BAX gene-knockout 293f cell line and use thereof

By knocking out the BAX gene in 293F cells and performing suspension acclimatization, the problem of insufficient transfection efficiency of the Gibco Expi293 system in expressing recombinant proteins was solved, achieving more efficient recombinant protein production and improving expression levels and stability.

WO2026020536A1PCT designated stage Publication Date: 2026-01-29SHANGHAI OPM BIOSCI CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/114649
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-22
Filing Date
2024-08-26
Publication Date
2026-01-29

AI Technical Summary

Technical Problem

In the existing technology, the Gibco Expi293 system has insufficient transfection efficiency and expression level when expressing certain recombinant proteins such as cytokines and VLPs, as well as complex Fc fusion proteins, and cannot meet the needs of rapid and efficient recombinant protein production.

Method used

The BAX gene in 293F cells was knocked out using the CRISPR/Cas9 system to obtain a recombinant 293F cell line with BAX gene knockout. The cells were then subjected to suspension acclimatization to increase the expression level of the recombinant protein.

Benefits of technology

It significantly improved the expression level and stability of recombinant proteins, shortened the expression cycle, and provided a more efficient tool for recombinant protein production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024114649_29012026_PF_FP_ABST
    Figure CN2024114649_29012026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to the technical field of molecular biology and genetics, and specifically to a BAX gene-knockout 293F cell line and a use thereof. Disclosed is a BAX gene‑knockout 293F cell line, wherein gene knockout is performed on a wild-type 293F cell by using a CRISPR-Cas9 technology: a target sequence is introduced into a CRISPR-Cas9 knockout vector by using a homologous recombination technology, and a homologous recombination fragment for genome repair is designed on the basis of a selected knockout target and transfected, followed by monoclonal culture, to finally obtain a BAX knockout cell line. The obtained BAX knockout cell line is subjected to suspension adaptation followed by passaging, the passaged cell line is tested, and the result shows a significant increase in the antibody expression level thereof.
Need to check novelty before this filing date? Find Prior Art

Description

BAX gene knockout 293F cell strain and application thereof

[0001] The present application claims priority to the following:

[0002] Application No.: CN202410980731.0; Filing Date: July 22, 2024. TECHNICAL FIELD

[0003] The present application belongs to the technical field of molecular biology and genetics, and specifically relates to a BAX gene knockout 293F cell strain and application thereof. BACKGROUND

[0004] There are two kinds of expression of recombinant proteins, transient expression and stable expression. In the state of transient expression, the exogenous gene introduced into the cell and the host cell chromosomal DNA do not integrate, and the target protein can be obtained for a short time, and it has the advantages of strong universality. In the early stage of research and development, time is a key factor. Although the expression amount of protein obtained by stable transformation is high, the construction cycle is long and the cost is high, so it is not suitable. However, in transient expression, the exogenous gene in the cell will be lost with cell division, and the expression of the target protein can only be maintained for several days to several weeks, which has the disadvantage of low expression amount. Therefore, how to improve the expression amount of transient transfection and obtain more recombinant proteins with the shortest time and the lowest cost for efficacy, preparation research has become a problem to be solved.

[0005] At present, the methods for improving the recombinant transient expression of humanized cells mainly include two kinds. One is to optimize the growth environment and transfection conditions of the cells, but this method has the defects of instability and low repeatability. The other method is to improve and optimize the expression system to improve the expression of the target protein, such as 1. Optimizing the host cell line, reducing cell apoptosis, and cell rejection of exogenous proteins. 2. Optimizing the expression system such as setting an episomal maintenance system, a strong promoter / enhancer, and a protein transactivation system in the plasmid. However, optimizing the expression system requires strong molecular biology knowledge background, and the cycle is long, and there are many uncertain factors, which cannot meet the demand of short-term rapid expression of protein. However, from the long-term research and development and income point of view, the modification of these two systems has great significance. Once the optimized suitable expression system is obtained, it will greatly improve the transient expression capacity of the platform, and the combination of efficient transfection reagent and culture medium will bring long-term economic benefits.

[0006] Currently, Expi293F cells are commonly used in research and development. Time is critical when expressing candidate drugs. This is the reason why the Gibco Expi293 expression system has become a reliable choice for 293 cell transient expression. This fast, high-yield system can obtain 293-derived recombinant proteins in just five to seven days, allowing for faster access to the desired product. However, with the continuous development of biological medicine and time, in some cases, the use of the Gibco Expi293 system cannot achieve satisfactory transfection efficiency and expression results, such as some cytokines, VLPs, complex Fc fusion proteins, and other recombinant proteins expressed very low in the 293 system.

[0007] SUMMARY

[0008] In view of the problems existing in the prior art using the Gibco Expi293 system, the present application attempts to modify the 293 host cells in order to improve their expression.

[0009] The protein encoded by the BAX gene belongs to the BCL2 protein family. Members of the BCL2 family form hetero- or homo-dimers and act as anti-apoptotic or pro-apoptotic regulators involved in various cellular activities. This protein forms heterodimers with BCL2 and acts as an apoptosis activator. The binding and ratio of BAX to BCL2 also determine the survival or death of cells after apoptosis stimulation.

[0010] The present application unexpectedly found that after knocking out the BAX gene of 293F cells, the cell strain obtained by domestication culture can improve the expression level of recombinant proteins. The obtained recombinant 293F cells are registered in the China General Microbiological Culture Collection Center with the registration number CGMCC No. 45934.

[0011] [According to Rule 26 correction 06.11.2024] The first aspect of the present application discloses a recombinant 293F cell, which is obtained by knocking out the BAX gene in a recipient cell; the recipient cell is a wild 293F cell.

[0012] The BAX gene is any of the following:

[0013] [According to Rule 26 correction 06.11.2024] 1) a DNA molecule with a nucleotide sequence as shown in SEQ ID NO: 1;

[0014] 2) a DNA molecule with more than 90% similarity to the nucleotide sequence defined in 1) and reduced BAX protein expression.

[0015] The BAX protein in the recombinant 293F cell after the above gene knockout is not expressed, the expression amount of the BAX protein is reduced, or the activity of the BAX protein is reduced.

[0016] The second aspect of the present application discloses a construction method of the above-mentioned recombinant 293F cell, based on the CRISPR / Cas9 system, the BAX gene in the wild type 293F cell is edited, so that the function of the BAX gene in the 293F cell is lost or reduced. The BAX gene knockout 293F cell strain obtained is subjected to suspension domestication and then subcultured, and the subcultured cell strain is tested, and the results show that the expression amount of the exogenous recombinant protein is significantly improved.

[0017] The CRISPR / Cas9 system comprises sgRNA targeting the BAX gene;

[0018] The sgRNA comprises sgRNA1 and sgRNA2;

[0019] The nucleotide sequence of the sgRNA1 is shown in SEQ ID NO: 2;

[0020] The nucleotide sequence of the sgRNA2 is shown in SEQ ID NO: 3.

[0021] [According to Rule 26 Correction 06.11.2024] sgRNA1: CCAGACAACTGAGTCCCTGA (SEQ ID NO: 2);

[0022] [According to Rule 26 Correction 06.11.2024] sgRNA2: GGGTTGATACCACGATCCCC (SEQ ID NO: 3);

[0023] [According to Rule 26 Correction 06.11.2024] wherein after the gene editing of the 293F cell, the nucleotide sequence for repair is shown in SEQ ID NO: 4.

[0024] The third aspect of the present application discloses the application of the above-mentioned recombinant 293F cell in the production of recombinant proteins and mAb drugs.

[0025] As one of the embodiments, the recombinant 293F cell is used in the Expi293 expression system.

[0026] The present application has the following advantages and effects relative to the prior art:

[0027] Compared with the prior art, the BAX gene knockout recombinant 293F cell strain prepared in the application can maintain stable expression for a long time after transfection, improve the productivity of the cells, and improve the expression amount of the recombinant protein, thereby providing an advantageous tool for the development of recombinant protein / monoclonal antibody drugs.

[0028] Deposition certificate: The cell strain Expi293-Bax10#-P10 OPM-RD23003 belongs to a human embryonic kidney cell line (HEK293), which was received by the China General Microbiological Culture Collection Center (CGMCC) on May 29, 2024, and was registered and recorded, and the registration and recording number of the preservation center is CGMCC No. 45934. BRIEF DESCRIPTION OF DRAWINGS

[0029] FIG. 1 is a graph of protein expression of Expi293 and Bax10 cell strains detected by Cedex in Example 3.

[0030] FIG. 2 is a Bag2-His and Rspondin-His protein expression test in Example 3.

[0031] FIG. 3 is a schematic diagram of BAX gene knockout in Example 1. DETAILED DESCRIPTION

[0032] The present application will be further described by way of examples, but the present application is not limited to the scope of the examples. The experimental methods in the following examples are not specified, and are selected according to conventional methods and conditions, or according to the instructions of the commodity. The raw materials and equipment used in the examples are well known to those skilled in the art, and are commercially available or easily obtained or prepared.

[0033] Example 1, construction of BAX knockout cell line

[0034] CRISPR-Cas9 technology was used to knockout the gene of wild type 293F cells. sgRNA1: ccagacaactgagtccctga and sgRNA2: gggttgataccacgatcccc were chemically synthesized, then mixed with cas9 protein to prepare RNP (ribonucleoprotein complex), which was introduced into cells by electroporation, and then monoclonal selection was performed to obtain a single clone of Bax cells with successful gene knockout;

[0035] Wherein sgRNA1 is located between exon 1 and 2, sgRNA2 is located between exon 4 and 5, and the genomic layer is about 1000bp at this BAX gene location, which contains exons 2, 3, 4, further to achieve the integrity of the gene, to achieve the purpose of gene knockout.

[0036] Knockout cell line basic information:

[0037] (1) Sequence information

[0038] Expi293-BAX-RNP-10#:

[0039] [According to Rule 26 correction 06.11.2024] Upstream sequence:

[0040] [According to Rule 26 correction 06.11.2024] Insertion sequence:

[0041] [According to Rule 26 correction 06.11.2024] Deleted sequence: -del1037bp- (SEQ ID NO: 1).

[0042] [According to Rule 26 correction 06.11.2024] Downstream sequence:

[0043] [According to Rule 26 correction 06.11.2024] 1037bp sequence deleted

[0044] Example 2, suspension domestication

[0045] 1. Instrument equipment:

[0046] 2. Reagents and consumables:

[0047] 3. Experimental steps:

[0048] 3.1 Subculture process

[0049] The Bax cells obtained in Example 1 were placed under an inverted microscope, and when the cell density reached about 80% and no abnormal conditions were observed, the cells were placed in a biological safety cabinet. The culture solution in the cell culture bottle was poured out, 10 ml of PBS was added, and the culture bottle was gently shaken to wash away the floating dead cells and serum (serum has an inhibitory effect on trypsin). The PBS solution was then aspirated, 2 ml of trypsin was added for digestion (trypsin concentration 0.25%), and after 5 minutes of digestion, 10 ml of growth medium (DMEM basic medium) was added to terminate the reaction. The cells were blown down and collected in a centrifuge tube. Centrifugation was performed at 1000 rpm for 5 minutes, the supernatant was discarded, and the cells were resuspended with 10 ml of growth medium. The cell suspension was added to a new culture bottle or the original bottle, shaken well, and then placed in a 37°C, 5% CO2 incubator for culture. The cell state was observed the next day.

[0050] 3.2 Cell domestication

[0051] The cells were placed under an inverted microscope, and when the cell density reached about 80% and no abnormal conditions were observed, the cells were placed in a biological safety cabinet. The culture solution in the cell culture bottle was poured out, 10 ml of PBS was added, and the culture bottle was gently shaken to wash away the floating dead cells and serum (serum has an inhibitory effect on trypsin). The PBS solution was then aspirated, 2 ml of trypsin was added for digestion (trypsin concentration 0.25%), and after 5 minutes of digestion, 10 ml of growth medium was added to terminate the reaction. The cells were blown down and collected in a centrifuge tube. Centrifugation was performed at 1000 rpm for 5 minutes, the supernatant was discarded, and the cells were resuspended with 100% OPM-293CD05. After resuspension, the cells were transferred to a shaking tube and placed in a 220 rpm, 37°C, 8% CO2, 80% humidity shaking incubator for suspension culture. After the cell viability and density recovered, the cells were frozen to obtain Bax10 cells.

[0052] Example 3, expression test

[0053] A, use Cedex to quantify PDL1 antibody:

[0054] Select the IgG HB mode of Cedex, then place the centrifuged PDL1 transient supernatant on the Cedex sample stage, and after 15 minutes of detection, the results are printed. The results are shown in Figure 1; the Bax10 cell line was transiently expressed to express the PDL1 monoclonal antibody, and it was found that the Bax10 gene knockout cell line could have a higher antibody expression in a shorter time, with an expression period shortened by 1 day and an expression increased by about 24%. If the sample is collected on D7, the expression can be increased by 35%.

[0055] B, use Octet Red to test and compare the expression of Bag2-His and Rspondin-His, which is not a precise quantification:

[0056] 1. Instrumentation:

[0057] 2. Reagents and consumables:

[0058] 3. Experimental procedure:

[0059] Take 200 μL PBS (0.05% P20) buffer solution into the pre-wetting plate, put four Octet HIS2 Biosensors sensors into the pre-wetting hole containing the buffer solution for 10 minutes, and take 200 μL of sample stock solution with similar cell density and cell viability into the sample plate. Double-click the Data Acquisition operation software on the computer desktop to open the existing program Anti-HIS2 Quantitation Assays in the Basic Quantitation folder to set the experimental parameters, set the capture time of the sample to 400 s, the rotation speed to 1000 rpm, select the position of the sensor, and browse the experimental process and data saving path. Put the sensor disc and sample plate into the instrument, close the instrument door, and run the experiment.

[0060] 4. Experimental results:

[0061] By comparing the response values of different samples, the expression amount can be compared, and the results are shown in FIG. 2, wherein A3 is Expi293 group BAG2-His, B3 is Bax10 group BAG2-His, C3 is Expi293 group Rspondin-His, and D3 is Bax10 group Rspondin-His. It can be seen that the expression amount of BAG2 protein and Rspondin protein in the Bax10 knockout group is higher than that in the Expi293 group.

[0062] [According to Rule 26, corrected on 06.11.2024] The above description is only a preferred specific embodiment of the present application, but the protection scope of the present application is not limited thereto. Any person skilled in the art can make equivalent replacements or changes to the technical solutions and inventive concepts of the present application within the technical scope disclosed by the present application, which should be covered within the protection scope of the present application.

Claims

1. Recombinant 293F cells characterized in that, The recombinant 293F cell is obtained by knocking out the BAX gene in the recipient cell; The BAX gene is any one of the following: 1) a DNA molecule with a nucleotide sequence as shown in SEQ ID NO: 1; 2) a DNA molecule with more than 90% similarity with the nucleotide sequence defined in 1) and reduced BAX protein expression.

2. The recombinant 293F cell of claim 1, wherein, The BAX protein in the cell after gene knockout is not expressed, the expression amount of BAX protein is reduced, or the activity of BAX protein is reduced.

3. The recombinant 293F cell of claim 2, wherein, Based on the CRISPR / Cas9 system, the BAX gene in the wild type 293F cell is edited to make the BAX gene in the 293F cell lose function or be reduced.

4. The recombinant 293F cell of claim 3, wherein, The CRISPR / Cas9 system includes sgRNA targeting the BAX gene; The sgRNA includes sgRNA1 and sgRNA2; The nucleotide sequence of the sgRNA1 is as shown in SEQ ID NO: 2; The nucleotide sequence of the sgRNA2 is as shown in SEQ ID NO:

3.

5. The recombinant 293F cell of claim 3, wherein, After the gene editing of the 293F cell, the nucleotide sequence for repair is as shown in SEQ ID NO:

4.

6. A recombinant 293F cell with a preservation number of CGMCC No. 45934 in the China General Microbiological Culture Collection Center.

7. Use of the recombinant 293F cell according to any one of claims 1-6 in an Expi293 expression system.

Citation Information

Patent Citations

  • Construction method of anti-apoptosis CHO-K1 cell line capable of improving expression level by combining with valproic acid

    CN107384924A

  • Anti-apoptosis cell lines

    CN115943158A

  • BAX gene knockout 293F cell strain and application thereof

    CN118516313A

  • Methods and compositions for generation of Bax-and Bak-deficient cell lines

    US20100003756A1

  • Production cells

    US20240011066A1