other appropriate carbon sources can be used in various amounts without limitation, but are not limited thereto. Nitrogen sources include inorganic nitrogen sources such as ammonia; amino acids such as glutamic acid and cysteine; and organic nitrogen sources such as peptone, meat extract, and yeast extract. These nitrogen sources can be used alone or in combination, but are not limited thereto. The media may include, but are not limited to, phosphoric acid, potassium dihydrogen phosphate, or dipotassium hydrogen phosphate or their corresponding sodium-containing salts as the personnel. Inorganic compounds may include, but are not limited to, magnesium sulfate, iron sulfate, manganese sulfate, and calcium chloride, and other compounds may include amino acids, vitamins, and appropriate precursors. These media or precursors may be added to the culture in batch or continuous fashion, but are not limited to these.

[0123] During cultivation, compounds such as potassium hydroxide, ammonia, and phosphoric acid can be appropriately added to the culture to adjust the pH of the culture. Furthermore, foaming agents such as fatty acid polyglycol esters can be used to suppress foaming during cultivation. Furthermore, oxygen or an oxygen-containing gas can be injected into the culture to maintain an aerobic state. The culture temperature ranges from 27°C to 37°C, specifically from 30°C to 33°C. The cultivation period can continue until the desired amount of useful substances is obtained, and is typically 20 to 160 hours.

[0124] As used herein, the term "culture" refers to a substance containing a medium in which microorganisms are growing or have completed growth under appropriately artificially controlled environmental conditions. In a narrow sense, the culture does not include the grown microorganisms themselves, but in a broader sense, it may include them. The "culture" may include various target substances released into the medium by the microorganisms during growth, along with medium components formulated for microbial culture.

[0125] In the culture of the present disclosure, the culture temperature may be maintained at 20°C to 45°C, specifically 25°C to 40°C, 25°C to 40°C, 25°C to 37°C, 25°C to 35°C, 27°C to 40°C, 27°C to 37°C, 27°C to 35°C, 30°C to 40°C, 30°C to 37°C, or 30°C to 35°C, and the culture may be performed for about 10 to 160 hours, 20 to 100 hours, 30 to 90 hours, or 50 to 70 hours, but is not limited thereto.

[0126] The target product produced by the culture of the present disclosure may be secreted into the medium or remain within the cells.

[0127] The step of recovering the above target product may be to collect the target product using a suitable method known in the art according to a culture method, such as a batch, continuous or fed-batch culture method. For example, various chromatography methods such as centrifugation, filtration, treatment with a crystallized protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, but is not limited thereto, and the target product may be recovered from a medium or microorganism using a suitable method known in the art.

[0128] Additionally, the method for producing the target product of the present disclosure may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, if the method for producing the target product of the present disclosure includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially (or sequentially) regardless of the order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.

[0129]

[0130] Another aspect of the present disclosure provides a method for increasing the productivity of a target product, comprising the step of culturing a microorganism comprising a polynucleotide of the present disclosure, the polynucleotide and a target gene, or an expression cassette comprising the polynucleotide and the target gene in a medium.

[0131] The polynucleotide, target gene, expression cassette, microorganism, and target product are as described above.

[0132]

[0133] Another aspect of the present disclosure provides a method for producing a microorganism having increased production capacity of a target product, comprising the step of introducing into the microorganism a polynucleotide of the present disclosure, the polynucleotide and a target gene, or an expression cassette comprising the polynucleotide and a target gene.

[0134] The polynucleotide, target gene, expression cassette, microorganism, and target product are as described above.

[0135]

[0136] In another aspect of the present disclosure, the present disclosure provides a composition, method, product, process, or use characterized by one or more elements disclosed in the present disclosure.

[0137]

[0138] The present disclosure relates to a novel polynucleotide having promoter activity and a method for producing L-histidine using the same. Since a microorganism into which the novel polynucleotide of the present disclosure is introduced has a significantly increased ability to produce L-histidine, the novel polynucleotide can be usefully utilized for efficiently producing L-histidine.

[0139]

[0140] Hereinafter, the present disclosure will be described in more detail through examples. These examples are intended solely to more specifically illustrate the present disclosure, and it will be apparent to those skilled in the art that the scope of the present disclosure is not limited by these examples, in accordance with the gist of the present disclosure.

[0141]

[0142] Example

[0143]

[0144] (Throughout this disclosure, "%" used to indicate the concentration of a particular substance, unless otherwise stated, is (weight / weight) % for solid / solid, (weight / volume) % for solid / liquid, and (volume / volume) % for liquid / liquid.)

[0145]

[0146] Example 1: Production of L-histidine-producing microorganisms

[0147] Example 1-1. Production of a histidine-producing strain with resolved feedback limitations.

[0148] To relieve feedback inhibition of HisG, the first enzyme in the L-histidine biosynthetic pathway, a mutant HisG (G233H, T235Q) (ACS Synth. Biol., 2014, 3 (1), pp 21-29) was introduced into a strain of Corynebacterium spp., and the initiation codon was substituted from GTG to ATG to enhance the activity of the hisE gene, which is located in the same operon as hisG.

[0149] Specifically, using the genomic DNA of the Corynebacterium glutamicum ATCC13032 strain as a template, the left homology fragment of 'hisE(g1a)G(G233H / T235Q)' was obtained by PCR using the primer pair of SEQ ID NO: 1 and SEQ ID NO: 2, and the right homology fragment of 'hisE(g1a)G(G233H / T235Q)' was obtained by PCR using the primer pair of SEQ ID NO: 3 and SEQ ID NO: 4.

[0150] PCR reactions were performed using SolgTM Pfu-X DNA polymerase, with the following conditions: denaturation at 95°C for 5 minutes, 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, polymerization at 72°C for 60 seconds, and then polymerization at 72°C for 5 minutes.

[0151] Using the two amplified DNA fragments as templates, PCR was performed in the same manner as above using the primer pairs of SEQ ID NO: 1 and SEQ ID NO: 4 to obtain the 'hisE(g1a)G(G233H / T235Q)' gene fragment. In addition, PCR was performed using the genomic DNA of the Corynebacterium glutamicum ATCC13032 strain as a template using the primer pairs of SEQ ID NO: 5 and SEQ ID NO: 6 to obtain the upstream region of the hisE gene.

[0152] To replace the strong promoter, PCR was performed in the same manner as above using the synthetic promoter Pspl13 promoter (Korean Patent No. 10-1783170) as a template and the primer pair of SEQ ID NO: 7 and SEQ ID NO: 8.

[0153] The gene fragment obtained through the above process was cloned into the pDC24 vector (KR 10-2024-0167588 A) digested with SmaI restriction enzyme using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) by mixing the Gibson assembly reagent and each gene fragment in the calculated molar number and then storing at 50°C for 1 hour. The constructed recombinant plasmid was named pDC24ΔPn_hisEG::Pspl13_hisEG(G233H / T235Q).

[0154] The constructed pDC24ΔPn_hisEG::Pspl13_hisEG(G233H / T235Q) vector was transformed into Corynebacterium glutamicum ATCC13032 strain by electroporation (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999), and then a second crossover process was performed to introduce mutations into the existing hisG gene, thereby eliminating feedback restriction, and a strain with enhanced hisE activity was obtained by substituting the start codon of the hisE gene. In addition, the genetic manipulation was confirmed through PCR using the primer pairs of SEQ ID NOs: 9 and 10 and genome sequencing. The transformed strain obtained above was named CJ-HIS1.

[0155] The primer sequences used at this time are as shown in Table 1 below.

[0156] SEQ ID NO: Sequence (5' → 3')1gaggagatcaaaacaATGAAGACATTTGAC2AGTGGGGATACCTGTGGGTGGGATAAGCCT3GGCTTATCCCACCCACAGGTATCCCCACTG4ACTCTAGAGGATCCCCCTAGATGCGGGC5TCGAGCTCGGTACCCACCGAA CTCCTGACAGAGT6acatgaagcgccTCGGTACATTCTTCCACA7AAGAATGTACCGAggcgcttcatgtcaaca8CAAATGTCTTCATtgttttgatctcctcca9AGCTTTTCGACGAATCCC10CTGCCTCTCACAAGTTGAAG

[0157]

[0158] Example 1-2. Production of a histidine-producing strain with an enhanced biosynthetic pathway through promoter replacement.

[0159] Next, in order to enhance the activity of the biosynthetic genes hisN, hisH, hisD, hisA, and hisB, the wild-type promoter of each gene was replaced with a strong promoter, and for this purpose, a plasmid was constructed as follows.

[0160] Specifically, PCR was performed in the same manner as in Example 1-1 using the genomic DNA of the Corynebacterium glutamicum ATCC13032 strain as a template and the primer pairs of SEQ ID NO: 11 and SEQ ID NO: 12; SEQ ID NO: 13 and SEQ ID NO: 14; SEQ ID NO: 15 and SEQ ID NO: 16; SEQ ID NO: 17 and SEQ ID NO: 18; and SEQ ID NO: 19 and SEQ ID NO: 20, thereby obtaining upstream fragments of the hisN, hisH, hisD, hisA, and hisB genes.

[0161] In addition, using the genomic DNA of the Corynebacterium glutamicum ATCC13032 strain as a template, downstream fragments of the hisN, hisH, hisD, hisA, and hisB genes were obtained using primer pairs of SEQ ID NO: 21 and SEQ ID NO: 22; SEQ ID NO: 23 and SEQ ID NO: 24; SEQ ID NO: 25 and SEQ ID NO: 26; SEQ ID NO: 27 and SEQ ID NO: 28; and SEQ ID NO: 29 and SEQ ID NO: 30, respectively.

[0162] To replace the endogenous promoters of the hisN, hisH, and hisD genes with the strong promoter Pcj7 (US Patent Publication No. US 7662943 B), PCR was performed in the same manner as above using the genomic DNA of the Corynebacterium ammoniagenes strain as a template and the primer pairs of SEQ ID NO: 31 and SEQ ID NO: 32; SEQ ID NO: 33 and SEQ ID NO: 34; and SEQ ID NO: 35 and SEQ ID NO: 36.

[0163] In addition, in order to replace the endogenous promoters of the hisA and hisB genes with the strong promoter Pspl13, PCR was performed in the same manner as above using the primer pairs of SEQ ID NO: 37 and SEQ ID NO: 38; SEQ ID NO: 39 and SEQ ID NO: 40 using the Pspl13 promoter as a template.

[0164] After treating the pDC24 vector with the restriction enzyme SmaI, the amplified hisN, hisH, and hisD gene upstream DNA fragments, the Pcj7 promoter fragment, and the hisN, hisH, and hisD gene downstream DNA fragments were cloned using the Gibson assembly method to obtain recombinant plasmids, which were named pDC24ΔPn::Pcj7_hisN, pDC24ΔPn::Pcj7_hisH, and pDC24ΔPn::Pcj7_hisD.

[0165] In addition, after treating the pDC24 vector with the restriction enzyme SmaⅠ, the amplified upstream DNA fragments of the hisA and hisB genes, the Pspl13 promoter fragment, and the downstream DNA fragments of the hisA and hisB genes were cloned using the Gibson assembly method to obtain recombinant plasmids, which were named pDC24ΔPn::Pspl13_hisA and pDC24ΔPn::Pspl13_hisB. Gibson cloning was performed in the same manner as in Example 1-1.

[0166] The constructed pDC24ΔPn::Pcj7_hisN vector was transformed into the CJ-HIS1 strain constructed in Example 1-1 by electroporation, and then a second crossover process was performed to replace the promoter in the existing hisN gene, thereby obtaining a strain with an enhanced gene. Then, the genetic manipulation was confirmed through PCR using the primer pair of SEQ ID NO: 41 and SEQ ID NO: 42 and genome sequencing. The strain thus obtained was named CJ-HIS2.

[0167] Next, the constructed pDC24ΔPn::Pcj7_hisH vector was transformed into the constructed CJ-HIS2 strain by electroporation, and then a second crossover process was performed to replace the promoter of the existing hisH gene, thereby obtaining a strain with an enhanced gene. Then, the genetic manipulation was confirmed through PCR using the primer pair of SEQ ID NO: 43 and SEQ ID NO: 44 and genome sequencing. The strain thus obtained was named CJ-HIS3.

[0168] Next, the constructed pDC24ΔPn::Pcj7_hisD vector was transformed into the constructed CJ-HIS3 strain by electroporation, and then a second crossover process was performed to replace the promoter of the existing hisD gene, thereby obtaining a strain with an enhanced gene. Then, the genetic manipulation was confirmed through PCR using the primer pair of SEQ ID NO: 45 and SEQ ID NO: 46 and genome sequencing. The strain thus obtained was named CJ-HIS4.

[0169] Next, the constructed pDC24ΔPn::Pspl13_hisA vector was transformed into the constructed CJ-HIS4 strain by electroporation, and a second crossover process was performed to replace the promoter of the existing hisA gene, thereby obtaining a strain with an enhanced gene. Then, the genetic manipulation was confirmed through PCR using the primer pair of SEQ ID NO: 47 and SEQ ID NO: 48 and genome sequencing. The strain thus obtained was named CJ-HIS5.

[0170] Next, the constructed pDC24ΔPn::Pspl13_hisB vector was transformed into the constructed CJ-HIS5 strain by electroporation, and a second crossover process was performed to replace the promoter of the existing hisB gene, thereby obtaining a strain with an enhanced gene. Then, the genetic manipulation was confirmed through PCR using the primer pair of SEQ ID NO: 49 and SEQ ID NO: 50 and genome sequencing. The strain thus obtained was named CJ-HIS6. The primer sequences used at this time are as follows in Table 2.

[0171]

[0172]

[0173]

[0174] Example 1-3. Production of a histidine-producing strain with an enhanced biosynthetic pathway through additional gene insertion.

[0175] Next, in order to additionally insert the 'hisE(g1a)G(G233H / T235Q)' gene and hisD gene, NCgl1021, known as a gene encoding a transposon in a Corynebacterium glutamicum strain, was used as an insertion site. Specifically, in order to construct a NCgl1021 deletion and target gene insertion vector, PCR was performed in the same manner as in Example 1-1 using the genomic DNA of the Corynebacterium glutamicum ATCC13032 strain as a template and the primer pairs of SEQ ID NO: 51 and SEQ ID NO: 52; SEQ ID NO: 53 and SEQ ID NO: 54, and the left homologous arm region of NCgl1021 and the right homologous arm region of NCgl1021 were amplified.

[0176] PCR was performed in the same manner as above using the vector pDC24ΔPn::Pspl13_hisEG(G233H / T235Q) produced in the above Example 1-1 as a template and the primer pair of SEQ ID NO: 55 and SEQ ID NO: 56, and the 'Pspl13_hisE(g1a)G(G233H / T235Q)' gene fragment was obtained.

[0177] In addition, PCR was performed in the same manner as above using the vector pDC24ΔPn::Pcj7_hisD produced in Example 1-2 as a template and the primer pair of SEQ ID NO: 57 and SEQ ID NO: 58, and the 'Pcj7_hisD' gene fragment was obtained.

[0178] After treating the pDC24 vector with the restriction enzyme SmaⅠ, the amplified left homology arm of NCgl1021, the right homology arm of NCgl1021, 'Pspl13_hisEG(G233H / T235Q)' and 'Pcj7_hisD' gene fragments were cloned using the Gibson assembly method to obtain a recombinant plasmid, which was named 'pDC24ΔNCgl1021::Pspl13_hisEG(G233H / T235Q)- Pcj7_hisD'. Gibson cloning was performed in the same manner as in Example 1-1.

[0179] The constructed 'pDC24ΔNCgl1021::Pspl13_hisEG(G233H / T235Q)-Pcj7_hisD' vector was transformed into the CJ-HIS6 strain constructed in Example 1-2 by electroporation, and then a secondary crossing process was performed to obtain a strain with an enhanced histidine biosynthetic pathway through additional gene insertion. Then, the genetic manipulation was confirmed through PCR using the primer pair of SEQ ID NO: 59 and SEQ ID NO: 60 and genome sequencing. The primer sequences used at this time are as follows in Table 3.

[0180] SEQ ID NO: Sequence (5' → 3')51TTCGAGCTCGGTACCCATGAAGTCTACCGGC52gacatgaagcgccGACATCTAATAACCGGG53CCGACGAGGCCTAAGAACTCATTCCTTCTGCT54CTCTAGAGGATCCCCTTAGAGTGCATTGATC55CCGGTTATTAG ATGTCggcgcttcatgtca56ggatgtttctCTAGATGCGGGCGAT57GCCCGCATCTAGagaaacatcccagcgct58AGAAGGAATGAGTTCTTAGGCCTCGTCGG59CTTTCAGCTTTCCCTCCCG60GCTGTACTTTTAGTACA

[0181] The transformed strain obtained above was named CJH1.

[0182]

[0183] Example 2: Selection of mutant strains with increased histidine production through artificial mutation.

[0184] Example 2-1: Random mutagenesis through UV irradiation

[0185] To select mutant strains with increased histidine production, the histidine-producing strain CJH1 was spread on a nutrient medium containing agar and cultured at 30°C for 16 hours. The colonies thus obtained were irradiated with UV (Ultraviolet mutation) at room temperature to induce random mutations in the strain genome.

[0186] Nutrient medium (pH 7.2)

[0187] 10g glucose, 5g meat extract, 10g polypeptone, 2.5g sodium chloride, 5g yeast extract, 20g agar, 2g urea (per 1 liter of distilled water)

[0188]

[0189] Example 2-2: Selection of strains with improved L-histidine production

[0190] To select mutant strains with increased histidine production compared to the parent strain CJH1, the CJH1 strain and mutant strains in which random mutations were induced were cultured using the following method.

[0191] The strains were inoculated into 96-Deep Well Plate-Dome (Bioneer) containing 400 μl of seed medium each and cultured in a plate shaking incubator (TAITEC) at 32°C and 1200 rpm for approximately 48 hours. The histidine concentrations of approximately 3,000 cultured strains were individually confirmed using a near-infrared (NIR) spectrophotometer, and the top five mutant strains with enhanced histidine production compared to the parent strain CJH1 were selected.

[0192] To select the strains with reproducibly increased L-histidine production ability among the five selected mutant strains, the parent strain and the mutant strains were inoculated into a 250 mL corner-bottom flask containing 25 mL of histidine production medium, and then cultured with shaking at 200 rpm at 30°C for 48 hours. The composition of the medium used at this time is as follows.

[0193] <Seed medium (pH 7.0)>

[0194] 50 g glucose, 10 g peptone, 10 g yeast extract, 4 g urea, 2.5 g sodium chloride (per 1 liter of distilled water)

[0195] <Production medium (pH 7.2)>

[0196] 6% raw sugar, 2% ammonium sulfate, 0.1% monobasic potassium phosphate, 0.05% magnesium sulfate heptahydrate, 2.0% CSL (corn steep liquor), 200 μg / L biotin, 30 g / L calcium carbonate (based on 1 liter of distilled water)

[0197] After the culture was completed, the L-histidine concentration in the culture solution was analyzed using HPLC, and the L-histidine production concentration of each mutant strain is shown in Table 4 below.

[0198] Strain name L-histidine (g / L) CJH13.8 CJH1_mt14.1 CJH1_mt25.3 CJH1_mt35.2 CJH1_mt46.8 CJH1_mt54.7

[0199] Among the five selected mutant strains, strain CJH1_mt4, which showed the greatest increase in L-histidine production compared to CJH1, was finally selected.

[0200]

[0201] Example 3: Mutation Identification through Whole-Genome Sequencing (WGS)

[0202] Whole-genome sequencing (WGS) was performed on the CJH1_mt4 strain selected in the above Example 2-2 to analyze the sequence, and by comparing it with the parent strain CJH1, the location where mutations occurred in the base sequence was identified, and each substitution type is indicated in Tables 5 to 7 below.

[0203]

[0204]

[0205]

[0206] tRNA, rRNA region mutations TYPE gene ID variant sequence rRNANCg1r02 SEQ ID NO: 118 rRNANCg1r04 SEQ ID NO: 119 rRNANCg1r05 SEQ ID NO: 120 rRNANCg1r08 SEQ ID NO: 121 rRNANCg1r09 SEQ ID NO: 122 tRNANCg1t33 SEQ ID NO: 123 rRNANCg1r12 SEQ ID NO: 124 rRNANCg1r16 SEQ ID NO: 125 rRNANCg1r19 SEQ ID NO: 126

[0207] In the following examples, the effect of each of the mutants in Tables 5 to 7 on the L-histidine production ability of a Corynebacterium genus microorganism was evaluated to identify effective factors affecting the L-histidine production ability.

[0208]

[0209] Example 4: Evaluation of histidine production ability of L-histidine producing strains into which mutant genes and promoters have been introduced.

[0210] Example 4-1: Production of a recombinant vector for introducing mutant genes and promoters.

[0211] In order to confirm the effect of the mutant identified in Example 3 above, a vector capable of introducing it onto a chromosome was created.

[0212] Specifically, NCgl0206, NCgl0337, NCgl0338, NCgl0627, NCgl0686, NCgl0706, NCgl1062, NCgl1063, NCgl1147, NCgl1165, NCgl1205, NCgl1432, NCgl1588, NCgl1858, NCgl1859, NCgl1874, NCgl2384, NCgl2420, NCgl2561, NCgl2628, NCg1r02, NCg1r04, NCg1r05, NCg1r08, NCg1r09, NCg1t33, NCg1r12, NCg1r16, NCg1r19 gene mutations and Ncgl0295, To insert each mutant promoter of the Ncgl0355, Ncgl0780, NCg1r04, NCg1r08, NCg1r09, Ncgl1855, Ncgl1876, Ncgl1969, NCgl1999, NCgl2000, Ncgl2132, NCg1r15, NCg1r18, NCgl2845, NCgl2917, and NCgl2993 genes into CJH1, a vector containing the target mutation was constructed.

[0213] Specifically, the genomic DNA of the CJH1_mt4 strain was extracted using a G-spin Total DNA Extraction Mini Kit (Intron, Cat. No. 17045) according to the protocol provided in the kit, and PCR was performed using the genomic DNA as a template. PCR was performed using the same method as in Example 1-1, and the primer sequences used are as shown in Table 8 below.

[0214]

[0215]

[0216]

[0217] The obtained mutation introduction fragment and pDC24 treated with the restriction enzyme smaI were cloned using the Gibson assembly method to obtain a recombinant plasmid, and the vectors PDC24-NCgl0206*, PDC24-NCgl0337*, PDC24-NCgl0338*, PDC24-NCgl0627*, PDC24-NCgl0686*, PDC24-NCgl0706*, PDC24-NCgl1062*, PDC24-NCgl1063*, PDC24-NCgl1147*, PDC24-NCgl1165*, PDC24-NCgl1205*, PDC24-NCgl1432*, PDC24-NCgl1588*, PDC24-NCgl1858*, containing each mutation introduction fragment, PDC24-NCgl1859*, PDC24-NCgl1874*, PDC24-NCgl2384*, PDC24-NCgl2420*, PDC24-NCgl2561*, PDC24-NCgl2628*, PDC24-NCg1r02*, PDC24-NCg1r04*, PDC24-NCg1r05*, PDC24-NCg1r08*, PDC24-NCg1r09*, PDC24-NCg1t33*, PDC24-NCg1r12*, PDC24-NCg1r16*, PDC24-NCg1r19*, PDC24-PNcgl0295*, PDC24-PNcgl0355*, PDC24-PNcgl0780*, PDC24-PNCg1r04*, PDC24-PNCg1r08*, PDC24-PNCg1r09*, PDC24-PNcgl1855*, PDC24-PNcgl1876*, PDC24-PNcgl1969*, PDC24-PNCgl1999*, PDC24-PNCgl2000*, They were named PDC24-PNcgl2132*, PDC24-PNCg1r15*, PDC24-PNCg1r18*, PDC24-PNCgl2845*, PDC24-PNCgl2917*, and PDC24-PNCgl2993*.

[0218]

[0219] Example 4-2: Production of an L-histidine-producing strain with a mutant gene and promoter introduced.

[0220] The 46 vectors produced in Example 4-1 were transformed into the histidine-producing strain CJH1 by electroporation (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999), and strains in which the vectors were inserted into the chromosome by recombination of homologous sequences were selected on kanamycin medium. Thereafter, strains into which mutant genes were introduced were confirmed by PCR using the primer pairs in Table 9 for transformants that had completed the secondary recombination. PCR was performed in the same manner as in Example 1-1.

[0221]

[0222]

[0223]

[0224] The recombinant strains produced by the above process were CJH1△NCgl0206::NCgl0206*, CJH1△NCgl0337::NCgl0337*, CJH1△NCgl0338::NCgl0338*, CJH1△NCgl0627::NCgl0627*, CJH1△NCgl0686::NCgl0686*, CJH1△NCgl0706::NCgl0706*, CJH1△NCgl1062::NCgl1062*, CJH1△NCgl1063::NCgl1063*, CJH1△NCgl1147::NCgl1147*, CJH1△NCgl1165::NCgl1165*, CJH1△NCgl1205::NCgl1205*, CJH1△NCgl1432::NCgl1432*, CJH1△NCgl1588::NCgl1588*, CJH1△NCgl1858::NCgl1858*, CJH1△NCgl1859::NCgl1859*, CJH1△NCgl1874::NCgl1874*, CJH1△NCgl2384::NCgl2384*, CJH1△NCgl2420::NCgl2420*, CJH1△NCgl2561::NCgl2561*, CJH1△NCgl2628::NCgl2628*, CJH1△PNcgl0295::PNcgl0295*, CJH1△PNcgl0355::PNcgl0355*, CJH1△PNcgl0780::PNcgl0780*, CJH1△PNCg1r04::PNCg1r04*, CJH1△PNCg1r08::PNCg1r08*, CJH1△PNCg1r09::PNCg1r09*, CJH1△PNcgl1855::PNcgl1855*, CJH1△PNcgl1876::PNcgl1876*, CJH1△PNcgl1969::PNcgl1969*, CJH1△PNcgl1999::PNcgl1999*, CJH1△PNcgl2000::PNcgl2000*, CJH1△PNcgl2132::PNcgl2132*, CJH1△PNCg1r15::PNCg1r15*, CJH1△PNCg1r18::PNCg1r18*, CJH1△PNcgl2845::PNcgl2845*, CJH1△PNcgl2917::PNcgl2917*,They were named CJH1△PNcgl2993::PNcgl2993*, CJH1△NCg1r02::NCg1r02*, CJH1△NCg1r04::NCg1r04*, CJH1△NCg1r05::NCg1r05*, CJH1△NCg1r08::NCg1r08*, CJH1△NCg1r09::NCg1r09*, CJH1△NCg1t33::NCg1t33*, CJH1△NCg1r12::NCg1r12*, CJH1△NCg1r16::NCg1r16*, CJH1△NCg1r19::NCg1r19*.

[0225]

[0226] Example 4-3: Evaluation of histidine production ability of L-histidine producing strains into which mutant genes and promoters have been introduced.

[0227] In order to confirm the L-histidine production ability of the 46 recombinant strains produced in Example 4-2 above, a 12-well plate evaluation was conducted using the following method.

[0228] First, the strain was inoculated into a 2 ml 96-Deep Well Plate containing 0.35 ml of seed medium, sealed with a breathable cover, and cultured at 33°C for 20 hours with shaking at 950 rpm. Then, 0.02 ml of the seed culture was inoculated into a 10 ml 12-Deep Well Plate containing 0.4 ml of production medium, sealed with a breathable cover, and cultured at 33°C for 48 hours with shaking at 950 rpm. The compositions of the seed medium and production medium are as follows.

[0229] <Seed medium (pH 7.2)>

[0230] 50 g glucose, 10 g peptone, 10 g yeast extract, 4 g urea, 2.5 g sodium chloride (per 1 liter of distilled water)

[0231] <Production medium (pH 7.2)>

[0232] Glucose 60 g, ammonium sulfate 55 g, monobasic potassium phosphate 1.1 g, magnesium sulfate heptahydrate 1.2 g, copper sulfate pentahydrate 0.9 mg, iron sulfate pentahydrate 18 mg, manganese sulfate pentahydrate 18 mg, zinc sulfate pentahydrate 0.9 mg, biotin 1.8 mg, thiamine-HCl 9 mg, calcium pantothenate 9 mg, nicotinamide 60 mg, calcium carbonate 30 g, yeast extract 3 g (per 1 liter of distilled water)

[0233]

[0234] The above experiment was repeated twice, and after the culture was completed, L-histidine production was measured using high-performance liquid chromatography (HPLC). The average results of the analysis are shown in Table 10 below.

[0235]

[0236]

[0237] As a result, it was confirmed that most of the histidine-producing strains into which the mutant polynucleotide was introduced had histidine production ability equivalent to or superior to that of the parent strain. In particular, it was confirmed that CJH1△PNcgl1999::PNcgl1999* showed a marked increase in histidine production ability compared to the parent strain CJH1.

[0238] From the above description, those skilled in the art will understand that the present disclosure can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present disclosure should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.

Claims

A polynucleotide comprising a nucleotide sequence in which the nucleotide at the 7th position in the nucleotide sequence of SEQ ID NO: 311 is substituted with thymine (T), the nucleotide at the 8th position with guanine (G), the nucleotide at the 11th position with guanine (G), the nucleotide at the 12th position with thymine (T), the nucleotide at the 16th position with cytosine (C), the nucleotide at the 46th position with thymine (T), the nucleotide at the 241st position with guanine (G), and the nucleotide at the 258th position with adenine (A). In claim 1, the polynucleotide has promoter activity. In claim 1, the polynucleotide has a sequence identity of 80% or more and less than 100% with the nucleotide sequence of SEQ ID NO:

311. In claim 1, the polynucleotide comprises a nucleotide sequence of SEQ ID NO:

110. An expression cassette comprising the polynucleotide of claim 1 and the target gene. Corynebacterium sp. comprising a polynucleotide of any one of claims 1 to 4 or the polynucleotide and a target gene operably linked thereto microorganism. In claim 6, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum. A method for producing L-histidine, comprising the step of culturing the microorganism of claim 6 in a medium. A method for producing L-histidine, wherein the method further comprises a step of recovering L-histidine from a cultured medium or microorganism in claim 8. Use of the microorganism of claim 6 or 7 for producing L-histidine.

Images