Postbiotic compositions and methods of preparation and use

Abstract

Provided herein are postbiotic compositions prepared using successive fermentation methods of specific bacteria and plant fiber material. Also provided herein are methods, including for the treatment or prevention of the disruption of gut microbiota, or dysbiosis, associated with an antibiotic treatment, chemotherapy treatment, or administration of a dysbiosis-causing medications or medical treatments, using said postbiotic compositions, or for improving responses and / or reducing complications to treatments such as antibiotics or chemotherapy. Such postbiotic compositions can also be used for the treatment or prevention of the disruption of the gut-brain axis, including to treat or prevent neurological diseases or disorders, such as synucleinopathies, including but not limited to Parkinson's disease.

Description

POSTBIOTIC COMPOSITIONS AND METHODS OF PREPARATION AND USECROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 63 / 673,346 filed July 19. 2024, the contents of which are incorporated herein by reference in their entirety.SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in XML file format and is hereby incorporated by reference in its entirety. Said XML copy, created on July 17, 2025, is named 084487-000102WOPT_SL.xml and is 2,871,296 bytes in size.FIELD

[0003] The present disclosure is broadly concerned with postbiotic compositions, as well as methods of their preparation and use.BACKGROUND

[0004] Microbial communities develop by sequentially filling and / or creating ecological niches, allowing different groups to exploit resources. To understand how to manipulate bacteria in the gut and on the skin, scientists need to understand the community structure of bacteria and how they assemble to create stable and resilient communities that interact with the body to modulate immune and inflammatory functions. Such a microbiome succession model entails staging competing interests for nutrients, similar to how an ecosystem is built from inception to maturation. Medications, pesticides, disease, and many other life stressors can erode and destroy the stability and diversity of the gut and skin microbiome, therefore limiting its functionality. A destroyed ecosystem can result in immune and inflammatory dysregulation.

[0005] Cancer patients who have a disrupted gut microbiota and lower gut diversity can respond worse to treatment. In the case of some cancer treatments, antibiotics are administered in association with chemotherapy treatments. In some cases, medications lower the patient’s white blood cell count and destroy the diversity and balance in their gut microbiomc, leaving patients prone to infections and complications. Many patients also receive a high dose of prophylactic or empirical antibiotics which further destroy the gut microbiome. It has also been shown that exposure to antibiotic therapy influences the probability of response to immune checkpoint inhibitor (ICPI) therapy and is predictive of shorter patient survival across malignancies. It has also been shown that antibiotics influence the probability of response and positive treatment outcome of chimeric antigen receptor T cell (CAR T) therapy. It has been shown that loss of anaerobic bacteria is associated with loss of bacterial diversity,and it has been shown that loss of anaerobic bacteria is associated with decreased probability of response to CAR T therapy.

[0006] By disrupting the gut ecosystem, antibiotics and other therapies, including chemotherapies, immunotherapies, and CAR-T therapies themselves, can instigate downstream alterations within the microbiome and tumor microenvironment, with complex repercussions on the tumor-host-microbe interface.

[0007] Additionally, other treatments that can be administered in association with chemotherapy, immunotherapy, or cell therapies such as hematopoietic cell transplantation (HCT) cause large shifts in microbiota populations. It has been shown that the resulting low microbiota diversity at the time of neutrophil engraftment in patients undergoing HCT is associated with 5 -fold increased transplant- related mortality, indicating that microbiota diversity is critical for clinical outcomes. Low gut diversity can also alter the response to treatments.

[0008] Body systems beyond the nervous system are impacted in neurological disease. Among these, gastrointestinal (GI) health and the role of the gut microbiomc is a component of nervous system disorders, including in synucleinopathies such as Parkinson’s disease (PD), dementia with Levy bodies (DLB), and multiple system atrophy (MSA). As GI abnormalities are common in PD and can precede the manifestation of the movement disorder, the GI system can contribute to PD pathogenesis. Significant perturbation of the gut microbial community has been consistently reported in PD patients compared to healthy individuals. However, whether this contributes to the disease process in PD or is a consequence of the disease remains unknown. There is need for therapeutics for synucleinopathies, and for diseases or disorders related to disruptions of the gut-brain axis.

[0009] Few interventions support healthy immune function and inflammatory responses. Accordingly, additional compositions and methods for preventing or treating disease (e.g.. associated with dysbiosis) are desirable. Additionally, compositions and methods to reconstitute a damaged microbiome are also desirable.SUMMARY

[0010] The present disclosure is broadly concerned with postbiotic compositions and methods of preparing and using them. In multiple aspects, described herein are postbiotic compositions prepared using successive fermentation, for example at least first and second successive stages with at least a first bacterial species in the first stage and at least a second bacterial species in the second stage. Nonlimiting examples of such bacterial species are provided herein. Such successive fermentation mimics early developmental environments of the healthy microbiomc and promotes microbial diversity.

[0011] The disclosure is also concerned with herbal / botanical / plant-based substrate compositions for use in preparing fermented or postbiotic compositions using such successive fermentation methods. Non-limiting examples of such plant-based substrates are provided herein. Also described herein are methods of using such postbiotic compositions for immune and / or inflammatory' modulation. The present disclosure is also related to the treatment or prevention of graft versus hostdisease, autoimmune disease, inflammatory conditions, and / or disruption of the gut-brain axis. Also provided herein are methods for the treatment or reconstitution or prevention of the disruption of gut microbiota associated with lifestyle, stress, an antibiotic treatment, chemotherapy treatment, or administration of dysbiosis-causing medications or medical treatments or other environmental or lifesty le factors in a subject. The present disclosure is also related to the treatment or prevention of dysbiosis or dysbacteriosis in a subject receiving an antibiotic treatment, a chemotherapy treatment, or administration of a dysbiosis-causing medication or medical treatment. The present disclosure is also related to the adjuvant treatment of cancer patients and other patients receiving immunotherapy, in some instances such as hematopoietic cell therapies, or chimeric antigen receptor T cell therapies or immune checkpoint inhibitor therapies. The present disclosure is also related to the prevention or treatment of antimicrobial resistance gene selection. The present disclosure is also related to the prevention or treatment of the disruption of the gut-brain axis in a neurological disease or disorder such as: a synucleinopathy; Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and / or multiple system atrophy (MSA).

[0012] Antibiotics are indispensable tools to treat and cure microbial infections, especially in immunocompromised patients, or populations with otherwise suboptimal immune function such as the elderly and young children. Most antibiotics are derivatives of molecules that microbes secrete to kill each other, and as a defense, microbes are readily able to evolve antimicrobial resistance (AMR). Treating multi -resistant strain infections is one of the grand challenges of modern medicine, and therefore, it is pivotal to limit the emergence of resistant strains. Oral antibiotics can collaterally destroy the vast majority of commensal microbes, dramatically reducing microbial diversity in the gut and eventually leading to invasion and domination of the gut microbiota by resistant strains, the few surviving strains that can include opportunistic or obligate pathogens.

[0013] Chemotherapy treatments are also known to disrupt gut microbiota. In the case of some cancer treatments, antibiotics are administered in association with chemotherapy treatments. For example, patients with blood cancer who receive hematopoietic cell transplants (HCT) are treated with high doses of chemotherapy and / or radiation therapy. These medications lower the patient’s white blood cell count and destroy the diversity and balance in their gut microbiome, leaving patients prone to infections and complications. Many patients also receive a high dose of prophylactic or empirical antibiotics which further destroy the gut microbiome. It has also been shown that exposure to antibiotic therapy influences the probability' of response to immune checkpoint inhibitor (ICPI) therapy and is predictive of shorter patient survival across malignancies. It has also been shown that antibiotics influence the probability of response and positive treatment outcome of chimeric antigen receptor T cell (CAR T) therapy. It has been shown that loss of anaerobe bacteria is associated with loss of bacterial diversity , and it has been shown that loss of anaerobe bacteria is associated with decreased probability of response to CAR T therapy.

[0014] By disrupting the gut ecosystem, antibiotics and other therapies including chemotherapies and CAR-T therapies themselves can instigate downstream metabolic alterations within the microenvironment with complex repercussions to the tumour-host-microbe interface.

[0015] Additionally, other therapeutic treatments that can be administered in association with chemotherapy such as HCT cause large shifts in microbiota populations. It has been shown that the resulting low microbiota diversity at the time of neutrophil engraftment in patients undergoing HCT is associated with 5-fold increased transplant-related mortality, indicating that microbiota diversity is critical for clinical outcomes.

[0016] Furthermore, the administration of many human-targeted drugs has been linked to unintentional dysbiosis or dysbacteriosis in subjects. Such dysbiosis-causing drugs can include acidblocking medications such as proton-pump inhibitors (PPIs) and H2 blockers, birth control, steroids, antipsychotics, opioids, metformin, selective serotonin reuptake inhibitors (SSRIs), and nonsteroidal anti-inflammatory’ drugs (NSAIDs).

[0017] Furthermore, it has been shown that antibiotics directly kill and / or interfere with the natural growth of most gut microbiota bacteria commonly found in healthy subjects and can negatively impact response to immunotherapy; see e.g., Derosa et al. “Negative association of antibiotics on clinical activity’ of immune checkpoint inhibitors in patients with advanced renal cell and non-small-cell lung cancer.” Ann Oncol. 29(6): 1437-1444 (2018).

[0018] The disruption of gut microbiota can have severe health consequences including deleterious effects on the immune system, inflammation, secondary infections, and other complications. Accordingly, described herein are postbiotic compositions and methods for preventing or treating the disruption of gut microbiota. In some embodiments, such compositions can be used in methods for preventing or treating the disruption of gut microbiota as a result of a subject receiving an antibiotic treatment, a chemotherapy treatment, and / or administration of a dysbiosis-causing medication or medical treatments. Additionally, such compositions can be used in methods to reconstitute a microbiome damaged by one or many of the afore mentioned factors, or other factors.

[0019] Accordingly, in one aspect, described herein is a postbiotic composition comprising plant fiber material fermented in at least first and second successive stages with at least a first bacterial species in the first stage and at least a second bacterial species in the second stage. In agreement with, and as illustrated in the Examples set out herein, a first bacterial species as described herein is introduced in the first stage of fermentation, and a second bacterial species as described herein is introduced in the second stage of fermentation.

[0020] In some embodiments of any of the aspects, the plant fiber material comprises material from one plant species or a plurality of plant species.

[0021] In some embodiments of any of the aspects, the composition is treated to inactivate the bacterial species to generate the postbiotic composition.

[0022] In some embodiments of any of the aspects, the postbiotic composition comprises a liquid.

[0023] In some embodiments of any of the aspects, the postbiotic composition is dried.

[0024] In some embodiments of any of the aspects, the postbiotic composition is not processed other than inactivating the bacterial species.

[0025] In some embodiments of any of the aspects, the profile of microbial metabolites generated via the first and second successive stages differs from the profile of microbial metabolites generated when the first and second bacterial species are introduced in a single, combined fermentation stage.

[0026] In some embodiments of any of the aspects, the profile of organic acid metabolites generated via the first and second successive stages differs from the profile of organic acid metabolites generated when the first and second bacterial species are introduced in a single, combined fermentation stage.

[0027] In some embodiments of any of the aspects, the profile of microbial metabolites differs in the identity’ and / or amount of one or more such metabolites.

[0028] In some embodiments of any of the aspects, the postbiotic composition comprises microbial metabolite organic acids including acetic acid, citric acid, lactic acid and succinic acid.

[0029] In some embodiments of any of the aspects, the postbiotic composition comprises one or more short chain fatty acids selected from acetate, propionate and butyrate.

[0030] In some embodiments of any of the aspects, the postbiotic composition comprises ketone bodies.

[0031] In some embodiments of any of the aspects, the ketone bodies comprise Beta- hydroxybutyric acid (BHB; 3-hydroxybutyric acid).

[0032] In some embodiments of any of the aspects, the postbiotic composition comprises at least one bacterial metabolite selected from the group consisting of 3-hydroxybutyric acid, quercetin, phloionolic acid, wedelolactone, luteolin. N-[(2S)-2-hydroxypropanoyl]-L-leucine, an indole organic acid or a combination thereof.

[0033] In some embodiments of any of the aspects, the postbiotic composition comprises at least one metabolite selected from Table 2.

[0034] In some embodiments of any of the aspects, the postbiotic composition comprises at least 15% organic acids in the dried formulation.

[0035] In some embodiments of any of the aspects, the postbiotic composition comprises at least 0.1 ng DNA per gram of postbiotic composition.

[0036] In some embodiments of any of the aspects, the postbiotic composition comprises at least 1.0 ng DNA per gram of postbiotic composition.

[0037] In some embodiments of any of the aspects, the first successive stage of fermentation comprises two or more species of bacteria.

[0038] In some embodiments of any of the aspects, the second successive stage of fermentation comprises two or more species of bacteria that differ from the species used in the first successive stage.

[0039] In some embodiments of any of the aspects, the first and / or second successive stage of fermentation comprises at least one bacterial species belonging to a phylum selected from the group consisting of: Pseudomonadota. Bacillota. Bacteroidota, and Verrucomicrobiota.

[0040] In some embodiments of any of the aspects, the bacterial species of the Pseudomonadota phylum belongs to the genus Escherichia or Klebsiella.

[0041] In some embodiments of any of the aspects, the bacterial species of the Pseudomonadota phylum is Escherichia coli (E. coli; e.g., Nissle strain) or Klebsiella spp. (e.g.. characterized by rRNA of SEQ ID NO: 760).

[0042] In some embodiments of any of the aspects, the bacterial species of the Bacillota phylum belongs to a genus selected from the group consisting of: Clostridium, Faecalibacterium, Ruminococcus, Mediterraneibacter, Erysipelotrichaceae, Erysipelatoclostridium, Streptococcus, Roseburia, and Agathobacter.

[0043] In some embodiments of any of the aspects, the bacterial species of the Bacillota phylum is a species selected from the group consisting of: Clostridium scindens, Clostridium butyricum, Clostridium beijerinckii, Clostridium acetobutylicum, Faecalibacterium prausnitzii, Ruminococcus bromii, Ruminococcus spp, Mediterraneibacter gnavus, Mediterraneibacter torques, Erysipelotrichaceae, Erysipelatoclostridium, Streptococcus thermophilus, Streptococcus salivarius, Roseburia intestinalis, and Agathobacter rectalis.

[0044] In some embodiments of any of the aspects, the bacterial species of the Bacteroidota phylum belongs to a genus selected from the group consisting of: Bacteroides and Prevotella.

[0045] In some embodiments of any of the aspects, the bacterial species of the Bacteroidota phylum is a species selected from the group consisting of: Bacteroides thetaiotaomicron, Bacteroides ovatus, Bacteroides vulgatus, Bacteroides fragilis, Prevotella copri, Bacteroides dorei, Bacteroides uniformis, and Prevotella bivia.

[0046] In some embodiments of any of the aspects, the bacterial species of the Verrucomicrobiota phylum belongs to the genus Akkermansia.

[0047] In some embodiments of any of the aspects, the bacterial species of the Verrucomicrobiota phylum is: Akkermansia muciniphila.

[0048] In some embodiments of any of the aspects, the first and second bacterial species comprise a species from the Actinobacterium phylum and a species from the Bacillota phylum, respectively.

[0049] In some embodiments of any of tire aspects, the first and second bacterial species comprise Bifidobacterium and Lactobacillus species, respectively.

[0050] In some embodiments of any of the aspects, the plant fiber material comprises a leaf root, flower, berry, fruit, seed, or extract of one or more species of plant.

[0051] In some embodiments of any of the aspects, the plant fiber material is from at least one plant selected from the group consisting of: an herb of the Astragalus family; an herb of the Solanaceae or nightshade family; a berry of the Sambucus L. genus; a legume of the Lens oriental! s or Lens culinaris species; a berry of the Vaccinium genus; a berry of the Malpighia genus; a leaf from the Urtica genus; a seed from the Avena genus; a root from the Panax genus; and a root from the Curcuma genus.

[0052] In some embodiments of any of the aspects, (a) the herb of the Astragalus family is Astragalus membranaceus root; (b) the herb of the Solanaceae or nightshade family is ashwagandha root and / or leaf; (c) the berry of the Sambucus L. genus is elderberry; (d) the legume of the Lens orientalis or Lens culinaris species is a lentil; (e) the berry of the Vaccinium genus is a cranberry; (1) the berry of the Malpighia genus is acerola (Barbados cherry); (g) the leaf from the Urtica genus is a nettle; (h) the seed from the Avena genus is an oat top; (i) the root from the Panax genus is a ginseng root; or (j) the root from the Curcuma genus is a turmeric root.

[0053] In some embodiments of any of the aspects, the plant fiber material is from at least one plant material selected from the group consisting of: Astragalus membranaceus root; ashwagandha root and / or leaf; elderberry; lentil; cranberry: acerola (Barbados cheriy); nettle; oat top (oat seeds); ginseng root; and turmeric root.

[0054] In some embodiments of any of the aspects, the plant fiber material is from ashwagandha root and elderberry'.

[0055] In some embodiments of any of the aspects, the plant fiber material is from ashwagandha leaf and elderberry.

[0056] In some embodiments of any of the aspects, the plant fiber material is from ashwagandha root, ashwagandha leaf, and elderberry.

[0057] In some embodiments of any of the aspects, the plant fiber material is from a berry of the Vaccinium genus (e.g., cranberry).

[0058] In some embodiments of any of the aspects, the plant fiber material is in combination with a cyanobacterium of the genus Spirulina.

[0059] In some embodiments of any of the aspects, the plant fiber material is in combination with a mushroom.

[0060] In some embodiments of any of the aspects, the plant fiber material comprises polyphenols.

[0061] In one aspect, described herein is a pharmaceutical composition comprising a postbiotic composition as described herein and a pharmaceutically acceptable carrier.

[0062] In some embodiments of any of the aspects, the pharmaceutical composition is formulated for oral administration.

[0063] In some embodiments of any of the aspects, the pharmaceutical composition is formulated in an enteric release capsule.

[0064] In some embodiments of any of the aspects, the pharmaceutical composition is formulated in a colonic release capsule.

[0065] In some embodiments of any of the aspects, the pharmaceutical composition is formulated for release in the colon.

[0066] In one aspect, described herein is a method of modulating, stabilizing, or restoring the gut microbiome or treating a dysbiosis of a subject in need thereof, the method comprising administering a composition as described herein to the subject.

[0067] In some embodiments of any of the aspects, the subject has received or is receiving a treatment that disrupts the gut microbiome or promotes dysbiosis.

[0068] In some embodiments of any of the aspects, the treatment is selected from the group consisting of treatment with: a dysbiosis-causing drug, an antibiotic, chemotherapy, cancer immunotherapy, and vaccination.

[0069] In some embodiments of any of tire aspects, the subject has and / or has been diagnosed with a cancer, a microbial infection, an inflammatory disease, an autoimmune disease, or a neurological disease or disorder associated with a disruption in the gut-brain axis.

[0070] In some embodiments of any of the aspects, the neurological disease or disorder associated with a disruption in the gut-brain axis is selected from the group consisting of: Parkinson's disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and multiple system atrophy (MSA).

[0071] In some embodiments of any of the aspects, the subject has and / or has been diagnosed with a chronic disease (e.g., psychological stress) that alters the microbiome and / or is associated with dysbiosis.

[0072] In some embodiments of any of the aspects, the method which increases the efficacy of a cancer immunotherapy.

[0073] In some embodiments of any of the aspects, the method increases the efficacy of an immune checkpoint inhibitor therapy (e.g.. anti-PD-1).

[0074] In some embodiments of any of the aspects, the method decreases or prevents dysbiosis caused by cancer immunotherapy.

[0075] In some embodiments of any of the aspects, the method decreases or prevents graft versus host disease (GvHD) (e g., acute or chronic).

[0076] In one aspect, described herein is a postbiotic composition comprising Withcmia somnifera plant material and berry material or extract of the Sambucus genus fermented in successive fermentations with Bifidobacterium and then Lactobacillus species.

[0077] In some embodiments of any of the aspects, the postbiotic composition comprises a liquid.

[0078] In some embodiments of any of the aspects, the postbiotic composition is dried.

[0079] In some embodiments of any of the aspects, the postbiotic composition is not processed other than inactivating the bacterial species.

[0080] In some embodiments of any of the aspects, the berry material or extract of the Sambucus genus comprises elderberry material or extract.

[0081] In some embodiments of any of the aspects, the Bifidobacterium species comprises one or more of B. lactis, B. longum, and B. breve.

[0082] In some embodiments of any of the aspects, the Bifidob cterium species comprises one or more of B. lactis PBP1418518, B. longum PBP234451, and B. breve PBP2741300.

[0083] In some embodiments of any of tire aspects, the Lactobacillus species comprises one or more of L. paracasei, L. rhamnosus, and L. casei.

[0084] In some embodiments of any of tire aspects, the Lactobacillus species comprises one or more of L. paracasei PBP5197148, L. rhamnosus PBP4542118, and L. casei PBP4157051.

[0085] In some embodiments of any of the aspects, the postbiotic composition comprises hcat- inactivated Bifidobacterium and Lactobacillus. In some embodiments of any of the aspects, the Bifidobacterium and Lactobacillus bacteria are heat-inactivated following the successive fermentations.

[0086] In some embodiments of any of the aspects, the postbiotic composition comprises less than 1000 efu of inoculated bacteria per gram. In some embodiments of any of the aspects, the postbiotic composition comprises less than 5000 efu of inoculated bacteria per gram

[0087] In some embodiments of any of the aspects, the postbiotic composition further comprises a co-drying agent.

[0088] In some embodiments of any of the aspects, the co-drying agent comprises resistant maltodextrin, tapioca, or resistant starch.

[0089] In some embodiments of any of the aspects, the postbiotic composition was dried by lyophilization or spray -drying.

[0090] In some embodiments of any of the aspects, the dried postbiotic composition has a moisture content of <4% and water activity <0.2.

[0091] In some embodiments of any of the aspects, the postbiotic composition comprises organic acids including acetic acid, citric acid, lactic acid, and succinic acid.

[0092] In some embodiments of any of the aspects, the successive fermentations further include plant material of an herb in the Astragalus family; a berry of the Laccinium genus; a berry of the Malpighia genus; a leaf from the Urtica genus; a seed from the Avena genus; a root from the Panax genus; or a root from the Curcuma genus.

[0093] In some embodiments of any of the aspects, the postbiotic composition further comprises ribosomal RNA (rRNA) at least 95% identical to one or more of SEQ ID NO: 14-16 (B. lactis), SEQ ID NO: 17-20 (B. breve), SEQ ID NO: 21-26 or SEQ ID NO: 854 (B. longum subsp. infantis), SEQID NO: 767-851 (B. longum subsp. longum), SEQ ID NO: 852-853 (B. longum). SEQ ID NO: 27-32 (Z. plantarum), SEQ ID NO: 33-39 (Z. acidophilus), SEQ ID NO: 40-44 (Z. rhamnosus). SEQ ID NO: 45-48 (Z. paracasei), or SEQ ID NO: 49-52 (Z. casei).

[0094] In some embodiments of any of the aspects, the postbiotic composition further comprises rDNA at least 95% identical to one or more of SEQ ID NOs: 60-759.

[0095] In some embodiments of any of the aspects, the dried composition comprises a microorganism concentration from about 1.0 x 101CFU / g to about IxlO3CFU / g.

[0096] In some embodiments of any of the aspects, the postbiotic composition comprises non- viable cells, lysed cells, cell walls, bacterial nucleic acids, culture supernatant, and bacterial metabolites.

[0097] In some embodiments of any of the aspects, the postbiotic composition comprises at least one bacterial metabolite selected from the group consisting of 3-hydroxybutyric acid, quercetin, phloionolic acid, wedelolactone, luteolin, N-[(2S)-2-hydroxypropanoyl]-L-leucine, an indole organic acid or a combination thereof.

[0098] In some embodiments of any of tire aspects, the postbiotic composition comprises at least one metabolite selected from Table 2.

[0099] In some embodiments of any of the aspects, the postbiotic composition comprises one or more short chain fatty acid selected from acetic acid, propionic acid, and butyric acid.

[0100] In some embodiments of any of the aspects, the postbiotic composition comprises ketone bodies.

[0101] In some embodiments of any of the aspects, the ketone bodies comprise Betahydroxybutyric acid (BHB; 3-hydroxybutyric acid).

[0102] In some embodiments of any of the aspects, the postbiotic composition comprises at least 15% organic acids in the dried formulation.

[0103] In some embodiments of any of the aspects, the postbiotic composition comprises at least 15 billion non-live cells / gram.

[0104] In some embodiments of any of the aspects, the postbiotic composition comprises at least 0.1 ng DNA per gram of postbiotic composition.

[0105] In some embodiments of any of the aspects, the postbiotic composition comprises at least 1 .0 ng DNA per gram of postbiotic composition.

[0106] In some embodiments of any of the aspects, the postbiotic composition is formulated for oral delivery'.

[0107] In some embodiments of any of the aspects, the postbiotic composition is formulated in an enteric release capsule.

[0108] In some embodiments of any of the aspects, the postbiotic composition is formulated in a colonic release capsule.

[0109] In some embodiments of any of the aspects, the postbiotic composition is formulated for release in the colon.

[0110] In some embodiments of any of the aspects, the postbiotic composition is formulated for topical delivery to the skin.

[0111] In some embodiments of any of the aspects, the composition is formulated as a tablet, pill, capsule, or microcapsule.

[0112] In one aspect, described herein is a postbiotic composition comprising berry material or extract of the Vaccinium genus (e.g., a cranberry ) fermented in successive fermentations with Bifidobacterium and then Lactobacillus species.

[0113] In one aspect, described herein is a pharmaceutical composition comprising a composition as described herein, and a pharmaceutically acceptable carrier.

[0114] In one aspect, described herein is a method of preparing a postbiotic composition, the method comprising: (a) inoculating a substrate composition comprising plant material comprising fermentable fiber and water sufficient to suspend or submerge the plant material with a first bacterial inoculum; (b) maintaining the inoculated substrate prepared in (a) under anaerobic conditions, at a temperature and for a time sufficient to permit growth of the first bacterial inoculum thereby producing a primary fermented composition; (c) inoculating the primary' fermented composition produced in step (b) with a second bacterial inoculum; (d) maintaining the composition formed in step (c) under anaerobic conditions at a temperature and for a time sufficient to permit growth of the second bacterial inoculum to produce a secondary fermented composition; (e) inactivating the bacteria in the secondary fermented composition; and (I) drying the secondary' fermented composition, thereby producing a dried postbiotic composition.

[0115] In some embodiments of any of the aspects, the first bacterial inoculum comprises one or more species of Bifidobacterium.

[0116] In some embodiments of any of the aspects, the first bacterial inoculum comprises two or more species of Bifidobacterium.

[0117] In some embodiments of any of the aspects, the first bacterial inoculum comprises three or more species of Bifidobacterium.

[0118] In some embodiments of any of the aspects, the first bacterial inoculum consists essentially of Bifidobacterium species.

[0119] In some embodiments of any of the aspects, the first bacterial inoculum consists essentially of tw o Bifidobacterium species.

[0120] In some embodiments of any of tire aspects, the first bacterial inoculum consists essentially of three Bifidobacterium species.

[0121] In some embodiments of any of the aspects, the Bifidobacterium species are selected from B. lactis, B. longum and B. breve.

[0122] In some embodiments of any of the aspects, the second bacterial inoculum comprises one or more species of Lactobacillus.

[0123] In some embodiments of any of the aspects, the second bacterial inoculum comprises two or more species of Lactobacillus.

[0124] In some embodiments of any of the aspects, the second bacterial inoculum comprises three or more species of Lactobacillus.

[0125] In some embodiments of any of the aspects, the second bacterial inoculum consists essentially of Lactobacillus species.

[0126] In some embodiments of any of the aspects, the second bacterial inoculum consists essentially of tw o Lactobacillus species.

[0127] In some embodiments of any of the aspects, the second bacterial inoculum consists essentially of three Lactobacillus species.

[0128] In some embodiments of any of the aspects, the Lactobacillus species are selected from L. paracasei, L. rhamnosus, and L. casei.

[0129] In some embodiments of any of the aspects, the method further comprises inoculating the substrate composition of step (a) or the primary fermented composition produced in step (b) with one or more of a bacterial species belonging to a phylum selected from the group consisting of: Pseudomonadota, Bacillota, Bacteroidota. and Verrucomicrobiota.

[0130] In some embodiments of any of the aspects, the bacterial species of the Pseudomonadota phylum belongs to the genus Escherichia or Klebsiella.

[0131] In some embodiments of any of the aspects, the bacterial species of the Pseudomonadota phylum is Escherichia coli (E. coir, e.g., Nissle strain) or Klebsiella spp. (e.g., characterized by rRNA of SEQ ID NO: 760).

[0132] In some embodiments of any of the aspects, the bacterial species of the Bacillota phylum belongs to a genus selected from the group consisting of: Clostridium, Eaecalibacterium, Ruminococcus, Mediterraneibacter, Erysipelotrichaceae, Erysipelatoclostridium, Streptococcus, Roseburia, and Agathobacter.

[0133] In some embodiments of any of the aspects, the bacterial species of the Bacillota phylum is a species selected from the group consisting of: Clostridium scindens, Clostridium butyricum, Clostridium beijerinckii, Clostridium acetobutylicum, Eaecalibacterium prausnitzii, Ruminococcus bromii, Ruminococcus spp, Mediterraneibacter gnavus, Mediterraneibacter torques, Erysipelotrichaceae, Erysipelatoclostridium, Streptococcus thermophilus, Streptococcus salivarius, Roseburia intestinalis, and Agathobacter rectalis.

[0134] In some embodiments of any of the aspects, the bacterial species of the Bacteroidota phylum belongs to a genus selected from the group consisting of: Bacteroides and Prevotella.

[0135] In some embodiments of any of the aspects, the bacterial species of the Bacteroidota phylum is a species selected from the group consisting of: Bacteroides thetaiotaomicron, Bacteroidesovatus, Bacteroides vulgatus, Bacteroides fragilis, Prevotella copri, Bacteroides dorei, Bacteroides unijormis, and Prevotella bivia.

[0136] In some embodiments of any of the aspects, the bacterial species of the Verrucomicrobiota phylum belongs to the genus Akkermansia.

[0137] In some embodiments of any of the aspects, the bacterial species of the Verrucomicrobiota phylum is: Akkermansia muciniphila.

[0138] In some embodiments of any of the aspects, the substrate composition in step (a) is adjusted to a pH of about 6.6 prior to addition of the first bacterial inoculum, and wherein the pH of the fermented composition produced in step (b) is about 4.0.

[0139] In some embodiments of any of the aspects, the method further comprises the step, after step (b) and before step (c). of adjusting the pH of the fermented composition to about 6.6.

[0140] In some embodiments of any of the aspects, the pH of the secondary fermented composition produced in step (d) is about 3.8.

[0141] In some embodiments of any of tire aspects, the secondary’ fermented composition produced in step (d) comprises at least 15g / liter of organic acids.

[0142] In some embodiments of any of the aspects, inoculating the substrate composition comprises purging the fermenter with nitrogen gas such that the percentage of oxygen in the fermenter is maintained < 1.5%.

[0143] In some embodiments of any of the aspects, the plant material comprising fermentable fiber is a dry' powder prior to addition to water.

[0144] In some embodiments of any of the aspects, the plant material comprising fermentable fiber comprises Withania somnifera plant material and berry material or extract of the Sambucus genus (e.g., elderberry).

[0145] In some embodiments of any of the aspects, the plant material comprising fermentable fiber comprises berry material or extract of the Vaccinium genus (e.g., cranberry).

[0146] In some embodiments of any of the aspects, the plant material comprising fermentable fiber further comprises an herb in the Astragalus family.

[0147] In some embodiments of any of the aspects, the substrate composition of step (a) further comprises one or more of added glucose, sucrose, fructose, honey, and molasses.

[0148] In some embodiments of any of the aspects, the substrate composition of step (a) further comprises about 3.5% sucrose.

[0149] In some embodiments of any of the aspects, maintaining step (b) is performed for about 48 horns.

[0150] In some embodiments of any of the aspects, maintaining step (d) is performed for about 48 horns to 10 days.

[0151] In some embodiments of any of tire aspects, inactivating step (e) comprises heat treatment or gamma irradiation.

[0152] In some embodiments of any of the aspects, heat treatment comprises pasteurization.

[0153] In some embodiments of any of the aspects, inactivating step (e) comprises heat treatment, lyophilization, ultrasonic disruption, freeze-thaw, and gamma irradiation.

[0154] In some embodiments of any of the aspects, the dried postbiotic composition comprises less than 1000 cfu / g of inoculated bacteria.

[0155] In some embodiments of any of the aspects, the method further comprises, after step (e), the addition of a co-drying agent to the secondary fermented composition.

[0156] In some embodiments of any of the aspects, the co-drying agent comprises resistant maltodextrin, tapioca, or resistant starch.

[0157] In some embodiments of any of tire aspects, the co-drying agent is added at about 1 : 1 ratio (weightweight or weightvolume) relative to total solid content in the fermentation.

[0158] In some embodiments of any of tire aspects, drying step (f) comprises lyophilization or spray drying.

[0159] In some embodiments of any of the aspects, the dried postbiotic composition has a moisture content of <4% and water activity <0.2.

[0160] In some embodiments of any of the aspects, the postbiotic composition comprises organic acids including acetic acid, citric acid, lactic acid and succinic acid.

[0161] In some embodiments of any of the aspects, the substrate further includes plant material of an herb in the Astragalus family.

[0162] In some embodiments of any of the aspects, the postbiotic composition further comprises rRNA at least 95% identical to one or more of SEQ ID NO: 14-16 (B. lactis). SEQ ID NO: 17-20 (B. breve), SEQ ID NO: 21-26 or SEQ ID NO: 854 (B. longum subsp. infantis), SEQ ID NO: 767-851 (B. longum subsp. longum), SEQ ID NO: 852-853 (B. longum), SEQ ID NO: 27-32 (L. plantarum), SEQ ID NO: 33-39 L. acidophilus). SEQ ID NO: 40-44 (L. rhamnosus), SEQ ID NO: 45-48 (L. paracasei), or SEQ ID NO: 49-52 (7.. casei).

[0163] In some embodiments of any of the aspects, the postbiotic composition further comprises rDNA at least 95% identical to one or more of SEQ ID NOs: 60-759.

[0164] In some embodiments of any of the aspects, the postbiotic composition comprises non- viable cells, lysed cells, cell walls, bacterial nucleic acid, culture supernatant, and bacterial metabolites.

[0165] In one aspect, described herein is a postbiotic composition produced by a method as described herein.

[0166] In one aspect described herein is a method of preparing a postbiotic composition, the method comprising: (a) providing a fermentation substrate comprising plant material comprising prebiotic fiber; (b) providing a culture of one or more Bifidobacterium bacterial species and a culture of one or more Lactobacillus bacterial species; (c) inoculating the fermentation substrate in first and second stages with the cultures of Bifidobacterium and Lactobacillus species; (d) incubating theinoculated fermentation substrate of (c) under conditions and for a time sufficient to generate a postbiotic composition comprising bacterial metabolites and organic acids; and (e) inactivating the bacterial species; whereby a postbiotic composition is prepared.

[0167] In one aspect, described herein is a method of modulating, stabilizing, or restoring the gut microbiota of a subject, the method comprising administering to the subject an amount of a composition as described herein effective to modulate, stabilize or restore the gut microbiota of the subject.

[0168] In some embodiments of any of the aspects, the subject is a healthy subject.

[0169] In some embodiments of any of the aspects, the subject has and / or has been diagnosed with a cancer, a microbial infection, an inflammatory disease, an autoimmune disease, or a neurological disease or disorder associated with a disruption in the gut-brain axis.

[0170] In some embodiments of any of the aspects, the neurological disease or disorder associated with a disruption in the gut-brain axis is selected from the group consisting of: Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and multiple system atrophy (MSA).

[0171] In some embodiments of any of the aspects, the subject has and / or has been diagnosed with a chronic disease (e.g., psychological stress) that alters the microbiome and / or is associated with dysbiosis.

[0172] In some embodiments of any of the aspects, the method increases the efficacy of a cancer immunotherapy.

[0173] In some embodiments of any of the aspects, the method increases the efficacy of an immune checkpoint inhibitor therapy (e.g., anti-PD-1).

[0174] In some embodiments of any of the aspects, the method decreases or prevents dysbiosis caused by cancer immunotherapy.

[0175] In some embodiments of any of the aspects, the method decreases or prevents graft versus host disease (GvHD) (e.g.. acute or chronic).

[0176] In one aspect, described herein is a method of treating or preventing disruption of the immune system due to gut dysbiosis caused by lifestyle, stress, or associated with an antibiotic treatment, chemotherapy treatment, or administration of a dysbiosis-causing medication or medical treatment in a subject, the method comprising administering to the subject an amount of a composition as described herein effective to treat or prevent the disruption.

[0177] In some embodiments of any of the aspects, the medical treatment comprises a cancer immunotherapy.

[0178] In some embodiments of any of the aspects, the cancer immunotherapy comprises immune checkpoint modulator / inhibitor therapy, hematopoietic cell transplantation therapy, CAR-T therapy, a dendritic cell vaccine, or any other approach that facilitates or activates an immune cell response against a cancer.

[0179] In some embodiments of any of the aspects, the medical treatment comprises vaccination.

[0180] In some embodiments of any of the aspects, the medical treatment comprises treatment with a dysbiosis-causing drug.

[0181] In some embodiments of any of the aspects, the dysbiosis-causing drug is selected from the group consisting of acid-blocking medications, proton-pump inhibitors (PPIs), H2 blockers, birth control, steroids, antipsychotics, opioids, metformin. SSRIs, nonsteroidal anti-inflammatory drugs (NSAIDs). and any combination thereof.

[0182] In one aspect, described herein is a method of treating cancer, the method comprising administering a cancer immunotherapy and administering a composition as described herein to a subject in need thereof, wherein the administering is effective to treat the cancer.

[0183] In one aspect, described herein is a method of treating cancer, the method comprising administering a CAR-T therapy and administering a composition as described herein to a subject in need thereof, wherein the administering is effective to treat the cancer.

[0184] In one aspect, described herein is a method of treating cancer, the method comprising administering chemotherapy and administering a composition as described herein to a subject in need thereof, wherein the administering is effective to treat cancer.

[0185] In one aspect, described herein is a method of treating an autoimmune disease, the method comprising administering an autoimmune disease therapy and administering a composition as described herein to a subject in need thereof, wherein the administering is effective to treat the autoimmune disease.

[0186] In one aspect, described herein is a method of treating or preventing graft versus host disease (GvHD), the method comprising administering a GvHD disease therapy and administering a composition as described herein to a subject in need thereof, wherein the administering is effective to treat or prevent the GvHD.

[0187] In one aspect, described herein is a method of treating an inflammatory disease, the method comprising administering an anti-inflammatory therapy and administering a composition as described herein to a subject in need thereof, wherein the administering is effective to treat the inflammatory disease.

[0188] In one aspect, described herein is a method of treating an infection, the method comprising administering at least one antibiotic and administering a composition as described herein to a subject in need thereof, wherein the administering is effective to treat the infection.

[0189] In one aspect, described herein is a method of increasing neutrophil engraftment. the method comprising administering an effective amount of a composition as described herein to a subject in need thereof.

[0190] In one aspect, described herein is a method of treating or preventing intestinal mucositis associated with chemotherapy, the method comprising administering chemotherapy and administeringa composition as described herein to a subject in need thereof, wherein the administering is effective to treat or prevent the intestinal mucositis.

[0191] In some embodiments of any of the aspects, administering the composition is associated with at least one of the following outcomes, as compared to a subject not receiving the composition or the treated subject prior to being administered the composition: decreased incidence of cancer relapse (e.g., relapse-free); increased cancer survival; decreased time to neutrophil engraftment; increased peripheral blood mononuclear cell recovery trajectories (e.g., higher peripheral blood mononuclear cell counts); decreased incidence of febrile neutropenia; decreased blood stream infection incidence; and / or decreased 30-day readmission events.

[0192] In some embodiments of any of the aspects, administering the composition in combination with chemotherapy is associated with an improvement in intestinal mucositis associated with the chemotherapy, as compared to a subject not receiving the composition or the treated subject prior to being administered the composition.

[0193] In one aspect, described herein is a method of improving non-human animal health, the method comprising administering to a non-human animal an animal feed comprising a postbiotic composition comprising berry material or extract of the Vaccinium genus (e.g., a cranberry ) fermented in successive fermentations with Bifidobacterium and then Lactobacillus species.

[0194] In some embodiments of any of the aspects, the method increases diversity in the gut microbiome of the subject.

[0195] In one aspect, described herein is a method of increasing gut microbiome diversity in a subject, the method comprising administering to the subject an amount of a composition as described herein effective to increase gut microbiome diversity'.

[0196] In one aspect, described herein is a method of treating a synucleinopathy, the method comprising administering an effective amount of a postbiotic composition to a subject in need thereof, wherein the administering is effective to treat the synucleinopathy. wherein the postbiotic composition comprises the products of successive fermentation of herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, with a first fermentation comprising at least one Bifidobacterium species and a second fermentation comprising at least one Lactobacillus species.

[0197] In one aspect, described herein is a method of treating a synucleinopathy, the method comprising administering an effective amount of a postbiotic composition to a subject in need thereof, wherein the administering is effective to treat the synucleinopathy, wherein the postbiotic composition is prepared according to a process comprising: (a) providing a fermentation substrate comprising plant material comprising prebiotic fiber; (b) providing a culture of one or more Bifidobacterium bacterial species and a culture of one or more Lactobacillus bacterial species; (c) inoculating the fermentation substrate in first and second stages with the cultures of Bifidobacterium and Lactobacillus species; (d) incubating the inoculated fermentation substrate of (c) under conditions and for a time sufficient togenerate a postbiotic composition comprising bacterial metabolites and organic acids; and (e) inactivating the bacterial species.

[0198] In some embodiments of any of the aspects, the disease or disorder is selected from the group consisting of: Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and multiple system atrophy (MSA).

[0199] In some embodiments of any of the aspects, the disease or disorder is Parkinson’s disease.

[0200] In some embodiments of any of the aspects, the disease or disorder is REM SleepBehavior Disorder.

[0201] In some embodiments of any of the aspects, administering the postbiotic composition is associated with at least one of the following outcomes, as compared to a negative control such as a subject not receiving the postbiotic composition or the treated subject prior to being administered the postbiotic composition: higher diversity in microbiome; higher abundance of beneficial microbiome species (e.g., Faecalibacterium, Akkermansia, and / or Ruminococcus); decreased abundance of pathogenic or non-bcncficial microbiomc species (e.g., Scardovia, Escherichia-Shigella, and / or Streptococcus)', decreased alpha-sy nuclein accumulates or inclusions (e.g., in samples from the stool, colon, gut, skin, and / or CSF); decreased inflammatory cytokines (e.g., tumor necrosis factor-alpha (TNFa), interleukin- ip (IL- 1(3), and / or interleukin-6 (IL-6)); decreased immune activation; decreased constipation; decreased stool hardness; decreased bowel movement frequency; decreased incidence or severity of sleep behavior disorders; decreased incidence or severity of Parkinson’s symptoms (e.g., tremor in hands, arms, legs, jaw, or head; muscle stiffness; slowness of movement; impaired balance and coordination); increased cognitive function; decreased depression; decreased anxiety; and / or increased quality of life.

[0202] In some embodiments of any of the aspects, administering the postbiotic composition in combination with a synucleinopathy treatment is associated with an improvement in intestinal mucositis, as compared to a negative control such as a subject not receiving the postbiotic composition or the treated subject prior to being administered the postbiotic composition.BRIEF DESCRIPTION OF THE DRAWINGS

[0203] In order to describe the manner in which the advantages and features of the disclosure can be obtained, reference is made to embodiments thereof which are illustrated in the appended drawings. Understanding that these drawings depict only exemplary embodiments of the disclosure and are not therefore to be considered limiting of its scope, the principles herein are described and explained with additional specificity and detail through the use of the accompanying drawings.

[0204] FIG. 1A-1C is a series of schematics and graphs showing an exemplary pipeline for microbiome product development. FIG. 1A shows a schematic to visualize the procedure by which machine-learning aided analysis of ecological microbiome assembly paths from human data to generate candidate assembly strategies; see e.g., Liao et al. “Compilation of longitudinal microbiota data and hospitalome from hematopoietic cell transplantation patients,” Scientific Data 8, Articlenumber: 71 (2021), the contents of which are incorporated herein by reference in its entirety. Large longitudinal human microbiome data is used to define characteristic states of different diversity levels (symbols: states, shade of grey: average diversity level in state); transitions of microbiome states observed in individual subject time courses reveal characteristic ecosystem community assembly paths to inform in vitro experiments mimic a similar assembly path. FIG. IB shows longitudinal amplicon-based sequencing of candidate bacterial consortia in a lab scale fermentation process to over time to analyze optimal assembly strategies that define fermentation processes; the experiment revealed community assembly paths in lab scale fermentations (3 repeats per candidate strategy, sequencing data from 3 timepoints). “(p)-BLC” stands for a strategy where Bifidobacteriales strains were inoculated the 0 hour time point, followed by Lactobacillales strains 48 hours after, and Clostridiales strains another 24 hours later (72 hours relative to start); “(p)-BL” stands for a strategy where Bifidobacteriales strains were inoculated on the 0 hour time point, followed by Lactobacillales strains 48 hours after; and “(p)-LB” stands for a strategy where Lactobacillales strains were inoculated on the 0 hour time point, followed by Bifidobacteriales strains 48 hours after. At three timepoints (62 hours, 98 hours, and 170 hours), community profiling was conducted by 16S rRNA gene amplicon sequencing to trace community assembly; the strategy that maximized cumulative ecological distances was selected for further testing. FIG. 1C shows the cumulative ecological distance of the three strategies. The pathway resulting in the maximum ecological distance was “3 (p)- BL”, which defined the further-refined fermentation strategy termed "B2L2" for production purposes (e.g., including carrier compounds to make the fermentation material flow better through the valves of the bioreactors; for more details about the B2L2 method, see e.g., Example 1).DETAILED DESCRIPTION

[0205] The present disclosure provides methods for preparing and using postbiotic compositions with advantageous metabolite and secondary metabolite and organic acid levels and profiles to treat or prevent dysbiosis and associated conditions. Postbiotics comprise primary and secondary metabolic products, molecular cues that can be membrane-bound or dissolved, secreted products created by probiotic microorganisms, and / or components of microbial substrates converted or not by microbial activity that influence the gut microbiome and its host.

[0206] The presently disclosed gut microbiome protecting postbiotic compositions can be prepared according to a process that uses successive fermentation, e.g., at least first and second successive stages of fermentation. The successive fermentation also mimics early developmental environments of the healthy microbiomc and promotes microbial diversity. In particular, the presently disclosed compositions provide probiotics combined with fermented herbal substrates in a particular successive order, and produced postbiotic compositions comprise compounds from microbial activity that protect, stimulate, and stabilize a healthy gut ecosystem. It has been surprisingly discovered that the successive fermentation provides postbiotic compositions with metabolite profiles that can be used to treat or prevent disruption of the microbiome. In particular, the successive fermentation results inpostbiotic compositions with elevated advantageous metabolites, such as 3 -hydroxy butyric acid, quercetin, phloionolic acid, wedelolactone, luteolin. N-[(2S)-2-hydroxypropanoyl]-L-leucine, ketone bodies, organic acids such as citric acid, succinic acid, lactic acid, glycerol and acetic acid, as well as indole organic acids, and vitamin C.

[0207] As used herein, the term “postbiotic” or “postbiotics” is defined as the metabolites in. the secondary metabolites of. and the secretions, membrane proteins, intra- and / or extra- cellular components of a microbial community. As a non-limiting example, postbiotic compositions can comprise any of the following: non-viable cells, lysed or otherwise fragmented cells, cells disrupted by viruses or phages or ultrasound, cell walls, nucleic acids, and / or metabolites, or combinations thereof. The postbiotic compositions described herein can influence immune system-based therapies because they contribute to immunomodulatory properties.

[0208] In one aspect, ecological diversity was increased in a postbiotic composition, which yielded a significantly higher level of organic acids, e.g., greater than 15% of the dried formula and greater than 15 billion total dead cells per dose (e.g., 400 mg).

[0209] In one aspect, common patterns were identified from earliest, least diverse, most “damaged” communities, which are rich in Lactobacillales and Bifidobacteria. These bacteria facilitate the growth of more mature microbiomes.

[0210] In one aspect, optimizing for ecological diversity allowed for growth ranging from 72 hours to 96 hours (e.g., for both stages of successive fermentation).

[0211] In one aspect, computational analyses showed that competition prevents the dominance of one species and allows for a more complex metabolite profile and protects diversity.

[0212] Exemplary' amounts in the final dried material includes more than 15% organic acids, including 3-Hydroxybutyric acid. 6-Methoxysalicylic acid, trans-caffeic acid. Phloroglucinol carboxylic acid, 1. 6. 8-trimethyl-allantoate. Vitamin C, wedelolactone. 9, 10-Dihydroxy stearic acid. Isorhamnetin, Pseudopurpurin. Quercetin. Luteolin, 2-Ethylglutaric acid, and Phloionolic acid (see e.g., Table 2). In some embodiments of any of the aspects, the indole organic acids comprise indole- 3-acetate and / or indole-3-lactate.

[0213] In some embodiments of any of the aspects, the oral postbiotic formulation is for the treatment or prevention of disruption of gut microbiota or dysbiosis. In some embodiments of any of the aspects, the oral postbiotic formulation is for the treatment or prevention of immune dysregulation. In some embodiments of any' of the aspects, the oral postbiotic formulation is for the treatment or prevention of dysbiosis or dysbacteriosis associated with a chemotherapy' treatment in a subject. In some embodiments of any of the aspects, the oral postbiotic formulation is for the treatment or prevention of dysbiosis or dysbacteriosis associated with cancer immunotherapy , including but not limited to immune checkpoint modulator / inhibitor therapy, hematopoietic cell transplantation therapy and CAR-T therapy, or vaccination (e.g., a dendritic cell vaccine). In some embodiments of any of the aspects, the oral postbiotic formulation is for the prevention or treatmentof the disruption of the gut-brain axis in a neurological disease or disorder such as: a synucleinopathy; Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and / or multiple system atrophy (MSA).Fermentation Substrate Compositions

[0214] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition. In one aspect, the fermentation substrate used to produce tire postbiotic composition comprises plant fiber material with at least a first bacterial species (e.g., during the first successive stage of fermentation); at least a second bacterial species can be added during the second successive stage of fermentation. In another aspect, the fermentation substrate used to produce the postbiotic composition comprises Withania somnifera plant material and berry material or extract of the Sambucus genus with at least one Bifidobacterium (e.g., during the first successive stage of fermentation); at least one Lactobacillus species can be added during the second successive stage of fermentation. Further non-limiting examples of plant fiber material and bacterial species are provided herein.Plant Fiber Material

[0215] In some embodiments of any of the aspects, the fermentation substrate is or comprises plant fiber material. In some embodiments, the plant fiber material comprises material from one plant species or a plurality of plant species. In some embodiments of any of the aspects, the fermentation substrate is or comprises an herbal substrate composition or herbal material. In some embodiments of any of the aspects, the plant fiber material, substrate composition, or herbal material comprises: at least one of an herb of the Astragalus family, an herb of the Solanaceae or nightshade family, a berry of the Sambucus L. genus, a legume of the Lens orientalis or Lens culinaris species, a berry of the Vaccinium genus, a berry of the Malpighia genus, a leaf from the Urtica genus, a seed from the A vena genus, a root from the Panax genus, and / or a root from the Curcuma genus. In some embodiments, the substrate composition also comprises liquid water, e.g., sufficient to suspend or submerge the plant substrate material.

[0216] In some embodiments, the herb of the Astragalus family is Astragalus membranaceus root. In some embodiments, the herb of the Solanaceae or nightshade family is ashwagandha root. In some embodiments, the herb of the Solanaceae or nightshade family is ashwagandha leaf. In some embodiments, the herb of the Solanaceae or nightshade family is ashwagandha root and leaf. In some embodiments, the berry of the Sambucus L. genus is elderberry. In some embodiments, the legume of the Lens orientalis or Lens culinaris species is a lentil. In some embodiments, the berry of the Vaccinium genus is a cranberry. In some embodiments, the berry of the Malpighia genus is acerola (Barbados cherry). In some embodiments, the leaf from the Urtica genus is a nettle. In some embodiments, the seed from the Avena genus is an oat top. In some embodiments, the root from thePanax genus is a ginseng root. In some embodiments, the root from the Curcuma genus is a turmeric root.

[0217] In some embodiments, the plant fiber material is from at least one plant material selected from the group consisting of: Astragalus membranaceus root; ashwagandha root and / or leaf; elderberry; lentil; cranberry; acerola (Barbados cherry); nettle; oat top (oat seeds); ginseng root; and turmeric root; or any combination thereof. In one non-limiting example, the plant fiber material is from ashwagandha root and elderberry. In another non-limiting example, the plant fiber material is from ashwagandha leaf and elderberry.

[0218] In some embodiments, the plant fiber material comprises a leaf, root, flower, berry, fruit, seed, or extract of one or more species of plant, or any combination thereof. In some embodiments, the plant fiber material comprises a root (e.g., Astragalus; ashwaganda; ginseng; turmeric). In some embodiments, the plant fiber material comprises a berry (e.g., elderberry, cranberry, acerola). In some embodiments, the plant fiber material comprises a leaf (e.g., nettle, ashwaganda). In some embodiments, the plant fiber material comprises a seed (e.g., lentil, oat top, legume, bean). In some embodiments, the plant fiber material comprises a flower. In some embodiments, the plant fiber material comprises a fruit. In some embodiments, the plant fiber material comprises an extract, such as an extract of a leaf, root, flower, berry, fruit, or seed. Non-limiting examples of combinations of plant fiber materials are provided in Table 7 and Table 8.

[0219] Table 7: Exemplary combinations of plant fiber materials

[0220] In some embodiments, the plant fiber material comprises material from a plurality of (e.g., at least 2, 3,4 5, 6, 7, 8, 9. 10, or more) plant species, non-limiting examples of which are provided in Table 8 below.

[0221] Table 8: Exemplary combinations of plant fiber materials

[0222] In Table 8, “1st” designates a first plant fiber material, and “2nd” designates a second plant fiber material, as represented by the following letter code:(a) the herb of the Astragalus family (e.g.. Astragalus membranaceus root);(b) the herb of the Solanaceae or nightshade family (e g.. ashwagandha root and / or leaf):(c) the hern of the Sambucus L. genus (e.g.. elderberry);(d) the legume of the Lens orientalis or Lens culinaris species (e.g.. a lentil);(e) the hern of the Vaccinium genus (e.g., a cranberry);< f) the berryrof the Malpighia genus (e.g.. acerola (Barbados cherry));(g) the leaf from the Urtica genus (e.g., a nettle);(h) the seed from the Avena genus (e.g., an oat top);(i) the root from the Panax genus (e.g., a ginseng root); and(j) the root from the Curcuma genus (e.g., a turmeric root).

[0223] In some embodiments of any of the aspects, the herbal material is provided as a dried powder prior to combination with water. In some embodiments of any of the aspects, the dried powder comprises dried powder of a juice.

[0224] In some embodiments of any of the aspects, the herb of the Astragalus family is Astragalus membranaceus. In some embodiments of any of the aspects, the herb of the Astragalus family is Astragalus membranaceus root. In some embodiments of any of the aspects, the herb is provided as a dried powder.

[0225] In some embodiments of any of the aspects, the herb of the Solanaceae or nightshade family is ashwagandha root. In some embodiments of any of the aspects, the herb of the Solanaceae or nightshade family is ashwagandha leaf. In some embodiments of any of the aspects, the herb is provided as a dried powder.

[0226] In some embodiments of any of tire aspects, the berry of the Sambucus L. genus is elderberry. In some embodiments of any of the aspects, the berry is provided as a dried powder.

[0227] In some embodiment of any of the aspects s, the legume of the Lens orientalis or Lens culinaris family is a lentil. In some embodiments of any of the aspects, the legume is red lentil. In some embodiments of any of the aspects, the legume is provided as a dried powder.

[0228] In some embodiments of any of the aspects, the fermentation substrate comprises at least an herb of the Astragalus family and an herb of the Solanaceae or nightshade family. In some embodiments of any of the aspects, the fermentation substrate comprises an herb of the Astragalus family and a berry of the Sambucus L. genus. In some embodiments of any of the aspects, the fermentation substrate comprises an herb of the Astragalus family and a legume of the Lens orientalis or Lens culinaris family. In some embodiments of any of the aspects, the fermentation substrate comprises an herb of the Astragalus family, an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus. In some embodiments of any of the aspects, the fermentation substrate comprises an herb of the Astragalus family, an herb of the Solanaceae or nightshade family and a legume of the Lens orientalis or Lens culinaris family. In some embodiments of any of the aspects, the fermentation substrate comprises an herb of the Astragalus family, a berry of the Sambucus L. genus and a legume of the Lens orientalis or Lens culinaris family. In some embodiments of any of the aspects, the fermentation substrate comprises an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus. In some embodiments of any of the aspects, the fermentation substrate comprises ashwagandha root and elderberry (e.g.. elderberry juice). In some embodiments of any of the aspects, the fermentation substrate comprises ashwagandha leaf and elderberry (e.g., elderberry7juice). In some embodiments of any of the aspects, the fermentation substrate comprises ashwagandha root, ashwagandha leaf, and elderberry7(e.g., elderberry juice). In some embodiments of any of the aspects, the fermentation substrate comprises an herb of the Solanaceae or nightshade family and a legume of the Lens orientalis or Lens culinaris family. In some embodiments of any of the aspects, the fermentation substrate comprises an herb of theSolanaceae or nightshade family, a berry of the Sambucus L. genus and a legume of the Lens orientalis or Lens culinaris family. In some embodiments of any of the aspects, the fermentation substrate comprises a berry of the Sambucus L. genus and a legume of the Lens orientalis or Lens culinaris family. In some embodiments of any of the aspects, an herb of the Astragalus family, an herb of the Solanaceae or nightshade family, a berry' of the Sambucus L. genus and a legume of the Lens orientalis or Lens culinaris family.

[0229] In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus and Ashwagandha. In some embodiments of any' of the aspects, the fermentation substrate comprises Astragalus and elderberry. In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus and red lentil. In some embodiments of any of the aspects, the fermentation substrate comprises ashwagandha and elderberry. In some embodiments of any of the aspects, the fermentation substrate comprises elderberry' and red lentil. In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus, ashwagandha and elderberry . In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus, ashwagandha and red lentil. In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus, elderberry and red lentil.

[0230] In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus membranaceus root and Ashwagandha. In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus membranaceus root and elderberry. In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus membranaceus root and red lentil. In some embodiments of any of the aspects, the fermentation substrate comprises ashwagandha and elderberry. In some embodiments of any of the aspects, the fermentation substrate comprises elderberry and red lentil. In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus membranaceus root, ashwagandha and elderberry. In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus membranaceus root, ashwagandha and red lentil. In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus membranaceus root, elderberry and red lentil. In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus membranaceus root, ashwagandha, elderberry and red lentil.

[0231] In some embodiments, the plant fiber material comprises material from: pea. oats, beets, juniper, buckwheat, dandelion, chamomile, burdock, broccoli, alfalfa, calendula, plantain, chlorella, or any combination thereof.

[0232] In some embodiments, the plant fiber material comprises material from pea plant species Pisum sativum (Family: Fabaceae).

[0233] In some embodiments, the plant fiber material comprises material from oats plant species Avena sativa (Family: Poaceae).

[0234] In some embodiments, the plant fiber material comprises material from beets plant species Beta vulgaris (Family: Amaranthaceae).

[0235] In some embodiments, the plant fiber material comprises material from juniper plant genus Juniperus, which includes multiple species eg.. Juniperus communis') (Family: Cupressaceae).

[0236] In some embodiments, the plant fiber material comprises material from buckwheat plant species Fagopyrum esculentum (Family: Polygonaceae).

[0237] In some embodiments, the plant fiber material comprises material from dandelion plant species Taraxacum officinale (Family: Asteraceae).

[0238] In some embodiments, the plant fiber material comprises material from chamomile plant species Matricaria chamomilla or Chamaemelum nobile (Family: Asteraceae).

[0239] In some embodiments, the plant fiber material comprises material from burdock plant species Arctium lappa (Family: Asteraceae).

[0240] In some embodiments, the plant fiber material comprises material from broccoli plant species Brassica oleracea var. italica (Family: Brassicaccac).

[0241] In some embodiments, the plant fiber material comprises material from alfalfa plant species Meclicago sativa (Family: Fabaceae).

[0242] In some embodiments, the plant fiber material comprises material from calendula plant species Calendula officinalis (Family: Asteraceae).

[0243] In some embodiments, the plant fiber material comprises material from plantain plant species Plantago major or Plantago lanceolata (Family: Plantaginaceae).

[0244] In some embodiments, the plant fiber material is in combination with non-plant material in the fermentation substate. As a non-limiting example, the plant fiber material is in combination with a cyanobacterium. In some embodiments, the cyanobacterium is from the genus Spirulina. In some embodiments, the fermentation substrate comprises cyanobacterium (e.g.. Spirulina) and plant fiber material. In some embodiments, the fermentation substrate comprises cyanobacterium (e.g., Spirulina) and no plant fiber material.

[0245] As another non-limiting example, the plant fiber material is in combination with a green algae. In some embodiments, the green algae is from the genus Chlorella, which is a genus of singlecelled green algae (Phylum: Chlorophyta). In some embodiments, the fermentation substrate comprises green algae (e.g.. Chlorella) and plant fiber material. In some embodiments, the fermentation substrate comprises green algae (e.g.. Chlorella) and no plant fiber material. In some embodiments, the non-plant material comprises material from Chlorella, (e.g.. Chlorella vulgaris).

[0246] In some embodiments, the plant fiber material is in combination with a fungal fiber material. In some embodiments, the fungal fiber material comprises a mushroom. In some embodiments, the fungal fiber material (e.g., mushroom) is from the genus Ganoderma (e.g.. Ganoderma sichuanense, also known as reishi, lingzhi, or Ganoderma lingzhi) Cordyceps (e.g., Cordyceps militaris); Hericium (e.g., Hericium erinaceus, also known as lion's mane mushroom,yamabushitake, bearded tooth fungus, bearded hedgehog, or old man's beard Lions mane); Inonotus (e.g., Inonotus obliquus, also known as chaga); Trametes (e.g.. Trametes versicolor, also known as Coriolus versicolor, Polyporus versicolor, or turkey tail); Grifola (e.g., Grifola frondosa, also known as hen-of-the-woods or maitake). In some embodiments, the fermentation substrate comprises fungal fiber material (e.g.. mushroom) and plant fiber material. In some embodiments, the fermentation substrate comprises fungal fiber material (e.g.. mushroom) and no plant fiber material. In some embodiments, the fermentation substrate comprises fungal fiber material (e g., mushroom) and cyanobacterium (e.g., Spirulind).

[0247] In some embodiments, the plant fiber material comprises polyphenols, including but not limited to phenolic acids, flavonoids, tannic acid, and / or ellagitaimin.Bacterial Species

[0248] In some embodiments of any of the aspects, the fennentation substrate comprises or is in combination with at least one bacterial species. In some embodiments, the plant fiber material is in combination with at least one bacterial species (e.g., during the first successive stage of fermentation). In some embodiments, at least a second bacterial species can be added during the second successive stage of fermentation, to the plant fiber material fermented during the first successive stage of fermentation by the at least one bacterial species.|00249| In some embodiments, the first and / or second successive stage of fermentation comprises at least one bacterial species belonging to a phylum selected from the group consisting of: Actinobacterium, Pseudomonadota, Bacillota (also known as Finnicutes), Bacteroidota, and Verrucomicrobiota. or any combination thereof (see e.g.. Table 9). In some embodiments, the first and / or second successive stage of fermentation comprises at least one bacterial species belonging to a phylum selected from the group consisting of: Pseudomonadota, Bacillota, Bacteroidota. and Verrucomicrobiota.

[0250] In some embodiments, the bacterial species of the Actinobacterium phylum belongs to the genus Bifidobacterium.

[0251] In some embodiments, the bacterial species of the Pseudomonadota phylum belongs to the genus Escherichia or Klebsiella. In some embodiments, the bacterial species of the Pseudomonadota phylum belongs to the Enterobacteriaceae family. In some embodiments, the bacterial species of the Pseudomonadota phylum is Escherichia coli (E. coli; e.g., Nissle strain) or Klebsiella spp. In some embodiments, the Klebsiella spp is characterized by rRNA of SEQ ID NO: 760 or a nucleic acid sequence that is at least at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to SEQ ID NO: 760.

[0252] SEQ ID NO: 760, Klebsiella spp. Ribosomal RNA gene (rDNA; e.g., encoding for rRNA)

[0253] In some embodiments, the bacterial species of the Bacillota phylum belongs to a genus selected from the group consisting of: Clostridium, Faecalibacterium, Ruminococcus,Mediterraneibacter, Erysipelotrichaceae, Erysipelatoclostridium, Streptococcus, Roseburia, and Agathobacter. In some embodiments, the bacterial species of the Bacillota phylum is a species selected from the group consisting of: Clostridium scindens, Clostridium butyricum, Clostridium beijerinckii, Clostridium acetobutylicum, Faecalibacterium prausnitzii, Ruminococcus bromii, Ruminococcus spp, Mediterraneibacter gnavus, Mediterraneibacter torques, Erysipelotrichaceae, Erysipelatoclostridium, Streptococcus thermophilus, Streptococcus salivarius, Roseburia intestinalis, and Agathobacter rectalis.

[0254] In some embodiments, the bacterial species of the Bacillota (Firmicutes) phylum belongs to a genus selected from the group consisting of: Lactobacillus, Ruminococcus, Faecalibacterium, and Veillonella. In some embodiments, the bacterial species of the Bacillota phylum belongs to the genus Lactobacillus. In some embodiments, the bacterial species of the Bacillota phylum belongs to the genus Lacticaseibacillus. In some embodiments, the bacterial species of the Bacillota phylum belongs to the genus Ruminococcus (e.g., Ruminococcus bromii). In some embodiments, the bacterial species of the Bacillota phylum belongs to the genus Faecalibacterium (e.g., Faecalibacterium prausnitzii). In some embodiments, the bacterial species of the Bacillota phylum belongs to the genus Veillonella.

[0255] In some embodiments, the bacterial species of the Bacteroidota phylum belongs to a genus selected from the group consisting of: Bacteroides and Prevotella. In some embodiments, the bacterial species of the Bacteroidota phylum is a species selected from the group consisting of: Bacteroides thelaiolaomicron, Bacteroides ovalus, Bacteroides vulgatus, Bacteroides firagilis, Prevotella copri, Bacteroides dorei, Bacteroides uniformis, and Prevotella bivia. In some embodiments, the bacterial species of the Bacteroidota phylum belongs to a genus selected from the group consisting of: Bacteroides, Parabacteroides, and Prevotella.

[0256] In some embodiments, the bacterial species of the Verrucomicrobiota phylum belongs to the genus Akkermansia. In some embodiments, the bacterial species of the Verrucomicrobiota phylum is: Akkermansia muciniphila.

[0257] In some embodiments, the first and second bacterial species (e.g.. in the first and second successive stages of fermentation, respectively) comprise a species from the Actinobacterium phylum and a species from the Bacillota (Firmicutes) phylum, respectively. In some embodiments, the first and second bacterial species (e.g.. in the first and second successive stages of fermentation, respectively) comprise at least one species from the Bifidobacterium genus and at least one species from the Lactobacillus genus, respectively. In some embodiments, the first and second bacterial species (e.g.. in the first and second successive stages of fermentation, respectively) comprise at least one species from the Bifidobacterium genus and at least one species from the Lacticaseibacillus genus, respectively. Table 9 provides further non-limiting examples of bacteria or combinations thereof, which can be used in the first and / or second successive stages of fermentation.

[0258] Table 9: Exemplary combinations of bacteria in the first and / or second stage of successive fermentation

[0259] In some embodiments of any of the aspects, the fermentation substrate further comprises at least one Bifidobacterium species (e.g., for the first fermentation stage) and further comprises at least one Lactobacillus species (e.g., for the second fermentation stage).

[0260] In some embodiments of any of the aspects, the Bifidobacterium is selected from the group consisting of B. lactis, B. breve, B. infiantis, and any combination thereof. In some embodiments of any of the aspects, the Bifidobacterium is selected from the group consisting of B. lactis, B. breve. B. longum, and any combination thereof. In some embodiments, the Bifidobacterium species comprises one or more of B. lactis, B. longum, and B. breve. In some embodiments of any of the aspects, the Bifidobacterium is selected from the group consisting of B. lactis, B. breve, B. infiantis, B. longum, and any combination thereof. In some embodiments of any of the aspects, the B. longum is B. longum subspecies infiantis (B. infiantis). In some embodiments of any of the aspects, the B. longum isB. longum subspecies longum (B. longum longum). In some embodiments, the Bifidobacterium species comprises one or more of B. lactis PBP 1418518, B. longum PBP234451 , and / or B. breve PBP2741300.

[0261] In some embodiments of any of the aspects, the Lactobacillus is selected from the group consisting of L. plantarum, L. acidophilus. L. rhamnosus. L. paracasei, L. casei. and any combination thereof. In some embodiments, the Lactobacillus species comprises one or more of L. paracasei, L. rhamnosus, and / or L. casei. In some embodiments, the Lactobacillus species comprises one or more of L. paracasei PBP5197148. L. rhamnosus PBP4542118, and L. casei PBP4157051.

[0262] In some embodiments of any of tire aspects, the fermentation substrates comprise at least 2 of the following: B. lactis, B. infantis, and / or B. breve (e.g.. during the first fermentation stage). In some embodiments of any of the aspects, the fermentation substrates comprise at least 2 of the following: B. lactis, B. longum, and / or B. breve (e.g., during the first fermentation stage). In some embodiments of any of the aspects, die fermentation substrates comprise at least 2 of the following: / .. paracasei, L. rhamnosus, and / or / .. casei (e.g., during the second fermentation stage).

[0263] In some embodiments of any of tire aspects, the fermentation substrates comprise at least 2 (e.g., at least 3, at least 4, at least 5, or 6) of the following: B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and / or L. casei (e.g., during the first and / or second successive fermentation stage(s)). In some embodiments of any of the aspects, the fermentation substrates comprise at least 2 (e.g., at least 3, at least 4, at least 5, or 6) of the following: B. lactis, B. longum, B. breve, L. paracasei, L. rhamnosus, and / or L. casei (e.g., during the first and / or second successive fermentation stage(s)).

[0264] ft is contemplated that in some embodiments of any of the aspects, other immune- supportive bacteria can be used, alone or in combination with species described herein, to ferment substrates as described herein to provide postbiotic compositions as described herein. Examples are provided, for example, in Schluter et al., Nature 588: 303-307 (2020), the contents of which are incorporated herein by reference in their entirety.Exemplary^ Fermentation Substrate Compositions

[0265] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising at least one of an herb of the Astragalus family, an herb of the Solanaceae or nightshade family, a berry’ of the Sambucus L. genus, and a legume of the Lens orientalis or Lens culinaris family, in combination with liquid water sufficient to suspend or submerge the herbal material.

[0266] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising an herb of the Solanaceae or nightshade family and a berry ofthe Sambucus L. genus, in combination with liquid water sufficient to suspend or submerge the herbal material.

[0267] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising ashwagandha root (and / or ashwagandha leal and elderberry, in combination with liquid water sufficient to suspend or submerge the herbal material.

[0268] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, in combination with at least one Bifidobacterium species (e.g.. for the first successive fermentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0269] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising an herb of the Solanaceae or nightshade family and a berry of tire Sambucus L. genus, in combination with at least one Bifidobacterium species and at least one Lactobacillus species (e.g., for the first and second successive fermentation stages, respectively), and liquid water sufficient to suspend or submerge the herbal material.

[0270] For each second successive stage fermentation substrate described herein, the fermentation substrate for die second successive stage includes fermentation products of the first stage, plus the bacterial species used for the second successive stage. For each diird successive stage fermentation substrate described herein, the fermentation substrate for the third successive stage includes fermentation products of the first and second stages, plus the bacterial species used for the third successive stage. For each fourth successive stage fermentation substrate described herein, the fermentation substrate for the fourth successive stage includes fermentation products of the first, second, and third stages, plus the bacterial species used for the fourth successive stage. For each fifth successive stage fermentation substrate described herein, the fermentation substrate for the fifth successive stage includes fermentation products of the first, second, third, and fourth stages, plus the bacterial species used for the fifth successive stage.

[0271] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising ashwagandha root (and / or ashwagandha leal and elderberry, in combination with at least one Bifidobacterium species (e.g., for the first successive fermentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0272] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising ashwagandha root (and / or ashwagandha leaf) and elderberry, in combination with at least one Bifidobacterium species and at least one Lactobacillus species (e.g.,for the first and second successive fermentation stages, respectively), and liquid water sufficient to suspend or submerge the herbal material.

[0273] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, in combination with at least two of the following: B. lactis, B. longum, B. breve (e.g., for the first successive fermentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0274] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, in combination with at least two of the following: B. lactis, B. infantis, B. breve (e.g., for the first successive fermentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0275] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, in combination with at least two of the following: B. lactis, B. longum. and / or B. breve (e.g., for the first successive fermentation stage), and further in combination with at least two of the following: L. paracasei, L. rhamnosus. and / or L. casei (e.g., for the second successive fermentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0276] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, in combination with at least two of the following: B. lactis, B. infantis, and / or B. breve (e.g.. for the first successive fermentation stage), and further in combination with at least two of the following: L. paracasei, L. rhamnosus, and / or L. casei (e.g., for the second successive fermentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0277] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising ashwagandha root (and / or ashwagandha leal and elderberry, in combination with at least two of the following: B. lactis, B. infantis, B. breve (e.g., for the first successive fermentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0278] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising ashwagandha root (and / or ashwagandha leaf) and elderberry,in combination with at least two of the following: B. lactis. B. longum, B. breve (e.g., for the first successive fennentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0279] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising ashwagandha root (and / or ashwagandha leal and elderberry, in combination with at least two of the following: B. lactis, B. infantis, and / or B. breve (e g., for the first successive fermentation stage), and further in combination with at least two of the following: L. paracasei. L. rhamnosus. and / or L. casei (e.g.. for the second successive fermentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0280] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising ashwagandha root (and / or ashwagandha leaf) and elderberry, in combination with at least two of the following: B. lactis, B. longum, and / or B. breve (e.g., for the first successive fermentation stage), and further in combination with at least two of the following: L. paracasei, L. rhamnosus, and / or L. casei (e.g., for the second successive fermentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0281] In one aspect, described herein is a fennentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, in combination with B. lactis, B. infantis, and B. breve (e.g.. for the first successive fennentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0282] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, in combination with B. lactis, B. longum, and B. breve (e.g.. for the first successive fennentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0283] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, in combination with B. lactis, B. infantis. and B. breve (e.g., for the first successive fermentation stage), and further in combination with L. paracasei, L. rhamnostis, and L. casei (e.g.. for the second successive fermentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0284] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising an herb of the Solanaceae or nightshade family and a berry’ of the Sambucus L. genus, in combination with B. lactis, B. longum. and B. breve (e.g., for the firstsuccessive fermentation stage), and further in combination with L. paracasei. L. rhamnosus. and L. casei (e.g., for the second successive fermentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0285] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising ashwagandha root (and / or ashwagandha leaf) and elderberry, in combination with B. lactis. B. infantis, and B. breve (e.g., for the first successive fermentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0286] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising ashwagandha root (and / or ashwagandha leaf) and elderberry, in combination with B. lactis, B. longum, and B. breve (e.g., for the first successive fermentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0287] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising ashwagandha root (and / or ashwagandha leaf) and elderberry, in combination with B. lactis, B. infantis, and B. breve (e.g., for the first successive fermentation stage), and further in combination with L. paracasei, L. rhamnosus, and L. casei (e.g., for the second successive fermentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0288] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising ashwagandha root (and / or ashwagandha leaf) and elderberry, in combination with B. lactis, B. longum, and B. breve (e.g., for the first successive fermentation stage), and further in combination with L. paracasei, L. rhamnosus, and L. casei (e.g.. for the second successive fennentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0289] In some embodiments of any of the aspects, the fermentation substrate further comprises one or more of glucose, sucrose, fructose, honey, and molasses. In some embodiments of any of the aspects, the fermentation substrate further comprises glucose, sucrose, fructose, honey, or molasses.

[0290] The pH of the fermentation substrate can vary, and can change over the course of successive fermentation stages. As used herein in reference to pH, the term “about” can refer to + / - 1.0 pH. In some embodiments of any of the aspects, the pH of the fermentation substrate is from about 5.0 to about 8.0. In some embodiments of any of the aspects, the pH of the fermentation substrate is from about 5.0 to about 7.5. In some embodiments of any of the aspects, the pH of the fermentation substrate is from about 5.0 to about 7.5, about 5.0 to about 7.0, about 5.0 to about 6.8, about 5.0 to about 6.6, about 5.0 to about 6.4, about 5.0 to about 6.2, about 5.0 to about 6.0, about 5.5 to about 8.0, about 5.5 to about 7.5, about 5.5 to about 7.0, about 5.5 to about 6.8. about 5.5 to about 6.6, about 5.5 to about 6.4, about 5.5 to about 6.2, about 5.5 to about 6.0, about 6.0 to about 8.0, about 6.0 to about7.5. about 6.0 to about 7.0. about 6.0 to about 6.8. about 6.0 to about 6.6, about 6.0 to about 6.4, about 6.0 to about 6.2. about 6.2 to about 8.0. about 6.2 to about 7.5, about 6.2 to about 7.0, about 6.2 to about 6.8, about 6.2 to about 6.6, about 6.2 to about 6.4, about 6.4 to about 8.0, about 6.4 to about 7.5, about 6.4 to about 7.0, about 6.4 to about 6.8, about 6.4 to about 6.6, about 6.5 to about 6.7, about 6.6 to about 8.0, about 6.6 to about 7.5, about 6.6 to about 7.0, about 6.6 to about 6.8, about 6.8 to about 8.0, about 6.8 to about 7.5, about 6.8 to about 7.0, about 7.0 to about 8.0 or about 7.0 to about 7.5. In some embodiments of any of the aspects, the pH of the fermentation substrate is from about 3.5 to 6.7 (e.g., during the successive fermentation). In some embodiments of any of the aspects, the pH of the fermentation is from about 3.5 to 4.2 (e.g.. end of the first and / or second stage of fermentation). In some embodiments of any of the aspects, the pH of the end product of the fermentation process (e.g., a postbiotic composition) is from 5.0 to 8.0.

[0291] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising at least one herbal material selected from Astragalus membranaceus root (and / or ashwagandha leaf), ashwagandha, elderberry and red lentil, in combination with liquid water sufficient to suspend or submerge the herbal material.

[0292] In some embodiments of any of die aspects, the fermentation substrate composition further comprises glucose, sucrose, fructose, honey, or molasses. In some embodiments of any of the aspects, the fermentation substrate composition further comprises a source of fermentable sugar, e.g., glucose, sucrose, fructose, malt extract, molasses, honey, or other fennentable sugar.

[0293] In some embodiments of any of the aspects, the plant fiber material is provided as a dried powder prior to combination with water. In some embodiments of any of the aspects, the herbal material is provided as a dried powder prior to combination with water.

[0294] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2% by weight to about 10% by weight herb of the Astragalus family. In some embodiments of any of the aspects, the substrate composition comprises from about 2.5% by weight to about 5% by weight herb of the Astragalus family. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2% by weight to about 10% by weight Astragalus. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2.5% by weight to about 5% by weight Astragalus.

[0295] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2% by weight to about 10% by weight herb of the Solanaceae or nightshade family. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2.5% by weight to about 5% by weight herb of the Solanaceae or nightshade family. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2% by weight to about 10% by weight ashwagandha. In some embodiments of any of theaspects, the fermentation substrate composition comprises from about 2.5% by weight to about 5% by weight ashwagandha.

[0296] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2% by weight to about 10% by weight berry of the Sambucus L. genus. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2% by weight to about 10% by weight born of the Sambucus L. genus. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2% by weight to about 10% by weight elderberry. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2.5% by weight to about 5% by weight elderberry.

[0297] In some embodiments of any of tire aspects, the fermentation substrate composition comprises from about 2% by weight to about 10% by weight glucose, sucrose, fructose, honey, or molasses. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2.5% by weight to about 5% by weight glucose, sucrose, fructose, honey, or molasses.

[0298] In some embodiments of any of tire aspects, the fermentation substrate composition comprises from about 0.5% by weight to about 3% by weight legume of the Lens orientalis or Lens culinaris family. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 0.5% by weight to about 1.5% by weight legume of the Lens orientalis or Lens culinaris family. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 0.5% by weight to about 3% by weight red lentil. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 0.5% by weight to about 1.5% by weight red lentil.

[0299] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 70% by weight to about 95% by weight water. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 80% by weight to about 90% by weight water.

[0300] In some embodiments of any of the aspects, the fermentation substrate composition comprises: from about 2.5% by weight to about 5% by weight Astragalus from about 2.5% by weight to about 5% by weight ashwagandha; from about 2.5% by weight to about 5% by weight elderberry; from about 2.5% by weight to about 5% by weight sucrose or molasses; from about 0.5% by weight to about 1.5% by weight red lentil; and from about 80% by weight to about 90% by weight water.

[0301] In some embodiments of any of the aspects, the fermentation substrate composition comprises: from about 2.5% by weight to about 5% by weight ashwagandha; from about 2.5% by weight to about 5% by weight elderberry; from about 2.5% by weight to about 5% by weight sucrose or molasses; from about 0.5% by weight to about 1.5% by weight red lentil; and from about 80% by weight to about 90% by weight water.

[0302] In some embodiments of any of the aspects, the substrate composition comprises: from about 2.5% by weight to about 5% by weight ashwagandha; from about 2.5% by weight to about 5% by weight elderberry; from about 2.5% by weight to about 5% by weight sucrose or molasses; and from about 80% by weight to about 90% by weight water.

[0303] In some embodiments of any of the aspects, the substrate composition comprises: from about 2.5% by weight to about 5% by weight Astragalus', from about 2.5% by weight to about 5% by weight ashwagandha; from about 2.5% by weight to about 5% by weight elderberry; from about 2.5% by weight to about 5% by weight sucrose or molasses; and from about 80% by weight to about 90% by weight water.

[0304] In one aspect, described herein is a substrate composition for use in a process to prepare a postbiotic composition. In some embodiments of any of the aspects, the substrate is or comprises an herbal substrate composition or herbal material. In some embodiments of any of the aspects, the substrate composition or herbal material comprises at least one (e.g., 1, 2, 3, or 4) of an herb of the Astragalus family, an herb of the Solanaceae or nightshade family, a berry of the Sambucus L. genus, and / or a legume of the Lens orientalis or Lens culinaris family. The substrate composition also comprises liquid water, e.g., sufficient to suspend or submerge the plant substrate material.

[0305] In one aspect, described herein is an herbal substrate composition, in combination with at least one Bifidobacterium species (e.g., in the first successive stage of fermentation) and seeding at least one Lactobacillus species, and seeding one commensal, pathobiontic, or pathogenic species of the phylum Pseudomonadota, Bacillota. Bacteroidota, Verrucomicrobiota, the family Enterobacteriaceae in combination with liquid water liquid water sufficient to suspend or submerge the herbal material. It is contemplated herein that pathobiontic or pathogenic bacterial species can contribute in beneficial ways to the microbiome or to metabolites produced; as such, in embodiments where the fermentation composition is inactivated to yield no viable bacteria in the postbiotic composition, pathobiontic or pathogenic bacterial species can be used in the successive fermentation methods described herein.

[0306] In one aspect, described herein is an herbal substrate composition, in combination with at least one Bifidobacterium species (e.g., in the first successive stage of fermentation) and seeding at least one Lactobacillus species (e.g.. in the second successive stage of fermentation), and seeding at least one Ruminococcus bromii strain (e.g., in the first and / or second successive stage of fermentation). The terms “seed” and “inoculate” are used interchangeably herein, and in such contexts refer to adding the specific bacterial strain(s) to the fermentation, under conditions that permit such bacterial strains to be viable, metabolically active, grow, and / or reproduce.

[0307] In one aspect, described herein is an herbal substrate composition, in combination with at least one Bifidobacterium species (e.g., in the first successive stage of fermentation) and seeding at least one Lactobacillus species (e.g., in the second successive stage of fermentation), and seeding atleast one P'aecalibacterium prausnitzii strain (e.g.. in the first and / or second successive stage of fermentation).

[0308] In one aspect, described herein is an herbal substrate composition, in combination with at least one Bifidobacterium species (e.g., in the first successive stage of fermentation) and seeding at least one Lactobacillus species (e.g.. in the second successive stage of fermentation), and seeding at least one Klebsiella strain (e.g., in the first and / or second successive stage of fermentation).

[0309] In one aspect, described herein is an herbal substrate composition, in combination with at least one Bifidobacterium (e.g., in the first successive stage of fermentation) and species seeding at least one Lactobacillus species (e.g., in the second successive stage of fermentation), and seeding at least one Escherichia strain (e.g., in the first and / or second successive stage of fermentation).

[0310] In one aspect, described herein is an herbal substrate composition, in combination with at least one Bifidobacterium (e.g., in the first successive stage of fermentation) and species seeding at least one Lactobacillus species (e.g., in the second successive stage of fermentation), and seeding at least one Veillonella strain (e.g., in the first and / or second successive stage of fermentation).

[0311] In one aspect, described herein is an herbal substrate composition, in combination with at least one Bifidobacterium species (e.g., in the first successive stage of fermentation) and seeding at least one Lactobacillus species (e.g., in the second successive stage of fermentation), and seeding at least one Akkermansia strain (e.g., in the first and / or second successive stage offermentation).

[0312] In one aspect, described herein is an herbal substrate composition, in combination with at least one Bifidobacterium species (e.g., in the first successive stage of fermentation) and seeding at least one Lactobacillus species (e.g., in the second successive stage of fennentation), and seeding at least one Ruminococcus bromil strain (e.g., in the first and / or second successive stage of fermentation).

[0313] In one aspect, described herein is an herbal substrate composition, in combination with at least one Bifidobacterium (e.g.. in the first successive stage of fermentation) and species seeding at least one Lactobacillus species (e.g., in the second successive stage of fermentation), and seeding at least one Parabacteroides strain (e.g., in the first and / or second successive stage of fermentation).

[0314] In one aspect, described herein is an herbal substrate composition, in combination with at least one Bifidobacterium species (e.g., in the first successive stage of fermentation) and seeding at least one Lactobacillus species (e.g., in the second successive stage of fennentation). and seeding at least one Mediterraneibacter gnavus strain (also known as Ruminococcus gnavus) (e.g., in the first and / or second successive stage of fermentation).

[0315] In one aspect, described herein is a method of cross-feeding metabolites produced by at least one species of Bifidobacterium to at least one species of Lactobacillus, the method comprising inoculating a first culture comprising at least one of the following: B. lactis, B. longum, and / or B. breve, with a second culture comprising at least one of the following: L. paracasei, L. rhamnosus, and / or L. casei, wherein the first and / or second cultures are in combination with plant fiber materialand / or herbal material and liquid water sufficient to suspend or submerge the plant fiber material and / or herbal material. In some embodiments of any of the aspects, the plant fiber material and / or herbal material is provided as a dried powder prior to combination with water.

[0316] In one aspect, described herein is a postbiotic composition, wherein the postbiotic composition is prepared according to a process comprising: (a) preparing a culture of microorganisms;(b) preparing a substrate composition as described herein, e.g., an herbal substrate composition as described herein; (c) inoculating the substrate composition with the culture of microorganisms to generate an inoculate composition; (d) incubating the inoculate composition for a predetermined amount of time to generate a fermented composition and; (e) inactivating, virus or phage-induced lysing, ultrasound induced lysis, heat killing or irradiating the postbiotic composition to eliminate the majority of living bacteria, leaving less than 1,000 cfu per gram, (I) lyophilizing or spray -drying the fermented composition to obtain the postbiotic composition. In some embodiments of any of the aspects, the culture of microorganisms in the postbiotic composition comprises a microorganism concentration from about 1.0 x 101CFU / g to about IxlO3CFU / g.

[0317] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising a berry of the Vaccinium genus, in combination with liquid water sufficient to suspend or submerge the herbal material.

[0318] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising cranberry, in combination with liquid water sufficient to suspend or submerge the herbal material.

[0319] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising a berry of the Vaccinium genus, in combination with at least one Bifidobacterium species (e.g., for the first successive fermentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0320] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising cranberry, in combination with at least one Bifidobacterium species and at least one Lactobacillus species (e g., for the first and second successive fermentation stages, respectively), and liquid water sufficient to suspend or submerge the herbal material.

[0321] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising cranberry, in combination with at least one Bifidobacterium species (e.g., for the first successive fermentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0322] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising cranberry, in combination with at least one Bifidobacterium species and at least one Lactobacillus species (e.g.. for the first and second successive fermentation stages, respectively), and liquid water sufficient to suspend or submerge the herbal material.

[0323] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising a berry of the Vaccinium genus, in combination with at least two of the following: B. lactis, B. longum. B. breve (e.g., for the first successive fermentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0324] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising a berry of the Vaccinium genus, in combination with at least tw o of the following: B. lactis, B. longum, and / or B. breve (e.g., for the first successive fermentation stage), and further in combination with at least two of the following: L. paracasei, L. rhamnosus, and / or L. casei (e.g., for the second successive fermentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0325] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising cranberry, in combination with at least two of the following: B. lactis, B. longum, B. breve (e.g., for the first successive fermentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0326] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising cranberry, in combination with at least two of the following: B. lactis, B. longum. and / or B. breve (e.g.. for the first successive fermentation stage), and further in combination with at least two of the following: L. paracasei, L. rhamnosus, and / or L. casei (e.g., for the second successive fermentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0327] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising a berry of the Vaccinium genus, in combination with B. lactis, B. longum, and B. breve (e.g.. for the first successive fermentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0328] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising a berry of the Vaccinium genus, in combination with B. lactis,B. longum, and B. breve (e.g., for the first successive fermentation stage), and further in combination with L. paracasei. L. rhamnosus. and L. casei (e.g., for the second successive fermentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0329] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising a cranberry, in combination with B. lactis, B. longum. and B. breve (e.g., for the first successive fermentation stage), and liquid water sufficient to suspend or submerge the herbal material.

[0330] In one aspect, described herein is a fermentation substrate composition for use in a successive fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising a cranberry , in combination with B. lactis, B. longum, and B. breve (e.g., for the first successive fermentation stage), and further in combination with L. paracasei, L. rhamnosus, and L. casei (e.g., for the second successive fermentation stage), and liquid water sufficient to suspend or submerge the herbal material.Preparation Methods

[0331] According to at least one aspect of the present disclosure, a method of preparing a postbiotic composition by successive fermentation is provided. As used herein, the term “successive fermentation” refers to a fermentation process comprising at least two stages (e.g.. secondary fermentation; e g., 2, 3. 4. 5, or more stages), where each fermentation stage comprises a different microbe or microbial community compared to at least one other stage. Successive fermentation methods can be used to model and / or mimic successive fermentation that occurs in vivo, such as when earlier microbial communities of microbes provide conditions that encourage the growth of later microbial communities.

[0332] In one aspect, the method can include obtaining or preparing first and second cultures each comprising at least one microorganism, wherein the microorganisms in the first and second cultures differ, and a fermentation substrate composition comprising plant fiber material as described herein, e.g., a plant fiber material fermentation substrate as described herein, followed by inoculating the substrate composition with the first culture of microorganisms to generate an inoculate composition in a first stage, followed by inoculating the composition resulting from the first stage with the second culture. The method can also include fermenting the inoculate composition for a predetermined amount of time to generate a fermented composition using at least 2 rounds of successive fermentation. The successively fennented composition can be dried (e.g., lyophilized, spray -dried) to obtain the postbiotic composition.

[0333] In another aspect, described herein is a method of preparing a postbiotic composition, the method comprising: (a) inoculating a substrate composition comprising plant material comprising fermentable fiber and water sufficient to suspend or submerge the plant material with a first bacterial inoculum; (b) maintaining the inoculated substrate prepared in (a) under anaerobic conditions, at atemperature and for a time sufficient to permit growth of the first bacterial inoculum thereby producing a primary fermented composition; (c) inoculating the primary fermented composition produced in step (b) with a second bacterial inoculum; (d) maintaining the composition formed in step (c) under anaerobic conditions at a temperature and for a time sufficient to permit growth of the second bacterial inoculum to produce a secondary fermented composition; and (e) inactivating the bacteria in the secondary fermented composition. In some embodiments, the method further comprises the step of (f) drying the secondary fermented composition, thereby producing a dried postbiotic composition. In some embodiments, the first and second bacterial species comprise Bifidobacterium and Lactobacillus species, respectively.

[0334] In one aspect, described herein is a method of preparing a postbiotic composition comprising fermenting Withania somnifera plant material and berry material or extract of the Sambucus genus in successive fermentations with Bifidobacterium and then Lactobacillus species.

[0335] In one aspect, described herein is a method of preparing a postbiotic composition, the method comprising: (a) providing a fermentation substrate comprising plant material comprising prebiotic fiber; (b) obtaining or providing a culture of one or more Bifidobacterium bacterial species and a culture of one or more Lactobacillus bacterial species; (c) inoculating the fermentation substrate in first and second stages with the cultures of Bifidobacterium and Lactobacillus species; (d) incubating the inoculated fermentation substrate of (c) under conditions and for a time sufficient to generate a postbiotic composition comprising bacterial metabolites and organic acids; and (e) inactivating the bacterial species; whereby a postbiotic composition is prepared.Successive Fermentation Stages

[0336] In one aspect, the method comprises fermenting plant fiber material in a first successive fermentation with at least a first bacterial species, and then fermenting the resultant material in a second successive fermentation with at least a second bacterial species.

[0337] In another aspect, the method comprises fermenting plant fiber material in a first successive fermentation with at least a first bacterial species, then fermenting the resultant material in a second successive fermentation with at least a second bacterial species, and then fermenting the resultant material in a third successive fermentation with at least a third bacterial species.

[0338] In another aspect, the method comprises fermenting plant fiber material in a first successive fermentation with at least a first bacterial species, then fermenting the resultant material in a second successive fermentation with at least a second bacterial species, then fermenting the resultant material in a third successive fermentation with at least a third bacterial species, and then fermenting the resultant material in a fourth successive fermentation with at least a fourth bacterial species.

[0339] In another aspect, the method comprises fermenting plant fiber material in a first successive fermentation with at least a first bacterial species, then fermenting the resultant material in a second successive fermentation with at least a second bacterial species, then fermenting the resultant material in a third successive fermentation with at least a third bacterial species, then fermenting theresultant material in a fourth successive fermentation with at least a fourth bacterial species, and , then fermenting the resultant material in a fifth successive fermentation with at least a fifth bacterial species.

[0340] In some embodiments, the first, second, third, fourth, and / or fourth successive stage of fermentation comprises two or more species of bacteria, non-limiting examples of which are provided herein. In some embodiments, the first successive stage of fermentation comprises two or more species of bacteria. In some embodiments, the second successive stage of fermentation comprises two or more species of bacteria that differ from the species used in the first successive stage. Table 1 provides non-limiting examples of bacteria that can be used in the first and second successive stages. In some embodiments, the third successive stage of fermentation comprises two or more species of bacteria that differ from the species used in the first and / or second successive stage. In some embodiments, the fourth successive stage of fermentation comprises two or more species of bacteria that differ from the species used in the first, second, and / or third successive stage. In some embodiments, the fifth successive stage of fermentation comprises tw o or more species of bacteria that differ from the species used in the first, second, third, and / or fourth successive stage.

[0341] Table 1: Exemplary bacteria in first and second fermentation stages (exemplary genera and species are provided herein for these phyla)

[0342] In some embodiments, the first bacterial inoculum comprises one or more species of Bifidobacterium. In some embodiments, the first bacterial inoculum comprises two or more species of Bifidobacterium. In some embodiments, the first bacterial inoculum comprises three or more species of Bifidobacterium .

[0343] In some embodiments, the first bacterial inoculum comprises one species of Bifidobacterium. In some embodiments, the first bacterial inoculum comprises at most two species of Bifidobacterium. In some embodiments, the first bacterial inoculum comprises at most three species of Bifidobacterium.

[0344] In some embodiments, the first bacterial inoculum consists essentially of Bifidobacterium species. In some embodiments, the first bacterial inoculum consists essentially of tw o Bifidobacterium species. In some embodiments, the first bacterial inoculum consists essentially of threeBifidobacterium species. In some embodiments, the Bifidobacterium species are selected from B. lactis, B. longum and B. breve.

[0345] In some embodiments, the second bacterial inoculum comprises one or more species of Lactobacillus. In some embodiments, the second bacterial inoculum comprises two or more species of Lactobacillus. In some embodiments, the second bacterial inoculum comprises three or more species of Lactobacillus.

[0346] In some embodiments, the second bacterial inoculum comprises one species of Lactobacillus. In some embodiments, the second bacterial inoculum comprises at most two species of Lactobacillus. In some embodiments, the second bacterial inoculum comprises at most three species of Lactobacillus.

[0347] In some embodiments, the second bacterial inoculum consists essentially of Lactobacillus species. In some embodiments, the second bacterial inoculum consists essentially of two Lactobacillus species. In some embodiments, the second bacterial inoculum consists essentially of three Lactobacillus species. In some embodiments, the Lactobacillus species arc selected from L. paracasei, L. rhamnosus, and L. casei.

[0348] In at least some instances, first and second successive cultures of microorganisms comprises at least one microorganism selected from the group consisting of Bifidobacterium and Lactobacillus. In some cases, tire first successive culture of microorganisms comprises Bifidobacterium. In some cases, the second successive culture of microorganisms comprises Lactobacillus. The Bifidobacterium can be selected, for example, from the group consisting of B. lactis (also referred to as B. animalis subsp. lactis), B. breve, B. longum, B. infantis, and any combination thereof. The Lactobacillus can be selected, for example, from the group consisting of L. plantarum, L. acidophilus, L. rhamnosus, L. paracasei, L. casei, and any combination thereof.

[0349] In some embodiments, the method further comprises inoculating the substrate composition of step (a) (i.e., the first successive fermentation stage) with one or more of a bacterial species belonging to a phylum selected from the group consisting of: Pseudomonadota, Bacillota, Bacteroidota, and Verrucomicrobiota, non-limiting examples of which are provided herein. In some embodiments, the method further comprises inoculating the primary fermented composition produced in step (b) (i.e.. the second successive fermentation stage) with one or more of a bacterial species belonging to a phylum selected from the group consisting of: Pseudomonadota, Bacillota, Bacteroidota, and Verrucomicrobiota, non-limiting examples of which are provided herein. In some embodiments, the method further comprises inoculating the second, third, fourth, and / or fifth or more successive fermentation stage with one or more of a bacterial species belonging to a phylum selected from the group consisting of: Pseudomonadota, Bacillota, Bacteroidota, and Verrucomicrobiota, nonlimiting examples of which are provided herein.

[0350] In at least some aspects, any of the cultures of microorganisms described herein (e.g., first, second, third, fourth, fifth, or more successive cultures) can comprise a microorganismconcentration from about 1.0 x 108CFU / mL to about IxlO12CFU / mL, or from about 1.0 x 109CFU / mL to about IxlO11CFU / mL. or from about 1.0 x 109CFU / mL to about IxlO10CFU / mL, or from about 1.0 x 108CFU / mL to about IxlO11CFU / mL.

[0351] In some embodiments of any of the aspects, the final bacteria content after any stage of fermentation (e.g., first, second, third, fourth, fifth, or more successive fermentation stages) is about 1.0 x 108to about 1 x 1011colony -forming units per milliliter (cfu / ml) of living bacteria, or about 1 .0 x 109to about 1 x IO10cfu / ml, or about 1.0 x 106to about 1.5 x 109cfu / ml.

[0352] In some embodiments, the plant material comprising fermentable fiber is a dry powder prior to addition to water. Non-limiting examples of plant fiber materials and exemplary combinations thereof are provided herein. In some embodiments, the plant material comprising fermentable fiber comprises Withania somnifera plant material and berry material or extract of the Sambucus genus. In some embodiments, the berry material or extract of the Sambucus genus comprises elderberry material or extract. In some embodiments, the Withania somnifera plant material comprises ashwagandha root. In some embodiments, the Withania somnifera plant material comprises ashwagandha leaf. In some embodiments, the plant material comprising fermentable fiber further comprises an herb in the Astragalus family. In some embodiments, the substrate composition further comprises one or more of added glucose, sucrose, fructose, honey, and molasses. In some embodiments, the substrate composition further comprises about 3.5% sucrose.

[0353] As described herein, the preparation method can involve monitoring and adjusting of the pH before, during, and / or after successive stages of the fermentation. In some embodiments, the substrate composition is adjusted to a pH of about 6.6 prior to addition of the first bacterial inoculum. In some embodiments, the pH of the fermented composition produced after the first successive stage of fennentation is about 4.0. In some embodiments, the method further comprises the step, after the first successive stage of fermentation and before the second successive stage of fermentation, of adjusting the pH of the fermented composition to about 6.6. In some embodiments, the pH of the secondary fermented composition produced after the second successive stage of fermentation is about 3.8.

[0354] In some embodiments of any of the aspects, the substrate composition, the bacterial inoculate composition (e.g.. first, second, third, fourth, fifth, or more bacterial inoculate composition) and / or the fermented composition (e.g., first, second, third, fourth, fifth, or more fermented composition), is maintained at a pH from about 3.5 to about 7.0. As used herein in reference to pH. the term “about” can refer to + / - 1.0 pH. In some embodiments, the pH of the substrate composition, the bacterial inoculate composition (e.g., first, second, third, fourth, fifth, or more bacterial inoculate composition) and / or the fermented composition (e.g., first, second, third, fourth, fifth, or more fermented compositionjis maintained from about 5.0 to about 8.0, about 5.0 to about 7.5, about 5.0 to about 7.0, about 5.0 to about 6.8, about 5.0 to about 6.6, about 5.0 to about 6.4, about 5.0 to about 6.2, about 5.0 to about 6.0, about 5.5 to about 8.0, about 5.5 to about 7.5, about 5.5 to about 7.0, about 5.5to about 6.8. about 5.5 to about 6.6. about 5.5 to about 6.4. about 5.5 to about 6.2. about 5.5 to about 6.0. about 6.0 to about 8.0. about 6.0 to about 7.5. about 6.0 to about 7.0, about 6.0 to about 6.8, about 6.0 to about 6.6, about 6.0 to about 6.4, about 6.0 to about 6.2, about 6.2 to about 8.0, about 6.2 to about 7.5, about 6.2 to about 7.0, about 6.2 to about 6.8, about 6.2 to about 6.6, about 6.2 to about 6.4, about 6.4 to about 8.0, about 6.4 to about 7.5, about 6.4 to about 7.0, about 6.4 to about 6.8, about 6.4 to about 6.6, about 6.6 to about 8.0, about 6.6 to about 7.5, about 6.6 to about 7.0, about 6.6 to about 6.8, about 6.8 to about 8.0, about 6.8 to about 7.5, about 6.8 to about 7.0, about 7.0 to about 8.0 or about 7.0 to about 7.5. In some embodiments of any of the aspects, the pH of the fermentation is from about 3.5 to 6.7 (e.g.. during the first, second, third, fourth, fifth, or more successive stage of fermentation). In some embodiments of any of the aspects, the pH of the fermentation is from about 3.5 to 4.2, about 3.5 to about 4.5, about 3.5 to about 4.0, about 3.7 to about 3.9, or about 3.9 to about 4.1 (e.g., end of first, second, third, fourth, fifth, or more successive stage of fermentation). In some embodiments of any of the aspects, the pH of the end product of the fermentation process (e.g., a postbiotic composition) is from 5.0 to 8.0.

[0355] In some embodiments, maintaining the first successive stage of fermentation (e.g., step (b)), the second successive stage offermentation (e.g., step (d)), the third successive stage of fermentation, the fourth successive stage of fermentation, the fifth successive stage of fermentation, or more successive stage(s) of fermentation is performed for about 48 hours to 10 days. In some embodiments of any of the aspects described herein, the predetermined amount of time for any successive stages of fermentation is from about 24 hours to about 10 days, or a period therebetween as described herein. In some embodiments of any of the aspects, the predetermined amount of time is from about 24 hours to about 8 days, about 24 horns to about 7 days, about 24 hours to about 6 days, about 24 hours to about 5 days, about 24 hours to about 4 days, about 24 hours to about 72 hours, about 24 hours to about 48 hours, about 24 hours to about 36 hours, about 36 hours to about 8 days, about 36 hours to about 7 days, about 36 hours to about 6 days, about 36 hours to about 5 days, about 36 hours to about 4 days, about 36 hours to about 72 hours, about 36 horns to about 48 hours, about 48 hours to about 8 days, about 48 hours to about 7 days, about 48 hours to about 6 days, about 48 hours to about 5 days, about 48 hours to about 4 days, about 48 hours to about 72 hours, about 72 hours to about 8 days, about 72 hours to about 7 days, about 72 hours to about 6 days, about 72 hours to about 5 days, or about 72 hours to about 4 days.

[0356] In some embodiments of any of the aspects, any of the culture(s) of microorganisms (e.g., first, second, third, fourth, fifth, or more for successive stage(s) of fermentation) further comprises de Man, Rogosa & Sharpe (MRS) broth (see e.g.. Table 4). In some embodiments of any of the aspects, any of the culture(s) of microorganisms (e.g., first, second, third, fourth, fifth, or more for successive stage(s) of fermentation) further comprises Becton, Dickinson and Company (BD) broth (see e.g., Table 5). In some embodiments or any of the aspects, the fermentation substrate or culture(s) of microorganisms do not include MRS broth or BD broth. In some embodiments or any of the aspects.the fermentation substrate or culture(s) of microorganisms does not include any animal product(s) (i.e., is vegetarian and / or vegan).

[0357] In some embodiments of any of the aspects, fermenting the first, second, third, fourth, fifth, or more bacterial inoculate composition comprises sealing the inoculate composition in a fermentation vat under substantially anaerobic conditions. In some embodiments of any of the aspects, fermenting the first, second, third, fourth, fifth, or more bacterial inoculate composition further comprises purging the fermentation vat with nitrogen gas such that the percentage of oxygen in the fermentation vat is maintained < 1.5%.

[0358] In some embodiments of any of the aspects, fermenting the first, second, third, fourth, fifth, or more bacterial inoculate composition further comprises incubating the inoculate composition at a temperature from about 33°C to about 40°C. In some embodiments of any of the aspects, fermenting the first, second, third, fourth, fifth, or more bacterial inoculate composition further comprises incubating the inoculate composition at a temperature from about 33°C to about 37°C.

[0359] In some embodiments, the secondary’ fermented composition (e.g., produced after the second successive round of fermentation, e.g., in step (d)) comprises at least 5g / liter, at least 1 Og / liter, at least 15g / liter, at least 20g / liter, at least 25g / liter, at least 30g / liter, at least 35g / liter, at least 40g / liter, at least 45g / liter, at least 5 Og / liter, at least 60g / liter, at least 70g / liter, at least 80g / liter, at least 90g / liter, at least lOOOg / liter, or more, of organic acids, non-limiting examples of which are provided herein.Post-Fermentation Steps

[0360] In some embodiments of any of the aspects, the method of preparing a postbiotic composition comprises processing the fermented composition from the successive stages of fermentation to produce the postbiotic composition. In some embodiments of any of the aspects, the postbiotic composition is a liquid. In some embodiments of any of the aspects, the postbiotic composition is dried. In some embodiments of any of the aspects, the postbiotic composition is not processed other than inactivating the bacterial species.

[0361] In some embodiments of any of the aspects, the method of preparing a postbiotic composition comprises treating the composition to inactivate the bacterial species. In some embodiments, the inactivating step comprises heat treatment (e.g., pasteurization), lyophilization (which, absent cryopreservative agents can inactivate bacteria), ultrasonic disruption, freeze-thaw, and / or gamma irradiation, or any combination thereof. In some embodiments, the inactivating step comprises heat treatment. In some embodiments, the heat treatment comprises pasteurization. In some embodiments, the inactivating step comprises lyophilization, e g., without the addition or presence of a cryopreservative agent. In some embodiments, the inactivating step comprises ultrasonic disruption. In some embodiments, the inactivating step comprises freeze-thaw. In some embodiments, the inactivating step comprises gamma irradiation.

[0362] In some embodiments of any of the aspects, the method further comprises lyophilizing the inactivated fermented inoculate composition to obtain the postbiotic composition. In some embodiments of any of the aspects, the method further comprises spray-drying the inactivated fermented inoculate composition to obtain the postbiotic composition.

[0363] In some embodiments, the postbiotic composition can further comprise a carrier, e.g.. a carrier suitable for spray drying and / or freeze drying (also referred to as lyophilization). In some embodiments, the carrier is resistant starch (e.g.. digestion resistant starch). In some embodiments, the carrier comprises maltodextrin. In some embodiments, the carrier comprises resistant maltodextrin (e.g., FIBERSOL). In some embodiments, the carrier comprises at least one prebiotic fiber co-drying agent, including but not limited to resistant maltodextrin, tapioca, resistant starch, or combinations thereof. The term “excipient” can be used interchangeably with “carrier.” In some embodiments, the co-drying agent is added at about 1:1, about 1:1.5, about 1:2, about 1:3, about 1:4, about 1:5, about 5:1, about 4:1 about 3:1, about 2:1, or about 1.5: 1 ratio (e.g., weightweight or weightvolume) relative to total content (e.g., solid content) in the fermentation.

[0364] In some embodiments, the dried postbiotic composition has a moisture content of <4%, for example at most 1%, at most 1.5%, at most 2%, at most 2.5%, at most 3%, at most 3.1%, at most 3.2%, at most 3.3%, at most 3.4%, at most 3.5%, at most 3.6%, at most 3.7%, at most 3.8%, at most 3.9%, or at most 4.0% moisture content. In some embodiments, the dried postbiotic composition has a water activity <0.2, for example at most 0.01, at most 0.05, at most 0.11, al most 0.12. at most 0.13, at most 0.14, at most 0.15, al most 0.16, at most 0.17, at most 0.18, at most 0.19, or at most 0.2 water activity.

[0365] In some embodiments, the postbiotic compositions described herein are prepared by spray -drying. In some embodiments, the bacterial content after spray drying is about 0 efu / g. In some embodiments, the postbiotic compositions described herein are prepared by freeze-drying. In some embodiments, the postbiotic compositions described herein are prepared by freeze-drying. In some embodiments, the bacterial content after freeze drying is at most about IO3efu / g. In some embodiments, the bacterial content after freeze drying is at most about 2000 efu / g, at most about 3000 efu / g, at most about 4000 efu / g. or at most about 5000 efu / g. The fermentation substrate composition can be as described herein above.

[0366] In some embodiments of any of the aspects, the bacterial content after drying (e.g.. spray drying or freeze drying) is about 1 x 108active-fluorescent units per gram (afu / g; e.g., using flow cytometry) to about 2 x 109afu / g of bacterial cells, e.g., living or non-living. In some embodiments of any of the aspects, the bacterial content after drying is about 3 x 109afu / g to about 3 x 1010afu / g (see e.g.. Example 7). In some embodiments of any of the aspects, the bacterial content after drying is about 1 x 109afu / g to about 5 x 1O1CIafu / g. In some embodiments of any of the aspects, the bacterial content after drying is about 1 x 108afu / g to about 1.5 x 109afu / g. In some embodiments of any of tire aspects, the bacterial content after dry ing is about 1 x 108afu / g to about 1 x 109afu / g. In someembodiments of any of the aspects, the bacterial content after drying is about 5 x 108afu / g to about 2 x 109afu / g. In some embodiments of any of the aspects, the bacterial content after drying is about 5 x 108afu / g to about 1.5 x 109afu / g. In some embodiments of any of the aspects, the bacterial content after drying is about 5 x IO8afu / g to about 1 x 109afu / g. In some embodiments of any of the aspects, the bacterial content after drying is about 5 x 108afu / g to about 8.8 x 108afu / g. In some embodiments of any of the aspects, the bacterial content after drying is about 5 x 108afu / g to about 8.5 x 108afu / g. In some embodiments of any of the aspects, the bacterial content after dry ing is about 5 x 108afu / g to about 8.2 x 108afu / g. In some embodiments of any of the aspects, the bacterial content after dry ing is about 5 x 108afu / g to about 8.0 x 108afu / g.

[0367] In some embodiments of any of the aspects, the postbiotic composition after dry ing (e.g.. spray drying or freeze drying) comprises non-viable or non-living bacteria. In some embodiments of any of the aspects, the postbiotic composition after drying (e.g., spray drying or freeze dry ing) comprises a low level of viable or living bacteria. In embodiments where the postbiotic composition is administered to an immunocompromised subject, it is beneficial for the composition to comprise a low or zero level of viable or living bacteria. In embodiments where the postbiotic composition is administered to a non-immunocompromised subject, the composition can comprise viable or non- viable bacteria.

[0368] In some embodiments of any of the aspects, the bacterial content after spray drying is about 0 efu / g of living or viable bacteria. In some embodiments of any of the aspects, the bacterial content after spray drying is greater than 0 efu / g of living or viable bacteria. In some embodiments of any of the aspects, the bacterial content after spray drying is less than 100,000 efu / g of living or viable bacteria. In some embodiments of any of the aspects, the bacterial content after spray drying is less than 10' efu / g of living or viable bacteria. In some embodiments of any of the aspects, the bacterial content after spray drying is less than 101efu / g, less than 102efu / g. less than IO3efu / g, less than 104efu / g. less than 103efu / g, less than 106efu / g, or less than 10 efu / g of living or viable bacteria.

[0369] In some embodiments of any of the aspects, the bacterial content after freeze drying is less than 101efu / g, less than IO2efu / g, less than 103efu / g, less than 104efu / g, less than 10’ efu / g, less than 106efu / g, or less than 107efu / g.

[0370] In some embodiments of any of the aspects, the viability of the bacteria in the postbiotic composition after drying (e.g., spray drying or freeze drying) is at most 1 %. In some embodiments of any of the aspects, the viability of the bacteria in the postbiotic composition after drying (e.g., spray drying or freeze drying) is at most 0.01%, at most 0.02%, at most 0.03%, at most 0.04%. at most 0.05%, at most 0.06%, at most 0.07%, at most 0.08%, at most 0.09%, at most 0.1%, at most 0.2%, at most 0.3%, at most 0.4%, at most 0.5%. at most 0.6%, at most 0.7%, at most 0.8%, at most 0.9%, at most 1%, at most 2%, at most 3%, at most 4%, at most 5%, at most 6%, at most 7%. at most 8%, at most 9%, or at most 10%.

[0371] In some embodiments of any of the aspects, the method further comprises formulating the postbiotic composition for oral delivery. In some embodiments of any of the aspects, the method further comprises formulating the postbiotic composition as a tablet, pill, capsule, or microcapsule. In some embodiments of any of the aspects, the method further comprises formulating the postbiotic composition in a liquid suspension.

[0372] In some embodiments of any of the aspects, the method further comprises formulating the postbiotic composition as a food or as part of a food. In some embodiments of any of the aspects, the method further comprises formulating the postbiotic composition as an animal feed or as part of an animal feed. In some embodiments of any of the aspects, the method further comprises formulating the postbiotic composition as a domestic animal feed or as part of a domestic animal feed (e.g.. dog food, cat food). In some embodiments of any of the aspects, the method further comprises adding food-grade and / or medical-grade fillers, including but not limited to rice, com, wheat, and / or soy products.Postbiotic Compositions

[0373] In one aspect, described herein is a postbiotic composition, wherein the postbiotic composition is prepared according to a successive fermentation process as described further herein.

[0374] For example, in one aspect, described herein is a postbiotic composition comprising plant fiber material fermented in at least first and second successive stages with at least a first bacterial species in the first stage and at least a second bacterial species in the second stage. Non-limiting examples of such plant fiber material and bacterial species are provided herein.

[0375] In another aspect, described herein is a postbiotic composition comprising Withania somnifera plant material and berry material or extract of the Sambucus genus fermented in successive fermentations with Bifidobacterium and then Lactobacillus species.

[0376] In some embodiments, the postbiotic composition comprises non-viable cells, lysed cells, cell walls, nucleic acids (e.g., bacterial nucleic acids and / or plant nucleic acids), culture supernatant, and / or bacterial metabolites.

[0377] In one aspect, described herein is a postbiotic composition comprising berry material or extract of the Vaccinium genus (e.g., a cranberry ) fermented in successive fermentations with Bifidobacterium and then Lactobacillus species.

[0378] some embodiments of any of the aspects, the postbiotic composition is a food or part of a food. In some embodiments of any of the aspects, the postbiotic composition is an animal feed or part of an animal feed. In some embodiments of any of the aspects, the postbiotic composition is a domestic animal feed or part of a domestic animal feed (e.g., dog food, cat food). In some embodiments of any of the aspects, the postbiotic composition further comprises food-grade fillers , including but not limited to rice, com, wheat, and / or soy products. In some embodiments of any of the aspects, the postbiotic composition further comprises medical-grade fillers.

[0379] In one aspect, described herein is a postbiotic composition comprising berry material or extract of the Vaccinium genus (e.g., a cranberry ) fermented in successive fermentations with Bifidobacterium and then Lactobacillus species, which is a domestic animal feed or part of a domestic animal feed.

[0380] For more details about postbiotic compositions in general, see e.g., International Publication WO 2023 / 137418 A2 and US Application 18 / 728,273 filed July 11 , 2024, published as US 2025 / 0064882 Al, and PCT / US2025 / 023826 filed April 9, 2025, the contents of each of which are incorporated herein by reference in their entireties.Metabolite Profiles

[0381] The postbiotic compositions prepared according to the presently disclosed successive fermentation methods have unique metabolite profiles. In some embodiments, the profile of microbial metabolites generated via the first and second (and third and fourth and fifth, as applicable) successive stages differs from the profile of microbial metabolites generated when the first and second (and third and fourth and fifth, as applicable) bacterial species are introduced in a single, combined fermentation stage. In some embodiments, the profile of organic acid metabolites generated via the first and second (and third and fourth and fifth, as applicable) successive stages differs from the profile of organic acid metabolites generated when the first and second (and third and fourth and fifth, as applicable) bacterial species are introduced in a single, combined fermentation stage. In some embodiments, the profile of microbial metabolites differs in the identity of one or more such metabolites. In some embodiments, the profile of microbial metabolites differs in the amount of one or more such metabolites. In some embodiments, the profile of microbial metabolites differs in the identity and amount of one or more such metabolites.

[0382] In some embodiments of any of the aspects, the postbiotic composition comprises at least one bacterial metabolite selected from the group consisting of 3-hydroxybutyric acid, quercetin, phloionolic acid, wedelolactone, luteolin, N-[(2S)-2-hydroxypropanoyl]-L-leucine, an indole organic acid or any combination thereof.

[0383] In some embodiments of any of the aspects, the postbiotic composition comprises at least one bacterial metabolite selected from the group consisting of 3-hydroxybutyric acid, quercetin, phloionolic acid, wedelolactone, luteolin, N-[(2S)-2-hydroxypropanoyl]-L-leucine, and any combination thereof. The postbiotic composition can also include organic acids produced by the fermentation, including, for example, citric acid, succinic acid, lactic acid, glycerol, and / or acetic acid. In some embodiments, the postbiotic composition comprises microbial metabolite organic acids including acetic acid, citric acid, lactic acid and succinic acid.

[0384] In some embodiments of any of the aspects, the postbiotic composition comprises each of 3-hydroxybutyric acid, quercetin, phloionolic acid, wedelolactone, luteolin and N-[(2S)-2- hydroxypropanoyl]-L-leucine and an indole organic acid.

[0385] In some embodiments of any of the aspects, the postbiotic composition comprises one or more organic acids produced by the fermentation, selected from citric acid, succinic acid, lactic acid, glycerol and acetic acid.

[0386] In some embodiments of any of the aspects, the postbiotic composition comprises each of citric acid, succinic acid, lactic acid, glycerol and acetic acid.

[0387] Exemplary amounts in the final fermentation broth include 0.5 to 3.0 g / L citric acid, 0.02 to 0.9 g / L succinic acid, 2.0 to 20 g / L lactic acid. 0.1 to 2.5 g / L glycerol, and 1.0 to 20 g / L acetic acid. An exemplary organic acid profile for the final fermentation broth includes about 1.2 g / L citric acid, about 0.1 g / L succinic acid, about 14.5 g / L lactic acid, about 0.5 g / L glycerol, and about 7.75 g / L acetic acid.

[0388] In some embodiments of any of the aspects, the postbiotic composition comprises one or more components selected from 3 -hydroxybutyric acid, quercetin, phloionolic acid, wedelolactone. luteolin, N-[(2S)-2-hydroxypropanoyl]-L-leucine, and indole organic acids. In some embodiments of any of the aspects, the indole organic acids comprise indolc-3-acctatc and / or indole -3 -lactate.

[0389] In some embodiments of any of the aspects, the postbiotic composition comprises at least one bacterial metabolite selected from Table 2. Hundreds of metabolites can exhibit a significant increase in concentration in the postbiotic product. In some embodiments, a bacterial metabolite increases at least about 10%, at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%. or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3 -fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater, following the successive fermentation, as compared to a reference level, such as the metabolite levels in a single, combined fermentation stage of the same plant fiber material and bacterial species as the successive fermentation. In some embodiments of any of the aspects, the postbiotic composition comprises at least one metabolite selected from: 3 -Hydroxy butyric acid, 6- Methoxysalicylic acid, trans-caffeic acid. Phloroglucinol carboxylic acid, 1, 6, 8-trimethyl-allantoate, Vitamin C. wedelolactone, 9, 10-Dihydroxy stearic acid, Isorhamnetin, Pseudopurpurin, Quercetin, Luteolin. 2-Ethylglutaric acid, and Phloionolic acid (see e.g., Table 2).

[0390] Table 2: Non-limiting examples of metabolites in the postbiotic composition.

[0391] In some embodiments of any of the aspects, the postbiotic composition comprises a metabolite profile exhibiting elevated levels of one or more bacterial metabolites selected from the group consisting of 3 -hydroxy butyric acid, quercetin, phloionolic acid, wedelolactone, luteolin. N- [(2S)-2-hydroxypropanoyl]-L-leucine. indole organic acid(s). and any combination thereof.

[0392] In one aspect, described herein is a postbiotic composition comprising 3 -hydroxy butyric acid, quercetin, phloionolic acid, wedelolactone, luteolin. N-[(2S)-2-hydroxypropanoyl]-L-leucine and an indole organic acid.

[0393] In some embodiments, the postbiotic composition comprises one or more short chain fatty acids selected from acetate, propionate and buty rate. In some embodiments, the postbiotic composition comprises one or more short chain fatty acid selected from acetic acid, propionic acid, and buty ric acid.

[0394] In some embodiments, the postbiotic composition comprises ketone bodies. Ketones can be produced by the bacterial species during fermentation. As ketone bodies are also produced in the liver, it is contemplated herein that providing ketone bodies via the postbiotic compositions described herein mimics healthy liver function, with consequent systemic immune tone modulation and improvement. In some embodiments, the ketone bodies comprise Beta-hydroxybutyric acid (BHB; 3- hydroxybutyric acid).

[0395] In some embodiments, the postbiotic composition comprises at least 15% organic acids, e.g.. in the dried formulation, e g., weight of total weight. In some embodiments, the postbiotic composition comprises at least 1%, at least 2%, at least 3%, at least 4%. at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%. at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, at least 20%. or more organic acids.

[0396] In some embodiments, the postbiotic composition comprises at most 1%, at most 2%, at most 3%, at most 4%, at most 5%, at most 6%, at most 7%, at most 8%, at most 9%, at most 10%, at most 11%, at most 12%, at most 13%, at most 14%, at most 15%, at most 1 %, at most 17%, at most 18%, at most 19%, at most 20%, or more organic acids.

[0397] In some embodiments, the postbiotic composition comprises about 1%, about 2%, about 3%. about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%. about 18%, about 19%, about 20%, or more organic acids.Nucleic Acids

[0398] In some embodiments, the postbiotic composition comprises nucleic acid including sequences from the plant and / or bacterial species described herein. In some embodiments, the postbiotic composition comprises nucleic acid including sequences selected from any of the following bacterial species: B. lactis, B. breve, B. infantis, B. longum, L. plantarum. L. acidophilus, L. rhamnosus, L. casei, and / or L. paracasei. Such nucleic acids can include DNA or RNA indicative of any one of these bacterial species. In some embodiments, the postbiotic composition comprises nucleic acid including sequences selected from any of the following plant genera or species: the Astragalus family, the Solanaceae or nightshade family, the Sambucus L. genus, and / or the Lens orientalis or Lens culinaris family. In some embodiments, the postbiotic composition comprises nucleic acid including sequences selected from any of the following plant genera or species: Astragalus membranaceus, Astragalus complanatus, ashwagandha (species IVithania somnifera, family Solanaceae), elderberry (species Sambucus nigra) and / or red lentil (species Lens culinaris or L. culinaris subsp. orientalis). Such nucleic acids can include DNA or RNA indicative of any one of these plant genera or species.

[0399] In some embodiments, the nucleic acids in the postbiotic composition comprise DNA. In some embodiments, the nucleic acids in the postbiotic composition comprise RNA. In someembodiments, the nucleic acids in the postbiotic composition comprise DNA and R A. Exemplar,' nucleic acids (e.g.. from plant or bacterial species) are provided herein. In some embodiments, the nucleic acids comprise ribosomal RNA (rRNA) and / or DNA encoding rRNA (rDNA). It is understood that exemplary rRNA sequences are also inclusive of and / or interchangeable with their corresponding rDNA sequences, and exemplary rDNA sequences are also inclusive of and / or interchangeable with their corresponding rRNA sequences.

[0400] In some embodiments, the postbiotic composition comprises free nucleic acids. As used herein, the term "‘free nucleic acids” refers to DNA or RNA that is extracellular and not inside a cell. Free DNA can be immunostimulatory. Free DNA influences immune modulation, enhancing both innate and adaptive immune responses. Known mechanisms of free DNA immunostimulation include but are not limited to: activation of immune receptors, promotion of dendritic cell maturation, induction of th 1 -type responses, enhancement of mucosal immunity.

[0401] Activation of Immune Receptors: Free DNA can activate immune receptors such as Toll-like receptor 9 (TLR9), which recognizes umncthylatcd CpG motifs common in microbial DNA but rare in mammalian DNA. This activation signals tire immune system to initiate an inflammatory' response, enhancing immunogenicity.

[0402] Promotion of Dendritic Cell Maturation: Free DNA can lead to the maturation of dendritic cells, which are involved in antigen presentation. Mature dendritic cells effectively present antigens to T cells, initiating a robust adaptive immune response.

[0403] Induction of Thl-Type Responses: Free DNA can skew the immune response towards a Thl-type profile, which is effective in combating viral and bacterial infections. This is particularly beneficial in vaccines where a strong cellular immune response is needed for effective protection.

[0404] Enhancement of Mucosal Immunity: When used in oral adjuvants, free DNA can enhance mucosal immunity' by stimulating immune cells located in mucosal tissues. This is involved in the defense against pathogens that enter the body via mucosal surfaces.

[0405] In some embodiments, the postbiotic composition comprises at least 0.1 ng free nucleic acids per gram of postbiotic composition. In some embodiments, the postbiotic composition comprises at least 1.0 ng free nucleic acids per gram of postbiotic composition. In some embodiments, the postbiotic composition comprises at least 0.1 ng, at least 0.2 ng. at least 0.3 ng. at least 0.4 ng. at least 0.5 ng, at least 0.6 ng, at least 0.7 ng. at least 0.8 ng. at least 0.9 ng, at least 1 ng, at least 2 ng, at least 3 ng, at least 4 ng. at least 5 ng, at least 6 ng, at least 7 ng. at least 8 ng. at least 9 ng, at least 10 ng, at least 20 ng, at least 30 ng, at least 40 ng. at least 50 ng. at least 60 ng, at least 70 ng, at least 80 ng, at least 90 ng, at least 100 ng, at least 200 ng, at least 300 ng, at least 400 ng, at least 500 ng, at least 600 ng. at least 700 ng, at least 800 ng. at least 900 ng, at least 1000 ng, or more ng free nucleic acids per gram of postbiotic composition.Exemplary Sambucus sequences

[0406] In some embodiments, the plant is a Sambucus species, e.g., Sambucus nigra. In some embodiments, the plant comprises a nucleic acid sequence (e.g., an 23S or 16S sequence; e.g.. chloroplast rRNA sequences) comprising one of SEQ ID NOs: 761 or 762 or a nucleic acid sequence that is at least 80%. at least 85%, at least 90%. at least 91%, at least 92%, at least 93%, at least 94%, at least 95%. at least 96%, at least 97%, at least 98%. at least 99%, or at least 99.5% or more identical to one of SEQ ID NOs: 761 or 762

[0407] SEQ ID NO: 761 , Sambucus nigra (European elder) 23 S ribosomal RNA gene sequenceURS0001A0F705 4202

[0408] SEQ ID NO: 762, Sambucus nigra (European elder) 16S ribosomal RNA gene sequenceURS00019A83DB_4202Exemplary Withania sequences

[0409] In some embodiments, the plant is a Withania species, e.g., Withania somnifera (see e.g., Accession number NC 047245.1). In some embodiments, the plant comprises a nucleic acid sequence (e.g., an 18S sequence) comprising one of SEQ ID NO: 54-58 or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%. at least 94%, at least 95%, at least 96%. at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical one of SEQ ID NO: 54-58|00410] SEQ ID NO: 55 Withania 18S rDNA, Accession number NC_047245.1 :

[0411] SEQ ID NO: 56 Withania 18S rDNA, Accession number NC_047245.1:

[0412] SEQ ID NO: 57 Withania 18S rDNA, Accession number NC_047245.1

[0413] SEQ ID NO: 58 Withania 18S rDNA. Accession number NC_047245.1

[0414] SEQ ID NO: 59 Withania 18S rDNA. Accession number NC_047245.1

[0415] In some embodiments, the postbiotic composition comprises at least one compound produced by any of the following plant genera or species: the Astragalus family, the Solanaceae or nightshade family, the Sambucus L. genus, and / or the Lens orientalis or Lens culinaris family. In some embodiments, the postbiotic composition comprises Withanolides (e.g., Withaferin A); the Withanolides can be produced by ashwagandha root and / or ashwagandha leaf. In some embodiments, the postbiotic composition comprises at least one of the following compounds, that can be produced by elderberry: Anthocyanins (e.g., cyanidin-3-glucoside; e.g., measured using a pH-Differential method); Anthocyanins (e.g., cyanidin-3-glucoside; e.g., measured using HPLC); and / or Polyphenols (e.g., catechin; e.g., expressed as gallic acid equivalent; e.g., measured using Folin-Ciocalteu reagent).Exemplary / Astragalus sequences

[0416] In some embodiments, the plant is an Astragalus species, e.g., Astragalus membranaceus or Astragalus complanatus (see e.g., Accession number NC 065024.1). In some embodiments, the plant comprises a nucleic acid sequence (e.g.. an 18S sequence) comprising one of SEQ ID NOs: 53- 54 or a nucleic acid sequence that is at least 80%, at least 85%. at least 90%, at least 91%. at least92%, at least 93%. at least 94%, at least 95%. at least 96%, at least 97%, at least 98%. at least 99%, or at least 99.5% or more identical to one of SEQ ID NOs: 53-54.

[0417] SEQ ID NO: 53 Astragalus complanatus 18 S rDNA Accession number NC 065024.1 :

[0418] SEQ ID NO: 54 KY316029.1 rDNA As / rago / z / .s membranaceusBacterial Sequences

[0419] In some embodiments of any of the aspects, the postbiotic composition comprises nucleic acid including sequences selected from: B. lactis, B. breve, B. infantis, B. longum, L. plantarum, L. acidophilus, L. rhamnosus, L. casei, and / or L. paracasei. In some embodiments of any of the aspects, the postbiotic composition comprises at least a portion of the 16S rRNA gene sequence from at least one of the following bacterial species: B. lactis, B. breve, B. infantis, B. longum, L. plantarum, L. acidophilus, L. rhamnosus, L. casei, and / or L. paracasei. In some embodiments of any of the aspects, the postbiotic composition comprises the V4 and / or V5 region of the 16S rRNA gene sequence from at least one of the following bacterial species: B. lactis, B. breve, B. infantis, B. longum, L. plantarum, L. acidophilus, L. rhamnosus, L. casei, and / or L. paracasei. In some embodiments, the V4 and / or V5 region is about 250 base pairs long.

[0420] In some embodiments of any of the aspects, the postbiotic composition comprises nucleic acid, including nucleic acid molecules that can hybridize with primer sequences (e.g., 16S primer) sequences selected from SEQ ID NOs: 1-13, SEQ ID NOs: 763-766, or nucleic acid complementary to at least one of SEQ ID NOs: 1-13 or SEQ ID NOs: 763-766: B. lactis'.TGGAGGGTTCGATTCTGGCTCAGGATGAACGCTG (SEQ ID NO: 1), B. breve'. CCGGATGCTCCATCACAC (SEQ ID NO: 2). B. breve'. ACAAAGTGCCTTGCTCCCT (SEQ ID NO: 3), B. longum longum : TTCCAGTTGATCGCATGGTC (SEQ ID NO: 4). B. infantis or B. breve-. GGAAACCCCATCTCTGGGAT (SEQ ID NO: 5). L. plantarum-.GCTGGCAATGCCATCGTGCT (SEQ ID NO: 6), L. plantarum'. TCTCAACGGTTGCTGTATCG (SEQ ID NO: 7), L. acidophilus'. CCTTTCTAAGGAAGCGAAGGAT (SEQ ID NO: 8). L. acidophilus-. ACGCTTGGTATTCCAAATCGC (SEQ ID NO: 9), L. rhamnosus: GCCGATCGTTGACGTTAGTTGG (SEQ ID NO: 10), L. rhamnosus: CAGCGGTTATGCGATGCGAAT (SEQ ID NO: 11), L. paracasei: CAATGCCGTGGTTGTTGGAA (SEQ ID NO: 12), L. paracasei: GCCAATCACCGCATTAATCG (SEQ ID NO: 13), and / or L. casei: CTC AAA ACT AAA CAA AGT TTC (SEQ ID NO: 763, target site LbLMAl-rev), CTT GTA CAC ACC GCC CGT CA (SEQ ID NO: 764, target site R16-1: 5'; see e.g., Dubcrnct ct al. FEMS Microbiology Letters 214(2): 271-275 (2002)), CTCTAGTTGATCCTGCTAGA (SEQ ID NO: 765, 21AF) or TACGG(A / T)TACCTTGTTACGACTT (SEQ ID NO: 766, 1492R-22 W).

[0421] In some embodiments, the primer(s) hybridizes specifically under stringent conditions to a DNA fragment having the nucleotide sequence (e.g., at least a portion of the 16S rRNA gene sequence). As herein used, the term “stringent conditions” means hybridization will occur only ifthere is at least 95% identity in nucleotide sequences. In another embodiment, hybridization under “stringent conditions” occurs when there is at least 97% identity betw een the sequences.

[0422] In some embodiments of any of the aspects, the postbiotic composition further comprises bacteria of the genera Bifidobacterium and Lactobacillus.

[0423] In some embodiments of any of the aspects, the postbiotic composition further comprises an rRNA (e.g.. 16S RNA) having a nucleic acid sequence at least 90% identical to one of SEQ ID NO: 14-16 (B. lactis), SEQ ID NO: 17-20 (B. breve), SEQ ID NO: 21-26 or SEQ ID NO: 854 (B infantis), SEQ ID NO: 767-851 (B. longum subsp. longum , SEQ ID NO: 852-853 (B. longum), SEQ ID NO: 27-32 (L. plantarum), SEQ ID NO: 33-39 (£. acidophilus), SEQ ID NO: 40-44 (£. rhamnosus), SEQ ID NO: 45-48 (£. paracasei), or SEQ ID NO: 49-52 (£. casei).

[0424] In some embodiments, the microorganism is Bifidobacterium lactis (also referred to as Bifidobacterium animalis subsp. lactis), e.g., strain DSM 10140 (see e.g., NCBI Reference Sequence: NC 012815.1 for an exemplary B. lactis genome sequence). In some embodiments, the microorganism is B. lactis strain BLC1- (Centro spcrimcntalc del Latte (CSL) / SACCO). In some embodiments, the microorganism is B. lactis strain PBP1418518. In some embodiments, a nucleic acid primer for 16S sequencing of B. lactis comprises TGGAGGGTTCGATTCTGGCTCAGGATGAACGCTG (SEQ ID NO: 1). In some embodiments, the microorganism comprises a nucleic acid sequence (e g., 16S sequence) comprising one of SEQ ID NO: 14-16 or a nucleic acid sequence that is at least 80%, at least 85%. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 14-16.

[0425] In some embodiments, the microorganism is Bifidobacterium breve, e.g., strain ATCC 15700 (see e.g., RefSeq: NZ CP006712.1 for an exemplary B. breve genome sequence). In some embodiments, the microorganism is B. breve strain Bbr8 (CSL / SACCO). In some embodiments, the microorganism is B. breve strain PBP2741300. In some embodiments, a nucleic acid primer for 16S sequencing of B. breve comprises CCGGATGCTCCATCACAC (SEQ ID NO: 2) or ACAAAGTGCCTTGCTCCCT (SEQ ID NO: 3). In some embodiments, the microorganism comprises a nucleic acid sequence (e.g., 16S sequence) comprising one of SEQ ID NO: 17-20 or a nucleic acid sequence that is at least 80%, at least 85%. at least 90%, at least 91%. at least 92%, at least 93%, at least 94%, at least 95%, at least 96%. at least 97%, at least 98%, at least 99%. or at least 99.5% or more identical to one of SEQ ID NO: 17-20. For further non-limiting examples of 16S rRNA-gene-targeted Bifidobacterium-specifc primers, see e.g.. Matsuki et al.. Appl Environ Microbiol. 2004 Jan; 70(1): 167-173 (see e.g.. Table 1 of Matsuki 2004), the contents of which are incorporated herein by reference in their entirety .

[0426] In some embodiments, the microorganism is Bifidobacterium infantis (also referred to as Bifidobacterium longum subsp. infantis) e.g., strain ATCC 15697 (see e.g., RefSeq: NC_015052.1 for an exemplary’ B. infantis genome sequence). In some embodiments, the microorganism is B. infantisstrain SP 37 (CSL / SACCO). In some embodiments, the microorganism comprises a nucleic acid sequence (e.g., 16S sequence) comprising one of SEQ ID NO: 21-26 or SEQ ID NO: 854 or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 21-26 or SEQ ID NO: 854.

[0427] In some embodiments, the microorganism is Bifidobacterium longu longum (also referred to as Bifidobacterium longum subsp. longum or as B. longum). In some embodiments, the microorganism comprises a nucleic acid sequence (e.g., 16S sequence) comprising one of SEQ ID NO: 767-851 or a nucleic acid sequence that is at least 80%, at least 85%. at least 90%, at least 91%, at least 92%. at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 767-851.

[0428] In some embodiments, the microorganism is Bifidobacterium longum, e.g., strain ATCC 15707 (see e.g., RefSeq: NC GCF 000196555.1 for an exemplar}7B. longum genome sequence). In some embodiments, the microorganism is B. longum strain ATCC 15707 or JCM 1217 or PBP234451 (see e.g., SEQ ID NO: 852-853). In some embodiments, the microorganism comprises a nucleic acid sequence (e.g., 16S sequence) comprising SEQ ID NO: 852, SEQ ID NO: 853, or a nucleic acid sequence drat is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to SEQ ID NO: 852 or SEQ ID NO: 853.

[0429] In some embodiments, a nucleic acid primer for 16S sequencing of B. longum, B. longum longum. B. breve, and / or B. infantis comprises TTCCAGTTGATCGCATGGTC (SEQ ID NO: 4) or GGAAACCCCATCTCTGGGAT (SEQ ID NO: 5). For example, SEQ ID NO: 4 can be used for 16S sequencing of B. longum longum, and SEQ ID NO: 5 can be used for 16S sequencing of B. breve or B. infantis.

[0430] In some embodiments, the microorganism is Lactobacillus plantarum (also referred to asLactiplantibacillus plantarum), e.g., strain Korean Agricultural Culture Collection (KACC) 11451 (see e.g., RefSeq: NZ CP030105.1 for an exemplary L. plantarum genome sequence). In some embodiments, a nucleic acid primer for sequencing of L. plantarum comprises GCTGGCAATGCCATCGTGCT (SEQ ID NO: 6) or TCTCAACGGTTGCTGTATCG (SEQ ID NO: 7). In some embodiments, the microorganism comprises a nucleic acid sequence (e.g.. 16S sequence) comprising one of SEQ ID NO: 27-32 or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%. at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 27-32. For further non-limiting examples of 16S rRNA-gene-targeted Lactob ac / 7 / r / .s-specific primers, see e.g.. Kim et al., BMC Microbiology volume 20, Article number: 96 (2020) (see e.g., Table 1 of Kim 2020), the contents of which are incorporated herein by reference in their entirety.

[0431] In some embodiments, the microorganism is Lactobacillus acidophilus, e.g., strain KACC 12419 (see e.g., RefSeq: NC 021181.2 for an exemplary L. acidophilus genome sequence). In some embodiments, a nucleic acid primer for 16S-23S region sequencing of L. acidophilus comprises CCTTTCTAAGGAAGCGAAGGAT (SEQ ID NO: 8) or ACGCTTGGTATTCCAAATCGC (SEQ ID NO: 9) In some embodiments, the microorganism comprises a nucleic acid sequence (e.g., 16S sequence) comprising one of SEQ ID NO: 33-39 or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%. at least 93%, at least 94%, at least 95%. at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 33-39.

[0432] In some embodiments, the microorganism is Lactobacillus rhamnosus (also referred to as Lactic aseibacillus rhamnosus), e.g., strain Korean Collection for Type Cultures (KCTC) 3237 (see e.g.. RefSeq: NZ CP086326.1, NZ LRl 34331.1, or ASM284801vl for an exemplary L. rhamnosus genome sequence). In some embodiments, the microorganism is L. rhamnosus strain CRL1505 (CSL / SACCO). In some embodiments, the microorganism is L. rhamnosus strain PBP4542118. In some embodiments, a nucleic acid primer for 16S-23S region sequencing of L. rhamnosus comprises GCCGATCGTTGACGTTAGTTGG (SEQ ID NO: 10) or CAGCGGTTATGCGATGCGAAT (SEQ ID NO: 11) In some embodiments, the microorganism comprises a nucleic acid sequence (e.g., 16S sequence) comprising one of SEQ ID NO: 40-43 or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 40-43.

[0433] In some embodiments, the microorganism is Lactobacillus paracasei (also referred to as Lacticaseibacillus paracasei), e.g., strain KACC 12361 (see e.g.. RefSeq: NC 014334.2 for an exemplary' L. paracasei genome sequence). In some embodiments, the microorganism is L. paracasei strain IMC502 (CSL / SACCO). In some embodiments, the microorganism is L. paracctsei strain PBP5197148. In some embodiments, a nucleic acid primer for sequencing of L. paracasei comprises CAATGCCGTGGTTGTTGGAA (SEQ ID NO: 12) or GCCAATCACCGCATTAATCG (SEQ ID NO: 13). In some embodiments, the microorganism comprises a nucleic acid sequence (e.g., 16S sequence) comprising one of SEQ ID NO: 45-48 or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%. at least 93%, at least 94%, at least 95%. at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 45-48

[0434] In some embodiments, the microorganism is Lactobacillus casei, e.g., strain BGP 93 (CSL / SACCO) (see e.g., RefSeq: NZ AP012544.1 or CP017065 for exemplary7L. casei genome sequences; see e.g., Kang et al.. Front Immunol. 2017; 8: 413, the contents of which are incorporated herein by reference in their entirety ). In some embodiments, the microorganism is L. casei strain PBP4157051. In some embodiments, the microorganism is L. casei strain DSM 20011, JCM 1134,ATCC 393, or LC5. In some embodiments, a nucleic acid primer for sequencing of L. casei comprises: CTC AAA ACT AAA CAA AGT TTC (SEQ ID NO: 763. target site LbLMAl-rev), CTT GTA CAC ACC GCC CGT CA (SEQ ID NO: 764, target site R16-1: 5'; see e.g., Dubernet et al. FEMS Microbiology Letters 214(2): 271-275 (2002)), CTCTAGTTGATCCTGCTAGA (SEQ ID NO: 765, 21 AF) or TACGG(A / T)TACCTTGTTACGACTT (SEQ ID NO: 766. 1492R-22 W). In some embodiments, the microorganism comprises a nucleic acid sequence (e.g., 16S sequence) comprising one of SEQ ID NO: 49-52 or a nucleic acid sequence that is at least 80%, at least 85%. at least 90%, at least 91%, at least 92%, at least 93%. at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 49-52.

[0435] In some embodiments, the microorganism comprises a nucleic acid sequence (e.g.. 16S sequence; e.g.. from a Lactobacillus species) comprising one of SEQ ID NO: 60-759or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%. at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 60-759.

[0436] In some embodiments of any of tire aspects, the bacterial strain is selected from Table 3. While specific strains of bacteria are named herein, other strains of these species are contemplated to perform in a similar manner. As a non-limiting example, to determine whether any given strain of a species is effective, the strain can be substituted for another strain of the same species in the fermentation process of the fermentation substrate composition to prepare the postbiotic composition. The postbiotic composition prepared using the substituted strain can be tested for efficacy compared to the postbiotic composition prepared using the original strain. Non-limiting examples of tests for efficacy include cell or animal models or human clinical testing of diseases and disorders such as: dysbiosis; a cancer; a microbial infection; an inflammatory disease; an autoimmune disease; disruption of the gut-brain axis; a neurological disease or disorder; a synucleinopathy; Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and / or multiple system atrophy (MSA).

[0437] Table 3: Exemplary Bacterial Strains (sequence GENBANK accession number and location of gene of interest, e.g., rRNA genes, 16S, 23S, 5S)Exemplary B. lactis sequences

[0438] SEQ ID NO: 14, B. lactis rDNA gene, 1538 nucleotides (nt).

[0439] SEQ ID NO: 15, B. lactis, Accession Number: CP001853.168853.171909 Bifidobacterium; Bifidobacterium animalis subsp. lactis. rRNA Sequence.

[0440] SEQ ID NO: 16, B. lactis. Accession Number: CP001892.1476835.1479961 Bifidobacterium; Bifidobacterium animalis subsp. lactis. rRNA Sequence.Exemplary B. breve sequences

[0441] SEQ ID NO: 17, B. breve rRNA sequence, 1531 nt (see e.g., NCBI Reference Numbers B7017_RS06345 or B7017_RS09250, rDNA ribosomal RNA gene, Bifidobacterium breve JCM 7017, NCBI Gene IDs: 56564913 or 56565465).

[0442] SEQ ID NO: 18, B. breve, Accession Number: BCXW01000037.1900.4963 Bifidobacterium; Bifidobacterium breve. rRNA Sequence.

[0443] SEQ ID NO: 19, B. breve, Accession Number: CP021558.1782121.1785182 Bifidobacterium; Bifidobacterium breve. rRNA Sequence.

[0444] SEQ ID NO: 20, B. breve, Accession Number: CP021388.2282979.2286039 Bifidobacterium; Bifidobacterium breve. rRNA Sequence.Exemplary! B. longum or B. infantis sequences

[0445] SEQ ID NO: 21 , B. infantis rDNA sequence, 1526 nt (see e.g.. NCBI Gene ID: 66505550).

[0446] SEQ ID NO: 22, B. infantis, Accession Number: AP010889.2757707.2760771 Bifidobacterium; Bifidobacterium longum subsp. infantis. rRNA Sequence.

[0447] SEQ ID NO: 23, B. infantis, Accession Number: AP010889.2751543.2754607 Bifidobacterium; Bifidobacterium longum subsp. infantis. rRNA Sequence.

[0448] SEQ ID NO: 24, B. infantis, Accession Number: CP001095.2539820.2542677Bifidobacterium; Bifidobacterium longum subsp. infantis ATCC 15697 = JCM 1222 = DSM 20088. rRNA Sequence.

[0449] SEQ ID NO: 25, B. infantis, Accession Number: BCYG01000038.1.1181 Bifidobacterium; Bifidobacterium longum subsp. infantis. rRNA Sequence.

[0450] SEQ ID NO: 26, B. infantis, Accession Number: BCYF01000054.143.3206 Bifidobacterium; Bifidobacterium longum subsp. infantis. rRNA Sequence.

[0451] SEQ ID NO: 767, OP984807.1 Bifidobacterium longum subsp. longum strain BB68S 16S ribosomal RNA gene, partial sequence

[0452] SEQ ID NO: 768, AB924523.1 Bifidobacterium longum subsp. longum gene for 16S ribosomal RNA. partial sequence, strain: YIT 10937

[0453] SEQ ID NO: 769, AB924527.1 Bifidobacterium longum subsp. longum gene for 16S ribosomal RNA. partial sequence, strain: YIT 11976

[0454] SEQ ID NO: 770, AB924521.1 Bifidobacterium longum subsp. longum gene for 16S ribosomal RNA. partial sequence, strain: YIT 4037

[0455] SEQ ID NO: 771, AB924528.1 Bifidobacterium longum subsp. longum gene for 16S ribosomal RNA. partial sequence, strain: YIT 11977

[0456] SEQ ID NO: 772, AB924526.1 Bifidobacterium longum subsp. longum gene for 16S ribosomal RNA, partial sequence, strain: YIT 11074

[0457] SEQ ID NO: 773. OR564099.1 Bifidobacterium longum subsp. longum strain DS0950 16S ribosomal RNA gene, partial sequence

[0458] SEQ ID NO: 774, AB437359.1 Bifidobacterium longum subsp. longum gene for 16S ribosomal RNA, partial sequence

[0459] SEQ ID NO: 775, AB924524.1 Bifidobacterium longum subsp. longum gene for 16S ribosomal RNA, partial sequence, strain: YIT 10938

[0460] SEQ ID NO: 776, AB924522.1 Bifidobacterium longum subsp. longum gene for 16S ribosomal RNA, partial sequence, strain: YIT 10936

[0461] SEQ ID NO: 777, AB924529.1 Bifidobacterium longum subsp. longum gene for 16S ribosomal RNA, partial sequence, strain: YIT 12147

[0462] SEQ ID NO: 778, AB924530.1 Bifidobacterium longum subsp. longum gene for 16S ribosomal RNA, partial sequence, strain: YIT 12736

[0463] SEQ ID NO: 779, AB924525.1 Bifidobacterium longum subsp. longum gene for 16S ribosomal RNA, partial sequence, strain: YIT 11061

[0464] SEQ ID NO: 780, AJ311606.1 Bifidobacterium longum 16S rRNA gene, strain Y10

[0465] SEQ ID NO: 781, LC306854.1 Bifidobacterium longum subsp. longum gene for 16S ribosomal RNA. partial sequence, strain: JCM 11342

[0466] SEQ ID NO: 782, LC589223.1 Bifidobacterium longum subsp. longum JCM 7052 gene for 16S rRNA, partial sequence

[0467] SEQ ID NO: 783, LC638742.1 Bifidobacterium longum subsp. longum JCM 11343 gene for 16S rRNA, partial sequence

[0468] SEQ ID NO: 784, HQ259741.1 Bifidobacterium longum subsp. longum strain LCR6 16S ribosomal RNA gene, partial sequence

[0469] SEQ ID NO: 785, PV478448.1 Bifidobacterium longum subsp. longum strain J0070-1 16S ribosomal RNA gene, partial sequence

[0470] SEQ ID NO: 786, LC071818.1 Bifidobacterium longum subsp. longum gene for 16S ribosomal RNA, partial sequence, strain: JCM 1217

[0471] SEQ ID NO: 787, LC612559.1 Bifidobacterium longum subsp. longum TL80 gene for 16S rRNA, partial sequence

[0472] SEQ ID NO: 788, KM577186.1 Bifidobacterium longum subsp. longum 16S ribosomal RNA gene, partial sequence

[0473] SEQ ID NO: 789, ON706015.1 Bifidobacterium longum subsp. longum strain 514 16S ribosomal RNA gene, partial sequence

[0474] SEQ ID NO: 790, MH701980.1 Bifidobacterium longum subsp. longum strainHBUAS54191 16S ribosomal RNA gene, partial sequence

[0475] SEQ ID NO: 791, HQ259737.1 Bifidobacterium longum subsp. longum strain LCR2716S ribosomal RNA gene, partial sequence

[0476] SEQ ID NO: 792. OR267355.1 Bifidobacterium longum subsp. longum strain BBH 0161 S ribosomal RNA gene, partial sequence

[0477] SEQ ID NO: 793, PQ896568.1 Bifidobacterium longum subsp. longum strain BF-P-320 16S ribosomal RNA gene, partial sequence

[0478] SEQ ID NO: 794, OK148594.1 Bifidobacterium longum subsp. longum strain H6 16S ribosomal RNA gene, partial sequence

[0479] SEQ ID NO: 795, OK559573.1 Bifidobacterium longum subsp. longum strain B264 16S ribosomal RNA gene, partial sequence

[0480] SEQ ID NO: 796, OR240787.1 Bifidobacterium longum subsp. longum strain NWAFU 0004 16S ribosomal RNA gene, partial sequence

[0481] SEQ ID NO: 797, OK148578.1 Bifidobacterium longum subsp. longum strain Hl 16S ribosomal RNA gene, partial sequence

[0482] SEQ ID NO: 798, OK148593.1 Bifidobacterium longum subsp. longum strain F9 16S ribosomal RNA gene, partial sequence

[0483] SEQ ID NO: 799, OP 183547.1 Bifidobacterium longum subsp. longum strainRACS DI121 16S ribosomal RNA gene, partial sequence

[0484] SEQ ID NO: 800, OK148428.1 Bifidobacterium longum subsp. longum strain B2 16S ribosomal RNA gene, partial sequence

[0485] SEQ ID NO: 801, OQ737778.1 Bifidobacterium longum subsp. longum strain Iraq-Basrah 1 16S ribosomal RNA gene, partial sequence

[0486] SEQ ID NO: 802, OK148581.1 Bifidobacterium longum subsp. longum strain F6 16S ribosomal RNA gene, partial sequence

[0487] SEQ ID NO: 803, OK148580.1 Bifidobacterium longum subsp. longum strain F12 16S ribosomal RNA gene, partial sequence

[0488] SEQ ID NO: 804. OK148583.1 Bifidobacterium longum subsp. longum strain F10 16S ribosomal RNA gene, partial sequence

[0489] SEQ ID NO: 805, OK148597.1 Bifidobacterium longum subsp. longum strain B5 16S ribosomal RNA gene, partial sequence

[0490] SEQ ID NO: 806, OK148737.1 Bifidobacterium longum subsp. longum strain K15 16S ribosomal RNA gene, partial sequence

[0491] SEQ ID NO. 807, OK161352.1 Bifidobacterium longum subsp. longum strain K25 16S ribosomal RNA gene, partial sequence

[0492] SEQ ID NO: 808, OK148592.1 Bifidobacterium longum subsp. longum strain 19 16S ribosomal RNA gene, partial sequence

[0493] SEQ ID NO: 809, OK148572.1 Bifidobacterium longum subsp. longum strain Fl 16S ribosomal RNA gene, partial sequence

[0494] SEQ ID NO: 810. MZ675761.1 Bifidobacterium longum subsp. longum strain xswl666 16S ribosomal RNA gene, partial sequence

[0495] SEQ ID NO: 811, KC429787.1 Bifidobacterium longum subsp. longum strain CICC 21717 16S ribosomal RNA gene, partial sequence

[0496] SEQ ID NO: 812, MK561773.1 Bifidobacterium longum subsp. longum strain C25.3 16S ribosomal RNA gene, partial sequence

[0497] SEQ ID NO: 813, OK148582.1 Bifidobacterium longum subsp. longum strain K2 16S ribosomal RNA gene, partial sequence

[0498] SEQ ID NO: 814, OK148573.1 Bifidobacterium longum subsp. longum strain K3 16S ribosomal RNA gene, partial sequence

[0499] SEQ ID NO: 815, OK161350.1 Bifidobacterium longum subsp. longum strain K13 16S ribosomal RNA gene, partial sequence

[0500] SEQ ID NO: 816, OK161351.1 Bifidobacterium longum subsp. longum strain K16 16S ribosomal RNA gene, partial sequence

[0501] SEQ ID NO: 817, OK148601.1 Bifidobacterium longum subsp. longum strain K4 16S ribosomal RNA gene, partial sequence

[0502] SEQ ID NO: 818, OK148878.1 Bifidobacterium longum subsp. longum strain K20 16S ribosomal RNA gene, partial sequence

[0503] SEQ ID NO: 819, HM009032.1 Bifidobacterium longum subsp. longum strain R017516S ribosomal RNA gene, partial sequence

[0504] SEQ ID NO: 820, OK148730.1 Bifidobacterium longum subsp. longum strain K10 16S ribosomal RNA gene, partial sequence

[0505] SEQ ID NO: 821, OM980089.1 Bifidobacterium longum subsp. longum strain 112 16S ribosomal RNA gene, partial sequence

[0506] SEQ ID NO: 822. OK148636.1 Bifidobacterium longum subsp. longum strain K8 16S ribosomal RNA gene, partial sequence

[0507] SEQ ID NO: 823, AB733110.1 Bifidobacterium longum subsp. longum gene for 16S rRNA, partial sequence, strain: NIF1AN3

[0508] SEQ ID NO: 824, LC515577.1 Bifidobacterium longum subsp. longum Oni062 gene for16S ribosomal RNA. partial sequence

[0509] SEQ ID NO: 825, OK148513.1 Bifidobacterium longum subsp. longum strain B13 16S ribosomal RNA gene, partial sequence

[0510] SEQ ID NO: 826, OK148576.1 Bifidobacterium longum subsp. longum strain 12 16S ribosomal RNA gene, partial sequence

[0511] SEQ ID NO: 827, MN759472.1 Bifidobacterium longum subsp. longum strain LPB0331 16S ribosomal RNA gene, partial sequence

[0512] SEQ ID NO: 828. MT268981.1 Bifidobacterium longum subsp. longum strain ADE3 16S ribosomal RNA gene, partial sequence

[0513] SEQ ID NO: 829, OK148711.1 Bifidobacterium longum subsp. longum strain K9 16S ribosomal RNA gene, partial sequence

[0514] SEQ ID NO: 830, OK148613.1 Bifidobacterium longum subsp. longum strain K5 16S ribosomal RNA gene, partial sequence

[0515] SEQ ID NO: 831, AB733111.1 Bifidobacterium longum subsp. longum gene for 16S rRNA, partial sequence, strain: NIF7AN2

[0516] SEQ ID NO: 832, OR885559.1 Bifidobacterium longum subsp. longum strain CCDM 219 16S ribosomal RNA gene, partial sequence

[0517] SEQ ID NO: 833, OK559571.1 Bifidobacterium longum subsp. longum strain Bi l l 16S ribosomal RNA gene, partial sequence

[0518] SEQ ID NO: 834, MT275466.1 Bifidobacterium longum subsp. longum strain D51-2 16S ribosomal RNA gene, partial sequence

[0519] SEQ ID NO: 835, GU723307.1 Bifidobacterium longum subsp. longum strainKCTC5915 16S ribosomal RNA gene, partial sequence

[0520] SEQ ID NO: 836, HQ012022.1 Bifidobacterium longum subsp. longum strain DSM 20219 16S ribosomal RNA gene, partial sequence

[0521] SEQ ID NO: 837, GU723306.1 Bifidobacterium longum subsp. longum strainKCTC3914 16S ribosomal RNA gene, partial sequence

[0522] SEQ ID NO: 838, KC415589.1 Bifidobacterium longum subsp. longum strain DR4 hypothetical protein gene, complete cds; and 16S ribosomal RNA gene, partial sequence

[0523] SEQ ID NO: 839, AB507101.1 Bifidobacterium longum gene for 16S rRNA, partial sequence, strain: JCM 1217

[0524] SEQ ID NO: 840. AB507114.1 Bifidobacterium longum subsp. longum gene for 16S rRNA. partial sequence, strain: JCM 7054

[0525] SEQ ID NO: 841, MZ348910.1 Bifidobacterium longum subsp. longum strain y37 16S ribosomal RNA gene, partial sequence

[0526] SEQ ID NO: 842, AB116313.1 Bifidobacterium longum subsp. longum JCM 1217 gene for 16S rRNA. partial sequence

[0527] SEQ ID NO: 843, AB116314.1 Bifidobacterium longum subsp. longum gene for 16S rRNA, partial sequence, strain: JCM 7050

[0528] SEQ ID NO: 844, AB116315.1 Bifidobacterium longum subsp. longum gene for 16S rRNA, partial sequence, strain: JCM 5052

[0529] SEQ ID NO: 845, AB116317.1 Bifidobacterium longum subsp. longum gene for 16S rRNA. partial sequence, strain: JCM 7054

[0530] SEQ ID NO: 846. AB116320.1 Bifidobacterium longum subsp. longum gene for 16S rRNA. partial sequence, strain: JCM 7060

[0531] SEQ ID NO: 847, AB116318.1 Bifidobacterium longum subsp. longum gene for 16S rRNA, partial sequence, strain: JCM 7055

[0532] SEQ ID NO: 848, KM009018.1 Bifidobacterium longum subsp. longum strain LMG 13197 16S-23S ribosomal RNA gene, partial sequence

[0533] SEQ ID NO: 849, AB116316.1 Bifidobacterium longum subsp. longum gene for 16S rRNA, partial sequence, strain: JCM 7053

[0534] SEQ ID NO: 850, AB116319.1 Bifidobacterium longum subsp. longum gene for 16S rRNA, partial sequence, strain: JCM 7056

[0535] SEQ ID NO: 851, GU361823.1 Bifidobacterium longum subsp. longum strain KCTC 3128 16S ribosomal RNA gene, partial sequence

[0536] SEQ ID NO: 852, ATCC 15707 B. longum 16S sequence

[0537] SEQ ID NO: 853, GenBank: M58739.2. Bifidobacterium longum strain ATCC 1570716S ribosomal RNA gene, partial sequence

[0538] SEQ ID NO: 854, GenBank: D86184.1, Bifidobacterium longum subsp. infantis gene for 16S rRNA, partial sequence, strain: ATCC 15697Exemplary! L. plantarum sequences

[0539] SEQ ID NO: 27, L. plantarum rRNA sequence, 1474 nt (see e.g., Lactobacillus plantarum strain NRRL B-14768 1 S ribosomal rDNA gene, partial sequence, NCBI Reference Sequence: NR_042394.1).

[0540] SEQ ID NO: 28, L. plantarum, Accession Number: CP026743.575947.578869 Lactiplantibacillus; Lactobacillus plantarum. rRNA Sequence.

[0541] SEQ ID NO: 29, L plantarum, Accession Number: CP020816.489843.492761 Lactiplantibacillus; Lactobacillus plantarum. rRNA Sequence.

[0542] SEQ ID NO: 30, L. plantarum, Accession Number: CP025412.483014.485936 Lactiplantibacillus; Lactobacillus plantarum. rRNA Sequence.

[0543] SEQ ID NO: 31, L. plantarum, Accession Number: CP029349.2063132.2066054 Lactiplantibacillus; Lactobacillus plantarum. rRNA Sequence.

[0544] SEQ ID NO: 32, L. plantarum, Accession Number: LUXF01000016.189.3109 Lactiplantibacillus; Lactobacillus plantarum. rRNA Sequence.Exemplary) L. acidophilus sequences

[0545] SEQ ID NO: 33, L. acidophilus rRNA sequence, 1564 nt (see e.g.. NCBI Reference Number LA14 RS08025 16S ribosomal rDNA gene Lactobacillus acidophilus La-14. NCBI Gene ID: 56943192).

[0546] SEQ ID NO: 34, L. acidophilus. Accession Number: CP000033.60957.64007 Lactobacillus; Lactobacillus acidophilus. rRNA Sequence.

[0547] SEQ ID NO: 35, Z. acidophilus, Accession Number: CP010432.436310.439215 Lactobacillus; Lactobacillus acidophilus. rRNA Sequence.

[0548] SEQ ID NO: 36, L. acidophilus, Accession Number: LWSH01000065.1.1873 Lactobacillus; Lactobacillus acidophilus. rRNA Sequence.

[0549] SEQ ID NO: 37, L. acidophilus, Accession Number: CBLR010000038.101.3004 Lactobacillus; Lactobacillus acidophilus. rRNA Sequence.

[0550] SEQ ID NO: 38, L. acidophilus, Accession Number: KC161284.1.671 Lactobacillus;Lactobacillus acidophilus. rRNA Sequence.

[0551] SEQ ID NO: 39, L. acidophilus, Accession Number: NXEYO 1000033.151.1480 Salmonella; Lactobacillus acidophilus. rRNA Sequence.Exemplary' L. rhamnosus sequences

[0552] SEQ ID NO: 40, L. rhamnosus rRN A sequence. 1521 nt (see e.g., Lactobacillus rhamnosus strain JCM 1136 16S ribosomal rDNA gene, partial sequence NCBI Reference Sequence: NR 043408.1).

[0553] SEQ ID NO: 41, L. rhamnosus, Accession Number: JUPX01000234.110.2909 Lacticaseibacilhis; Lactobacillus rhamnosus. rRNA Sequence.

[0554] SEQ ID NO: 42, Z. rhamnosus. Accession Number: JTIN01000086.137.3056 Lacticaseibacilhis; Lactobacillus rhamnosus. rRNA Sequence.

[0555] SEQ ID NO: 43, 1. rhamnosus. Accession Number: CP014201.1702655.1705574 Lacticaseibacilhis; Lactobacillus rhamnosus. rRNA Sequence.

[0556] SEQ ID NO: 44, L. rhamnosus. Accession Number: AFYD01000005.110.1639 Lacticaseibacilhis; Lactobacillus rhamnosus. rRNA Sequence.Exemplary L. paracasei sequences

[0557] SEQ ID NO: 45, L. paracasei rRNA sequence, 1522 nt (see e.g., Lactobacillus paracasei strain R094 16S ribosomal rDNA gene, partial sequence, NCBI Reference Sequence: NR 025880.1.

[0558] SEQ ID NO: 46, L. paracasei, Accession Number: CP002391.1862810.1865725 Lacticaseibacilhis; Lactobacillus paracasei. rRNA Sequence.

[0559] SEQ ID NO: 47, L. paracasei, Accession Number: CP016355.2612922.2615840 Lacticaseibacilhis; Lactobacillus paracasei. rRNA Sequence.

[0560] SEQ ID NO: 48, L. paracasei, Accession Number: ANKB01000105.125.3044 Lacticaseibacilhis; Lactobacillus paracasei. rRNA Sequence.Exemplary L. casei sequences

[0561] SEQ ID NO: 49, L. casei rRNA, Lacticaseibacillus casei DSM 20011 = JCM 1134 = ATCC 393 16S ribosomal rDNA gene, partial sequence, 1517 nucleotides (nt).

[0562] SEQ ID NO: 50, L. casei. Accession Number: AB092640.223.705 Lacticaseibacillus; Lactobacillus casei. rRNA Sequence.

[0563] SEQ ID NO: 51 , L. casei, Accession Number: AY221478.1.556 Lacticaseibacillus; Lactobacillus casei. rRNA Sequence.

[0564] SEQ ID NO: 52, L. casei, Accession Number: FM177140.909841.912756 Lacticaseibacillus; Lactobacillus casei. rRNA Sequence.Compositions and Administration

[0565] In one aspect, described herein is a pharmacal composition comprising a composition as described herein (e.g., a postbiotic composition) and a pharmaceutically acceptable carrier. In one aspect, described herein is a pharmacal composition comprising a composition (e.g., a postbiotic composition) prepared by a method as described herein, and a pharmaceutically acceptable carrier.Formulations

[0566] In one aspect, described herein is an oral postbiotic formulation, the formulation comprising a composition as described herein (e.g., a postbiotic composition). In one aspect, described herein is a composition for oral delivery, the composition comprising a postbiotic composition as described herein, formulated for oral delivery. In some embodiments of any of die aspects, the oral postbiotic formulation is formulated as a tablet, pill, capsule, or microcapsule. In some embodiments of any of the aspects, the oral postbiotic formulation is formulated for buccal, sublabial, or sublingual administration. In some embodiments of any of the aspects, the oral postbiotic formulation is a liquid suspension. In some embodiments of any of the aspects, the formulation comprises a liquid suspension.

[0567] In some embodiments, the postbiotic composition is formulated in an enteric release capsule, examples of which are known in the art. In some embodiments, the postbiotic composition is formulated in a colonic release capsule. In some embodiments, the postbiotic composition is formulated for release in the colon.|00568] In some embodiments, the technology described herein relates to a pharmaceutical composition comprising a postbiotic composition as described herein, and optionally a pharmaceutically acceptable carrier. In some embodiments, the active ingredients of the pharmaceutical composition comprise a postbiotic composition as described herein. In some embodiments, the active ingredients of the pharmaceutical composition consist essentially of a postbiotic composition as described herein. In some embodiments, the active ingredients of the pharmaceutical composition consist of a postbiotic composition as described herein.

[0569] Pharmaceutically acceptable carriers and diluents include saline, aqueous buffer solutions, solvents and / or dispersion media. The use of such carriers and diluents is well known in the art. Some non-limiting examples of materials which can serve as pharmaceutically -acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as com starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, methylcellulose, ethyl cellulose, microcrystalline cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; (10) glycols, such as propylene glycol;(11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol (PEG); (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and / or polyanhydridcs; (22) bulking agents, such as polypeptides and amino acids; (23) scrum component, such as serum albumin, HDL and LDL; (24) C2-C12 alcohols; and (25) other non-toxic compatible substances employed in pharmaceutical formulations. Wetting agents, coloring agents, release agents, coating agents, sweetening agents, flavoring agents, perfuming agents, preservative and antioxidants can also be present in tire formulation. The terms such as "excipient", "carrier", "pharmaceutically acceptable carrier" or the like are used interchangeably herein. In some embodiments, the carrier inhibits the degradation of the active agent, e.g. a postbiotic composition as described herein.

[0570] In some embodiments, the pharmaceutical composition comprising a postbiotic composition as described herein can be a parenteral dose form (i.e.. administered or occurring elsewhere in the body than the mouth and alimentary canal). Since administration of parenteral dosage forms typically bypasses the patient's natural defenses against contaminants, parenteral dosage forms are preferably sterile or capable of being sterilized prior to administration to a patient. Examples of parenteral dosage forms include, but are not limited to, solutions ready for injection, dry products ready to be dissolved or suspended in a pharmaceutically acceptable vehicle for injection, suspensions ready for injection, and emulsions.

[0571] Pharmaceutical compositions comprising a postbiotic composition as described herein can also be formulated to be suitable for oral administration, for example as discrete dosage forms, such as, but not limited to. tablets (including without limitation scored or coated tablets), pills, caplets, capsules, chewable tablets, powder packets, cachets, troches, wafers, aerosol sprays, or liquids, such as but not limited to, syrups, elixirs, solutions or suspensions in an aqueous liquid, a non-aqueous liquid, an oil-in-water emulsion, or a water-in-oil emulsion. Such compositions contain a predetermined amount of the postbiotic composition, and can be prepared by methods well known to those skilled in the art. See generally, Remington: The Science and Practice of Pharmacy, 21st Ed., Lippincott, Williams, and Wilkins, Philadelphia PA. (2005).

[0572] Suitable vehicles that can be used to provide parenteral dosage forms of a postbiotic composition as disclosed within are well known to those skilled in the art. For example, in some embodiments, the postbiotic composition is formulated for topical delivery to the skin. Non-limiting examples include, without limitation: sterile water; water for injection USP; saline solution; glucose solution; aqueous vehicles such as but not limited to. sodium chloride injection, Ringer's injection, dextrose injection, dextrose and sodium chloride injection, and lactated Ringer's injection; water- miscible vehicles such as, but not limited to. ethyl alcohol, polyethylene glycol, and propylene glycol; and non-aqueous vehicles such as, but not limited to. com oil, cottonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate, and benzyl benzoate.Dosing

[0573] In some embodiments, the methods described herein comprise administering an effective amount of postbiotic compositions described herein to a subject in order to alleviate a symptom of a disease or disorder, such as a dysbiosis. As used herein, "alleviating a symptom of a disease or disorder " is ameliorating any condition or symptom associated with the disease or disorder. As compared with an equivalent untreated control, such reduction is by at least 5%. 10%, 20%, 40%, 50%, 60%, 80%, 90%. 95%, 99% or more as measured by any standard technique. A variety of means for administering the compositions described herein to subjects are known to those of skill in the art.

[0574] In some embodiments, the postbiotic composition comprises at least 15 billion non-live cells / gram. In some embodiments, the postbiotic composition comprises at least IxlO6, at least IxlO7, at least IxlO8, at least IxlO9, at least 2xl()9, at least 3xl09, at least 4xl09, at least 5xl09, at least 6xl09, at least 7xl09, at least 8xl09, at least 9xl09, at least 10xl09. at least 1 IxlO9, at least 12xl09. at least 13xl09, at least 14xl09. at least 15xl09, at least 16xl09. at least 17xl09, at least 18xl09, at least 19xl09, at least 20xl09. or more non-live cells / gram.

[0575] In some embodiments, the postbiotic composition comprises at most IxlO6, at most IxlO7. at most IxlO8, at most IxlO9, at most 2xl09, at most 3xl09, at most 4xl09, at most 5xl09, at most 6xl09, at most 7xl09, at most 8xl09, at most 9xl09, at most 10xl09, at most l lxlO9, at most 12xl09, at most 13xl09, at most 14xl09. at most 15xl09, at most 16xl09, at most 17xl09. at most 18xl09, at most 19xl09, at most 20xl09. or more non-live cells / gram.

[0576] In some embodiments, the postbiotic composition comprises about IxlO6, about IxlO7, about IxlO8, about IxlO9, about 2xl09, about 3xl09, about 4xl09, about 5xl09, about 6xl09, about 7xl09, about 8xl09, about 9xl09, about 10xl09, about l lxlO9, about 12xl09, about 13xl09, about 14xl09, about 15xl09, about 16xl09, about 17xl09, about 18xl09, about 19xl09, about 20xl09, or more non-live cells / gram.

[0577] The term “effective amount" as used herein refers to the amount of a postbiotic composition needed to alleviate at least one or more symptom of the disease or disorder, and relates to a sufficient amount of postbiotic composition to provide the desired effect. The term "therapeuticallyeffective amount" therefore refers to an amount of a postbiotic composition that is sufficient to provide a particular anti-dysbiotic effect when administered to a typical subject. An effective amount as used herein, in various contexts, would also include an amount sufficient to delay the development of a symptom of the disease, alter the course of a symptom disease (for example but not limited to, slowing the progression of a symptom of the disease), or reverse a symptom of the disease. Thus, it is not generally practicable to specify an exact “effective amount". However, for any given case, an appropriate “effective amount" can be determined by one of ordinary skill in the art using only routine experimentation.

[0578] Effective amounts, toxicity, and therapeutic efficacy can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the ED50 (the dose therapeutically effective in 50% of the population). The dosage can vary depending upon the dosage form employed and the route of administration utilized. A therapeutically effective dose can be estimated initially from cell culture assays. The effects of any particular dosage can be monitored by a suitable bioassay or animal model. The dosage can be determined by a phy sician and adjusted, as necessary, to suit observed effects of the treatment.

[0579] The dosage ranges for the administration of a postbiotic composition as described herein, according to the methods described herein depend upon, for example, the form of the postbiotic composition, its potency, and the extent to which symptoms, markers, or indicators of a condition described herein are desired to be reduced, for example the percentage reduction desired for dysbiosis or the extent to which, for example, microbial diversity are desired to be induced. The dosage should not be so large as to cause adverse side effects, such as infection, an immune reaction, or inflammation. Generally, the dosage will vary with the age, condition, and sex of the patient and can be determined by one of skill in the art. The dosage can also be adjusted by the individual physician in the event of any complication.

[0580] The efficacy of a postbiotic composition as described herein in, e.g. the treatment of a condition described herein, or to induce a response as described herein (e.g. anti-dysbiotic) can be determined by the skilled clinician. However, a treatment is considered “effective treatment," as the term is used herein, if one or more of the signs or symptoms of a condition described herein are altered in a beneficial manner, other clinically accepted symptoms are improved, or even ameliorated, or a desired response is induced e.g., by at least 10% following treatment according to the methods described herein. Efficacy can be assessed, for example, by measuring a marker, indicator, symptom, and / or the incidence of a condition treated according to the methods described herein or any other measurable parameter appropriate, e.g. microbial diversity in the microbiota. Efficacy can also be measured by a failure of an individual to worsen as assessed by hospitalization, or need for medical interventions (i.e., progression of the disease is halted). Methods of measuring these indicators are known to those of skill in the art and / or are described herein. Treatment includes any treatment of a disease in an individual or an animal (some non-limiting examples include a human or an animal) andincludes: (1) inhibiting the disease, e.g.. preventing a worsening of symptoms (e.g., pain or inflammation); or (2) relieving the severity of the disease, e.g.. causing regression of symptoms. An effective amount for the treatment of a disease means that amount which, when administered to a subject in need thereof, is sufficient to result in effective treatment as that term is defined herein, for that disease. Efficacy of an agent can be determined by assessing physical indicators of a condition or desired response. It is well within the ability of one skilled in the art to monitor efficacy of administration and / or treatment by measuring any one of such parameters, or any combination of parameters. Efficacy can be assessed in animal models of a condition described herein, for example treatment of dysbiosis. When using an experimental animal model, efficacy of treatment is evidenced when a statistically significant change in a marker is observed, e.g. microbial amount and / or diversity.

[0581] With respect to duration and frequency of treatment, it is ty pical for skilled clinicians to monitor subjects in order to determine when the treatment is providing therapeutic benefit, and to determine whether to increase or decrease dosage, increase or decrease administration frequency, discontinue treatment, resume treatment, or make other alterations to tire treatment regimen.

[0582] In certain embodiments, an effective dose of a postbiotic composition as described herein can be administered to a patient once. In certain embodiments, an effective dose of a postbiotic composition can be administered to a patient repeatedly.

[0583] The dosing schedule can vary from once a week to daily depending on a number of clinical factors, such as the subject's sensitivity to the postbiotic composition. The desired dose or amount can be administered at one time or divided into subdoses, e.g., 2-4 subdoses and administered over a period of time, e.g., at appropriate intervals through the day or other appropriate schedule. In some embodiments, administration can be one or more doses and / or treatments daily over a period of weeks or months. Examples of dosing and / or treatment schedules are administration daily, twice daily, three times daily or four or more times daily over a period of 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month. 5 weeks, 6 weeks, 7 weeks, 8 weeks, 2 months, 3 months, 4 months, 5 months, or 6 months, or more. A postbiotic composition can be administered over a period of time, such as over a 5 minute, 10 minute, 15 minute, 20 minute, or 25 minute period.

[0584] In some embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis. For example, after treatment biweekly for three months, treatment can be repeated once per month, for six months or a year or longer.Administration

[0585] A variety' of means for administering the postbiotic compositions described herein to subjects are known to those of skill in the art. Such methods can include, but are not limited to oral, parenteral, subcutaneous (SC), transdermal, cutaneous, topical, or intrarectal administration. Administration can be local or systemic.

[0586] In some embodiments of any of the aspects, administering to the subject comprises oral administration in the form of a tablet, pill, capsule, or microcapsule. In some embodiments of any ofthe aspects, administering to the subject comprises buccal, sublabial, or sublingual administration. In some embodiments of any of the aspects, administering to the subject comprises oral administration in the form of a liquid suspension.

[0587] In some embodiments of any of the aspects, the postbiotic composition described herein is administered as a monotherapy, e.g., another treatment for the dysbiosis or other condition is not administered to the subject.

[0588] In some embodiments of any of the aspects, the methods described herein can further comprise administering a cancer therapy, e.g., as part of a combinatorial therapy. Non-limiting examples of a cancer therapy can be selected from the group consisting of: radiation therapy, surgery7, gemcitabine, cisplatin, paclitaxel, carboplatin, bortezomib, AMG479, vorinostat, rituximab, temozolomide, rapamycin, ABT-737, PI-103; alkylating agents such as thiotepa and CYTOXAN® cyclophosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylmelamines including altretamine, triethylenemelamine, trietylenephosphoramide, trie thy lenethiophosphoramide and trimethylol melamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocannycin (including the synthetic analogues, KW-2189 and CB1- TM1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide. estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan. novembichin. phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosoureas such as carmustine, chlorozotocin, fotemustine. lomustine, nimustine, and ranimustine; antibiotics such as the enediyne antibiotics (e.g., calicheamicin. especially calicheamicin gammall and calicheamicin omegall (see, e.g., Agnew, Chem. Inti. Ed. Engl., 33: 183-186 (1994)); dynemicin, including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antibiotic chromophores), aclacinomycins. actinomycin, authramycin. azaserine, bleomycins, cactinomycin, carabicin, caminomycin, carzinophilin, chromomycins. dactinomycin, daunorubicin. detorubicin, 6-diazo-5-oxo-L-norleucine, ADRIAMYCIN® doxorubicin (including morpholinodoxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, pcplomycin, potfiromycin, puromycin, quclamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone,dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformithine; elliptinium acetate; an epothilone; etoghicid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK® polysaccharide complex (JHS Natural Products, Eugene, Oreg.); razoxane; rhizoxin; sizofuran; spirogermanium; tenuazonic acid; triaziquone; 2,2'.2"-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside ("Ara-C"); cyclophosphamide; thiotepa; taxoids, e.g.. TAXOL® paclitaxel (Bristol-Myers Squibb Oncology, Princeton, N.J.), ABRAXANE® Cremophor- free, albumin-engineered nanoparticle formulation of paclitaxel (American Pharmacal Partners, Schaumberg, Ill.), and TAXOTERE® doxetaxel (Rhone-Poulenc Rorer, Antony, France); chloranbucil; GEMZAR® gemcitabine; 6-thioguanine; mercaptopurine; methotrexate; platinum analogs such as cisplatin, oxaliplatin and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine; NAVELBINE® vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; irinotecan (Camptosar. CPT-11) (including the treatment regimen of irinotecan with 5-FU and leucovorin); topoisomerase inhibitor RFS 2000; difluoromethylomithine (DMFO); retinoids such as retinoic acid; capecitabine; combretastatin; leucovorin (LV); oxaliplatin, including the oxaliplatin treatment regimen (FOLFOX); lapatinib (Tykerb®); inhibitors of PKC-alpha, Raf, H-Ras, EGFR (e.g., erlotinib (Tarceva®)) and VEGF-A that reduce cell proliferation (e.g., pazopanib, sunitinib, sorafenib, regorafenib, cabozantinib, lenvatinib, ponatinib, ziv-aflibercept, axitinib, tivozanib, vandetanib, ramucirumab) and pharmaceutically acceptable salts, acids or derivatives of any of tire above.

[0589] One of skill in the art can readily identify a chemotherapeutic agent of use (e.g., see Physicians' Cancer Chemotherapy Drug Manual 2014, Edward Chu, Vincent T. DeVita Jr., Jones & Bartlett Learning; Principles of Cancer Therapy, Chapter 85 in Harrison's Principles of Internal Medicine. 18th edition; Therapeutic Targeting of Cancer Cells: Era of Molecularly Targeted Agents and Cancer Pharmacology. Chs. 28-29 in Abeloff’s Clinical Oncology, 2013 Elsevier; and Fischer D S (ed): The Cancer Chemotherapy Handbook. 4th ed. St. Louis, Mosby -Year Book, 2003).

[0590] In addition, the methods of treatment can further include the use of radiation or radiation therapy. Further, the methods of treatment can further include the use of surgical treatments.

[0591] In some embodiments of any of the aspects, the methods described herein can further comprise administering an immune checkpoint inhibitor, e.g., as part of a combinatorial therapy. In some embodiments of any of the aspects, the immune checkpoint inhibitor comprises an immune checkpoint inhibitor antibody. In some embodiments of any of the aspects, the checkpoint inhibitorimmunotherapy is an inhibitor of a checkpoint molecule selected from the group consisting of: programmed cell death 1 (PD-1), programmed death-ligand 1 (PD-L1), cytotoxic T-lymphocyte- associated protein 4 (CTLA-4), Adenosine A2A receptor (A2AR), CD276, CD39, CD73, B7 family immune checkpoint molecules, V-set domain-containing T-cell activation inhibitor 1 (B7H4), B and T Lymphocyte Attenuator (BTLA), Indoleamine 2.3-dioxygenase (IDO), Killer-cell Immunoglobulin- like Receptor (KIR), Lymphocyte Activation Gene-3 (LAG-3), nicotinamide adenine dinucleotide phosphate NADPH oxidase isofonn 2 (N0X2), T-cell Immunoglobulin domain and Mucin domain 3 (TIM-3), T cell immunoreceptor with Ig and ITIM domains (TIGIT), V-domain Ig suppressor of T cell activation (VISTA), and Sialic acid-binding immunoglobulin-type lectin 7 (SIGLEC7).

[0592] Non-limiting examples of immune checkpoint inhibitors (ICIs) include: pembrolizumab (Keytruda®), nivolumab (Opdivo®), cemiplimab (Libtayo®), spartalizumab, camrelizumab (AiRuiKa™), sintilimab (TYVYT®), tislelizumab, toripalimab (Tuoyi™), dostarlimab (JEMPERLI), INCMGA00012, AMP-224, AMP-514 (MEDI0608), atezolizumab (Tecentriq®), avelumab (Bavcncio®), cnvafolimab (KN035), cosibclimab (CK-301), AUNP12, CA-170, BMS-986189, BMS- 936559 (MDX-1105), durvalumab (IMFINZI®), tremelimumab, and ipilimumab (Yervoy®). See e.g., US Patents US5811097, US5855887, US6051227, US6682736, US6984720, US7595048, US7605238, US7943743, US8008449, US8217149, US8354509, US8383796, US8728474, US8735553, US8779105, US8779108, US8907053, US8900587, US8952136, US9067999, US9073994, US9683048, US9987500, US10160736, US10316089, US10441655, US10590199, US11225522, US Patent Publication US2014341917; Storz et al., MAbs. 2016 Jan; 8(1): 10-26; the contents of each of which are incorporated herein by reference in their entireties.

[0593] The methods described herein can further comprise administering a second agent and / or treatment to the subject, e.g. as part of a combinatorial therapy for inflammation. By way of nonlimiting example, if a subject is to be treated for pain or inflammation according to the methods described herein, the subject can also be administered a second agent and / or treatment known to be beneficial for subjects suffering from pain or inflammation. Examples of such agents and / or treatments include, but are not limited to, non-steroidal anti-inflammatory drugs (NSAIDs - such as aspirin, ibuprofen, or naproxen); corticosteroids, including glucocorticoids (e.g. cortisol, prednisone, prednisolone, methylprednisolone, dexamethasone, betamethasone, triamcinolone, and beclometasone); methotrexate; sulfasalazine; leflunomide; anti-TNF medications; cyclophosphamide; pro-resolving drugs; my cophenolate; or opiates (e.g. endorphins, enkephalins, and dynorphin), steroids, analgesics, barbitmates, oxycodone, morphine, lidocaine, and the like.

[0594] The methods described herein can further comprise administering a second agent and / or treatment to the subject, e.g. as part of a combinatorial therapy for an infection. By way of nonlimiting example, if a subject is to be treated for a microbial infection according to the methods described herein, the subject can also be administered a second agent and / or treatment known to be beneficial for subjects suffering from an infection, such as an antibiotic. Such antibiotics include, butare not limited to, aminoglycosides, ansamycins, beta-lactams, bis-biguanides, carbacephems, carbapenems, cationic polypeptides, cephalosporins, fluoroquinolones, glycopeptides, iron- sequestering glycoproteins, linosamides, lipopeptides, macrolides, monobactams, nitrofurans, oxazolidinones, penicillins, polypeptides, quaternary ammonium compounds, quinolones, silver compounds, sulfonamides, tetracyclines, and any combinations thereof.

[0595] Some exemplary specific antimicrobial agents include broad penicillins, amoxicillin (e.g., Ampicillin, Bacampicillin, Carbenicillin Indanyl, Mezlocillin, Piperacillin, Ticarcillin), Penicillins and Beta Lactamase Inhibitors (e.g.. Amoxicillin-Clavulanic Acid, Ampicillin-Sulbactam, Benzy lpenicillin, Cloxacillin. Dicloxacillin, Methicillin, Oxacillin, Penicillin G, Penicillin V, Piperacillin Tazobactam, Ticarcillin Clavulanic Acid, Nafcillin), Cephalosporins (e.g., Cephalosporin I Generation, Cefadroxil, Cefazolin, Cephalexin, Cephalothin, Cephapirin, Cephradine), Cephalosporin II Generation (e.g., Cefaclor, Cefamandole, Cefonicid, Cefotetan, Cefoxitin, Cefprozil, Cefmetazole, Cefuroxime, Loracarbef), Cephalosporin III Generation (e.g., Cefdmir, Ceftibuten, Ccfopcrazonc, Ccfiximc, Cefotaxime, Ccfpodoximc proxctil, Ceftazidime, Ccftizoximc, Ceftriaxone), Cephalosporin IV Generation (e.g., Cefepime), Macrolides and Lincosamides (e.g., Azithromycin, Clarithromycin, Clindamycin, Dirithromycin, Erythromycin, Lincomycin, Troleandomycin), Quinolones and Fluoroquinolones (e.g., Cinoxacin, Ciprofloxacin, Enoxacin, Gatifloxacin, Grepafloxacin, Levofloxacin, Lomefloxacin, Moxifloxacin, Nalidixic acid, Norfloxacin, Ofloxacin, Sparfloxacin, Trovafloxacin, Oxolinic acid, Gemifloxacin, Perfloxacin), Carbapenems (e.g., Imipenem-Cilastatin, Meropenem), Monobactams (e.g., Aztreonam), Aminoglycosides (e.g., Amikacin, Gentamicin, Kanamycin, Neomycin, Netilmicin, Streptomycin, Tobramycin, Paromomycin), Glycopeptides (e g., Teicoplanin, Vancomycin), Tetracyclines (e.g.. Demeclocycline, Doxycycline, Methacycline, Minocycline, Oxytetracycline, Tetracycline, Chlortetracycline). Sulfonamides (e.g., Mafenide, Silver Sulfadiazine, Sulfacetamide, Sulfadiazine. Sulfamethoxazole, Sulfasalazine. Sulfisoxazole. Trimethoprim- Sulfamethoxazole. Sulfamethizole), Rifampin (e.g., Rifabutin. Rifampin. Rifapentine), Oxazolidinones (e.g.. Linezolid. Streptogramins. Quinupristin Dalfopristin), Bacitracin, Chloramphenicol, Fosfomycin, Isoniazid, Methenamine, Metronidazole, Mupirocin, Nitrofurantoin, Nitrofurazone, Novobiocin, Polymyxin, Spectinomycin, Trimethoprim, Colistin. Cycloserine. Capreomycin. Ethionamide, Pyrazinamide. Para-aminosalicylic acid. Erythromycin ethylsuccinate, and the like.Treatment Methods

[0596] It has been surprisingly discovered that postbiotic compositions prepared according to the presently disclosed successive fermentation methods have unique metabolite profiles and advantageous properties. In at least some instances, the presently disclosed postbiotic compositions have a metabolite profile exhibiting elevated levels of one or more advantageous metabolites selected from the group consisting of 3 -hydroxy butyric acid, quercetin, phloionolic acid, wedelolactone, luteolin. N-[(2S)-2-hydroxypropanoyl]-L-leucine. organic acids including citric acid, succinic acid,lactic acid, glycerol and acetic acid, as well as indole organic acids, vitamin C, and any combination thereof.

[0597] According to another aspect of the present disclosure, oral postbiotic formulations comprising the presently disclosed postbiotic compositions are provided. The oral postbiotic formulations can be formulated as a tablet, pill, capsule, or microcapsule. In other instances, the oral postbiotic formulation can be formulated for buccal, sublabial, or sublingual administration. In still other instances, the oral postbiotic formulation can be a liquid suspension. The oral postbiotic formulations can be useful for the modulation, stabilization, restoration, treatment, and / or prevention of disruption of the gut microbiota. Accordingly, in one aspect, described herein is a method of modulating, stabilizing, or restoring the gut microbiota of a subject, the method comprising administering to the subject an amount of a postbiotic composition or pharmaceutical composition as described herein, at an amount effective to modulate, stabilize or restore the gut microbiota of the subject. In some embodiments, the subject is a healthy subject.

[0598] The oral postbiotic formulations can also be useful for the treatment or prevention of a disease or disorder, including but not limited to a cancer, a microbial infection, an inflammatory disease, or an autoimmune disease, or a chronic disease (e.g., psychological stress) that alters the microbiome and / or is associated with dysbiosis. Psychological stress has been shown to alter the microbiome and thereby exacerbate disease, see e.g., Wei et al. “Psychological stress-induced microbial metabolite indole-3 -acetate disrupts intestinal cell lineage commitment,” Cell Metabolism Volume 36, Issue 3, P466-483.E7, March 05, 2024, the contents of which are incorporated herein by reference in their entirety.

[0599] In some embodiments, the subject has and / or has been diagnosed with a cancer, nonlimiting examples of which are provided herein. In some embodiments, the subject has and / or has been diagnosed with a microbial infection, such as a bacterial, fungal, or viral infection. In some embodiments, the subject has and / or has been diagnosed with an inflammatory disease. In some embodiments, the inflammatory disease is selected from the group consisting of: an autoimmune disease; a cardiovascular disease (e.g., high blood pressure, heart disease); a gastrointestinal disorder (e.g., inflammatory bowel disease. Crohn's disease, ulcerative colitis); a lung disease (e.g., chronic obstructive pulmonary disease (COPD), asthma). In some embodiments, the subject has and / or has been diagnosed with an autoimmune disease, non-limiting examples of which are provided herein. In some embodiments, the subject has and / or has been diagnosed with a chronic disease (e.g.. psychological stress) that alters the microbiome and / or is associated with dysbiosis.

[0600] In some embodiments, the subject has and / or has been diagnosed with graft versus host disease (GvHD) (e.g., acute or chronic). In some embodiments, the treatment method decreases or prevents graft versus host disease (GvHD) (e.g., acute or chronic), such as following allo-HSCT (see e.g.. Example 5).

[0601] In some embodiments, the subject has and / or has been diagnosed with a neurological disease or disorder, such as a synucleinopathy, such as Parkinson’s disease (PD), REM Sleep Behavior Disorder, dementia with Lewy bodies (DLB), pure autonomic failure (PAF), or multiple system atrophy (MSA) (see e.g., Example 6).

[0602] In some embodiments, the treatment method comprises a step (prior to administering a postbiotic composition as described herein) of selecting a subject having or diagnosed as having a dysbiosis. In some embodiments, the treatment method comprises a step (prior to administering a postbiotic composition as described herein) of selecting a subject having or diagnosed as having at least one of the following: a cancer, a microbial infection, an inflammatory disease, an autoimmune disease, a chronic disease that alters the microbiome and / or is associated with dysbiosis, graft versus host disease (GvHD) (e.g., acute or chronic), or a neurological disease or disorder associated with a disruption in the gut-brain axis.

[0603] In some embodiments, the treatment method increases the efficacy of a cancer immunotherapy. In some embodiments, the treatment method increases the efficacy of an immune checkpoint inhibitor therapy (e.g., anti-PD-1). In some embodiments, tire treatment method decreases or prevents dysbiosis caused by cancer immunotherapy. Immune checkpoint inhibitor therapy can impacts the microbiome with negative consequences for outcomes, see e.g., Bjork et al., “Longitudinal gut microbiome changes in immune checkpoint blockade-treated advanced melanoma,” Nature Medicine volume 30, pages 785-796 (2024), the contents of which are incorporated herein by reference in their entirety. In some embodiments, the treatment method increases the efficacy of a cancer immunotherapy and decreases or prevents dysbiosis caused by cancer immunotherapy.

[0604] According to another aspect of the present disclosure, a method of treating or preventing the disruption of gut microbiota associated with an antibiotic treatment in a subject is also provided. The method includes administering to the subject a pharmaceutically effective amount of any one of the presently disclosed postbiotic compositions or postbiotic formulations prepared according to the presently disclosed method and processes. The administering to the subject can include oral administration in the form of a tablet, pill, capsule, or microcapsule. Alternatively, the administering to the subject can include buccal, sublabial, or sublingual administration or oral administration in the form of a liquid suspension.

[0605] According to another aspect of the present disclosure, a method of treating or preventing dysbiosis or dysbacteriosis associated with an antibiotic treatment in a subject is provided. The method includes administering to the subject a pharmaceutically effective amount of any one of the presently disclosed postbiotic compositions or postbiotic formulations prepared according to the presently disclosed method and processes. The administering to the subject can include oral administration in the form of a tablet, pill, capsule, or microcapsule. Alternatively, the administering to the subject can include buccal, sublabial, or sublingual administration or oral administration in the form of a liquid suspension.

[0606] According to another aspect of the present disclosure, a method of mitigating or preventing antibiotic resistance in a subject receiving an antibiotic treatment is provided. The method includes administering to the subject a pharmaceutically effective amount of any one of the presently disclosed postbiotic compositions or postbiotic formulations prepared according to the presently disclosed method and processes. The administering to the subject can include oral administration in the form of a tablet, pill, capsule, or microcapsule. Alternatively, the administering to the subject can include buccal, sublabial, or sublingual administration or oral administration in the form of a liquid suspension.

[0607] According to another aspect of the present disclosure, a combination therapy for administering an antibiotic to a subject in need thereof while reducing or preventing antimicrobial resistance in the subject is provided. The combination therapy can include administration of a therapeutically effective amount of an antibiotic to the subject and administration of a therapeutically effective amormt of one of the presently disclosed postbiotic compositions or postbiotic formulations, prepared according to the presently disclosed methods and processes. The administering to the subject can include oral administration in the form of a tablet, pill, capsule, or microcapsule. Alternatively, the administering to the subject can include buccal, sublabial, or sublingual administration or oral administration in the form of a liquid suspension.

[0608] In some embodiments of any of the aspects, the oral postbiotic formulation is for the treatment or prevention of disruption of gut microbiota associated with an antibiotic treatment, chemotherapy treatment, or administration of a dysbiosis-causing medication or medical treatment in a subject.

[0609] In some embodiments of any of the aspects, the oral postbiotic formulation is for the treatment or prevention of dysbiosis or dysbacteriosis associated with an antibiotic treatment, chemotherapy treatment, or administration of a dysbiosis-causing medication or medical treatment in a subject.

[0610] In some embodiments of any of the aspects, the oral postbiotic formulation is for the treatment or prevention of disruption of gut microbiota associated with a chemotherapy treatment in a subject.

[0611] In some embodiments of any of the aspects, the oral postbiotic formulation is for the treatment or prevention of dysbiosis or dysbacteriosis associated with a chemotherapy treatment in a subject. In some embodiments of any of the aspects, the oral postbiotic formulation is for the treatment or prevention of dysbiosis or dysbacteriosis associated with cancer immunotherapy, including but not limited to immune checkpoint modulator / inhibitor therapy, hematopoietic cell transplantation therapy and CAR-T therapy, vaccination (e.g., a dendritic cell vaccine), or any other approach that facilitates or activates an immune cell response against a cancer.

[0612] In some embodiments of any of the aspects, the oral postbiotic formulation is for the treatment or prevention of disruption of gut microbiota associated with administration of a dysbiosiscausing drug in a subject.

[0613] In some embodiments of any of the aspects, the oral postbiotic formulation is for the treatment or prevention of dysbiosis or dysbacteriosis associated with administration of a dysbiosiscausing drug in a subject.

[0614] In one aspect, described herein is a method of treating or preventing disruption of gut microbiota associated with an antibiotic treatment, chemotherapy treatment, or administration of a dysbiosis-causing medication or medical treatment in a subject, the method comprising administering to the subject an amount of a composition as described herein (e.g., a postbiotic composition) effective to treat or prevent the disruption.

[0615] In another aspect, described herein is a method of treating or preventing disruption of the immune system due to gut dysbiosis caused by lifesty le, stress, or associated with an antibiotic treatment, chemotherapy treatment, or administration of a dysbiosis-causing medication or medical treatment in a subject, the method comprising administering to the subject an amount of a composition as described herein effective to treat or prevent the disruption.

[0616] In some embodiments of any of die aspects, the medical treatment comprises a cancer immunotherapy.

[0617] In some embodiments of any of the aspects, the cancer immunotherapy comprises immune checkpoint modulator / inliibitor therapy, hematopoietic cell transplantation therapy, CAR-T therapy, a dendritic cell vaccine, or any other approach that facilitates or activates an immune cell response against a cancer.

[0618] In some embodiments of any of the aspects, the medical treatment comprises vaccination.

[0619] In some embodiments of any of the aspects, the medical treatment comprises treatment with a dysbiosis-causing drug.

[0620] In some embodiments of any of the aspects, the dysbiosis-causing drug is selected from the group consisting of acid-blocking medications, proton-pump inhibitors (PPIs). H2 blockers, birth control, steroids, antipsychotics, opioids, metformin. SSRIs, nonsteroidal anti-inflammatory drugs (NSAIDs). and any combination thereof. Metabolic diseases, such as diabetes, can also cause or be associated with dysbiosis, as can poor management of blood sugar in such conditions. As such, insulin can also be considered a drug that influences dysbiosis, and the compositions described herein are specifically contemplated for use in treating or preventing dysbiosis related to diabetes.

[0621] In one aspect, described herein is a method of treating cancer, the method comprising administering a cancer immunotherapy and administering a composition as described herein to a subject in need thereof, wherein the administering is effective to treat the cancer. In some embodiments of any of the aspects, such a combination therapy increases the efficacy of the cancer immunotherapy (see e.g., Example 3, Example 4).

[0622] In one aspect, described herein is a method of treating cancer, the method comprising administering a CAR-T therapy and administering a composition as described herein to a subject in need thereof, wherein the administering is effective to treat the cancer. In some embodiments of any of the aspects, such a combination therapy increases the efficacy of the CAR-T therapy (see e.g.. Example 3).

[0623] In one aspect, described herein is a method of treating cancer, the method comprising administering chemotherapy and administering a composition as described herein to a subject in need thereof, wherein the administering is effective to treat the cancer. In some embodiments of any of the aspects, such a combination therapy increases the efficacy of the chemotherapy (see e.g.. Example 3).

[0624] In one aspect, described herein is a method of treating an autoimmune disease, the method comprising administering an autoimmune disease therapy and administering a composition as described herein to a subject in need thereof, wherein the administering is effective to treat the autoimmune disease.

[0625] In one aspect, described herein is a method of preventing or treating graft versus host disease (GvHD; e.g., acute or chronic), the method comprising administering a GvHD disease therapy and administering a composition as described herein to a subject in need thereof, wherein the administering is effective to prevent or treat die GvHD.

[0626] In one aspect, described herein is a method of treating an inflammatory disease, the method comprising administering an anti-inflammatory therapy and administering a composition as described herein to a subject in need thereof, wherein the administering is effective to treat the inflammatory disease.

[0627] In one aspect, described herein is a method of treating an infection, the method comprising administering at least one antibiotic and administering a composition as described herein to a subject in need thereof, wherein the administering is effective to treat the infection. In some embodiments of any of the aspects, such a combination therapy increases the efficacy of the at least one antibiotic (see e.g., Example 2).

[0628] In one aspect, described herein is a method of increasing neutrophil engraftment, the method comprising administering an effective amount of a composition as described herein to a subject in need thereof.

[0629] In one aspect, described herein is a method of treating or preventing intestinal mucositis associated with chemotherapy, the method comprising administering chemotherapy and administering a composition as described herein to a subject in need thereof, wherein the administering is effective to treat the intestinal mucositis.

[0630] Mucositis occurs when cancer treatments break down the rapidly dividing epithelial cells lining the gastro-intestinal tract. Non-limiting examples of measurements for mucositis include: microscopic inspection of intestinal biopsy; a patient-reported assessment scale based on symptoms such as vomiting, diarrhea, pain, abdominal complaints, and / or nutritional support (e.g., the NationalCancer Institute Common Terminology Criteria for Adverse Events (NC1-CTCAE) scale and the Daily Gut Score (DGS)): and / or a biomarker in a blood, fecal, breath, or urine sample. Non-limiting examples of such mucositis biomarkers or tests include: citrulline; pro-inflammatory cytokines such as TNF-a, IL 1 -beta, or IL-6; C-reactive protein (CRP); intestinal fatty acid binding protein (I-FABP); ileal bile acid binding protein (I-BABP); calprotectin; calgranulin (S100A12); ratio of fecal human DNA / total DNA; sugar permeability test; hydrogen breath test; 13Clactose test; 3C-sucrose breath test; see e.g.. Kuiken et al., “Biomarkers and non-invasive tests for gastrointestinal mucositis,” Support Care Cancer. 2017; 25(9): 2933-2941, the contents of which are incorporated by reference herein in its entirety.

[0631] In some embodiments of any of the aspects, administration of a composition as described herein (e.g., a postbiotic composition; e.g., an oral postbiotic formulation; e.g., in combination with a cancer treatment) is associated with at least one of the following outcomes, as compared to a negative control such as a subject not receiving the composition or the treated subject prior to being administered the composition: decreased incidence of cancer relapse (e.g., rclapsc-frcc); increased cancer survival; decreased time to neutrophil engraftment; increased peripheral blood mononuclear cell recover}' trajectories (e.g., higher peripheral blood mononuclear cell counts); decreased incidence of febrile neutropenia; decreased blood stream infection incidence; and / or decreased 30-day readmission events (see e.g., Example 3).

[0632] In some embodiments of any of the aspects, administration of a composition as described herein (e.g., a postbiotic composition; e.g., an oral postbiotic formulation; e.g., in combination with chemotherapy) is associated with an improvement in intestinal mucositis associated with chemotherapy (e.g., decreased intestinal mucositis), as compared to a negative control such as a subject not receiving the composition or the treated subject prior to being administered the composition (see e.g., Example 3).

[0633] In one aspect, described herein is a method of treating or preventing the disruption of gut microbiota associated with an antibiotic treatment, chemotherapy treatment, or administration of a dysbiosis-causing medication or medical treatment in a subject, the method comprising administering to the subject a pharmaceutically effective amount of a composition as described herein (e.g.. a postbiotic composition).

[0634] In one aspect, described herein is a method of treating or preventing dysbiosis or dysbacteriosis associated with an antibiotic treatment, chemotherapy treatment, or administration of a dysbiosis-causing medication or medical treatment in a subject, the method comprising administering to the subject a pharmaceutically effective amount of a composition as described herein (e.g., a postbiotic composition).

[0635] In one aspect, described herein is a method of treating or preventing the disruption of gut microbiota associated with an antibiotic treatment, chemotherapy treatment, or administration of a dysbiosis-causing medication or medical treatment in a subject, the method comprising administeringto the subject a pharmaceutically effective amount of an oral postbiotic formulation as described herein.

[0636] In one aspect, described herein is a method of treating or preventing dysbiosis or dysbacteriosis associated with a radiation therapy treatment in a subject, the method comprising administering to the subject a pharmaceutically effective amount of an oral postbiotic formulation as described herein.

[0637] In one aspect, described herein is a method of mitigating or preventing antibiotic resistance in a subject receiving an antibiotic treatment, the method comprising administering to the subject a pharmaceutically effective amount of a composition as described herein (e.g., a postbiotic composition) or a pharmaceutically effective amount of an oral postbiotic formulation as described herein.

[0638] In one aspect, described herein is a method of treating or preventing dysbiosis or dysbacteriosis associated with a chemotherapy treatinent in a subject, the method comprising administering to the subject a pharmaceutically effective amount of a composition as described herein (e.g., a postbiotic composition).

[0639] In one aspect, described herein is a method of treating or preventing the disruption of gut microbiota associated with a chemotherapy treatment in a subject, the method comprising administering to the subject a pharmaceutically effective amount of an oral postbiotic formulation as described herein.

[0640] In one aspect, described herein is a method of treating or preventing dysbiosis or dysbacteriosis associated with a chemotherapy treatment in a subject, the method comprising administering to the subject a pharmaceutically effective amount of an oral postbiotic formulation as described herein.

[0641] In one aspect, described herein is a method of treating or preventing the disruption of gut microbiota associated with administration of a dysbiosis-causing drug in a subject, the method comprising administering to the subject a pharmaceutically effective amount of a composition as described herein (e.g., a postbiotic composition).

[0642] In one aspect, described herein is a method of treating or preventing dysbiosis or dysbacteriosis associated with administration of a dysbiosis-causing drug in a subject, the method comprising administering to the subject a pharmaceutically effective amount of a composition as described herein (e.g., a postbiotic composition).

[0643] In one aspect, described herein is a method of treating or preventing the disruption of gut microbiota associated with administration of a dysbiosis-causing drug in a subject, the method comprising administering to the subject a pharmaceutically effective amount of an oral postbiotic formulation as described herein.

[0644] In one aspect, described herein is a method of treating or preventing dysbiosis or dysbacteriosis associated with administration of a dysbiosis-causing drug in a subject, the methodcomprising administering to the subject a pharmaceutically effective amount of an oral postbiotic formulation as described herein.

[0645] In one aspect, described herein is a combination therapy for administering an antibiotic to a subject in need thereof while reducing or preventing antimicrobial resistance in the subject, the combination therapy comprising: administration of a therapeutically effective amount of an antibiotic to the subject; and administration of a therapeutically effective amount of a composition as described herein (e.g., a postbiotic composition) or a therapeutically effective amount of an oral postbiotic formulation as described herein.

[0646] In one aspect, described herein is a combination therapy comprising: administration of a therapeutically effective amount of an antibiotic to the subject; administration of a chemotherapy treatment to the subject; and administration of a therapeutically effective amount of a composition as described herein (e.g., a postbiotic composition) or a therapeutically effective amount of an oral postbiotic formulation as described herein.

[0647] In one aspect, described herein is a combination therapy comprising: administration of an immune checkpoint inhibitor (ICPI) therapy to a subject; and administration of a therapeutically effective amount of a composition as described herein (e.g., a postbiotic composition) or a therapeutically effective amount of an oral postbiotic formulation as described herein.

[0648] In one aspect, described herein is a combination therapy comprising: administration of a bone marrow transplant to a subject; and administration of a therapeutically effective amount of a composition as described herein (e.g.. a postbiotic composition) or a therapeutically effective amount of an oral postbiotic formulation as described herein.

[0649] In one aspect, described herein is a combination therapy comprising: administration of a hematopoietic cell transplantation (HCT) or stem cell engraftment to a subject; and administration of a therapeutically effective amount of a composition as described herein (e.g., a postbiotic composition) or a therapeutically effective amount of an oral postbiotic formulation as described herein.

[0650] In one aspect, described herein is a combination therapy comprising: administration of a chimeric antigen receptor T cell therapy to a subject; and administration of a therapeutically effective amount of a composition as described herein (e.g., a postbiotic composition) or a therapeutically effective amount of an oral postbiotic formulation as described herein.

[0651] In some embodiments of any of the aspects, the combination therapy further comprising administering a chemotherapy treatment to the subject.

[0652] In one aspect, described herein is a method of treating cancer, the method comprising administering at least one cancer treatment and administering a postbiotic composition to a subject in need thereof, wherein the administering is effective to treat the cancer, wherein the postbiotic composition is prepared according to a process comprising: a) under anaerobic conditions, at a temperature and for a time sufficient to permit growth of the first bacterial inoculum therebyproducing a primary fermented composition; (c) inoculating the primary fermented composition produced in step (b) with a second bacterial inoculum; (d) maintaining the composition formed in step (c) under anaerobic conditions at a temperature and for a time sufficient to permit growth of the second bacterial inoculum to produce a secondary fermented composition; (e) inactivating the bacteria in the secondary fermented composition; and (f) optionally lyophilizing or spray-drying the secondary fermented composition to obtain the postbiotic composition.

[0653] In one aspect, described herein is a method of improving non-human animal health, the method comprising administering to a non-human animal an animal feed comprising a postbiotic composition comprising berry material or extract of the Vaccinium genus (e.g., a cranberry ) fermented in successive fermentations with Bifidobacterium and then Lactobacillus species.

[0654] The postbiotic formulations described herein can be useful for the modulation, treatment or prevention of disruption of the gut-brain axis. The oral postbiotic formulations can also be useful for the treatment or prevention of a neurological disease or disorder; a synucleinopathy; Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and / or multiple system atrophy (MSA) (see e.g., Example 6).

[0655] In some embodiments of any of the aspects, a treatment method as described herein increases diversity in the microbiome (e.g., gut microbiome, skin microbiome, etc.) of the subject. Microbiome diversity includes the number and distribution of different types of microbes, such as bacteria, fungi, and viruses. A diverse microbiome can be more resilient and functional than one with fewer types of microbes; for example, if a first microbe cannot perform its function, a second microbe can fulfill the function of the first microbe. A diverse microbiome is linked to overall health and wellbeing, including gut health. Microbiome diversity can be measured, for example, using alpha diversity (e.g., the Shannon diversity' index, inverse Simpson, and / or species richness) and / or beta diversity (e.g., Bray Curtis dissimilarity) as known in the art.

[0656] Accordingly, in one aspect, described herein is a method of increasing microbiome (e.g.. gut microbiome, skin microbiome, etc.) diversity in a subject. In some embodiments, the method comprising administering to the subject an amount of a postbiotic composition as described herein. In some embodiments, the dose of the postbiotic composition is effective to significantly increase microbiome (e.g., gut microbiome, skin microbiome, etc.) diversity7in the subject.

[0657] In some embodiments, the microbiome (e.g.. gut microbiome, skin microbiome, etc.) diversity is increased by at least about 10%, at least about 20%. or at least about 30%, or at least about 40%, or at least about 50%. or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any? increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3 -fold, or at least about a 4- fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level. In some embodiments of any of the aspects, a reference level is the same or similar subject not administered the successive fermentation postbioticcomposition, or a subject administered a postbiotic composition produced in a single, combined fermentation stage of the same plant fiber material and bacterial species as the successively fermented postbiotic composition.Cancer

[0658] As used herein, the term “cancer” relates generally to a class of diseases or conditions in which abnormal cells divide without control and can invade nearby tissues. Cancer cells can also spread to other parts of the body through the blood and lymph sy stems. There are several main ty pes of cancer. Carcinoma is a cancer that begins in the skin or in tissues that line or cover internal organs. Sarcoma is a cancer that begins in bone, cartilage, fat, muscle, blood vessels, or other connective or supportive tissue. Leukemia is a cancer that starts in blood-forming tissue such as the bone marrow, and causes large numbers of abnormal blood cells to be produced and enter the blood. Lymphoma and multiple myeloma are cancers that begin in the cells of the immune system. Central nervous system cancers are cancers that begin in the tissues of the brain and spinal cord.

[0659] In some embodiments of any of the aspects, the cancer is a primary cancer. In some embodiments of any of the aspects, the cancer is a malignant cancer. As used herein, the tenn “malignant” refers to a cancer in which a group of tumor cells display one or more of uncontrolled growth ( / .e.. division beyond normal limits), invasion i.e.. intrusion on and destruction of adjacent tissues), and metastasis (i.e., spread to other locations in the body via lymph or blood). As used herein, the tenn “metastasize” refers to the spread of cancer from one part of the body to another. A tumor formed by cells that have spread is called a “metastatic tumor” or a “metastasis.” The metastatic tumor contains cells that are like those in the original (primary) tumor. As used herein, the term “benign” or “non-malignanf ’ refers to tumors that may grow larger but do not spread to other parts of the body. Benign tumors are self-limited and typically do not invade or metastasize.

[0660] A “cancer cell” or “tumor cell” refers to an individual cell of a cancerous growth or tissue. A “tumor” refers generally to a swelling or lesion formed by an abnormal growth of cells, which may be benign, pre-malignant, or malignant. In some embodiments, the tumor is a solid tumor. Most cancer cells form tumors, but some, e.g.. leukemia, do not necessarily form tumors. For those cancer cells that form tumors, the terms cancer (cell) and tumor (cell) are used interchangeably.

[0661] As used herein the term "neoplasm" refers to any new and abnormal growth of tissue, e.g., an abnormal mass of tissue, the growth of which exceeds and is uncoordinated with that of the normal tissues. Thus, a neoplasm can be a benign neoplasm, premalignant neoplasm, or a malignant neoplasm.

[0662] A subject that has a cancer or a tumor is a subject having objectively measurable cancer cells present in the subject's body. Included in this definition are malignant, actively proliferative cancers, as well as potentially dormant tumors or micrometastases. Cancers which migrate from their original location and seed other vital organs can eventually lead to the death of the subject through the functional deterioration of the affected organs.

[0663] In some embodiments of any of the aspects, the cancer is any cancer that can be treated with chemotherapy or immunotherapy. Examples of cancer include but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, leukemia, basal cell carcinoma, biliary tract cancer; bladder cancer; bone cancer; brain and CNS cancer; breast cancer; cancer of the peritoneum; cervical cancer; choriocarcinoma; colon and rectum cancer; connective tissue cancer; cancer of the digestive system; endometrial cancer; esophageal cancer; eye cancer; cancer of the head and neck; gastric cancer (including gastrointestinal cancer); glioblastoma (GBM); hepatic carcinoma; hepatoma; intraepithelial neoplasm.; kidney or renal cancer; larynx cancer; leukemia; liver cancer; lung cancer (e.g., small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, and squamous carcinoma of the lung); lymphoma including Hodgkin’s and non-Hodgkin’s lymphoma; melanoma; myeloma; neuroblastoma; oral cavity’ cancer (e.g., lip, tongue, mouth, and pharynx); ovarian cancer; pancreatic cancer; prostate cancer; retinoblastoma; rhabdomyosarcoma; rectal cancer; cancer of the respiratory’ system; salivary’ gland carcinoma; sarcoma; skin cancer; squamous cell cancer; stomach cancer; testicular cancer; thyroid cancer; uterine or endometrial cancer; cancer of the urinary system; vulval cancer; as well as other carcinomas and sarcomas; as well as B-cell lymphoma (including low grade / follicular non-Hodgkin’s lymphoma (NHL); small lymphocytic (SL) NHL; intermediate grade / follicular NHL; intermediate grade diffuse NHL; high grade immunoblastic NHL; high grade lymphoblastic NHL; high grade small non-cleaved cell NHL; bulky disease NHL; mantle cell lymphoma; AIDS-related lymphoma; and Waldenstrom’s Macroglobulinemia); chronic lymphocytic leukemia (CLL); acute lymphoblastic leukemia (ALL); Hairy' cell leukemia; chronic myeloblastic leukemia; and post-transplant lymphoproliferative disorder (PTLD), as well as abnormal vascular proliferation associated with phakomatoses. edema (such as that associated with brain tumors), and Meigs’ syndrome.

[0664] A “cancer cell” is a cancerous, pre-cancerous, or transformed cell, either in vivo, ex vivo. or in tissue culture, that has spontaneous or induced phenotypic changes that do not necessarily involve the uptake of new genetic material. Although transformation can arise from infection with a transforming virus and incorporation of new genomic nucleic acid, or uptake of exogenous nucleic acid, it can also arise spontaneously or following exposure to a carcinogen, thereby mutating an endogenous gene. Transformation / cancer is associated with, e.g.. morphological changes, immortalization of cells, aberrant growth control, foci formation, anchorage independence, malignancy, loss of contact inhibition and density limitation of growth, growth factor or serum independence, tumor specific markers, invasiveness or metastasis, and tumor growth in suitable animal hosts such as nude mice.Autoimmune Diseases

[0665] In various embodiments, the postbiotic compositions described herein can be used to treat autoimmune disease.

[0666] “Autoimmune disease” refers to a class of diseases in which a subject's own antibodies react with host tissue or in which immune effector T cells are autoreactive to endogenous self-peptides and cause destruction of tissue. Thus an immune response is mounted against a subject's own antigens, referred to as self-antigens. A “self-antigen” as used herein refers to an antigen of a normal host tissue. Normal host tissue does not include neoplastic cells.

[0667] Autoantigens, as used herein, are endogenous proteins or fragments thereof that elicit this pathogenic immune response. Autoantigen can be any substance or a portion thereof normally found within a mammal that, in an autoimmune disease, becomes the primary (or a primary) target of attack by the immune system. The term also includes antigenic substances that induce conditions having the characteristics of an autoimmune disease when administered to mammals. Additionally, the term includes peptic subclasses consisting essentially of immunodominant epitopes or immunodominant epitope regions of autoantigens. Immunodominant epitopes or regions in induced autoimmune conditions are fragments of an autoantigen that can be used instead of the entire autoantigen to induce the disease. In humans afflicted with an autoimmune disease, immunodominant epitopes or regions are fragments of antigens specific to the tissue or organ under autoimmune attack and recognized by a substantial percentage (e g. a majority though not necessarily an absolute majority) of autoimmune attack T-cells.

[0668] Autoantigens that are known to be associated with autoimmune disease include myelin proteins with demyelinating diseases, e.g. multiple sclerosis and experimental autoimmune myelitis; collagens and rheumatoid arthritis; insulin, proinsulin, glutamic acid decarboxylase 65 (GAD65); islet cell antigen (ICA512; ICA12) with insulin dependent diabetes.

[0669] A common feature in a number of autoimmune related diseases and inflammatory conditions is the involvement of pro-inflammatory CD4+ T cells. These T cells are responsible for the release of inflammatory. Thl type cytokines. Cytokines characterized as Thf type include interleukin 2 (IL-2), y-interferon, TNFoc and IL- 12. Such pro-inflammatory cytokines act to stimulate the immune response, in many cases resulting in the destruction of autologous tissue. Cytokines associated with suppression of T cell response are the Th2 type, and include IL-10, IL-4 and TGF-p. It has been found that Thl and Th2 type T cells may use the identical antigen receptor in response to an immunogen; in the former producing a stimulatory response and in the latter a suppressive response.

[0670] Provided herein is a method of treating an autoimmune disease, which comprises administering an effective amount of a postbiotic composition to a patient in need thereof. In one embodiment of any one of the methods described, the autoimmune disorder is selected from the group consisting of thyroiditis, type 1 diabetes mellitus, Hashimoto's thyroidits, Graves' disease, celiac disease, multiple sclerosis, Guillain-Barre syndrome, Addison's disease, and Raynaud's phenomenon, Goodpasture's disease, arthritis (rheumatoid arthritis such as acute arthritis, chronic rheumatoid arthritis, gout or gouty arthritis, acute gouty arthritis, acute immunological arthritis, chronic inflammatory arthritis, degenerative arthritis, type II collagen-induced arthritis, infectious arthritis,Lyme arthritis, proliferative arthritis, psoriatic arthritis, Still's disease, vertebral arthritis, and juvenileonset rheumatoid arthritis, arthritis chronica progrediente, arthritis deformans, polyarthritis chronica primaria, reactive arthritis, and ankylosing spondylitis), inflammatory hyperproliferative skin diseases, psoriasis such as plaque psoriasis, guttate psoriasis, pustular psoriasis, and psoriasis of the nails, atopy including atopic diseases such as hay fever and Job's syndrome, dermatitis including contact dermatitis, chronic contact dermatitis, exfoliative dermatitis, allergic dermatitis, allergic contact dermatitis, dermatitis herpetiformis, nummular dermatitis, seborrheic dermatitis, non-specific dermatitis, primary irritant contact dermatitis, and atopic dermatitis, x-linked hyper IgM syndrome, allergic intraocular inflammatory diseases, urticaria such as chronic allergic urticaria and chronic idiopathic urticaria, including chronic autoimmune urticaria, myositis, polymyositis / dermatomyositis, juvenile dermatomyositis, toxic epidermal necrolysis, scleroderma (including systemic scleroderma), sclerosis such as systemic sclerosis, multiple sclerosis (MS) such as spino-optical MS, primary progressive MS (PPMS), and relapsing remitting MS (RRMS), progressive systemic sclerosis, atherosclerosis, arteriosclerosis, sclerosis disseminata, ataxic sclerosis, ncuromyclitis optica (NMO), inflammatory bowel disease (IBD) (for example, Crohn's disease, autoimmune-mediated gastrointestinal diseases, colitis such as ulcerative colitis, colitis ulcerosa, microscopic colitis, collagenous colitis, colitis polyposa, necrotizing enterocolitis, and transmural colitis, and autoimmune inflammatory bowel disease), bowel inflammation, pyoderma gangrenosum, erythema nodosum, primary sclerosing cholangitis, respiratory' distress syndrome, including adult or acute respiratory' distress syndrome (ARDS), meningitis, inflammation of all or part of the uvea, iritis, choroiditis, an autoimmune hematological disorder, rheumatoid spondylitis, rheumatoid synovitis, hereditary angioedema, cranial nerve damage as in meningitis, herpes gestationis, pemphigoid gestationis, pruritus scroti, autoimmune premature ovarian failure, sudden hearing loss due to an autoimmune condition. IgE-mediated diseases such as anaphylaxis and allergic and atopic rhinitis, encephalitis such as Rasmussen's encephalitis and limbic and / or brainstem encephalitis, uveitis, such as anterior uveitis, acute anterior uveitis, granulomatous uveitis, nongranulomatous uveitis, phacoantigenic uveitis, posterior uveitis, or autoimmune uveitis, glomerulonephritis (GN) with and without nephrotic syndrome such as chronic or acute glomerulonephritis such as primary GN, immune -mediated GN, membranous GN (membranous nephropathy), idiopathic membranous GN or idiopathic membranous nephropathy, membrano- or membranous proliferative GN (MPGN), including Type I and Type 11, and rapidly progressive GN, proliferative nephritis, autoimmune polyglandular endocrine failure, balanitis including balanitis circumscripta plasmacellularis. balanoposthitis, erythema annulare centrifugum. erythema dyschromicum perstans, erythema multiforme, granuloma annulare, lichen nitidus, lichen sclerosus et atrophicus. lichen simplex chronicus, lichen spinulosus, lichen planus, lamellar ichthyosis, epidermolytic hyperkeratosis, premalignant keratosis, pyoderma gangrenosum, allergic conditions and responses, allergic reaction, eczema including allergic or atopic eczema, asteatotic eczema, dyshidrotic eczema, and vesicular palmoplantar eczema, asthma such as asthmabronchiale, bronchial asthma, and auto-immune asthma, conditions involving infiltration of T cells and chronic inflammatory responses, immune reactions against foreign antigens such as fetal A-B-0 blood groups during pregnancy, chronic pulmonary inflammatory disease, autoimmune myocarditis, leukocyte adhesion deficiency, lupus, including lupus nephritis, lupus cerebritis, pediatric lupus, non- renal lupus, extra-renal lupus, discoid lupus and discoid lupus erythematosus, alopecia lupus, systemic lupus erythematosus (SLE) such as cutaneous SLE or subacute cutaneous SLE, neonatal lupus syndrome (NLE), and lupus ery thematosus disseminatus. juvenile onset (Type I) diabetes mellitus, including pediatric insulin-dependent diabetes mellitus (IDDM), adult onset diabetes mellitus (Type II diabetes), autoimmune diabetes, idiopathic diabetes insipidus, diabetic retinopathy, diabetic nephropathy, diabetic large-artery disorder, immune responses associated with acute and delayed hypersensitivity mediated by cytokines and T-lymphocytes, sarcoidosis, granulomatosis including lymphomatoid granulomatosis, Wegener's granulomatosis, agranulocytosis, vasculitides. including vasculitis, large-vessel vasculitis (including polymyalgia rheumatica and giant-cell (Takayasu's) arteritis), medium-vessel vasculitis (including Kawasaki's disease and polyarteritis nodosa / pcriarteritis nodosa), microscopic polyarteritis, immunovasculitis, CNS vasculitis, cutaneous vasculitis, hypersensitivity vasculitis, necrotizing vasculitis such as systemic necrotizing vasculitis, and ANCA- associated vasculitis, such as Churg-Strauss vasculitis or syndrome (CSS) and ANCA-associated small-vessel vasculitis, temporal arteritis, autoimmune aplastic anemia, Coombs positive anemia, Diamond Blackfan anemia, hemolytic anemia or immune hemolytic anemia including autoimmune hemolytic anemia (AIHA), pernicious anemia (anemia perniciosa), Addison's disease, pure red cell anemia or aplasia (PRC A), Factor VIII deficiency, hemophilia A, autoimmune neutropenia, pancytopenia, leukopenia, diseases involving leukocyte diapedesis. CNS inflammatory disorders, multiple organ injury syndrome such as those secondary to septicemia, trauma or hemorrhage, antigen-antibody complex-mediated diseases, anti-glomerular basement membrane disease, antiphospholipid antibody syndrome, allergic neuritis. Behcet's disease / syndrome, Castleman's syndrome, Goodpasture's syndrome, Reynaud's syndrome, Sjogren's syndrome, Stevens-Johnson syndrome, pemphigoid such as pemphigoid bullous and skin pemphigoid, pemphigus (including pemphigus vulgaris, pemphigus foliaceus, pemphigus mucus-membrane pemphigoid, and pemphigus erythematosus), autoimmune polyendocrinopathies, Reiter's disease or syndrome, an immune complex disorder such as immune complex nephritis, antibody -mediated nephritis, polyneuropathies, chronic neuropathy such as IgM polyneuropathies or IgM-mediated neuropathy, and autoimmune or immune-mediated thrombocytopenia such as idiopathic thrombocytopenic purpura (ITP) including chronic or acute ITP. scleritis such as idiopathic cerato-scleritis, episcleritis, autoimmune disease of the testis and ovary including autoimmune orchitis and oophoritis, primary hypothyroidism, hypoparathyroidism, autoimmune endocrine diseases including thyroiditis such as autoimmune thyroiditis, Hashimoto's disease, chronic thyroiditis (Hashimoto's thyroiditis), or subacute thyroiditis, idiopathic hypothyroidism, Grave's disease, polyglandular syndromes such as autoimmunepolyglandular syndromes (or polyglandular endocrinopathy syndromes), paraneoplastic syndromes, including neurologic paraneoplastic syndromes such as Lambert-Eaton myasthenic syndrome or Eaton-Lambert syndrome, stiff-man or stiff-person syndrome, encephalomyelitis such as allergic encephalomyelitis or encephalomyelitis allergica and experimental allergic encephalomyelitis (EAE), myasthenia gravis such as thymoma-associated myasthenia gravis, cerebellar degeneration, neuromyotonia, opsoclonus or opsoclonus myoclonus syndrome (OMS), and sensory neuropathy, multifocal motor neuropathy, Sheehan's syndrome, autoimmune hepatitis, lupoid hepatitis, giant-cell hepatitis, autoimmune chronic active hepatitis, lymphoid interstitial pneumonitis (LIP), bronchiolitis obliterans (non-transplant) vs NSIP. Guillain-Barre syndrome, Berger's disease (IgA nephropathy), idiopathic IgA nephropathy, linear IgA dermatosis, acute febrile neutrophilic dermatosis, subcorneal pustular dermatosis, transient acantholytic dermatosis, cirrhosis such as primary biliary cirrhosis and pneumonocirrhosis, autoimmune enteropathy syndrome, Celiac or Coeliac disease, celiac sprue (gluten enteropathy), refractory sprue, idiopathic sprue, cry oglobulinemia, amyotrophic lateral sclerosis (ALS; Lou Gehrig's disease), coronary artery disease, autoimmune car disease such as autoimmune inner ear disease (AIED), autoimmune hearing loss, polychondritis such as refractory or relapsed or relapsing polychondritis, pulmonary alveolar proteinosis, Cogan's syndrome / nonsyphilitic interstitial keratitis, Bell's palsy, Sweet's disease / syndrome, rosacea autoimmune, zoster-associated pain, amyloidosis, a non-cancerous lymphocytosis, a primary' lymphocytosis, which includes monoclonal B cell lymphocytosis (e.g., benign monoclonal gammopathy and monoclonal gammopathy of undetermined significance, MGUS), peripheral neuropathy, paraneoplastic syndrome, channelopathies including channelopathies of the CNS, autism, inflammatory myopathy, focal or segmental or focal segmental glomerulosclerosis (FSGS), endocrine opthalmopathy, uveoretinitis, chorioretinitis, autoimmune hepatological disorder, fibromyalgia, multiple endocrine failure. Schmidt's syndrome, adrenalitis, gastric atrophy, presenile dementia, demyelinating diseases such as autoimmune demyelinating diseases and chronic inflammatory demyelinating polyneuropathy. Dressier's syndrome, alopecia areata, alopecia totalis, CREST syndrome (calcinosis. Raynaud's phenomenon, esophageal dysmotility, sclerodactyly. and telangiectasia), male and female autoimmune infertility, e.g.. due to anti-spermatozoan antibodies, mixed connective tissue disease, Chagas' disease, rheumatic fever, recurrent abortion, farmer's lung, erythema multiforme, post- cardiotomy syndrome, Cushing's syndrome, bird-fancier's lung, allergic granulomatous angiitis, benign lymphocytic angiitis, Alport's syndrome, alveolitis such as allergic alveolitis and fibrosing alveolitis, interstitial lung disease, transfusion reaction. Sampler's syndrome, Caplan's syndrome, endocarditis, endomyocardial fibrosis, diffuse interstitial pulmonary fibrosis, interstitial lung fibrosis, pulmonary fibrosis, idiopathic pulmonary fibrosis, cystic fibrosis, endophthalmitis, erythema elevatuin et diutinum, erythroblastosis fetalis, eosinophilic fasciitis. Shulman's syndrome, Felty's syndrome, cyclitis such as chronic cyclitis, heterochromic cyclitis, iridocyclitis (acute or chronic), or Fuch's cyclitis, Henoch-Schonlein purpura, SCID, sepsis, endotoxemia, post-vaccination syndromes,Evan's syndrome, autoimmune gonadal failure, Sydenham's chorea, post-streptococcal nephritis, thromboangiitis obliterans, thyrotoxicosis, tabes dorsalis, chorioiditis, giant-cell polymyalgia, chronic hypersensitivity pneumonitis, keratoconjunctivitis sicca, idiopathic nephritic syndrome, minimal change nephropathy, benign familial and ischemia-reperfusion injury, transplant organ reperfusion, retinal autoimmunity, aphthae, aphthous stomatitis, arteriosclerotic disorders, aspermiogenesis. autoimmune hemolysis, Boeck's disease, enteritis allergica. ery thema nodosum leprosum, idiopathic facial paralysis, chronic fatigue syndrome, febris rheumatica, Hamman-Rich's disease, sensoneural hearing loss, ileitis regionalis. leucopenia, transverse myelitis, primary idiopathic myxedema, ophthalmia symphatica, polyradiculitis acuta, pyoderma gangrenosum, acquired splenic atrophy, vitiligo, toxic-shock syndrome, conditions involving infiltration of T cells, leukocyte-adhesion deficiency, immune responses associated with acute and delayed hypersensitivity mediated by cytokines and T-lymphocytes, diseases involving leukocyte diapedesis, multiple organ injury syndrome, antigen-antibody complex-mediated diseases, antiglomerular basement membrane disease, allergic neuritis, autoimmune polycndocrinopathics, oophoritis, primary' myxedema, autoimmune atrophic gastritis, rheumatic diseases, mixed connective tissue disease, nephrotic syndrome, insulitis, polyendocrine failure, autoimmune polyglandular syndrome type I, adult-onset idiopathic hypoparathyroidism (AOIH), myocarditis, nephrotic syndrome, primary' sclerosing cholangitis, acute or chronic sinusitis, ethmoid, frontal, maxillary, or sphenoid sinusitis, an eosinophil-related disorder such as eosinophilia, pulmonary infiltration eosinophilia, eosinophilia-myalgia syndrome, Loffler's syndrome, chronic eosinophilic pneumonia, tropical pulmonary' eosinophilia, granulomas containing eosinophils, seronegative spondyloarthritides, polyendocrine autoimmune disease, sclerosing cholangitis, sclera, episclera, Bruton's syndrome, transient hypogammaglobulinemia of infancy, Wiskott-Aldrich syndrome, ataxia telangiectasia syndrome, angiectasis, autoimmune disorders associated with collagen disease, rheumatism, allergic hypersensitivity disorders, glomerulonephritides, reperfusion injury, ischemic re-perfusion disorder, lymphomatous tracheobronchitis, inflammatory dermatoses, dermatoses with acute inflammatory components, and autoimmune uveoretinitis (AUR).

[0671] Autoimmune diseases can be mediated by IgG. by inappropriately high levels of IgG. auto-reactive IgG, and or immune complex. Non-limiting examples of IgG-mediated autoimmune diseases include Kawasaki disease, Sjogren's disease, Guillain-Barre, inflammatory bowel disease (IBD). Crohn's disease, ulcerative colitis, systemic lupus erythematosus (SLE), lupus arthritis, lupus nephritis, idiopathic thrombocytopenic purpura, rheumatoid arthritis (RA), warm autoimmune hemolytic anemia, heparin induced thrombocytopenia, thrombotic thrombocytopenic purpura, IgA nephritis, pemphigus vulgaris, systemic sclerosis, Wegener’s granulomatosis / granulomatosis with polyangiitis, myasthenia gravis, Addison’s disease, ankylosing spondylitis, Behcet’s syndrome, celiac disease, Goodpasture syndrome / anti-glomerular basement membrane disease, idiopathic membranous glomerulonephritis, Hashimoto’s disease, autoimmune pancreatitis, autoimmune hepatitis, primarybiliary sclerosis, multiple sclerosis, vasculitis, psoriasis vulgaris, sarcoidosis, type 1 diabetes gestational alloimmune liver disease. Rlr disease, ABO incompatibility, neonatal lupus, hemolytic disease of the newborn, neonatal alloimmune thrombocytopenia, neonatal alloimmune neutropenia, and / or neonatal myasthenia gravis.

[0672] In some embodiments, “immune complex” and “immunocomplexed antibody” are used interchangeably. Tn some embodiments, the immune complex is an immune complex of antigen+antigen-specific antibody. In some embodiments and particularly in some assays as described herein, the immune complex is artificial, i.e., does not occur naturally in the mammal. For example, the immune complex may be a multimeric complex of 4-hydroxy-5-iodo-3 -nitrophenyl acetic acid (NIP), chicken ovalbumin (OVA), and an anti-NIP antibody. In this context, the anti-NIP antibody is a chimeric IgG antibody that contains a murine variable region specific for 4-hydroxv-5-iodo-3- nitrophenyl acetic acid and an Fc domain from wild-type human IgGl (see e.g., Claypool, 2004, Mol. Biol. Cell 15:1746-1759).Neurological Diseases or Disorders

[0673] The present disclosure provides methods for using postbiotic compositions with advantageous metabolite and secondary metabolite and organic acid levels and profiles to treat or prevent the disruption of the gut-brain axis. As used herein, the term “gut-brain axis” refers to the gut- produced or modulated hormones, gut bacterial metabolites, etc. that influence function of the central and / or peripheral nervous system (e.g., neurons, glial cells, and the like). Postbiotics comprise primary and secondary metabolic products, molecular cues that can be membrane -bound or dissolved, secreted products created by probiotic microorganisms, and / or components of microbial substrates converted or not by microbial activity that influence the gut microbiome and its host.

[0674] According to at least one aspect of the present disclosure, the presently disclosed postbiotic compositions are effective in treating or preventing a neurological disease or disorder. In some aspects, the postbiotic compositions can be used to treat or prevent a synucleinopathy, which is a group of neurodegenerative disorders in which the protein alpha-synuclein accumulates abnormally to form inclusions in the cell bodies or axons of neurons or oligodendrocytes and is associated with multisystem neurodegeneration.

[0675] Non-limiting examples of diseases or disorders associated with synucleinopathy include movement disorders, parkinsonism (Parkinson's disease, pantothenate kinase-associated neurodegeneration), dementia (Parkinson's disease dementia, dementia with Lewy body), and autonomic dysfunction (pure autonomic failure, multiple system atrophy). In some embodiments, the subject to be treated has or is diagnosed with a disease or disorder selected from tire group consisting of: Parkinson's disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and multiple system atrophy (MSA). In some embodiments, tire subject to be treated has or is diagnosed with REM Sleep Behavior Disorder, which is characterized by complex motor enactment of dreams and is a potential prodromal marker of Parkinson's disease (PD).

[0676] The presently disclosed gut microbiome protecting postbiotic compositions can be prepared according to a process that uses fermentation. In particular, the presently disclosed compositions provide probiotics combined with fermented herbal substrates, and compounds from microbial activity that protects, stimulates and stabilizes a healthy gut ecosystem, thereby protecting the gut-brain axis. It has been surprisingly discovered that the fermentation provides postbiotic compositions with metabolite profiles that can be used to treat or prevent disruption of the gut-brain axis. In particular, the fermentation results in postbiotic compositions with elevated advantageous metabolites, such as 3-hydroxybutyric acid, quercetin, phloionolic acid, wedelolactone, luteolin, N- [(2S)-2-hydroxypropanoyl]-L-leucine, organic acids such as citric acid, succinic acid, lactic acid, glycerol and acetic acid, as well as indole organic acids, and vitamin C.

[0677] In some embodiments, administering the postbiotic composition is associated with at least one of the following outcomes, as compared to a negative control such as a subject not receiving the postbiotic composition or the treated subject prior to being administered the postbiotic composition: higher diversity in microbiomc; higher abundance of beneficial microbiomc species (e.g., Faecalibacterium, Akkermansia, and / or Ruminococcus)', decreased abundance of pathogenic or non- beneficial microbiome species (e.g., Scardovia, Escherichia-Shigella, and / or Streptococcus)', decreased alpha-synuclein accumulates or inclusions (e.g., in samples from the stool, colon, gut, skin, and / or CSF); decreased inflammatory cytokines (e.g., tumor necrosis factor-alpha (TNFa). interleukin- ip (IL-1 (3), and / or interleukin-6 (IL-6)); decreased immune activation: decreased constipation; decreased stool hardness; decreased bowel movement frequency; decreased incidence or severity of sleep behavior disorders; decreased incidence or severity of Parkinson’s symptoms (e.g., tremor in hands, arms, legs, jaw, or head; muscle stiffness; slowness of movement; impaired balance and coordination); increased cognitive function; decreased depression; decreased anxiety; and / or increased quality of life.

[0678] In some embodiments of any of the aspects, administering the postbiotic composition in combination with a synucleinopathy treatment is associated with an improvement in intestinal mucositis, as compared to a negative control such as a subject not receiving the composition or the treated subject prior to being administered the composition.

[0679] Non-limiting examples of synucleinopathy treatment include: LEVODOPA, dopamine agonists. Monoamine Oxidase B (MAO-B) inhibitors, Catechol-O-Methyltransferase (COMT) inhibitors (e.g., entacapone. tolcapone), anticholinergics (e.g., benztropine, trihexyphenidyl), amantadine, deep brain stimulation, alpha-synuclein immunotherapy (e.g., prasinezumab), aggregation inhibitors (e.g., Anlel38b), gene therapy (e.g., Aromatic L-amino acid decarboxylase (AADC) delivery), and / or iron chelators (e.g., deferiprone) .Definitions

[0680] For convenience, the meaning of some terms and phrases used in the specification, examples, and appended claims, are provided below. Unless stated otherwise, or implicit fromIl lcontext, the following terms and phrases include the meanings provided below. The definitions are provided to aid in describing particular embodiments, and are not intended to limit the claimed invention, because the scope of the invention is limited only by the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. If there is an apparent discrepancy between the usage of a term in the art and its definition provided herein, the definition provided within the specification shall prevail.

[0681] As used herein, the term “dysbiosis” (also referred to as “dysbacteriosis” or “disruption of gut microbiota”) refers to a disruption to the microbiota homeostasis caused by an imbalance in the microflora, changes in their functional composition and metabolic activities, or a shift in their local distribution. It is a term for a microbial imbalance or maladaptation on or inside the body, such as an impaired microbiota. For example, a part of the human microbiota, such as the skin flora, gut flora, or vaginal flora, can become deranged, with normally dominating species underrepresented and normally outcompctcd or contained species increasing to fill the void. Dysbiosis is most commonly reported as a condition in the gastrointestinal tract, but applies to other niches as well. As non-limiting examples, dysbiosis can be caused by antibiotic treatment, chemotherapy treatment, or administration of a dysbiosis-causing medication or medical treatment.

[0682] The terms “decrease”, “reduced”, “reduction”, or “inhibit” are all used herein to mean a decrease by a statistically significant amount. In some embodiments, “reduce,” “reduction" or “decrease" or “inhibit” typically means a decrease by at least 10% as compared to a reference level (e.g. the absence of a given treatment or agent) and can include, for example, a decrease by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%. at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%. at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%. at least about 98%, at least about 99% , or more. As used herein, “reduction” or “inhibition” does not encompass a complete inhibition or reduction as compared to a reference level. “Complete inhibition” is a 100% inhibition as compared to a reference level. A decrease can be preferably down to a level accepted as within the range of normal, e.g., for an individual without a given disorder.

[0683] The terms “increased”, “increase”, “enhance”, or “activate” are all used herein to mean an increase by a statistically significant amount. In some embodiments, the terms “increased”, “increase”, “enhance”, or “activate” can mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%. or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3 -fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase betw een 2-fold and 10-fold orgreater as compared to a reference level. In the context of a marker or symptom, an “increase” is a statistically significant increase in such level.

[0684] As used herein, a “subject” means a human or animal. Usually the animal is a vertebrate such as a primate, rodent, domestic animal or game animal. Primates include chimpanzees, cynomolgus monkeys, spider monkeys, and macaques, e.g.. Rhesus. Rodents include mice, rats, woodchucks, ferrets, rabbits and hamsters. Domestic and game animals include cows, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cat, canine species, e.g.. dog, fox, wolf, avian species, e.g.. chicken, emu, ostrich, and fish, e.g., trout, catfish and salmon. In some embodiments, the subject is a mammal, e.g.. a primate, e.g., a human. The terms, “individual,” “patient” and “subject” are used interchangeably herein.

[0685] Preferably, the subject is a mammal. The mammal can be a human, non-human primate, mouse, rat, dog, cat, horse, or cow, but is not limited to these examples. Mammals other than humans can be advantageously used as subjects that represent animal models of: dysbiosis; a cancer; a microbial infection; an inflammatory disease; an autoimmune disease; disruption of the gut-brain axis; a neurological disease or disorder; a synucleinopathy; Parkinson's disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and / or multiple system atrophy (MSA). A subject can be male or female.

[0686] A subject can be one who has been previously diagnosed with or identified as suffering from or having a condition in need of treatment (e g. dysbiosis; a cancer; a microbial infection; an inflammatory disease; an autoimmune disease; disruption of the gut-brain axis; a neurological disease or disorder; a synucleinopathy; Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and / or multiple system atrophy (MSA)) or one or more complications related to such a condition, and optionally, have already undergone treatment for dysbiosis or the one or more complications related to dysbiosis. Alternatively, a subject can also be one who has not been previously diagnosed as having dysbiosis or one or more complications related to dysbiosis. For example, a subject can be one who exhibits one or more risk factors for dysbiosis or one or more complications related to dysbiosis or a subject who does not exhibit risk factors. In some embodiments of any of the aspects, the subject is immunocompromised, e.g.. due to a medical treatment such as chemotherapy or cancer immunotherapy.

[0687] A “subject in need” of treatment for a particular condition can be a subject having that condition, diagnosed as having that condition, or at risk of developing that condition.

[0688] A variant amino acid or DNA sequence can be at least 80%, at least 85%, at least 90%. at least 91%, at least 92%, at least 93%, at least 94%. at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more, identical to a native or reference sequence. The degree of homology (percent identity) between a native and a mutant sequence can be determined, for example, by comparing the two sequences using freely available computer programs commonly employed for this purpose on the world wide web (e.g. BLASTp or BLASTn with default settings).

[0689] A variant amino acid sequence can be at least 50%, at least 60%, at least 70%. at least 80%, at least 90%. at least 91%, at least 92%. at least 93%, at least 94%, at least 95%. at least 96%, at least 97%, at least 98%, at least 99%, or more, similar to a native or reference sequence. As used herein, “similarity” refers to an identical amino acid or a conservatively substituted amino acid, as described herein. Accordingly, the percentage of “sequence similarity ” is the percentage of amino acids which is either identical or conservatively changed; e.g., “sequence similarity” = (% sequence identity)+(% conservative changes). It should be understood that a sequence that has a specified percent similarity to a reference sequence necessarily encompasses a sequence with the same specified percent identity to that reference sequence. The skilled person will be aware of various computer programs, using different mathematical algorithms, that are available to determine the identity or similarity between two sequences. For instance, use can be made of a computer program employing the Needleman and Wunsch algorithm (Needleman et al. (1970)); the GAP program in the Accelrys GCG software package (Accelerys Inc., San Diego U.S.A.); the algorithm of E. Meyers and W. Miller (Meyers ct al. (1989)) which has been incorporated into the ALIGN program (version 2.0); or more preferably the BLAST (Basic Local Alignment Tool using default parameters); see e.g., US Patent 10,023,890, the content of which is incorporated by reference herein in its entirety.

[0690] In some embodiments, sequencing comprises 16S rRNA gene sequencing, which can also be referred to as “16S ribosomal RNA sequencing”, “16S rDNA sequencing” or “16s rRNA sequencing”. Sequencing of the 16S rRNA gene can be used for genetic studies as it is highly conserved between different species of bacteria, but it is not present in eukaryotic species. In addition to highly conserved regions, the 16S rRNA gene also comprises nine hypervariable regions (V1-V9) that vary by species. 16S rRNA gene sequencing typically comprises using a plurality of universal primers that bind to conserved regions of the 16S rRNA gene, PCR amplifying the bacterial 16S rRNA gene regions (including hypervariable regions), and sequencing the amplified 16S rRNA genes with a next-generation sequencing technology as described herein (see also e.g.. US Patents 5.654,418; 6,344,316; and 8.889.358; and US Patent Application Numbers US 2013 / 0157265 and US 2018 / 0195111, which are incorporated by reference in their entireties).

[0691] As used herein, the terms "treat.” "treatment." "treating,” or “amelioration” refer to therapeutic treatments, wherein the object is to reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of a condition associated with a disease or disorder, e.g. dysbiosis that includes: a cancer; a microbial infection; an inflammatory disease; an autoimmune disease; disruption of the gut-brain axis; a neurological disease or disorder; a synucleinopathy; Parkinson’s disease (PD); REM Sleep Behavior Disorder: dementia with Lewy’ bodies (DLB); pure autonomic failure (PAF); and / or multiple system atrophy’ (MSA). The term “treating" includes reducing or alleviating at least one adverse effect or symptom of a condition, disease or disorder associated with such a dysbiosis, e.g.. that includes: a cancer; a microbial infection; an inflammatory disease; an autoimmune disease; or a disruption of the gut-brain axis. Treatment is generally “effective" if one or more sy mptoms orclinical markers are reduced. Alternatively, treatment is “effective" if the progression of a disease is reduced or halted. That is, “treatment" includes not just the improvement of symptoms or markers, but also a cessation of, or at least slowing of, progress or worsening of symptoms compared to what would be expected in the absence of treatment. Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptom(s), diminishment of extent of disease, stabilized (i.e.. not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, remission (whether partial or total), and / or decreased mortality, whether detectable or undetectable. The term "treatment" of a disease also includes providing relief from the symptoms or side-effects of the disease (including palliative treatment).

[0692] As used herein, the term “pharmaceutical composition” refers to the active agent in combination with a pharmaceutically acceptable carrier e.g. a carrier commonly used in the pharmaceutical industry. The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissue...

Claims

CLAIMSWhat is claimed is:

1. A postbiotic composition comprising plant fiber material fermented in at least first and second successive stages with at least a first bacterial species in the first stage and at least a second bacterial species in the second stage.

2. The postbiotic composition of claim 1, wherein the plant fiber material comprises material from one plant species or a plurality of plant species.

3. The postbiotic composition of claim 1 or claim 2, wherein the composition is treated to inactivate the bacterial species to generate the postbiotic composition.

4. The postbiotic composition of any one of claims 1-3. which comprises a liquid.

5. The postbiotic composition of any one of claims 1-3. which is dried.

6. The postbiotic composition of any one of claims 1-3. which is not processed other than inactivating the bacterial species.

7. The postbiotic composition of any one of claims 1-6, wherein the profile of microbial metabolites generated via the first and second successive stages differs from the profile of microbial metabolites generated when the first and second bacterial species are introduced in a single, combined fermentation stage.

8. The postbiotic composition of claim 7, wherein the profile of organic acid metabolites generated via the first and second successive stages differs from the profile of organic acid metabolites generated when the first and second bacterial species are introduced in a single, combined fermentation stage.

9. The postbiotic composition of claim 7 or claim 8, wherein the profile of microbial metabolites differs in the identity and / or amount of one or more such metabolites.

10. The postbiotic composition of any one of claims 1-9, which comprises microbial metabolite organic acids including acetic acid, citric acid, lactic acid and succinic acid.

11. The postbiotic composition of any one of claims 1-10, which comprises one or more short chain fatty' acids selected from acetate, propionate and buty rate.

12. The postbiotic composition of any one of claims 1-11, which comprises ketone bodies.

13. The postbiotic composition of claim 12, wherein the ketone bodies comprise Betahydroxybutyric acid (BHB; 3-hydroxybutyric acid).

14. The postbiotic composition of any one of claims 1-13, which comprises at least one bacterial metabolite selected from the group consisting of 3 -hydroxy butyric acid, quercetin, phloionolic acid, wedelolactone, luteolin, N-[(2S)-2-hydroxypropanoyl ]-L-leucine, an indole organic acid or a combination thereof.

15. The postbiotic composition of any one of claims 1-14, which comprises at least one metabolite selected from Table 2.

16. The postbiotic composition of any one of claims 1-15, which comprises at least 15% organic acids in the dried formulation.

17. The postbiotic composition of any one of claims 1-16, which comprises at least 0.1 ng DNA per gram of postbiotic composition.

18. The postbiotic composition of any one of claims 1-17, which comprises at least 1.0 ng DNA per gram of postbiotic composition.

19. The postbiotic composition of any one of claims 1-18, wherein the first successive stage of fermentation comprises two or more species of bacteria.

20. The postbiotic composition of any one of claims 1-19, wherein the second successive stage of fermentation comprises two or more species of bacteria that differ from the species used in the first successive stage.

21. The postbiotic composition of any one of claims 1-20, wherein the first and / or second successive stage of fermentation comprises at least one bacterial species belonging to a phylum selected from the group consisting of: Pscudomonadota, Bacillota, Bactcroidota, and Verrucomicrobiota.

22. The postbiotic composition of claim 21, wherein the bacterial species of the Pscudomonadota phylum belongs to die genus Escherichia or Klebsiella.

23. The postbiotic composition of claim 21, wherein the bacterial species of the Pseudomonadota phylum is Escherichia coli (E. coli', e.g., Nissle strain) or Klebsiella spp. (e.g.. characterized by rRNA of SEQ ID NO: 760).

24. The postbiotic composition of claim 21. wherein the bacterial species of the Bacillota phylum belongs to a genus selected from the group consisting of: Clostridium, Faecalibacterium, Ruminococcus, Mediterraneibacter, Erysipelotrichaceae, Erysipelatoclostridium, Streptococcus, Roseburia, and Agathobacter.

25. The postbiotic composition of claim 21. wherein the bacterial species of the Bacillota phylum is a species selected from the group consisting of: Clostridium scindens, Clostridium butyricum, Clostridium beijerinckii, Clostridium acetobutylicum, Faecalibacterium prausnitzii, Ruminococcus bromii, Ruminococcus spp, Mediterraneibacter gnavus, Mediterraneibacter torques, Erysipelotrichaceae, Erysipelatoclostridium, Streptococcus thermophilus, Streptococcus salivarius, Roseburia intestinalis, and Agathobacter rectalis.

26. The postbiotic composition of claim 21, wherein the bacterial species of the Bacteroidota phylum belongs to a genus selected from the group consisting of: Bacteroides and Prevotella.

1. The postbiotic composition of claim 21, wherein the bacterial species of the Bacteroidota phylum is a species selected from the group consisting of: Bacteroides thetaiotaomicron, Bacteroides ovatus, Bacteroides vulgatus, Bacteroides fragilis, Prevotella copri, Bacteroides dorei, Bacteroides uniformis, and Prevotella bivia.

28. The postbiotic composition of claim 21. wherein the bacterial species of the Verrucomicrobiota phylum belongs to the genus Akkermansia.

29. The postbiotic composition of claim 21, wherein the bacterial species of the Verrucomicrobiota phylum is: Akkermansia muciniphila.

30. The postbiotic composition of any one of claims 1-29, wherein the first and second bacterial species comprise a species from the Actinobacterium phylum and a species from the Bacillota phylum, respectively.

31. The postbiotic composition of any one of claims 1-30, wherein the first and second bacterial species comprise Bifidobacterium and Lactobacillus species, respectively.

32. The postbiotic composition of any one of claims 1-31, wherein the plant fiber material comprises a leaf, root, flower, berry, fruit, seed, or extract of one or more species of plant.

33. The postbiotic composition of any one of claims 1-32, wherein the plant fiber material is from at least one plant selected from the group consisting of: an herb of the Astragalus family; an herb of the Solanaceae or nightshade family ; a berry of the Sambucus L. genus; a legume of the Lens orientalis or Lens culinaris species; a berry of the Vaccinium genus; a berry' of the Malpighia genus; a leaf from the Urtica genus; a seed from the Avena genus; a root from the Panax genus; and a root from the Curcuma genus.

34. The postbiotic composition of claim 33, wherein:(a) the herb of the Astragalus family is Astragalus membranaceus root:(b) the herb of the Solanaceae or nightshade family is ashwagandha root and / or leaf;(c) the berry' of the Sambucus L. genus is elderberry;(d) the legume of the Lens orientalis or Lens culinaris species is a lentil;(e) the berry' of the Vaccinium genus is a cranberry;(f) the berry' of the Malpighia genus is acerola (Barbados cherry);(g) the leaf from the Urtica genus is a nettle;(h) the seed from the Avena genus is an oat top;(i) the root from the Panax genus is a ginseng root; or(j) the root from the Curcuma genus is a turmeric root.

35. The postbiotic composition of any one of claims 1-34, wherein the plant fiber material is from at least one plant material selected from the group consisting of: Astragalus membranaceus root; ashwagandha root and / or leaf; elderberry'; lentil; cranberry; acerola (Barbados cherry); nettle; oat top (oat seeds); ginseng root; and turmeric root.

36. The postbiotic composition of any one of claims 1-35, wherein the plant fiber material is from ashwagandha root and elderberry.

37. The postbiotic composition of any one of claims 1-36, wherein the plant fiber material is from ashwagandha leaf and elderberry.

38. The postbiotic composition of any one of claims 1-37, wherein the plant fiber material is from a berry of the Vaccinium genus (e.g., cranberry).

39. The postbiotic composition of any one of claims 1-38, wherein the plant fiber material is in combination with a cyanobacterium of the genus Spirulina.

40. The postbiotic composition of any one of claims 1-39, wherein the plant fiber material is in combination with a mushroom.

41. The postbiotic composition of any one of claims 1-40, wherein the plant fiber material comprises polyphenols.

42. A pharmaceutical composition comprising the postbiotic composition of any one of claims 1- 41 and a pharmaceutically acceptable carrier.

43. The pharmaceutical composition of claim 42, which is formulated for oral administration.

44. The pharmaceutical composition of any one of claims 42-43, which is formulated in an enteric release capsule.

45. The pharmaceutical composition of any one of claims 42-44, which is formulated in a colonic release capsule.

46. The pharmaceutical composition of any one of claims 42-45, which is formulated for release in the colon.

47. A method of modulating, stabilizing, or restoring the gut microbiome or treating a dysbiosis of a subject in need thereof, the method comprising administering a composition of any one of claims 1-41 to the subject.

48. The method of claim 47, wherein the subject has received or is receiving a treatment that disrupts the gut microbiome or promotes dysbiosis.

49. The method of claim 48, wherein the treatment is selected from the group consisting of treatment with: a dysbiosis-causing drug, an antibiotic, chemotherapy, cancer immunotherapy, and vaccination.

50. The method of any one of claims 47-49. wherein the subject has and / or has been diagnosed with a cancer, a microbial infection, an inflammatory disease, an autoimmune disease, or a neurological disease or disorder associated with a disruption in the gut-brain axis.

51. The method of claim 50, wherein the neurological disease or disorder associated with a disruption in the gut-brain axis is selected from the group consisting of: Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and multiple system atrophy (MSA).

52. The method of any one of claims 47-51, wherein the subject has and / or has been diagnosed with a chronic disease (e.g.. psychological stress) that alters the microbiome and / or is associated with dysbiosis.

53. The method of any one of claims 47-52, which increases the efficacy of a cancer immunotherapy.

54. The method of any one of claims 47-53. which increases the efficacy of an immune checkpoint inhibitor therapy (e.g., anti-PD-1).

55. The method of any one of claims 47-54. which decreases or prevents dysbiosis caused by cancer immunotherapy.

56. The method of any one of claims 47-55, which decreases or prevents graft versus host disease (GvHD) (e g., acute or chronic).

57. A postbiotic composition comprising Withania somnifera plant material and berry material or extract of the Sambucus genus fermented in successive fermentations with Bifidobacterium and then Lactobacillus species.

58. The postbiotic composition of claim 57, which comprises a liquid.

59. The postbiotic composition of claim 57, which is dried.

60. The postbiotic composition of claim 57, which is not processed other than inactivating the bacterial species.

61. The postbiotic composition of any one of claims 57-60, wherein the berry material or extract of the Sambucus genus comprises elderberry' material or extract.

62. The postbiotic composition of any one of claims 57-61, wherein the Bifidobacterium species comprises one or more of B. lactis, B. longum. and B. breve.

63. The postbiotic composition of any one of claims 57-62, wherein tire Lactobacillus species comprises one or more of paracasei, L. rhamnosus, and L. casei.

64. The postbiotic composition of any one of claims 57-63, wherein the Bifidobacterium and Lactobacillus bacteria are heat-inactivated following the successive fermentations.

65. The postbiotic composition of any one of claims 57-64, wherein the postbiotic composition comprises less than 1000 efu of inoculated bacteria per gram.

66. The postbiotic composition of any one of claims 57-65, further comprising a co-drying agent.

67. The postbiotic composition of claim 66. wherein the co-drying agent comprises resistant maltodextrin, tapioca, or resistant starch.

68. The postbiotic composition of any one of claims 57-67, which was dried by lyophilization or spray -drying.

69. The postbiotic composition of any one of claims 57-68. wherein the dried postbiotic composition has a moisture content of <4% and water activity <0.2.

70. The postbiotic composition of any one of claims 57-69. wherein the postbiotic composition comprises organic acids including acetic acid, citric acid, lactic acid and succinic acid.

71. The postbiotic composition of any one of claims 57-70, wherein the successive fermentations further include plant material of an herb in the Astragalus family; a berry of the Vaccinium genus; a berry of the Malpighia genus; a leaf from the Urtica genus; a seed from the Avena genus; a root from the Panax genus; or a root from the Curcuma genus.

72. The postbiotic composition of any one of claims 57-71, which further comprises ribosomal RNA (rRNA) at least 95% identical to one or more of SEQ ID NO: 14-16 (B. lactis), SEQ ID NO: 17-20 (B. breve), SEQ ID NO: 21-26 or SEQ ID NO: 854 (B. longum subsp. infantis), SEQ ID NO: 767-851 (B. longum subsp. longum), SEQ ID NO: 852-853 (B. longum). SEQ ID NO: 27-32 (L. plantarum), SEQ ID NO: 33-39 (L. acidophilus), SEQ ID NO: 40-44 (L. rhamnosus), SEQ ID NO: 45-48 (A. paracasei). or SEQ ID NO: 49-52 (L. c sei).

73. The dried postbiotic composition of any one of claims 57-72, which further comprises rDNA at least 95% identical to one or more of SEQ ID NOs: 60-759.

74. The postbiotic composition of any one of claims 57-73, wherein the dried composition comprises a microorganism concentration from about 1.0 x 101CFU / g to about IxlO3CFU / g.

75. The postbiotic composition of any one of claims 57-74, comprising non-viable cells, lysed cells, cell walls, bacterial nucleic acids, culture supernatant, and bacterial metabolites.

76. The postbiotic composition of any one of claims 57-75, which comprises at least one bacterial metabolite selected from the group consisting of 3 -hydroxy butyric acid, quercetin, phloionolic acid, wedelolactone, luteolin, N-[(2S)-2-hydroxypropanoyl]-L-leucine, an indole organic acid or a combination thereof.

77. The postbiotic composition of any one of claims 57-76, which comprises at least one metabolite selected from Table 2.

78. The postbiotic composition of any one of claims 57-77, which comprises one or more short chain fatty acid selected from acetic acid, propionic acid, and butyric acid.

79. The postbiotic composition of any one of claims 57-78, which comprises ketone bodies.

80. The postbiotic composition of claim 79. wherein the ketone bodies comprise Betahydroxybutyric acid (BHB; 3-hydroxybutyric acid).

81. The postbiotic composition of any one of claims 57-80, which comprises at least 15% organic acids in the dried formulation.

82. The postbiotic composition of any one of claims 57-81, which comprises at least 15 billion non-live cells / gram.

83. The postbiotic composition of any one of claims 57-82. which comprises at least 0.1 ng DNA per gram of postbiotic composition.

84. The postbiotic composition of any one of claims 57-83. which comprises at least 1.0 ng DNA per gram of postbiotic composition.

85. The postbiotic composition of any one of claims 57-84, which is formulated for oral delivery.

86. The postbiotic composition of any one of claims 57-85, which is formulated in an enteric release capsule.

87. The postbiotic composition of any one of claims 57-86, which is formulated in a colonic release capsule.

88. The postbiotic composition of any one of claims 57-87, which is formulated for release in the colon.

89. The postbiotic composition of any one of claims 57-88, which is formulated for topical delivery to the skin.

90. The postbiotic composition of any one of claims 57-89. wherein the composition is formulated as a tablet, pill, capsule, or microcapsule.91 A postbiotic composition comprising berry material or extract of the Vaccinium genus (e.g., a cranberry) fermented in successive fermentations with Bifidobacterium and then Lactobacillus species.

92. A pharmaceutical composition comprising a composition of any one of claims 57-91, and a pharmaceutically acceptable carrier.

93. A method of preparing a postbiotic composition, the method comprising:(a) inoculating a substrate composition comprising plant material comprising fermentable fiber and water sufficient to suspend or submerge the plant material with a first bacterial inoculum;(b) maintaining the inoculated substrate prepared in (a) under anaerobic conditions, at a temperature and for a time sufficient to pennit growth of the first bacterial inoculum thereby producing a primary fermented composition;(c) inoculating the primary fermented composition produced in step (b) with a second bacterial inoculum;(d) maintaining the composition formed in step (c) under anaerobic conditions at a temperature and for a time sufficient to permit growth of the second bacterial inoculum to produce a secondary fermented composition;(e) inactivating the bacteria in the secondary fermented composition; and(1) drying the secondary fermented composition, thereby producing a dried postbiotic composition.

94. The method of claim 93, wherein the first bacterial inoculum comprises one or more species of Bifidobacterium.

95. The method of claim 93 or claim 94. wherein the first bacterial inoculum comprises tw o or more species of Bifidobacterium.

96. The method of any one of claims 93-95, wherein the first bacterial inoculum comprises three or more species of Bifidobacterium.

97. The method of any one of claims 93-96, wherein the first bacterial inoculum consists essentially of Bifidobacterium species.

98. The method of claim 97, wherein the first bacterial inoculum consists essentially of two Bifidobacterium species.

99. The method of claim 97, wherein the first bacterial inoculum consists essentially of three Bifidobacterium species.

100. The method of any one of claims 94-99, wherein the Bifidobacterium species are selected from B. lactis, B. ton gum and B. breve.

101. The method of any one of claims 93-100, wherein the second bacterial inoculum comprises one or more species of Lactobacillus.

102. The method of any one of claims 93-101, wherein the second bacterial inoculum comprises two or more species of Lactobacillus.

103. The method of any one of claims 93-102, wherein the second bacterial inoculum comprises three or more species of Lactobacillus.

104. The method of any one of claims 93-103, wherein the second bacterial inoculum consists essentially of Lactobacillus species.

105. The method of any one of claims 93-104, wherein the second bacterial inoculum consists essentially of two Lactobacillus species.

106. The method of any one of claims 93-105, wherein the second bacterial inoculum consists essentially of three Lactobacillus species.

107. The method of any one of claims 101-106. wherein the Lactobacillus species are selected from L. paracasei, L. rhamnosus, and L. casei.

108. The method of any one of claims 93-107, further comprising inoculating the substrate composition of step (a) or the primary fermented composition produced in step (b) with one or more of a bacterial species belonging to a phylum selected from the group consisting of: Pseudomonadota, Bacillota, Bacteroidota. and Verrucomicrobiota.

109. The method of claim 108, wherein the bacterial species of the Pseudomonadota phylum belongs to the genus Escherichia or Klebsiella.

110. The method of claim 108, wherein the bacterial species of the Pseudomonadota phylum is Escherichia coli (E. coir, e.g., Nissle strain) or Klebsiella spp. (e.g.. characterized by rRNA of SEQ ID NO: 760).

111. The method of claim 108. wherein the bacterial species of the Bacillota phylum belongs to a genus selected from the group consisting of: Clostridium, Faecal ibacterium, Ruminococcus, Mediterraneibacter, Erysipelotrichaceae, Erysipelatoclostridium, Streptococcus, Roseburia, and Agathobacter.

112. The method of claim 108. wherein the bacterial species of the Bacillota phylum is a species selected from the group consisting of: Clostridium scindens, Clostridium butyricum, Clostridium beijerinckii, Clostridium acetobutylicum, Faecalibacterium prausnitzii, Ruminococcus bromii, Ruminococcus spp, Mediterraneibacter gnavus, Mediterraneibacter torques, Erysipelotrichaceae, Erysipelatoclostridium, Streptococcus thermophilus, Streptococcus salivarius, Roseburia intestinalis, and Agathobacter rectalis.

113. The method of claim 108, wherein the bacterial species of the Bacteroidota phylum belongs to a genus selected from the group consisting of: Bacteroides and Prevotella.

114. The method of claim 108, wherein the bacterial species of the Bacteroidota phylum is a species selected from the group consisting of: Bacteroides thet iotaomicron, Bacteroides ovatus, Bacteroides vulgatus, Bacteroides fragilis, Prevotella copri, Bacteroides dorei, Bacteroides uniformis, and Prevotella bivia.

115. The method of claim 108. wherein the bacterial species of the Verrucomicrobiota phylum belongs to the genus Akkermansia.

116. The method of claim 108. wherein the bacterial species of the Verrucomicrobiota phylum is: Akkermansia muciniphila.

117. The method of any one of claims 93-116, wherein the substrate composition in step (a) is adjusted to a pH of about 6.6 prior to addition of the first bacterial inoculum, and wherein the pH of the fermented composition produced in step (b) is about 4.0.

118. The method of any one of claims 93-117, further comprising the step, after step (b) and before step (c), of adjusting the pH of the fermented composition to about 6.6.

119. The method of any one of claims 93-118, wherein the pH of the secondary fermented composition produced in step (d) is about 3.8.

120. The method of any one of claims 93-119, wherein the secondary fermented composition produced in step (d) comprises at least 15 g / liter of organic acids.

121. The method of any one of claims 93-120, wherein inoculating the substrate composition comprises purging the fermenter with nitrogen gas such that the percentage of oxygen in the fermenter is maintained < 1.5%.

122. The method of any one of claims 93-121, wherein the plant material comprising fermentable fiber is a dry powder prior to addition to water.

123. The method of any one of claims 93-122, wherein the plant material comprising fermentable fiber comprises Withania somnifera plant material and berry material or extract of the Sambucus genus (e.g., elderberry).

124. The method of claim 123. wherein the plant material comprising fermentable fiber comprises berry material or extract of the Vaccinium genus (e.g., cranberry).

125. The method of claim 123 or 124, wherein the plant material comprising fermentable fiber further comprises an herb in the Astragalus family.

126. The method of any one of claims 93-125 wherein the substrate composition of step (a) further comprises one or more of added glucose, sucrose, fructose, honey, and molasses.

127. The method of any one of claims 93-126, wherein the substrate composition of step (a) further comprises about 3.5% sucrose.

128. The method of any one of claims 93-127, wherein maintaining step (b) is performed for about 48 hours.

129. The method of any one of claims 93-128, wherein maintaining step (d) is performed for about 48 hours to 10 days.

130. The method of any one of claims 93-129, wherein inactivating step (e) comprises heat treatment or gamma irradiation.

131. The method of claim 130. wherein heat treatment comprises pasteurization.

132. The method of any one of claims 93-131, wherein inactivating step (e) comprises heat treatment, lyophilization, ultrasonic disruption, freeze-thaw, and gamma irradiation.

133. The method of any one of claims 93-132, wherein the dried postbiotic composition comprises less than 1000 cfu / g of inoculated bacteria.

134. The method of any one of claims 93-133, further comprising, after step (c), the addition of a co-drying agent to the secondary fennented composition.

135. The method of claim 134, wherein the co-drying agent comprises resistant maltodextrin, tapioca, or resistant starch.

136. The method of claim 134 or 135, wherein the co-drying agent is added at about 1 : 1 ratio (weightweight or weightwolmne) relative to total solid content in the fermentation.

137. The method of any one of claims 93-136, wherein drying step (1) comprises lyophilization or spray drying.

138. The method of any one of claims 93-137, wherein the dried postbiotic composition has a moisture content of <4% and water activity <0.2.

139. The method of any one of claims 93-138, wherein the postbiotic composition comprises organic acids including acetic acid, citric acid, lactic acid and succinic acid.

140. The method of any one of claims 93-139, wherein the substrate further includes plant material of an herb in the Astragalus family.

141. The method of any one of claims 93-140. wherein the postbiotic composition further comprises rRNA at least 95% identical to one or more of SEQ ID NO: 14-16 (B. lactis), SEQ ID NO: 17-20 (B. breve). SEQ ID NO: 21-26 or SEQ ID NO: 854 (B. longum subsp. infantis). SEQ ID NO: 767-851 (B. longum subsp. longum), SEQ ID NO: 852-853 (B. longum). SEQ ID NO: 27-32 (L. plantarum), SEQ ID NO: 33-39 (£. acidophilus), SEQ ID NO: 40-44 (£. rhamnosus), SEQ ID NO: 45-48 (£. paracasei). or SEQ ID NO: 49-52 (£. casei).

142. The method of any one of claims 93-141, wherein the postbiotic composition further comprises rDNA at least 95% identical to one or more of SEQ ID NOs: 60-759.

143. The method of any one of claims 93-142, wherein the postbiotic composition comprises non-viablc cells, lysed cells, cell walls, bacterial nucleic acid, culture supernatant, and bacterial metabolites.

144. A postbiotic composition produced by tire method of any one of claims 93-143.

145. A method of preparing a postbiotic composition, the method comprising:(a) providing a fennentation substrate comprising plant material comprising prebiotic fiber;(b) providing a culture of one or more Bifidobacterium bacterial species and a culture of one or more Lactobacillus bacterial species;(c) inoculating die fermentation substrate in first and second stages with the cultures of Bifidobacterium and Lactobacillus species;(d) incubating the inoculated fermentation substrate of (c) under conditions and for a time sufficient to generate a postbiotic composition comprising bacterial metabolites and organic acids; and(e) inactivating the bacterial species; whereby a postbiotic composition is prepared.

146. A method of modulating, stabilizing, or restoring the gut microbiota of a subject, the method comprising administering to the subject an amount of a composition of any one of claims 1-46, 57-91, or 144 effective to modulate, stabilize or restore the gut microbiota of the subject.

147. The method of claim 146, wherein the subject is a healthy subject.

148. The method of any one of claims 146-147. wherein the subject has and / or has been diagnosed with a cancer, a microbial infection, an inflammatory disease, an autoimmune disease, or a neurological disease or disorder associated with a disruption in the gut-brain axis.

149. The method of claim 148, wherein the neurological disease or disorder associated with a disruption in the gut-brain axis is selected from the group consisting of: Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pine autonomic failure (PAF); and multiple system atrophy (MSA).

150. The method of any one of claims 146-149. wherein the subject has and / or has been diagnosed with a chronic disease (e.g., psychological stress) that alters the microbiome and / or is associated with dysbiosis.

151. The method of any one of claims 146-150, which increases the efficacy of a cancer immunotherapy.

152. The method of any one of claims 146-151 , which increases the efficacy of an immune checkpoint inhibitor therapy (e.g.. anti-PD-1).

153. The method of any one of claims 146-152, which decreases or prevents dysbiosis caused by cancer immunotherapy.

154. The method of any one of claims 146-153, which decreases or prevents graft versus host disease (GvHD) (e.g., acute or chronic).

155. A method of treating or preventing disruption of the immune system due to gut dysbiosis caused by lifestyle, stress, or associated with an antibiotic treatinent, chemotherapytreatment, or administration of a dysbiosis-causing medication or medical treatment in a subject, the method comprising administering to the subject an amount of a composition of any one of claims 1-46, 57-91, or 144 effective to treat or prevent the disruption.

156. The method of claim 155. wherein the medical treatment comprises a cancer immunotherapy.

157. The method of claim 156. wherein the cancer immunotherapy comprises immune checkpoint modulator / inhibitor therapy, hematopoietic cell transplantation therapy, CAR-T therapy, a dendritic cell vaccine, or any other approach that facilitates or activates an immune cell response against a cancer.

158. The method of claim 155. wherein the medical treatment comprises vaccination.

159. The method of claim 155. wherein the medical treatment comprises treatment with a dysbiosis-causing drug.1 0. The method of claim 159, wherein the dysbiosis-causing drug is selected from tire group consisting of acid-blocking medications, proton-pump inhibitors (PPIs), H2 blockers, birth control, steroids, antipsychotics, opioids, metformin, SSRIs, nonsteroidal antiinflammatory drugs (NSAIDs), and any combination thereof.

161. A method of treating cancer, the method comprising administering a cancer immunotherapy and administering a composition of any one of claims 1-46, 57-91, or 144 to a subject in need thereof, wherein the administering is effective to treat the cancer.

162. A method of treating cancer, the method comprising administering a CAR-T therapy and administering a composition of any one of claims 1-46, 57-91, or 144 to a subject in need thereof, wherein the administering is effective to treat the cancer.

163. A method of treating cancer, the method comprising administering chemotherapy and administering a composition of any one of clams 1-46. 57-91, or 144 to a subject in need thereof, wherein the administering is effective to treat cancer.

164. A method of treating an autoimmune disease, the method comprising administering an autoimmune disease therapy and administering a composition of any one of clams 1-46, 57-91. or 144 to a subject in need thereof, wherein the administering is effective to treat the autoimmune disease.

165. A method of treating graft versus host disease (GvHD). the method comprising administering a GvHD disease therapy and administering a composition of any one of clams 1-46, 57-91, or 144 to a subject in need thereof, wherein the administering is effective to treat the GvHD.

166. A method of treating an inflammatory disease, the method comprising administering an anti-inflammatory therapy and administering a composition of any one of clams 1-46, 57- 91, or 144 to a subject in need thereof, wherein the administering is effective to treat the inflammatory disease.

167. A method of treating an infection, the method comprising administering at least one antibiotic and administering a composition of any one of claims 1-46. 57-91, or 144 to a subject in need thereof, wherein the administering is effective to treat the infection.

168. A method of increasing neutrophil engraftment. the method comprising administering an effective amount of a composition of any one of claims 1-46. 57-91, or 144 to a subject in need thereof.

169. A method of treating or preventing intestinal mucositis associated with chemotherapy, the method comprising administering chemotherapy and administering a composition of any one of claims 1-46, 57-91, or 144 to a subject in need thereof, wherein the administering is effective to treat or prevent the intestinal mucositis.

170. The method of any one of claims 146-169, wherein administering the composition is associated with at least one of the following outcomes, as compared to a subject not receiving the composition or the treated subject prior to being administered the composition: decreased incidence of cancer relapse (c.g., rclapsc-frcc); increased cancer survival; decreased tunc to neutrophil engraftment; increased peripheral blood mononuclear cell recovery trajectories (e.g., higher peripheral blood mononuclear cell counts); decreased incidence of febrile neutropenia; decreased blood stream infection incidence; and / or decreased 30-day readmission events.

171. The method of claim 170, wherein administering the composition in combination with chemotherapy is associated with an improvement in intestinal mucositis associated with the chemotherapy, as compared to a subject not receiving the composition or the treated subject prior to being administered the composition.

172. A method of improving non -human animal health, the method comprising administering to a non-human animal an animal feed comprising a postbiotic composition comprising berry material or extract of the Vaccinium genus (e.g., a cranberry) fermented in successive fermentations with Bifidobacterium and then Lactobacillus species.

173. The method of any one of claims 146-172, which increases diversity in the gut microbiome of the subject.

174. A method of increasing gut microbiome diversity in a subject, the method comprising administering to the subject an amount of a composition of any one of claims 1 -46. 57-91 , or 144 effective to increase gut microbiome diversity.

175. A method of treating a synucleinopathy, the method comprising administering an effective amount of a postbiotic composition to a subject in need thereof, wherein the administering is effective to treat the synucleinopathy, wherein the postbiotic composition comprises the products of successive fermentation of herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, with a firstfermentation comprising at least one Bifidobacterium species and a second fermentation comprising at least one Lactobacillus species.

176. A method of treating a synucleinopathy, the method comprising administering an effective amount of a postbiotic composition to a subject in need thereof, wherein the administering is effective to treat the synucleinopathy, wherein the postbiotic composition is prepared according to a process comprising:(a) providing a fermentation substrate comprising plant material comprising prebiotic fiber;(b) providing a culture of one or more Bifidobacterium bacterial species and a culture of one or more Lactobacillus bacterial species;(c) inoculating the fermentation substrate in first and second stages with the cultures of Bifidobacterium and Lactobacillus species;(d) incubating the inoculated fermentation substrate of (c) under conditions and for a time sufficient to generate a postbiotic composition comprising bacterial metabolites and organic acids; and(e) inactivating the bacterial species.

177. The method of any one of claims 175-176. wherein the disease or disorder is selected from tire group consisting of: Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and multiple system atrophy (MSA).

178. The method of any one of claims 175-177. wherein the disease or disorder is Parkinson’s disease.

179. The method of any one of claims 175-178. wherein the disease or disorder is REM Sleep Behavior Disorder.

180. The method of any one of claims 175-179. administering the postbiotic composition is associated with at least one of the following outcomes, as compared to a negative control such as a subject not receiving the postbiotic composition or the treated subject prior to being administered the postbiotic composition: higher diversity in microbiome; higher abundance of beneficial microbiome species (e.g.. Faecalibacterium. Akkermansia, and / or Ruminococcus)'. decreased abundance of pathogenic or non-beneficial microbiome species (e g., Scardovia, Escherichia-Shigella. and / or Streptococcus)', decreased alpha-synuclein accumulates or inclusions (e.g., in samples from the stool, colon, gut, skin, and / or CSF); decreased inflammatory cytokines (e.g., tumor necrosis factor-alpha (TNFa), interleukin- ip (IL-1 ), and / or interleukin-6 (IL-6)); decreased immune activation; decreased constipation; decreased stool hardness; decreased bowel movement frequency; decreased incidence or severity of sleep behavior disorders; decreased incidence or severity of Parkinson’s symptoms (e.g., tremor in hands, arms, legs, jaw, or head; muscle stiffness; slowness of movement; impairedbalance and coordination); increased cognitive function; decreased depression; decreased anxiety; and / or increased quality of life.

181. The method of any one of claims 175-180, wherein administering the postbiotic composition in combination with a synucleinopathy treatment is associated with an improvement in intestinal mucositis, as compared to a negative control such as a subject not receiving the postbiotic composition or the treated subject prior to being administered the postbiotic composition.

Images