Novel recombinant vibrio sp. DHG strain that produces itaconic acid from brown algae, and method for producing itaconic acid by using same

Abstract

The present invention relates to a novel recombinant vibrio sp. DHG strain that produces itaconic acid from brown algae, and a method for producing itaconic acid by using same. A recombinant microorganism according to an embodiment of the present invention can produce itaconic acid by using alginic acid and mannitol, and can also produce itaconic acid even if directly added without a pretreatment process of brown algae. Therefore, an eco-friendly, low-cost, and high-yield production process of itaconic acid can be developed and be variously used in industrial fields such as those of synthetic resins, latex, and food additives.

Description

A novel recombinant Vibrio sp. DHG strain producing itaconic acid from brown algae and a method for producing itaconic acid using the same

[0001] The present invention relates to a recombinant microorganism producing itaconic acid, and more particularly, to a novel recombinant Vibrio sp. DHG strain producing itaconic acid from brown algae and a method for producing itaconic acid using the same.

[0002] Itaconic acid, a type of platform compound, is a five-carbon dicarboxylic acid. Its structural properties make it an industrially useful precursor for the synthesis of polymers such as plastics and latex. Due to this potential, it was selected as one of the Top 12 bio-based platform chemicals by the United States Department of Energy in 2004.

[0003] Various metabolic engineering approaches for the high-efficiency production of itaconic acid have already been described. Several studies have optimized metabolic pathways for various strains and carbon sources to maximize productivity. Currently, itaconic acid production through microbial fermentation is predominantly achieved using the fungus Aspergillus terreus, which is produced from glucose or sugars harvested from terrestrial plants (such as corn).

[0004] However, the production of itaconic acid using Aspergillus terreus is challenging due to the difficulty in genetically modifying the microorganism, limiting the adoption of effective metabolic engineering techniques. Furthermore, because itaconic acid is produced primarily from sugars derived from sugarcane or corn, both of which are commonly used as food sources, ethical concerns remain a potential source of criticism.

[0005] In addition, even when producing itaconic acid using platform strains such as E. coli or yeast to overcome these limitations, there is a problem in that the cost of the feedstock is the main cause of increasing the overall process and itaconic acid production cost, thereby reducing economic feasibility, as glucose or citric acid are often used as feedstock.

[0006] Accordingly, the inventors of the present invention have completed the present invention by developing a microorganism capable of producing itaconic acid from brown algae in order to solve the problems of the prior art as described above.

[0007] Accordingly, the purpose of the present invention is to provide a recombinant vector for producing itaconic acid comprising a cad gene expression cassette including a cis-aconitate decarboxylase (cad) gene.

[0008] Another object of the present invention is to provide a recombinant microorganism for producing itaconic acid into which the recombinant vector for producing itaconic acid has been introduced.

[0009] Another object of the present invention is to provide a method for producing itaconic acid, which comprises a step of culturing the recombinant microorganism for producing itaconic acid.

[0010] In order to achieve the above purpose, according to one embodiment of the present invention, a recombinant vector for producing itaconic acid is provided, which includes a cad gene expression cassette including a cis-aconitate decarboxylase (cad) gene.

[0011] In one embodiment of the present invention, “itaconic acid” is a dicarboxylic acid consisting of five carbon atoms, and is used as a precursor for the synthesis of polymers such as plastics and latex due to its structural characteristics.

[0012] In one embodiment of the present invention, “cad gene” means a gene expressing cis-aconite decarboxylase derived from Aspergillus terreus, wherein the cis-aconite decarboxylase decarboxylates cis-aconitic acid in the microorganism and converts itaconic acid.

[0013] In one embodiment of the present invention, the cad gene may be a cad gene obtained by codon-optimizing the cad gene derived from Aspergillus terreus (Shin, et al., 2008) to fit the Vibrio genus DHG strain. The codon-optimized cad gene is preferably represented by the base sequence of SEQ ID NO: 1, but is not limited thereto.

[0014] In one embodiment of the present invention, an "expression cassette" refers to a unit cassette that includes a promoter and a gene encoding a target protein, and can be expressed to produce a target protein operably linked downstream from the promoter. Various factors that can aid in the efficient production of the target protein may be included internally or externally within such an expression cassette. Specifically, the target protein expression cassette may be one in which a gene encoding the target protein is operably linked downstream from a promoter sequence.

[0015] The term "operably linked" as described above means that the gene sequence and the promoter sequence are functionally linked so that the nucleic acid sequence having the promoter activity of the present invention initiates and mediates transcription of the gene encoding the target protein. The operable linkage can be produced using genetic recombination techniques known in the art, and site-specific DNA cleavage and ligation can be produced using cleavage and ligation enzymes known in the art, but is not limited thereto.

[0016] In one embodiment of the present invention, the “recombinant gene expression cassette” can be inserted into the chromosome of a host cell and used to produce a recombinant microorganism, and it is obvious to those skilled in the art to which the present invention pertains that inserting the recombinant gene expression cassette into the genomic chromosome of the host cell will have the same effect as introducing the recombinant vector into the host cell as described above.

[0017] A commonly known genetic engineering method can be used as a method for inserting a recombinant gene expression cassette into the chromosome of a host cell, and examples include a method using a retroviral vector, an adenovirus vector, an adeno-associated virus vector, a herpes simplex virus vector, a poxvirus vector, a lentivirus vector, or a non-viral vector.

[0018] In one embodiment of the present invention, a "vector" means a genetic construct comprising a base sequence of a gene operably linked to a suitable regulatory sequence so as to express the target gene in a suitable host, wherein the regulatory sequence may include a promoter capable of initiating transcription, an arbitrary operator sequence for regulating such transcription, and a sequence for regulating the termination of transcription and translation. The vector of the present invention is not particularly limited as long as it is replicable in a cell, and any vector known in the art may be used, for example, a plasmid, cosmid, phage particle, or viral vector.

[0019] In one embodiment of the present invention, a "recombinant vector" can be used as an expression vector of a target polypeptide that can express the target polypeptide with high efficiency in an appropriate host cell when the encoding gene of the target polypeptide to be expressed is operably linked, and the recombinant vector can be expressed in the host cell. The host cell can preferably be a eukaryotic cell, and depending on the type of host cell, expression control sequences such as a promoter, terminator, enhancer, etc., sequences for membrane targeting or secretion, etc. can be appropriately selected and variously combined depending on the purpose.

[0020] In addition, according to one embodiment of the present invention, a recombinant microorganism for producing itaconic acid is provided into which the recombinant vector for producing itaconic acid is introduced.

[0021] In one embodiment of the present invention, the “recombinant microorganism” refers to one transformed with the recombinant vector of the present invention. In one embodiment of the present invention, “transformation” refers to introducing a vector containing a promoter according to the present invention, or additionally a gene encoding a target protein, into a host cell. In addition, the gene encoding the transformed target protein may be inserted into and located within the chromosome of the host cell or located outside the chromosome, as long as it can be expressed within the host cell.

[0022] In one embodiment of the present invention, the itaconic acid recombinant microorganism may be introduced with one or more recombinant vectors including the recombinant vector of the present invention, and the one or more recombinant vectors may be introduced into the microorganism respectively. In addition, the recombinant vectors may be introduced sequentially into the microorganism, or may be introduced in a reversed order.

[0023] In one embodiment of the present invention, the recombinant microorganism for producing itaconic acid may further have an isocitrate dehydrogenase (icd) gene deleted. The icd gene is preferably represented by the base sequence of SEQ ID NO: 2, but is not limited thereto.

[0024] In one embodiment of the present invention, “icd gene” means a gene that expresses isocitrate dehydrogenase, wherein the isocitrate dehydrogenase converts isocitrate into alpha-ketoglutarate in the TCA cycle.

[0025] In one embodiment of the present invention, the recombinant microorganism for producing itaconic acid may be characterized by being selected from the group consisting of bacteria, yeast, and mold, and may preferably be a strain of the genus Vibrio, and more preferably, may be a recombinant strain of the genus Vibrio DHG deposited under the accession number KCTC 19196P.

[0026] In one embodiment of the present invention, the recombinant microorganism for producing itaconic acid may produce itaconic acid using alginic acid and mannitol. Alginic acid is a polysaccharide acid contained in the cell walls of brown algae, and mannitol is a sugar alcohol that is a reduced form of D-mannose, widely distributed in nature, and is abundantly contained in brown algae such as kelp, in addition to sweet potatoes, mushrooms, and celery.

[0027] In one embodiment of the present invention, the alginic acid and mannitol include alginic acid and mannitol extracted from raw materials and purified, as well as alginic acid and mannitol contained in the raw materials in an unrefined state without undergoing an extraction process.

[0028] In one embodiment of the present invention, the recombinant microorganism for producing itaconic acid may produce itaconic acid using seaweed, and preferably may produce itaconic acid using brown algae.

[0029]

[0030] * In one embodiment of the present invention, “seaweed” generally refers to a group of multicellular organisms that are large enough to be seen with the naked eye and grow by attaching to rocks or mud, among photosynthetic organisms living in the sea, and are broadly classified into green algae, brown algae, and red algae depending on the photosynthetic pigment.

[0031] In one embodiment of the present invention, the “brown algae” may be at least one selected from the group consisting of kelp (Saccharina japonica), wakame (Undaria pinnatifida), seaweed (Sargassum fusiforme), seaweed (Ecklonia cava), sea mustard (Sargassum horneri), sea squirt (Sargassum muticum), sea squirt (Sargassum thunbergii), and sea mustard (Ecklonia stolonifera), and may be included without limitation as long as it is a brown algae containing mannitol.

[0032] In one embodiment of the present invention, the form of the seaweed for producing itaconic acid is not limited, and includes forms such as granules, powder, and juice.

[0033] In addition, according to one embodiment of the present invention, a method for producing itaconic acid is provided, including a step of culturing the recombinant microorganism for producing itaconic acid.

[0034] In one embodiment of the present invention, the medium and other culture conditions used for culturing the microorganism may be any medium commonly used for culturing Escherichia microorganisms, but must suitably satisfy the requirements of the microorganism of the present invention. Preferably, the microorganism of the present invention is cultured under aerobic conditions in a conventional medium containing appropriate carbon sources, nitrogen sources, amino acids, vitamins, etc., while controlling temperature, pH, etc.

[0035] In one embodiment of the present invention, the medium may include acetic acid as a carbon source. Inorganic compounds such as sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, and calcium carbonate may be used, and amino acids, vitamins, and appropriate precursors may also be included. These media or precursors may be added to the culture in batch or continuous mode.

[0036] During cultivation, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid can be added to the culture in an appropriate manner to adjust the pH of the culture. Furthermore, foaming can be suppressed during cultivation using antifoaming agents such as fatty acid polyglycol esters. Furthermore, to maintain aerobic conditions in the culture, oxygen or oxygen-containing gas can be injected into the culture. To maintain both anaerobic and aerobic conditions, nitrogen, hydrogen, or carbon dioxide can be injected without gas injection.

[0037] The temperature of the culture medium can be usually set to 27°C to 37°C, preferably 30°C to 35°C. The culture period can continue until the desired amount of useful substance is produced, and preferably, the culture can be performed for 10 to 100 hours.

[0038] The itaconic acid produced in the above culturing step of the present invention may include a step of further purifying or recovering, and a method of recovering itaconic acid from a microorganism or culture may be a method known in the art, such as centrifugation, filtration, anion exchange chromatography, crystallization, and HPLC, but is not limited to these examples.

[0039] The above recovery step may include a purification process, and a person skilled in the art may select and utilize one of several known purification processes as needed.

[0040] The recombinant microorganism for producing itaconic acid according to the present invention can not only produce itaconic acid using alginic acid and mannitol contained in brown algae, but can also produce itaconic acid by directly adding brown algae without a pretreatment process, thereby enabling the development of an environmentally friendly and low-cost high-production process for itaconic acid, and thus can be utilized in various industrial fields such as synthetic resins, latex, and food additives where itaconic acid is utilized.

[0041] Figure 1 shows the overall process and configuration for producing itaconic acid by a recombinant strain according to one embodiment of the present invention.

[0042] Figure 2 shows the itaconic acid production capacity when strains VI and VIC, in which the isocitrate dehydrogenase gene has been deleted, were inoculated into a modified buffered minimal medium supplemented with 10 g / L alginic acid and 10 g / L mannitol.

[0043] Figure 3a shows the biomass of the VIC strain compared to the VC strain in a modified buffered minimal medium with controlled amounts of glutamate.

[0044] Figure 3b shows the sugar consumption of the VIC strain compared to the VC strain in a modified buffered minimal medium with controlled amounts of glutamate.

[0045] Figure 3c shows the itaconic acid production of the VIC strain compared to the VC strain in a modified buffered minimal medium with controlled amounts of glutamic acid.

[0046] Figure 3d shows the itaconic acid yield of the VIC strain compared to the VC strain in a modified buffered minimal medium with controlled amounts of glutamic acid.

[0047] Figure 4 shows the itaconic acid production ability of the recombinant VIC strain of the present invention when unprocessed brown algae is used as a substrate.

[0048] Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by those of ordinary skill in the art to which this invention pertains. Terms defined in commonly used dictionaries should be interpreted as having a meaning consistent with their meaning in the context of the relevant technology, and shall not be interpreted in an idealized or overly formal sense unless explicitly defined herein.

[0049] In addition, when describing the present invention, if it is determined that a detailed description of a related known technology may unnecessarily obscure the gist of the present invention, the detailed description is omitted.

[0050] Hereinafter, preferred examples are presented to aid in understanding the present invention. However, the following examples are provided solely to facilitate a better understanding of the present invention, and the scope of the present invention is not limited by the following examples.

[0051]

[0052] Example 1. Production of a recombinant Vibrio sp. DHG strain for producing itaconic acid

[0053] 1-1. Construction of a plasmid vector for introducing the cis-aconitate decarboxylase (cad) gene.

[0054] To produce itaconic acid, the cad gene expressing cis-aconitate decarboxylase was introduced into the Vibrio sp. DHG strain. The cis-aconitate decarboxylase is an enzyme that converts cis-aconitate into itaconic acid.

[0055] Specifically, in order to introduce the cad gene derived from Aspergillus terreus represented by the base sequence of sequence number 1 into the Vibrio genus DHG strain, a recombinant vector containing a cad expression cassette including the cad gene was constructed.

[0056] To construct a recombinant vector containing the above cad expression cassette, the vector plasmid was amplified using the pACYC_duet plasmid as a template and the pACYC_cad FWD (1) and pACYC_cad REV (1) primers. The cad gene was amplified using the pCDF_CAD plasmid as a template and the pACYC_cad FWD (2) and pACYC_cad REV (2) primers. In addition, for synthetic overexpression of the gene, it was expressed under the tac promoter known to be strong in Vibrio sp. dhg, and a synthetic 5' UTR with high translation efficiency was designed to ensure smooth protein expression. The amplified vector plasmid and the cad gene were combined to generate the recombinant vector pACYC_cad plasmid. The pACYC_cad plasmid thus generated was introduced into the Vibrio sp. DHG strain to generate the VC strain. The base sequences of the primers used to construct the pACYC_cad plasmid are shown in Table 1.

[0057] Primer name Polynucleotide sequence (5'-3') Sequence number pACYC_cad FWD (1) AACTGTCCGGTTAAAAGTCCGCTGGTTTAAATCGCACCAAAAAAAAACCCCGCTTCGGCG3 pACYC_cad REV (1) GGAATTGTGAGCGGATAACAATTAAAAAAAACAAAAGGAGCATCACCCATGACCAAACAGAGCGCAGATAGCAATGCA4 pACYC_cad FWD (2) GGAATTGTGAGCGGATAACAATTAAAAAAAACAAAAGGAGCATCACCCATGACCAAACAGAGCGCAGATAGCAATGCA5 pACYC_cad REV (2) CGCCGAAGCGGGGTTTTTTTTTGGTGCGATTTAAACCAGCGGACTTTTAACCGGACAGTT6

[0058] 1-2. Construction of a plasmid vector for deletion of the isocitrate dehydrogenase (icd) gene and production of a recombinant strain.

[0059] To delete the gene encoding isocitrate dehydrogenase (icd) represented by the nucleotide sequence of SEQ ID NO: 2, the SXT recombination system described in the prior literature was utilized. The pCDF_icd_del plasmid used to delete the icd gene was designed to have 3 kb homology arms containing the target sequence and a cat gene fragment.

[0060] The vector fragment was amplified using the pCDF_duet plasmid as a template and the primers pCDF_icd_Cm_3K FWD (1) and pCDF_icd_Cm_3K REV (1). The homologous sequences upstream and downstream of the Icd gene were amplified using the genomic DNA of purified Vibrio spp. DHG strain with the primers pCDF_icd_Cm_3K FWD / pCDF_icd_Cm_3K REV (2) and pCDF_icd_Cm_3K FWD (4) / pCDF_icd_Cm_3K REV (4). The Cat gene was amplified using the FRTwt_cat plasmid as a template and the primers pCDF_icd_Cm_3K FWD (3) and pCDF_icd_Cm_3K REV (3). After integrating the cat gene fragment surrounded by the FRT sequence through the introduction of the pCDF_icd_del plasmid into the icd region, the pRSF_FLP plasmid was introduced to express flippase, thereby constructing the VI strain. Subsequently, the pACYC_cad plasmid was introduced into the VI strain, ultimately constructing the VIC strain. The base sequences of the primers used to construct the pCDF_icd_del plasmid are shown in Table 2. In addition, the itaconic acid production pathway of the VIC strain constructed through the above process is shown in Figure 1. The VIC strain, which is a recombinant Vibrio sp. DHG strain constructed in this way, was deposited with the Biological Resource Center of the Korea Research Institute of Bioscience and Biotechnology on May 28, 2024, and was assigned the accession number KCTC19196P.

[0061] Primer name Polynucleotide sequence (5'-3') Sequence number pCDF_icd_Cm_3K FWD (1)CTGATGCGGTGATCAAACACCCGCACTCTGCCACCGCTGAGCAATAACTAGCATAACCCC7 pCDF_icd_Cm_3K REV (1)GTGCTACTATTCGCCTCCAACGCATTTGAGAAATTGCACTGAAATCTAGAGCGGTTCAGT8 pCDF_icd_Cm_3K FWD (2)ACTGAACCGCTCTAGATTTCAGTGCAATTTCTCAAATGCGTTGGAGGCGAATAGTAGCAC9 pCDF_icd_Cm_3K REV (2)TTATTCTGCGAAGTGATCTTCCGTCACAGGGAAGTTCCTATTCTCTAGAAAGTATAGGAA10 pCDF_icd_Cm_3K FWD (3)TTCCTATACTTTCTAGAGAATAGGAACTTCCCTGTGACGGAAGATCACTTCGCAGAATAA11pCDF_icd_Cm_3K REV (3)TGCGTTGTTCAACTCGGCAACAATCGCTTCGGAGTACTCGCGGTTGACTGTGAAGTTCCT12pCDF_icd_Cm_3K FWD (4)AGGAACTTCACAGTCAACCGCGAGTACTCCGAAGCGATTGTTGCCGAGTTGAACAACGCA13pCDF_icd_Cm_3K REV (4)GGGGTTATGCTAGTTATTGCTCAGCGGTGGCAGAGTGCGGGTGTTTGATCACCGCATCAG14

[0062] Example 2. Preparation of an itaconic acid production experiment using a recombinant Vibrio spp. DHG strain.

[0063] 2-1. Preparation of culture medium and strain cultivation

[0064] E. coliMach1-T1 Rwere cultured in LB medium containing 10 g / L NaCl, 10 g / L tryptone, and 5 g / L yeast extract at 37°C, while Vibrio sp. DHG strain and its derived strains were cultured in LBv2 or modified buffered minimal medium at 30°C as described previously. LBv2 medium contains 10 g / L tryptone, 5 g / L yeast extract, 21.9 g / L NaCl, 0.3 g / L KCl, and 2.2 g / L MgCl2, and modified buffered minimal medium contains 5 g / L (NH4)2SO4, 10 g / L NaCl, 10.7 g / L K2HPO4, 5.2 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, and 2 mL / L trace metal solution (ATCC MD-TMS). Modified buffered minimal media were supplemented with a mixture of alginate and mannitol or with raw S. japonica and varying concentrations of glutamic acid. All media were adjusted to pH 7 and supplemented with appropriate antibiotics. Agar media were prepared by adding 15 g / L agar to the medium.

[0065]

[0066] 2-2. Inoculation of strains for producing itaconic acid from alginic acid and mannitol

[0067] For itaconic acid production, colonies were selected from LBv2 agar medium and inoculated into 3 mL of modified buffered minimal medium (MBM) supplemented with 10 g / L alginate, 10 g / L mannitol, and 1 g / L glutamic acid in a 15 mL test tube. After incubation for one day, the culture was diluted in fresh medium to an OD600 (optical density at 600 nm) of 0.05. When the OD600 reached 0.6 to 1.0, the cells were transferred to a 350 mL Erlenmeyer flask containing 20 mL of MBM adjusted to an OD600 of 0.05. 10 g / L alginate and 10 g / L mannitol were added to the medium as carbon sources. When S. japonica was used directly as a substrate instead of purified alginate and mannitol, 40 g / L of UV-sterilized powder was added to the medium. To express the Cad gene, 0.5 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) was added to the medium. Additionally, various concentrations of glutamic acid (0 to 3 g / L) were added to the main culture medium. All cultivations were performed in three biological replicates at 30°C and 220 rpm in a rotary shaker (Hanil Scientific, Gimpo, Korea).

[0068]

[0069] 2-3. Quantification of cell growth

[0070] To quantify cell growth, OD600 was measured using a UV-1700 spectrophotometer (Shimadzu, Kyoto, Japan). First, 1 mL of culture was harvested and centrifuged at 13,000 rpm for 1 min. Then, 100 μL of the supernatant was diluted in a solution containing 100 mg / L alginate-degrading enzyme from Sigma-Aldrich (St. Louis, MO, USA) and incubated at 37°C for 1 h. The sample was then filtered through a 0.22 μm nylon filter from Sigma-Aldrich (St. Louis, MO, USA).

[0071]

[0072] 2-4. Quantification of reactant and product concentrations

[0073] The concentrations of mannitol, itaconic acid, and acetic acid were quantified using an UltiMate™ 3000 analytical high-performance liquid chromatography (HPLC) system from Shimadzu (Kyoto, Japan). HPLC was performed at 30°C using an Aminex HPX-87H column from Bio-Rad Laboratories (Richmond, CA, USA). 5 mM sulfuric acid was used as the mobile phase, and the flow rate was 0.6 mL / min. The refractive index signal was monitored using a Shodex RI-101 detector from Shodex (Klokkerfaldet, Denmark).

[0074] For alginate quantification, 50 μL of filtered sample diluted to a concentration range of 0 to 2 g / L was added to a microtiter plate from Bio-Rad Laboratories (Richmond, CA, USA). 5 μL of 0.8 M sulfamic acid reagent and 200 μL of 98% sulfuric acid containing 75 mM disodium tetraborate were added, mixed thoroughly, and incubated at 65°C for 2 h. The sample was cooled to room temperature for 20 min, after which 50 μL of 0.125% carbazole in absolute ethanol was added. The absorbance of each well was measured at 550 nm using a Synergy™ LX Multi-Mode Reader from BioTek (Winooski, VT, USA). Afterwards, the standard curve was calibrated using alginic acid solutions prepared at concentrations of 0, 0.1, 0.5, 1, and 2 g / L.

[0075]

[0076] Example 3. Confirmation of itaconic acid production using a recombinant Vibrio spp. DHG strain.

[0077] 3-1. Confirmation of growth and itaconic acid production of strains with deleted Icd genes

[0078] To confirm the itaconic acid production ability of the strain with the Icd gene deleted, the VC strain and the VIC strain produced in Example 1 were inoculated into a modified buffered minimal medium supplemented with 10 g / L alginic acid and 10 g / L, respectively, and the results are shown in Fig. 2.

[0079] As shown in Fig. 2, in the case of the VC strain, cell growth, alginic acid and mannitol consumption were active, and acetic acid production was increased, whereas in the case of the VIC strain, cell growth, alginic acid and mannitol consumption were minimal, and acetic acid production was also low. However, since the itaconic acid yields of the VC and VIC strains were similar, it was confirmed that deletion of the icd gene was effective in itaconic acid production by reducing the carbon flow to alpha-ketoglutarate production.

[0080]

[0081] 3-2. Confirmation of growth and itaconic acid production of VC and VIC strains when supplemented with glutamic acid.

[0082] To increase the biomass of recombinant Vibrio spp. strains, a method was attempted to restore the growth of the VIC strain by supplementing glutamic acid, an intermediate of the TCA cycle. The biomass, sugar consumption, itaconic acid production, and itaconic acid yield of the VIC strain were measured compared to the VC strain while adjusting the amount of glutamic acid from 0 g / L to 3 g / L in the medium of Example 3-1, and the results are shown in Figures 3a to 3d.

[0083] As shown in Fig. 3a, the VIC strain hardly grew under conditions without glutamic acid, but growth was confirmed to recover as glutamic acid was added.

[0084] As shown in Fig. 3b, under conditions without glutamic acid, the VIC strain consumed little alginic acid and mannitol, but it was confirmed that the consumption of alginic acid and mannitol increased as glutamic acid was added.

[0085] As shown in Fig. 3c, even under conditions without glutamic acid, the VIC strain showed similar itaconic acid production ability to the VC strain, and as glutamic acid was added, itaconic acid production increased, and it was confirmed that the itaconic acid production concentration increased by about 5 times in the medium with 3 g / L of glutamic acid added.

[0086] As shown in Fig. 3d, when glutamic acid was added, the amount of itaconic acid converted to sugar in the VIC strain decreased compared to the sugar consumption, but it was confirmed that a higher itaconic acid yield was still shown than that of the VC strain.

[0087]

[0088] 3-3. Confirmation of direct itaconic acid production from brown algae of recombinant strains

[0089] In order to confirm whether the recombinant VIC strain of the present invention can directly produce itaconic acid using unprocessed brown algae as a substrate, the VIC strain was cultured in a minimal medium containing 40 g / L of kelp (S. japonica) and additionally supplemented with 3 g / L of glutamic acid, and the itaconic acid production ability was measured. The results are shown in Fig. 4.

[0090] As shown in Fig. 4, a total of 20.1 g / L of sugars (11.8 g / L of alginic acid and 8.3 g / L of mannitol) were quantified from 40 g / L of kelp. After 48 hours of measurement, 1.5 g / L of itaconic acid was produced with a yield of 0.08 g / g, and 11 g / L of alginic acid and 8.3 g / L of mannitol were consumed. Therefore, it was confirmed that itaconic acid can be directly produced from kelp containing unpurified alginic acid and mannitol using a recombinant strain.

[0091]

[0092] Although the preferred embodiments of the present invention have been described in detail above, the scope of the present invention is not limited thereto, and various modifications and improvements that can be made by a person skilled in the art using the basic concept of the present invention defined in the following claims also fall within the scope of the present invention.

[0093] [Accession number]

[0094] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0095] Accession number: KCTC19196P

[0096] Date of acceptance: 20240528

[0097]

[0098]

[0099] The recombinant microorganism for producing itaconic acid according to the present invention can not only produce itaconic acid using alginic acid and mannitol contained in brown algae, but can also produce itaconic acid by directly adding brown algae without a pretreatment process, thereby enabling the development of an environmentally friendly and low-cost high-production process for itaconic acid, and thus can be utilized in various industrial fields such as synthetic resins, latex, and food additives where itaconic acid is utilized, and thus has industrial applicability.

Claims

1. A recombinant vector for producing itaconic acid comprising a cad gene expression cassette including a gene encoding cis-aconitate decarboxylase (cad).

2. In paragraph 1, A recombinant vector for producing itaconic acid, characterized in that the above cad gene is represented by the base sequence of sequence number 1.

3. A recombinant microorganism for producing itaconic acid into which the recombinant vector of paragraph 1 has been introduced.

4. In paragraph 3, The recombinant microorganism for producing itaconic acid is characterized in that the isocitrate dehydrogenase (icd) gene represented by the base sequence of sequence number 2 is deleted.

5. In paragraph 3, A recombinant microorganism for producing itaconic acid, characterized in that the recombinant microorganism for producing itaconic acid is a Vibrio sp. DHG strain (Vibriosp. dhg).

6. In paragraph 5, A recombinant microorganism for producing itaconic acid, characterized in that the recombinant microorganism for producing itaconic acid is a recombinant Vibrio genus DHG strain deposited under accession number KCTC 19196P.

7. In paragraph 6, The recombinant microorganism for producing itaconic acid is characterized in that itaconic acid is produced using alginic acid and mannitol.

8. In paragraph 6, The recombinant microorganism for producing itaconic acid is characterized by producing itaconic acid using seaweed.

9. In paragraph 8, A recombinant microorganism for producing itaconic acid, characterized in that the above seaweed is brown algae.

10. A method for producing itaconic acid, comprising a step of culturing a recombinant microorganism for producing itaconic acid according to any one of claims 3 to 9.

Images