Novel gene therapy drug
By designing regulated gene expression cassettes for AAV capsid proteins and VEGF traps of specific serotype variants, the problems of broad-spectrum infectivity and frequent dosing of AAV vectors were solved, achieving highly efficient targeting and long-term therapeutic effects across the entire retinal layer, and improving patient compliance.
Patent Information
- Application Number
- PCT/CN2025/110286
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-25
- Filing Date
- 2025-07-24
- Publication Date
- 2026-01-29
AI Technical Summary
Existing AAV vectors have broad-spectrum infectivity and adverse reactions in gene therapy, making it difficult to efficiently target ocular tissues, especially the entire retinal layer. Furthermore, current gene therapy regimens require frequent administration, resulting in poor patient compliance.
By designing combinations of AAV capsid proteins of specific serotypes and regulated gene expression cassettes encoding VEGF traps, and optimizing promoters and regulatory elements, we can achieve efficient transduction and targeting of the entire retinal layer and homeostatic regulation to adapt to changes in the course of the disease.
It achieves efficient transduction of the entire retinal layer, reduces unnecessary over-suppression and overexpression, improves the long-term effectiveness of treatment and patient compliance, and reduces the frequency of administration.
Smart Images

Figure PCTCN2025110286-FTAPPB-I100001 
Figure PCTCN2025110286-FTAPPB-I100002 
Figure PCTCN2025110286-FTAPPB-I100003
Abstract
Description
A novel gene therapy drug
[0001] Cross-reference to Related Applications
[0002] This application is based on and claims priority to Chinese Patent Application No. 202411004407.1, filed on July 25, 2024, the entire contents of which are incorporated herein by reference. TECHNICAL FIELD
[0003] The present application relates to a recombinant AAV viral particle comprising a novel capsid protein and a VEGF trap encoding nucleic acid that specifically binds to VEGF-A and its use in the treatment and prevention of diseases. BACKGROUND
[0004] AMD is a major public health problem that currently threatens visual health. Age is the primary risk factor for AMD. Comprehensive studies by the Blue Mountain Eye Institute, the Beaver Dam Eye Institute, and the Rotterdam Research Center found that the incidence of nAMD in people aged 55-64, 65-74, 75-84, and over 85 was 0.17%, 0.54%, 2.52%, and 5.76%, respectively. In China, according to epidemiological studies in Shanghai, the prevalence of AMD in people over 50 years old was 15.5%. With the intensification of population aging and the advancement of fundus disease screening methods, the number of nAMD patients in China increased from 1.71 million in 1990 to 3.81 million in 2015, and is expected to reach 8.84 million in 2050.
[0005] Adeno-associated virus (AAV) belongs to the Parvoviridae family and the Dependovirus genus, members of which require a helper virus such as adenovirus to co-infect to initiate replication, and AAV establishes a latent infection in the absence of a helper virus. The virion is composed of an icosahedral capsid that encompasses a 4.9 kb single-stranded DNA genome with two open reading frames: rep and cap. The non-structural rep gene encodes four regulatory proteins necessary for viral replication, while cap encodes three structural proteins assembled into a 60-mer capsid shell, namely capsid proteins VP1, VP2, and VP3.
[0006] Adeno-associated virus has low pathogenicity and the ability to stably express proteins in various organ tissues, which makes AAV have obvious advantages in the field of gene therapy and is suitable for delivering therapeutic genes. However, wild-type AAV serotypes usually infect multiple tissues or organs of mammals in a broad spectrum, have extensive tissue targeting, and cause gene delivery to off-target tissues, thereby exacerbating adverse reactions. The capsid proteins of AAV particles not only regulate the assembly of AAV during replication, but also promote the interaction of the virus with receptors on the plasma membrane and entry into target cells.
[0007] Studies have shown that the tissue tropism and cell transformation efficiency of AAV vectors are mainly determined by their capsids. In view of this, in order to improve the treatment effect of ophthalmic related genetic diseases, it is expected to rationally design and modify the AAV capsid protein to obtain AAV vectors with organ (especially eye) specificity.
[0008] It is known that AAV1, 2, 4, 5, 7, 8 and 9 types can transduce retinal pigment epithelial cells or photoreceptor cells by subretinal cavity or local administration. The transduction efficiency of the above prior art serotypes will be greatly reduced by IVT (vitreous cavity) administration. The prior art patent (CN103561774B) relates to AAV2.7m8 known serotype is based on the modification of AAV2 virus, and its principle is to replace the 588th amino acid position of AAV2 capsid protein VP1 with a short peptide of 11 amino acids, which changes the ability of AAV2 virus capsid to bind HSPG receptor, and can significantly improve the penetration of AAV2 into the inner limiting membrane and reach the retinal tissue. However, AAV2.7m8 vitreous administration cannot effectively transduce the outer retinal tissue (especially the retinal pigment epithelial layer and the photoreceptor cell layer), and the existing serotype can only infect the inner retinal tissue in large animals, and cannot penetrate to the photoreceptor cell layer (outer retina).
[0009] Vascular endothelial growth factor (VEGF) is a major regulator of blood vessel development and function of blood and lymphatic vessels during health and disease in adults. The VEGF family is currently known to consist of five structurally related factors: VEGF-A (also known as VEGFA165), VEGFB, VEGF-C, VEGFD, and placental growth factor (PlGF). VEGF family members exist primarily as homodimeric polypeptides that induce signaling and elicit corresponding biological effects through binding to related VEGF receptors. Vascular endothelial growth factor A (VEGF-A) as a vasculogenic cytokine, is involved in normal and abnormal vasculogenesis through interaction with two high-affinity transmembrane tyrosine kinase receptors (VEGFR-1 and VEGFR-2). Various different ways to block the VEGF-A pathway have been proposed to improve diseases associated with neovascularization. VEGF-A blockers / antagonists that have been proposed include: neutralizing antibodies that target VEGF-A, and soluble decoy receptors and Trap molecules that prevent VEGF-A from binding to its normal receptors. For example, Aflibercept (also known as Zaltrap, VEGFA-Trap, and by the trade name Elyea) is a recombinant fusion protein formed by fusion of the ligand-binding domains from human VEGF receptors 1 and 2 with a human IgGl Fc region, has been approved for the treatment of neovascularization-related retinal diseases such as age-related macular degeneration. Vascular endothelial growth factor C (VEGF-C) was identified as a lymphangiogenic-related cytokine that acts through tyrosine kinase receptors VEGFR2 and VEGFR3. VEGF-C is involved in the process of neovascularization by binding to VEGFR2 on vascular endothelial cells. In addition, VEGF-C stimulates lymphangiogenesis and lymphatic endothelial cell growth and migration by binding to receptor VEGFR3. VEGFR3, although structurally similar to VEGFR1 and 2, does not bind VEGF-A. It has been found that in addition to being highly expressed on lymphatic vessel cells, VEGFR3 is also highly expressed in vascular endothelial cells.
[0010] The existing technology for gene therapy against AMD or other related eye diseases mostly uses AAV vectors carrying expression cassettes of anti-VEGF molecules for intraocular injection. The existing technology often uses a strong and broad-spectrum promoter CMV (CN 109641065A), but in primates and clinical experiments, the CMV promoter has the risk of being silenced and has certain toxicity to the photoreceptors and retinal pigment epithelial cells of the eye. In addition, the common strong and broad-spectrum promoter will indiscriminately overexpress the carried target gene, which cannot meet the needs of the dynamic development of the disease course (dynamic changes of the targeted gene) and may be more likely to cause cell exhaustion, which is not conducive to the long-term and stable role of gene therapy. The existing technology discloses serotypes of AAV2, AAV8 and AAV2.7m8. Among them, wild-type AAV2 and AAV8 cannot efficiently penetrate the internal limiting membrane of the retina to reach the main cell tissues (RPE and PR) of most types of nAMD lesions, so the subretinal space administration method is generally used, but this administration method has high requirements for clinical surgery and patient compliance. Under the route of intravitreal administration (which has lower difficulty in clinical surgery and better patient compliance), these two wild-type AAV vectors will cause most of the rAAV and expressed anti-VEGF molecules to remain in the vitreous cavity, which is easy to induce intraocular inflammation and may affect the clinical treatment effect.
[0011] The AAV2.7m8 disclosed in CN 109641065A and CN 110650733A has better retinal penetration than wild-type AAV2 and can be used for intravitreal injection. However, it also has high infection of the neural retinal inner layer and will also have a large amount of AAV transduction of non-lesion cell layers and expression of a large amount of anti-VEGF molecules, which may cause high intraocular inflammation.
[0012] The currently approved anti-VEGF drug or other anti-VEGF antibody or fusion protein molecule treatment scheme in clinical experiments usually has a 3-month loading phase (once a month) and a subsequent maintenance phase. The maintenance phase includes a fixed treatment scheme of once every 1-2 months (individual once every 3-4 months), which requires regular follow-up of patients and long-term multiple injections, which has high requirements for patient compliance, not only brings a large burden to patients and medical resources, but also often affects the treatment effect due to compliance problems (Mitchell P, Liew G, Gopinath B, Wong TY. Age-related macular degeneration. Lancet. 2018; 392(10153): 1147-59; Luo Man, Chen Xiaolong. Progress of intravitreal injection of anti-vascular endothelial growth factor drugs for treatment of neovascular age-related macular degeneration. New Progress in Ophthalmology. 2020; 40(6): 582-58).
[0013] For nAMD gene therapy, while considering drug effectiveness, how to achieve long-term effectiveness and safety of drug treatment, and solve the convenience of clinical trial administration, are the keys to improve patient compliance, and are the problems to be solved at present
[0014] Therefore, there is an urgent need for a new gene therapy product, especially a gene therapy product that can solve the burden of continuous and frequent medication of patients and has a more efficient targeting vector and shuttle gene target, such as a recombinant AAV virus particle that can deliver VEGF drugs to the tissue tropism of the target. SUMMARY
[0015] The gene therapy product of the present application not only solves the problem of the burden of continuous and frequent medication of patients, but also has more efficient targeting vectors and effective expression of shuttle genes that can be regulated according to the course of the disease compared with other related gene therapy drugs in the clinical application stage. It can better adjust to the changes of the course and target gene to achieve the steady-state regulation of neovascularization and retinal function nutrition support, and is expected to show better and longer-term clinical performance.
[0016] The combination of a series of AAV serotypes and a regulatable gene expression cassette combined with VEGF trap disclosed by the present technology can efficiently transduce the whole layer of the retina, express secreted anti-VEGF protein in multiple types of AMD lesion tissues, and can be regulated stably according to the dynamic expression changes of key targets to play a timely and effective therapeutic effect.
[0017] Therefore, the present application relates to a new recombinant adeno-associated virus particle comprising a specific combination of serotype variants and nucleic acids encoding specific VEGF-binding molecules and their regulatable gene expression cassettes.
[0018] The tissue specificity (i.e., tissue tropism) of AAV is determined by the capsid serotype, and the rationally designed new serotype of the AAV capsid described in the present application can change the tissue tropism of traditional AAV while improving the tissue transduction activity of AAV.
[0019] In addition to selecting specific serotype capsid protein variants, the rAAV of the present application also comprises nucleic acid molecules encoding specific VEGF-A-binding VEGF traps. In some embodiments, the rAAV of the present application further comprises specific regulatable promoters and other regulatory elements, etc.
[0020] In some embodiments, the rAAV of the present application is improved in capsid protein, carried genes and its codons, and modulatable promoters and elements, etc. In one aspect, the recombinant adeno-associated virus particle comprises an anti-VEGF gene expression cassette that can be modulated for target gene expression changes and a novel AAV vector based on the directed evolution of wild-type adeno-associated virus capsid suitable for intravitreal injection to effectively transduce the full layer of the retina, thus having one or more of the following improved properties compared to the known AAV-based gene therapy vectors for nAMD:
[0021] (i) There is a better selection and combination of elements to achieve steady-state regulation suitable for target gene expression changes, so that the expression and / or secretion of the target gene can be adjusted for changes in the course of the disease, reducing unnecessary over-inhibition of target molecules and cell exhaustion that may be caused by over-expression of exogenous proteins, and achieving better and longer-term effects are expected;
[0022] (ii) It has higher transduction activity and cell tropism in vitro and in vivo for the full layer of the ocular retina tissue, and the invasiveness of the retina cells (PR and RPE) is significantly enhanced compared to existing serotypes, while ensuring high inner limiting membrane penetration ability, and the invasiveness of the retinal pigment epithelial cells and photoreceptor cells is further improved compared to existing serotypes;
[0023] (iii) The transduction activity of the retina tissue layers is significantly improved in animal eyes; in particular, better full retinal infection and RPE transduction in primates are achieved, and it is more suitable for delivering shuttle genes to multiple layers of the retina for diseases such as different types of AMD through intravitreal injection IVT administration;
[0024] (iv) It can be distributed in the full layer of the retina after different administration methods (especially intravitreal administration), and stably and continuously express exogenous supplemental proteins; and / or
[0025] (v) It improves the efficacy of the agent, reduces the dosage, and avoids the disadvantages that may be caused by over-expression of the shuttle gene, and achieves the expected long-term effective treatment.
[0026] Therefore, the rAAV of the present application can express sufficient VEGF binding molecules in the key lesion tissues of AMD for the gene therapy of ophthalmic diseases such as AMD and related diseases, and play a timely and effective therapeutic role. At the same time of drug effectiveness, it also realizes the long-acting nature of drug treatment, solves the convenience of clinical trial administration, and improves patient compliance.
[0027] Detailed description
[0028] I. Expression cassette comprising a nucleic acid of interest
[0029] The present application provides expression cassettes comprising a nucleic acid of interest. In some embodiments, the nucleic acid of interest can be comprised in an expression cassette and packaged within an AAV capsid.
[0030] The present application has optimized and screened different combinations of regulatable promoters, regulatory elements, and enhancers and introns, and preferred more optimal combinations of gene expression regulatory elements that can adapt to the pathological environment of AMD (such as hypoxia, inflammation, ER stress and unfolded protein response, etc.) and the changes of target gene expression (VEGFA expression) in vitro and in vivo. The gene expression cassette of the present application can regulate the transcription and expression and secretion of VEGF trap molecules according to the changes of target gene expression in the eye under the combination of more effective AAV vectors, achieve the homeostasis of long-term vascular nutrition and angiogenesis in the eye, and is expected to achieve the effect of long-term and effective treatment.
[0031] The nucleic acid of interest for being encoded by the viral particle of the present application is any nucleic acid encoding a therapeutic or prophylactic protein, in particular a nucleic acid encoding a protein for the prevention or treatment of an ophthalmic disease, such as an ophthalmic relevant gene, such as RPE65, AIPL1, PROM1, RS1 gene, etc. In some embodiments, the protein for the prevention or treatment of an ophthalmic disease includes but is not limited to, for example, RPE65, AIPL1, PROM1, RS1 or antibody analogues, etc.
[0032] In some embodiments, the nucleic acid of interest contained in the viral particle of the present application encodes a binding molecule that specifically binds to VEGF-A, such as VEGF-Trap. VEGFA is a regulatory molecule necessary for neovascularization in AMD disease, and has been a major target protein for AMD treatment for a long time. However, VEGFA is involved in the formation of blood vessels and the provision of nutrition in normal physiological processes such as development and repair in addition to pathological neovascularization, so long-term and strong inhibition of VEGFA by indiscriminately and continuously expressing anti-VEGF molecules may not be able to adapt to the demand for anti-VEGF as the pathological target VEGFA changes; and effective long-term expression of VEGF trap molecules that can adaptively change with the changes of pathological target VEGFA may be a more ideal treatment strategy.
[0033] In some embodiments, the VEGF-Trap is, for example, the VEGF-Trap defined in 2023115138935.
[0034] In some embodiments, the VEGF-Trap is an anti-VEGF fusion protein having the structure of Formula I from N-terminus to C-terminus:
[0035] L-V-H-Fc (I)
[0036] wherein each "-" is independently a bond or a linking peptide;
[0037] L is nothing or is a secretion signal peptide, which is derived from Ig kappa chain;
[0038] V is an anti-VEGF protein, which comprises Ig C domain 2 of VEGFR1 (VEGF receptor 1) and Ig C domain 3 of VEGFR2;
[0039] H is an optional hinge region;
[0040] Fc is an optional immunoglobulin Fc region.
[0041] In another preferred embodiment, the sequence of the secretion signal peptide comprises or consists of the amino acid sequence set forth in SEQ ID NO: 18.
[0042] It should be understood that the secretion signal peptide will be cleaved off subsequently by a signal peptidase. Therefore, the functional VEGF-Trap of the present application does not contain the secretion signal peptide.
[0043] In another preferred embodiment, the anti-VEGF protein comprises or consists of the amino acid sequence set forth in SEQ ID NO: 50, or an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NO: 50.
[0044] In another preferred embodiment, the hinge region amino acid sequence comprises or consists of GPG.
[0045] In another preferred embodiment, the Fc is an Fc fragment of human IgG, e.g., an Fc fragment of human IgG1. In some embodiments, the Fc fragment comprises or consists of the amino acid sequence set forth in SEQ ID NO: 51, or an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NO: 51.
[0046] In another preferred embodiment, the anti-VEGF fusion protein can further comprise a HA tag.
[0047] In some embodiments, the VEGF fusion protein comprises the amino acid sequence set forth in SEQ ID NO: 16 or 52, or comprises an amino acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence set forth in SEQ ID NO: 16 or 52, or consists of said amino acid sequence.
[0048] In some embodiments, the VEGF fusion protein is a dimer of the structure of Formula I.
[0049] In some embodiments, the VEGF fusion protein is encoded by a polynucleotide comprising the nucleic acid sequence set forth in SEQ ID NO: 17, or comprising a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 17.
[0050] In some embodiments, the nucleic acid of interest suitable for use in the expression cassette of the application comprises or consists of a nucleic acid molecule encoding a binding molecule that specifically binds to VEGF as described above.
[0051] In the case where the binding molecule that specifically binds to VEGF comprises one polypeptide chain, the nucleic acid of interest encodes one polypeptide chain. In the case where the binding molecule that specifically binds to VEGF comprises two or more identical polypeptide chains, the nucleic acid of interest encodes one of the polypeptide chains.
[0052] In the case where the binding molecule that specifically binds to VEGF comprises two or more different polypeptide chains, the different nucleic acids of interest can each encode a different polypeptide chain, or the same nucleic acid of interest can encode multiple different polypeptide chains.
[0053] In a preferred embodiment, the nucleic acid molecule encoding a binding molecule that specifically binds to VEGF as described above encodes one polypeptide chain of an anti-VEGF-A binding molecule as defined above (e.g., comprising two identical polypeptide chains).
[0054] In some embodiments, the nucleic acid molecule comprises the nucleic acid sequence set forth in SEQ ID NO: 17, or comprises a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 17.
[0055] In some embodiments, the expression cassette comprises at least 2 ITR sequences flanking the nucleic acid of interest, such that the vector genome can be packaged by an AAV capsid. The expression cassette can be single-stranded DNA or double-stranded DNA.
[0056] In some embodiments, the expression cassette can comprise one or more regulatory sequences to direct expression of the nucleic acid of interest in target cells (e.g., retinal target cells, e.g., photoreceptor cells or optic nerve cells). The regulatory sequences can be selected from the group consisting of transcription initiation sequences, termination sequences, promoter and enhancer sequences operably linked to the nucleic acid of interest; efficient RNA processing signals such as splice and polyadenylation (poly A) regions, including the human growth hormone polyadenylation region; selectable markers or reporter genes, e.g., resistance genes; microRNAs; post-transcriptional regulatory sequences, e.g., WPRE (the woodchuck hepatitis virus post-transcriptional regulatory element); sequences that stabilize cytoplasmic mRNA; nucleic acid restriction sites; homologous recombination sequences; sequences that enhance translation efficiency (e.g., Kozak consensus sequences); sequences that enhance protein stability; and, when desired, sequences that enhance secretion of the encoded product. In some preferred embodiments, the regulatory sequences are in the 5’ UTR or 3’ UTR. In some preferred embodiments, the regulatory sequences are selected from one or more of the following:
[0057] promoters, introns, enhancers, inducible transcriptional regulatory sequences, post-transcriptional regulatory sequences, polyadenylation regions, selectable markers or reporter genes.
[0058] Examples of promoters suitable for use in the present application include, but are not limited to, promoters from bacteria, yeast, plants, viruses, and mammals, including simians and humans. The promoters can be constitutive or can be inducible or can be tissue-specific. Constitutive promoters initiate RNA synthesis independent of regulatory influences. In some embodiments, the constitutive promoter is selected from the group consisting of Ubiquitin C promoter or CAG promoter.
[0059] In preferred embodiments of the present application, the promoters suitable for use in the expression cassettes of the present application are regulatable promoters, e.g., cell-specific promoters or inducible promoters, preferably inducible promoters. In some embodiments, the cell-specific promoter is, e.g., a hBEST1 retinal epithelial cell-specific promoter. In some embodiments, the inducible promoter is, e.g., a VEGFa prmt1 promoter. In some embodiments, the promoter comprises a suppressor element (e.g., SE) and / or a hypoxia response element (e.g., HRE).
[0060] In some embodiments, the hBEST1 retinal epithelium cell-specific promoter comprises a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more sequence identity to the nucleotide sequence set forth in SEQ ID NO: 35. In some embodiments, the promoter comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 35.
[0061] In some embodiments, the VEGFa prmtl inducible promoter comprises a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more sequence identity to the nucleotide sequence set forth in SEQ ID NO: 38. In some embodiments, the VEGFa prmtl comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 38.
[0062] In some embodiments, the promoter suitable for use in the expression cassettes of the present application is a constitutive promoter, such as the Ubiquitin C broad spectrum promoter. In some embodiments, the Ubiquitin C broad spectrum promoter comprises a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more sequence identity to the nucleotide sequence set forth in SEQ ID NO: 31, or comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 31.
[0063] The expression cassettes or plasmids of the present application can also comprise a selectable marker or reporter gene, such as to determine expression of the vector in a growth system (e.g., a bacterial cell) or in a retinal target cell. The "selectable marker" or "reporter gene" of the present application can be selected from those known in the art. Suitable reporter genes include, but are not limited to, enhanced green fluorescent protein, red fluorescent protein, luciferase, and secreted embryonic alkaline phosphatase (seAP), which can include sequences encoding geneticin, hygromycin, or puromycin resistance, among others. Such selectable markers or reporter genes (which can or can not be located outside of the viral genome to be packaged into a viral particle) can be used to signal the presence of the plasmid in a bacterial cell, such as an antibiotic resistance marker gene, e.g., ampicillin or tetracycline resistance or kanamycin resistance. In one embodiment, the selectable marker of the present application is a kanamycin resistance marker. In some embodiments, such selectable marker or reporter gene is a fluorescent protein, such as a green fluorescent protein or a red fluorescent protein.
[0064] A "post-transcriptional regulatory sequence" of the present application is a DNA sequence that, when transcribed, enhances expression of one or more transgenes or fragments thereof delivered by the viral vectors of the present application. Post-transcriptional regulatory sequences include, but are not limited to, a Hepatitis B virus post-transcriptional regulatory element (HPRE) and a Woodchuck hepatitis post-transcriptional regulatory element (WPRE). The WPRE is a three-part cis-acting element that has been shown to enhance transgene expression driven by certain, but not all, promoters. In some embodiments, the post-transcriptional regulatory sequence is, for example, a nuclear matrix attachment region (MAR). In some embodiments, the MAR is positioned on one or both sides of a nucleic acid coding sequence of interest to influence expression and regulation of the gene. In some embodiments, the MAR comprises a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more sequence identity to the nucleotide sequence set forth in SEQ ID NO: 37, or comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 37. In some embodiments, the MAR is MAR5, which consists of the nucleotide sequence set forth in SEQ ID NO: 37.
[0065] The expression cassette or expression vector of the present application can also comprise a polyadenylation region, such as hGHpA (human growth hormone polyadenylation region) or SV40pA (SV40 poly(A) signal polyadenylation region). In one embodiment, the polyadenylation region of the present application is a human growth hormone polyadenylation region, such as one comprising a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more sequence identity to the nucleotide sequence set forth in SEQ ID NO: 33; or comprising or consisting of the nucleotide sequence set forth in SEQ ID NO: 33.
[0066] The expression cassette or expression vector of the present application can also comprise an enhancer, such as a CMV enhancer. In some embodiments, the CMV enhancer comprises a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more sequence identity to the nucleotide sequence set forth in SEQ ID NO: 42. In some embodiments, the CMV enhancer comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 42.
[0067] The expression cassette or expression vector of the present application can also comprise a 5' UTR, e.g., a native 5' UTR of the gene of interest. In some embodiments, when the gene of interest is a VEGF fusion protein, the 5' UTR is a VEGFA 5'-UTR. In some embodiments, the VEGFA 5'-UTR comprises a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more sequence identity to the nucleotide sequence set forth in SEQ ID NO: 39. In some embodiments, the VEGFA 5'-UTR comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 39.
[0068] The expression cassette or expression vector of the present application can also comprise an intron, e.g., a chimeric intron. In some embodiments, the chimeric intron is a long chimeric intron or a short chimeric intron.
[0069] In some embodiments, the long chimeric intron comprises a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more sequence identity to the nucleotide sequence set forth in SEQ ID NO: 32, or comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 32.
[0070] In some embodiments, the short chimeric intron comprises a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more sequence identity to the nucleotide sequence set forth in SEQ ID NO: 36, or comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 36.
[0071] In some embodiments, the expression cassette or expression vector of the present application further comprises an inducible transcriptional regulatory sequence. In some embodiments, the inducible regulatory sequence is a suppression element (SE). In some embodiments, the suppression element comprises or consists of TTCAGCACCGCGGACAGTGCCTGTCACGTCCTGCACGACGTA. In some embodiments, the inducible regulatory sequence is a hypoxia response element (HRE). In some embodiments, the hypoxia response element comprises a hypoxia response sequence centered on "ACGTG" or "RCGTG".
[0072] In some embodiments, the inducible regulatory sequence is hypoxia response positive and repressive sequence, e.g., it comprises SE and HRE, e.g., 1, 2, 3 or more SE, and 1, 2, 3, 4, or 5 or more HRE.
[0073] In some embodiments, the inducible regulatory sequence is 3SE-nHRE. In some embodiments, the 3SE-nHRE comprises a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more sequence identity to the nucleotide sequence set forth in SEQ ID NO: 34, or comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 34. In one embodiment, the expression cassette or plasmid of the application comprises, from 5' to 3':
[0074] L-ITR sequence, promoter sequence, enhancer (e.g., CMV enhancer) or other inducible regulatory sequence (SE or HRE), chimeric intron sequence (e.g., long chimeric intron or short chimeric intron), the nucleic acid molecule of the application encoding the VEGF trap protein, and downstream hGHpA sequence, R-ITR sequence.
[0075] In one embodiment, the expression cassette or plasmid of the application has the structure of Formula II, from 5' to 3':
[0076] Z0-Z1-Z2-Z3-Z4-Z5-Z6-Z7-Z8-Z9 (II),
[0077] wherein each "-" in the formula is independently a bond or a nucleotide linker sequence;
[0078] wherein Z0 is nothing or an L-ITR sequence;
[0079] Z1 is nothing or an enhancer,
[0080] Z2 is nothing or an inducible transcriptional regulatory element, e.g., a hypoxia response positive and / or repressive sequence
[0081] Z3 is a promoter;
[0082] Z4 is nothing or a 5' UTR;
[0083] Z5 is nothing or an intron, wherein Z4 and Z5 are not both nothing;
[0084] Z6 is a nucleic acid coding sequence of interest;
[0085] Z7 is nothing or a polyadenylation signal;
[0086] Z8 is nothing or other regulatory sequence, e.g., a MAR;
[0087] Z9 is nothing or R-ITR;
[0088] wherein Z0-Z9 are each as defined.
[0089] In some embodiments, the expression cassette or plasmid of the application has the structure of Formula II from 5'-3':
[0090] Z0-Z1-Z2-Z3-Z4-Z5-Z6-Z7-Z8-Z9 (II),
[0091] wherein each "-" in the formula is independently a bond or a nucleotide linker sequence; and wherein Z0-Z9 are each selected from the combinations shown in the table below:
[0092] In one embodiment, the expression cassette of the application comprises, or consists of, or comprises a nucleic acid sequence having at least about 80%, 85%, 90%, 95%, or at least about 96%, at least about 97%, at least about 98%, at least about 99% or more sequence identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 21-30.
[0093] In one embodiment, the application also relates to a vector comprising the expression cassette described herein.
[0094] In some embodiments, the vector is an expression vector. In some embodiments, the vector is a virus or a plasmid. In some embodiments, the vector is a shuttle plasmid.
[0095] In some embodiments, the vector is a viral vector. In some embodiments, the vector is an AAV vector. AAV vectors suitable for use in the application can be any adeno-associated viral vector, such as an AAV vector selected from the group consisting of serotypes AAV1, 2, 3, 4, 5, 6, 7, 8, 9, and 10, or chimeric AAVs derived thereof, such as AAV2-AAV3, AAVrh.10, AAVhu.14, AAV3a / 3b, AAVrh32.33, AAVHSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, AAV6.2, AAV2i8, AAV-HSC15 / 17, AAVM41, AAV9.45, AAV6(Y445F / Y731F), AAV2.5T, AAV-HAE1 / 2, AAV clone 32 / 83, AAVShH10, AAV2(Y->F), AAV8(Y733F), AAV2.15, AAV2.4, AAVM41, AAVr3.45, AAV2, or AAV5, which can be better suited for efficient transduction in the tissue of interest. Upon transfection, AAVs elicit only a mild immune response, if any, in the host. In preferred embodiments of the application, the vector is an AAV serotype 2 or 9 vector. In further preferred embodiments, the vector is an AAV 9 vector or an AAV2 vector.
[0096] II. Recombinant AAV viral particles
[0097] The present application relates to a recombinant adeno-associated viral particle (rAAV) comprising an expression cassette comprising a nucleic acid of interest as described herein.
[0098] In some embodiments, the nucleic acid molecule of interest is packaged within an AAV capsid.
[0099] In some embodiments, the present application relates to a recombinant adeno-associated viral particle (rAAV) comprising
[0100] (i) an AAV capsid protein;
[0101] (ii) a nucleic acid of interest, e.g., one or more (e.g., 2) nucleic acids of interest, packaged within the AAV capsid, wherein the nucleic acid of interest is comprised within an expression cassette.
[0102] Thus, in some embodiments, the present application relates to a recombinant adeno-associated viral particle (rAAV) comprising
[0103] (i) an AAV capsid protein;
[0104] (ii) an expression cassette comprising a nucleic acid of interest, e.g., one or more (e.g., 2) nucleic acids of interest.
[0105] The AAV capsid protein of rAAV suitable for use in this invention can be any serotype of AAV capsid protein known in the art, such as a specific AAV serotype (AAV serotype 2 to AAV serotype 12) or a modified version of any of these serotypes (including AAV 4YF and AAV2.7m8 vectors), such as AAV serotype 1 (AAV1), AAV serotype 2 (AAV2), AAV2 modified version 7m8 (AAV2.7m8), AAV serotype 3a (AAV3a), AAV serotype 3b (AAV3b), AAV serotype 4 (AAV4), AAV serotype 5 (AAV5), AAV serotype 6 (AAV6), AAV serotype 7 (AAV7), AAV serotype 8 (AAV8), AAV serotype 9 (AAV9), or AAV serotype 10 (AAV10).
[0106] In one exemplary embodiment, the parental capsid protein is the AAV9 serotype capsid protein. In one exemplary embodiment, the parental capsid protein VP1 is the AAV9 serotype capsid protein VP1. In some embodiments, the parental AAV9 serotype capsid protein VP1 comprises HQSAQAQAQTGWVQN.
[0107] In one exemplary embodiment, the capsid protein VP1 of the parental AAV9 serotype comprises or consists of the amino acid sequence shown in SEQ ID NO:1.
[0108] In one embodiment, the capsid protein variant contains the following amino acid mutation relative to the parental AAV capsid protein VP1: I240T.
[0109] In some embodiments, the present invention relates to an AAV capsid protein variant of AAV9 comprising a modified capsid protein VP1, wherein 15 functional amino acids (HQSAQAQAQTGWVQN) in the AAV variable region VRIII (584-598aa) are mutated and replaced with 25 specific amino acids (LQRGNLALGDVTRPARQAATADVNT or LQRGNLALGETTRPARQAATADVNT). The mutation in the VRIII region weakens the binding ability of the AAV9 capsid to cell surface galactosidase receptors, while simultaneously giving the capsid variant more efficient internal limiting membrane penetration (intravitreal administration).
[0110] In some embodiments, the present invention relates to an AAV capsid protein variant of AAV9 comprising a modified capsid protein VP1, wherein 15 functional amino acids in the AAV variable region VRIII (584-598aa) are mutated and replaced with LQRGNRQAATADVNT. In some embodiments, the 584-598aa corresponds to HQSAQAQAQTGWVQN. In some embodiments, the present invention relates to an AAV capsid protein variant of AAV9 comprising a modified capsid protein VP1, wherein a 6-16 amino acid insert (6mer-16mer) is inserted in the AAV variable region VIII and its vicinity (e.g., between positions 587 and 588, between positions 588 and 589, or between positions 590 and 600), preferably not exceeding 11 amino acids, and preferably, the insert is 6, 7, 8, 9, 10, or 11 amino acids.
[0111] In some embodiments, the inserted fragment may be a novel targeting short peptide, a polypeptide that alters the spatial structure of the original receptor-binding motif, a polypeptide that binds specifically to a potentially novel receptor, or a polypeptide that weakens the binding activity of AAV9 with galactose. In some embodiments, the inserted functional peptide is a decapeptide. In some embodiments, the functional peptide comprises LALGETTRPA, LALGDVTRPA, or LALGEVTRPA. In some embodiments, the functional peptide may consist of LALGETTRPA, LALGDVTRPA, or LALGEVTRPA. In some embodiments, the inserted functional peptide may be a polypeptide with 1-3 additional amino acids added to one or both ends of the amino acid sequence of LALGETTRPA, LALGDVTRPA, or LALGEVTRPA. In some embodiments, the functional peptide may be a polypeptide with 1-3 additional amino acids deleted from one or both ends of the amino acid sequence of LALGETTRPA, LALGDVTRPA, or LALGEVTRPA. In some embodiments, the functional peptide may consist of a polypeptide having 1-2 amino acid mutations (e.g., substitution or deletion mutations) with the amino acid short peptides LALGETTRPA, LALGDVTRPA, or LALGEVTRPA, said mutations not altering or substantially altering the stability or tissue tropism of AAV viral particles containing the capsid protein variants of the present invention.
[0112] In some embodiments, the AAV capsid protein variants of the present invention comprise, relative to the parental AAV9 capsid protein VP1, the aforementioned substitution and insertion mutations, and optionally I240T.
[0113] In some embodiments, the present invention relates to an AAV capsid protein variant comprising a modified AAV capsid protein VP1, which, relative to the parental AAV9 capsid protein VP1, comprises, or consists only of, the following amino acid mutations: a short peptide of the parental VP1 HQSAQAQAQTGWVQN amino acid or 15 amino acids corresponding to positions 584-598 of the parental VP1 replaced with LQRGNRQAATADVNT; an insertion of LALGDVTRPA or LALGETTRPA between N at position 588 and R at position 589; and optionally, a mutation of I to T (I240T) at position 240 of the parental capsid protein, wherein the amino acid position is determined with reference to the amino acid sequence of the AAV9 capsid protein VP1 (SEQ ID NO:1).
[0114] In some embodiments, the AAV capsid protein variant of the present invention comprises or is composed of the amino acid sequence described in SEQ ID NO:2; or comprises an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO:2, and comprises a parental VP1 HQSAQAQAQTGWVQN amino acid short peptide mutated to LQRGNRQAATADVNT.
[0115] In some embodiments, the AAV capsid protein variant of the present invention is encoded by the nucleic acid sequence shown in SEQ ID NO:7; or by a short amino acid peptide of HQSAQAQAQTGWVQN containing the parent VP1, encoded by a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence shown in SEQ ID NO:7, and mutated to LQRGNRQAATADVNT.
[0116] In some embodiments, the present invention also relates to a capsid protein variant encoding a nucleic acid comprising a nucleotide sequence encoding the AAV capsid protein variant described herein. In some embodiments, the encoding nucleic acid comprises or consists of the nucleic acid sequence shown in SEQ ID NO:7; or comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence shown in SEQ ID NO:7, and the encoded capsid protein variant comprises a parental VP1 HQSAQAQAQTGWVQN amino acid short peptide mutated to LQRGNRQAATADVNT.
[0117] In some embodiments, the AAV capsid protein variant of the present invention comprises or is composed of the amino acid sequence described in SEQ ID NO:3; or comprises an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO:3, and comprises a short peptide of the parental VP1 HQSAQAQAQTGWVQN mutated to LQRGNRQAATADVNT, and LALGETTRPA inserted between N at position 588 and R at position 589.
[0118] In some embodiments, the AAV capsid protein variant of the present invention is encoded by the nucleic acid sequence shown in SEQ ID NO:8; or is encoded by a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence shown in SEQ ID NO:8 and comprising a mutation of the parental VP1 HQSAQAQAQTGWVQN amino acid short peptide to LQRGNRQAATADVNT, and an insertion of LALGETTRPA between N at position 588 and R at position 589.
[0119] In some embodiments, the present invention also relates to a capsid protein variant encoding a nucleic acid comprising a nucleotide sequence encoding the AAV capsid protein variant described herein. In some embodiments, the encoding nucleic acid comprises or consists of the nucleic acid sequence shown in SEQ ID NO:8; or comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence shown in SEQ ID NO:8, and the encoded capsid protein variant comprises a parental VP1 HQSAQAQAQTGWVQN amino acid short peptide mutated to LQRGNRQAATADVNT, and an insertion of LALGETTRPA between N at position 588 and R at position 589.
[0120] In some embodiments, the AAV capsid protein variant of the present invention comprises or is composed of the amino acid sequence described in SEQ ID NO:4; or comprises an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO:4, and comprises a parental VP1 HQSAQAQAQTGWVQN amino acid short peptide mutated to LQRGNRQAATADVNT, and an insertion of LALGDVTRPA between N at position 588 and R at position 589.
[0121] In some embodiments, the AAV capsid protein variant of the present invention is encoded by the nucleic acid sequence shown in SEQ ID NO:9; or is encoded by a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence shown in SEQ ID NO:9 and comprising a mutation of the parental VP1 HQSAQAQAQTGWVQN amino acid short peptide to LQRGNRQAATADVNT, and an insertion of LALGDVTRPA between N at position 588 and R at position 589.
[0122] In some embodiments, the present invention also relates to a capsid protein variant encoding a nucleic acid comprising a nucleotide sequence encoding the AAV capsid protein variant described herein. In some embodiments, the encoding nucleic acid comprises or consists of the nucleic acid sequence shown in SEQ ID NO:9; or comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence shown in SEQ ID NO:9, and the encoding capsid protein variant comprises a parental VP1 HQSAQAQAQTGWVQN amino acid short peptide mutated to LQRGNRQAATADVNT, and an insertion of LALGDVTRPA between N at position 588 and R at position 589.
[0123] In some embodiments, the AAV capsid protein variant of the present invention comprises or is composed of the amino acid sequence described in SEQ ID NO:5; or comprises an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO:5, and comprises a parental VP1 HQSAQAQAQTGWVQN amino acid short peptide mutated to LQRGNRQAATADVNT, and an insertion of LALGDVTRPA between N at position 588 and R at position 589, and I240T.
[0124] In some embodiments, the AAV capsid protein variant of the present invention is encoded by the nucleic acid sequence shown in SEQ ID NO:10; or is encoded by a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence shown in SEQ ID NO:10 and comprising a mutation of the parental VP1 HQSAQAQAQTGWVQN amino acid short peptide to LQRGNRQAATADVNT, and the insertion of LALGDVTRPA between N at position 588 and R at position 589, and I240T.
[0125] In some embodiments, the present invention also relates to a capsid protein variant encoding a nucleic acid comprising a nucleotide sequence encoding the AAV capsid protein variant described herein. In some embodiments, the encoding nucleic acid comprises or consists of the nucleic acid sequence shown in SEQ ID NO:10; or comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence shown in SEQ ID NO:10, and the encoding capsid protein variant comprises a parental VP1 HQSAQAQAQTGWVQN amino acid short peptide mutated to LQRGNRQAATADVNT, and an insertion of LALGDVTRPA between N at position 588 and R at position 589, and I240T.
[0126] In some embodiments, the capsid protein variant of the present invention is the capsid protein variant described in CN 112342228 B (which is incorporated herein in its entirety).
[0127] In one exemplary embodiment, the parental capsid protein is the AAV2 or AAV2.7m8 serotype capsid protein. In one exemplary embodiment, the parental capsid protein VP1 is the AAV2 or AAV2.7m8 serotype capsid protein VP1.
[0128] In one exemplary embodiment, the capsid protein VP1 of the parental AAV2 serotype comprises or consists of the amino acid sequence shown in SEQ ID NO:11.
[0129] In one exemplary embodiment, the capsid protein VP1 of the parental AAV2.7m8 serotype comprises or consists of the amino acid sequence shown in SEQ ID NO:12.
[0130] In one embodiment, the AAV capsid protein variant comprises, relative to the parental AAV capsid protein, the following amino acid mutations: I240T and V708I, and an insert fragment (5mer-15mer) of 5-15 amino acids inserted into the AAV variable region VIII (e.g., between positions 587 and 588), preferably not exceeding 10 amino acids, and preferably, the insert fragment is 5, 6, 7, 8, 9, or 10 amino acids long.
[0131] In some embodiments, the insert fragment may be a novel targeting short peptide, a polypeptide that alters the spatial structure of the original receptor binding, a polypeptide that binds specifically to a potentially novel receptor, or a polypeptide that weakens the binding activity of AAV2 to HSPG. In some embodiments, the insert fragment comprises LALGDVTRPA. In some embodiments, the insert fragment may consist of LALGDVTRPA. In some embodiments, the inserted amino acid may be a polypeptide with 1-5 additional amino acids added to one or both ends of the amino acid sequence LALGDVTRPA. In some embodiments, the inserted amino acid may be a polypeptide with 1-3 additional amino acids deleted from one or both ends of the amino acid sequence LALGDVTRPA. In some embodiments, the inserted amino acid may consist of a polypeptide having 1-2 amino acid mutations (e.g., substitution or deletion mutations) with the amino acid short peptide LALGDVTRPA, said mutations not altering or substantially not altering the stability or tissue tropism of AAV viral particles containing the capsid protein variant of the present invention.
[0132] Therefore, in some embodiments, the present invention relates to an AAV capsid protein variant comprising a modified AAV capsid protein VP1 that contains, relative to the parental AAV capsid protein VP1, the following amino acid mutations, or mutations consisting only of the following amino acid mutations: I240T-V708I and the insertion fragment LALGDVTRPA between positions 587 and 588, wherein the amino acid positions are determined with reference to the amino acid sequence of AAV2 capsid protein VP1 (SEQ ID NO: 11).
[0133] In some embodiments, the AAV capsid protein variant of the present invention comprises the amino acid sequence described in SEQ ID NO:13; or comprises an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO:13, and comprises the substituted I240T-V708I and the insert fragment 587-LALGDVTRPA-588.
[0134] In some embodiments, the AAV capsid protein variant of the present invention is encoded by the nucleic acid sequence shown in SEQ ID NO:14; or is encoded by a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence shown in SEQ ID NO:14 and comprises the substitution I240T-V708I and the insert fragment 587-LALGDVTRPA-588.
[0135] In some embodiments, the invention also relates to capsid protein variants encoding nucleic acids comprising nucleotide sequences encoding the AAV capsid protein variants described herein.
[0136] In some embodiments, the encoding nucleic acid comprises or consists of the nucleic acid sequence shown in SEQ ID NO:14; or comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence shown in SEQ ID NO:14, and the encoded capsid protein variant comprises the substitution I240T-V708I and the insert fragment 587-LALGDVTRPA-588.
[0137] In some embodiments, the capsid protein variant of the present invention is the capsid protein variant described in PCT / CN2024 / 072554, which is incorporated herein by reference.
[0138] In other embodiments, the present invention relates to an AAV capsid protein variant comprising a modified AAV capsid protein VP1 containing, relative to the parental AAV capsid protein VP1, the following amino acid mutations, or mutations consisting only of the following amino acid mutations: M211V-I240T-V708I and the insertion fragment LALGDVTRPA between positions 587 and 588, wherein the amino acid positions are determined with reference to the amino acid sequence of AAV2 capsid protein VP1 (SEQ ID NO: 11).
[0139] In some embodiments, the AAV capsid protein variant of the present invention comprises the amino acid sequence described in SEQ ID NO:53; or comprises an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO:53, and comprises the substitution M211V-I240T-V708I and the insert fragment 587-LALGDVTRPA-588.
[0140] In some embodiments, the AAV capsid protein variant of the present invention is encoded by the nucleic acid sequence shown in SEQ ID NO:54; or is encoded by a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence shown in SEQ ID NO:54 and comprising the substitution M211V-I240T-V708I and the insert fragment 587-LALGDVTRPA-588.
[0141] In some embodiments, the invention also relates to capsid protein variants encoding nucleic acids comprising nucleotide sequences encoding the AAV capsid protein variants described herein.
[0142] In some embodiments, the encoding nucleic acid comprises or consists of the nucleic acid sequence shown in SEQ ID NO:54; or comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence shown in SEQ ID NO:54, and the encapsulated capsid protein variant comprises the substitution M211V-I240T-V708I and the insert fragment 587-LALGDVTRPA-588.
[0143] In some embodiments, the capsid protein variant of the present invention is the capsid protein variant described in CN202510832733.X, which is incorporated herein by reference.
[0144] In some embodiments, the nucleic acid encoding the capsid protein variant of the present invention is contained in a plasmid.
[0145] In some embodiments, the serotypes of the present invention containing capsid protein variants are significantly enhanced compared to existing serotypes, while ensuring highly efficient internal limiting membrane penetration. Compared to existing serotypes, they exhibit further enhanced invasiveness to retinal pigment epithelial cells and photoreceptor cells. Whether administered subretinal or intravitreal, the virus can be distributed across the entire retinal layer, stably and continuously expressing exogenous supplemental proteins. The stability of the virus is superior to that of existing known serotypes.
[0146] III. Preparation Method
[0147] This invention relates to a method for preparing recombinant adeno-associated virus (rAAV) particles. Many methods are known in the art for packaging and producing rAAV. Currently, commonly used rAAV packaging systems mainly include three-plasmid co-transfection systems, systems using adenovirus as a helper virus, packaging systems using herpes simplex virus type 1 (HSV1) as a helper virus, and baculovirus-based packaging systems. Each packaging system has its own characteristics, and those skilled in the art can make appropriate selections according to their needs.
[0148] rAAV production cultures used to produce rAAV viral particles require: 1) suitable host cells, including, for example, human cell lines such as 293 cells (e.g., HEK-293T cells, such as adherent HEK293T cells or suspension HEK293 cells), or insect cell lines (in the case of baculovirus production systems); 2) suitable helper viral functions provided by wild-type or mutant adenoviruses (e.g., temperature-sensitive adenoviruses), herpesviruses, baculoviruses, or plasmid constructs that provide helper functions; 3) AAV rep and cap genes and gene products; 4) a target gene with at least one AAV ITR sequence on each flanking side, preferably driven by effectively linked regulatory elements and promoters; and 5) a suitable culture system to support rAAV production.
[0149] In some embodiments, the host cell can be a prokaryotic cell, a lower eukaryotic cell, or a higher eukaryotic cell, such as mammalian cells (including human and non-human mammals). Representative examples include animal cells such as CHO, NSO, COS7, or 293 cells. In a preferred embodiment of the invention, 293T cells, photoreceptor cells (including cone cells and / or rod cells), other visual cells (such as biganglionic cells), and nerve cells are selected as host cells. In another preferred embodiment, the host cell is selected from the group consisting of rod cells, cone cells, light-exposed bipolar cells, light-deactivated bipolar cells, horizontal cells, ganglion cells, cells without long processes, or combinations thereof.
[0150] In some embodiments, the present invention relates to a method for producing recombinant AAV virus particles, comprising culturing packaging cells under conditions sufficient to produce recombinant AAV virus particles, wherein the packaging cells comprise a plasmid containing a nucleic acid encoding a capsid protein variant according to the present invention or a nucleic acid encoded by a capsid protein variant according to the present invention.
[0151] In some embodiments, the packaging cells further include helper plasmids and / or transfer plasmids containing the target nucleic acid.
[0152] .
[0153] In some embodiments, the method further includes lysing the packaging cells and separating recombinant AAV virus particles from the cell lysis products.
[0154] In some implementations, the method further includes one or more of the following steps:
[0155] a. Remove cell debris,
[0156] b. Treat the supernatant containing recombinant AAV virus particles with a totipotent nuclease.
[0157] c. Concentrated recombinant AAV virus particles,
[0158] d. Purify the recombinant AAV virus particles, for example, by density gradient centrifugation with iodixanol or by affinity ion chromatography.
[0159] Therefore, the present invention also relates to a packaging cell for producing recombinant AAV virus particles, said packaging cell comprising a plasmid containing a nucleic acid encoding a variant of the capsid protein described in the present invention, or a capsid protein encoding nucleic acid of the present invention, or an expression cassette of the present invention.
[0160] This invention also relates to methods for detecting AAV viral particles, such as assessing cell receptor-mediated AAV transduction efficiency (e.g., by flow cytometry). Different in vitro cell lines and different cell species have varying distributions and proportions of receptors on their membrane surfaces. Assessing cell receptor-mediated AAV transduction efficiency is directly determined by the percentage and intensity of fluorescence expressed in the transduced cells. Using genetically engineered cells and animal ocular tissues, the affinity of tissue-targeted AAV for different receptors can be further determined, applicable to the serotype screening and functional verification involved in this invention. Different serotypes of AAV viral particles can also be detected by detecting the expression and / or secretion of target molecules, for example, by Western blotting (WB).
[0161] III. Compositions, drugs, or formulations
[0162] Therefore, this invention provides a gene therapy product using the rAAV described herein, which can be used in both ophthalmic and non-ophthalmic fields.
[0163] In some embodiments, the present invention provides a pharmaceutical composition comprising (a) the rAAV described herein, and (b) pharmaceutical excipients, such as pharmaceutical carriers and pharmaceutical excipients known in the art, including buffers.
[0164] In some embodiments, the pharmaceutical composition is formulated as a dosage form. Therefore, the pharmaceutical composition also encompasses pharmaceutical dosage forms.
[0165] As used herein, “pharmaceutical carrier” includes any and all physiologically compatible solvents, dispersion media, isotonic agents, and absorption delay agents. For information on the use and applications of pharmaceutical excipients, see “Handbook of Pharmaceutical Excipients”, 8th edition, R.C. Rowe, P.J. Seskey and S.C. Wen, Pharmaceutical Press, London, Chicago.
[0166] In some embodiments, pharmaceutical excipients include, but are not limited to, one or more compatible solid or liquid fillers or gel substances, which are suitable for human use and must have sufficient purity and sufficiently low toxicity. "Compatibility" herein refers to the ability of the components in the composition to interact with and incorporate with the active ingredient of the invention without significantly reducing the efficacy of the active ingredient.
[0167] The pharmaceutical compositions of the present invention can be liquids or solids, such as powders, gels, or pastes. Preferably, the formulations, compositions, or pharmaceuticals of the present invention are liquids.
[0168] The rAAV of the present invention or a pharmaceutical composition comprising it can be administered intravenously, intramuscularly, subcutaneously, orally, via mucosal contact, intraperitoneally, and intralesionally, preferably topically to the eye, for example by intravitreal injection, subretinal injection, or suprachoroidal injection, most preferably via intravitreal administration.
[0169] IV. Combination Products
[0170] In one aspect, the present invention also provides combination products (e.g., pharmaceutical combination products) comprising the rAAV of the present invention, and one or more other therapeutic agents. The combination products of the present invention can be used in the treatment methods of the present invention.
[0171] The present invention also provides a complete set of medicine boxes comprising the combined products, for example, the complete set of medicine boxes comprising, within the same package:
[0172] - A first container containing the rAAV of the present invention or a drug containing therein;
[0173] - A second container containing a pharmaceutical composition of one or more other therapeutic agents (e.g., immunomodulators).
[0174] In some implementations, other therapeutic agents are immunomodulators, such as immunosuppressants, for example, used to reduce the immune response, such as the immune inflammatory response, generated by rAAV particles.
[0175] V. Treatment Methods
[0176] In one embodiment, the rAAV of the present invention or a pharmaceutical composition or combination product comprising it is used for therapies, such as for treating ocular diseases, including but not limited to diseases caused by retinal and choroidal lesions with VEGFA as the primary pathogenic target, such as age-related macular degeneration (AMD) such as nAMD, diabetic retinopathy, retinal vascular occlusion, and corneal neovascularization.
[0177] In one embodiment, the rAAV of the present invention, or a pharmaceutical composition or combination product comprising it, is administered intraocularly, such as via intraretinal or intravitreal administration, such as subretinal or intravitreal administration, for example, by injection.
[0178] In one embodiment, the invention also relates to the use of recombinant AAV virus particles, pharmaceutical compositions or combination products comprising them in the preparation of a medicament for treating the ocular disease of the present invention.
[0179] In some embodiments, the treatment method of the present invention includes introducing a nucleic acid sequence encoding a target nucleic acid into the vitreous cavity of the eye. Preferably, the method includes contacting cells with a vector (e.g., adeno-associated virus) containing a nucleic acid sequence encoding the target nucleic acid. Preferably, the cells are retinal cells, preferably cone cells, rod cells, photosensitive bipolar cells, photosensitive bipolar cells, horizontal cells, ganglion cells, and / or cells without long processes.
[0180] VI. Definition
[0181] For the purpose of interpreting this specification, the following definitions will be used, and terms used in the singular may also include the plural, and vice versa, where appropriate. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0182] The term "about" or "approximately" includes a range of values that are statistically significant. Such a range may be within an order of magnitude of a given value or range, preferably within 50%, more preferably within 20%, even more preferably within 10%, and even more preferably within 5% or 1%. The permissible variation covered by the term "about" or "approximately" depends on the specific system being studied and can be readily understood by those skilled in the art.
[0183] As used herein, the term “and / or” means any one of the options or two or more or all of the options.
[0184] As used herein, the terms “comprising” or “including” mean to include the stated elements, integers, or steps, but do not exclude any other elements, integers, or steps. In this document, when the terms “comprising” or “including” are used, unless otherwise specified, they also cover situations consisting of the mentioned elements, integers, or steps. For example, when referring to an antibody variable region “comprising” a specific sequence, it is also intended to cover the antibody variable region consisting of that specific sequence.
[0185] As described in this article, adeno-associated virus (AAV), also known as adeno-associated virus, belongs to the genus *Dependent Virus* of the family Parvoviridae. It is currently the simplest single-stranded DNA-deficient virus discovered, requiring a helper virus (usually adenovirus) to participate in replication. It encodes the cap and rep genes in two terminal inverted repeat sequences (ITRs). ITRs play a decisive role in viral replication and packaging. The cap gene encodes the viral capsid protein, and the rep gene participates in viral replication and integration. AAV can infect a variety of cell types. Due to the smaller size, non-pathogenicity, and transfection capabilities of AAV compared to other viral vectors, as well as its ability to transfect both dividing and non-dividing cells, gene therapy based on AAV vectors targeting ocular diseases, particularly hereditary retinal degeneration, has received widespread attention. Recombinant adeno-associated virus vectors (rAAV), derived from non-pathogenic wild-type AAV, are considered one of the most promising gene transfer vectors due to their good safety profile, broad host cell range (dividing and non-dividing cells), low immunogenicity, and long duration of exogenous gene expression in vivo. They are widely used in gene therapy and vaccine research worldwide. After more than 10 years of research, the biological characteristics of recombinant adeno-associated virus (rAAV) have been thoroughly understood, especially regarding its application effects in various cell, tissue, and in vivo experiments, for which a wealth of data has been accumulated. In medical research, rAAV has been used in gene therapy research for a variety of diseases (including in vivo and in vitro experiments); at the same time, as a distinctive gene transfer vector, it is also widely used in gene function research, disease model construction, and gene knockout mouse creation.
[0186] The term "capsid protein" encompasses the proteins that form part of the viral capsid. For adeno-associated virus (AAV), the capsid proteins are generally referred to as VP1, VP2, and / or VP3, and each is encoded by a single cap gene. For AAV, these three AAV capsid proteins are generated in an overlapping manner from the cap open reading frame (ORF) via alternating mRNA splicing and / or alternating translation start codons, although all three proteins use a common stop codon. Warrington et al. (2004) J.Virol. 78:6595, incorporated herein by reference in its entirety. VP1 of AAV2 is generally translated from an ATG start codon (amino acid M1) on 2.4-kb mRNA, while VP2 and VP3 of AAV2 originate from a smaller 2.3-kb mRNA, using a weaker ACG start codon to generate VP2 (amino acid T138), and read through to the next available ATG codon (amino acid M203) to generate the most abundant capsid protein, VP3. The amino acid sequences of adeno-associated virus (AAV) capsid proteins are well known in the art and are generally conserved, particularly depending on parvoviruses. See Rutledge et al. (1998) J. Virol. 72:309-19. Accordingly, although the amino acid positions provided herein can be provided with respect to the VP1 capsid protein of AAV, and unless otherwise specified, the amino acid positions provided herein are determined with reference to the amino acid positions of AAV2VP1 shown in SEQ ID NO:1, those skilled in the art can readily determine the positions of the same amino acids in the VP2 and / or VP3 capsid proteins of AAV, as well as the corresponding positions of the amino acids in different serotypes. The AAV capsid proteins described herein encompass AAV type 1 (AAV1), AAV type 2 (AAV2), AAV type 3 (AAV3), AAV type 4 (AAV4), AAV type 5 (AAV5), AAV type 6 (AAV6), AAV type 7 (AAV7), AAV type 8 (AAV8), AAV type 9 (AAV9), or AAV2.GL, etc.
[0187] The term "rAAV" as used in this article refers to recombinant adeno-associated virus, also known as recombinant adeno-associated virus particles or recombinant AAV.
[0188] The term "retinal cell" in this document may refer to any cell type, including the retina, such as retinal ganglion cells, amacrine cells, horizontal cells, bipolar cells and photoreceptor cells (including rod cells and cone cells), Müller's glial cells and retinal pigment epithelial cells.
[0189] As used herein, the phrase "operable connection" includes the physical juxtaposition (e.g., in three-dimensional space) of components or elements that interact directly or indirectly with each other, or otherwise coordinate with each other to participate in biological events, such juxtaposition achieving or allowing such interactions and / or coordination. In some embodiments, "operable connection" involves the covalent connection of related components or elements with each other. However, those skilled in the art will understand that in some embodiments, covalent connections are not required to achieve an effective operable connection.
[0190] The term "capsid protein variant" includes a capsid protein that has at least one mutation (e.g., substitution, deletion, or insertion) compared to the corresponding capsid protein that is the parent.
[0191] In this document, amino acid mutations can be amino acid substitutions, deletions, or insertions. Any combination of substitutions, deletions, or insertions can be performed to obtain optimized variants with desired properties. Amino acid deletions and insertions include deletions and insertions at the amino and / or carboxyl ends of the polypeptide sequence, as well as deletions and insertions within the polypeptide sequence. In some embodiments, amino acid mutations are amino acid substitutions, such as single amino acid substitutions, or combinations of several amino acid substitutions. In some embodiments, amino acid mutations are insertions, such as the insertion of several amino acid segments.
[0192] In this document, when referring to the amino acid position of the capsid protein to be mutated, it is determined by referring to the amino acid sequence shown in SEQ ID NO:1 or 11. The corresponding amino acid position on a hybrid protein or polypeptide with other amino acid sequences can be identified by amino acid sequence alignment with SEQ ID NO:1 or 11. For example, when “I240” is mentioned, it refers to isoleucine I at position 240 of SEQ ID NO:1 or 11, or the corresponding amino acid residue at the same position aligned with the amino acid sequence of other capsid proteins.
[0193] In this paper, when referring to mutations in capsid proteins, single amino acid substitutions are described as follows: [original amino acid residue / position / substituted amino acid residue] or [position / substituted amino acid residue]. For example, the substitution of isoleucine (or another corresponding amino acid) at position 240 for threonine can be represented as I240T or simply 240T. Accordingly, single amino acid substitutions can be linked together using "and" or "-" to represent combined mutations at multiple given positions. For example, the combined mutation of I240T and V708I can be represented as: I240T-V708I.
[0194] In this paper, when referring to mutations in capsid proteins, insertions are described as follows: [original amino acid position - insertion fragment - original amino acid position + 1]. For example, the insertion fragment LALGDVTRPA at positions 587 and 588 can be represented as 587-LALGDVTRPA-588.
[0195] The terms "transduction" or "infection" refer to the introduction of nucleic acids into target cells via a viral vector. The term "transduction efficiency" refers to the percentage (e.g., fraction) of cells expressing the target nucleotide after incubation with a predetermined number of viral vectors containing the target nucleotide. Well-known methods for determining transduction efficiency include fluorescence-activated cell sorting of cells transduced with a fluorescent reporter gene, PCR for target nucleotide expression, or the expression level of the encoded protein (Western immunoblotting, or enzyme-linked immunosorbent assay, ELISA).
[0196] The "percentage of identity (%)" for an amino acid sequence or nucleic acid sequence refers to the percentage of amino acid residues / nucleotides in the candidate sequence that are identical to the specific sequence shown in this specification after comparing the candidate sequence with the specific sequence shown herein, and, if necessary, introducing vacancies to achieve the maximum percentage of sequence identity, and without considering any conserved substitutions as part of sequence identity. In some embodiments, the invention contemplates variants of the protein, polypeptide, or nucleic acid of the invention that have a considerable degree of identity with respect to the polypeptide, protein, or nucleic acid specifically disclosed herein, for example, an identity of at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% or higher. These variants may contain conserved changes.
[0197] As used herein, the term "trap" molecule refers to a fusion protein containing an extracellular ligand-binding domain of a receptor with the Fc region of human IgG. Various "trap" molecules that "capture" VEGF ligands, including VEGF-A and VEGF-C, have been developed. These trap molecules can be used to bind the corresponding ligands in the extracellular environment and reduce their concentration. In one embodiment, the anti-VEGF-A component of the present invention comprises a trap molecule in the form of an Fc fusion protein that "captures" VEGF-A. This trap molecule is capable of competitively binding to VEGF-A with the native VEGF-A cellular receptor, thereby inhibiting VEGF-A-induced signaling. In one embodiment, the trap molecule in the form of an Fc fusion protein comprises the amino acid sequence of SEQ ID NO:11. This VEGF-A-trap molecule is formed by fusing extracellular ligand-binding domains from VEGF receptors 1 and 2 to the Fc region of human IgG1, having amino acids entirely derived from humans, thereby minimizing the immunogenicity of the molecule in the human body.
[0198] As used herein, the term “VEGF-A” or “VEGF-A” refers to vascular endothelial growth factor A (e.g., human VEGF-A protein under accession number UniProt P15692). VEGF-A binds to receptors VEGFR1 (also known as FLT1) and VEGFR2 (also known as KDR). In this context, “antigen binding specificity against VEGF-A” refers to a binding site or binding domain in the molecule that specifically binds to human VEGF-A.
[0199] "Anti-VEGF-A component" herein refers to a polypeptide capable of binding to the VEGF-A protein. For example, the anti-VEGF-A component may be a chimeric polypeptide / fusion protein comprising a polypeptide of the VEGF-A receptor extracellular domain and an Fc region fused to its C-terminus; or it may be an anti-VEGF-A antibody comprising a heavy chain and a light chain, such as a Fab antibody or fragment of another full-length antibody. In one embodiment, the anti-VEGF-A component is provided by a trap molecule in the form of an Fc fusion protein, forming a dimer through dimerization of the Fc region. In another embodiment, the anti-VEGF-A component is provided by an anti-VEGF-A antibody in the form of a Fab, wherein the heavy chain of the Fab (i.e., the polypeptide chain containing the heavy chain constant region) pairs with the light chain of the Fab (i.e., the polypeptide chain containing the light chain constant region) to form a dimer.
[0200] As used herein, the terms “binding” or “specific binding” mean that the binding is selective for the antigen and can be distinguished from unwanted or nonspecific interactions. The ability of an antigen-binding site to bind to a specific antigen can be determined by enzyme-linked immunosorbent assay (ELISA) or conventional binding assays known in the art.
[0201] “Affinity” or “binding affinity” refers to the inherent binding affinity that reflects the interaction between members of a binding pair. The affinity of molecule X for its partner Y can usually be represented by the dissociation constant (KD), which is the ratio of the dissociation rate constant to the association rate constant (kdis and kon, respectively). Affinity can be measured by common methods known in the art. One specific method used to measure affinity is the ForteBio kinetic binding determination described in this paper.
[0202] For polypeptide sequences, "conservative modification" includes substitutions, deletions, or additions to the polypeptide sequence that do not substantially alter the desired functional activity of the polypeptide sequence. For example, a conserved substitution often results in an amino acid being replaced by a chemically similar amino acid. Tables of conserved substitutions of functionally similar amino acids are well known in the art. The following lists eight groups of amino acids containing mutually conserved substitutions: 1) alanine (A), glycine (G); 2) aspartic acid (D), glutamic acid (E); 3) asparagine (N), glutamine (Q); 4) arginine (R), lysine (K); 5) isoleucine (I), leucine (L), methionine (M), valine (V); 6) phenylalanine (F), tyrosine (Y), tryptophan (W); 7) serine (S), threonine (T); and 8) cysteine (C), methionine (M). In some embodiments, the term "conserved sequence modification" is used to refer to amino acid modifications that do not significantly affect or alter the target antigen binding characteristics of the antibody molecule or binding protein molecule of the present invention containing the amino acid sequence. For example, conserved modified variants maintain at least 80%, 85%, 90%, 95%, 98%, 99% or higher, such as 100-110% or higher, binding affinity to the target antigen relative to the parent antibody or binding protein.
[0203] The term "host cell" refers to a cell into which exogenous polynucleotides have been introduced, including progeny cells of this type. Host cells include "transformers" and "transformed cells," which include primary transformed cells and their derived progeny. Host cells can be any type of cell system that can be used to produce the antibody molecules of this invention, including eukaryotic cells, such as mammalian cells, insect cells, and yeast cells; and prokaryotic cells, such as *E. coli* cells. Host cells include cultured cells, as well as cells within transgenic animals, transgenic plants, or cultured plant or animal tissues.
[0204] The terms “individual” or “subject” are used interchangeably and refer to mammals. Mammals include, but are not limited to, domesticated animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In particular, an individual is a human.
[0205] The term "treatment" includes the administration of a composition or hybrid polypeptide to prevent or delay the onset of symptoms, complications, or biochemical indicators of a disease, to alleviate symptoms, or to stop or inhibit the further development of a disease, symptom, or condition. The term "prevention" includes the suppression of the occurrence or development of a disease or condition or the symptoms of a particular disease or condition.
[0206] The term "pharmaceutical excipients" refers to diluents, adjuvants (e.g., Freund's adjuvants (complete and incomplete)), excipients, carriers, or stabilizers that are applied together with the active substance.
[0207] The term "pharmaceutical composition" refers to a composition which is present in a form that allows the biological activity of the active ingredient contained therein to be effective, and which does not contain any additional ingredients that would have unacceptable toxicity to a subject administering the composition.
[0208] The term "effective amount" refers to such an amount or dose of the rAAV or composition or combination of the present invention, which, when administered to a patient in a single or multiple doses, produces the desired effect in a patient requiring treatment or prevention.
[0209] "Therapeutic effective amount" refers to the amount that, at the required dose and for the required duration, effectively achieves the desired therapeutic outcome. Therapeutic effective amount is also a amount in which any toxic or harmful effects of rAAV or the composition or combination are less than the beneficial therapeutic effect. Relative to an untreated subject, "therapeutic effective amount" preferably inhibits or improves a measurable parameter by at least about 40%, and more preferably at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or even 100%.
[0210] "Prophylactic effective dose" refers to the amount of medication administered at the required dose for the required duration to effectively achieve the desired preventive outcome. Typically, because prophylactic doses are administered to individuals before or at an early stage of the disease, the prophylactic effective dose will be less than the therapeutic effective dose.
[0211] The term "polynucleotide" refers to a polymeric form of nucleotides of any length, including deoxyribonucleotides or ribonucleotides or their analogues. Polynucleotides may contain modified nucleotides, such as methylated nucleotides and nucleotide analogues, and may be interrupted by non-nucleotide components. As used herein, the term polynucleotide may refer alternately to both double-stranded and single-stranded molecules.
[0212] The term "target nucleic acid" refers to nucleic acid to be transduced by recombinant AAV viral particles, which encodes, for example, preventive or therapeutic proteins, particularly proteins used to prevent or treat ophthalmic diseases. Attached Figure Description
[0213] Figure 1 shows the transduction activity and tissue fraction of novel AAV serotypes (RC-C14 series and RC-C07V5 series) in mouse eyes.
[0214] Figure 2 shows the characterization of various properties of the novel AAV serotypes (RC-C14 series) during the preparation process.
[0215] Figure 3 shows the spectra of different GOI plasmids.
[0216] Figure 4 shows a comparison of the expression efficiency of expression cassettes with different combinations of regulatory elements in the GOI plasmid at the HEK293T cell level.
[0217] Figure 5 shows the effects of different secretion signal peptides on VEGF trap expression and secretion at the cellular level.
[0218] Figure 6 shows that the VEGF trap protein expressed and secreted by AAV-infected cells can effectively compete with VEGF antibody for binding to VEGF165 protein and inhibit the downstream signal transduction activity of VEGFR1.
[0219] Figure 7 shows a comparison of the transduction and expression efficiencies of AAV molecules at the cellular level for different GOI plasmid combinations.
[0220] Figure 8 shows a comparison of the expression efficiencies of different gene expression cassettes in AAV molecules under hypoxic (1% O2) conditions.
[0221] AAV2.7m8-E04: A virus containing the capsid of GOI-E04 and AAV2.7m8 serotypes;
[0222] “C14-DX” indicates an AAV virus containing the capsid of GOI-DX and RC-C14 serotypes.
[0223] Figure 9 shows a comparison of the expression efficiency of different gene expression cassettes in AAV molecules under hypoxic (CoCl2 treatment) conditions, where "C14-DX" represents AAV viruses containing GOI-DX and RC-C14 serotype capsids.
[0224] Figure 10 shows a comparison of the expression efficiency of different gene expression cassettes in AAV molecules under hypoxic (CoCl2 treatment) conditions, where “C14V12-DX” represents AAV virus containing GOI-DX and RC-C14V12 serotype capsids.
[0225] Figure 11 shows the efficacy of AAV molecules in AMD genetic model mice, where *: p < 0.05, **: p < 0.01, ***: p < 0.001, ****: p < 0.0001;
[0226] AAV2.7m8-D02 or 7m8-D02: Viruses containing GOI-D02 and AAV2.7m8 serotype capsids;
[0227] C07V5-DX indicates an AAV virus containing the capsids of GOI-DX and RC-C07V5 serotypes;
[0228] C14-DX indicates an AAV virus containing the capsid of GOI-DX and RC-C14 serotypes;
[0229] C14V12-DX indicates an AAV virus containing the capsid of GOI-DX and RC-C14V12 serotypes. Example:
[0230] Example 1: Preparation and activity verification of novel AAV serotype (R) capsid protein and its variants
[0231] 1.1 Construction of RC-C14 and its series of serological capsid plasmids, and preparation of AAV
[0232] It is known that the main receptor for the AAV2 serotype capsid to enter cells is heparan sulfate glycoprotein (HSPG). It can also enter cells via integrins, FGFR, HGFR, LamR, AAVR, and other co-receptors (co-receptor-mediated entry is less efficient). This invention rationally designed RC-C02 (a two-point mutation I240T-V708I) based on AAV2.7m8. Further, through computer simulation of tissue-targeting short peptides, novel serotypes such as RC-C14 were screened. Compared to the RC-C02 capsid, RC-C14 has an insertion of 10 amino acids after the VP1 587 position (587-LALGDVTRPA). Further three-dimensional structural analysis of the RC-C14 capsid revealed that VP1... The integration of a decapeptide from the VIII variable region introduces a new targeting short peptide onto the surface of the AAV capsid protein, altering the original receptor-binding spatial structure. This creates a switch on the capsid that specifically binds to potential new receptors, while simultaneously weakening the binding activity of rAAV2 to HSPG. The biological characteristics of the new serotype (RC-C14) are: it can efficiently enter photoreceptors and melanocyte epithelial cells through binding to multiple receptors (the main binding receptor for heparin recognition receptor HSPG binding force), significantly improving transduction efficiency in in vitro cell lines and in vivo retinal tissues.
[0233] 1. Comparison of RC-C14 serotype with AAV2 VP1 capsid amino acids, specific information on variant sites: 587-LALGDVTRPA-588 and I240T-V708I. ARPE19 and 293T exhibited the strongest transduction activity in vitro.
[0234] Construction of RC-C02 serological capsid plasmid
[0235] The VP1 gene and downstream poly sequence of the AAV2 serotype plasmid pRC2 (a Genescript whole-gene synthesized pRC plasmid containing AAV2 serotype VP1 (SEQ ID NO:xx)) were completely digested with Swa I at 2033 bp and Sma I at 4348 bp to obtain a linearized vector. The AAV2 VP1 gene and downstream poly sequence were removed, and a 2375 bp SwaI / SmaI fragment containing RC-CO2 VP1 and downstream poly sequence was replaced by homologous recombination. This fragment was amplified by polymerase chain reaction (PCR). Using pRC2 plasmid as a template, PCR yielded four amplification products: (a) the upstream fragment of the I240T mutant region, with the 5' amplification primer being RC-CO2-F1, AACAATAAATGATTTAAATCAGGTATGG (SEQ ID NO:46), and the 3' amplification primer being RC-CO2-R1, GTGGTGGTGACTCTGTCGCCCATCCATG (SEQ ID NO:xx). (b) Inserted downstream of the I240T mutation region and upstream of the 10aa mutation region at the 588aa position, with the 5' end amplification primer being RC-C02-F2, ACAGAGTCACCACCACCAGCACCCGAACC (SEQ ID NO:57), and the 3' end amplification primer being RC-C02-R2, TTGTTGTTTCGCCGAGTGCTAGGTTGCCTCTCTGGAGGTTG (SEQ ID NO:58). (c) Inserted downstream of the 10aa mutation region and upstream of the V708I mutation region at the 588aa position, with the 5' end amplification primer being RC-C02-F3, TCGGCGAAACAACAAGACCTGCTAGGCAAGCAGCTACCGCAG (SEQ ID NO:59), and the 3' end amplification primer being RC-C02-R3, ACATTAATAGACTTGTTGTAGTTGGAAG (SEQ ID NO:60). (d) Downstream of the V708I mutant region, the 5' amplification primer was RC-C02-F4, ACAAGTCTATTAATGTGGACTTTACTGTGG (SEQ ID NO:61), and the 3' amplification primer was RC-C02-R4, GCTGTTTAAACGCCCGGGCTGTAG (SEQ ID NO:49). These four amplification products were bridged to obtain a 2375bp SwaI / SmaI fragment containing RC-C02 VP1 and a downstream poly sequence. The obtained capsid protein exhibits I240T-V708I relative to AAV2 VP1 (SEQ ID NO:xx).
[0236] Construction of RC-C14 serotype capsid plasmid
[0237] Based on the RC-C02 serotype capsid plasmid obtained by cloning above, the VP1 gene and downstream poly sequence of the pRC-C02 plasmid were completely digested with SwaI at 2033 bp and SmaI at 4378 bp to obtain a linearized vector. The cap gene and downstream poly sequence of AAV2 were removed, and a 2375 bp SwaI / SmaI fragment containing RC-C14 VP1 and downstream polyA sequence was replaced by homologous recombination. The fragment was amplified by PCR to obtain two fragment products of the RC-C02 plasmid: (a) E592D, upstream of the T593V mutation region, with the 5' amplification primer being RC-C02-F1, AACAATAAATGATTTAAATCAGGTATGG (SEQ ID NO:46), and the 3' amplification primer being RC-C14-R1, TCTTGTTACATCGCCGAGTGCTAGGTTGC (SEQ ID NO:47). (b) Downstream of the E592D, T593V mutation region, the 5' amplification primer was RC-C14-F2, TCGGCGATGTAACAAGACCTGCTAGGCAAG (SEQ ID NO:48), and the 3' amplification primer was RC-C02-R4, GCTGTTTAAACGCCCGGGCTGTAG (SEQ ID NO:49). Overlapping these two amplification products yielded a 2375bp SwaI / SmaI fragment containing pRC-C14 VP1 and a downstream poly sequence. The obtained capsid protein (SEQ ID NO:13) possesses I240T-V708I and the insert fragment LALGDVTRPA relative to AAV2 VP1 (SEQ ID NO:11).
[0238] Construction of RC-C14V12 serotype capsid plasmid
[0239] The difference between RC-C14V12 and RC-C14 is only one amino acid change, with M211 in the VP1 protein sequence changing to V (hereinafter referred to as M211V).
[0240] The RC-C08 plasmid (SEQ ID NO: 79) from patent number CN116970648A was double-digested with HindIII and SmaI to generate 4626bp and 2656bp fragments. The 4626bp fragment was recovered and used as a vector. Two fragments containing the RC-C14V12 site-directed mutation cap and the downstream poly sequence were replaced by homologous recombination. This fragment was amplified by polymerase chain reaction (PCR). Using the RC-C08 plasmid from patent number CN116970648A as the PCR template, amplification product a and the RC-C14 plasmid from patent number CN117247434B as the PCR template, two amplification products were obtained. (a) The amplification primer at the 5' end upstream of the mutation region was LRCV30-F1: TCGACGTCAGACGCGGAAGCTTCGATCAAC (SEQ ID NO: 79). (a) NO:77); the 3' end amplification primer is C08V19-R1: tgtctgccaCtggtgcgccactgcctgtag (SEQ ID NO:56); (b) downstream of the mutation region, the 5' end amplification primer is C08V19-F2: cgcaccaGtggcagacaataacgaggg (SEQ ID NO:62); the 3' end amplification primer is LRCV30-R2: CGCTGTTTAAACGCCCGGGCTGTAG (SEQ ID NO:78); the above two amplification products are overlapped to obtain a SmaI / HindIII fragment containing the RC-C14V12 site-directed mutation cap and a downstream poly sequence. The obtained capsid protein (SEQ ID NO:53) has I240T-V708I-M211V and the insert fragment LALGDVTRPA relative to AAV2 VP1 (SEQ ID NO:11).
[0241] 1.2. Construction of R C-C07 and its series of serum-type capsid plasmids, and preparation of AAV.
[0242] As described in CN117247434B, the following AAV9 serotype capsid plasmid was constructed and validated, and its activity was verified.
[0243] RC-C07-V1(SEQ ID NO:2): Replace amino acid sequence 584-598 of SEQ ID NO:1 with LQRGNRQAATADVNT.
[0244] RC-C07-V2(SEQ ID NO:3): Insert 588-LALGETTRPA-589 into SEQ ID NO:2.
[0245] RC-C07-V5(SEQ ID NO:4): Insert 588-LALGDVTRPA-589 into SEQ ID NO:2.
[0246] RC-C07-V7 (SEQ ID NO:5): I240T mutation performed on SEQ ID NO:4.
[0247] 1.3 AAV virus preparation method:
[0248] Different AAV capsid serotype plasmids were co-transfected into HEK293 cells with GOI plasmids (such as GOI-E04 and GOI-E10 prepared in Example 2) and Helper plasmids for 72 h. Cells and supernatants were then collected for chromatographic purification (affinity C chromatography and anion exchange chromatography) and aseptic filtration. AAV titers were determined using real-time quantitative PCR (qPCR) with a polyA probe to detect rAAV nucleic acid copy number. The specific preparation process is as follows:
[0249] First, resuscitate suspended HEK293F cells and passage them at a 1:5 ratio until an E6 / ml density is reached. Then, perform three-plasmid transfection. Before transfection, prepare a suitable transfection system, preferably as follows: 500 μl of serum-free Opti-MEM (Gibco) medium, 15 μg of Helper plasmid, 7.5 μg of the AAV capsid serum-type plasmid prepared above, 7.5 μg of GOI plasmid, and 22.5 μl of PEIpro (Polyplus). The third step of the transfection procedure is to add the transfection mixture dropwise to the cell culture flask and gently mix. The fourth step is packaging and culture: transfer the transfected cells to a CO2 culture shaker and culture at 37°C for 72 h. After lysis, add lysis buffer and lyse at 37°C on a shaker for 1 h. Centrifuge at 4000 rpm for 10 min using a horizontal rotor to collect the supernatant. Filter the supernatant through a 0.45 μm needle filter and then proceed with AAVX affinity column (Thermo) and anion exchange column (BIA). Sartorius 2-step chromatography was performed, and the final product was aseptically filtered through 0.22µm before aliquoting. The viral gene copy number (vg / ml) in the cells was detected by real-time quantitative PCR.
[0250] Viruses containing either GOI-E04 (a shuttle plasmid carrying the EGFP green fluorescent reporter gene) or GOI-E10 (a shuttle plasmid carrying the mScarlet red fluorescent reporter gene) and different AAV capsids were obtained, including AAV2, RC-C14, RC-C14V12, RC-C07V1, RC-C07V2, RC-C07V5, and RC-C07V7 capsid viruses.
[0251] 1.4 Comparison of transduction activity and tissue distribution of RC-C14 and its series and RC-C07V5 and its series in mouse eyes
[0252] In vivo autofluorescence (AF) detection method:
[0253] The procedure for in vivo autofluorescence (AF) detection is as follows: First, 6-8 week old C57 mice (provided by Jicui Biotechnology) that have completed the examination are examined (2 mice per group, 6 groups, intravitreal administration in both eyes; AF is examined in 4 eyes per group). After verifying the ear tags, mydriasis is achieved by instilling medication into the ocular surface of both eyes. Mice are anesthetized with a 60 mg / kg dose of acetaminophen mixture, and topical anesthetic is instilled into both eyes. Corneal contact lenses are then applied to the ocular surface. The HRA control panel of the examination device is switched to IR mode, and the mouse fundus is focused until the image is clear. Then, the device is switched to FA mode, the SENS value is adjusted to 100, the focus is adjusted until the retinal vessels are clearly visible, the SENS value is reduced to 60, and the image is taken, ensuring that the exposure intensity of the image is within a reasonable range.
[0254] Figures 1A-1B show a comparison of viral distribution and transduction activity in retinal tissue after intravitreal injection of four variant capsids of the RC-C07 series, RC-C14, and wild-type AAV2 serotype vectors via IVT. The six serotypes of the virus described above (AAV2, RC-C14, RC-C07V1, RC-C07V2, RC-C07V5, and RC-C07V7) were administered intravitreally. The transduction activity of rAAV-EGFP virus in retinal tissue was assessed 6 weeks after administration. The viral dose administered to each eye was E9 VG. In vivo autofluorescence imaging (BAF) was performed at 2, 4, and 6 weeks after administration to detect the fluorescence intensity of the left and right fundus of each mouse group. As shown in Figures 1A-1B, two weeks after IVT administration, spontaneous green fluorescence signals were detected in the fundus of mice corresponding to all four variant serotypes. The fluorescence signal was weakest in the AAV2 group, while the fluorescence signal in the RC-C14 group was slightly stronger than that of the other serotypes, but individual differences existed. After six weeks of administration, the fluorescence signals of the C07V1, C07V2, and C07V7 variants continued to increase with the duration of administration, while no significant increase was observed in the experimental control group (RC-C14). Statistical results of fluorescence area (Figures 1C and 1D) and average fluorescence intensity (Figures 1E and 1F) further indicate that after six weeks of intravitreal administration, the fundus fluorescence signals of mice in the RC-C07V2 and RC-C07V7 groups were significantly enhanced compared to four weeks, while the fundus fluorescence intensity and fluorescence area of mice in the RC-C07V5 group were comparable to those of the experimental control (RC-C14).
[0255] Six weeks after drug administration, eye samples were collected from mice, and frozen sections of the retinal tissue were subjected to immunofluorescence staining (red indicates RPE65 protein in the RPE cell layer or Opsin protein in photoreceptor cells; blue indicates DAPI-labeled cell nuclei; green fluorescence represents the autofluorescent protein expressed by the EGFP gene carried by rAAV-infected cells). Immunofluorescence images of mouse retinal tissue showed that, according to Figure 1G, except for the control group (AAV2), the other four variant serotypes (RC-C07V1, RC-C07V2, RC-C07V5, and RC-C07V7) could efficiently infect the inner retinal tissues (ganglionic cell layer, nerve fiber layer, and nuclear lamina). The tissue distribution of the variant serotypes can be clearly observed from the complete retinal image stitched together by the fully automated scanning and imaging equipment. Among them, the green fluorescent signal expressed by RC-C07V5 is most widely distributed and has the strongest fluorescence brightness in the inner retinal tissue. Further comparative analysis of the fluorescence of the outer retinal layer shows that the two variants, RC-C07V2 and RC-C07V5, can fully transduce the outer retinal retina, outer nuclear layer, and part of the inner segment of the photoreceptor layer (PR). This further indicates that after intravitreal injection, RC-C07V2 and RC-C07V5 can be widely distributed throughout the retinal tissue, and the fluorescence brightness is significantly enhanced compared with the control group AAV2. The penetration power of RC-C07V2 into the internal limiting membrane (ILM) is higher than that of wild serotype (AAV2).
[0256] Figures 1H and 1I show a comparison of viral distribution and transduction activity in retinal tissue between the capsids of two variants of the RC-C14 series and the wild-type AAV2 serotype vector via intravitreal transfusion (IVT). The three serotypes of the virus described above (AAV2, RC-C14, and RC-C14V12) were administered intravitreally. The transduction activity of rAAV-mScarlet virus in retinal tissue was assessed 6 weeks after administration. The viral dose per eye was 1E9 VG. In vivo autofluorescence imaging (BAF) was performed at 2, 4, and 6 weeks after administration to detect the fluorescence intensity of the fundus in both eyes of each group of mice (Figure 1H). Figure 1H shows that two weeks after IVT administration, autofluorescence signals were detectable in the fundus of mice corresponding to all three serotypes. The fluorescence signal was weakest in the AAV2 group, while the fluorescence signals in the RC-C14 and RC-C14V12 groups were similar and stronger than those of AAV2. Four and six weeks after administration, the fluorescence signals of the three serotypes continued to increase with the extension of administration time. The fluorescence signals of the RC-C14 and RC-C14V12 administration groups were similar and stronger than those of AAV2.
[0257] Six weeks after drug administration, eye samples were collected from mice, and frozen sections of the retinal tissue were subjected to immunofluorescence staining (red indicates autofluorescent protein expressed by the mScarlet gene carried by rAAV-infected cells; blue indicates DAPI-labeled nuclear DNA; and green indicates Rhodopsin protein from photoreceptor cells). Immunofluorescence images of mouse retinal tissue (Figure 1I) show that, with intravitreal injection via IVT, RC-C14 and RC-C14V12 effectively infected the inner retinal tissues (ganglionic cell layer, nerve fiber layer, and nuclear lamina), except for the control group (AAV2). The tissue distribution of the variant serotypes was clearly observed in the large, stitched image of the complete retina obtained using an automated scanning device, and the red fluorescence signals expressed by RC-C14 and RC-C14V12 showed similar distribution and fluorescence intensity in the inner retinal tissues.
[0258] 1.5 Comparative characterization of novel AAV serotypes (RC-C14 and its series) during the preparation process
[0259] Affinity chromatography (AF) is a commonly used method for purifying AAV virus based on the interaction between biomolecules. It specifically binds to AAV to achieve efficient purification, and the A260 / 280 ratio after affinity (AF) can also indirectly reflect the solidity of the virus; the higher the value, the higher the solidity.
[0260] During the preparation and purification process, viruses may form some product-related impurities, molecular variants with different activities, efficacy and safety from the desired product, including empty shells, aggregates or other defective viral particles. These variant viral particles may impair or even competitively inhibit the transduction activity of viral vectors.
[0261] The literature (Characterization of Adeno-Associated Virus Capsid Proteins with Two Types of VP3-Related Components by Capillary Gel Electrophoresis and Mass Spectrometry. Hum Gene Ther. 2021 Nov; 32(21-22):1403-1416.) reported the evaluation of VP components of serum AAV1, AAV2, and AAV6 by capillary gel electrophoresis (CGE) and liquid chromatography-ultraviolet-mass spectrometry (LC-UV-MS). It was found that VP3-related components were divided into two categories: VP3 truncated fragments and VP3 intact fragments. Furthermore, the VP3 truncated fragments were identified as the minor peaks before VP3 in the HPLC chromatogram. The VP3 truncated fragments are VP3 with a shorter N-terminus, and their translation starts at M211 instead of the traditional start codon M203. Previous literature only identified VP3 truncated variants in different serotypes, without designing or addressing the VP3 truncated variants in AAV vectors of different serotypes. Furthermore, it failed to address the impact of the presence of VP3 truncated variants on viral activity and stability. Numerous experiments have revealed for the first time that an increased proportion of AAV VP3m truncated variants affects capsid infectivity and stability, particularly in variants of AAV1, AAV2, AAV6, and AAV9. When VP3m dominates in the capsid, activity significantly decreases. These potential problems and challenges necessitate rational design and targeted modification of the VP3-N-terminus of different serotypes to improve AAV capsid stability, thus providing more possibilities for enhancing the performance and clinical application of gene therapy vectors.
[0262] The RC-C14V12 serotype is based on a rational design that optimizes the natural VP3m truncated variant. The M211 in the RC-C14 VP1 capsid protein sequence is changed to V (M211V) to avoid the possibility of VP3m truncated variant formation.
[0263] The properties of the VP component in the purified RC-C14 series were analyzed using the following method.
[0264] Specific steps: (1) The present invention uses the AAV2 Xpress ELISA kit (PROGEN, A23007) to detect VP of RC-C14 and RC-C14V12, and analyzes the ratio of the number of viral particles (VP) determined by enzyme-linked immunosorbent assay (ELISA) to the number of genome copies determined by digital droplet polymerase chain reaction (ddPCR).
[0265] (2) Size exclusion chromatography (SEC-HPLC) for the detection of aggregates: The mobile phase was 10 mM NaH2PO4, 10 mM Na2HPO4, 350 mM KCl, pH 6.6, the flow rate was 0.3 ml / min, the injection volume was 10 μl, and the absorption peaks (260 nm and 280 nm) and fluorescence (excitation at 280 nm and emission at 348 nm) were detected.
[0266] (3) Infectivity titer (IU): On Day 1, 293T cells were seeded in 96-well plates at a density of 1E4 cells / well. On Day 2, when the cell confluence was approximately 50%, AAV virus was serially diluted using complete culture medium at the following dilution factors: 1×10⁻⁶. -2 =990μL of diluent+10μL of stock 1×10 -3 =900μL of diluent+100μL of previous dilution 1×10 -4 =900μL of diluent+100μL of previous dilution 1×10 -5 =900μL of diluent+100μL of previous dilution 1×10 -6 =900μL of diluent+100μL of previous dilution 1×10 -7 =900μL of diluent+100μL of previous dilution
[0267] After aspirating the complete culture medium, add 100 μL of virus-diluted culture medium (8 wells per dilution) and incubate at 37°C in a 5% CO2 cell culture incubator for 72 hours. Observe the autofluorescence of mScarlet using a microscope.
[0268] (4) Capillary gel electrophoresis (CE-SDS): Capillary gel electrophoresis (CE-SDS) utilizes the molecular sieving effect of polyacrylamide gel and SDS (sodium dodecyl sulfate) to eliminate differences in spatial structure and charge between different proteins. Under an electric field, proteins are separated according to their molecular weight, thereby achieving the purpose of detecting sample purity. It has higher sensitivity and resolution and can evaluate the VP component of AAV vectors. Take 100 μL of the virus to be tested, add 10 μL of 3% SDS and 10 μL of β-ME, vortex to mix, and heat at 90℃ for 10 min for lysis and denaturation. After the sample cools, take it out and put it into a 10 kD centrifugal filter device, make up to 500 μL with ultrapure water, centrifuge at 14000 rpm / min for 10 min, concentrate twice by ultrafiltration and collect the filtrate. Add 5 μL of 3% SDS and 0.2 μL of 10 kD internal standard to the collected liquid, vortex to mix thoroughly and centrifuge briefly, and put it into a sample vial for loading. Preparation of blank solution: Use the corresponding formulation buffer as a blank control, and perform the same procedures as above. Column temperature: 25℃, run for 40 min.
[0269] The results are shown in Figure 2. Compared with RC-C14, the VP3 truncated content of RC-C14V12 decreased significantly (3.22 times, Figure 2b). Meanwhile, CE-SDS analysis showed that the VP1:VP2:VP3 ratio of RC-C14 was 1:1:6, while that of RC-C14V12 was 1:1:6.9. Due to the reduction in VP3m truncated content, the relative ratio of VP3 in RC-C14V12 was increased compared with RC-C14 (Figure 2e). Furthermore, the presence of AAV aggregates may reduce the viral infectious titer, thereby reducing product efficacy. Aggregates can be detected by size exclusion chromatography (SEC-HPLC). The results are shown in Figure 2c, where the aggregate content of RC-C14V12 decreased significantly (2.74 times) compared with RC-C14.
[0270] Infectivity titer (IU, infection units) indicates the total number of infectious viral particles in a product. For AAV virus, infectious titer is a key parameter for assessing the quality of vector activity. As shown in Figure 2d, the infectious titer of RC-C14V12 is significantly increased by approximately 1.38 times compared to RC-C14.
[0271] In summary, compared with RC-C14, RC-C14V12 significantly reduced the proportion of VP3m truncated bodies and aggregates in AAV products, and improved the solidity and in vitro cell infection activity of AAV.
[0272] Example 2. Comparison of expression efficiency of expression cassettes with different combinations of regulatory elements in GOI plasmid at the HEK293T cell level.
[0273] First, several GOI plasmids with different combinations of promoters and introns were constructed. The VEGF trap coding sequence shown in SEQ ID NO:17 was used, with optimizations made to the percentage of CpG sequence and human codons. An Ig kappa chain was used to secrete the signal peptide (SEQ ID NO:44).
[0274] The construction of multiple GOI plasmids employed different combinations of promoters and auxiliary regulatory elements (specific sequences and names are listed in Table 1, "GOI Plasmid Information" appendix), including...
[0275] L-ITR;
[0276] Enhancers: For example, the CMV enhancer (SEQ ID NO:42);
[0277] Sequences that activate and inhibit hypoxia stress (SE, HRE sequences and combinations, VEGFA prmt1 promoter), such as 3SE-5HRE (SEQ ID NO:34);…
[0278] Intron: VEGFA 5'-UTR (SEQ ID NO:39), and / or synthetic chimeric introns (long chimeric intron: UBC-CAG chimeric intron, SEQ ID NO:32, short chimeric intron: SEQ ID NO:36);
[0279] Promoters: hBEST1 retinal epithelial cell-specific promoter (SEQ ID NO:35, D62 and D64), VEGFA prmt seq 1 promoter (SEQ ID NO:38), UbC promoter (based on GOI-D02 in patent application #2023115138935, SEQ ID NO:31);
[0280] Target nucleic acid: VEGF Trap, whose amino acid sequence is SEQ ID NO:16 and whose encoding nucleic acid sequence is SEQ ID NO:17; or EGFP reporter gene, whose amino acid sequence is SEQ ID NO:41 and whose encoding nucleic acid sequence is SEQ ID NO:40; the signal peptide in the VEGF Trap containing the signal peptide is the signal peptide from the Ig kappa chain (SEQ ID NO:18); or mScarlet reporter gene, whose amino acid sequence is SEQ ID NO:63 and whose encoding nucleic acid sequence is SEQ ID NO:64.
[0281] Polyadenylation signaling, such as hGH polyAsignal (SEQ ID NO:33);
[0282] Other regulatory signal sequences (e.g., MAR5, SEQ ID NO:37);
[0283] L-ITR.
[0284] The plasmid information for different GOIs is shown in Figure 3 and Table 1.
[0285] HEK293 suspension cells were transfected with the GOI plasmid, AAV capsid plasmid RC-C14, and helper plasmid of different designs described above for AAV virus packaging and purification (two-step purification using AAV affinity chromatography and anion exchange chromatography). The purified virus was used for infection and expression detection in HEK293T cells.
[0286] First, we tested the expression of the target gene after single plasmid transfection. HEK293T (abbreviated 293T) cells were seeded at 4E5 / well in 24-well plates and cultured normally. The next day, 0.5 μg of plasmid was transfected into the cells using Lipofectamine 3000 (Thermo). After culturing for 48 or 72 h, cells and supernatants were collected. The expression of VEGF trap in the supernatant and cells was detected by non-denaturing Western blotting using HRP horseradish peroxidase-labeled goat anti-human IgG (H+L) (YEASEN). Simultaneously, the expression of internal controls in the cells was detected using β-actin (ProteinTech) or GAPDH antibody (ProteinTech). The control (con) was a negative control without AAV transfection.
[0287] As shown in the Western blot results in Figure 4, all plasmids designed with expression cassettes could be transfected into HEK293T cells and expressed VEGF-trap protein to varying degrees, with a considerable amount being secreted into the cell supernatant. Among them, the RPE cell-specific promoter hBEST1 (D62, D64) showed the weakest relative expression in HEK293T cells, while the broad-spectrum promoters derived from Ubiquitin C (D75 and D76) showed higher expression, and the expression of the regulated broad-spectrum promoter derived from the VEGFA gene was intermediate between the two. Simultaneously, we observed that the addition of VEGFA 5'-UTR (D68, D70, D73, D74) better facilitated the expression of the target gene protein by the VEGFA promoter prmt1 than using the chimeric intron (D66) alone, and the chimeric intron was not necessary in the presence of VEGFA 5'-UTR; the 5' enhancers (D73 and D74 vs. D68) further enhanced the expression of the target gene.
[0288] Example 3: Construction and verification of VEGF trap molecules
[0289] The VEGF-trap was linked to different signal peptides (signal peptide from the Ig kappa chain (SEQ ID NO:18) and signal peptide from VEGFR1 (SEQ ID NO:19, see CN112342228A)) to construct the GOI plasmid. The plasmid construction method was the same as that of GOI-D02, except that the VEGF-trap was linked to the Ig Kappa chain signal peptide (SEQ ID NO:18) and the VEGFR1 signal peptide (SEQ ID NO:19) at the N-terminus, respectively.
[0290] HEK293 suspension cells were transfected with GOI plasmids containing different signal peptides, wild-type AAV2 capsid plasmids, and helper plasmids for AAV virus packaging and purification (two-step purification using AAV affinity chromatography and anion exchange chromatography). The purified virus was used for infection and expression detection in HEK293T cells.
[0291] 293T cells were seeded at a rate of 4E5 / well into 24-well plates and cultured using standard methods. The following day, based on the cell count in the wells and the calculated amount of AAV required per well according to different MOIs (3000 VG / cell), the required AAV was added to the cells for infection. Cells were cultured for another 72 hours, and the cell and supernatant suspension was collected.
[0292] VEGF trap expression was detected by non-denaturing SDS-PAGE and Western blotting (using HRP horseradish peroxidase-labeled goat anti-human IgG (H+L)). Purified virus was used to infect HEK293T cells at different MOIs (0, 300, 1000, 3000, 10000 VG / cell) and cultured for 72 h. Cells and supernatants were then collected. VEGF trap expression and its intracellular and extracellular distribution were detected by non-denaturing SDS-PAGE and Western blotting (using HRP horseradish peroxidase-labeled goat anti-human IgG (H+L) (YEASEN)).
[0293] The Western blot (WB) in Figure 5 shows that both the Ig kappa chain and VEGFR1 signal peptides can help express and secrete VEGF trap protein, but the Ig kappa chain and VEGFR1 signal peptides show superior expression. The total VEGF trap expression level in cells transduced with the Ig kappa chain secreted peptide is approximately 1.86 times that in cells carrying the VEGFR1 secreted peptide (the black triangles in Figure 5, from thin to thick from left to right, correspond to the fold increases of 2.78, 2.29, 1.47, and 1.28 times for each AAV gradient of 300, 1000, 3000, and 10000 VG / cell, respectively). Based on the MOI and expression level, the amount of virus carrying the Ig kappa chain signal peptide required to express a comparable amount of VEGF trap protein is only 1 / 3 of that required for the VEGFR1 signal peptide, significantly improving expression efficiency and reducing viral load. Meanwhile, the ratios of extracellular and intracellular secretion of VEGF trap protein carried by the expression vector containing Ig kappa chain and VEGR1 signal peptides were 2.47 and 2.08, respectively, suggesting that the Ig kappa chain secretory peptide can promote the extracellular secretion of VEGF traps. The extracellular secretion of biologically active VEGF traps produced by the Ig kappa chain secretory peptide was 1.96 times that of the VEGFR1 secretory peptide (2.50, 2.30, 1.48, and 1.15 times for 300, 1000, 3000, and 10000 VG / cell in Figure 5, respectively).
[0294] The results in Figure 5 suggest that signal peptides derived from Ig kappa chain have a greater advantage in the expression and secretion of VEGF traps.
[0295] HEK293T cells (MOI: 5000 VG / cell) were infected with the recombinant virus (GOI-D02, with the signal peptide of the Ig Kappa chain) prepared above. After 72 hours, the supernatant sample was collected, and the VEGF trap protein in the supernatant was concentrated using an Amicon Ultra centrifugal filter. The concentration of the expressed VEGF trap protein was quantified by Western blotting.
[0296] VEGF165 (one of the most common VEGFa protein isoforms) competitive binding ELISA assay: The free VEGF165 content was detected using an ELISA kit to determine the amount of VEGF165 bound to VEGF trap protein, thus reflecting the activity of secreted VEGF trap protein. Aflibercept was used as a control. The assay was performed according to the manual of the Human VEGF165 ELISA Kit (Sinobiological, KIT11066), using 2 ng / mL VEGF165 protein. The experimental results are shown in Figure 6A.
[0297] The competitive activity of VEGF165 was detected using H_VEGF Reporter 293 cells (GM-C09057, Jiman Biotechnology): VEGF165 binds to the surface VEGFR receptor of H_VEGF Reporter 293 cells, promoting luciferin expression in the cells. When VEGF165 is bound to VEGF trap protein expressed and secreted by recombinant AAV-infected cells, luciferin expression in H_VEGF Reporter 293 cells decreases. Therefore, detecting luciferin expression levels can reflect the activity of VEGF trap protein. Aflibercept was used as a control.
[0298] Experimental results:
[0299] Figure 6 shows the competitive binding of the protein molecules expressed and secreted by AAV2 / GOI-D02 after infection of HEK293T cells to VEGFA in vitro (Figure 6A) and their inhibitory effect on the cellular bioactivity of its downstream (VEGFR) pathway (Figure 6B). Compared with aflibercept as a control, the VEGF trap protein expressed and secreted after transduction of cells by the recombinant molecule showed superior in vitro binding affinity and bioactivity. The mean IC50 values of the VEGF trap protein expressed by AAV2 / GOI-D02 and aflibercept in the ELISA assay for competitive binding to VEGF165 in vitro were 9.6 and 33.6 pM, respectively; and the mean IC50 values in the assay based on the H_VEGF Reporter 293 cell reporter gene were 242.95 and 496.0 pM, respectively. This also demonstrates that the VEGF trap encoded by GOI-D02 has good VEGFA binding and inhibition of its interaction with VEGFR (Figure 6A) and downstream cell signaling (Figure 6B). This bioactivity advantage may be due to the increased GPG linker peptide in the protein encoded by GOI-D02, which further improves the stability of the protein molecule.
[0300] Example 4: Comparison of transduction and expression efficiency of AAV molecules carrying different GOI plasmid combinations at the cellular level
[0301] As described in the preparation method, HEK293 suspension cells were transfected with GOI plasmids of different designs and Rep / Cap(RC) capsid plasmids such as the RC-C14 series or RC-C07V5 series mentioned above, along with helper plasmids, for AAV virus packaging and purification (two-step purification using AAV affinity chromatography and anion exchange chromatography).
[0302] The purified virus was used for infection and expression detection in HEK293T (ATCC) or the human retinal epithelial cell line ARPE19 (Gift from Jiaotong University). HEK293T cells or ARPE19 cells were seeded at 4E5 / well in 24-well plates and cultured normally. The next day, based on the cell count in the wells and the calculated amount of AAV required per well according to different MOIs (VG / cell), the required AAV was added to the cells for infection. After 72 hours of culture, cells and supernatant were collected. Non-denaturing Western blotting was used to detect VEGF trap expression in the supernatant and cells using HRP-labeled goat anti-human IgG (H+L) (YEASEN). Simultaneously, β-actin antibody (ProteinTech) was used to detect the expression of internal controls in the cells.
[0303] As shown in Figure 7A, under HEK293T infection with the same MOI, the molecular combinations of GOIs carrying D60, D66, D68, and D70 in the RC-C14 AAV vector were compared. In the figure, Con represents the negative control group without any AAV infection. It can be observed that D68 and D70 with VEGFA5'-UTR showed relatively better expression and secretion of VEGF traps than D60 and D66 with only short chimeric introns; comparatively, D68 was slightly better than D70 (with the 3'MAR5 sequence).
[0304] Then, RC-C14 / GOI-D68 was compared with the regulated GOI molecules D74 and D76, as well as the broadly highly expressed GOI-D02. As expected, the transcriptional enhancer and VEGFA5'-UTR effectively enhanced the expression of the target gene (D74 vs. D68). Furthermore, after adding the oxygen-responsive HE-HRE combination element before the strong, broadly responsive promoter Ubc, D76 was expressed lower than D02 under normoxic conditions. These results were consistent with the design expectations. Similar conclusions were also drawn in the transduction experiments of ARPE19 in human retinal epithelial cells (Figure 7B, left).
[0305] In addition, we compared the transduction and expression of the weak promoter GOI-D68 in ARPE19 cells under different AAV vectors (RC-C07V5 and RC-C14) (Figure 7B, right panel). Under the same MOI, the secretory expression of VEGF trap protein was similar. C07V5 as a vector may have slightly higher transduction efficiency than RC-C14. These results are consistent with the in vitro and in vivo results in "Example 2".
[0306] In addition, we compared the transduction and expression of GOI-D76 in HEK293T cells under different AAV vectors (RC-C14 and RC-C14V12) (Figure 7C). Under the same MOI, the intracellular expression and secretion of VEGF trap protein were similar.
[0307] Example 5: Comparison of expression efficiency of different gene expression cassettes in AAV molecules under hypoxic (1% O2) conditions.
[0308] Hypoxia is a recognized pathogenic microenvironment in the course of AMD. With the aging process or the deterioration of other environmental factors, retinal cells will experience different degrees of hypoxic stress response, including increased activity of hypoxic stress factors such as HIF1, which will induce increased expression of factors such as VEGFA (VEGFA promoter), resulting in pathological proliferation and leakage of new blood vessels. The O2 content in normoxic conditions is about 21%, and reducing the O2 concentration using hypoxic chambers or hypoxic incubators is one of the conventional hypoxia modeling methods. ARPE19 cells treated with 1% O2 for 12, 24, 36, and 48 h can promote the expression of VEGFAmRNA, which is time-dependent [1]. In addition, 1% O2 treatment for 24 h can promote the transduction efficiency of AAV in pulmonary artery endothelial cells [2] and 293T cells [3]. In myocardial infarction model mice, AAV transduction efficiency is higher in the myocardial ischemia area than in the non-ischemic area [4]. To confirm that the designed regulatory elements can indeed respond to hypoxic microenvironments similar to AMD, we compared the transduction and expression of these molecules in an in vitro cell system using a hypoxic chamber with 1% O2.
[0309] First, we tested the expression of the EGFP reporter gene (encoding nucleic acid: SEQ ID NO: 40) carried by different promoters under 1% O2 conditions, as shown in Figure 8A. ARPE19 cells were seeded at 2E5 / well in 24-well plates and cultured normally. The next day, based on the number of cells in the wells and calculating the amount of AAV required per well according to MOI = 1000 or 3000 VG / cell, the required AAV was added to the cells for infection. Cells were collected after 24 hours of culture, and the EGFP positivity rate and fluorescence intensity were detected by flow cytometry. GOI-E04 is an EGFP reporter gene carried by the strong broad-spectrum promoter CAG, which maintains high but similar cell transduction rates and EGFP expression intensity under both normoxic and hypoxic conditions. However, although GOI-D71 and (which has the same VEGFA prmt1 promoter as D68 but carries an EGFP reporter gene) showed low expression levels, they exhibited increased cell transduction (1.5X and 1.32X) and EGFP fluorescent protein expression intensity (1.45X and 1.45X) under hypoxic conditions in both MOIs. This is consistent with the expectation that hypoxia can promote the activity of the VEGFA gene-derived prmt1 promoter, thereby enhancing the expression of the target gene.
[0310] Under similar cell culture conditions, we observed the expression of various regulated GOIs (carrying the target gene VEGF trap) under hypoxic conditions (Figures 8B and 8C). ARPE19 cells were seeded at 2E5 / well in 24-well plates and cultured normally. The next day, based on the number of cells in the wells and calculating the amount of AAV required per well at MOI = 10000 VG / cell, the required AAV was added to the cells for infection. After 72 h of culture, the medium was replaced with fresh complete medium, and the cells were placed in a hypoxic chamber and cultured at 1% O2, 5% CO2, and 37°C for another 24 h. Cells were collected after 24 h of hypoxic intervention. A portion of the cells were used to collect cellular RNA for reverse transcription using Trizol, followed by qPCR detection of VEGFa and VEGF trap mRNA expression levels (Figure 8B, primers are shown in Table 2). The other portion of cells was used to collect cells and supernatant after 24 h of hypoxic intervention. The expression of VEGF traps in the supernatant and cells was detected by non-denaturing Western blotting using HRP-labeled goat anti-human IgG (H+L) (Figure 8C). As expected, under hypoxic conditions, we generally observed increased transcriptional regulation of VEGFa (2.1–4.4X), which is consistent with the changes in the microenvironment that induces AMD. Simultaneously, we observed varying degrees of transcriptional increase in the modulotropic GOI molecules (D68, D74, D76) (increased by 4.68X, 1.70X, and 2.35X, respectively), comparable to the increase in VEGFa (Figure 8B). This regulation aligns with the technical design of this patent, increasing VEGF trap expression in response to the elevated expression of the AMD microenvironment and target genes, thereby better adaptively inhibiting pathological VEGFa activity. In contrast, the broad-spectrum promoter D02 molecule did not show expression promotion in response to hypoxia, but rather maintained a high expression level. Consistent with changes in RNA transcription levels, we observed an increase in the expression and secretion of corresponding proteins under hypoxic conditions (Figure 8C, D68, D74, and D76 showed extracellular VEGFtrap secretion increases of 2.78X, 1.24X, and 1.30X, respectively; and intracellular VEGFtrap increases of 4.54X, 1.40X, and 1.49X, respectively). These data demonstrate that the combination of gene expression regulatory elements designed in this invention can enhance VEGF trap protein expression and promote the inhibition of pathological VEGFA under conditions of hypoxia-related environmental changes (increased expression of the major pathogenic gene VEGFA).
[0311] Table 2. RT-PCR primers
[0312] Example 6: Comparison of expression efficiency of different gene expression cassettes in AAV molecules under hypoxic (CoCl2 treatment) conditions.
[0313] Cobalt chloride (CoCl2) can directly replace Fe in heme. 2+ CoCl2 prevents heme from binding with oxygen and inhibits the degradation of intracellular HIF-1α, making it a commonly used hypoxia inducer in in vitro and in vivo experiments. Primary human RPE cells treated with CoCl2 showed increased expression of HIF-1α and VEGFa mRNA [5]. In C57BL / 6J mice, intraperitoneal injection of CoCl2 simulated hypoxia, which induced enhanced AAV transduction efficiency in RPE [6]. We also used CoCl2 treatment as different hypoxia induction models to confirm the regulatory nature of our design system.
[0314] First, we observed the expression of various modifiable GOIs (carrying the target gene VEGF trap) in human retinal pigment epithelial cells ARPE19 under CoCl2-induced hypoxia (Figures 9A and 9B). The procedure was as follows: ARPE19 cells were seeded at 2E5 / well in 24-well plates and cultured normally. The next day, based on the number of cells in the wells and calculating the required amount of AAV per well at MOI = 10000 VG / cell, the required AAV was added to the cells for infection. After culturing for 72 h, the medium was replaced with fresh complete medium containing CoCl2 (0, 50, 100 μM), and cultured for another 48 or 72 h. Cells and supernatant were collected after 48 or 72 h of CoCl2 intervention. A portion of the cells were used to collect cellular RNA for reverse transcription using Trizol, followed by qPCR detection of VEGFa and VEGF trap mRNA expression levels (Figure 9A). Another portion of cells and supernatant were analyzed by non-denaturing Western blotting using HRP-labeled goat anti-human IgG (H+L) to detect VEGF trap expression in the supernatant (Figure 9B).
[0315] As expected, under CoCl2-induced hypoxia (simulating the AMD lesion microenvironment), we generally observed increased transcriptional regulation of VEGFA (2.73-4.7X in cells treated with 50 μM CoCl2, and 2.34-5.21X in cells treated with 100 μM CoCl2), with no significant difference between the two CoCl2 concentrations. Simultaneously, we observed varying degrees of transcriptional increase in the modulotropic GOI molecules (D68, D74, D76) designed in this technique (9.71X, 3.05X, and 2.86X in cells treated with 50 μM CoCl2, and 5.84X, 3.25X, and 3.26X in cells treated with 100 μM CoCl2, respectively). The increase in transcriptional expression was roughly equivalent to the increase in VEGFA (Figure 9A). This regulation aligns with our design expectations, enhancing the VEGF trap after targeting the AMD microenvironment and target genes to better adaptively inhibit pathological VEGFA activity. In contrast, the broad-spectrum promoter D02 molecule did not show a promoting effect on hypoxia, but maintained a high expression level.
[0316] Corresponding to the changes in RNA transcription level, we observed corresponding changes in protein expression level. The broad-spectrum promoter DO2 molecule did not show VEGF trap protein induction expression under hypoxia conditions, but remained at a high level. The designed regulated GOI molecules (D68, D74, D76) all showed corresponding induction expression and secretion (1.35-3.34X, WB gray quantification) under CoCl2 induction treatment (Figure 9B).
[0317] In addition, we tested whether GOI-D71 (which has the same promoter as D68 but carries an EGFP reporter gene) could have the same expression regulation in the eyes of CoCl2-treated mice (Figure 9C). Six 6-8 week old male C57BL / 6 mice (from Jicui Pharmaceutical Technology Co., Ltd., Figure 9C shows an example mouse) were injected with 1 μL of C14-D71 (1E8 VG / eye) via IVT, and the day of injection was recorded as Day (-28). 20 mg / kg CoCl2 was injected intraperitoneally on Days 0, 2, and 4, and eyeballs were harvested on Day 7. The eyeballs were fixed, dehydrated, sectioned, and stained to observe the range and intensity of EGFP expression. Under hypoxic conditions (CoCl2 treatment), we observed that RC-C14 / GOI-D71 could transduce the retina and showed enhanced GFP expression, consistent with the expected activation-enhanced expression under hypoxic conditions.
[0318] Similarly, we tested whether the modulotropic GOI-D76 expression was similarly regulated in the eyes of CoCl2-treated mice (Figure 10). 4-8 week old vldlr - / -Mutant mice (8 mice from Jicui Pharmaceutical Technology Co., Ltd.) were injected with 1 μL of C14V12-D02 or C14V12-D76 (3E7 VG / eye) via IVT. The day of injection was recorded as Day (-28). On Days 0, 2, and 4, mice were injected intraperitoneally with 20 mg / kg CoCl2. Eyeballs were harvested on Days 0 and 14. The cornea and lens were removed from the eyeballs, leaving the optic cup. After grinding, optic cup DNA and RNA were obtained using a DNA & RNA co-extraction kit (Tiangen, DP422). The copy number of VEGF trap DNA was detected by direct qPCR, and the copy number of VEGF trap mRNA was detected by qPCR after reverse transcription of RNA. The AAV transcription efficiency was determined by dividing the total VEGF trap mRNA copy number by the total VEGF trap DNA copy number. The results showed that compared with the saline control group, the relative transcription efficiency of RC-C14V12 / GOI-D76 increased by 3.35X under hypoxic conditions (CoCl2 treatment), while the transcription efficiency of RC-C14V12 / GOI-D02 did not increase. This indicates that GOI-D76 can be activated and enhanced under hypoxic conditions as expected, which is more in line with the drug dosage requirements under pathological changes. Meanwhile, Day 0 results showed that the relative transcription efficiency of C14V12-D02 was higher than that of C14V12-D76 (approximately 1.77X), while Day 14 results under hypoxic conditions (CoCl2 treatment) showed that the transcription efficiency of C14V12-D02 was basically the same as that of C14V12-D76 (~1.14X). This is consistent with the results of Examples 5 and 6, indicating that the expression of regulated VEGF traps can be adjusted according to the severity of the pathology, while maintaining a relatively low expression level in a relatively normal microenvironment, reducing cell load and potential side effects of drug overexpression.
[0319] Example 7: Efficacy of different AAV molecules in AMD genetic model mice
[0320] To confirm that the designed, tunable AAV-VEGF trap molecule could achieve the desired expression and efficacy in vivo, we used vldlr. - / - Mutant mice (Number 3 per group, Jiangsu Jicui Yaokang Biotechnology Co., Ltd.) were used as a small genetic model of AMD. Very-low-density lipoprotein receptor (VLDLR) knockout mice (VLDLR) were also used. - / - Progressive retinal angiogenesis can be observed as early as 12-13 days after birth. The new blood vessels originate within the retina and progress towards the photoreceptors, subretinal space, and choroid, leading to RPE damage and Bruch's membrane exposure, ultimately resulting in photoreceptor death [7]. Currently, vldlr... - / -Mice are considered a classic model of retinal angiomatous proliferation (RAP), a type of wet AMD [8,9]. Regarding the location of the angiogenesis, vldlr - / - The model covers various types of AMD. Furthermore, compared to acute induction models (such as laser-induced choroidal neovascularization models), VLDLR... - / - It is more suitable as a chronic disease model (simulating clinical AMD as an age-related chronic disease) for long-term efficacy studies.
[0321] Fundus fluorescein angiography (FFA):
[0322] Dilute sodium fluorescein stock solution 10 times for later use. General anesthesia was administered via intraperitoneal injection. Mydriasis was achieved with 0.5% compound tropicamide eye drops (Medoli), and local anesthesia was achieved with 0.4% oxybuprocaine hydrochloride eye drops (Beinox). After complete anesthesia, contact lenses were fitted to the mice, and they were placed on the operating table of the confocal laser-synchronized angiography (HRA) system. 0.1 mL of 10% diluted sodium fluorescein solution was subcutaneously injected into each mouse. The HRA system was set to FA mode and timing was started. Fundus fluorescence imaging was completed within 5-15 minutes after sodium fluorescein injection, aiming to capture angiography of all choroidal neovascularization and panretinal neovascularization (NV) lesions formed in VLDLR gene mutant mice.
[0323] Analysis of neovascularization and leakage lesions:
[0324] Due to the varying angles formed between the mouse's visual pathway and the contact lens worn on the eye and the laser beam, the results of each fluorescein angiography (FFA) scan in mice differ, leading to inconsistent image brightness. Therefore, the brightness of the images was first adjusted using ImageJ software. While maintaining consistent instrument parameters, a single image with moderate retinal arterial and venous brightness was selected as a reference. ImageJ's color selection and adjustment functions were then used to adjust the brightness of the remaining images accordingly, ultimately achieving similar brightness across all images of the central retinal vessels. Since neovascularization lesions in VLDLR- / - mice are distributed across the entire retinal and choroidal layers, monofocal FFA imaging makes it difficult to grade and assess the severity of different lesions. Therefore, a total assessment and comparison of all observable lesions was performed.
[0325] First, we compared wild-type and vldlr. - / - Protein levels of VEGFA in the vitreous humor and optic cup of mice (Figure 11A). VLDLR samples were collected from 12-week-old mice.- / - The cornea and lens of mice and WT mice were removed. The remaining optic cup tissue and cavity fluid mixture was added to 100 μL of PBS (containing 1% protease inhibitor), centrifuged at 3000 rpm for 5 min at 4°C, and the supernatant was collected as the cavity fluid. The remaining optic cup tissue was washed once with 200 μL of PBS, and optic cup tissue proteins were extracted. The concentration of VEGFa in the cavity fluid and optic cup tissue was detected using a mouse VEGFa ELISA kit (R&D, SMMV00). We found vldlr - / - The mouse eye contains high levels of VEGFa protein, which is related to vldlr - / - The presence of numerous long-term neovascularization lesions in the mouse model is consistent with the observations, confirming the applicability of this model for simulating AMD disease.
[0326] Secondly, mice were administered different AAVs (containing different shuttle genes) (drug administration on day D0), and the inhibitory effect on angiogenesis was observed:
[0327] Design the following experiment:
[0328] Then, vldlr was used with RC-C07V5 carrying broad-spectrum and strongly expressed GOI-D02, or weakly expressed but inducibly enhanced GOI-D68. - / - Mice (10 weeks old) underwent intravitreal injection (1E9VG / eye), with the day of injection designated as Day 0. Fundus fluorescein angiography (FFA) was used to assess vascular leakage in the mice at Day 0 (before IVT injection), 14, 28, and 42. A strong inhibitory effect on angiogenesis was observed in all cases (Figure 11B).
[0329] Similarly, when we use RC-C14 carrying GOI-D68 to vldlr - / - Intravitreal injection (1E9VG / eye) in mice also showed a good inhibitory effect on angiogenesis for about 3 months (Figure 11C). Surprisingly, this efficacy result was comparable to that of the relatively highly expressed AAV2.7m8-D02 molecule, despite the significant difference in expression levels between the two molecules in vivo (230.3X VEGF trap mRNA, 248.1X VEGF trap protein). This allows us to achieve similar efficacy with lower expression of the exogenous gene protein, which helps reduce the potential side effects of exogenous proteins and the cellular burden and exhaustion caused by possible high expression.
[0330] Similarly, we also used the RC-C14AAV serotype to carry regulated expression of GOI-D74 and GOI-D76 with slightly higher basal expression for vldlr. - / - Mice were administered intravitreal injections (1E9VG / eye) to observe drug efficacy and corresponding molecular expression (Figure 11D). Two weeks after administration (W2), we observed that all three AAV vector drugs completely inhibited angiogenesis and leakage and maintained this effect throughout the entire experimental period (8 weeks), while the buffer control group did not. When we further examined the transcriptional expression of VEGFA and VEGFtrap in intraocular retinal tissue, we observed that in vldlr... - / - VEGFA expression in the mouse eye was 1.22-1.83X that in WT mice, while the corresponding D74 and D76 expression levels in vldlr were significantly higher. - / - Intraocular expression in mice was 1.57X and 1.22X, respectively, compared to WT mice. This aligns with our design expectations: in the hypoxic microenvironment of AMD in vivo, the series of shuttle genes designed using this invention can be effectively delivered to retinal cells using novel AAV serotypes, and their expression increases with the enhancement of target gene expression, thereby more specifically inhibiting pathological angiogenesis and leakage. Similarly, we found that even with low expression of the relatively strong D02 broad-spectrum promoter (VEGF trap mRNA was 5.4 and 1.16X lower, and VEGF trap protein was 10.5 and 1.41X lower, respectively), we still observed the same stable and potent efficacy.
[0331] We also used the RC-C14V12 AAV serotype to carry regulated GOI-D76 expression against vldlr. - / - Mice were administered intravitreal injections (3E8VG / eye) to observe the efficacy and corresponding molecular expression (Figure 11E). One week after administration (day 7), we observed that both AAV vector drugs completely inhibited angiogenesis and leakage, maintaining this effect throughout the entire experimental period (4 weeks), while the buffer control group showed no angiogenesis inhibition. When we further examined the transcriptional expression of VEGF trap in the intraocular retinal tissue, we also found that even with a relatively strong D76 expression and a low D02 broad-spectrum promoter (VEGF trap mRNA low by 8.54X), we still observed the same stable and strong efficacy.
[0332] The novel AAV serotypes designed in this invention carry a gene that can regulate the expression of anti-VEGF shuttle genes. This gene can be effectively transduced into the entire retinal layer within the eye and can adapt to changes in the intraocular microenvironment to regulate the expression of VEGF trap proteins. It can stably inhibit pathological target gene proteins and angiogenesis at low doses and with low VEGF trap expression, providing a better option for the long-term safety and efficacy of this type of gene therapy drug.
[0333] literature:
[0334] [1]NAKAJIMAT,NAKAJIMAE,SHEARERT R,et al.Concerted inhibition of HIF-1αand-2αexpression markedly suppresses angiogenesis in cultured RPE cells[J].Mol Cell Biochem, 2013,383(1-2):113-22.
[0335] [2]LIU ML,
[0336] [3]CROSS KJ,BOMSZTYKE D,WEINSTEIN AL,et al.Anovel method for targeted gene therapy in ischemic tissues through viral transfection of an expression cassette containing multiple repetitions of hypoxia response element[J].Plast Reconstr Surg,2009,123(2Suppl):76s-82s.
[0337] [4]SU H,JOHO S,HUANG Y,et al.Adeno-associated viral vector delivers cardiac-specific and hypoxia-inducible VEGF expression in ischemic mouse hearts[J].Proc Natl Acad Sci U S A,2004,101(46):16280-5.
[0338] [5]ALIVAND M R,SABOUNI F,SOHEILI Z S.Probable Chemical Hypoxia Effects on Progress of CNV Through Induction of Promoter CpG Demethylation and Overexpression of IL17RC in HumanRPE Cells[J].Curr Eye Res,2016,41(9):1245-54.
[0339] [6]YUAN Y,KONG W,LIU X M,et al.AHypoxia-Regulated Retinal Pigment Epithelium-Specific Gene Therapy Vector Reduces Choroidal Neovascularization in a Mouse Model[J].Curr Gene Ther,2022,22(5):417-26.
[0340] [7]HU W,JIANG A,LIANG J,et al.Expression of VLDLRin the retina and evolution of subretinal neovascularization in the knockout mouse model's retinal angiomatous proliferation[J].Invest Ophthalmol Vis Sci,2008,49(1):407-15.
[0341] [8]CAI X, SEALS, MCGINNIS J F. Sustained inhibition of neovascularization in vldlr- / - mice following intravitreal injection of cerium oxide nanoparticles and the role of the ASK1-P38 / JNK-NF-κB pathway[J]. Biomaterials, 2014, 35(1): 249-58.
[0342] [9]HECKEL E, CAGNONE G, AGNIHOTRI T, et al. Triglyceride-derived fatty acids reduce autophagy in a model of retinal angiomatous proliferation[J]. JCI Insight, 2022, 7(6).
[0343] Sequence:
Claims
1. An expression cassette having the structure of Formula II from 5'-3': Z0-Z1-Z2-Z3-Z4-Z5-Z6-Z7-Z8-Z9 (II), wherein each "-" in the formula independently is a bond or a nucleotide linker sequence; wherein Z0 is nothing or an L-ITR sequence; Z1 is nothing or an enhancer, Z2 is nothing or an inducible transcriptional regulatory element, e.g., a hypoxia response positive and / or repressive sequence Z3 is a promoter; Z4 is nothing or a 5' UTR; Z5 is nothing or an intron, wherein Z4 and Z5 are not both nothing; Z6 is a coding sequence for an anti-VEGF fusion protein; Z7 is nothing or a polyadenylation signal; Z8 is nothing or other regulatory sequences, e.g., a MAR; Z9 is nothing or an R-ITR; wherein the anti-VEGF fusion protein has the structure of Formula I from N-terminus to C-terminus: L-V-H-Fc (I) wherein each "-" independently is a bond or a linking peptide; L is nothing or is a secretion signal peptide, which is derived from Ig kappa chain; V is an anti-VEGF protein, which comprises Ig C domain 2 of VEGFR1 (VEGF receptor 1) and Ig C domain 3 of VEGFR2; H is an optional hinge region; Fc is an optional immunoglobulin Fc region.
2. The expression cassette of claim 1, wherein the sequence of the secretion signal peptide comprises or consists of the amino acid sequence set forth in SEQ ID NO: 18; the anti-VEGF protein comprises or consists of the amino acid sequence set forth in SEQ ID NO: 50, or an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NO: 50; the hinge region amino acid sequence comprises or consists of GPG; and / or the Fc is a Fc fragment of human IgG, e.g., a Fc fragment of human IgG1, e.g., the Fc fragment comprises or consists of the amino acid sequence set forth in SEQ ID NO: 51, or an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NO:
51. 3. The expression cassette of claim 1 or 2, wherein the fusion protein comprises the amino acid sequence set forth in SEQ ID NO: 16 or 52, or an amino acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence set forth in SEQ ID NO: 16 or 52, or consists of said amino acid sequence; or is encoded by a polynucleotide comprising the nucleic acid sequence set forth in SEQ ID NO: 17, or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence set forth in SEQ ID NO:
17.
4. The expression cassette of claim 3, wherein the fusion protein coding sequence comprises the nucleic acid sequence set forth in SEQ ID NO: 17, or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence set forth in SEQ ID NO:
17.
5. The expression cassette of any one of claims 1-4, wherein Z3 is a regulatable promoter, e.g., an inducible or tissue-specific promoter, e.g., the promoter comprises a suppressor element (e.g., SE) and / or a hypoxia response element (e.g., SRE), e.g., the promoter comprises a nucleic acid sequence that is at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more sequence identical to the nucleotide sequence set forth in SEQ ID NO: 35 or 38; or comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 35 or 38.
6. The expression cassette of any one of claims 1-5, wherein the polyadenylation region is selected from hGHpA (human growth hormone polyadenylation region) or SV40pA (SV40 poly(A) signal polyadenylation region), e.g., the hGHpA comprises a nucleic acid sequence that is at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more sequence identical to the nucleotide sequence set forth in SEQ ID NO: 33; or comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 33; the 5’UTR is a VEGFA 5’UTR, e.g., the VEGFA 5’-UTR comprises a nucleic acid sequence that is at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more sequence identical to the nucleotide sequence set forth in SEQ ID NO: 39; or comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 39; the intron is a long chimeric intron or a short chimeric intron, for example the long chimeric intron comprises a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more sequence identity to the nucleotide sequence set forth in SEQ ID NO: 32, or comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 32; or the short chimeric intron comprises a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more sequence identity to the nucleotide sequence set forth in SEQ ID NO: 36, or comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 36; the inducible transcriptional regulatory element comprises a suppression element SE and / or a hypoxia response element HRE, for example the suppression element comprises TTCAGCACCGCGGACAGTGCCTGTCACGTCCTGCACGACGTA or consists of the same; or the hypoxia response element comprises a hypoxia response sequence centered on "ACGTG" or "RCGTG"; for example the inducible transcriptional regulatory element is a 3-SE-nHRE, such as it comprises a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more sequence identity to the nucleotide sequence set forth in SEQ ID NO: 34, or comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 34; the further regulatory sequence is a post-transcriptional regulatory sequence, such as a matrix attachment region (MAR), for example the MAR comprises a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more sequence identity to the nucleotide sequence set forth in SEQ ID NO: 37, or comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 37; or the enhancer is a CMV enhancer, for example the CMV enhancer comprises a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more sequence identity to the nucleotide sequence set forth in SEQ ID NO: 42, or comprises or consists of the nucleotide sequence set forth in SEQ ID NO:
42.
7. The expression cassette of any one of claims 1-6, wherein Z0-Z9 is selected from the combinations set forth in the following table:
9. The expression cassette of claim 8, wherein the expression cassette comprises, or consists of, or comprises a nucleic acid sequence having at least about 80%, 85%, 90%, 95%, or at least about 96%, at least about 97%, at least about 98%, at least about 99% or more sequence identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 21-25, 27-30.
10. An expression vector comprising the expression cassette of any one of claims 1-9.
11. The expression vector of claim 10, which is an AAV vector.
12. A recombinant adeno-associated viral particle (rAAV) comprising (i) an AAV capsid protein; (ii) the expression cassette of any one of claims 1-9.
13. The recombinant adeno-associated viral particle of claim 12, wherein the AAV capsid protein is an AAV2 capsid protein or an AAV9 capsid protein or a variant thereof.
14. The recombinant adeno-associated viral particle of claim 13, wherein the VP1 of the AAV9 capsid protein comprises or consists of the amino acid sequence set forth in SEQ ID NO:
1.
15. The recombinant adeno-associated viral particle of claim 12 or 13, wherein the VP1 of the AAV9 capsid protein variant comprises or consists solely of the following amino acid mutations relative to the VP1 of the parental AAV9 capsid protein: (i) the amino acid short peptide of HQSAQAQAQTGWVQN of the parental VP1 or the substitution of the 15 amino acids corresponding to positions 584-598 of the parental VP1 by LQRGNRQAATADVNT; (ii) the insertion of LALGDVTRPA or LALGETTRPA between the N at position 588 and the R at position 589, (iii) a combination of (i) and (ii); optionally the mutation of the amino acid at position 240 of the parent by I to T (I240T), wherein the amino acid positions are determined with reference to the amino acid sequence of the VP1 of the AAV9 capsid protein (SEQ ID NO: 1).
16. The recombinant adeno-associated viral particle of claim 15, wherein the VP1 of the AAV9 capsid protein variant comprises, consists of, or is encoded by, the amino acid sequence set forth in any one of SEQ ID NOs: 2-5, or an amino acid sequence that has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in any one of SEQ ID NOs: 2-5; or the nucleotide sequence set forth in any one of SEQ ID NOs: 7-10, or a nucleotide sequence that has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 7-10.
17. The recombinant adeno-associated viral particle of claim 13, wherein the VP1 of the AAV2 capsid protein comprises or consists of the amino acid sequence set forth in SEQ ID NO:
11.
18. The recombinant adeno-associated viral particle of claim 17, wherein the VP1 of the AAV2 capsid protein variant comprises, or consists of mutations in amino acids only, relative to the parent AAV2 capsid protein VP1 : I240T-V708I and the insertion of the fragment LALGDVTRPA between positions 587-588, or M211V-I240T-V708I and the insertion of the fragment LALGDVTRPA between positions 587-588. wherein the amino acid positions are determined with reference to the amino acid sequence of AAV2 capsid protein VP1 (SEQ ID NO: 11).
19. The recombinant adeno-associated viral particle of claim 18, wherein the VP1 of the AAV2 capsid protein variant comprises the amino acid sequence set forth in SEQ ID NO: 13 or 53, or an amino acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence set forth in SEQ ID NO: 13 or 53, or consists of said amino acid sequence; or the VP1 of the AAV2 capsid protein variant is encoded by a nucleotide sequence comprising the nucleotide sequence set forth in SEQ ID NO: 14 or 54, or a nucleotide sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence set forth in SEQ ID NO: 14 or 54, or consists of said nucleotide sequence.
20. A method of producing a recombinant AAV viral particle, comprising culturing a packaging cell under conditions sufficient to produce a recombinant AAV viral particle, wherein the packaging cell comprises an expression cassette according to any one of claims 1-9 and a capsid protein as defined in any one of claims 10-19.
21. The method of claim 20, wherein the packaging cell further comprises a helper plasmid and / or a transfer plasmid comprising a nucleic acid of interest, optionally further comprising isolating the recombinant adeno-associated virus (rAAV) particle from the complement in the culture supernatant, and optionally further comprising lysing the packaging cell and isolating the recombinant AAV viral particle from the cell lysate, and optionally further comprising one or more of the following: a. clearing cell debris, b. treating the supernatant containing the recombinant AAV viral particle with Benzonase®, c. concentrating the recombinant AAV viral particle, d. purifying the recombinant AAV viral particle.
22. A recombinant AAV viral particle produced according to the method of claim 20 or 21.
23. A pharmaceutical composition comprising the recombinant AAV viral particle of any one of claims 10-19 or 22, and optionally a pharmaceutical excipient, such as a pharmaceutically acceptable carrier, a pharmaceutically acceptable excipient, including a buffer, as known in the art.
24. A combination product comprising the recombinant AAV viral particle of any one of claims 10-19 or 22 and one or more other therapeutic agents.
25. A method of treating an ocular disease in an individual, comprising administering to the individual the recombinant AAV viral particle of any one of claims 10-19 or 22, or the pharmaceutical composition of claim 23, or the combination product of claim 24.
26. The method of claim 25, wherein the administration is via intraocular administration, for example by intraretinal administration or intravitreal administration, for example subretinal space administration or intravitreal cavity administration, for example the administration is an injection.
27. The method of claim 25 or 26, wherein the ocular disease comprises, but is not limited to, retinal and choroidal pathologies leading to diseases with VEGFA as a major pathogenic target, for example age-related macular degeneration (AMD) such as nAMD, diabetic retinopathy, retinal vascular occlusion and corneal neovascularization.
Citation Information
Patent Citations
Protein inhibitors to complement and vegf pathways and methods of use thereof
CN104159926A
Fusion protein with remarkably prolonged half-life period for treating ocular angiogenesis diseases
CN113493519A
Gene therapeutic drug for treatment of age-related macular degeneration
CN120005036A
An Anti-VEGF scfv adeno-associated virus (AAV) vector and uses thereof
WO2021255590A1