Tumor-targeting long non-coding RNA molecule and use thereof

Abstract

Provided are a tumor-targeting long non-coding RNA molecule and a use thereof. The long non-coding RNA molecule is lncD&T1, a truncated fragment thereof, or a variant thereof containing a chemically modified nucleotide. The term "tumor-targeting" refers to, after administration, the drug distribution in tumor tissues or cells being higher than that in non-cancerous tissues or cells. Also provided are: (1) a use of the long non-coding RNA molecule as a delivery carrier molecule for delivering an active molecule or a drug molecule to a tumor tissue; (2) an anti-tumor drug or anti-tumor drug composition comprising the long non-coding RNA molecule or a core fragment thereof; and (3) a use of the long non-coding RNA molecule directly as an anti-tumor drug.

Description

A tumor-targeting long non-coding RNA molecule and its applications Technical Field

[0001] This invention belongs to the field of pharmaceutical biotechnology, specifically relating to a tumor-targeting long non-coding RNA molecule and its applications. Background Technology

[0002] Nucleic acid aptamers are single-stranded nucleic acid (DNA or RNA molecules) that can specifically bind to a target. They have small molecular weights, are easy to design and synthesize, and can fold into specific conformations to specifically bind to biological targets. Nucleic acid aptamers have advantages such as simple synthesis, easy modification, chemical stability, low immunogenicity, and low cost, making them promising novel, efficient, and stable molecular probes with great potential in early cancer diagnosis and precision targeted therapy, drug therapy, and biochemical sensing. However, nucleic acid aptamers also face many challenges, including poor stability and low delivery efficiency.

[0003] Furthermore, long non-coding RNAs (lncRNAs) are a class of non-coding RNA molecules longer than 200 nucleotides. They do not participate in protein synthesis, but through mechanisms such as epigenetic remodeling, transcriptional interference, and subcellular structural assembly, they precisely control physiological and pathological processes such as development, immunity, and neural plasticity. Compared to nucleic acid aptamers, long non-coding RNAs are longer and can contain multiple functional modules with certain higher-order structures. Therefore, long non-coding RNA molecules possess the material basis for specifically binding to biological targets and exerting certain biological functions.

[0004] Based on this, the present invention is proposed. Summary of the Invention

[0005] This invention first relates to a tumor-targeting long non-coding RNA (lncRNA) molecule, which comprises the following nucleic acid fragments:

[0006] Nucleic acid fragments of lncD&T-1 (number 25) with sequences as shown in SEQ ID NO.1 or SEQ ID NO.53;

[0007] Or an artificial mutant 25M2 with a sequence such as SEQ ID NO.15;

[0008] The term "targeted tumor" refers to a situation where, after administration, the drug distribution in tumor tissues or cells is higher than in non-cancerous organs, tissues, or cells.

[0009] Preferably, the tumors include, but are not limited to: colorectal cancer, liver cancer, lung cancer, pancreatic cancer, gastric cancer, osteosarcoma, cervical cancer, breast cancer, prostate cancer, bladder transitional cell papilloma, glioma, or hematologic malignancy;

[0010] Preferably, the molecule is a chemically modified nucleic acid fragment, and the chemical modification includes, but is not limited to, fluorine substitution, methoxy modification, thio modification, etc.

[0011] Furthermore, the molecule is:

[0012] (1) lncD&T1 (number 25) is a nucleic acid fragment with the 3' adapter removed and / or the 5' adapter removed, the 5' adapter sequence is shown in SEQ ID NO.51 and the 3' adapter sequence is shown in SEQ ID NO.52;

[0013] (2) The core fragment 25sub-7 / 16 of lncD&T1 (number 25), the sequence of which is shown in SEQ ID NO.37;

[0014] (3) A truncated segment of lncD&T1 (number 25), wherein the truncated segment contains at least the core segment 25sub-7 / 16;

[0015] (4) A molecule further comprising an extended fragment, wherein the extended fragment is an additional fragment at the 3' and / or 5' end of the human genome location where lncD&T1 (number 25) is located, and is 20-5000 nt in length; preferably, the nucleic acid sequence of the molecule comprising the extended fragment is shown in SEQ ID NO.38-50;

[0016] Preferably, the molecule is a chemically modified nucleic acid fragment, and the chemical modification includes, but is not limited to, fluorine substitution, methoxy modification, thio modification, etc.

[0017] Furthermore, the long non-coding RNA molecule is also coupled with one or more second functional units, wherein the second functional units are:

[0018] (1) A stable fragment for stabilizing the long non-coding RNA molecule, preferably, the stable fragment is the 2911 fragment with the sequence shown in SEQ ID NO.3; the stable fragment is located at either end or both ends of the molecule or inserted therein;

[0019] (2) An immunomodulatory element, preferably, the immunomodulatory element is a 3F30 fragment with the sequence shown in SEQ ID NO.5; the immunomodulatory element is located at either end or both ends of the long non-coding RNA molecule;

[0020] (3) Reverse complementary fragments, preferably, the reverse complementary fragments are derived from the 3F30 fragment, and the sequences are shown in SEQ ID NO.7 or SEQ ID NO.8 respectively; the reverse complementary fragments are located at both ends of the molecule respectively;

[0021] (4) An optional flanking nucleic acid sequence of 20-5000 nt in length, preferably, the flanking nucleic acid sequence of 20-2000 nt in length, more preferably, the flanking nucleic acid sequence of 20-500 nt in length; the flanking nucleic acid sequence is located at either end or both ends of the molecule; further, the flanking nucleic acid sequence is: a protein-coding sequence or a non-coding sequence, wherein the non-coding sequence is siRNA or modified siRNA, ASO or modified ASO, long non-coding RNA or modified long non-coding RNA, aptamer or modified aptamer; the protein has a biological function, preferably, the protein includes, but is not limited to, cytokines, growth hormones, antibodies or antibody variants;

[0022] (5) Small molecule cytotoxic compounds, immune agonists or radioactive nuclide groups;

[0023] Preferably, the long non-coding RNA molecule is a chemically modified nucleic acid fragment, and the chemical modification includes, but is not limited to, fluorine substitution, methoxy modification, thio modification, etc.

[0024] This invention also relates to a drug conjugated to the aforementioned long non-coding RNA molecule, wherein the drug is a nucleic acid drug, a small molecule cytotoxic drug, an immune agonist, or a radionuclide; preferably, the molecular form of the nucleic acid drug is RNA, chemically modified RNA, ASO, or chemically modified ASO; the drug has the function of targeting tumors; the term "targeting tumors" refers to the fact that, after administration, the drug distribution in tumor tissues or cells is higher than in non-cancerous organs, tissues, or cells;

[0025] Preferably, the tumors include, but are not limited to: colorectal cancer, liver cancer, lung cancer, pancreatic cancer, gastric cancer, osteosarcoma, cervical cancer, breast cancer, prostate cancer, bladder transitional cell papilloma, glioma, or hematologic malignancy.

[0026] The present invention also relates to an antitumor pharmaceutical composition, wherein the pharmaceutical composition comprises:

[0027] (1) A therapeutically effective amount of the long noncoding RNA molecule lncD&T1 or a truncated fragment thereof, wherein the truncated fragment contains at least 25 sub-7 / 16 of the core fragment; and / or

[0028] (2) The long noncoding RNA molecule lncD&T1 or a truncated fragment thereof coupled with the stable fragment and / or the reverse complementary fragment, wherein the truncated fragment contains at least 25 sub-7 / 16 of the core fragment; and / or

[0029] (3) A nucleic acid fragment with flanking nucleic acid sequences coupled to either or both ends of the long non-coding RNA molecule lncD&T1 or a truncated fragment thereof, wherein the truncated fragment contains at least the core fragment 25 sub-7 / 16; preferably, the nucleic acid fragment is also coupled to the stable fragment and / or the reverse complementary fragment; preferably, the flanking sequence is a protein-coding sequence or a non-coding sequence, wherein the protein has a biological function; and / or

[0030] (4) A compound having a small molecule cytotoxic compound, an immune agonist or a radionuclide group coupled to any end, both ends or within the molecule of the long non-coding RNA molecule lncD&T1 or a truncated fragment thereof, wherein the truncated fragment contains at least the core fragment 25sub-7 / 16; preferably, the compound is also coupled to the stable fragment and / or the reverse complementary fragment.

[0031] In addition, optional (5) necessary pharmaceutical excipients.

[0032] The present invention also relates to a method for treating tumors, the method comprising administering to a patient a therapeutically effective amount of the long non-coding RNA molecule, and / or the drug conjugated to the long non-coding RNA molecule, and / or the antitumor drug composition; wherein the tumors include, but are not limited to: colorectal cancer, liver cancer, lung cancer, pancreatic cancer, gastric cancer, osteosarcoma, cervical cancer, breast cancer, prostate cancer, bladder transitional cell papilloma, glioma, or hematologic malignancy.

[0033] This invention also relates to the application of the aforementioned long non-coding RNA molecule in the preparation of a drug targeting tumors, wherein the drug is a nucleic acid drug, preferably an RNA drug; the drug has the function of targeting tumors; and the term "targeting tumors" refers to the fact that, after administration, the drug distribution in tumor tissues or cells is higher than that in non-cancerous organs, tissues, or cells.

[0034] Preferably, the tumors include, but are not limited to: colorectal cancer, liver cancer, lung cancer, pancreatic cancer, gastric cancer, osteosarcoma, cervical cancer, breast cancer, prostate cancer, bladder transitional cell papilloma, glioma, or hematologic malignancy.

[0035] This invention also relates to the application of the aforementioned long non-coding RNA molecule in the preparation of tumor-targeting delivery vectors, wherein the delivery vector is:

[0036] (1) A delivery vector formed by directly chemically conjugating the long non-coding RNA molecule to the substance being delivered; or

[0037] (2) The delivery carriers prepared by non-chemical coupling of the long non-coding RNA molecules, the delivered substance, and other pharmaceutical excipients include, but are not limited to: liposomes, nanoparticles, water-in-oil / oil-in-water emulsions, ointments, etc.

[0038] Preferably, the delivered substance is a therapeutic agent or a contrast agent, and the therapeutic agent includes, but is not limited to, nucleic acid drugs, small molecule cytotoxic drugs, or radionuclides;

[0039] Preferably, the tumors include, but are not limited to: colorectal cancer, liver cancer, lung cancer, pancreatic cancer, gastric cancer, osteosarcoma, cervical cancer, breast cancer, prostate cancer, bladder transitional cell papilloma, glioma, or hematologic malignancy.

[0040] The present invention also relates to long non-coding RNA molecule-drug conjugates (LncRNA-Drug Conjugates, LncDC) comprising the long non-coding RNA molecule or a truncated fragment thereof, or a chemically modified long non-coding RNA molecule or a truncated fragment thereof.

[0041] The drugs mentioned are: nucleic acid drugs or cytotoxic drugs;

[0042] Preferably, the nucleic acid drug is an oligonucleotide drug, including but not limited to: single-stranded DNA, double-stranded DNA, single-stranded RNA, double-stranded RNA, mRNA or ncRNA (non-coding RNA); more preferably, the nucleic acid drug is siRNA, ASO or a multivalent ASO tandem.

[0043] Preferably, the cytotoxic drug is an antitumor cytotoxic drug, including but not limited to: cytotoxic drugs affecting nucleic acid synthesis, cytotoxic drugs affecting nucleic acid transcription, cytotoxic drugs affecting DNA replication, and cytotoxic drugs affecting mitosis; more preferably, the cytotoxic drug is MMAE (Monomethyl auristatin E), DXd (Deruxtecan), or PBD (pyrrolobenzodiazepine). Eribulin (E7389), SN-38 (Synonyms: 7-Ethyl-10-hydroxycamptothecin).

[0044] Furthermore, in the aforementioned long non-coding RNA molecule-drug conjugate (LncDC), the long non-coding RNA molecule or its truncated fragment, or a chemically modified long non-coding RNA molecule or its truncated fragment, is conjugated to the drug molecule in the following manner:

[0045] (1) Direct coupling via covalent connection; or

[0046] (2) Coupling is performed using a set of complementary bridging nucleic acid fragments, specifically:

[0047] The sense / antisense strand of the bridging nucleic acid fragment is attached to the drug molecule;

[0048] A bridging nucleic acid fragment antisense / sense strand is attached to the long non-coding RNA molecule or its truncated fragment, or a chemically modified long non-coding RNA molecule or a chemically modified long non-coding RNA molecule truncated fragment.

[0049] The antisense strand of the bridging nucleic acid fragment is complementary or partially complementary to the sense strand of the bridging nucleic acid fragment;

[0050] Annealing is used to pair the sense and antisense strands of the bridging nucleic acid fragment, thereby conjugating the drug molecule to the long non-coding RNA molecule or its truncated fragment, or a chemically modified long non-coding RNA molecule or a chemically modified truncated fragment of a long non-coding RNA molecule.

[0051] The structure of a long non-coding RNA molecule-bridging nucleic acid fragment-drug conjugate is shown in the following formula.

[0052] Preferably, the complementary bridging nucleic acid fragment is a reverse complementary double-stranded RNA, a double-stranded DNA, or an RNA / DNA hybrid strand; or a chemically modified reverse complementary double-stranded RNA, a double-stranded DNA, or an RNA / DNA hybrid strand.

[0053] Preferably, the sequence of the bridging nucleic acid fragment sense strand is shown in SEQ ID NO.55, and the sequence of the bridging nucleic acid fragment antisense strand is shown in SEQ ID NO.56.

[0054] Furthermore, the drug molecule is linked to the sense / antisense strand of the bridging nucleic acid fragment via an adaptor (spacer);

[0055] The structure of the linker is a straight-chain structure that connects one drug molecule or a branched structure that connects multiple drug molecules;

[0056] The bridging nucleic acid fragment's sense / antisense strand connects to a single drug molecule via a straight-chain linker, or connects to multiple drug molecules via multiple linkers attached to multiple ribonucleotides in the bridging fragment's sense / antisense strand, or connects to multiple drug molecules via a branched linker. A schematic diagram of the structure is shown below:

[0057] A linear structure connects individual drug molecules

[0058] Multiple drug molecules can be linked at multiple connection sites:

[0059] Or a branched structure connects multiple drug molecules.

[0060] The linker is covalently linked to the drug molecule via an N or S atom and to the sense / antisense strand of the bridging nucleic acid fragment via a phosphodiester bond or a thiophosphate diester bond.

[0061] Preferably, the chemical structure of the linker is selected from the following structural formulas, or a combination of one or more of them linked together, or a combination of structures formed by repeated linkage of one of them.

[0062] in,

[0063] Z represents oxygen or sulfur;

[0064] R1 is R2 is

[0065] Q is selected from hydrogen, methyl, ethyl, or n- / isopropyl;

[0066] m is an integer from 1 to 5, n is an integer from 1 to 11, p is 1 or 2, and q is an integer from 1 to 3.

[0067] Furthermore, the precursor compound forming the aforementioned linker structure is:

[0068] In each structural formula in the table, the substituent E is... (Compounds LKa1-P, LKa2-P, LKa12-P, LKb1-P, LKb11-P, LKc1-P, LKc11-P) or (Compounds LKa1-S, LKa2-S, LKa12-S, LKb1-S, LKb11-S, LKc1-S, LKc11-S);

[0069] Optionally, the drug molecule includes connective fragments that can be broken under certain conditions and / or connective fragments that are not easily broken;

[0070] The cleavable linker fragments are prone to breakage in the intracellular environment or tumor microenvironment, including but not limited to short peptide fragments that can be cleaved by intracellular proteases, glycosylated linker fragments that can be cleaved by glycosylated enzymes (such as β-glucuronidase and β-galactosidase), disulfide bond fragments that are prone to breakage in a reducing environment (such as glutathione containing free sulfhydryl groups), and linker fragments containing acylhydrazones, imines, or carbonates that are prone to breakage within a certain pH range.

[0071] The aforementioned non-breakable linker fragment refers to a fragment that maintains stable connection in a typical circulatory system, tissue, and cellular environment, and can break or release the drug molecule after the degradation of long non-coding RNA molecules or adaptors or under lysosomal enzyme cleavage conditions.

[0072] Optionally, the drug molecule may further include a modifying group, which is used to protect the drug molecule and / or couple the drug molecule to the linker; the modifying group is a protecting group, an activating group, or a linking group; the activating group may undergo condensation, addition, or substitution reactions with nucleophilic groups such as amino / amine groups, thiol groups, and hydroxyl groups to complete the linking reaction.

[0073] Preferably, the modifying groups include, but are not limited to, carboxyl activated ester groups, maleimide groups, phosphoramidide groups, halogens, carbonyl groups, alkenyl groups, alkynyl groups, etc.

[0074] More preferably, the modifying group is a maleimide group, and its structure after the linkage reaction is a succinimide group;

[0075] Most preferably, in the aforementioned long non-coding RNA molecule-drug conjugate, the modifying group on the drug molecule is a group formed by the hydrolysis and ring-opening of the maleimide group after the ligation reaction, with the following structure:

[0076] This invention also relates to a method for preparing the aforementioned long non-coding RNA molecule-drug conjugate, the method comprising:

[0077] (1) The long non-coding RNA molecule and the drug molecule are directly coupled via covalent linkage; or

[0078] (2) The long non-coding RNA molecule and the drug molecule are coupled by complementary bridging nucleic acid fragments.

[0079] Furthermore, the method for conjugating the long non-coding RNA molecule and the drug molecule via complementary bridging nucleic acid fragments includes the following steps:

[0080] (1) Prepare a drug molecule containing a bridging nucleic acid fragment sense / antisense strand; preferably, the bridging nucleic acid fragment sense / antisense strand and the drug molecule are connected using the adapter precursor compound; depending on the structure of the adapter precursor compound, the bridging nucleic acid fragment sense / antisense strand can connect one or more drug molecules;

[0081] (2) Prepare a long non-coding RNA molecule with a complementary bridging nucleic acid fragment connected to the sense / antisense strand; preferably, the long non-coding RNA molecule with a complementary bridging nucleic acid fragment connected to the sense / antisense strand is prepared by a nucleic acid solid-phase or liquid-phase synthesis method.

[0082] (3) Using annealing hybridization, the drug molecule containing the bridging nucleic acid fragment sense strand / antisense strand is coupled to the long non-coding RNA molecule connected with the complementary bridging nucleic acid fragment sense strand / antisense strand by complementary linking of the bridging nucleic acid fragment sense strand / antisense strand, to obtain the long non-coding RNA molecule-drug conjugate.

[0083] The present invention also relates to the linker precursor compounds described in the table below.

[0084] The present invention also relates to the use of the aforementioned adaptor precursor compound in linking drugs and delivery molecules, preferably, the drug being a nucleic acid drug or a cytotoxic drug;

[0085] Preferably, the nucleic acid drug is an oligonucleotide drug, including but not limited to: single-stranded DNA, double-stranded DNA, single-stranded RNA, double-stranded RNA, mRNA or ncRNA (non-coding RNA); more preferably, the nucleic acid drug is siRNA, ASO or a multivalent ASO tandem.

[0086] Preferably, the cytotoxic drug is an antitumor cytotoxic drug, including but not limited to: cytotoxic drugs affecting nucleic acid synthesis, cytotoxic drugs affecting nucleic acid transcription, cytotoxic drugs affecting DNA replication, and cytotoxic drugs affecting mitosis; more preferably, the cytotoxic drug is MMAE (Monomethyl auristatin E), camptothecin-like toxin DXd (Deruxtecan), or PBD (pyrrolobenzodiazepine). Eribulin (E7389), SN-38 (Synonyms: 7-Ethyl-10-hydroxycamptothecin).

[0087] This invention also relates to a method for synthesizing the aforementioned linker precursor compound and its activated ester.

[0088] (1) The synthesis methods of the integrators LKa1 and LKa2 and their activated esters (LKa1-P, LKa2-P) are as follows:

[0089] Synthesis of intermediate LKa1-Z01:

[0090] Cystamine hydrochloride (CAS: 56-17-7), DIEA, DMF and water were stirred until homogeneous, and then acetic anhydride was added to the reaction system. The reaction was continued at room temperature until most of the starting material was converted.

[0091] The reaction solution was concentrated under reduced pressure to an oily state to obtain a crude product, which was purified by silica gel column chromatography. The product fraction was collected, concentrated, and dried to obtain a pale yellow oily substance.

[0092] Synthesis of intermediate LKa1-Z02:

[0093] LKa1-Z01, Boc-DL-aspartic acid (CAS:120341-32-4), DIEA and anhydrous DMF were stirred evenly, and HATU (CAS:148893-10-1, 6.35g, 16.7mmol) was added under a cold water bath. After the addition was complete, the reaction system was raised to room temperature and the reaction was carried out until the raw materials were basically converted.

[0094] The reaction was quenched with water, the reaction solution was concentrated under reduced pressure, the crude product was purified by silica gel column chromatography, the product components were collected and concentrated, and dried to obtain a pale yellow oily substance.

[0095] Synthesis of intermediate LKa1-Z03:

[0096] LKa1-Z02 and 1,4-dioxane were stirred evenly, and HCl / 1,4-dioxane solution was added to the reaction system. Stirring continued until the raw materials were completely converted.

[0097] The reaction solution was concentrated to dryness under reduced pressure. The crude product was purified by silica gel column chromatography. The product fraction was collected and concentrated, and dried to obtain a white solid.

[0098] Synthesis of LKa1:

[0099] LKa1-Z03, DIEA, DMAP and DMF were stirred evenly under cold bath cooling, succinic anhydride was added and stirring was continued until the raw material conversion was complete.

[0100] The reaction was quenched with water, the reaction solution was concentrated under reduced pressure, the crude product was purified by silica gel column chromatography, the product components were collected and concentrated, and dried to obtain a colorless oil.

[0101] Synthesis of activated ester LKa1-P:

[0102] LKa1, pentafluorophenol and DMF were stirred evenly under cold bath cooling, DIC was added and stirring continued until the raw material conversion was complete;

[0103] The reaction solution was concentrated under reduced pressure to an oily state, diluted with DCM, and washed once with 0.2M KHSO4aq., saturated sodium bicarbonate, and saturated sodium chloride solution. After drying and concentrating the organic phase, it was crystallized with DCM / MTBE (1 / 10) and dried for 1 hour to obtain a white powdery solid.

[0104] Synthesis of LKa2:

[0105] LKa1-Z03, DIEA and DMF were stirred evenly under cold bath cooling, and adipic anhydride was added and stirring continued until the raw material conversion was complete.

[0106] The reaction was quenched with water, the reaction solution was concentrated under reduced pressure, the crude product was purified by silica gel column chromatography, the product components were collected and concentrated, and dried for 1 hour to obtain a brownish-yellow oily substance.

[0107] Synthesis of activated ester LKa2-P:

[0108] LKa2, pentafluorophenol and DMF were stirred evenly under cold bath cooling, and DIC was added and stirring continued until the raw material conversion was complete.

[0109] The reaction solution was concentrated under reduced pressure to an oily state, diluted with DCM, and washed once with 0.2M KHSO4aq., saturated sodium bicarbonate, and saturated sodium chloride solution. After drying and concentration, the organic phase was crystallized with DCM / MTBE (1 / 10) and dried to obtain a pale yellow solid.

[0110] (2) The synthesis method of the linker LKa12 and its activated ester (LKa12-P) is as follows:

[0111] Synthesis of intermediate LKa12-Z01:

[0112] A white solid was synthesized from 5-aminoisophthalic acid.

[0113] Synthesis of intermediate LKa12-Z02:

[0114] LKa1-Z03, LKa12-Z01, DIEA and anhydrous DMF were stirred evenly under cold bath cooling, HATU (CAS:148893-10-1) was added, and the mixture was allowed to rise naturally to room temperature and stirred until the raw materials were basically converted.

[0115] The reaction was quenched with water, the reaction solution was concentrated under reduced pressure, the crude product was purified by silica gel column chromatography, the product fraction was collected and concentrated, and dried to obtain a pale yellow solid.

[0116] Synthesis of intermediate LKa12-Z03:

[0117] LKa12-Z02 and 1,4-dioxane (10 mL) were stirred evenly. The HCl / 1,4-dioxane solution was added to the reaction system and stirring was continued until the raw materials were completely converted.

[0118] The reaction solution was concentrated under reduced pressure and dried to obtain a brownish-yellow oily substance.

[0119] Synthesis of LKa12:

[0120] Dodecanoic acid (CAS: 693-23-2), DIEA and DMF were stirred evenly under cold bath cooling. PfpO-TFA was added and stirring continued until the raw material diacid was basically converted into a single activated ester. LKa12-Z03 was added to the reaction system and stirring continued until the raw material conversion was complete.

[0121] The reaction was quenched with water, the reaction solution was concentrated under reduced pressure, the crude product was purified by silica gel column chromatography, the product components were collected and concentrated, and dried to obtain a brownish-yellow oily substance.

[0122] Synthesis of activated ester LKa12-P:

[0123] LKa12, DIEA and DMF were stirred evenly under cold bath cooling, PfpO-TFA was added and stirring was continued until the raw material conversion was complete;

[0124] The reaction solution was concentrated under reduced pressure to an oily state, diluted with DCM, and then a saturated sodium bicarbonate solution was added and stirred to form a white suspension. The mixture was filtered to collect the solid, which was then dried to obtain a white solid.

[0125] (3) The synthesis method of the linker LKb11 and its activated ester (LKb11-P) is as follows:

[0126] Synthesis of intermediate LKb11-Z01:

[0127] Boc-β-alanine (CAS: 3303-84-2), pentafluorophenol and DMF were stirred evenly under cold bath cooling, DIC was added and the mixture was allowed to rise naturally to room temperature and stirred to obtain the activated ester reaction solution.

[0128] Cystamine hydrochloride (CAS: 56-17-7) and DIEA were mixed in water and stirred evenly under cold bath cooling. The activated ester reaction solution obtained above was added to the reaction system and stirring was continued until the raw material conversion was complete.

[0129] Concentrate the reaction solution under reduced pressure to an oily state, then add DIEA and DCM sequentially, and add acetic anhydride while stirring at a constant speed. React at room temperature until the raw material conversion is complete.

[0130] The reaction solution was concentrated under reduced pressure, diluted with EtOAc, and washed once with saturated sodium bicarbonate and saturated sodium chloride solutions. The organic phase was separated, dried, and concentrated. The crude product was purified by silica gel column chromatography. The product fraction was collected and concentrated, and dried for 1 hour to obtain a white solid.

[0131] Synthesis of intermediate LKb11-Z02:

[0132] LKb11-Z01 and 1,4-dioxane were stirred at a constant speed. The HCl / 1,4-dioxane solution was added to the reaction system and stirring was continued until the raw materials were completely converted.

[0133] The reaction solution was concentrated to dryness under reduced pressure, and dried to obtain a white solid.

[0134] Synthesis of intermediate LKb11-Z03:

[0135] LKb11-Z02, N-Boc-iminodiacetic acid (CAS:56074-20-5), DIEA and anhydrous DMF were stirred evenly under cold bath cooling, HATU (CAS:148893-10-1) was added, the reaction system was allowed to rise naturally to room temperature, and stirred until the raw materials were basically converted.

[0136] The reaction was quenched with water, the reaction solution was concentrated under reduced pressure, the crude product was purified by silica gel column chromatography, the product components were collected and concentrated, and dried to obtain a yellow solid.

[0137] Synthesis of intermediate LKb11-Z04:

[0138] Using LKb11-Z03 as a raw material, the target product (pale yellow oily substance, hydrochloride) was obtained by following steps similar to those used in the synthesis of LKb11-Z02.

[0139] Synthesis of intermediate LKb11-Z05:

[0140] Using LKb11-Z04 and N-Boc-iminodiacetic acid (CAS:56074-20-5) as raw materials, the target product (pale yellow solid) was obtained by following a similar procedure to that used in the synthesis of LKb11-Z03.

[0141] Synthesis of intermediate LKb11-Z06:

[0142] Using LKb11-Z05 as a raw material, the target product (white solid, hydrochloride) was obtained by following steps similar to those used in the synthesis of LKb11-Z04.

[0143] Synthesis of LKb11 and its activated ester LKb11-P:

[0144] Using LKb11-Z06 as raw material, the target product LKb11 (pale yellow oily substance) was obtained by following steps similar to those used in the synthesis of LKa2.

[0145] Using LKb11 as a raw material, the product LKb11-P can be obtained by following a similar procedure to that used in the synthesis of LKa12-P.

[0146] (4) The synthesis method of the linker LKc1 and its activated ester (LKc1-P) is as follows:

[0147] Synthesis of intermediate LKc1-Z01:

[0148] 3,3'-Dihydrooxolinetic acid (CAS:1119-62-6), N-Boc-1,3-propanediamine (CAS:75178-96-0), DIEA, HOBt (CAS:2592-95-2) and anhydrous DCM were stirred evenly under cold bath cooling, EDCI (CAS:7084-11-9) was added, and the mixture was allowed to rise naturally to room temperature and stirred until the raw materials were basically converted.

[0149] The reaction was quenched with water, the reaction solution was concentrated under reduced pressure, the crude product was purified by silica gel column chromatography, the product components were collected and concentrated, and dried for 1 hour to obtain a pale yellow oil.

[0150] Synthesis of intermediate LKc1-Z02:

[0151] LKc1-Z01, DMAP, MeOH and DCM were stirred evenly under cold bath cooling, DIC was added, and stirring was continued until the raw materials were completely converted;

[0152] The reaction was quenched with water, the reaction solution was concentrated under reduced pressure, the crude product was purified by silica gel column chromatography, the product components were collected and concentrated, and dried to obtain a colorless oily liquid.

[0153] Synthesis of intermediate LKc1-Z03:

[0154] LKc1-Z02 and DCM were stirred evenly under cold bath cooling, and TFA (20 mL) was added to the reaction system and stirring was continued until the raw materials were completely converted.

[0155] The reaction solution was concentrated under reduced pressure and dried to obtain a pale yellow solid.

[0156] Synthesis of intermediate LKc1-Z04:

[0157] Using LKc1-Z03 (TFA salt) and N-Boc-iminodiacetic acid (CAS:56074-20-5) as raw materials, the target product (pale yellow oil) was obtained by following a similar procedure to that used in the synthesis of LKb11-Z03.

[0158] Synthesis of intermediate LKc1-Z05:

[0159] Using LKc1-Z04 as a raw material, the target product (pale yellow oily substance, TFA salt) was obtained by following steps similar to those used in the synthesis of LKc1-Z03.

[0160] Synthesis of LKc1:

[0161] Using LKc1-Z05 (TFA salt) as raw material, the target product (pale yellow oily substance) was obtained by following a similar procedure to that used in the synthesis of LKb11.

[0162] Synthesis of activated ester LKc1-P:

[0163] Using LKc1-Z05 as raw material, the target product (pale yellow oily substance) was obtained by following a similar procedure to that used in the synthesis of LKa12-P.

[0164] (5) The synthesis method of the linker LKc11 is as follows:

[0165] Synthesis of intermediate LKc11-Z01:

[0166] Using LKc1-Z05 (TFA salt) and N-Boc-iminodiacetic acid (CAS: 56074-20-5) as raw materials, the target product (pale yellow oil) was obtained by following a similar procedure to that used in the synthesis of LKb11-Z03.

[0167] Synthesis of intermediate LKc11-Z02:

[0168] Using LKc11-Z01 as raw material, the target product (TFA salt) was obtained by following a similar procedure to that used in the synthesis of LKc1-Z03.

[0169] Synthesis of LKc11:

[0170] Using LKc11-Z02 (TFA salt) as raw material, the target product (pale yellow oily substance) was obtained by following steps similar to those used in the synthesis of LKb11. Attached Figure Description

[0171] Figure 1. Laser confocal microscopy detection of Cy3-labeled long non-coding RNA molecule lncD&T-1 and Cy3 signal in cells after incubation (HCT116 cell line).

[0172] Figure 2. Flow cytometry analysis of the delivery efficiency of a candidate long non-coding RNA molecule, lncD&T-1, in various tumor cells.

[0173] Figure 3. In the HCT116CDX nude mouse model, the long non-coding RNA molecule lncD&T-1 labeled with Cy5 dye was injected into the tail vein, and the distribution of the long non-coding RNA molecule in vivo was detected by in vivo imaging. The organs in the figure are arranged in order from left to right and from top to bottom: heart, liver, spleen, lung, kidney, brain, and tumor.

[0174] Figure 4. Serum stability test of long non-coding RNA molecule lncD&T-1 and long non-coding RNA molecule lncD&T1 with added stabilizing element 2911 on different flanks.

[0175] Figure 5. Flow cytometry analysis of the delivery activity of the long non-coding RNA molecule lncD&T-1 and its different modifications / mutants in various cell types.

[0176] Figure 6. In the HCT116 CDX nude mouse model, the long non-coding RNA molecule lncD&T-1, which is coupled with Cy5-labeled stabilizing elements and functional elements, was injected into the tail vein. The distribution of Cy5 signal in vivo was detected by in vivo imaging. The organs in the figure are arranged in order from left to right and from top to bottom: heart, liver, spleen, lung, kidney, brain, and tumor.

[0177] Figure 7. In the HCT116 CDX nude mouse model, various variants / modifiers of the Cy5-labeled long non-coding RNA molecule lncD&T-1 were injected via the tail vein, and the distribution of Cy5 signal in vivo was detected by in vivo imaging.

[0178] 7A: In vivo imaging images at different time points after administration of various variants / modifiers;

[0179] 7B: Six hours after administration, the animals were sacrificed (each administration group included 3 animals that received parallel administration) and each organ was taken for fluorescence signal detection. The organs in the figure are arranged in the following order from left to right and from top to bottom: heart, liver, spleen, lung, kidney, brain, and tumor. It can be seen that 6 hours after administration, there are still high fluorescence signals in the kidney and tumor.

[0180] Figure 8. Flow cytometry analysis of the delivery effect of the long non-coding RNA molecule lncD&T-1 and its various mutants on tumor cells.

[0181] Figure 9. Flow cytometry detection of the efficiency of lncD&T-1, a long non-coding RNA molecule, in targeting tumor cells with exogenous nucleic acid fragments of different lengths. In the figure, 20, 40, 60, 80, 100, 200, and 400 refer to the length of the flanking sequence at the genomic position of the 182nt active sequence. If the number is to the left of 25, such as "20-25", it means that the 5' end of the 182nt sequence extends by 20nt, so the length of the "20-25" fragment is 202nt. Similarly, if the number is to the right of "25", it means that the 182nt sequence extends by 3'.

[0182] Figure 10. Base modification can effectively enhance the tumor-targeting signal intensity of the long non-coding RNA molecule lncD&T-1(25).

[0183] Figure 11. Drug efficacy in CDX tumor-bearing mouse model (long non-coding RNA molecule lncD&T-1 and its different modifications), 11A: tumor volume; 11B: tumor weight.

[0184] Figure 12. Long non-coding RNA molecule lncD&T1 and its different modifications, transmembrane delivery efficiency targeting tumor cells, HCT116 cell line.

[0185] Figure 13 shows that the serum stability of 25M2 was significantly improved after thiolation modification. In the figure, Blank is the molecular control with an equal amount of molecules; the Mock group is the control group with an equal amount of molecules after the same treatment steps as the serum incubation group (serum is first mixed with TRIZOL reagent to denature the serum, and then an equal amount of long non-coding RNA molecules are added to help determine the recovery rate of the extraction step); the inverted triangle "▽" marks the long non-coding RNA molecule band in the folded state, and the upright triangle "Δ" marks the long non-coding RNA molecule band in the linear state; the dashed box marks the modified sequence with the best serum stability (CAUαS modification).

[0186] Figure 14 shows that 25M2-CAUαS has good targeted delivery activity in various tumor cell lines, with a treatment concentration of 10 nM. In the figure, MCF-10A is normal human breast epithelial cells, which serve as a non-tumor control cell line. 25Sub-12 is a truncated control molecule with almost no targeted delivery activity (like the blank control, no fluorescence signal can be detected).

[0187] Figure 15 shows that after administration of 25M2-CAUαS, the tumor signal persisted in the body for up to 48 hours. In the upper figure, the organs are arranged from left to right and from top to bottom as follows: heart, liver, spleen, lung, kidney, brain, and tumor. The lower figure shows the tumor tissue. The control group (blank) consisted of 1 mouse model, and the experimental groups (25M2 molecule: unmodified; 25M2-CAUαS molecule: CAUαS) each consisted of 2 mice model.

[0188] Figure 16. The thiolated molecules have a stronger ability to activate key cytokines.

[0189] Figure 17. Antitumor efficacy of thiolated molecules in CT26 tumor-bearing mice when delivering single MMAEs. 17A: Tumor proliferation curves of single MMAEs delivered by three different thiolated long non-coding RNA molecules (tail vein administration, 5 mg / kg, q3d, n=6); 17B: Survival curves of single MMAEs delivered by three different thiolated long non-coding RNA molecules; 17C: Antitumor efficacy and survival curves of 25M2-CAUαS-MMAE at different doses in CT26 tumor-bearing mice; 17D: Antitumor efficacy of 25M2-Eribulin in CT26 tumor-bearing mice (tail vein administration, 5 mg / kg, q3d, n=6).

[0190] Figure 18. In vivo efficacy study: 25M2-CAUαS was coupled with 1, 2, and 4 MMAEs respectively, administered via tail vein at a dose of 0.3 mg / kg twice a week. After the experiment was terminated, the tumor was removed and weighed.

[0191] Figure 19. Pharmacodynamic evaluation of 25M2-CAUαS-4MMAE (CT26 tumor-bearing mice);

[0192] 19A. Tail vein administration (25M2-CAUαS-bridge2-(MMAE)4-01 conjugate), administered 5 times consecutively, with dose gradients of 0.3, 1, 3, and 6 mg / kg. The upper figure shows the tumor proliferation curve, and the lower figure shows the tumor weight data at the experimental endpoint.

[0193] 19B. Tail vein administration (25M2-CAUαS-bridge2-(MMAE)4 conjugate with hydrolysis and ring opening of succinimide), administered 5 times consecutively at dose gradients of 1, 3, and 6 mg / kg, tumor proliferation curve.

[0194] Figure 20. In vitro activity assay of 25M2-conjugated siRNA;

[0195] 20A: Flow cytometry was used to detect the delivery activity of the delivery element 25M2 and the chimeric molecule 25M2-siKRAS-1 / 2 coupled with siRNA in PANC-1 cells, and the results were obtained after incubation at 10 nM for 60 min.

[0196] 20B: RT-qPCR was used to detect the knockdown of target gene mRNA by chimeric molecules coupled with siRNA under transfection and incubation conditions. The transfection concentration was 10 nM and the incubation concentration was 100 nM. Cells were collected after 24 hours of treatment to detect the expression level of KRAS mRNA.

[0197] 20C: Immunoblotting detection of the knockdown of the target gene KRAS protein by 25M2-siRNA incubation at a concentration of 100 nM. Samples were collected and detected 48 hours after treatment.

[0198] Figure 21. In vivo Kras knockdown efficiency test of CT26 tumor-bearing CDX mouse model.

[0199] Figure 22. RT-qPCR detection of AR mRNA knockdown activity under 25M2-AR-ASO-1 / 25M2-AR-ASO-2 incubation conditions. The incubation concentration was 500 nM, and the samples were collected and detected after 48 hours of incubation. Detailed Implementation

[0200] Unless otherwise specified, the nucleic acid fragments represented by the sequence information in the following examples are all RNA fragments.

[0201] Example 1: Design, construction, and stability testing of long non-coding RNA molecules targeting tumors.

[0202] 1.1. Design, construction, and screening of the long non-coding RNA molecule lncD&T1

[0203] The main steps are as follows:

[0204] (1) Constructing a DNA library;

[0205] (2) An RNA library was obtained by in vitro transcription using a DNA library as a template;

[0206] (3) Incubate RNA libraries with cells for cell-level screening;

[0207] (4) Collect the incubated cells and extract RNA, and perform reverse transcription using specific primers. The primers are matched with the adapter sequence introduced in the library construction.

[0208] (5) The final RNA sub-library is used for NGS or Sanger sequencing to identify the most abundant nucleic acid fragments as delivery element candidates.

[0209] 5' adapter, sequence number SEQ ID NO.51:

[0210] 3' adapter, sequence number SEQ ID NO.52:

[0211] The candidate sequence obtained through the above screening process was named the long non-coding RNA molecule lncD&T1. The sequence was derived from human cells. In subsequent experiments, all lncD&T1 RNA molecules were prepared by in vitro transcription.

[0212] The nucleic acid sequence of lncD&T1 (number 25) is shown in SEQ ID NO.1.

[0213] SEQ ID NO.1 (the adapters at both ends are sequences introduced during library construction for screening):

[0214] SEQ ID NO.1:

[0215] The sequence after removing the connectors at both ends is SEQ ID NO. 53:

[0216] 6) In subsequent experiments, the sequence used as the negative control (NC) is shown in SEQ ID NO.2.

[0217] SEQ ID NO.2:

[0218] 1.2. A general method for labeling nucleic acids with Cy3 / Cy5 dyes

[0219] (1) In the in vitro transcription system using DNA as a template, in addition to adding the four unmodified ribonucleotides ATP, GTP, CTP, and UTP, Cy3-UTP or Cy5-UTP should be added (Cy3 labeling is suitable for RNA tracing at the cellular level, while Cy5 emission has a longer wavelength, better transdermal effect, and is suitable for in vivo animal tracing).

[0220] (2) Under the action of T7 RNA polymerase, Cy3 / Cy5-UTP is added to the RNA sequence in a random manner during RNA transcription, thereby achieving random labeling of RNA.

[0221] 1.3. Additional modifications to the stabilization module 2911

[0222] Furthermore, the sequence (2911) for enhancing nucleic acid stability, as shown in SEQ ID NO.3, is tandemly attached to the 3' or 5' end of a long non-coding RNA molecule to obtain a tandemly attached long non-coding RNA molecule with enhanced stability.

[0223] The sequence of 2911 is as shown in SEQ ID NO.3.

[0224] SEQ ID NO.3: GGAAGGGGGGAAGGAAAGGGA

[0225] 1.4. Stability test of long non-coding RNA molecule lncD&T1

[0226] Long non-coding RNA molecule lncD&T-1 (number 25), sequence 25-2911 (with 2911 tandemly at the 3' end), and sequence 2911-25 (with 2911 tandemly at the 5' end) were incubated with 10% fetal bovine serum. Samples were taken at time intervals (0, 20 min, 1 h, 3 h), and the stability of the sequences was then assessed by agarose gel electrophoresis. The results are shown in Figure 4.

[0227] The addition of stabilizing element 2911 to the flanking position of long non-coding RNA molecule number 25 significantly improves the serum stability of the sequence. Specifically,

[0228] When 2911 is added to the 5' end of 25, long non-coding RNA molecules can be preserved for up to 1 hour; when 2911 is added to the 3' end of 25, long non-coding RNA molecules can be preserved for up to 3 hours; while long non-coding RNA molecules alone can only be preserved for up to 20 minutes.

[0229] Similarly, when 100 ng of long non-coding RNA molecules were incubated in 95% mouse serum for 20 min to 1 h, the stability of the sequences was detected by agarose gel electrophoresis. It can be seen that the stability of all types of long non-coding RNA molecules was significantly increased after the addition of the stabilizing element 2911.

[0230] Example 2: Validation of the targeted delivery function of long non-coding RNA molecules to tumor cells in vitro (cell biology experiment)

[0231] Detecting the cell entry function of long non-coding RNA molecules in various cell lines

[0232] The following tumor cell lines were selected

[0233] Colorectal cancer: HCT116 (#CCL-247), HuTu80 (#HTB-40), KM12SM;

[0234] Liver cancer: MHCC-97H;

[0235] Pancreatic cancer: PANC-1 (#CRL-1469);

[0236] Stomach cancer: MKN74;

[0237] Osteosarcoma: Saos-2 (#HTB-85), U2OS (#HTB-96);

[0238] Cervical cancer: Hela (#CCL-2);

[0239] Breast cancer: SKBR3 (#HTB-30);

[0240] Prostate cancer: LNCap (#CRL-1740);

[0241] Leukemia: HEL 92.1.7(#TIB-180);

[0242] 2.1. Targeted delivery function test of long non-coding RNA molecules to tumor cells

[0243] The experimental method is as follows:

[0244] (1) Culture the cells in a 24-well plate (if it is a confocal detection experiment, the cells need to be placed in advance), and the density during the formal incubation experiment is about 80%-90%;

[0245] (2) The Cy3-labeled long non-coding RNA molecule lncD&T-1 was added to the serum-reduced medium to a final concentration of 100 nM. After incubation for 2 hours, RNase A was added to remove extracellular RNA, the cells were washed and fixed, and the cells were mounted for laser confocal microscopy detection.

[0246] Or (3) After incubation for 2 hours, the cell suspension treated with trypsin and washed was used for flow cytometry analysis of intracellular fluorescence signals;

[0247] The results are shown in Figure 1 and Figure 2.

[0248] As shown in Figure 1, the laser confocal microscopy results revealed clear intracellular pericellular signals, indicating that the tested long non-coding RNA molecules successfully entered HCT116 cells.

[0249] As shown in Figure 2, the flow cytometry results indicate that the tested long non-coding RNA molecules have delivery activity in various tumor cells and can effectively enter the tumor cell interior.

[0250] 2.2. Detection of transmembrane delivery efficiency of long non-coding RNA molecules modified with stable module functional elements

[0251] The method is the same as in the steps above.

[0252] Long non-coding RNA molecules lncD&T and their variants labeled with 100 nM Cy3 were incubated with different test cells for 2 hours. The cell suspensions were then trypsin-digested and washed for flow cytometry analysis. The long non-coding RNA molecules used in each group are as follows:

[0253] 25mut is a mutant of 25, with the sequence SEQ ID NO.4:

[0254] 3F30 is an immunomodulatory element, with the sequence SEQ ID NO.5:

[0255] 25sub5 is one of the subclones of 25, with the sequence SEQ ID NO.6:

[0256] 25-3F30 is a fusion fragment that connects the 3' end of the long non-coding RNA molecule numbered 25 to the 5' end of the 3F30 sequence;

[0257] 25sub5-2911 is a fusion fragment that connects the 3' end of the long non-coding RNA molecule numbered 25sub5 to the 5' end of the 2911 sequence;

[0258] The fusion fragment 25sub5-2911-3F30 is arranged sequentially from the 5' end to the 3' end as 25sub5, 2911, and 3F30.

[0259] The fusion fragment 25sub5-3F30-2911 is arranged sequentially from the 5' end to the 3' end as 25sub5, 3F30, and 2911.

[0260] The results are shown in Figure 5.

[0261] (1) After mutation (25mut) in the lncD&T1 sequence of long non-coding RNA molecules, the delivery activity targeting tumor cells is lost;

[0262] (2) The long non-coding RNA molecule lncD&T1(25) alone or conjugated with a specific sequence (3F30) still has the delivery activity targeting tumor cells;

[0263] (3) The delivery activity of the long non-coding RNA molecule lncD&T1 (25 and its subclone molecule 25sub5) to tumor cells was reduced after being modified by the stabilizing element 2911, but the delivery activity of the triplet fusion fragment was restored to the level of the unmodified stabilizing fragment.

[0264] Note: When a single long non-coding RNA molecule is modified with the 2911 stabilizing fragment, the secondary structure or active structure of the RNA is significantly affected by the stabilizing module (intracellular fluorescence intensity decreases). However, by further coupling the long non-coding RNA molecule with the 3F30 element to construct a triplet nucleic acid fragment, the secondary structure or active structure of the long non-coding RNA molecule and its transmembrane-mediated function are restored.

[0265] Furthermore, the stem structure, 20nt, 60nt and 80nt genomic flanking sequences from 3F30, the polyA tail (added to facilitate subsequent purification, which can be performed using oligo dT), and the 2911 sequence were added to the adapter-removed long non-coding RNA molecule 25 to construct the following long non-coding RNA molecule:

[0266] The stem structure sequence of 3F30 is (reverse complementary sequence):

[0267] The sequence is SEQ ID NO.7: GCAGUUGCCAUG

[0268] The sequence is SEQ ID NO.8: CAUGGCAACUGC

[0269] The 20nt, 60nt, and 80nt genome flanking sequences are as follows:

[0270] 20nt: The sequence is SEQ ID NO.9: CAGGGGGCUUUGUGACAUAC

[0271] 60nt: The sequence is SEQ ID NO.54:

[0272] 80nt: The sequence is SEQ ID NO.10:

[0273] F20-25-80F, sequence number SEQ ID NO.11:

[0274] F20-25-80F-2911, sequence number SEQ ID NO.12:

[0275] F60-25-80F, sequence number SEQ ID NO.13:

[0276] F60-25-80F-2911, sequence number SEQ ID NO.14:

[0277] 25-M2, with mutations at both ends of the original sequence, the sequence is SEQ ID NO.15:

[0278] 25-M2-2911, the original sequence was mutated at both ends, and stabilizing elements 2911 were added. The sequence is SEQ ID NO.16:

[0279] 25-M4, with mutations at both ends of the original sequence, the sequence is SEQ ID NO.17:

[0280] 25-M4-2911, the original sequence was mutated at both ends, and stabilizing elements 2911 were added. The sequence is SEQ ID NO.18.

[0281] The detection results are shown in Figure 12. In the colorectal cancer cell line HCT116, different long non-coding RNA molecules labeled with 100 nM Cy3 were incubated for 2 h, followed by incubation at 37 °C for 30 min (degradation of free nucleic acids) with 60 μg / mL RNase A. After washing once with PBS, trypsin was added to digest the cells, followed by the addition of complete culture medium to terminate the reaction. The cell suspension was collected, centrifuged, washed, and finally resuspended in PBS for flow cytometry detection.

[0282] The test results showed that

[0283] (1) Mutations in the linker sequence have little effect on delivery activity, while the core region segment (25sub7 / 16) retains a certain level of delivery activity;

[0284] (2) The delivery activity of 25, 25-M2, 25-M4, and 25sub7 / 16 was inhibited after the addition of 2911;

[0285] (3) The delivery activity of F20-25-80F and F60-25-80F is not affected by 2911.

[0286] 2.3. Functional testing of lncD&T1 modified variants of long non-coding RNA molecules

[0287] Similarly, using 100 nM Cy3-lncD&T1 and its various modified lncD&T1 variants, HCT116 tumor cells were incubated for 2 hours. The resulting cell suspension, after trypsin digestion and washing, was used for flow cytometry analysis.

[0288] The sequence of 25mut is SEQ ID NO.4:

[0289] The structural descriptions and sequences of the other modified variants are as follows:

[0290] 25sub-1 (with the 5' adapter removed), sequence number SEQ ID NO.19:

[0291] 25sub-2 (with the 3' adapter removed), sequence number SEQ ID NO.20:

[0292] 25sub-3 (5' adapter truncated by 23nt), sequence is SEQ ID NO.21:

[0293] 25sub-4 (3' adapter truncated by 23nt), sequence is SEQ ID NO.22:

[0294] 25sub-5 (the 5' / 3' adapter is truncated by 23nt), the sequence is SEQ ID NO.23:

[0295] 25sub-6 (deleted single-stranded regions 157–177), sequence number SEQ ID NO.24:

[0296] 25sub-7 (sub-1 with a further 20nt deletion at the 5' end), sequence number SEQ ID NO. 25:

[0297] 25sub-8 (with a further 20nt deletion at the 5' end compared to Sub-7), sequence number SEQ ID NO.26:

[0298] 25sub-9 (with a further 20nt deletion at the 5' end compared to Sub-8), sequence number SEQ ID NO. 27:

[0299] 25sub-10 (with a further 20nt deletion at the 5' end compared to Sub-9), sequence number SEQ ID NO.28:

[0300] 25sub-11 (with a further 20nt deletion at the 5' end compared to Sub-10), sequence number SEQ ID NO. 29:

[0301] 25sub-12 (with a further 20nt deletion at the 5' end compared to Sub-11), sequence number SEQ ID NO. 30:

[0302] 25sub-13 (with a further 20nt deletion at the 3' end compared to Sub-2), sequence number SEQ ID NO. 31:

[0303] 25sub-14 (with a further 20nt deletion at the 3' end compared to Sub-13), sequence number SEQ ID NO.32:

[0304] 25sub-15 (with a further 20nt deletion at the 3' end compared to Sub-14), sequence number SEQ ID NO. 33:

[0305] 25sub-16 (with a further 20nt deletion at the 3' end compared to Sub-15), sequence number SEQ ID NO. 34:

[0306] 25sub-17 (with a further 20nt deletion at the 3' end compared to Sub-16), sequence number SEQ ID NO. 35:

[0307] 25sub-18 (with a further 20nt deletion at the 3' end compared to Sub-17), sequence number SEQ ID NO. 36:

[0308] 25sub-7 / 16 (overlapping region of Sub-7 and Sub-16), sequence number SEQ ID NO.37:

[0309] The results are shown in Figure 8.

[0310] (1) The linker sequences at both ends of the long non-coding RNA molecule lncD&T1 (25) do not affect its function, but truncation of the sequence, especially the core region, will affect the function of the long non-coding RNA molecule lncD&T1.

[0311] 2.3. Cytotoxicity assay of long non-coding RNA molecules

[0312] The aforementioned long non-coding RNA molecules were seeded at 80 ng / well in 96-well plates and transfected into HCT116 cells with Lipofectamine RNAiMAX reagent. After 24 hours, the cytotoxicity of the long non-coding RNA molecules to the cells was detected by the CCK-8 assay. The results showed that the aforementioned long non-coding RNA molecules had no significant cytotoxicity.

[0313] Example 3: Validation of in vivo tumor-targeting delivery function of long non-coding RNA molecules (CDX tumor-bearing nude mouse in vivo imaging)

[0314] 1. In vivo distribution assay of CDX tumor-bearing mouse model (uncoupled long non-coding RNA molecules)

[0315] Nude mice: Sichuan Vital River Laboratory Animal Technology Co., Ltd., BALB / cNude-VR-♀-6-8 weeks old.

[0316] Human colon cancer cells HCT116: Nanjing Kebai Biotechnology Co., Ltd., CBP60028, P4

[0317] CDX Model Construction

[0318] 1. After observing nude mice in isolation for one week without any obvious abnormalities, select groups with similar weights for future use;

[0319] 2. HCT116 cells were cultured using McCoy's 5a (10% fetal bovine serum + 1% penicillin-streptomycin). Once the cells reached the logarithmic growth phase, the cell pellet was collected and resuspended in PBS to a concentration of 5 × 10⁻⁶. 7 / ml;

[0320] 3. Wipe the skin of the mouse's back and shoulder blades with alcohol, and use a 1ml syringe to draw 100μL of cell suspension (1×10⁻⁶). 6 Injected into the right scapular region of the mouse;

[0321] 4. Observe the overall health of the mice routinely, and measure the tumor volume three times a week. When the volume reaches 500 mm², continue monitoring. 3 It should be incorporated into the experimental design.

[0322] Experimental methods

[0323] (1) HCT116 CDX model nude mice were administered drugs via tail vein injection (each of the long non-coding RNA molecules in Examples 1 and 2 above was given and labeled with Cy5). The drug administration injection dose gradient was: 1 μg / mouse, 5 μg / mouse, 10 μg / mouse, 20 μg / mouse, and 60 μg / mouse.

[0324] (2) In vivo imaging was performed at 1, 3 and 6 hours after injection to detect Cy5 signal;

[0325] (3) At the last time point, an autopsy was performed to detect Cy5 signals in various tissues and organs;

[0326] The results showed that

[0327] (1) Figure 3 shows that after administration, Cy5-labeled lncD&T1 exhibited good tumor tissue specificity at various doses, indicating that lncD&T1 also has significant tumor targeting function in vivo.

[0328] (2) Tumor fluorescence signal [p / s / cm2 / sr / (μw / cm2)] after administration of different types of long non-coding RNA molecules 2 The mean values ​​are shown in the table below;

[0329] In summary, the long non-coding RNA molecule lncD&T1(25) and its various variants / modifiers have significant delivery activity targeting solid tumors, and at the same time, they have high drug accumulation in the kidneys after administration.

[0330] 2. In vivo distribution of CDX-bearing tumor model in nude mice (Second group experiment)

[0331] Using the same CDX-bearing nude mouse model, the in vivo distribution of lncD&T1 conjugates was tested.

[0332] The administration method is tail vein, and the dosage is also 0.5 mg / kg.

[0333] The samples used were specifically:

[0334] 25 is a long non-coding RNA molecule of lncD&T1;

[0335] 25mut is a mutant of 25, with the sequence: SEQ ID NO.4

[0336] The 25sub5 subclone is a subclone of 25, with the sequence: SEQ ID NO.6

[0337] 25-3F30 is a fusion fragment that connects the 3' end of the long non-coding RNA molecule numbered 25 to the 5' end of the 3F30 sequence;

[0338] 25-2911 is a fusion fragment that connects the 3' end of the long non-coding RNA molecule numbered 25 to the 5' end of the 2911 sequence;

[0339] 25sub5-2911 is a fusion fragment that connects the 3' end of the long non-coding RNA molecule numbered 25sub5 to the 5' end of the 2911 sequence;

[0340] The fusion fragment 25sub5-3F30-2911 is arranged sequentially from the 5' end to the 3' end as 25sub5, 3F30, and 2911.

[0341] The results are shown in Figure 6.

[0342] (1) In vivo targeting tests showed that 25, 25-2911, and 25Sub-5 had no residual liver signal 6 hours after tail vein administration and had good tumor signal enrichment.

[0343] (2) Photographs of fluorescence signals collected from tissues and organs of the dissected model mouse. The order of tissues and organs from left to right and from top to bottom is: heart, liver, spleen, lung, kidney, brain, and tumor. Among them, "25mut" is a mutant of the 25 sequence without target delivery activity; "25Sub-5" is one of the subclones of 25; "2911" is a stable element; and "3F30" is an immune regulatory element.

[0344] As can be seen, unlike in vitro experiments, among the seven tested sequences, 25-2911, which was modified with a stabilizing element, not only had a better tumor-targeting signal but also higher specificity.

[0345] 3. The chemically modified long non-coding RNA molecule lncD&T-1(25) has a better tumor-targeting effect.

[0346] Using the same method and mouse model, the injection dose was 5 μg / mouse (0.25 mg / kg), and in vivo imaging was performed to detect Cy5 signal at 3 and 6 hours after injection;

[0347] 2'-OMe-25 is a chemically modified long non-coding RNA molecule lncD&T-1(25). (During in vitro transcription, 2'-OMe-UTP and 2'-OMe-CTP are incorporated. Since the modified sequence is also used for in vivo experimental tracking, Cy5-UTP is also present in the transcription system. Therefore, all the "C"s in the entire RNA are 2'-OMe modified "Cs," while the "U"s are divided into two categories: one part is modified with "2'-OMe," and the other part is unmodified but carries the Cy5 fluorescent group. The A and G in the RNA chain are unmodified.)

[0348] The results are shown in Figure 10.

[0349] 2'-OMe modification can effectively enhance the tumor-targeting signal intensity of the long non-coding RNA molecule lncD&T-1(25).

[0350] 4. Pharmacological experiments in tumor-bearing mouse models

[0351] (1) Balb / c mice were inoculated with CT26 cells to establish a tumor-bearing mouse model, 2.0 × 10 5 cells / animal, subcutaneously inoculated;

[0352] (2) The tumor grows to 120-130 mm 3 The medication was administered at a dose of 5 mg / kg via the tail vein, once every 3 days for a total of 4 doses.

[0353] (3) The specific groupings (three animals per group) are as follows:

[0354] 1) Solvent control group

[0355] 2) 25-2911_5mg / kg (iv, Q3D*4, once every 3 days, for 4 consecutive doses)

[0356] 3) 25M2-2911_5mg / kg (iv, Q3D*4)

[0357] 4) 25M4-2911_5mg / kg (iv, Q3D*4)

[0358] 5)F20-25-80F-2911_5mg / kg(iv,Q3D*4)

[0359] 6)F60-25-80F-2911_5mg / kg(iv,Q3D*4)"

[0360] Thirteen days after drug administration, the experiment was terminated, and tumor size was measured. The results (Figure 11) show...

[0361] (1) 25-2911 and F60-25-80F-2911 showed the strongest anti-tumor effects, with tumor inhibition rates (%TGI) of ~80.80% and 80.43%, respectively;

[0362] (2) Other groups also showed certain therapeutic effects.

[0363] Example 4: Delivery efficiency test of exogenous nucleic acid fragments mediated by long non-coding RNA molecules.

[0364] 1. Long non-coding RNA molecules can mediate the targeting of tumor cells by longer exogenous nucleic acid fragments.

[0365] (1) Using the long non-coding RNA molecule lncD&T-1(25) as a template, nucleic acid fragments of different lengths (20nt, 40nt, 60nt, 80nt, 100nt, 200nt) were added to its flanks. Specifically, 20-25 means that a 20nt flanking sequence (extended fragment) was added to the 5' end of the 25 sequence, and 100-25-100 means that a 100nt flanking sequence (extended fragment) was added to each end of the 25 sequence.

[0366] (2) Referring to the in vitro experimental steps of Example 2, HCT116 cells were treated with 100 nM for 2 hours, then treated with RNase A and washed. The cells were then used for flow cytometry analysis and laser confocal analysis, respectively.

[0367] 20-25, sequence number SEQ ID NO.38:

[0368] 40-25, sequence number SEQ ID NO.39:

[0369] 60-25, sequence number SEQ ID NO.40:

[0370] 80-25, sequence number SEQ ID NO.41:

[0371] 100-25, sequence number SEQ ID NO.42:

[0372] 25-20, sequence number SEQ ID NO.43:

[0373] 25-40, sequence number SEQ ID NO.44:

[0374] 25-60, sequence number SEQ ID NO.45:

[0375] 25-80, sequence number SEQ ID NO.46:

[0376] 25-100, sequence number SEQ ID NO.47:

[0377] 100-25-100, sequence number SEQ ID NO.48:

[0378] 200-25-200, the sequence is SEQ ID NO.49:

[0379] 400-25-400, sequence number SEQ ID NO.50:

[0380] The results are shown in Figure 9. It can be seen that...

[0381] Even after being conjugated with a longer extended fragment (60 nt or longer), lncD&T1(25) still maintains good delivery efficiency targeting tumor cells. This suggests that the long non-coding RNA molecule lncD&T1(25), which contains flanking sequences (extended fragments), can be used for tumor-targeted delivery of ncRNAs and exogenous protein genes.

[0382] Example 5: Optimization of Long Non-coding RNA Molecules

[0383] In Example 2 above, the adapter sequence of the long non-coding RNA molecule lncD&T1(25) was replaced to obtain a new long non-coding RNA molecule named 25M2 (SEQ ID NO.15). After stability testing and pharmacodynamic experiments (see Figure 12), the function of 25M2 was no weaker than that of the long non-coding RNA molecule lncD&T1(25). It can be seen that replacing the adapter sequence does not affect the activity of the long non-coding RNA molecule.

[0384] 2. Molecular optimization using modified ribonucleotide triphosphates instead of normal ribonucleotides.

[0385] To further optimize the stability of long non-coding RNA molecules, modified ribonucleotide triphosphates were used to replace normal ribonucleotides. The resulting RNA was more resistant to nucleases. The modified ribonucleotides completely replaced the corresponding ribonucleotides in the sequence (e.g., C, A, U, and G were replaced with CTPαS, ATPαS, UTPαS, and GTPαS, respectively). The modified 25M2-CαS indicates that all C values ​​in the 25M2 molecule were replaced with CTPαS; 25M2-CAUαS indicates that all C, A, and U values ​​in the 25M2 molecule were replaced with CTPαS, ATPαS, and UTPαS, respectively. The following functional verifications were performed.

[0386] 2.1 In vitro stability test

[0387] After incubating the long non-coding RNA molecules 25-CAUαS or 25M2-CAUαS, which had undergone CTPαS, ATPαS, and UTPαS substitutions, with 95% mouse serum for a certain period of time, the target long non-coding RNA molecules were extracted using a method similar to that described in the previous examples, and detected by agarose gel electrophoresis. The detection used unmodified long non-coding RNA molecules (25M2) as a control. The results are shown in Figure 13.

[0388] (1) The long non-coding RNA molecules with modified nucleotide substitutions maintained a level comparable to the (unincubated) control group after 60 minutes of incubation (marked by the black dashed box);

[0389] (2) Long non-coding RNA molecules that undergo nucleotide substitution have more folded states. (As shown).

[0390] (3) Among various modification methods, the whole sequence CAUαS modification has the best stability.

[0391] In the figure, the Mock group is formed by first mixing serum with TRIZOL reagent to denature the serum, and then adding an equal amount of long non-coding RNA molecules to determine the recovery rate of the extraction step; 0 min is the time point at which the long non-coding RNA molecules are immediately mixed with TRIZOL reagent after being mixed with serum, corresponding to the start of incubation.

[0392] 25M2-N1-Me-pUαS is: all UTPs in the 25M2 molecule are replaced with N1-Me-pUTPαS (CAS No.: 1428903-59-6), and the remaining triphosphate ribonucleotide monomers are unmodified. The RNA obtained under these conditions is named 25M2-N1-Me-pUαS.

[0393] 25M2-CαS is: all CTP in the 25M2 molecule is replaced with CTPαS (CAS No.: 110972-40-2), and the remaining triphosphate ribonucleotide monomers are unmodified. The RNA obtained under these conditions is named 25M2-CαS.

[0394] 25M2-CAαS is: CTP and ATP in the 25M2 molecule are replaced with CTPαS and ATPαS respectively (CAS No.: 29220-54-0), and the remaining triphosphate ribonucleotide monomers are unmodified monomers. The RNA obtained under these conditions is named 25M2-CAαS.

[0395] 25M2-CGαS is: CTP and GTP in the 25M2 molecule are replaced with CTPαS and GTPαS respectively, and the remaining triphosphate ribonucleotide monomers are unmodified. The RNA obtained under these conditions is named 25M2-CGαS.

[0396] 25M2-CUαS is: CTP and UTP in the 25M2 molecule are replaced with CTPαS and UTPαS respectively (CAS No.: 18875-71-3), and the remaining triphosphate ribonucleotide monomers are unmodified. The RNA obtained under these conditions is named 25M2-CUαS.

[0397] 25M2-CAGαS is: CTP, ATP, and GTP in the 25M2 molecule are replaced with CTPαS, ATPαS, and GTPαS, respectively, and the remaining triphosphate ribonucleotide monomers are unmodified. The RNA obtained under these conditions is named 25M2-CAGαS.

[0398] 25M2-CAUαS is: CTP, ATP, and UTP in the 25M2 molecule are replaced with CTPαS, ATPαS, and UTPαS, respectively, and the remaining triphosphate ribonucleotide monomers are unmodified. The RNA obtained under these conditions is named 25M2-CAUαS.

[0399] 25M2-CAGUαS is: CTP, ATP, UTP and GTP in the 25M2 molecule are replaced with CTPαS, ATPαS, UTPαS and GTPαS respectively. The RNA obtained under this condition is named 25M2-CAUαS.

[0400] 2.2. The CAUαS-modified molecules still exhibit good delivery activity in various tumor cell lines.

[0401] Using a method similar to that described in the previous embodiments, Cy3-labeled 25M2-CAUαS molecules were incubated with 42 tumor cell lines, followed by trypsin digestion and washing. Finally, the proportion of test cells with Cy3 signal was detected by flow cytometry to determine the efficiency of 25M2-CAUαS molecules entering the cells (two incubation doses of 10 nM and 33 nM).

[0402] The results are shown in Figure 14, indicating that all tumor cells had a high Cy3 positivity rate, suggesting that the CAUαS-modified molecule still has good targeted delivery function to tumor cells; in the figure, MCF 10A is a human normal breast epithelial cell, which serves as a non-tumor cell control.

[0403] 2.3. In vivo activity test of CAUαS-modified molecules

[0404] Using a method similar to that described in the previous embodiments, the Cy5-labeled 25M2-CAUαS sequence was administered to HCT116CDX model mice via tail vein injection. Cy5 signaling in various tissues, organs, and tumors was detected 48 hours later upon dissection.

[0405] The results are shown in Figure 15, indicating that:

[0406] The CAUαS-modified molecule showed a stronger signal intensity in tumors than the unmodified molecule, suggesting that the improved stability also leads to better in vivo efficacy.

[0407] 2.4 The modified molecules enhance the stimulation of inflammatory cytokines.

[0408] HCT116 cells were transfected with equal amounts of 25M2 and 25M2-CAUαS molecules (cell density ~80%, final transfection concentration 10 nM). Cells were collected 24 hours later to detect the expression levels of typical immune-related inflammatory cytokines.

[0409] The results, as shown in Figure 16, indicate that the thiolated molecules have a stronger activating ability for immune-related inflammatory cytokines than the unmodified molecules. Example 6: Synthesis of adaptor compounds for conjugating long non-coding RNA molecules / modified long non-coding RNA molecules with toxins. Unless otherwise specified, all raw materials, reagents, and solvents used in this example are of analytical grade.

[0410] Explanation of main solvents, reagents, and abbreviations: Ac: Acetyl; Boc2O: Di-tert-butyl dicarbonate; DCM: Dichloromethane; DIC: N,N'-diisopropylcarbodiimide; DIEA: N,N-diisopropylethylamine; DMAP: 4-dimethylaminopyridine; DMF: N,N-dimethylformamide; DMTr: 4,4'-dimethoxytriphenylmethyl; EDCI: 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride; HATU: O-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethylurea hexafluorophosphate (a condensation reagent); HOBt: 1-hydroxybenzotriazole; MTBE: Methyl tert-butyl ether; PfpO-TFA: Pentafluorophenyl trifluoroacetic acid; TFA: Trifluoroacetic acid.

[0411] First, the various unmodified / modified long non-coding RNA molecules described in the foregoing embodiments are conjugated with toxins (MMAE). The conjugation is accomplished through an adaptor compound, and the specific chemical synthesis steps of the adaptor compound are as follows.

[0412] 6.1 The synthetic routes for the linkers LKa1 and LKa2 and their activated esters (LKa1-P, LKa2-P) are as follows:

[0413] Specifically,

[0414] Synthesis of intermediate LKa1-Z01:

[0415] Cystamine hydrochloride (CAS: 56-17-7, 12.0 g, 78.8 mmol), DIEA (30.6 g, 236 mmol), DMF (200 mL), and water (20 mL) were added sequentially to a 500 mL single-necked flask equipped with a magnetic stirrer, and the mixture was stirred at a constant speed (500 r / min). Acetic anhydride (4.02 g, 39.4 mmol) was then slowly added dropwise to the reaction system over 0.5 h. After the addition was complete, the mixture was stirred for another 4 h at room temperature (20–25 °C). The reaction was monitored by TLC (developing solvent: DCM / MeOH, 10 / 1), which showed that most of the starting material was converted, and product R... f The value is approximately 0.1.

[0416] The reaction solution was concentrated under reduced pressure at 40°C to an oily state to obtain a crude product, which was purified by silica gel column chromatography (eluent: DCM / MeOH, 30 / 1 to 10 / 1, containing 0.5% vol DIEA). The product fraction was collected and concentrated, and dried under vacuum (50-70 Pa) for 2 hours to obtain 3.21 g of a pale yellow oily substance (yield 31%).

[0417] MS(ESI): m / z[M+H] +The theoretical value is 195.1, and the measured value is 195.1.

[0418] Synthesis of intermediate LKa1-Z02:

[0419] To a 250 mL single-necked flask equipped with a magnetic stirrer, LKa1-Z01 (2.95 g, 15.2 mmol), Boc-DL-aspartic acid (CAS: 120341-32-4, 1.18 g, 5.06 mmol), DIEA (1.96 g, 15.2 mmol), and anhydrous DMF (100 mL) were added sequentially, and the mixture was stirred at a constant speed (500 rpm). The system temperature was maintained at 5–15 °C in a cold bath. HATU (CAS: 148893-10-1, 6.35 g, 16.7 mmol) was added to the flask in five portions over 15 min. After the addition was complete, the reaction system was allowed to naturally warm to room temperature (20–25 °C) and stirred for 16 h. The reaction was monitored by TLC (developing solvent: DCM / MeOH, 10 / 1), which showed that the starting material was basically converted and the product R... f The value is approximately 0.5.

[0420] The reaction was quenched with 5 mL of water and the reaction solution was concentrated under reduced pressure at 60 °C. The crude product was purified by silica gel column chromatography (eluent: DCM / MeOH, 50 / 1 to 10 / 1). The product fraction was collected and concentrated and dried under vacuum (50-70 Pa) for 1 h to obtain 2.32 g of pale yellow oil (yield 78%).

[0421] MS(ESI): m / z[M+H] + Theoretical value 586.2, measured value 586.1; m / z[M+Na] + The theoretical value is 608.2, and the measured value is 608.1.

[0422] Synthesis of intermediate LKa1-Z03:

[0423] LKa1-Z02 (1.47 g, 2.51 mmol) and 1,4-dioxane (10 mL) were added sequentially to a 50 mL single-necked flask equipped with a magnetic stirrer. The system temperature was maintained at 20–30 °C and the mixture was stirred at a constant speed (500 r / min). A 4N HCl / 1,4-dioxane solution (10 mL) was slowly added to the reaction system, and stirring was continued for 1 h. The reaction was monitored by TLC (developing solvent: DCM / MeOH, 5 / 1), indicating that the starting material conversion was complete and the product R was ready. f The value is approximately 0.5.

[0424] The reaction solution was concentrated to dryness under reduced pressure at 40°C. The crude product was purified by silica gel column chromatography (eluent: DCM / MeOH, 10 / 1 to 7 / 1). The product fraction was collected and concentrated, and dried under vacuum (50-70 Pa) for 1 h to give 629 mg of white solid (yield 52%, hydrochloride).

[0425] MS(ESI): m / z[M+H] + The theoretical value is 486.1, and the measured value is 486.1.

[0426] Synthesis of LKa1:

[0427] To a 25 mL single-necked flask equipped with a magnetic stirrer, LKa1-Z03 (100 mg, 0.191 mmol, hydrochloride), DIEA (50 mg, 0.383 mmol), DMAP (5 mg, 0.041 mmol), and DMF (5 mL) were added sequentially. The reaction system was cooled in an ethanol bath at 10–20 °C and stirred at a constant speed (500 rpm). Succinic anhydride (19 mg, 0.191 mmol) was added over 5 min, and stirring continued for 5 h. TLC analysis (developing solvent: DCM / MeOH, 10 / 1) showed complete conversion of the starting material and the product R... f The value is approximately 0.2.

[0428] The reaction was quenched with 5 mL of water and the reaction solution was concentrated under reduced pressure at 60 °C. The crude product was purified by silica gel column chromatography (eluent: DCM / MeOH, 10 / 1 to 5 / 1). The product fraction was collected and concentrated and dried under vacuum (50-70 Pa) for 1 h to obtain 107 mg of colorless oil (yield 96%).

[0429] MS(ESI): m / z[MH] - Theoretical value 584.1, measured value 584.1; m / z [M+H] + Theoretical value 586.1, measured value 585.6; m / z [M+Na] + The theoretical value is 608.1, and the measured value is 607.5.

[0430] Synthesis of activated ester LKa1-P:

[0431] LKa1 (101 mg, 0.172 mmol), pentafluorophenol (38 mg, 0.206 mmol), and DMF (5 mL) were added sequentially to a 25 mL single-necked flask equipped with a magnetic stirrer. The reaction system was cooled in an ethanol bath at 15–20 °C and stirred at a constant speed (500 rpm). DIC (44 mg, 0.344 mmol) was added in two portions over 5 min, and stirring continued for 17 h. TLC analysis (developing solvent: DCM / MeOH, 10 / 1) showed complete conversion of the starting material and the product R... f The value is approximately 0.8.

[0432] The reaction solution was concentrated under reduced pressure at 60°C to an oily state, diluted with DCM (20 mL), and washed once each with 0.2 M KHSO4 aq., saturated sodium bicarbonate, and saturated sodium chloride solution (15 mL each). After drying and concentrating the organic phase, it was crystallized with DCM / MTBE (1 / 10) and dried under vacuum (50–70 Pa) for 1 h to obtain 90 mg of white powdery solid (yield 70%).

[0433] MS(ESI): m / z[M+H] + Theoretical value 752.1, measured value 752.1; m / z[M+Na] + The theoretical value is 774.1, and the measured value is 774.0.

[0434] Synthesis of LKa2:

[0435] To a 50 mL single-necked flask equipped with a magnetic stirrer, LKa1-Z03 (200 mg, 0.383 mmol, hydrochloride), DIEA (99 mg, 0.766 mmol), and DMF (10 mL) were added sequentially. The reaction system was cooled in an ethanol bath at 10–20 °C and stirred at a constant speed (500 rpm). Adipic anhydride (74 mg, 0.575 mmol) was added in three portions over 5–10 min, and stirring continued for 3 h. TLC analysis (developing solvent: DCM / MeOH, 5 / 1) showed complete conversion of the starting material and the product R... f The value is approximately 0.4.

[0436] The reaction was quenched with 5 mL of water and the reaction solution was concentrated under reduced pressure at 60 °C. The crude product was purified by silica gel column chromatography (eluent: DCM / MeOH, 10 / 1 to 5 / 1). The product fraction was collected and concentrated and dried under vacuum (50-70 Pa) for 1 h to obtain 136 mg of brownish-yellow oil (yield 58%).

[0437] MS(ESI): m / z[MH] - The theoretical value is 612.2, and the measured value is 612.1.

[0438] Synthesis of activated ester LKa2-P:

[0439] LKa2 (136 mg, 0.222 mmol), pentafluorophenol (49 mg, 0.266 mmol), and DMF (5 mL) were added sequentially to a 25 mL single-necked flask equipped with a magnetic stirrer. The reaction system was cooled in an ethanol bath at 15–20 °C and stirred at a constant speed (500 rpm). DIC (56 mg, 0.444 mmol) was added in three portions over 5 min, and stirring continued for 22 h. TLC analysis (developing solvent: DCM / MeOH, 5 / 1) showed complete conversion of the starting material and the product R... f The value is approximately 0.9.

[0440] The reaction solution was concentrated under reduced pressure at 60°C to an oily state, diluted with DCM (20 mL), and washed once each with 0.2 M KHSO4 aq., saturated sodium bicarbonate, and saturated sodium chloride solution (15 mL each). After drying and concentration, the organic phase was crystallized with DCM / MTBE (1 / 10) and dried under vacuum (50–70 Pa) for 1 h to obtain 84 mg of pale yellow solid (yield 49%).

[0441] MS(ESI): m / z[M+H] + The theoretical value is 780.2, and the measured value is 780.1.

[0442] 6.2 The synthetic route of the linker LKa12 and its activated ester (LKa12-P) is as follows:

[0443] Specifically,

[0444] Synthesis of intermediate LKa12-Z01:

[0445] Following the method described in Synlett 2010, 9, 1331-1332, 1.86 g of a white solid was synthesized from 5-aminoisophthalic acid (CAS: 99-31-0, 1.4 g), with a yield of 86%. MS (ESI): m / z [MH] - The theoretical value is 280.1, and the measured value is 280.1.

[0446] Synthesis of intermediate LKa12-Z02:

[0447] To a 100 mL single-necked flask equipped with a magnetic stirrer, LKa1-Z03 (1.13 g, 2.17 mmol), LKa12-Z01 (277 mg, 0.985 mmol), DIEA (382 mg, 3.0 mmol), and anhydrous DMF (15 mL) were added sequentially, and the mixture was stirred at a constant speed (500 rpm). The system temperature was maintained at 5–15 °C in a cold bath. HATU (CAS: 148893-10-1, 899 mg, 2.36 mmol) was added to the flask in 4–5 batches over 15 min. After the addition was complete, the reaction system was allowed to naturally warm to room temperature (20–25 °C) and stirred for 2 h. The reaction was monitored by TLC (developing solvent: DCM / MeOH, 5 / 1), showing that the starting material was basically converted and the product R… f The value is approximately 0.5.

[0448] The reaction was quenched with 5 mL of water and the reaction solution was concentrated under reduced pressure at 60 °C. The crude product was purified by silica gel column chromatography (eluent: DCM / MeOH, 10 / 1 to 5 / 1). The product fraction was collected and concentrated and dried under vacuum (50–70 Pa) for 1 h to give 733 mg of pale yellow solid (yield 61%).

[0449] MS(ESI): m / z[M+H] + Theoretical value 1216.3, measured value 1216.2; m / z[M+Na] + The theoretical value is 1238.3, and the measured value is 1238.1.

[0450] Synthesis of intermediate LKa12-Z03:

[0451] LKa12-Z02 (733 mg, 0.602 mmol) and 1,4-dioxane (10 mL) were added sequentially to a 50 mL single-necked flask equipped with a magnetic stirrer. The system temperature was maintained at 20–30 °C and the mixture was stirred at a constant speed (500 r / min). A 4N HCl / 1,4-dioxane solution (10 mL) was slowly added to the reaction system, and stirring was continued for 1 h. LCMS analysis showed that the starting material conversion was complete. The reaction solution was concentrated to dryness under reduced pressure at 40 °C and dried under vacuum (50–70 Pa) for 1 h to obtain 1.0 g of a brownish-yellow oil (hydrochloride).

[0452] MS(ESI): m / z[M+H] + Theoretical value 1116.3, measured value 1116.1; m / z[M+Na] + The theoretical value is 1138.3, and the measured value is 1138.1.

[0453] Synthesis of LKa12:

[0454] To a 50 mL single-necked flask equipped with a magnetic stirrer, dodecanoic acid (CAS: 693-23-2, 102 mg, 0.445 mmol), DIEA (288 mg, 2.23 mmol), and DMF (10 mL) were added sequentially. The reaction system was cooled in an ethanol bath at 15–20 °C and stirred at a constant speed (500 r / min). PfpO-TFA (137 mg, 0.49 mmol) was added over 10 min, and stirring continued for 1 h. LC-MS analysis showed that the starting diacid was essentially converted to a single activated ester. While maintaining stirring, LKa12-Z03 (695 mg, hydrochloride) was added to the reaction system in 3–4 batches over 10 min, and stirring continued for 6 h. TLC analysis (developing solvent: DCM / MeOH, 5 / 1) showed that the starting material conversion was complete, and product R... f The value is approximately 0.4.

[0455] The reaction was quenched with 5 mL of water and the reaction solution was concentrated under reduced pressure at 60 °C. The crude product was purified by silica gel column chromatography (eluent: DCM / MeOH, 50 / 1 to 10 / 1). The product fraction was collected and concentrated and dried under vacuum (50-70 Pa) for 1 h to obtain 175 mg of brownish-yellow oil (32% yield from two steps from LKa12-Z02).

[0456] MS(ESI): m / z[M+H] + Theoretical value 1328.4, measured value 1328.3; m / z [1 / 2M+H] + The theoretical value is 664.7, and the measured value is 664.7.

[0457] Synthesis of activated ester LKa12-P:

[0458] LKa12 (85 mg, 0.064 mmol), DIEA (33 mg, 0.256 mmol), and DMF (5 mL) were added sequentially to a 25 mL single-necked flask equipped with a magnetic stirrer. The reaction system was cooled in an ethanol bath at 15–20 °C and stirred at a constant speed (500 rpm). PfpO-TFA (36 mg, 0.128 mmol) was added within 5 min, and stirring continued for 1.5 h. TLC analysis (developing solvent: DCM / MeOH, 5 / 1) showed complete conversion of the starting material and the product R... f The value is approximately 0.6.

[0459] The reaction solution was concentrated under reduced pressure at 60°C to an oily state, diluted with DCM (10 mL), and then stirred with saturated sodium bicarbonate solution (10 mL) to form a white suspension. The mixture was filtered to collect the solid, which was dried under vacuum (50–70 Pa) for 1 h to obtain 75 mg of white solid (yield 78%).

[0460] MS(ESI): m / z[M+H] + Theoretical value 1494.4, measured value 1494.2; m / z [1 / 2M+H] + The theoretical value is 747.7, and the measured value is 747.7.

[0461] 6.3 The synthetic route of the linker LKb11 and its activated ester (LKb11-P) is as follows:

[0462] Specifically,

[0463] Synthesis of intermediate LKb11-Z01:

[0464] Boc-β-alanine (CAS: 3303-84-2, 10.0 g, 52.9 mmol), pentafluorophenol (10.7 g, 58.1 mmol), and DMF (150 mL) were added sequentially to a 500 mL single-necked flask equipped with a magnetic stirrer. The reaction system was cooled in an ethanol bath at 5–10 °C with constant stirring (400 rpm), and DIC (8.0 g, 63.5 mmol) was slowly added over 20 min. The mixture was then allowed to rise naturally to room temperature and stirred for another 1 h to obtain the activated ester reaction solution. Subsequently, cystamine hydrochloride (CAS: 56-17-7, 16.1 g, 105.8 mmol) and DIEA (27.3 g, 212 mmol) were dissolved in water (30 mL). The mixture was cooled in an ethanol bath at 15–20 °C with constant stirring (500 rpm), and the aforementioned activated ester reaction solution was added to the reaction system over 20 min. The mixture was then stirred for another 16 h. LCMS analysis shows that the raw material conversion is complete.

[0465] The reaction solution was concentrated under reduced pressure at 60℃ to an oily state. DIEA (30.6 g, 236 mmol) and DCM (150 mL) were added sequentially. Acetic anhydride (16.2 g, 158.7 mmol) was gradually added under constant stirring (500 r / min), and the reaction was carried out at room temperature for 16 h. TLC analysis (developing solvent: DCM / MeOH, 5 / 1) showed that the starting material conversion was complete and the product R... f The value is approximately 0.5.

[0466] The reaction solution was concentrated under reduced pressure, diluted with EtOAc (120 mL), and washed once each with saturated sodium bicarbonate and saturated sodium chloride solutions (50 mL each). The organic phase was separated, dried, and concentrated. The crude product was purified by silica gel column chromatography (eluent: DCM / MeOH, 50 / 1 to 20 / 1). The product fraction was collected and concentrated, and dried under vacuum (50–70 Pa) for 1 h to obtain 13.5 g of white solid (70% yield).

[0467] MS(ESI): m / z[M+H]+ Theoretical value 366.1, measured value 366.2; m / z[M+Na] + The theoretical value is 388.1, and the measured value is 388.1.

[0468] Synthesis of intermediate LKb11-Z02:

[0469] LKb11-Z01 (13.0 g, 35.6 mmol) and 1,4-dioxane (60 mL) were added sequentially to a 250 mL single-necked flask equipped with a magnetic stirrer. The system temperature was maintained at 20–30 °C and the mixture was stirred at a constant speed (500 r / min). A 4N HCl / 1,4-dioxane solution (60 mL) was slowly added to the reaction system, and stirring was continued for 1 h. TLC analysis (developing solvent: DCM / MeOH, 5 / 1) showed that the starting material conversion was complete and the product R was obtained. f The value is approximately 0.1. The reaction solution was concentrated to dryness under reduced pressure at 40°C and dried in a vacuum (50-70 Pa) environment for 1 hour to obtain 10.1 g of white solid (yield 94%, hydrochloride).

[0470] MS(ESI): m / z[M+H] + The theoretical value is 266.1, and the measured value is 266.1.

[0471] Synthesis of intermediate LKb11-Z03:

[0472] To a 250 mL single-necked flask equipped with a magnetic stirrer, LKb11-Z02 (5.8 g, 19.3 mmol), N-Boc-iminodiacetic acid (CAS: 56074-20-5, 2.25 g, 9.65 mmol), DIEA (3.7 g, 28.9 mmol), and anhydrous DMF (150 mL) were added sequentially, and the mixture was stirred at a constant speed (500 rpm). The system temperature was maintained at 5–15 °C in a cold bath. HATU (CAS: 148893-10-1, 8.1 g, 21.2 mmol) was added to the flask in five portions over 30 min. After the addition was complete, the reaction system was allowed to naturally warm to room temperature (20–25 °C) and stirred for 20 h. The reaction was monitored by TLC (developing solvent: DCM / MeOH, 10 / 1), showing that the starting material was basically converted and the product R... f The value is approximately 0.8.

[0473] The reaction was quenched with 5 mL of water and the reaction solution was concentrated under reduced pressure at 60 °C. The crude product was purified by silica gel column chromatography (eluent: DCM / MeOH, 20 / 1 to 10 / 1). The product fraction was collected and concentrated and dried under vacuum (50-70 Pa) for 1 h to give 5.14 g of yellow solid (yield 73%).

[0474] MS(ESI): m / z[M+H] + Theoretical value 728.3, measured value 728.2; m / z[M+Na] + The theoretical value is 750.3, and the measured value is 750.2.

[0475] Synthesis of intermediate LKb11-Z04:

[0476] Using LKb11-Z03 (5.1 g, 7.0 mmol) as a starting material, and following a similar procedure to the synthesis of LKb11-Z02, 3.01 g of the target product (pale yellow oil, 80% yield, hydrochloride) was obtained.

[0477] MS(ESI): m / z[M+H] + The theoretical value is 628.2, and the measured value is 628.2.

[0478] Synthesis of intermediate LKb11-Z05:

[0479] Using LKb11-Z04 (2.1 g, 3.2 mmol) and N-Boc-iminodiacetic acid (CAS: 56074-20-5, 298 mg, 1.28 mmol) as starting materials, following a similar procedure to the synthesis of LKb11-Z03, 1.56 g of the target product (pale yellow solid, yield 84%) was obtained. f Value approximately 0.2 (developing solvent: DCM / MeOH, 5 / 1).

[0480] MS(ESI): m / z[M+Na] + Theoretical value 1474.5, measured value 1474.3; m / z [1 / 2M+H] + The theoretical value is 726.8, and the measured value is 726.8.

[0481] Synthesis of intermediate LKb11-Z06:

[0482] Using LKb11-Z05 (1.56 g, 1.07 mmol) as the starting material, and following a similar procedure to the synthesis of LKb11-Z04, 1.31 g of the target product (white solid, 88% yield, hydrochloride) was obtained.

[0483] MS(ESI): m / z[M+Na] + Theoretical value 1374.4, measured value 1374.3; m / z [1 / 2M+H] + The theoretical value is 676.7, and the measured value is 676.7.

[0484] Synthesis of LKb11 and its activated ester LKb11-P:

[0485] Using LKb11-Z06 (150 mg, 0.108 mmol) as a starting material, and following a similar procedure to the synthesis of LKa2, 107 mg of the target product (pale yellow oil, yield 67%) was obtained.

[0486] MS(ESI): m / z[1 / 2M+H] + Theoretical value 740.8, measured value 740.7; m / z 1 / 2[M+H+Na] + Theoretical value 751.8, measured value 751.8; m / z[1 / 2M+Na] + The theoretical value is 762.8, and the measured value is 762.7.

[0487] Using LKb11 as a raw material, the product LKb11-P can be obtained by following a similar procedure to that used in the synthesis of LKa12-P.

[0488] 6.4 The synthetic route of the linker LKc1 and its activated ester (LKc1-P) is as follows:

[0489] Specifically,

[0490] Synthesis of intermediate LKc1-Z01:

[0491] To a 250 mL single-necked flask equipped with a magnetic stirrer, add 3,3'-dihydrooxolineric acid (CAS: 1119-62-6, 4.2 g, 20.0 mmol), N-Boc-1,3-propanediamine (CAS: 75178-96-0, 3.48 g, 20.0 mmol), DIEA (5.17 g, 40.0 mmol), HOBt (CAS: 2592-95-2, 2.7 g, 20.0 mmol), and anhydrous DCM (40 mL), and stir at a constant speed (500 r / min). Maintain the system temperature at 10–20 °C with a cold bath, and add EDCI (CAS: 7084-11-9, 5.75 g, 30.0 mmol) in 4–5 batches over 20 min. After the addition is complete, allow the reaction system to naturally warm to room temperature (20–25 °C) and stir for 12 h. TLC analysis of the reaction (developing solvent: DCM / MeOH, 15 / 1) showed that the starting material was basically converted, and the product R... f The value is approximately 0.8.

[0492] The reaction was quenched with 5 mL of water and the reaction solution was concentrated under reduced pressure at 40 °C. The crude product was purified by silica gel column chromatography (eluent: DCM / MeOH, 50 / 1 to 30 / 1). The product fraction was collected and concentrated and dried under vacuum (50-70 Pa) for 1 h to obtain 4.4 g of pale yellow oil (yield 60%).

[0493] MS(ESI): m / z[M+Na] + The theoretical value is 389.1, and the measured value is 389.1.

[0494] Synthesis of intermediate LKc1-Z02:

[0495] LKc1-Z01 (4.4 g, 12.0 mmol), DMAP (2.9 g, 24.0 mmol), MeOH (13 mL), and DCM (68 mL) were added sequentially to a 250 mL single-necked flask equipped with a magnetic stirrer. The reaction system was cooled in an ethanol bath at 15–20 °C and stirred at a constant speed (500 rpm). DIC (5.05 g, 40.0 mmol) was added in two portions over 5 min, and stirring continued for 12 h. TLC analysis (developing solvent: DCM / MeOH, 15 / 1) showed complete conversion of the starting material and the product R... f The value is approximately 0.4.

[0496] The reaction was quenched with 5 mL of water and the reaction solution was concentrated under reduced pressure at 40 °C. The crude product was purified by silica gel column chromatography (petroleum ether / ethyl acetate, 3 / 1 to 2 / 3). The product fraction was collected and concentrated and dried under vacuum (50–70 Pa) for 1 h to obtain 4.0 g of colorless oily liquid (yield 88%).

[0497] MS(ESI): m / z[M+Na] + The theoretical value is 403.1, and the measured value is 403.1.

[0498] Synthesis of intermediate LKc1-Z03:

[0499] LKc1-Z02 (4.0 g, 10.5 mmol) and DCM (40 mL) were added sequentially to a 250 mL single-necked flask equipped with a magnetic stirrer. The system temperature was maintained at 15–25 °C with an ethanol bath, and the mixture was stirred at a constant speed (500 r / min). TFA (20 mL) was slowly added to the reaction system over 15 min, and stirring was continued for 3 h. LCMS analysis showed that the starting material conversion was complete. The reaction solution was concentrated to dryness under reduced pressure at 40 °C and dried under vacuum (50–70 Pa) for 1 h to obtain 2.7 g of a pale yellow solid (92% yield, TFA salt).

[0500] MS(ESI): m / z[M+H] + The theoretical value is 281.1, and the measured value is 281.1.

[0501] Synthesis of intermediate LKc1-Z04:

[0502] Using LKc1-Z03 (3.8 g, 10.0 mmol, TFA salt) and N-Boc-iminodiacetic acid (CAS: 56074-20-5, 700 mg, 3.0 mmol) as starting materials, following a similar procedure to the synthesis of LKb11-Z03, 1.6 g of the target product (pale yellow oil, yield 70%) was obtained. f Value approximately 0.5 (developing solvent: DCM / MeOH, 7 / 1).

[0503] MS(ESI): m / z[M+H] + The theoretical value is 758.3, and the measured value is 758.2.

[0504] Synthesis of intermediate LKc1-Z05:

[0505] Using LKc1-Z04 (800 mg, 1.06 mmol) as a starting material, and following a similar procedure to the synthesis of LKc1-Z03, 700 mg of the target product (pale yellow oil, 100% yield, TFA salt) was obtained. f Value approximately 0.4 (developing solvent: DCM / MeOH, 7 / 1).

[0506] MS(ESI): m / z[M+H] + Theoretical value 658.2, measured value 658.1; m / z[M+Na] + The theoretical value is 680.2, and the measured value is 680.2.

[0507] Synthesis of LKc1:

[0508] Using LKc1-Z05 (300 mg, 0.397 mmol, TFA salt) as a starting material, following a similar procedure to the synthesis of LKb11, 123 mg of the target product (pale yellow oil, yield 39%) was obtained. f Value approximately 0.6 (developing solvent: DCM / MeOH, 5 / 1).

[0509] MS(ESI): m / z[M+H] + Theoretical value 786.2, measured value 786.2; m / z[M+Na] + The theoretical value is 808.2, and the measured value is 808.1.

[0510] Synthesis of activated ester LKc1-P:

[0511] Using LKc1-Z05 (123 mg, 0.156 mmol) as a starting material, and following a similar procedure to the synthesis of LKa12-P, 115 mg of the target product (pale yellow oil, yield 77%) was obtained. f Value approximately 0.8 (developing solvent: DCM / MeOH, 7 / 1).

[0512] MS(ESI): m / z[M+H] + Theoretical value 952.2, measured value 952.1; m / z[M+Na] + The theoretical value is 974.2, and the measured value is 974.1.

[0513] 6.5 The synthetic route of the linker LKc11 is as follows:

[0514] Specifically,

[0515] Synthesis of intermediate LKc11-Z01:

[0516] Using LKc1-Z05 (277 mg, 0.366 mmol, TFA salt) and N-Boc-iminodiacetic acid (CAS: 56074-20-5, 29 mg, 0.122 mmol) as starting materials, following a similar procedure to the synthesis of LKb11-Z03, 135 mg of the target product (pale yellow oil, yield 73%) was obtained. f Value approximately 0.3 (developing solvent: DCM / MeOH, 7 / 1).

[0517] MS(ESI): m / z[1 / 2M+Na] + The theoretical value is 778.8, and the measured value is 778.7.

[0518] Synthesis of intermediate LKc11-Z02:

[0519] Using LKc11-Z01 (135 mg, 0.0892 mmol) as a starting material, and following a similar procedure to the synthesis of LKc1-Z03, 340 mg of the target product (crude product, TFA salt) was obtained. f Value approximately 0.6 (developing solvent: DCM / MeOH, 4 / 1).

[0520] MS(ESI): m / z[1 / 2M+H] + Theoretical value 706.7, measured value 706.7; m / z 1 / 2[M+H+Na] + The theoretical value is 717.7, and the measured value is 717.7.

[0521] Synthesis of LKc11:

[0522] Using LKc11-Z02 (340 mg, crude product) as a starting material, and following a similar procedure to the synthesis of LKb11, 91 mg of the target product (pale yellow oil, 66% yield from the two-step synthesis of LKc11-Z01) was obtained. f Value approximately 0.2 (developing solvent: DCM / MeOH, 4 / 1).

[0523] MS(ESI): m / z[1 / 2M+H] + Theoretical value 770.8, measured value 770.8; m / z[1 / 2M+Na] + The theoretical value is 792.8, and the measured value is 792.7.

[0524] Example 7: Conjugation and activity assay of long non-coding RNA molecules with toxin molecules

[0525] Taking methylaurestatin E (MMAE) toxin as an example, MMAE molecules can be conjugated using a direct linking method well known to those skilled in the art, or a bridging nucleic acid fragment can be used to link the two.

[0526] 7.1. Coupling a single toxin molecule (MMAE) via a bridging nucleic acid fragment (bridge)

[0527] The long non-coding RNA molecule and MMAE toxin are coupled by bridging nucleic acid fragments. The method of coupling long non-coding RNA molecules and MMAE by bridging nucleic acid fragments is as follows;

[0528] (1) Preparation of bridging nucleic acid fragment-MMAE conjugate

[0529] A 5'-SH modified bridge2sense-SH sequence was obtained using a solid-phase nucleic acid synthesis method (the 5'-end of the sequence was modified with the linker compound LKmd5). Using a liquid-phase organic synthesis method, bridge2 sense-SH was coupled with maleimide-modified MMAE (Mc-VcMMAE, CAS: 646502-53-6) via Michael addition to obtain the bridge2 sense-MMAE-01 conjugate. This conjugate was then hydrolyzed under appropriate conditions (pH 10–12) to obtain the succinimide-hydrolyzed ring-opening bridge2 sense-MMAE molecule.

[0530] (2) Preparation of long noncoding RNA molecule-MMAE conjugate

[0531] A bridge2 antisense fragment complementary to the aforementioned bridge2 sense fragment is added to the end of a long non-coding RNA molecule. Then, the long non-coding RNA molecule is coupled to bridge2 sense-MMAE-01 or a succinimide-hydrolyzed bridge2 sense-MMAE molecule by means of the complementarity of bridge2 sense and bridge2 antisense through annealing hybridization, to obtain a long non-coding RNA molecule-bridge-MMAE-01 conjugate or a succinimide-hydrolyzed bridge2 sense-MMAE conjugate.

[0532] 7.2. Couple multiple MMAEs through complementary bridge segments

[0533] Long non-coding RNA molecules and multiple MMAE toxins are coupled by bridging nucleic acid fragments. The method of coupling long non-coding RNA molecules and MMAEs by bridging nucleic acid fragments is as follows;

[0534] (1) Preparation of bridging nucleic acid fragment-MMAE conjugate

[0535] Using the various adaptor compounds prepared in Example 6 to couple MMAE and bridge nucleic acid fragments, taking the adaptor LKa12-P as an example, the specific steps are as follows:

[0536] A solid-phase nucleic acid synthesis method was used (the 5' end of the nucleic acid sequence was modified with the linker precursor LKmd4) to obtain the bridge2 sense-NH2 sequence with 5'-NH2. In a liquid-phase organic synthesis reaction, bridge2 sense-NH2 was condensed with LKa12-P, which has a carboxyl-activated ester group, and then subjected to disulfide bond cleavage to obtain bridge2 sense-(SH)4 with four active thiol groups. The four SH groups were then subjected to a Michael addition coupling reaction with maleimide-modified MMAE (Mc-VcMMAE, CAS: 646502-53-6) to obtain the bridge2 sense-(MMAE)4-01 conjugate. This conjugate was then hydrolyzed under appropriate conditions (pH 10–12) to obtain four succinimide-hydrolyzed ring-opening bridge2 sense-(MMAE)4 molecules.

[0537] (2) Preparation of long non-coding RNA molecules-MMAE conjugates coupled with multiple MMAEs

[0538] A bridge2 antisense fragment complementary to the aforementioned bridge2 sense fragment is added to the end of a long non-coding RNA molecule. Then, the long non-coding RNA molecule is coupled to bridge2 sense-(MMAE)4-01 or a succinimide-hydrolyzed ring-opened bridge2 sense-(MMAE)4 molecule by means of the complementarity of bridge2 sense and bridge2 antisense through annealing hybridization, to obtain a long non-coding RNA molecule-bridge2-(MMAE)4-01 conjugate or a succinimide-hydrolyzed ring-opened long non-coding RNA molecule-bridge2-(MMAE)4 conjugate.

[0539] 7.3 In vivo efficacy study of long non-coding RNA molecules conjugated to a single MMAE

[0540] The experimental steps are as follows:

[0541] In CT26 tumor-bearing mouse models (tumor volume 80–150 mm² before drug administration) 3 The drug was administered via tail vein at a dose of 5 mg / kg to 6 animals in each group. The drug was administered once every 3 days for 5 consecutive days. Tumor volume was measured (Figure 17), and overall survival was observed. The results showed that:

[0542] (1) 25M2-CAUαS-MMAE has a clear antitumor effect, and all patients remained alive up to day 30 after administration (Figure 17B).

[0543] (2) The chimeric molecules of 25M2-AUαS, 25M2-CUαS, and 25M2-CAUαS with the toxin had TGI values ​​of 90.4%, 99.7%, and 105.8% at the experimental endpoint, respectively (Figure 17A).

[0544] Further investigation of the efficacy of high and low doses (1 mg / kg and 5 mg / kg) showed that both the tumor proliferation curve and survival curve indicated that the efficacy was dose-dependent and superior to that of MMAE alone (the equivalent doses of MMAE corresponding to 1 mg / kg and 5 mg / kg 25M2-CAUαS-MMAE were 0.008 mg / kg and 0.041 mg / kg, respectively) (Figure 17C).

[0545] (3) The 25M2 molecule without CAUαS modification, when conjugated to toxin Eribulin via the bridge bridging fragment in the same way as described in Section 7.1 above, also showed clear antitumor efficacy in the same tumor-bearing mouse model (6 animals per group, administered once every 3 days for 5 consecutive times during the experiment) (Figure 17D).

[0546] 7.4. Pharmacological evaluation of long non-coding RNA molecules coupled with multiple toxin molecules.

[0547] As described in Section 7.2 above, 25M2-CAUαS can be coupled with multiple toxins.

[0548] The efficacy evaluation method is the same as in Section 7.3, using CT26 tumor-bearing mice (tumor volume 80–150 mm² before administration). 3 25M2-CAUαS was conjugated to 1, 2, and 4 MMAEs, respectively, and administered via tail vein at a dose of 0.3 mg / kg. Five animals were in each group. The drug was administered once every 3 days for 5 consecutive days. The experiment was terminated on the 13th day after the first administration, and the tumors were harvested and weighed. The results are shown in Figure 18. The efficacy of the conjugated molecule was positively correlated with the number of conjugated toxins (DAR).

[0549] Experimental results

[0550] The efficacy of the drug is positively correlated with DAR (a common parameter in ADC, Drug-Antibody-Rate) and the number of conjugated toxins (DAR), as shown in Figure 18.

[0551] 7.5. In vivo dose-response relationship study of 25M2-CAUαS-4MMAE

[0552] (1) Pharmacological evaluation of 25M2-CAUαS-bridge2-(MMAE)4-01 conjugate (unopened ring)

[0553] The efficacy evaluation method was the same, using the CT26 tumor-bearing model (tumor volume 80-150 mm² before drug administration). 3 The long non-coding RNA molecule bridge2-(MMAE)4-01 conjugate was administered via tail vein at dose gradients of 0.3, 1, 3, and 6 mg / kg (the control group MMAE used an equivalent dose of 0.1967 mg / kg of the test substance at 6 mg / kg). The drug was administered once every 3 days for 5 consecutive times, with continuous measurement of tumor volume and observation of overall survival.

[0554] The results, as shown in Figure 19A, indicate that the tumor proliferation curve and the experimental endpoint of tumor weight have a clear dose-response relationship with the dose, and are superior to the MMAE group.

[0555] (2) Pharmacological evaluation of the 25M2-CAUαS-bridge2-(MMAE)4 conjugate formed by succinimide hydrolysis ring opening

[0556] The efficacy evaluation method was the same, using the CT26 tumor-bearing model (tumor volume 80-150 mm² before drug administration). 3The drug was administered via tail vein. The dose gradient of the succinimide-hydrolyzed long non-coding RNA molecule bridge2-(MMAE)4 conjugate was 1, 3, and 6 mg / kg (the control group MMAE used an equivalent dose of 0.1967 mg / kg of the test substance at 6 mg / kg). The drug was administered once every 3 days for 5 consecutive times. Tumor volume was continuously measured and overall survival was observed.

[0557] The results are shown in Figure 19B. The results indicate that the succinimide-hydrolyzed long non-coding RNA molecule bridge2-(MMAE)4 conjugate has better antitumor efficacy. Two tumor-free mice were observed in the 6 mg / kg group on day 13 after administration. On day 13 after administration, the TGI (tumor growth inhibition rate) of all three dose groups was greater than 90%.

[0558] The above results indicate that long non-coding RNA molecules have the function of acting as carriers for cytotoxic drugs, thereby improving / extending the efficacy of antitumor cytotoxic drugs.

[0559] Example 7: Long non-coding RNA molecules / modified long non-coding RNA molecules used as vectors for delivering siRNA

[0560] 1. 25M2 was used for siRNA delivery assays. The molecular construction process is as follows:

[0561] (1) A bridge2-sense sequence (as shown in SEQ ID NO.55) is added to the 3' end of the positive strand of the target siRNA used for delivery.

[0562] SEQ ID NO.55:GGCUAUCUAGAAUGUACGCGGUA, can be modified in various ways, such as MOE\Ps\2'-OMe, etc.

[0563] (2) A bridge 2 antisense fragment complementary to the aforementioned bridge 2-sense fragment was added to the 3' end of the 25M2 molecule (the sequence is shown in SEQ ID NO.56).

[0564] SEQ ID NO.56:CAUUACCGCGUACAUUCUAGAUAGCC, can use various modification modes, such as MOE\Ps\2'-OMe, etc.;

[0565] (3) By annealing hybridization, the target siRNA and 25M2 molecule are coupled through complementary bridge2-sense and bridge2-antisense fragments to prepare a long non-coding RNA molecule with coupled siRNA.

[0566] 2. The delivery activity detection test is as follows:

[0567] (1) Following the method described in the previous embodiment, flow cytometry analysis showed no significant difference in the Cy3 positivity rate of PANC-1 cells before and after conjugation of Cy3-labeled 25M2 with siRNA (Figure 20A), indicating that loading siRNA onto the 3'-end of 25M2 does not interfere with its delivery activity.

[0568] (2) Functional tests were conducted using siRNA targeting KRAS as the target siRNA. 25M2-siRNA was introduced into PANC-1 cells through transfection and incubation. After 24 hours, the knockdown of the target gene (KRAS) mRNA was detected. The results showed (Figure 20B) that 10nM transfection and 100nM incubation had comparable knockdown efficiency for KRAS mRNA, and the KRAS protein level was also significantly downregulated under incubation.

[0569] siRNA-1sense(KRAS):SEQ ID NO.57:GUUGGAGCUGAUGGCGUAA;

[0570] siRNA-1antisense(KRAS):SEQ ID NO.58:UUACGCCAUCAGCUCCAACUA;

[0571] siRNA-2sense(KRAS):SEQ ID NO.59:GUUGGAGCUGUUGGCGUAA;

[0572] siRNA-2antisense(KRAS):SEQ ID NO.60:UUACGCCAACAGCUCCAACUA;

[0573] 3. Detect the knockdown activity of 25M2-siRNA (KRAS) chimera molecules on target genes in tumor tissue in tumor-bearing mouse models.

[0574] Similarly, the aforementioned 25M2-siRNA molecule targeting KRAS was administered via tail vein, with the 25M2 delivery element alone serving as a control. Two CT26 tumor-bearing mice (n=2) were used in each of the control and experimental groups. The mice were administered the drug once every 3 days for 3 consecutive times at a dose of 5 mg / kg. Tumor tissue was collected 24 hours after the last administration to detect the knockdown of the target gene (Figure 21).

[0575] RT-qPCR results showed that Kras mRNA levels in tumor tissue were downregulated to approximately 50% in the 25M2-siRNA administration group.

[0576] Immunoblotting analysis showed that the Kras protein level in tumor tissue was significantly downregulated in the 25M2-siRNA administration group.

[0577] Example 8: Long non-coding RNA molecules / modified long non-coding RNA molecules for delivery of bivalent or multivalent forms of ASO

[0578] Long non-coding RNA molecules coupled with bivalent or multivalent ASOs were constructed using the following design approach:

[0579] (1) Two or more ASO molecules are tandemly connected by a linker or directly tandemly to obtain divalent / multivalent ASO molecules;

[0580] (2) The addition of a sequence to the 3' end of 25M2 and one of the ASO reverse complementary sequences;

[0581] (3) After hybridization and coupling, long non-coding RNA molecules or modified long non-coding RNA molecules can be coupled with divalent ASO molecules to form conjugates;

[0582] This embodiment uses ASO targeting AR (androgen receptor) for testing.

[0583] Using the above design approach, two bivalent ASO molecules, BivalentASO-1(AR) (SEQ ID NO. 61, underlined portion is the ASO1 sequence complementary to the long non-coding RNA molecule) and BivalentASO-2(AR) (SEQ ID NO. 62, underlined portion is the ASO1 sequence complementary to the long non-coding RNA molecule), were constructed. Furthermore, each ASO was modified as follows: three cEts on each side, with a plain DNA base in the middle, the sequence was fully thiolated, and the two ASOs were linked by LKmd5.

[0584] SEQ ID NO.61: TGCCAGTGAACATACATAGAAAGTTGTAGTAGTCGCGA

[0585] SEQ ID NO.62: TGCCAGTGAACATACATAGTGCCAGTGAACATACATAA

[0586] And 25M2-ASO antisense, which is complementary to the divalent ASO molecule.

[0587] The sequence is SEQ ID NO.63 (the underlined portion is the antisense region that is inversely complementary to ASO1):

[0588] SEQ ID NO.63:

[0589] The chimeric molecules formed by annealing the above two bivalent ASOs (Bivalent ASO-1 / Bivalent ASO-2) with 25M2-ASO antisense are named 25M2-AR-ASO-1 and 25M2-AR-ASO-2.

[0590] Two 25M2-AR-ASO incubators were used to incubate prostate cancer cell lines 22Rv1 and LNCap at a concentration of 500 nM. After 48 hours of incubation, cells were collected and AR mRNA expression was detected by RT-qPCR. The results showed that 25M2-AR-ASO incubation could effectively knock down the target gene AR (Figure 22).

[0591] Finally, it should be noted that the above embodiments are only used to help those skilled in the art understand the essence of the present invention, and are not intended to limit the scope of protection of the present invention.

Claims

A long non-coding RNA (LncRNA) molecule targeting tumor, the molecule comprising a nucleic acid fragment of: a nucleic acid fragment of lncD&T1 (No. 25) with sequence as shown in SEQ ID NO. 1 or SEQ ID NO. 53; or an artificial mutant 25M2 with sequence as shown in SEQ ID NO. 15; said targeting tumor means that the drug distribution in tumor tissue or cells is higher than that in non-cancerous organs, tissues or cells after administration; preferably, the tumor includes but is not limited to colorectal cancer, liver cancer, lung cancer, pancreatic cancer, gastric cancer, osteosarcoma, cervical cancer, breast cancer, prostate cancer, bladder transitional cell papilloma, glioma or hematological tumor; preferably, the long non-coding RNA molecule is a chemically modified nucleic acid fragment, and the chemical modification includes but is not limited to fluorine substitution, methoxy modification, thio modification, etc. The long non-coding RNA molecule according to claim 1, characterized in that the long non-coding RNA molecule is: (1) a nucleic acid fragment of lncD&T1 (No. 25) after removing 3' adaptor and / or 5' adaptor, the sequence of the 5' adaptor is as shown in SEQ ID NO. 51, and the sequence of the 3' adaptor is as shown in SEQ ID NO. 52; (2) a core fragment 25sub-7 / 16 of lncD&T1 (No. 25), the sequence of the core fragment 25sub-7 / 16 is as shown in SEQ ID NO. 37; (3) a truncated fragment of lncD&T1 (No. 25), the truncated fragment at least comprises the core fragment 25sub-7 / 16; (4) a molecule further comprising an extension fragment, the extension fragment is an additional fragment of 20-5000 nt in length at the 3' end and / or 5' end of the human genome position where lncD&T1 (No. 25) is located; preferably, the nucleic acid sequence of the molecule comprising the extension fragment is as shown in SEQ ID NO. 38-50; preferably, the molecule is a chemically modified nucleic acid fragment, and the chemical modification includes but is not limited to fluorine substitution, methoxy modification, thio modification, etc. The long non-coding RNA molecule according to claim 1 or 2, characterized in that the long non-coding RNA molecule is further coupled with one or more second functional unit fragments, and the second functional fragment is: (1) a stabilizing fragment for stabilizing the long non-coding RNA molecule, preferably, the stabilizing fragment is a 2911 fragment with sequence as shown in SEQ ID NO. 3; the stabilizing fragment is located at either end or both ends of the molecule or inserted therein; (2) an immune regulatory element, preferably, the immune regulatory element is a 3F30 fragment with sequence as shown in SEQ ID NO. 5; the immune regulatory element is located at either end or both ends of the long non-coding RNA molecule. (3) a reverse complementary fragment, preferably, the reverse complementary fragment is derived from the 3F30 fragment, the sequence of which is shown in SEQ ID NO. 7 or SEQ ID NO. 8, respectively; the reverse complementary fragment is located at either end of the molecule; (4) an optional flanking nucleic acid sequence with a length of 20-5000 nt, preferably, the flanking nucleic acid sequence has a length of 20-2000 nt, more preferably, the flanking nucleic acid sequence has a length of 20-500 nt; the flanking nucleic acid sequence is located at either end or both ends of the molecule; further, the flanking nucleic acid sequence is a sequence encoding a protein or a non-coding sequence, the non-coding sequence including but not limited to siRNA or modified siRNA, ASO or modified ASO, long non-coding RNA or modified long non-coding RNA, aptamer or modified aptamer; the protein has a biological function, preferably, the protein includes but is not limited to cytokine, growth hormone, antibody or variant of antibody; (5) a small molecule cytotoxic compound, an immune agonist or a radionuclide group; Preferably, the long non-coding RNA molecule is a chemically modified nucleic acid fragment, the chemical modification including but not limited to fluorine substitution, methoxy modification, thio modification, etc. A drug coupled with the long non-coding RNA molecule of any one of claims 1-3, the drug being a nucleic acid drug, a small molecule cytotoxic drug, an immune agonist or a radionuclide, preferably, the nucleic acid drug has a molecular form of RNA, chemically modified RNA, ASO or chemically modified ASO; the drug has a function of targeting tumor; the targeting tumor refers to that the drug distribution in tumor tissue or cells is higher than that in non-cancerous organs, tissues or cells after administration; Preferably, the tumor includes but is not limited to colorectal cancer, liver cancer, lung cancer, pancreatic cancer, gastric cancer, osteosarcoma, cervical cancer, breast cancer, prostate cancer, bladder transitional cell papilloma, glioma or hematological tumor. An anti-tumor pharmaceutical composition, the pharmaceutical composition comprising: (1) a therapeutically effective amount of the long non-coding RNA molecule lncD&T1 or a truncated fragment thereof, the truncated fragment comprising at least the core fragment 25sub-7 / 16; and / or (2) the long non-coding RNA molecule lncD&T1 or a truncated fragment thereof coupled with the stabilizing fragment and / or the reverse complementary fragment, the truncated fragment comprising at least the core fragment 25sub-7 / 16; and / or (3) a nucleic acid fragment coupled with a flanking nucleic acid sequence at either end or both ends of the long non-coding RNA molecule lncD&T1 or a truncated fragment thereof, the truncated fragment comprising at least the core fragment 25sub-7 / 16; preferably, the nucleic acid fragment is further coupled with the stabilizing fragment and / or the reverse complementary fragment; preferably, the flanking sequence is a sequence encoding a protein or a non-coding sequence, the protein having a biological function; and / or (4) a nucleic acid fragment coupled with a flanking nucleic acid sequence at either end or both ends of the long non-coding RNA molecule lncD&T1 or a truncated fragment thereof, the truncated fragment comprising at least the core fragment 25sub-7 / 16; preferably, the nucleic acid fragment is further coupled with the stabilizing fragment and / or the reverse complementary fragment; preferably, the flanking sequence is a sequence encoding a protein or a non-coding sequence, the protein having a biological function; and / or (4) a compound conjugated with a small molecule cytotoxic agent, an immune agonist or a radionuclide group at either end, both ends or within the molecule of the long non-coding RNA molecule lncD&T1 or a truncated fragment thereof, the truncated fragment comprising at least the core fragment 25sub-7 / 16; preferably, the compound is further conjugated with the stabilizing fragment and / or the reverse complementary fragment; and, optionally (5) necessary pharmaceutical excipients. The long non-coding RNA molecule of any one of claims 1-3 for use in the preparation of a medicament for targeting tumor, the medicament being a nucleic acid drug, preferably, the nucleic acid drug is an RNA drug; the medicament has the function of targeting tumor; the targeting tumor means that the distribution of the medicament in the tumor tissue or cells is higher than that in the non-cancerous organs, tissues or cells after administration; Preferably, the tumor includes but is not limited to colorectal cancer, liver cancer, lung cancer, pancreatic cancer, gastric cancer, osteosarcoma, cervical cancer, breast cancer, prostate cancer, bladder transitional cell papilloma, glioma or hematological tumor. The long non-coding RNA molecule of any one of claims 1-3 for use in the preparation of a delivery carrier for targeting tumor, the delivery carrier being: (1) a delivery carrier formed by directly chemically conjugating the long non-coding RNA molecule with a delivered substance; or (2) a delivery carrier prepared by non-chemical conjugation of the long non-coding RNA molecule, the delivered substance and other formulation excipients, including but not limited to liposomes, nanoparticles, water-in-oil / oil-in-water emulsions, ointments, etc.; Preferably, the delivered substance is a therapeutic agent or an imaging agent, the therapeutic agent including but not limited to a nucleic acid drug, a small molecule cytotoxic drug or a radionuclide; Preferably, the tumor includes but is not limited to colorectal cancer, liver cancer, lung cancer, pancreatic cancer, gastric cancer, osteosarcoma, cervical cancer, breast cancer, prostate cancer, bladder transitional cell papilloma, glioma or hematological tumor. The long non-coding RNA molecule-drug conjugate (LncRNA-Drug Conjugates, LncDC) comprising the long non-coding RNA molecule of any one of claims 1-3 or a truncated fragment thereof, or a chemically modified long non-coding RNA molecule or a truncated fragment thereof, characterized in that, the drug is a nucleic acid drug or a cytotoxic drug; Preferably, the nucleic acid drug is an oligonucleotide drug, including but not limited to single-stranded DNA, double-stranded DNA, single-stranded RNA, double-stranded RNA, mRNA or ncRNA (non-coding RNA), etc.; more preferably, the nucleic acid drug is siRNA, ASO or a multivalent ASO tandem; Preferably, the cytotoxic drug is an anti-tumor cytotoxic drug, including but not limited to: cytotoxic drugs affecting nucleic acid synthesis, cytotoxic drugs affecting nucleic acid transcription, cytotoxic drugs affecting DNA replication, cytotoxic drugs affecting mitosis, etc.; more preferably, the cytotoxic drug is MMAE (Monomethyl auristatin E), a taxoid DXd (Deruxtecan), a PBD (pyrrolobenzodiazepine Eribulin (E7389), SN-38 (Synonyms: 7-Ethyl-10-hydroxycamptothecin). The long non-coding RNA molecule-drug conjugate of claim 8, characterized in that, The long non-coding RNA molecule or a truncated fragment thereof, or a chemically modified long non-coding RNA molecule or a truncated fragment thereof is conjugated with the drug molecule by the following ways: (1) directly covalently coupling; or (2) coupling through a set of complementary bridge nucleic acid fragments (bridge), specifically: 1) connecting the sense / antisense strand of the bridge nucleic acid fragment on the drug molecule; 2) connecting the antisense / sense strand of the bridge nucleic acid fragment on the long non-coding RNA molecule or its truncated fragment, or the chemically modified long non-coding RNA molecule or the chemically modified long non-coding RNA molecule truncated fragment; the antisense strand of the bridge nucleic acid fragment is complementary or partially complementary to the sense strand of the bridge nucleic acid fragment; 3) annealing the sense and antisense strands of the bridge nucleic acid fragment to each other, thereby coupling the drug molecule and the long non-coding RNA molecule or its truncated fragment, or the chemically modified long non-coding RNA molecule or the chemically modified long non-coding RNA molecule truncated fragment; Preferably, the complementary bridge nucleic acid fragment (bridge) is a reverse complementary RNA double strand, DNA double strand or RNA\DNA hybrid strand; or a chemically modified reverse complementary RNA double strand, DNA double strand or RNA\DNA hybrid strand; Preferably, the sequence of the sense strand of the bridge nucleic acid fragment is shown in SEQ ID NO. 55, and the sequence of the antisense strand of the bridge nucleic acid fragment is shown in SEQ ID NO.

56. The long non-coding RNA molecule-drug conjugate of claim 9, characterized in that, In the step 1) of connecting the sense / antisense strand of the bridge nucleic acid fragment on the drug molecule; the drug molecule is connected to the sense / antisense strand of the bridge nucleic acid fragment through a spacer; the structure of the spacer is a straight chain structure connecting one drug molecule, or a branched structure connecting multiple drug molecules; the sense / antisense strand of the bridge nucleic acid fragment is connected to one drug molecule through a straight chain spacer, or to multiple drug molecules through multiple spacers connected to the ribonucleotides in the sense / antisense strand of the bridge fragment, or to multiple drug molecules through a branched spacer. The long non-coding RNA molecule-drug conjugate according to claim 10, wherein the spacer is covalently connected to the drug molecule through N or S atom, and connected to the sense / antisense strand of the bridge nucleic acid fragment through phosphodiester bond or phosphorothioate bond; Preferably, the chemical structure of the adaptor is selected from the following structural formulae, or a combination structure formed by one or more mutual connection of the structural formulae, or a combination structure formed by repeated connection of a certain structural formula, wherein, Z is oxygen or sulfur; R1 is R2 is Q is selected from hydrogen, methyl, ethyl or n / iso-propyl; m is an integer from 1 to 5, n is an integer from 1 to 11, p is 1 or 2, and q is an integer from 1 to 3. The long non-coding RNA molecule-drug conjugate according to claim 10 or 11, characterized in that The precursor compound for forming the adaptor is: In each of the structural formulas in the table, the substituent group E is hydrogen (compounds LKa1, LKa2, LKa12, LKb1, LKb11, LKc1, LKc11), (compounds LKa1-P, LKa2-P, LKa12-P, LKb1-P, LKb11-P, LKc1-P, LKc11-P) (compounds LKa1-S, LKa2-S, LKa12-S, LKb1-S, LKb11-S, LKc1-S, LKc11-S). The long non-coding RNA molecule-drug conjugate according to any one of claims 8-12, characterized in that The drug molecule further comprises a cleavable linker and / or a non-cleavable linker; the cleavable linker includes but is not limited to: a short peptide-containing fragment that can be cleaved by intracellular proteases, a glycosyl-containing linker that can be cleaved by glycosyl hydrolases, a disulfide bond-containing fragment that is easily broken in a reducing environment, an acylhydrazone, imine or carbonate-containing linker that is easily broken in a certain pH range; The non-easily broken linker fragment refers to a fragment that remains stable connection in the circulatory system, tissue and cell environment, but can be broken after the long non-coding RNA molecule or the adapter is degraded or under lysosomal enzyme cleavage conditions. The long non-coding RNA molecule-drug conjugate according to any one of claims 8-12, characterized in that, The drug molecule further comprises a modification group, which is used to protect the drug molecule and / or couple the drug molecule with the adapter; The modification group is a protecting group, an activating group or a linking group; the activating group can react with nucleophilic groups such as amino groups / amines, thiol groups, hydroxyl groups, etc. to complete the linking reaction through condensation, addition or substitution, etc. Preferably, the modification group is a carboxyl activated ester group, a maleimide group, a phosphoramidite group, a halogen, a carbonyl group, an alkenyl group, an alkynyl group, etc.; more preferably, the modification group is a maleimide group, and the structure after completing the linking reaction is a succinimide group; The long non-coding RNA molecule-drug conjugate of claim 14, characterized in that, The long non-coding RNA molecule-drug conjugate, wherein the modification group of the drug molecule is a group that is hydrolyzed to open the ring after completing the connection reaction of the maleimide group, and the structure is:

16. A method for preparing the long non-coding RNA molecule-drug conjugate according to any one of claims 8-15, the method comprising: (1) directly coupling the long non-coding RNA molecule and the drug molecule through covalent linkage; or (2) coupling the long non-coding RNA molecule and the drug molecule through a complementary bridging nucleic acid fragment, comprising the following steps: 1) preparing a drug molecule containing a bridging nucleic acid fragment sense strand / antisense strand; preferably, using the adapter precursor compound to link the bridging nucleic acid fragment sense strand / antisense strand and the drug molecule; according to the structure of the adapter precursor compound, the bridging nucleic acid fragment sense strand / antisense strand can be linked to one or more drug molecules; 2) preparing a long non-coding RNA molecule linked with a complementary bridging nucleic acid fragment sense strand / antisense strand; preferably, using nucleic acid solid-phase or liquid-phase synthesis method to prepare the long non-coding RNA molecule linked with a complementary bridging nucleic acid fragment sense strand / antisense strand; 3) using annealing synthesis method to prepare the long non-coding RNA molecule-drug conjugate through complementary linkage of the bridging nucleic acid fragment sense strand and the antisense strand.

Images