Aptamers and riboswitches of cannabielsoin for in vitro and in VIVO sensing

Abstract

Disclosed is an aptamer capable of binding to Cannabielsoin (CBE), wherein the aptamer is: an RNA aptamer having a nucleotide sequence of: CGCGGGCAGUGNNNUGCANNNNNNNNUGUGNNNUAUUAGC (SEQ ID NO: 1); or a DNA aptamer having a nucleotide sequence of: CGCGGGCAGTGNNNTGCANNNNNNNNTGTGNNNTATTAGC (SEQ ID NO: 2), wherein for SEQ ID NO: 1, N is one nucleotide selected from the group consisting of A, G, U and C, and wherein for SEQ ID NO: 2, N is one nucleotide selected from the group consisting of A, G, C and T. Also disclosed is a riboswitch and a DNA expression cassette comprising the aptamer, a composition thereof, and a microbe containing the riboswitch or DNA expression cassette. Further disclosed is a method of detecting CBE produced in a microbe using the aptamer or riboswitch as disclosed herein.

Description

APTAMERS AND RIBOSWITCHES OF CANNABIELSOIN FOR IN VITRO AND IN VIVO SENSINGFIELD OF THE INVENTION

[0001] The present invention generally relates to an aptamer and a riboswitch comprising the aptamer. In particular, the present invention relates to an aptamer and a riboswitch comprising the aptamer for detecting cannabinoid Cannabielsoin (CBE).BACKGROUND

[0002] There is an increasing demand for sustainable and environmentally friendly solutions to produce essential chemicals, leading to the use of microbcs / cnzymcs that have been engineered to produce high-value chemicals from renewable feedstocks through synthetic biology / metabolic engineering. Cannabinoids are a family of secondary metabolites that are produced by plants and are gaining more interest due to their numerous beneficial effects, such as using for anaesthesia and has treatment effect for a wide range of conditions, including Parkinson's disease, schizophrenia, diabetes, multiple sclerosis and anxiety [1]. Global cannabinoids market size is expected to reach $84.38 Bn by 2028 at a rate of 20.6% (https: / / www.thebusinessresearchcompany.com / report / cannabinoids-global-market-report). There is growing importance of engineering microbes to produce cannabinoids such as Cannabielsoin (CBE), because traditional methods of CBE production which extracted from plant (Cannabis sativa, C. indica, and C. ruderalis, C. ruderalis), and chemical synthesis using petroleum as substrates are not sustainable and environment friendly. Additionally, legal restrictions on cannabis cultivation make plant-based production difficult to monitor, whereas microbial bioproduction offers a controlled, factory-based alternative. As such, the industries arc moving away from conventional extraction methods and moving towards synthetic biology technology to increase cannabinoids production. There is an increasing demand for sustainable and environmentally friendly solutions that arc characterized by rapid growth rates and cost-effective scalability [2-5],

[0003] Although earlier studies have engineered microbes / enzymes to produce cannabinoids from renewable feedstocks using synthetic biology and metabolic engineering approaches [6], the developed microbial strains for cannabinoids production still need to be improved further for industrial-scale production. Specifically, microbialproduction of CBE remains underexplored, with low titre highlighting the need for further strain and enzyme engineering.

[0004] Despite the recent advancement of synthetic biology and computational tools, predictively designing microbial strains remains challenging due to the complexity of biological systems. Therefore, iteratively design-build-test-leam (DBTL) and screening of large number of strains is inevitable process in metabolic engineering. Different methods have been used to screen for the desired strains, including traditional manual screening, with the assistance of automated equipment, and modem cell analysis technique fluorescent- activated cell sorting (FACS). Conventional method for screening or measuring CBE in biological samples largely relies on manual work and using precise but low throughput titration equipment such as High-performance Liquid Chromatography (HPLC) and Liquid Chromatography Mass Spectrometry (LCMS). While HPLC or LCMS instruments are sensitive, they are bulky, expensive, and difficult to use, as well as requiring regular maintenance. Similarly, while these methods are precise and accurate, they suffer from time-consuming, resource intensive, and complex procedures, significantly limiting their application in high throughput screening. More importantly, they have low throughput, as each sample requires around 45 minutes to process, in addition to tedious sample preparation steps, giving raise to inefficiency (—30 strains per week). More advanced approaches, such as microfluidic systems or flow cytometry can enable ultra -high throughput screening (millions of cells). However, biosensors are necessary for the screening methods to work. Although high throughput techniques and instruments, such as automation, microfluidic systems, or flow cytometry arc said to achieve high throughput screening, without high throughput analysis methods, high throughput techniques will not work.

[0005] While electrochemical sensors would allow easier detection of the molecules, the electrochemical sensor is limited to in vitro detection and can be difficult to fabricate. Thus, to overcome these limitations, genetically encoded biosensors have been developed to enhance the screening throughput to improve productivity of microbial cell factories [7]. These biosensors enable high throughput screening of engineered strains, real-time monitoring of product concentration, and regulation of the metabolic pathways to enhance production performance [7-11]. Recently, a GPCR-based yeast biosensor was developed for the detection of cannabidiol (CBD) based on the membrane receptor

[0012] . However,GPCR-based yeast biosensor lacks specificity for individual cannabinoids, often responding to a broad range of related compounds.

[0006] Biosensors have wide ranging applications in many areas (e.g., screening of high producers in biomanufacturing, detection of biomarkers in diagnostics, and environmental monitoring). However, developing functional biosensors is challenging, time consuming (usually takes years to develop a biosensor), and costly (development cost can take up to US$3O-$5O million). In recent years, genetically encoded biosensors have been used to improve the productivity of microbial cell factories. Riboswitches are RNA sensors that can recognize small-molecule compounds with high specificity and affinity, and regulate downstream metabolic genes on transcriptional, translational, or post-translational levels. Riboswitchcs offer several advantages over protein-based transcriptional factor biosensors [13, 14], including lower metabolic burden [15, 16], faster responses time, and reduced off-target effects

[0017] . Although riboswitches usually exhibit relatively lower sensitivity compared to aptamer-based biosensor [18, 19], they offer distinct advantages, such as the reporter fluorescence proteins (e.g., GFP) expressed by riboswitch are more stable than fluorogenic RNA in bacterial cells

[0020] , Besides, riboswitches eliminate the need for external dyes. In addition, aptamer-based sensors are not suitable for regulating gene expression, whereas riboswitches can modulate gene expression in response to specific ligand binding. A typical riboswitch consist two components: an aptamer domain allows binding of target molecule and an gene regulatory expression domain generates readout or regulates the downstream genes

[0021] . Ligand binding triggers structural rearrangements in the RNA, altering accessibility to regulatory elements and enabling control over translation [22, 23]. Since riboswitchcs can be used in the bacteria cells to measure intracellular metabolite concentrations, they have been used to screen for highly productive strains or enzymes [24-27], as well as real-time monitoring, and dynamic control of metabolic flux [7, 8, 1 1 ]. Synthetic riboswitches have been developed for a variety of ligands [28-46]. However, in the cannabinoids family, there is no riboswitches have been developed.

[0007] To fill this gap, aptamers that sensitively and specifically respond to and bind to CBE, as well as novel synthetic riboswitches that respond to CBE have been developed. The CBE-binding aptamers were first found using systematic evolution of ligands by exponential enrichment (SELEX)

[0047] . These aptamers were integrated into a green fluorescence protein (GFP) expression module to construct the riboswitches. Functionalriboswitches were selected using replica plating approach [48, 49]. This method involves comparing the fluorescence of the colonies in the absence and presence of CBE. The functional riboswitch was successfully developed, exhibiting operational range of 5 - 60 pM concentration of CBE, with a maximum fold activation of 10.1. In addition, the specificity of the riboswitch to CBE was evaluated to ascertain their utility for monitoring cannabinoids biosynthesis pathways. Moreover, the sensing of CBE produced by engineered yeast Pichia was demonstrated. The biosensor output achieved a good correlation (R2= 0.97) with CBE concentrations measured by LCMS. To further demonstrate the utility of the CBE biosensor for high throughput screening, the CBE biosensor was used to screen 36 Pichia colonies with combinatorial assembly library plasmid, and higher-performance colony was identified, demonstrating a 600-fold increase in characterization efficiency as compared to using LCMS. To the best of the inventors' knowledge, this is the first work that developed functional synthetic aptamers and riboswitches for cannabinoids. These tools enable precise detection of CBE, offering potential for screening and engineering cannabinoid-producing strains and enzymes. Furthermore, the CBE aptamers discovered in this work have the versatility to be functioned for other applications, such as in vitro cannabis detection. Overall, the aptamers and riboswitches developed and disclosed herein represent a valuable toolkit for cannabinoids research and applications.SUMMARY

[0008] In one aspect, the present disclosure refers to an aptamer capable of binding to Cannabiclsoin (CBE), wherein the aptamer is: an RNA aptamer having a nucleotide sequence of: CGCGGGCAGUGNNNUGCANNNNNNNNUGUGNNNUAUUAGC (SEQ ID NO: 1); or a DNA aptamer having a nucleotide sequence of: CGCGGGCAGTGNNNTGCANNNNNNNNTGTGNNNTATTAGC (SEQ ID NO: 2), wherein for SEQ ID NO: 1, N is one nucleotide selected from the group consisting of A, G, U and C, and wherein for SEQ ID NO: 2, N is one nucleotide selected from the group consisting of A, G, C and T.

[0009] In another aspect, the present disclosure refers to a riboswitch comprising the RNA aptamer as disclosed herein, a ribosomal binding site (RBS) and a reporter; wherein the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 1.

[0010] In another aspect, the present disclosure refers to a DNA expression cassette for the regulation of the expression of the reporter as disclosed herein, comprising a promoter, a DNA aptamer as disclosed herein, a DNA sequence encoding the RBS and a DNA sequence encoding the reporter of the riboswitch as disclosed herein.

[0011] In another aspect, the present disclosure refers to a composition for detecting CBE, comprising the riboswitch as disclosed herein, and a translation mixture.

[0012] In another aspect, the present disclosure refers to a composition for detecting CBE, comprising the DNA expression cassette as disclosed herein, a transcription mixture and a translation mixture.

[0013] In another aspect, the present disclosure refers to a microbe containing the riboswitch as disclosed herein or the DNA expression cassette as disclosed herein.

[0014] In another aspect, the present disclosure refers to a method of detecting CBE produced in a microbe, comprising (a) introducing the riboswitch as disclosed herein or the DNA expression cassette as disclosed herein into the microbe, wherein when the microbe produces the CBE in an effective amount, the CBE specifically binds the aptamer to induce a conformational change in the riboswitch that allows translation of the reporter into a reporter protein; and (b) detecting the reporter protein, wherein the presence of the reporter protein is indicative of detection of the CBE.

[0015] In another aspect, the present disclosure refers to a method of detecting CBE produced by a microbe, comprising (a) incubating the microbe with the composition as disclosed herein in a medium, wherein when the microbe produces and releases the CBE in an effective amount into the medium, the CBE specifically binds the aptamer of the riboswitch to induce a conformational change in the riboswitch that allows translation of the reporter into a reporter protein; and (b) detecting the reporter protein, wherein the presence of the reporter protein is indicative of detection of the CBE.

[0016] In another aspect, the present disclosure refers to a method of detecting CBE produced by a first microbe, comprising (a) incubating the first microbe and the microbe as disclosed herein in a medium; wherein when the first microbe produces and releases the CBE in an effective amount into the medium, the CBE specifically binds the aptamer of the riboswitch produced by the microbe as disclosed herein to induce a conformational change in the riboswitch that allows translation of the reporter into a reporter protein; and (b) detecting the reporter protein, wherein the presence of the reporter protein is indicative of detection of the CBE.

[0017] Advantageously, the whole cell-based living biosensor allows single cell realtime monitoring the CBE concentration, thus avoids the need to do sample preparation and running HPLC which is tedious, time consumption and limited in throughput.

[0018] Advantageously, the biosensors of the present disclosure can be easily fabricated at a low cost (about SGD 0.0035 per sensing reaction), ft is only needed to grow the cells to expand the biosensor for larger quantity measurement.

[0019] Advantageously, the biosensors of the present disclosure have dynamic sensing ranges from about 5 uM to about 120 pM. Wide dynamic sensing range is sufficient to cover the working concentration for CBE detection and relevant strain / enzyme screening.

[0020] Advantageously, the biosensors of the present disclosure enable ultra-high throughput screening. They arc effective and cheap biosensors that allow ultra-high throughput screening for strain / enzymes.BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the accompanying drawings, in which:

[0022] Figure 1 shows the development of CBE biosensor. A) SELEX workflow to identify CBE aptamer. The oligos were incubated with CBE conjugated beads for binding. After the unbound oligos were washed away, the bound oligos were amplified using PCR. The amplified oligos were then purified via gel electrophoresis and used for the next round of SELEX. B) CBE biosensor selection. Upon binding to CBE, the RNA secondary structure undergoes conformation change, leading to the exposure of RBS and enable translation. The functional CBE biosensor would be selected by comparing the GFP change. C) Identified CBE biosensor’s response to CBE. CBE biosensor showed significant GFP expression increase when exposing to CBE. Data information: The experimental data were represented as mean ± S.D. (n = 3). Error bars indicate the standard deviations of three technical replicates. Statistical significances of ***? < 0.001 were calculated based on two-sample unpaired t-test.

[0023] Figure 2 illustrates the characterization of the CBE biosensor. A) Dose response of CEBS to different CBE concentration, represented by the GFP / OD at 24 hours. Overall, CEBS exhibits great sensitivity and achieved high fold activation. B) CEBS dose response fitted by Hill Equation. CEBS demonstrated good curve fitting, withn CBER2= 0.97. GFP / OD = Kmax- where Kmax, EC50, and CBE refer to maximumGFP / OD, CBE concentration to achieve half-maximum GFP / OD, and concentration of CBE. Data information: The experimental data were represented as mean ± S.D. (n = 3). Error bars indicate the standard deviations of three technical replicates. Statistical significances of ***P < 0.001 were calculated based on two-sample unpaired t-test.

[0024] Figure 3 illustrates the responses of the developed biosensor to other cannabinoids. (A) The dose response of CEBS to different cannabinoids at different concentrations. CEBS showed significantly higher GFP expression levels towards CBE than other cannabinoids. (B) Fold activation of CEBS to different cannabinoids at different concentrations. CEBS showed significantly higher fold activations towards CBE than other cannabinoids. (C) Specificity of CEBS in the presence of CBGA, CBD, and CBDA. CEBS showed significantly higher specificity towards CBE than other cannabinoids. Data information: The experimental data were represented as mean ± S.D. (n = 3). Error bars indicate the standard deviations of three technical replicates. Statistical significances of ***? < 0.001 were calculated based on two-sample unpaired t-test.

[0025] Figure 4 illustrates CBE biosensor for sensing CBE that produced by pichia. A) Illustration of the CBE producing genetic circuits and CEBS sensing mechanism. The E. coli harbouring both CBE-producing plasmid and biosensor. M4DIE5 will be expressed when adding inducer and converts the CBGA to CBE. CBE further binds to the biosensor and triggers GFP translation. B) The workflow that using CEBS to sense the pzc / hn-produced CBE, and validated using LCMS. C) Sensor response and LCMS measured CBE concentrations at different pichia colonics. Increasing CBE concentrations leads to higher GFP expression levels. D) The correlation between CEBS response and CBE produced by different pichia colonies. The biosensor’s signal showed strong linear correlation with the CBE concentration measured by LCMS. Data information: The experimental data were represented as mean ± S.D. (n = 3). Error bars indicate the standard deviations of three technical replicates. Statistical significances of ***P < 0.001 were calculated based on two-sample unpaired t-test.

[0026] Figure 5 illustrates HTS of pichia library using CEBS. A) Comparison of the developed HTS workflow and convention screening methods. The HTS workflow that uses the co-culture of CEBS and pichia greatly simplifies the process and increases the throughput. B) Construction of pichia combinatorial library. The promoter, signaling peptides, and purification tags were varied in order to tune the CBE production. C) Thecorrelation of HTS results and LCMS measurement. HTS results showed good accuracy in the high throughput settings and co-culture systems.DETAILED DESCRIPTION

[0027] This disclosure describes the development of novel RNA-based biosensors (synthetic riboswitches) for the detection of cannabinoid Cannabielsoin (CBE), which can be used for anesthesia and has treatment effect for a wide range of conditions, including Parkinson's disease, schizophrenia, diabetes, multiple sclerosis and anxiety [1], As there is a growing interest in engineering microbes to produce cannabinoids such as CBE in biomanufacturing, a biosensor was created to enable the high throughput screening of high-performance producer strains. There is currently no RNA-based biosensor for the detection of CBE.

[0028] While biomanufacturing has been growing in recent years due to a global shift towards bio-based products and sustainable bioeconomy [2, 3], it remains challenging (typically taking 6-8 years and over US$50 million [4]) to engineer efficient high producer s train s / enzymes, largely due to the complexity of biological systems. Consequently, screening for high production strains / cells / enzymes (hereafter as producer) is a common practice in the industry. Currently, there is still lack of sensitive and target specific biosensors for a wide range bioproducts.

[0029] To address this challenge, novel RNA-based biosensors are developed, which can be used with high throughput screening technology (e.g., Fluorescence-activated cell sorting (FACS), droplet microfluidic sorting) to identify high-performance producers quickly and accurately. In addition to screening for high performance strains, synthetic riboswitches have a wide range of potential applications in the rapidly growing field of synthetic biology / engineering biology, such as they can also be used to regulate gene expression, used as Boolean logic gates [5], and control cell behaviors, such as chemotaxis and motility [6], Riboswitches can also be used as antimicrobial drug targets[7]. Besides, the biosensors of the present invention can be used for food quality control[8].

[0030] The biosensor of the present invention addressed an important limitation in the sensing of CBE and represents a significant step towards achieving efficient andsustainable CBE production. There is no CBE riboswitch currently available in the market or reported in the literature.

[0031] In one aspect, the present disclosure refers to an aptamer capable of binding to Cannabielsoin (CBE), wherein the aptamer is: an RNA aptamer having a nucleotide sequence of: CGCGGGCAGUGNNNUGCANNNNNNNNUGUGNNNUAUUAGC (SEQ ID NO: 1); or a DNA aptamer having a nucleotide sequence of: CGCGGGCAGTGNNNTGCANNNNNNNNTGTGNNNTATTAGC (SEQ ID NO: 2), wherein for SEQ ID NO: 1, N is one nucleotide selected from the group consisting of A, G, U and C, and wherein for SEQ ID NO: 2, N is one nucleotide selected from the group consisting of A, G, C and T.

[0032] As used herein, the term "aptamer" refers to a nucleic acid or oligonucleotide molecule that binds to a ligand such as CBE. Aptamers are derived from an in vitro evolutionary process (e.g., SELEX, (Systematic Evolution of Ligands by Exponential Enrichment), described in U.S. Patent No.5,270,163), which selects for target- specific aptamer sequences from large combinatorial libraries. Generally, generation of aptamers by SELEX involves the following steps: (1) Aptamer (nucleic acid, DNA / RNA) pools are incubated with target ligand (such as CBE) for binding. (2) Target ligand (such as CBE) are thoroughly washed to remove nonbinding species. (3) Target ligand (such as CBE)-bound aptamers are eluted from the target. (4) Amplification of candidate aptamers by PCR (DNA) or RT-PCR and transcription (RNA). Steps (l)-(4) is repeated for multiple rounds to deplete non-binders and enrich for target-binders. Following the final round of selection, binding nucleotides arc cloned and sequenced to determine the specific nucleotide composition. Aptamer compositions may be double-stranded or single-stranded, and may include deoxyribonucleotides, ribonucleotides, nucleotide derivatives, or other nucleotide-like molecules.

[0033] Illustrative ligands that bind to an aptamer include, without limitation, small molecules, such as drugs, metabolites, intermediates, cofactors, transition state analogs, ions, metals, nucleic acids, and toxins. Aptamers may also bind natural and synthetic polymers, including proteins, peptides, nucleic acids, polysaccharides, glycoproteins, hormones, receptors and cell surfaces such as cell walls and cell membranes. The binding of a ligand to an aptamer, which may be DNA or RNA, causes a conformational change and alters its ability to modulate the activity of another part such as an expression platformof a riboswitch that the aptamer is part of. In one example, the conformational change inhibits translation of an mRNA in which the aptamer is located. In another example, the conformational change removes the inhibition and allows translation of an mRNA in which the aptamer is located. Aptamers may also be composed of DNA or may comprise nonnatural nucleotides and nucleotide analogs. An aptamer will most typically have been obtained by in vitro selection for binding of a target molecule. However, in vivo selection of an aptamer is also possible.

[0034] An aptamer will typically be between about 10 and about 300 nucleotides in length. More commonly, an aptamer will be between about 30 and about 100 nucleotides in length.

[0035] As used herein, the term "riboswitch", or "biosensor" refers to regulatory RNA- based biosensor that control gene expression in response to a ligand (such as CBE), and the synthetic riboswitches developed in this invention can activate gene expression in response to CBE with high specificity. A typical riboswitch is composed of an aptamer domain and an expression platform. The term “riboswitch” reflects the ability of these noncoding RNAs to function as genetic switches. When the abundance of a ligand (such as CBE) exceeds a threshold level, binding of the ligand to a sensor of the riboswitch (such as the aptamer as disclosed herein) induces a conformational change of the riboswitch, leading to modulation of downstream events (e.g. in the expression platform). In one example, the RNA aptamers disclosed herein comprise a sequence that folds into a particular structure (e.g., a hairpin), which can specifically bind a ligand (such as CBE). Binding of the ligand causes a structural change in the folding of the RNA, which induces unfolding of the hairpin and expression of the reporter gene of the expression platform.

[0036] The aptamer and the riboswitch as disclosed herein can have at least two conformational states or configurations, an “off’ state and an “on” state, defined by the aptamer's ability or availability to interact with a specific ligand (such as CBE). For example, the aptamer can adopt a hairpin loop configuration in which the expression platform of the riboswitch is rendered unavailable to be translated, and therefore, the hairpin loop conformation can be considered as at an “off’ state and the corresponding riboswitch is “off.” On the other hand, a riboswitch that is “on” may have the aptamer in an “on” configuration that allows it to interact with a specific ligand (such as CBE). The riboswitch may switch from “off’ to “on” in response to the presence of the ligand thatinteracts with the aptamer of the riboswitch, thereby causing a conformational change of the riboswitch that leads to the “on” configuration.

[0037] In one example, the specific ligand binding to the aptamer and riboswitch as disclosed herein is CBE. Cannabielsoin, also known as CBE, is a non-psychoactive cannabinoid metabolite of cannabidiol (CBD). The chemical structure of CBE is illustrated in Figure IB.

[0038] In one example, the aptamer is a DNA aptamer. A DNA aptamer can be part of a DNA expression cassette. In another example, the aptamer is an RNA aptamer. An RNA aptamer can be part of a riboswitch.

[0039] In one example, the RNA aptamer capable of binding to CBE as disclosed herein comprises a nucleotide sequence ofCGCGGGCAGUGNNNUGCANNNNNNNNUGUGNNNUAUUAGC (SEQID NO: 1). For SEQ ID NO: 1, N is one nucleotide selected from the group consisting of A, G, U and C.

[0040] In another example, the DNA aptamer capable of binding to CBE as disclosed herein comprises a nucleotide sequence of CGCGGGCAGTGNNNTGCANNNNNNNNTGTGNNNTATTAGC (SEQ ID NO: 2). For SEQ ID NO: 2, N is one nucleotide selected from the group consisting of A, G, C and T.

[0041] In another aspect, the present disclosure refers to a riboswitch comprising the RNA aptamer as disclosed herein, a ribosomal binding site (RBS) and a reporter; wherein the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 1.

[0042] In one example, the riboswitch comprises an RNA aptamer capable of binding to CBE comprising the nucleotide sequence of SEQ ID NO: 1.

[0043] The RBS is selected from the group consisting of E.coli RBS having a consensus sequence of AGGA, a default RBS having a sequence of tttaagaaggagatatacat, and RBS34 having a sequence of tctagagaaagaggagaaatactag. In one example, the RBS is any RBS having an "AGGA" sequence. In another example, the RBS comprises Kozak sequence (yeast RBS): CCCGCCGCCACCATGGAG. In another example, the RBS comprises Kozak sequence from yeast a-factor mating pheromone (MFal): GGATCCACGATTAAAAGAATG.

[0044] The reporter can be any suitable reporter capable of generating a detectable signal upon conformational change of the aptamer after binding to its ligand such as CBE.In one example, the reporter is a fluorescence protein. In another example, the reporter is a fluorophore. In another example, the reporter is a colour dye. In another example, the reporter is a luminophore. In another example, the reporter is luciferase.

[0045] Commonly used reporter genes are - GFP (green fluorescent protein gene), lacZ (P- galactosidase gene), RFP (red fluorescent protein gene), and Luc (luciferase gene). The cells expressing GFP glow green when excited by wavelengths of blue to the ultraviolet range, while those expressing RFP glow red when excited by wavelengths of 488 nm or 532 nm. The cells expressing the Luc gene produce luciferase enzymes that catalyze a reaction with luciferin to produce light. The lacZ gene is the most common reporter gene used in E.coli. It produces an enzyme -galactosidase that causes the bacteria to appear blue when grown in a media containing X-gal substrate.

[0046] Examples of the fluorescence protein include a green fluorescence protein selected from the group consisting of EGFP, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen and T-Sapphire; a blue fluoresce protein selected from the group consisting of EBFP, EBFP2, Azurite and mTagBFP; a cyan fluoresce protein selected from the group consisting of ECFP, mECFP, Cerulean, mTurquoise, CyPet, AmCyanl, Midori-Ishi Cyan, TagCFP and mTFPl (Teal); a yellow fluorescence protein selected from the group consisting of EYFP, Topaz, Venus, mCitrine, YPet, TagYFP, PhiYFP, ZsYellow! and mBanana; an orange fluorescence protein selected from the group consisting of Kusabira Orange, Kusabira Orange2, mOrange, mOrange2, dTomato, dTomato -Tandem, TagRFP, TagRFP-T, DsRed, DsRed2, DsRed-Express (Tl), DsRed-Monomer and mTangerine; and a red fluorescence protein selected from the group consisting of mRuby, mApplc, mStrawbcrry, AsRcd2, mRFPl, JRed, mCherry, HcRedl, mRaspberry, dKeima -Tandem, HcRed-Tandem, mPlum, and AQ143. Typical fluorescence protein reporters are listed in Table 1.

[0047] Table 1. Examples of fluorescence protein reporters[0048 J In another aspect, the present disclosure refers to a DNA expression cassette for the regulation of the expression of the reporter as disclosed herein, comprising a promoter, a DNA aptamer as disclosed herein, a DNA sequence encoding the RBS and a DNA sequence encoding the reporter of the riboswitch as disclosed herein.

[0049] As used herein, an “DNA expression cassette” is a nucleic acid construct, generated recombinantly or synthetically, with nucleic acid elements that are capable of effecting expression of a gene in hosts compatible with such sequences. DNA expression cassettes include at least promoters, ribosome binding site (RBS), coding sequence (CDS), and optionally, transcription termination signals. Typically, the recombinant expression cassette includes a nucleic acid to be transcribed (c.g., a nucleic acid encoding a reporter, or other protein), RBS, and a promoter. Additional factors necessary or helpful in effecting expression may also be used as described herein. For example, an expression cassette can also include DNA aptamers that modulate the expression of the reporter protein. Transcription termination signals, enhancers, and other nucleic acid sequences that influence gene expression, can also be included in an expression cassette.

[0050] Specifically, in this disclosure, the DNA expression cassette comprises the DNA aptamer as disclosed herein. In one example, the DNA expression cassette comprises the DNA aptamer comprising the nucleotide sequence of SEQ ID NO: 2 being the DNA sequence of the aptamer.

[0051] As used herein, "promoter” refers to a region of the DNA expression cassette as disclosed herein involved in binding to proteins such as RNA polymerase to initiate transcription of DNA (e.g. the reporter gene) downstream of the promoter. Promoters are located near the transcription start sites of genes, upstream on the DNA (towards the 5' region of the sense strand). Promoters can be about 30-1000 base pairs long, the sequence of which is highly dependent on the gene and product of transcription, type or class of RNA polymerase recruited to the site, and species of organism. In one example, the promoter is inducible, i.e. the promoter directs expression of a reporter gene only when receiving a specific stimulus, such as chemical, protein, light, heat, etc. In another example, the promoter is constantly on, i.e. it is always able to direct expression of a reporter gene but it is only accessible to the RNA polymerase and transcriptional factors. Subsequent translation will only be enabled when the hairpin structure of the aptamer isunfolded by binding of the ligand such as CBE. Promoter used herein is to enable the transcription of the DNA expression cassette, which includes the aptamer, RBS, CDS. In a riboswitch, promoter controls transcription, and aptamer controls translation.

[0052] The promoter can be any promoter suitable to initiate transcription. In one example, the promoter is a E. coli a70promoter. In another example, the promoter is a E. coli o19promoter. In another example, the promoter is a E. coli o24promoter. In another example, the promoter is a E. coli o2Spromoter. In another example, the promoter is a E. coli o32promoter. In another example, the promoter is a E. coli o38promoter. In another example, the promoter is a E. coli o54promoter. Non-cxhaustivc examples of the promoter are listed in Table 2. In bacteria such as E. coli, the promoter contains two short sequence elements approximately 10 (Pribnow Box) and 35 nucleotides upstream from the transcription start site. Sigma70 (a70) promoter comprises two well-defined short sequences located at- 10 and-35 base pairs upstream of genes' transcription start sites (TSS), respectively. The sequence of the promoter at -10 (the -10 element, relative to the transcription start site) has the consensus sequence TATAAT. The sequence of the promoter at -35 (the -35 element, relative to the transcription start site) has the consensus sequence TTGACA. Optimal inter-base distance between the -10 element and the -35 element is 17(±1) bp.

[0053] Table 2. Examples of bacteria promoter.

[0054] In another example, the promoter is a yeast promoter, with non-exhaustive examples listed in Table 3.

[0055] Table 3. Examples of yeast promoter.

[0056] In another aspect, the present disclosure refers to a composition for detecting CBE, comprising the riboswitch as disclosed herein, and a translation mixture.

[0057] In another aspect, the present disclosure refers to a composition for detecting CBE, comprising the DNA expression cassette as disclosed herein, a transcription mixture and a translation mixture.

[0058] As used herein, "transcription mixture" and "translation mixture" refer to cell- free protein synthesis systems which are generally constructed with cell extract prepared from E. coli, wheat germ, insect or human cells, or rabbit reticulocytes. The E. coll extract-based cell-free expression system is the most popular, and broad varieties of in vitro protein synthesis systems are commercialized by various companies (e.g., Arbor Bioscicnccs, Biotechrabbit, Invitrogcn, Qiagen, Promcga). Other examples of ccll-frcc protein synthesis systems include yeast-based cell-free expression systems such as Next Generation Cell Free Protein Expression Kit (Merck, Sigma- Aldrich), Cell-Free Protein Expression (Promega), and so on. The cell-free protein synthesis system has several advantages over in vivo processes. Firstly, since there is no need to support cellular metabolism; all of the cellular resources can be efficiently directed toward the production of an encoded protein. Although the coupled (i.e., combining both transcription and translation processes) cell-free system has been proven to be more efficient than the uncoupled one, it is possible to use mRNA or PCR fragments as the matrices escaping genetic engineering and cloning procedures. Taken together, this makes cell-free technology a reliable and fast way to obtain a high yield of the desired protein. Secondly, the reaction environment can be directly controlled and easily manipulated, since there is no cell barrier. In addition, the cell-fee reaction mixture can be supplemented with the required additives. These additives include chaperones and reducing agents, stabilizing mRNA or promoting complex protein folding, hydrophobic compounds required for soluble expression of membrane proteins (MPs), rare tRNA molecular species for codon usage bias compensation, and orthogonal aminoacyl-tRNA synthetase (aaRS) / tRNA pairs (orthogonal translation system, OTS) for site-specific non-canonical amino acids (NAAs) incorporation in response to unique codon.

[0059] Any E. coli cell-free transcription or translation mixture (lab-made or commercially available mixture, including but not limited to Promega, NEB, myTXTL Sigma 70 Master Mix, Arbor Science), can be used in the composition as disclosed herein. The composition as disclosed herein facilitates the functioning of the riboswitch as disclosed herein or the DNA expression cassette as disclosed herein for the detection of CBE in vitro.

[0060] As used herein, "in vitro" detection of CBE refers to detecting CBE outside a host ceil (such as a microbe) producing the CBE.

[0061] In another aspect, the present disclosure refers to a microbe containing the riboswitch as disclosed herein or the DNA expression cassette as disclosed herein.

[0062] In one example, the microbe is a prokaryole. The prokaryote can be a bacterium, or an archaeon. The prokaryote is selected from the group consisting of E. coli, B. subtilis, Pseudomonas, Lactobacillus, Spirilla, Vibrio, Salmonella, Acetobacter, Cyanobacteria, Spirochetes, Chlamydias. Caulobacter, Mycoplasma, Aliivibrio, Bactcroidcs, Syncchocystis, Azotobactcr, Strcptomyccs, Thcrmococcus, Sulfolobus, Streptococcus, Methanococcus, Halobacterium, other proteobacteria, and a gram-positive bacterium.

[0063] In another example, the microbe is a eukaryote. The eukaryote can be a yeast. The eukaryote is selected from the group consisting of yeast Pichia, Saccharomyces, Yarrowia, Cryptococcus, Candida albicans, Meyerozyma, Zygosaccharomyces, Brettanomyces, Torulaspora Saccharomycetales, Aureobasidium, Rhodotorula, Candida, Trichosporon, Nakaseomyces, Schizosaccharomyces, and Cannabaceae.

[0064] In another aspect, the present disclosure refers to a method of detecting CBE produced in a microbe, comprising (a) introducing the riboswitch as disclosed herein or the DNA expression cassette as disclosed herein into the microbe, wherein when the microbe produces the CBE in an effective amount, the CBE specifically binds the aptamer to induce a conformational change in the riboswitch that allows translation of the reporter into a reporter protein; and (b) detecting the reporter protein, wherein the presence of the reporter protein is indicative of detection of the CBE.

[0065] The method as disclosed above refers to "in vivo" detection of CBE produced inside a host cell (such as a microbe as disclosed herein). As used herein, "in vivo" detection refers to detecting CBE inside a host cell (such as a microbe) that produces the CBE.

[0066] For step (a) of the above "in vivo" detection method, the riboswitch as disclosed herein or the DNA expression cassette as disclosed herein can be introduced (or transfected) into the microbe producing CBE. Transfection may occur under natural or artificial conditions according to various methods well known in the art, and may rely on any known method for the insertion of the riboswitch as disclosed herein or the DNA expression cassette as disclosed herein into a prokaryotic or eukaryotic microbe disclosedherein. The method for transfection is selected based on the type of prokaryotic or eukaryotic microbe being transfected and may include, but is not limited to, bacteriophage or viral infection, electroporation, heat shock, lipofection, nanoparticle delivery, and particle bombardment. The term "transfected cells / transformed cells" includes stably transfected / transformed cells in which the riboswitch as disclosed herein or the DNA expression cassette as disclosed herein is capable of replication either as an autonomously replicating plasmid or as part of the host chromosome, as well as transiently transformed cells which express the introduced riboswitch as disclosed herein or the DNA expression cassette as disclosed herein for limited periods of time.

[0067] In the above "in vivo" detection method, once the riboswitch as disclosed herein or the DNA expression cassette as disclosed herein is introduced into the microbe, the DNA expression cassette is transcribed into the riboswitch containing the aptamer disclosed herein. When the microbe produces the CBE in an effective amount, the CBE specifically binds the aptamer of the riboswitch as disclosed herein or the DNA expression cassette as disclosed herein, and this binding induces a conformational change in the riboswitch that allows translation of the reporter into a reporter protein.

[0068] The presence of the reporter protein is indicative of detection of the CBE. Detecting the reporter protein is done by a method selected from the group consisting of fluorescent detection, colorimetric detection, bioluminescence detection, spectrophotometry, and DNA microarray.

[0069] In another aspect, the present disclosure refers to a method of detecting CBE produced by a first microbe, comprising (a) incubating the first microbe and the microbe as disclosed herein in a medium; wherein when the first microbe produces and releases the CBE in an effective amount into the medium, the CBE specifically binds the aptamer of the riboswitch produced by the microbe as disclosed herein to induce a conformational change in the riboswitch that allows translation of the reporter into a reporter protein; and (b) detecting the reporter protein, wherein the presence of the reporter protein is indicative of detection of the CBE.

[0070] The method as disclosed above is the first embodiment of "in vitro" detection of CBE produced by a host cell (such as a microbe as disclosed herein). As used herein, "in vitro" detection of CBE refers to detecting CBE outside a host cell (such as a microbe) which produces the CBE.

[0071] For step (a) of the first embodiment of "in vitro" detection method as disclosed above, (i) the composition comprising the riboswitch as disclosed herein and a translation mixture; or (ii) the composition comprising the DNA expression cassette as disclosed herein, a transcription mixture and a translation mixture, is incubated in a medium, in which the microbe producing the CBE is also incubated. When the microbe produces and releases the CBE in an effective amount into the medium, the CBE specifically binds the aptamer of the riboswitch (the DNA expression cassette can be transcribed into the riboswitch containing the aptamer disclosed herein, by the transcription mixture included in the composition), to induce a conformational change in the riboswitch that allows translation of the reporter into a reporter protein, using the translation mixture included in the composition disclosed herein.

[0072] Any E. coli cell-free transcription or translation mixture (lab-made or commercially available mixture, including but not limited to Promega, NEB, myTXTL Sigma 70 Master Mix, Arbor Science, can be used in the composition as disclosed herein. The composition as disclosed herein facilitates the functioning of the riboswitch as disclosed herein or the DNA expression cassette as disclosed herein for the detection of CBE in vitro.

[0073] The presence of the reporter protein is indicative of detection of the CBE. Detecting the reporter protein is done by a method selected from the group consisting of fluorescent detection, colorimetric detection, bioluminescence detection, spectrophotometry, and DNA microarray.

[0074] In another aspect, the present disclosure refers to a method of detecting CBE produced by a first microbe, comprising (a) incubating the first microbe and the microbe as disclosed herein; wherein when the first microbe produces and releases the CBE in an effective amount into the medium, the CBE specifically binds the aptamer of the riboswitch produced by the microbe as disclosed herein to induce a conformational change in the riboswitch that allows translation of the reporter into a reporter protein; and (b) detecting the reporter protein, wherein the presence of the reporter protein is indicative of detection of the CBE.

[0075] The method as disclosed above is the second embodiment of "in vitro" detection of CBE produced by a host cell (such as a microbe as disclosed herein). As used herein, "in vitro" detection of CBE refers to detecting CBE outside a host cell (such as a microbe) which produces the CBE.

[0076] For step (a) of the second embodiment of "in vitro" detection method as disclosed above, a first microbe producing the CBE is co-cultured with a second microbe which has been transformed / transfected with riboswitch as disclosed herein or the DNA expression cassette as disclosed herein. When the first microbe produces and releases the CBE in an effective amount into the medium, the CBE specifically binds the aptamer of the riboswitch produced by the transformed / transfected second microbe to induce a conformational change in the riboswitch that allows translation of the reporter into a reporter protein.

[0077] The presence of the reporter protein is indicative of detection of the CBE. Detecting the reporter protein is done by a method selected from the group consisting of fluorescent detection, colorimetric detection, biolumincsccncc detection, spectrophotometry, and DNA microarray.

[0078] In the "in vitro" detection method or "in vivo" detection method as disclosed herein, in one example, the microbe producing the CBE, or the microbe which has been transformed / transfected with riboswitch as disclosed herein or the DNA expression cassette as disclosed herein, is a prokaryote. The prokaryote can be a bacterium, or an archaeon. The prokaryote is selected from the group consisting of E. coli, B. subtilis. Pseudomonas, Lactobacillus, Spirilla, Vibrio, Salmonella, Acetobacter, Cyanobacteria, Spirochetes, Chlamydias, Caulobacter, Mycoplasma, Aliivibrio, Bacteroides, Synechocystis, Azotobacter, Streptomyces, Thermococcus, Sulfolobus, Streptococcus, Methanococcus, Halobacterium, other proteobacteria, and a gram-positive bacterium.

[0079] In another example, the microbe producing the CBE, or the microbe which has been transformed / transfected with riboswitch as disclosed herein or the DNA expression cassette as disclosed herein, is a eukaryote. The eukaryote can be a yeast. The eukaryote is selected from the group consisting of yeast Pichia. Saccharomyces, Yarrowia, Cryptococcus, Candida albicans, Meyerozyma, Zy go accharomyces, Brettanomyces, Torulaspora Saccharomycetales, Aureobasidium, Rhodotorula, Candida, Trichosporon, Nakaseomyces, Schizosaccharomyces, and Cannabaceae.

[0080] In the "in vitro" detection method or "in vivo" detection method as disclosed herein, a range of suitable media are available for incubating the microbe as disclosed herein, the types and compositions of which are well known to those of skill in the art. Preferably the culture medium contains at least water, salts, nutrients, essential amino acids, vitamins and hormones, and may also include one or more growth factors. A varietyof suitable culture media is commercially available, for example LB broth, LB Agar, Terrific Broth, M9, M63, SOC Medium, ImMedia Medium, MagicMedia Medium.

[0081] Using the "in vitro" detection method or "in vivo" detection method as disclosed herein, in one example, CBE can be detected at a concentration of 5 pM to 120 pM. Tn another example, CBE can be detected at a concentration of at least 0.2 pM, at least 1 pM, at least 2 pM, at least 5 pM, at least 10 pM, at least 15 pM, at least 20 pM, at least 30 pM, at least 30.2 pM, at least 50 pM, at least 60 pM, at least 60.4 pM, at least 80 pM, at least 90 pM, at least 100 pM, at least 120 pM, or a higher concentration. The level of the reporter protein translated is at least about 10-fold higher when the CBE is present than the level when CBE is absent, hi one example, the level of the reporter protein translated is about 10.1 -fold higher when the CBE is present than the level when CBE is absent.

[0082] As such, the aptamers and riboswitches in the present disclosure enable ultra- high throughput and highly sensitive, specific, and effective screening of producer strains of CBE.

[0083] As used in this application, the singular form “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a primer” includes a plurality of primers, including mixtures and combinations thereof.

[0084] As used herein, the term “comprising” means “including.” Variations of the word "comprising", such as “comprise” and “comprises,” have correspondingly varied meanings. Thus, for example, a composition “comprising” X may consist exclusively of X or may include one or more additional unrecited components.

[0085] As used herein, the term “about” in the context of concentration of a substance, size of a substance, length of time, or other stated values means + / - 5% of the stated value, or + / - 4% of the stated value, or + / - 3% of the stated value, or + / - 2% of the stated value, or + / - 1 % of the stated value, or + / - 0.5% of the stated value.

[0086] Throughout this disclosure, certain embodiments may be disclosed in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosed ranges. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

[0087] The invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms "comprising", "including", "containing", etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications arc possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the inventions embodied herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.

[0088] The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.

[0089] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the ail to which the invention belongs.

[0090] Other embodiments are within the following claims and non-limiting examples.EXAMPLES

[0091] Non-limiting examples of the disclosure will be further described in greater detail by reference to specific Examples, which should not be construed as in any way limiting the scope of the disclosure.

[0092] Cannabielsoin (CBE), a cannabinoid with anesthetic properties, shows therapeutic potential for conditions such as Parkinson’s disease, schizophrenia, diabetes, multiple sclerosis, and anxiety. Biomanufacturing cannabinoids through microbialproduction offers a sustainable alternative to plant extraction, but engineering efficient CBE-producing strains remains challenging. A major obstacle is the lack of a reliable biosensor to enable high-throughput screening (HTS). To address this gap, a genetically encoded biosensor-riboswitch that detects CBE and generates fluorescence readout was developed. The biosensor exhibited a detection range from 0.1 nM to 60 pM, with a ECso of 15.3 pM and exhibited a robust dynamic range, achieving up to 9.3-fold activation. The biosensor responded specifically to CBE, successfully distinguishing it from other cannabinoids. Additionally, the riboswitch showed its capability in detecting CBE that produced by engineered yeast, with fluorescence output correlating closely (R2= 0.96) with CBE concentrations measured by LCMS. Further, the application of the CBE biosensor in HTS of yeast strain library through co-culturc was demonstrated and a simplified characterization workflow was developed, increasing 600 times in the characterization efficiency compared to traditional methods. To the best of the inventors' knowledge, this is the first riboswitch-based biosensor developed for cannabinoid, expanding the toolkit for cannabinoids detection and strain engineering. This biosensor holds potential in significantly accelerating the development of industrially viable CBE producers and highlights the broader potential of biosensor-guided strain optimization in synthetic biology.

[0093] Example 1 - Results

[0094] 1.1 Development of high sensitivity CBE riboswitch

[0095] CBE-binding aptamers were first selected and enriched in vitro using the inventors' previously SELEX setup

[0049] , as outlined in Figure 1A. CBE was conjugated to beads and incubated with a single- stranded oligo library to allow binding. Bound oligos were amplified by PCR, and the products denatured to regenerate single-stranded oligos for the next SELEX round, enriching for CBE-binding aptamers. Enrichment was tracked by PCR yield, which increased over successive rounds and plateaued between rounds 13 and 15, indicating saturation. SELEX was therefore concluded at round 15.

[0096] Next, CBE riboswitches were constructed using the aptamers enriched through SELEX. The aptamers were assembled into plasmids and cloned into the E. coli cells, with green fluorescence protein (GFP) serves as the reporter for riboswitches activity. In the presence of CBE, the cell harbouring CBE riboswitch would produce GFP as the readout, as illustrated in Figure IB. To select functional riboswitches, replica approach

[0049] was employed and CBE concentration of 30 pM was used, as most recombinantrecombinant microbial systems produce CBE below this concentration. To minimize differences in interfering factors and ensure consistency in the biosensors' operating conditions, the replica method utilized LB agar that sourced from the same supplier as the LB broth medium. Using this method, a riboswitch was identified, named CBE biosensor (CEBS). Its functionality was subsequently confirmed in liquid LB culture through continuous incubation and GFP measurement using a spectrophotometer, as shown in Figure 1C. When 30 pM CBE was added, CEBS showed ~ 5.7-fold activation, confirming its responsiveness to CBE.

[0097] 1.2 Characterization and validation of developed riboswitch: Dose-responses of CEBS

[0098] To characterize the performance of the developed riboswitchcs, dose-response experiments were conducted across various CBE concentrations. The concentrations gradient was set at 0, 5, 10, 30, 60 M. by taking together the consideration of CBE concentration reported in microbial production systems. The biosensor activity was quantified by GFP intensity measured using a microplate reader. Figure 2A shows the dose-response curves for CEBS, based on GFP / OD reading after 24 hours of incubation. The fold activation at 5, 10, 30, and 60 pM for CEBS were around 3.0, 4.5, 7.9, and 9.3, respectively. CEBS showed activation at low CBE concentration of 5 pM, indicating low detection limit. CEBS shows linear increasing from 5 - 60 pM, reflecting a broad dynamic range and operational range. The dose-response curves were fitted using Hill equation, with R2= 0.97 indicating good fitting, as shown in Figure 2B. CEBS showed a lower ECso of 15.3 pM, implying good sensitivity to CBE.

[0099] 1.3 Characterizing the response of CEBS to other cannabinoids

[0100] The CBE biosensor was then used to detect CBE produced in situ, and this demonstrated the advantage of using CBE biosensor in biomanufacturing. In the process of CBE production, metabolic pathways involve a range of enzymatic reactions where cannabinoids might act as substrates or products. It is important for the biosensor to be able to distinguish the target products from the substrates. Therefore, the responses of the biosensors to other four cannabinoids, specifically cannabigerolic acid (CBGA), cannabigerovarinic Acid (CBGVA), cannabidiol (CBD), and cannabidiolic acid (CBDA), were evaluated. CBGA usually serves as the substrate for cannabinoids synthesis, while CBDA and CBD might serve as intermediates or byproduct in CBE synthesis.

[0101] Fluorescence intensities of the biosensors were measured at cannabinoids concentrations of 0, 5, 10, 30, 60 pM. The dose-responses of CEBS to different cannabinoids were shown in Figure 3A. The results showed that the GFP expression level of CEBS when exposing to CBE is much higher than other cannabinoids. While the CEBS also had certain GFP expressions when adding other cannabinoids, the GFP levels didn’t increase after 5 pM, suggesting CEBS had either lower sensitivity to other cannabinoids or saturated at lower concentrations. More importantly, the response to CBE was 3.8 times higher (p <0.001) than CBGA at concentration of 60 pM, implying that CEBS is more sensitive towards CBE. Their fold activations were also calculated and plotted in Figure 3B. The results showed that the GFP fold activation (normalized to GFP expression at 0 pM cannabinoids) of CEBS increased with increasing CBE concentrations. While the fold activations did not increase when increasing cannabinoid concentrations. To further quantify specificity, fluorescence intensities for each cannabinoid were normalized against the response to CBE at the same concentration (Figure 3C). CEBS more responsive to CBE as compared to CBGA, CBD, and CBDA, despite structural similarities among the cannabinoids. While other cannabinoids might have some interference with CEBS at lower concentration such as 5 pM, CEBS maintained stronger response to CBE than other cannabinoids at higher concentrations, confirming the specificity of CEBS to CBE.

[0102] 1.4 Sensing yeast-produced CBE

[0103] In addition to the ability of CEBS to detect the externally added CBE, its capability to sense the CBE that produced by microbes was further demonstrated. To this end, a CBE-producing yeast pichia strain was engineered and CEBS was employed to monitor the produced CBE. To enable CBE production, CBE synthase (MADIE5) enzyme responsible for converting CBGA to CBE was cloned into pichia. The MADIE5 expression was under the control of a methanol-inducible promoter, as illustrated in Figure 4A. The CBE-producing pichia was first growth to OD 10, followed by enzyme expression, pichia was then lysed, followed by enzyme extraction and purification. The substrate CBGA was then added to the extracted enzyme for CBE production. To test if CEBS can sense the concentration in the pichia cell culture, part of the pichia cell culture was first spin down, and the supernatant was added to the CEBS. To validate the accuracy of the CEBS in sensing the CBE that produced by pichia, the CEBS’s readout was compared against to LCMS measurement. To do this, the remaining produced CBE in thepichia culture would then be purified using conventional organic extraction (acetonitrile). The LCMS would then be used to measure the concentration of extracted and purified CBE. The illustration of the conventional measurement and CEBS-enabled sensing is shown in Figure 4B. In this study, eight pichia colonies were characterized, which harboring plasmids with different M4DIE5 expression level. The outputs generated by sensing the produced CBE concentrations using CEBS and actual CBE concentrations measured by LCMS were shown in Figure 4C. Colonies 1-5 produced lower CBE concentrations as compared to colonies 6-8. The GFP / OD signal generated by CEBS when sensing the CBE produced by colonics 1-5 also lower than colonics 6-8. The CBE concentrations increase from colony 5 to colony 8, and CEBS’s signals also demonstrated increasing trend, indicating the CEBS could capture the relative pzc / zz'a-produccd CBE concentrations. To have a more direct comparison between CEBS signal and CBE concentrations measured by LCMS, their correlation was plotted and analysed in Figure 4D. From the results, there as a linear correlation established with R2= 9.6, demonstrating good accuracy when using CEBS to sense the CBE that produced pichia. The CEBS showed response at when the CBE concentration was 0.036 ppm (0.1 nM) produced by colony 5, demonstrating very low detection limit. These results suggested that CEBS can be used to sense and measure pzc7zz'a-produced CBE in situ, avoid the need of running organic extraction and LCMS, simplifying the analysis processing and saving effort.

[0104] 1.5 CBE biosensor enabled high throughput screening (HTS) for yeast combinatorial library

[0105] Having demonstrated CEBS’s capability to detect pzc / zza-produced CBE in situ, it was intended to further simplify the characterization process and demonstrate the ability to perform HTS. Conventionally, to screen such a library, using LCMS to measure the CBE produced by each strain is required. Despite the time-consuming and tedious enzyme purification and CBE extraction, it took 3-5 minutes to run each CBE sample. With the help of CEBS, the measurement of produced CBE in situ could improve the analysis throughput. To increase the efficiency, the reaction volume needs to be reduced and process should be further simplified. To achieve this, pichia were first cultured in deep-well plates using BMGY media, and co-cultured with CEBS after enzyme expression in 96-wells plate, in which the produced CEBS will be released by pichia and uptake by E. coli, and activate the CEBS to expression GFP, the HTS workflow is shown in Figure 5A, highlighting the increased throughput and simplified operation procedures.As a case study, a CBE-producing pichia library was construct, which consisted of 36 plasmids whose promoters, signalling peptides, and purification tags were varied (promoter-signal peptide-CBS5-purification tag or promoter / signal peptide / purification tag), as illustrated in Figure 5B. In this study, pichia were first grow to OD 36 using BMGYmedia, while CEBS were grow to OD 0.6 and diluted to OD 0.1 in LB media. Different co-culture seeding ratios were evaluated, and found seeding with 75% of CEBS and 25% of pichia achieved best sensing accuracy. At the same time, the LCMS was used to verify the actual concentrations of the CBE produced by the pichia library. The biosensor readouts were compared against to the LCMS measurement, and the correlation is shown in Figure 5C, with R2= 0.85 highlighting the accuracy and reliability of using CEBS to characterize the pichia library in HTS settings. The GFP expression by CEBS was measured by microplate reader at speed of 0.3-0.5s / sample, it increased the pichia screening throughput by > 600 times as compared to the rate of using HPLC at 5 minutes / sample.

[0106] Example 2 - Materials and Methods

[0107] 2.1 Preparation of CBE-beads conjugation

[0108] First, 1 L dilute H2SO4 was diluted to pH 6 in DI water. Add 50 pl of well- mixed epoxy-activated Magnetic Beads (Bioclone, USA) to an Eppendorf tube. Then 4 pl of 30 pM CBE (>98%, Sigma, USA), was added (or appropriate ketone-containing target compound) to 996 pl of dilute H2SO4 (pH 6) (Sigma, USA) to make a solution of 120 nM CBE in diluted acid. The CBE-acid solution was dispensed to 96-well plate, with 300 pl in each well, and the samples were prepared in triplicates. After reading the absorbance, 300 pl samples were recovered and added to the magnetic beads. The beads and solution were mixed and incubated for 3 hours, with shaking (250 rpm) for 1 hour. After incubation, the absorbance of the supernatant was measured at 355 nm to confirm that the concentration of free CBE has decreased to confirm the conjugation efficiency. The beads were then washed with 1ml PBS (phosphate-buffered saline) solution (1st Base, Singapore) to remove all unbound CBE from the beads. A magnet was used to aggregate and separate the beads before aspirating the wash solution for discarding. After discarding the third wash solution, the beads were resuspended in 1ml PBS and stored at 4°C.

[0109] 2.2 In Vitro Selection of the Aptamers

[0110] The single-stranded oligos library was prepared by heating at 95 °C for 10 minutes, and subsequently added to the CBE-bound magnetic beads. After incubating for an hour at 37 °C with gentle shaking, the mixture was exposed to a magnet to isolate the beads from the unbound oligos. The beads were washed using PBS, and the bound oligos on the beads were then amplified through PCR (KOD One™ PCR Master Mix, TOYOBO, Japan) for 25 cycles. In this study, 25 cycles of PCR at initial rounds provided an adequate number of aptamers while minimize the PCR bias for subsequent rounds of SELEX. The PCR product was run through gel electrophoresis to confirm the size of the oligos. Gel extraction was then performed to extract and purify the oligos. PCR product was heated to form single-stranded oligos for next round of SELEX. Fifteen rounds of SELEX were conducted before terminating the selection.

[0111] 2.3 Development of Riboswitches

[0112] The selected and enriched PCR product was cloned into the vector pBbE6k (Addgene, plasmid #35288, USA). The vector was replaced with chloramphenicol resistance gene. The pLac promoter was replaced by Anderson promoter J23114 to drive the transcription. The amplified oligos were cloned onto upstream of GFP gene, which served as reporter. The constructed riboswitches were transformed into E. coli Acella through heat-shock method. The transformants were spread onto the LB agar (Thermo Fisher Scientific, USA) plate without CBE. Subsequently, the colonies formed on the plate were replicated onto a new LB agar plate with 30 pM CBE

[0050] . After overnight incubation, the fluorescence of the colonies on both plates were compared under an illuminator, and the colonies with more significant fluorescence intensity change were selected for characterization.

[0113] 2.4 Characterization of dose-response of the developed riboswitches

[0114] Cells were inoculated from glycerol stock and incubated overnight in LB (Lysogeny broth) supplemented with 25 pg / ml chloramphenicol at 37°C with shaking at 225 rpm. Subsequently, 50 pl of the overnight culture was transferred into 5 mL fresh LB (Thermo Fisher Scientific, USA) containing 25 pg / ml chloramphenicol (Sigma, USA) and incubated for 2 hours. The optical density at 600 nm (OD600) was measured, and the culture was then diluted to an OD600 of 0.1 using fresh LB supplemented with 25 pg / ml chloramphenicol. Based on the usual concentrations in microbial production systems

[0051] , cannabinoids were added to final concentrations of 5, 10, 30, and 60 pM, respectively. The mixtures were dispensed into a 96-well plate (Greiner Bio-One, Austria)with 300 pl in each well. Samples without cannabinoids served as controls. Each sample was prepared in triplicate. Cell growth (measured as absorbance at 600 nm) and biosensor response (quantified by GFP fluorescence with excitation and emission wavelengths of 470 nm and 520 nm, respectively, using a gain of 75) were monitored using a microplate reader (Hl , Biotek, USA). The 96-well plate was shaken kinetically, and readings were taken every 10 minutes over a period of 24 hours. All data were baseline-corrected using the reading of LB supplemented with 25 pg / ml chloramphenicol.

[0115] 2.5 LCMSfor CBE and other cannabinoids measurement

[0116] Cannabidiol (CBD, %95%. CHIRON), cannabidiolic acid (CBDA, %97%. Cayman chemical), cannabigerolic acid (CBGA,97%, Cayman chemical), cannabigerovarinic acid (CBGVA, ^95%, Cayman chemical) and cannabielsoin (CBE, %95% . Cayman chemical) were detected and quantified by LCMS (Agilent 1290 Infinity UHPLC coupled with Agilent 6500 iFunnel Q-TOF high resolution mass spectrometer, Agilent Technologies). 1 uL of acetonitrile extracted cannabinoid products were injected into reverse phase HPLC column (InfinityLab Poroshcll 120 EC-C18 column, 2.1 x 50 mm, particle size of 1.9 micron, Agilent Technologies). Compound separation was performed under the conditions described in Table 4. Mass spectrometer was set to a MS scan range of 100-1000 m / z at 2 scan / sec. Electrospray ionisation was conducted in negative ion mode and a capillary voltage of 3000 V was used. Eluted compounds were identified by comparison of retention time (Rt), mass and mass fragmentation patterns against cannabinoid standards.

[0117] Table 4. Multi step gradient used in compound separation.

[0118] 2.6 Construction of the CBE-producing pichia strain

[0119] A non-canonical cannabinoid synthase, MADIE5 (Uniprot ID MADIE5) was selected based on previous publication on minor cannabinoid CBE production. Strain construction of CBE-producing Pichia pastoris strains was slightly modified in this study. Gene sequences of MADIE5 were modified by adding a C-terminal Strep II purification tag and codon optimised (Twist Bioscience) before cloning into pPinka-HC vector (Invitrogen). PichiaPink (Invitrogen) cells were transformed by electroporation using linearised plasmid DNA. Clones with correct genome integration of MADIE5 were confirmed using protocols published by Invitrogen.

[0120] 2.7 Characterizing CBE-producing pichia using conventional methods

[0121] Cells of each CBE-producing Pichia pastoris clone were harvested and lysed to screen for good protein expression and CBE-producing enzymatic activity. SDS- polyacrylamide gel electrophoresis (SDS-PAGE) coupled with western blot was used for the evaluate of protein expression level. This procedure usually involves an overnight antibody incubation for each round of analysis. For the CBE-producing activity, enzymatic assay was set up using cannabigerolic acid (CBGA) as substrate and organic products were extracted for later analysis in LCMS. Each sample run in the applied LCMS method was 10 minutes and the initial set-up / preparation usually took about an hour.

[0122] 2.8 Sensing CBE produced by pichia

[0123] CBE-producing Pichia cells were first cultured to an optical density (GD600) of 10, followed by induction of enzyme expression using methanol. Cells were then lysed, and the enzymes were extracted and purified using acetonitrile. The substrate cannabigerolic acid (CBGA) was subsequently added to the extracted enzymes to produce CBE. After 24 hours of bioconversion, the pichia cell culture was spin down, and 333 pl of the supernatant was together with 667 pl CBE biosensor (OD OO 0.1) into an 1.5 ml centrifuge tube. The mixtures were dispensed into a 96-well plate (Greiner Bio-One, Austria) with 300 pl in each well, and each sample was prepared in triplicate Cell growth and GFP fluorescence were measured over 24 hours using the microplate reader. The accuracy of CEBS sensing was further validated by comparing fluorescence outputs with CBE concentrations measured by LC-MS analysis.

[0124] 2.9 HTS of CBE-producing pichia library

[0125] A combinatorial assembly library of CBE-producing yeast clones was established using an episomal Pichia pastoris promoter and signal peptide shuffling system (Yeast Secrete and Detect, Kit #1000000166, Addgene, USA). By the shufflingof promoters (11, both endogenous and orthologous), signalling peptides (18), and purification tags (7) combinations with Golden Gate cloning, it led to 1386 possible combinations of expression cassette in the transformed Pichia pastoris (GS115) cells. Details of library construction could be found in previous publication 63. Transformed yeast clones were inoculated and grown to an OD600 of 36 in BMGY medium, while CEBS cells were grown to an OD600 of 0.6 and then diluted to an OD600 of 0.1 in LB medium. Different co-culture seeding ratios were tested, microplate reader was used to incubate and measure the GFP expression in the co-cultures. Concurrently, LC-MS was used to measure the actual CBE concentrations produced by the engineered yeast clones. Biosensor fluorescence readouts were then compared with the LC-MS measurements to validate sensing accuracy.

[0126] Example 3 - Discussion

[0127] Due to the increasing interest and demand in sustainable and environmentally friendly solutions, more and more industries started to engineer microbes for bioproduction of high value chemicals or drugs for the bioeconomy. As compared to traditional detection methods, such as HPLC and LCMS, riboswitch has several advantages, such as extremely low cost, easy operation, sensing speed, and sensitivity. Most importantly, riboswitches can be used to control genetic circuits and perform in vitro and in vivo sensing at the single-cell level, while other sensing methods (e.g., electrochemical sensors or HPLC) do not possess these capabilities. Therefore, other than some common applications in healthcare, security, environment, food, agriculture, and water, riboswitches are ideal for large-scale screening efforts, enabling researchers to quickly identify the most promising candidates for further optimization and development.

[0128] Cannabinoids have multiple beneficial applications, such as has treatment effect for a wide range of conditions, including Parkinson's disease, schizophrenia, diabetes, multiple sclerosis and anxiety. Currently, cannabinoids are predominantly extracted from plants, which is not sustainable. As a result, there is a growing interest in developing biomanufacturing methods to produce cannabinoids in a more sustainable way. To make cannabinoids biomanufacturing economically viable, it is necessary to create a strain with high cannabinoids productivity. Therefore, a significant amount of research and development has been made in the field of strain engineering. However, due to the complexity of biosystem engineering, design-build-test-learn cycle has to be repeated many times until successfully engineering a good producer. Consequently,screening is inevitable to identify the strains that have the desired properties or characteristics during the process of strain engineering. High throughput screening methods, such as FACS, LCMS, automated equipment, and micro fluidics -based screening system methods are limited by the availability of specific biosensors. However, the development of biosensors is a time-consuming and labor-intensive process.

[0129] The current state-of-the-art for the measurement of CBE in biological samples mainly relies on HPLC, LCMS. A GPCR-based yeast biosensor was developed for the detection of CBD based on the membrane receptor. However, GPCR-based yeast biosensor’s application is limited due to the requirement of membrane receptor. Moreover, it also responses to other cannabinoids.

[0130] While HPLC or LCMS instruments arc sensitive, they arc bulky, expensive, and difficult to use, as well as requiring regular maintenance. More importantly, they have low throughput, as each sample requires around 45 minutes to process, in addition to tedious sample preparation steps. While electrochemical sensors would allow easier detection of the molecules, the electrochemical sensor is limited to in vitro detection and can be difficult to fabricate.

[0131] This invention describes the development of synthetic riboswitches that respond to Cannabielsoin (CBE), and the sensing capability of the riboswitches on purified CBE and cell -producing CBE was validated. Riboswitches are regulatory RNA- based biosensor that control gene expression in response to small molecules, and the synthetic riboswitches developed in this invention can activate gene expression in response to CBE with high specificity. The specificity and dynamic range of the riboswitchcs were assessed, ensuring that they respond specifically to CBE and have a broad enough range of activation to be useful in metabolic engineering. The ability to activate gene expression more than 10-folds provides a significant level of control over the metabolic pathways of microorganisms, making them useful tools for the production of cannabinoids.

[0132] Specifically, in this work, a novel CBE-responsive riboswitch biosensor with high sensitivity and specificity was developed. The biosensor showed significant responses to CBE and exhibited operational range of 5 - 60 pM, with an ECso of 15.3 pM and fold activation of up to 9.3. Unlike existing GPCR-based biosensors that respond to multiple cannabinoids, the present riboswitch sensor distinguishes CBE with high specificity. Importantly, the present biosensors effectively detected CBE produced byengineered pichia, displaying consistent results (R2= 0.96) with LCMS analysis, and demonstrated a detection limit as low as 0.1 nM. To demonstrate its application in high throughput settings, the biosensor was used to screen a combinatorial library consisting of 36 pichia strains. The biosensor readouts again displayed high accuracy (R2= 0.85), with a > 600 increase in throughput compared to conventional methods that use LCMS. In addition, a co-culture screening workflow that reduced reaction volumes, simplified operations, and further improved screening efficiency was established. This biosensor provides a powerful tool for accelerating the development of industrially viable CBE producers. By enabling controlled, factory-based bioproduction, this platform also addresses the legal and regulatory challenges associated with traditional cannabis cultivation. Together, this work expands the synthetic biology toolkit for cannabinoid detection and strain engineering, and provides a scalable strategy for accelerating the development of industrially viable CBE producers.[OO133J In comparison to HPLC or LCMS instruments, the CBE biosensor as disclosed in this invention offers significant advantages. In addition to being cheaper to fabricate and simpler to use, this invention can detect the CBE in situ without sample preparation. Moreover, the CBE biosensor as disclosed in this invention is capable of high throughput screening at single cells level, which is not possible / extremely challenging with most other CBE detection methods (HPLC, LCMS). The CBE biosensor as disclosed in this invention showed specificity to CBE in the presence of CBGA. More importantly, the CBE biosensor as disclosed in this invention doesn’t require a membrane receptor to work, therefore it can be applied in different cell types and in cell-free culture. In addition to the potential use in biomanufacturing and strain engineering, the CBE riboswitch biosensor can also be utilized for security and drug quality control. It is anticipated that the CBE biosensor and its aptamer will have great commercial applications due to cannabinoids’ huge market potential ($84.38 Bn by 2028).

[0134] Overall, the development of these CBE riboswitches has the potential to enhance the production of cannabinoids in microorganisms, which have applications in the food, pharmaceutical, and cosmetic industries. Additionally, these riboswitches could also be used in the development of biosensors for the detection of CBE for drug quality and security control. More importantly, CBE riboswitches developed in this invention can be used for high throughput screening for the enzymes and strains with high performance.

[0135] Commercial applications for these CBE biosensors include:i) Using this biosensor to develop CBE detection kits for point of use. ii) Using the biosensor for ultra-high throughput screening of the CBE producing enzyme / strains - this will greatly reduce the labour and time requirements, accelerating the biomanufacturing of CBE for market. iii) Dynamic regulation of biosynthesis pathways to control and optimize CBE bioproduction. iv) Drug quality control, for example, determination of CBE in relative drugs. v) Bioprocess optimization for scaling up, monitoring of CBE produced by microbes in biorcactor.

[0136] The biosensor as disclosed herein offers several significant advantages:

[0137] First, the biosensor as disclosed herein is a whole cell-based living biosensor. It allows single cell real-time monitoring the CBE concentration, thus avoids the need to do sample preparation and running HPLC which is tedious, time consumption and limited in throughput.

[0138] Second, the biosensor as disclosed herein can be easily fabricated at a low cost of about SGD 0.0035 per sensing reaction. It is only needed to grow the cell to expand the biosensor for larger quantity measurement.

[0139] Third, the biosensor as disclosed herein has dynamic detection ranges from about 5 pM to about 120 pM. The wide dynamic sensing range is sufficient to cover the working concentration for CBE detection and relevant strain / enzyme screening.

[0140] Last, the biosensor as disclosed herein enables ultra-high throughput screening. It is an effective and cheap biosensor that allows ultra-high throughput screening for CBE producing strain / enzymes.

[0141] Industrial Applicability

[0142] It will be apparent that various other modifications and adaptations of the invention will be apparent to the person skilled in the art after reading the foregoing disclosure without departing from the spirit and scope of the invention and it is intended that all such modifications and adaptations come within the scope of the appended claims.Reference1 Laudanski, K. & Wain, J. Considerations for Cannabinoids in Perioperative Care by Anesthesiologists. Journal of clinical medicine 11, doi: 10.3390 / jcml 1030558 (2022).2 Lou, H., Hu, L., Lu, H., Wei, T. & Chen, Q. Metabolic Engineering of Microbial Cell Factories for Biosynthesis of Flavonoids: A Review. Molecules 26 (2021).3 Pandey, R. P., Parajuli, P., Koffas, M. A. G. & Sohng, J. K. Microbial production of natural and non-natural flavonoids: Pathway engineering, directed evolution and systems / synthetic biology. Biotechnology advances 34, 634-662, doi:https: / / doi.org / l 0.1016 / j.biotechadv.2016.02.012 (2016).4 Wang, J., Guleria, S., Koffas, M. A. G. & Yan, Y. Microbial production of value-added nutraceuticals. Current opinion in biotechnology 37, 97-104, doi:https: / / doi.org / 10.1016 / j.copbio.2015.11.003 (2016).5 Hesami, M., Pepe, M., Baiton, A. & Jones, A. M. P. Current status and future prospects in cannabinoid production through in vitro culture and synthetic biology. Biotechnology advances 62, 108074, doi: 10.1016 / j.biotcchadv.2022.108074 (2023).6 Giilck, T. et al. Synthetic Biology of Cannabinoids and Cannabinoid Glucosides in Nicotiana benthamiana and Saccharomyces cerevisiae. Journal of Natural Products 83, 2877-2893, doi: 10.1021 / acs.jnatprod.0c00241 (2020).7 Zhang, J., Jensen, M. K. & Keasling, J. D. Development of biosensors and their application in metabolic engineering. Current Opinion in Chemical Biology 28, 1-8, doi:https: / / doi.org / 10.1016 / j.cbpa.2015.05.013 (2015).8 Liu, D., Evans, T. & Zhang, F. Applications and advances of metabolite biosensors for metabolic engineering. Metabolic Engineering 31, 35-43, doi:https: / / doi.org / 10.1016 / j.ymben.2015.06.008 (2015).9 Williams, T. C., Pretorius, I. S. & Paulsen, I. T. Synthetic Evolution of Metabolic Productivity Using Biosensors. Trends in biotechnology 34, 371-381, doi: 10.1016 / j .tibtech.2016.02.002 (2016).10 Teng, Y. et al. Biosensor-enabled pathway optimization in metabolic engineering. Current opinion in biotechnology 75, 102696, doi: 10.1016 / j .copbio.2022.102696 (2022) .1 1 Rogers, J. K., Taylor, N. D. & Church, G. M. Biosensor-based engineering of biosynthetic pathways. Current opinion in biotechnology 42, 84-91, doi:https: / / doi.org / 10.1016 / j.copbio.2016.03.005 (2016).12 Micttincn, K. et al. A GPCR-bascd yeast biosensor for biomedical, biotechnological, and point-of-use cannabinoid determination. Nature communications 13, 3664, doi: 10.1038 / s41467-022-31357-6 (2022).13 Latchman, D. S. Transcription factors: an overview. The international journal of biochemistry & cell biology 29, 1305-1312, doi: 10.1016 / sl357-2725(97)00085-x (1997).14 Rogers, J. K. & Church, G. M. Genetically encoded sensors enable real-time observation of metabolite production. Proceedings of the National Academy of Sciences 113, 2388-2393, doi:doi:10.1073 / pnas.l600375113 (2016).15 Serganov, A. & Patel, D. J. Ribozymes, riboswitches and beyond: regulation of gene expression without proteins. Nature Reviews Genetics 8, 776-790, doi: 10.1038 / nrg2172 (2007).16 Liang, Joe C., Bloom, Ryan J. & Smolke, Christina D. Engineering Biological Systems with Synthetic RNA Molecules. Molecular Cell 43, 915-926, doi:https: / / doi.org / 10.1016 / j.molcel.2011.08.023 (2011).17 Berens, C. & Suess, B. Riboswitch engineering - making the all-important second and third steps. Current opinion in biotechnology 31, 10-15, doi: 10.1016 / j.copbio.2014.07.014 (2015).18 Sequeira-Antunes, B. & Ferreira, H. A. Nucleic Acid Aptamer-Based Biosensors: A Review. Biomedicines 11, doi: 10.3390 / biomedicinesl 1 123201 (2023).19 McKeague, M. & DeRosa, M. C. Challenges and Opportunities for Small Molecule Aptamer Development. Journal of Nucleic Acids 2012, 748913, doi:https: / / doi.org / 10.1155 / 2012 / 748913 (2012).20 Breaker, R. R. Riboswitches and Translation Control. Cold Spring Harbor perspectives in biology 10, doi: 10.1101 / cshpcrspcct.a032797 (2018).21 Scrganov, A. & Nudlcr, E. A decade of riboswitchcs. Cell 152, 17-24, doi: 10.1016 / j.ccll.2012.12.024 (2013).22 Breaker, R. R. Riboswitchcs and the RNA world. Cold Spring Harbor perspectives in biology 4, doi: 10.1101 / cshperspect.a003566 (2012).23 Garst, A. D., Edwards, A. L. & Batey, R. T. Riboswitches: structures and mechanisms. Cold Spring Harbor perspectives in biology 3, doi: 10.1101 / cshperspect.a003533 (2011).24 Liu, Y. el al. Establishment of a Biosensor-based High-Throughput Screening Platform for Tryptophan Overproduction. ACS Synth Biol 10, 1373-1383, doi: 10.1021 / acssynbio.0c00647 (2021).25 Yang, J. et al. Synthetic RNA devices to expedite the evolution of metaboliteproducing microbes. Nature communications 4, 1413, doi:10.1038 / ncomms2404 (2013).26 Hallberg, Z. F., Su, Y., Kitto, R. Z. & Hammond, M. C. Engineering and In Vivo Applications of Riboswitches. Annu Rev Biochem 86, 515-539, doi: 10.1 146 / annurev-biochem-060815-014628 (2017).27 Chau, T. H. T., Mai, D. H. A., Pham, D. N., Le, H. T. Q. & Lee, E. Y. Developments of Riboswitches and Toehold Switches for Molecular Detection- Biosensing and Molecular Diagnostics. International journal of molecular sciences 21, doi: 10.3390 / ijms21093192 (2020).28 Grohcr, F. & Suess, B. Synthetic riboswitchcs — A tool comes of age.Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms 1839, 964-973, doi:https: / / doi.org / 10.1016 / j.bbagrm.2014.05.005 (2014).29 Sudarsan, N., Cohen-Chalamish, S., Nakamura, S., Emilsson, G. M. & Breaker, R. R. Thiamine Pyrophosphate Riboswitches Are Targets for the Antimicrobial Compound Pyrithiamine. Chemistry & biology 12, 1325-1335, doi:https: / / doi.org / 10.1016 / j.chembiol.2005.10.007 (2005).30 Mirihana Arachchilage, G., Sherlock, M. E., Weinberg, Z. & Breaker, R. R. SAM-VI RNAs selectively bind S-adenosylmethionine and exhibit similarities to SAM- III riboswitches. RNA Biol 15, 371-378, doi: 10.1080 / 15476286.2017.1399232 (2018).31 Chau, T. H. T„ Mai, D. H. A., Pham, D. N.. Le, H. T. Q. & Lee, E. Y.Developments of Riboswitches and Toehold Switches for Molecular Detection- Biosensing and Molecular Diagnostics. International journal of molecular sciences 21, 3192, doi: 10.3390 / ijms21093192 (2020).32 Wickiser, J. K., Winkler, W. C., Breaker, R. R. & Crothers, D. M. The Speed of RNA Transcription and Metabolite Binding Kinetics Operate an FMN Riboswitch. Molecular Cell 18, 49-60, doi:10.1016 / j.molcel.2005.02.032 (2005).33 Sherman, E. M., Esquiaqui, J., Elsayed, G. & Ye, J. D. An energetically beneficial leader-linker interaction abolishes ligand -binding cooperativity in glycine riboswitches. RNA (New York, N.Y.) 18, 496-507, doi: 10.1261 / rna.031286.111 (2012).34 Kelvin, D. & Suess, B. Tapping the potential of synthetic riboswitches: reviewing the versatility of the tetracycline aptamer. RNA Biol 20, 457-468, doi: 10.1080 / 15476286.2023.2234732 (2023).35 Ketzer, P. et al. Artificial riboswitches for gene expression and replication control of DNA and RNA viruses. Proceedings of the National Academy of Sciences 111, E554-E562, doi:doi: 10.1073 / pnas,1318563111 (2014).36 Bauer, G. & Suess, B. Engineered riboswitches as novel tools in molecular biology. J Biotechnol 124, 4-11, doi:10.1016 / j.jbiotec.2005.12.006 (2006).37 Ketzer, P. et al. Artificial riboswitches for gene expression and replication control of DNA and RNA viruses. Proceedings of the National Academy of Sciences 111, E554-E562, doi:doi: 10.1073 / pnas,1318563111 (2014).38 Kent, R. & Dixon, N. Systematic Evaluation of Genetic and Environmental Factors Affecting Performance of Translational Riboswitchcs. ACS Synthetic Biology 8, 884-901, doi: 10.1021 / acssynbio.9b00017 (2019).39 Etzel, M. & Morl, M. Synthetic Riboswitches: From Plug and Pray toward Plug and Play. Biochemistry 56, 1181-1198, doi:10.1021 / acs.biochem.6b01218 (2017).40 Sherlock, M. E., Sudarsan, N., Stav, S. & Breaker, R. R. Tandem riboswitches form a natural Boolean logic gate to control purine metabolism in bacteria. eLife 7, e33908, doi:10.7554 / eLife.33908 (2018).41 Lu, C. et al. Crystal structures of the SAM-III / SMK riboswitch reveal the SAM- dependent translation inhibition mechanism. Nature Structural & Molecular Biology 15, 1076-1083, doi: 10.1038 / nsmb,1494 (2008).42 Strobel, B. et al. A Small-Molecule-Responsive Riboswitch Enables Conditional Induction of Viral Vector-Mediated Gene Expression in Mice. ACS Synthetic Biology 9, 1292-1305, doi: l0.102l / acssynbio.9b004l0 (2020).43 Villa, J. K., Su, Y., Contreras, L. M. & Hammond, M. C. Synthetic Biology of Small RNAs and Riboswitches. Microbiology spectrum 6, doi:10.1128 / tnicrobiolspec.RWR-0007-2017 (2018).44 Wu, M.-C. et al. Rational Re-engineering of a Transcriptional Silencing PreQi Riboswitch. 9021, doi: 10.102145 Jang, S. et al. Development of Artificial Riboswitches for Monitoring of Naringenin In Vivo. ACS Synth Biol 6, 2077-2085, doi: 10.1021 / acssynbio.7b00128 (2017).46 Mehrshahi, P. et al. Development of Novel Riboswitches for Synthetic Biology in the Green Alga Chlamydomonas. ACS Synthetic Biology 9, 1406-1417, doi: 10.1021 / acssynbio.0c00082 (2020).47 Gold, L. SELEX: How It Happened and Where It will Go. J Mol Evol 81, MO- 143. doi: 10.1007 / s00239-015-9705-9 (2015).48 Lederberg, J. & Lederberg, E. M. Replica plating and indirect selection of bacterial mutants. Journal of bacteriology 63, 399-406, doi: 10.1128 / jb.63.3.399- 406.1952 (1952).49 Jingyun, Z., Kunartama, A. A., Han, T. Y. & Loo, P. C. Developing genetically encoded biosensors for flavonoid luteolin. Sensors and Actuators B: Chemical, 137117, doi:https: / / doi.org / 10.1016 / j.snb.2024.137117 (2024).50 Chee, W. K. D., Yeoh, J. W., Dao, V. L. & Poli, C. L. Highly Reversible Tunable Thermal-Repressible Split-T7 RNA Polymerases (Thermal-T7RNAPs) for Dynamic Gene Regulation. ACS Synthetic Biology 11, 921-937, doi: 10.1021 / acssynbio. lc00545 (2022).

Claims

Claims1. An aptamer capable of binding to Cannabielsoin (CBE), wherein the aptamer is: an RNA aptamer having a nucleotide sequence of: CGCGGGCAGUGNNNUGCANNNNNNNNUGUGNNNUAUUAGC (SEQ ID NO: 1); or a DNA aptamer having a nucleotide sequence of: CGCGGGCAGTGNNNTGCANNNNNNNNTGTGNNNTATTAGC (SEQ ID NO: 2), wherein for SEQ ID NO: 1, N is one nucleotide selected from the group consisting of A, G, U and C, and wherein for SEQ ID NO: 2, N is one nucleotide selected from the group consisting of A, G, C and T.

2. A riboswitch comprising the RNA aptamer of claim 1, a ribosomal binding site (RBS) and a reporter; wherein the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 1.

3. The riboswitch of claim 2, wherein the RBS is selected from the group consisting of E.coli RBS having a consensus sequence of AGGA, a default RBS having a sequence of tttaagaaggagatatacat, and RBS34 having a sequence of tctagagaaagaggagaaatactag.

4. The riboswitch of claim 2, wherein the reporter is selected from the group consisting of fluorescence protein, fluorophore, colour dye, luminophore, and luciferase.

5. The riboswitch of claim 4, wherein the fluorescence protein is selected from the group consisting of a green fluorescence protein selected from the group consisting of EGFP, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen and T-Sapphire; a blue fluoresce protein selected from the group consisting of EBFP, EBFP2, Azurite and mTagBFP; a cyan fluoresce protein selected from the group consisting of ECFP, mECFP, Cerulean, mTurquoisc, CyPct, AmCyanl, Midori-Ishi Cyan, TagCFP and mTFPl (Teal); a yellow fluorescence protein selected from the group consisting of EYFP, Topaz, Venus, mCitrine, YPet, TagYFP, PhiYFP, ZsYellowl and mBanana; an orange fluorescence protein selected from the group consisting of Kusabira Orange, Kusabira Orange2, mOrange, m0range2, dTomato, dTomato-Tandem, TagRFP, TagRFP-T, DsRed, DsRed2, DsRed-Express (Tl), DsRed -Monomer and mTangerine; and a red fluorescence protein selected from the group consisting of mRuby, mApple, mStrawberry, AsRed2, mRFPl, IRed, mCherry, HcRedl, mRaspberry, dKeima-Tandem, HcRed-Tandem, mPlum, and AQ143.

6. A DNA expression cassette for the regulation of the expression of the reporter of claim 4 or 5, comprising a promoter, a DNA aptamer of claim 1, a DNA sequence encoding the RBS and a DNA sequence encoding the reporter of the riboswitch of any one of claims 2-5.

7. The DNA expression cassette of claim 6, wherein the promoter is selected from the group consisting of a E. coli o70, o19, o24, o28, o32, o38, and o54promoter.

8. A composition for detecting CBE, comprising the riboswitch of any one of claims 2- 5, and a translation mixture.

9. A composition for detecting CBE, comprising the DNA expression cassette of claim 6 or 7, a transcription mixture and a translation mixture.

10. The composition of claim 8 or 9, wherein the translation mixture is a E. coli cell-free translation mixture.

11. The composition of claim 9, wherein the transcription mixture is E. coli cell-free transcription mixture.

12. A microbe containing the riboswitch of any one of claims 2-5 or the DNA expression cassette of claim 6 or 7.

13. The microbe of claim 12, wherein the microbe is a prokaryote selected from the group consisting of E. coli, B. subtilis, Pseudomonas, Lactobacillus, Spirilla, Vibrio, Salmonella, Acetobacter, Cyanobacteria, Spirochetes, Chlamydias, Caulobacter, Mycoplasma, Aliivibrio, Bacteroides, Synechocystis, Azotobacter, Streptomyces, Thermococcus, Sulfolobus, Streptococcus, Methanococcus, Halobacterium, other proteobacteria and a gram-positive bacterium.

14. The microbe of claim 12, wherein the microbe is a eukaryote selected from the group consisting of yeast Pichia, Saccharomyces, Yarrowia, Cryptococcus, Candida albicans, Meyerozyma, Zygosaccharomyces, Brettanomyces, Torulaspora Saccharomycetales, Aureohasidium, Rhodotorula, Candida, Trichosporon, Nakaseomyces, Schizosaccharomyces, and Cannabaceae.

15. A method of detecting CBE produced in a microbe, comprising(a) introducing the riboswitch of any one of claims 2-5 or the DNA expression cassette of claim 6 or 7 into the microbe, wherein when the microbe produces the CBE in an effective amount, the CBE specifically binds the aptamer to induce a conformational change in the riboswitch that allows translation of the reporter into a reporter protein; and(b) detecting the reporter protein, wherein the presence of the reporter protein is indicative of detection of the CBE.

16. A method of detecting CBE produced by a microbe, comprising(a) incubating the microbe with the composition of claim 8 or the composition of claim 9 in a medium, wherein when the microbe produces and releases the CBE in an effective amount into the medium, the CBE specifically binds the aptamer of the riboswitch to induce a conformational change in the riboswitch that allows translation of the reporter into a reporter protein; and(b) detecting the reporter protein, wherein the presence of the reporter protein is indicative of detection of the CBE.

17. A method of detecting CBE produced by a first microbe, comprising(a) incubating the first microbe and the microbe of any one of claims 12-14 in a medium; wherein when the first microbe produces and releases the CBE in an effective amount into the medium, the CBE specifically binds the aptamer of the riboswitch produced by the microbe of any one of claims 12-14 to induce a conformational change in the riboswitch that allows translation of the reporter into a reporter protein; and(b) detecting the reporter protein, wherein the presence of the reporter protein is indicative of detection of the CBE.

18. The method of any one of claims 15-17, wherein the microbe is a prokaryote selected from the group consisting of E. coli, B. subtilis, Pseudomonas, Lactobacillus, Spirilla, Vibrio, Salmonella, Acetobacter, Cyanobacteria, Spirochetes, Chlamydias, Caulobactcr, Mycoplasma, Aliivibrio, Bactcroidcs, Syncchocystis, Azotobactcr, Streptomyces, Thermococcus, Sulfolobus, Streptococcus, Methanococcus, Halobacterium, other proteobacteria and a gram-positive bacterium.

19. The method of any one of claims 15-17, wherein the microbe is a eukaryote selected from the group consisting of yeast Pichia, Saccharomyces, Yarrowia, Cryplococcus, Candida albicans, Meyerozyma, Zygosaccharomyces, Brettanomyces, Torulaspora Saccharomycetales, Aureobasidium, Rhodotorula, Candida, Trichosporon, Nakaseomyces, Schizosaccharomyces, and Cannabaceae.

20. The method of any one of claims 15-19, wherein the CBE has a concentration of at least 0.2 pM, at least 1 pM, at least 2 pM, at least 5 pM, at least 10 pM, at least 15pM, at least 20 pM, at least 30 pM, at least 30.2 pM, at least 50 pM, at least 60 pM, at least 60.4 pM, at least 80 pM, at least 90 pM, at least 100 pM, or at least 120 |aM.

21. The method of any one of claims 15-20, wherein the reporter protein is detected by fluorescent detection, colorimetric detection, bioluminescence detection, spectrophotometry, and DNA microarray.

22. The method of any one of claims 15-21, wherein the level of the reporter protein translated is at least about 10-fold higher when the CBE is present than the level when CBE is absent.

Images