Ligand-nucleic acid conjugate and pharmaceutical composition using the same

A ligand-nucleic acid conjugate with specific linkers and ligands addresses the limitations of existing delivery systems by enhancing targeted delivery to organs like the spleen and pancreas, improving nucleic acid drug efficacy.

WO2026023273A1PCT designated stage Publication Date: 2026-01-29OSAKA UNIVERSITY
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2025/021443
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-23
Filing Date
2025-06-13
Publication Date
2026-01-29

AI Technical Summary

Technical Problem

Existing nucleic acid drug delivery systems, such as lipid nanoparticles (LNPs), struggle to target organs and tissues other than the liver effectively, limiting their therapeutic applications and being difficult to control synthetically.

Method used

Development of a ligand-nucleic acid conjugate with specific linker and ligand moieties, such as GalNAc and palmitic acid, to enhance targeted delivery to organs like the spleen, pancreas, and muscle tissue.

Benefits of technology

The conjugate enables efficient delivery of nucleic acid drugs to various organs and tissues, expanding therapeutic targets and improving treatment options for diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure JP2025021443_29012026_PF_FP_ABST
    Figure JP2025021443_29012026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention is a conjugate represented by Lg-Lk-NCA. Here, Lk is a linker moiety, NCA is a nucleic acid moiety, and Lg is a ligand moiety represented by formula (II). The present invention can expand a means for enabling delivery of a nucleic acid drug to various organs or tissues, and can provide a means useful for treating or preventing various diseases involving the organs or tissues.
Need to check novelty before this filing date? Find Prior Art

Description

Ligand-nucleic acid conjugate and pharmaceutical composition using the same

[0001] The present invention relates to a ligand-nucleic acid conjugate and a pharmaceutical composition using the same.

[0002] Nucleic acid drugs have attracted considerable attention as a new drug discovery modality for difficult-to-treat diseases. However, because systemically administered nucleic acid drugs tend to accumulate in the liver, it is extremely difficult to target organs and tissues other than the liver. Therefore, there is an urgent need to develop drug delivery systems (DDS) to expand the therapeutic targets of nucleic acid drugs. For example, the following DDS technologies for nucleic acid drugs are known.

[0003] Lipid nanoparticles (LNPs) are used as DDS tools for not only nucleic acid drugs but also mRNA drugs. LNP-formulated nucleic acid drugs are characterized by their ability to accumulate in the liver and escape from endosomes. However, due to their tendency to accumulate in the liver, the combination of LNPs and nucleic acid drugs currently only treats a limited number of diseases. Furthermore, compared to the ligand conjugates described below, which are produced entirely synthetically, LNP formulations have the disadvantage of being difficult to control.

[0004] On the other hand, conjugates of nucleic acid drugs with ligands capable of drug delivery can achieve selective delivery of nucleic acid drugs to target tissues. For example, GalNAc conjugates enable efficient delivery of nucleic acid drugs to the liver (Non-Patent Document 1, etc.). Furthermore, palmitic acid conjugates are known to enhance muscle tissue delivery (Non-Patent Document 2), and ligand conjugates of the eGLP-1 receptor, which is highly expressed in the pancreas, are effective in enhancing pancreatic targeting (Non-Patent Document 3).

[0005] However, conjugates of such ligands and nucleic acid drugs (hereinafter sometimes referred to as "ligand-nucleic acid conjugates") have not yet achieved satisfactory delivery of nucleic acid drugs to target tissues, and further technological development is desired.

[0006] Prakash TP et al., Nucleic Acids Res. 2014, 42, 8796-8807 Prakash TP et al., Nucleic Acids Res. 2019, 47, 6029-6044 Knerr et al., J. Am. Chem. Soc. 2021, 143, 3416-3429

[0007] The present invention aims to solve the above problems, and its object is to provide a conjugate of a ligand and a nucleic acid drug that can be useful in the development of nucleic acid drug delivery technology.

[0008] The present invention relates to a compound of the following formula (I):

[0009]

[0010] wherein Lk is a linker moiety, NCA is a nucleic acid moiety, and Lg is a conjugate represented by the following formula (II):

[0011]

[0012] (In formula (II), * 1 is a bond with Lk, and A 1 is a sulfur atom or an oxygen atom, R 1 and R 2 are each independently: (i) a hydrogen atom; (ii) an alkyl group having 1 to 9 carbon atoms which may be branched and which may be substituted with at least one group selected from the group consisting of an alkyl group having 1 to 3 carbon atoms which may be branched, an alkoxy group having 1 to 3 carbon atoms which may be branched, an alkylthio group having 1 to 3 carbon atoms which may be branched, a hydroxyl group, a nitro group, and a halogen atom; or R 1 and R 2 and R are taken together to form a phenyl or thiophene ring which may be substituted with a halogen atom.

[0013] In one embodiment, Lg in the above formula (I) is represented by the following formula (II-1):

[0014]

[0015] (In formula (II-1), * 1 is a bond with Lk, and A 1 is a sulfur atom or an oxygen atom, R 3 is a group selected from the group consisting of a hydrogen atom, an optionally branched alkyl group having 1 to 3 carbon atoms, an optionally branched alkoxy group having 1 to 3 carbon atoms, an optionally branched alkylthio group having 1 to 3 carbon atoms, a hydroxyl group, a nitro group, and a halogen atom).

[0016] In one embodiment, Lg in the above formula (I) is represented by the following formula (II-2) or (II-3):

[0017]

[0018] (In formulas (II-2) and (II-3), * 1 is a bond with Lk, and A 1 is a sulfur atom or an oxygen atom, R 3 is a group selected from the group consisting of a hydrogen atom, an optionally branched alkyl group having 1 to 3 carbon atoms, an optionally branched alkoxy group having 1 to 3 carbon atoms, an optionally branched alkylthio group having 1 to 3 carbon atoms, a hydroxyl group, a nitro group, and a halogen atom).

[0019] In one embodiment, Lg in the above formula (I) is a group represented by the following formula (II-4):

[0020]

[0021] (In formula (II-4), * 1 is a bond to Lk).

[0022] In one embodiment, Lk in the above formula (I) is represented by the following formula (III):

[0023]

[0024] (In formula (III), * 2 and *3 is a bond, and X i is an oxygen atom or a sulfur atom, and X ii + is a pharmaceutically acceptable cation, and Y is —(CH 2 ) m - or - (CH 2 OCH 2 ) n - (wherein m and n are each independently an integer of 1 to 40).

[0025] In one embodiment, the above formula (I) is the following formula (I-1):

[0026]

[0027] (In formula (I-1), NCA is a nucleic acid moiety, and A 1 is a sulfur atom or an oxygen atom, R 3 is a group selected from the group consisting of a hydrogen atom, an optionally branched alkyl group having 1 to 3 carbon atoms, an optionally branched alkoxy group having 1 to 3 carbon atoms, an optionally branched alkylthio group having 1 to 3 carbon atoms, a hydroxyl group, a nitro group, and a halogen atom; i is an oxygen atom or a sulfur atom, and X ii + is a pharmaceutically acceptable cation, and Y is —(CH 2 ) m - or - (CH 2 OCH 2 ) n wherein m and n are each independently an integer of 1 to 40.

[0028] In one embodiment, the above formula (I) is the following formula (I-2):

[0029]

[0030] (In formula (I-2), NCA is a nucleic acid moiety, and A 1 is a sulfur atom or an oxygen atom, R 3is a group selected from the group consisting of a hydrogen atom, an optionally branched alkyl group having 1 to 3 carbon atoms, an optionally branched alkoxy group having 1 to 3 carbon atoms, an optionally branched alkylthio group having 1 to 3 carbon atoms, a hydroxyl group, a nitro group, and a halogen atom; i is an oxygen atom or a sulfur atom, and X ii + is a pharmaceutically acceptable cation, and Y is —(CH 2 ) m - or - (CH 2 OCH 2 ) n wherein m and n are each independently an integer of 1 to 40.

[0031] In one embodiment, the above formula (I) is the following formula (I-3):

[0032]

[0033] (In formula (I-3), NCA is a nucleic acid moiety, and A 1 is a sulfur atom or an oxygen atom, and X i is an oxygen atom or a sulfur atom, and X ii + is a pharmaceutically acceptable cation, and Y is —(CH 2 ) m - or - (CH 2 OCH 2 ) n wherein m and n are each independently an integer of 1 to 40.

[0034] The present invention also relates to a compound in which the NCA in the above formula (I) is an oligonucleotide.

[0035] In one embodiment, the oligonucleotide is an antisense oligonucleotide, siRNA, miRNA, or a nucleic acid aptamer.

[0036] The present invention also relates to a pharmaceutical composition comprising the above conjugate.

[0037] In one embodiment, the pharmaceutical composition of the present invention is used for drug delivery to the spleen.

[0038] According to the present invention, it is possible to expand the means for delivering nucleic acid drugs to various organs (e.g., the spleen) or tissues, and to provide means useful for treating or preventing various diseases in the organs or tissues.

[0039] FIG. 1 is an HPLC chart of purified conjugate 1-ASO1. FIG. 2 is an HPLC chart of purified conjugate 1-ASO2. FIG. 3 is an HPLC chart of purified conjugate 1-ASO2(PS). FIG. 4 is an HPLC chart of purified conjugate 1-ASO3. FIG. 5 is an HPLC chart of purified conjugate 2-ASO1. FIG. 6 is an HPLC chart of purified conjugate 3-ASO1. FIG. 7 is an HPLC chart of purified conjugate 4-ASO1. FIG. 8 is an HPLC chart of purified conjugate 5-ASO1. FIG. 9 is an HPLC chart of purified conjugate 5-ASO2. FIG. 10 is an HPLC chart of purified conjugate 6-ASO1. FIG. 11 is an HPLC chart of purified conjugate 6-ASO2. Figure 12 is an HPLC chart of purified conjugate 7-ASO1. Figure 13 is an HPLC chart of purified conjugate 7-ASO2. Figure 14 is an HPLC chart of purified conjugate 8-ASO1. Figure 15 is an HPLC chart of purified conjugate 8-ASO2. Figure 16 is an HPLC chart of purified conjugate 9-ASO1. Figure 17 is an HPLC chart of purified conjugate 9-ASO2. Figure 18 is an HPLC chart of purified conjugate 10-ASO1. Figure 19 is an HPLC chart of purified conjugate 10-ASO2. Figure 20 is an HPLC chart of purified conjugate 11-ASO1. Figure 21 is an HPLC chart of purified conjugate 12-ASO1. Figure 22-1 is a graph showing the relative levels of Malat1 mRNA expression in the liver, kidney, heart, lung, brain, and skeletal muscle when mice were administered ASO2 conjugated with carboxylic acid ligand 1, 6, 7, 8, 9, or 10. Figure 22-2 is a graph showing the relative levels of Malat1 mRNA expression in the spleen, pancreas, stomach, large intestine, mammary gland, and skin when mice were administered ASO2 conjugated with carboxylic acid ligand 1, 6, 7, 8, 9, or 10.Figure 23 is a graph showing the dose-dependence of the inhibitory effect of ASO2 conjugated with carboxylic acid ligand 1, 8, or 10 on Malat1 mRNA expression in the liver, spleen, or kidney when administered to mice. Figure 24 is a graph showing the relative levels of Malat1 mRNA expression in the liver, spleen, and kidney when ASO3 conjugated with carboxylic acid ligand 1 is administered to mice. Figure 25 is a graph showing the relative levels of Malat1 mRNA expression in the liver, spleen, and kidney when ASO2(PS) conjugated with carboxylic acid ligand 1 is administered to mice.

[0040] (Definition of Terms) Terms used in this specification are used in the sense commonly used in the art unless otherwise specified.

[0041] First, we will define the main terms used in this specification.

[0042] As used herein, the term "alkyl group having 1 to n carbon atoms" refers to any linear, branched, or cyclic alkyl group having 1 to n carbon atoms, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, s-butyl, t-butyl, n-pentyl, isopentyl, neopentyl, t-pentyl, n-hexyl, isohexyl, n-heptyl, n-octyl, and n-nonyl. Furthermore, for example, an "optionally branched alkyl group having 1 to 9 carbon atoms" refers to a linear or branched alkyl group having 1 to 9 carbon atoms. The term "optionally branched alkyl group having 1 to 3 carbon atoms" refers to any linear or branched alkyl group having 1 to 3 carbon atoms. Furthermore, the term "linear alkyl group having 1 to 6 carbon atoms" refers to any linear alkyl group having 1 to 6 carbon atoms.

[0043] As used herein, the term "alkoxy group having 1 to n carbon atoms" refers to any linear, branched, or cyclic alkoxy group having 1 to n carbon atoms (where n is an integer), and examples thereof include methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, s-butoxy, and t-butoxy. Furthermore, for example, an "alkoxy group having 1 to 3 carbon atoms, which may be branched," refers to a linear or branched alkoxy group having 1 to 3 carbon atoms. Furthermore, the term "linear alkoxy group having 1 to 6 carbon atoms" encompasses an alkoxy group having any linear alkyl group having 1 to 6 carbon atoms. On the other hand, the term "alkoxy group having 1 to 6 carbon atoms" refers to any linear, branched, or cyclic alkoxy group having 1 to 6 carbon atoms. Furthermore, the term "alkoxy group having 1 to 6 carbon atoms" may also be simply referred to as a "lower alkoxy group."

[0044] The term "a straight-chain alkoxy group having 1 to 6 carbon atoms which may be substituted with a straight-chain alkoxy group having 1 to 6 carbon atoms" refers to the above-mentioned "straight-chain alkoxy group having 1 to 6 carbon atoms" as well as an alkoxy group in which one or more hydrogen atoms constituting the "straight-chain alkoxy group having 1 to 6 carbon atoms" have been substituted with other "straight-chain alkoxy groups having 1 to 6 carbon atoms", which may be the same or different. Examples of such "straight-chain alkoxy groups having 1 to 6 carbon atoms which may be substituted with a straight-chain alkoxy group having 1 to 6 carbon atoms" include a methoxy group, an ethoxy group, an n-propoxy group, a methoxymethoxy group, an ethoxymethoxy group, an n-propoxymethoxy group, a methoxyethoxy group (for example, a 2-methoxyethoxy group), an ethoxyethoxy group (for example, a 2-ethoxyethoxy group), and an n-propoxyethoxy group.

[0045] As used herein, the term "cyanoalkoxy group having 1 to 6 carbon atoms" refers to any linear, branched, or cyclic alkoxy group having 1 to 6 carbon atoms in which at least one hydrogen atom has been substituted with a cyano group.

[0046] As used herein, the term "straight-chain alkylthio group having 1 to n carbon atoms" encompasses alkylthio groups having any straight-chain alkyl group having 1 to n carbon atoms. Examples include a methylthio group, an ethylthio group, and an n-propylthio group. On the other hand, the term "alkylthio group having 1 to 3 carbon atoms" refers to any straight-chain, branched-chain, or cyclic alkylthio group having 1 to 3 carbon atoms.

[0047] As used herein, the term "straight-chain alkylamino group having 1 to 6 carbon atoms" encompasses alkylamino groups having one or two alkylamino groups each having any straight-chain alkyl group having 1 to 6 carbon atoms. Examples include a methylamino group, a dimethylamino group, an ethylamino group, a methylethylamino group, and a diethylamino group.

[0048] As used herein, the term "an alkyl group having 1 to 7 carbon atoms, which may be branched or cyclic" includes any linear alkyl group having 1 to 7 carbon atoms, any branched alkyl group having 3 to 7 carbon atoms, and any cyclic alkyl group having 3 to 7 carbon atoms. It may also be simply referred to as a "lower alkyl group." For example, any linear alkyl group having 1 to 7 carbon atoms includes a methyl group, an ethyl group, an n-propyl group, an n-butyl group, an n-pentyl group, an n-hexyl group, and an n-heptyl group; any branched alkyl group having 3 to 7 carbon atoms includes an isopropyl group, an isobutyl group, a tert-butyl group, an isopentyl group, and the like; and any cyclic alkyl group having 3 to 7 carbon atoms includes a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, and the like.

[0049] In this specification, the term "an alkenyl group having 2 to 7 carbon atoms which may be branched or cyclic" includes any linear alkenyl group having 2 to 7 carbon atoms, any branched alkenyl group having 3 to 7 carbon atoms, and any cyclic alkenyl group having 3 to 7 carbon atoms. It may also be simply referred to as a "lower alkenyl group." For example, any linear alkenyl group having 2 to 7 carbon atoms includes ethenyl, 1-propenyl, 2-propenyl, 1-butenyl, 2-butenyl, 1-pentenyl, 2-pentenyl, 3-pentenyl, 4-pentenyl, and 1-hexenyl. Any branched alkenyl group having 3 to 7 carbon atoms includes isopropenyl, 1-methyl-1-propenyl, 1-methyl-2-propenyl, 2-methyl-1-propenyl, 2-methyl-2-propenyl, and 1-methyl-2-butenyl. Any cyclic alkenyl group having 3 to 7 carbon atoms includes cyclobutenyl, cyclopentenyl, and cyclohexenyl.

[0050] As used herein, the term "carbon number n 1 ~n 2 The aryl group having n carbon atoms 1 ~n 2 (where n 1 and n 2 is an integer, and n 1 <n 2 For example, the term "aryl group having 6 to 20 carbon atoms" includes a phenyl group, a naphthyl group, and the like.

[0051] As used herein, the term "carbon number n 1 ~n 2 The heteroaryl group of the formula "heteroaryl group of the formula n" refers to a heteroaryl group having n carbon atoms and containing one or more heteroatoms. 1 ~n 2 (where n 1 and n 2 is an integer, and n 1 <n 2Examples of heteroatoms constituting a heteroaryl group include an oxygen atom, a nitrogen atom, and a sulfur atom. For example, a "heteroaryl group having 4 to 20 carbon atoms" includes heteroaryl groups having 4 to 20 carbon atoms and containing one or more such heteroatoms.

[0052] As used herein, the term "carbon number n 1 ~n 2 The polycyclic group of the formula "n" means a polycyclic group having n carbon atoms which may contain one or more heteroatoms. 1 ~n 2 (where n 1 and n 2 is an integer, and n 1 <n 2 (wherein R is an integer of 1 to 10; R is an integer of 1 to 10; and ...

[0053] As used herein, the term "aryl group having 3 to 10 carbon atoms which may contain a heteroatom" includes any aryl group having 6 to 10 carbon atoms which is composed solely of hydrocarbon, and any heteroaryl group having 3 to 12 carbon atoms in which at least one carbon atom constituting the ring structure of the aryl group is replaced with a heteroatom (e.g., a nitrogen atom, an oxygen atom, a sulfur atom, or a combination thereof). Examples of the aryl group having 6 to 10 carbon atoms include a phenyl group, a naphthyl group, an indenyl group, an azulenyl group, etc., and examples of the heteroaryl group having 3 to 12 carbon atoms include a pyridyl group, a pyrrolyl group, a quinolyl group, an indolyl group, an imidazolyl group, a furyl group, a thienyl group, etc.

[0054] In this specification, examples of the term "aralkyl group having an aryl moiety having 3 to 12 carbon atoms and optionally containing a heteroatom" include a benzyl group, a phenethyl group, a naphthylmethyl group, a 3-phenylpropyl group, a 2-phenylpropyl group, a 4-phenylbutyl group, a 2-phenylbutyl group, a pyridylmethyl group, an indolylmethyl group, a furylmethyl group, a thienylmethyl group, a pyrrolylmethyl group, a 2-pyridylethyl group, a 1-pyridylethyl group, and a 3-thienylpropyl group.

[0055] As used herein, examples of the term "acyl group" include aliphatic acyl groups and aromatic acyl groups. Specific examples of the aliphatic acyl group include a formyl group, an acetyl group, a propionyl group, a butyryl group, an isobutyryl group, a pentanoyl group, a pivaloyl group, a valeryl group, an isovaleryl group, an octanoyl group, a nonanoyl group, a decanoyl group, a 3-methylnonanoyl group, an 8-methylnonanoyl group, a 3-ethyloctanoyl group, a 3,7-dimethyloctanoyl group, an undecanoyl group, a dodecanoyl group, a tridecanoyl group, a tetradecanoyl group, a pentadecanoyl group, a hexadecanoyl group, a 1-methylpentadecanoyl group, a 14-methylpentadecanoyl group, a 13,13-dimethyltetradecanoyl group, a heptadecanoyl group, a 2-methylpentadecanoyl group, a 1-methylpentadecanoyl group, a 14-methylpentadecanoyl group, a 13,13-dimethyltetradecanoyl group, a 2-methylpentadecano ... alkylcarbonyl groups such as noyl, 15-methylhexadecanoyl, octadecanoyl, 1-methylheptadecanoyl, nonadecanoyl, eicosanoyl, and henaicosanoyl groups; carboxylated alkylcarbonyl groups such as succinoyl, glutaroyl, and adipoyl groups; halogeno-lower alkylcarbonyl groups such as chloroacetyl, dichloroacetyl, trichloroacetyl, and trifluoroacetyl groups; lower alkoxy-lower alkylcarbonyl groups such as methoxyacetyl group; and unsaturated alkylcarbonyl groups such as (E)-2-methyl-2-butenoyl group. Examples of the aromatic acyl group include arylcarbonyl groups such as benzoyl, α-naphthoyl, and β-naphthoyl; halogenoarylcarbonyl groups such as 2-bromobenzoyl and 4-chlorobenzoyl; lower alkylated arylcarbonyl groups such as 2,4,6-trimethylbenzoyl and 4-toluoyl; lower alkoxylated arylcarbonyl groups such as 4-anisoyl; carboxylated arylcarbonyl groups such as 2-carboxybenzoyl, 3-carboxybenzoyl, and 4-carboxybenzoyl; nitrated arylcarbonyl groups such as 4-nitrobenzoyl and 2-nitrobenzoyl; lower alkoxycarbonylated arylcarbonyl groups such as 2-(methoxycarbonyl)benzoyl; and arylated arylcarbonyl groups such as 4-phenylbenzoyl.Preferred are a formyl group, an acetyl group, a propionyl group, a butyryl group, an isobutyryl group, a pentanoyl group, a pivaloyl group, and a benzoyl group.

[0056] As used herein, examples of the term "silyl group" include tri-lower alkylsilyl groups such as trimethylsilyl, triethylsilyl, isopropyldimethylsilyl, t-butyldimethylsilyl, methyldiisopropylsilyl, methyldi-t-butylsilyl, and triisopropylsilyl; and tri-lower alkylsilyl groups substituted with one or two aryl groups such as diphenylmethylsilyl, butyldiphenylbutylsilyl, diphenylisopropylsilyl, and phenyldiisopropylsilyl. Preferred are trimethylsilyl, triethylsilyl, triisopropylsilyl, t-butyldimethylsilyl, and t-butyldiphenylsilyl groups, with trimethylsilyl being more preferred.

[0057] As used herein, the term "halogen atom" includes, for example, a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom. A fluorine atom or a chlorine atom is preferred.

[0058] As used herein, the "protecting group" in the terms "protecting group for an amino group in nucleic acid synthesis," "protecting group for a hydroxyl group in nucleic acid synthesis," "hydroxyl group protected by a protecting group in nucleic acid synthesis," "phosphate group protected by a protecting group in nucleic acid synthesis," and "mercapto group protected by a protecting group in nucleic acid synthesis" is not particularly limited as long as it can stably protect an amino group, hydroxyl group, phosphate group, or mercapto group during nucleic acid synthesis. Specifically, it refers to a protecting group that is stable under acidic or neutral conditions and can be cleaved by chemical methods such as hydrogenolysis, hydrolysis, electrolysis, and photolysis. Examples of such protecting groups include lower alkyl groups, lower alkenyl groups, acyl groups, tetrahydropyranyl or tetrahydrothiopyranyl groups, tetrahydrofuranyl or tetrahydrothiofuranyl groups, silyl groups, lower alkoxymethyl groups, lower alkoxylated lower alkoxymethyl groups, halogeno lower alkoxymethyl groups, lower alkoxylated ethyl groups, halogenated ethyl groups, methyl groups substituted with 1 to 3 aryl groups, "methyl groups substituted with 1 to 3 aryl groups in which the aryl ring is substituted with a lower alkyl group, a lower alkoxy group, a halogen atom or a cyano group", lower alkoxycarbonyl groups, "aryl groups substituted with a halogen atom, a lower alkoxy group or a nitro group", "lower alkoxycarbonyl groups substituted with a halogen atom or a tri-lower alkylsilyl group", alkenyloxycarbonyl groups, and "aralkyloxycarbonyl groups in which the aryl ring may be substituted with a lower alkoxy or a nitro group".

[0059] More specifically, examples of tetrahydropyranyl or tetrahydrothiopyranyl groups include tetrahydropyran-2-yl, 3-bromotetrahydropyran-2-yl, 4-methoxytetrahydropyran-4-yl, tetrahydrothiopyran-4-yl, and 4-methoxytetrahydrothiopyran-4-yl groups. Examples of tetrahydrofuranyl or tetrahydrothiofuranyl groups include tetrahydrofuran-2-yl and tetrahydrothiofuran-2-yl groups. Examples of lower alkoxymethyl groups include methoxymethyl, 1,1-dimethyl-1-methoxymethyl, ethoxymethyl, propoxymethyl, isopropoxymethyl, butoxymethyl, and t-butoxymethyl groups. Examples of lower alkoxylated lower alkoxymethyl groups include 2-methoxyethoxymethyl groups. Examples of halogeno lower alkoxymethyl groups include 2,2,2-trichloroethoxymethyl and bis(2-chloroethoxy)methyl groups. Examples of lower alkoxylated ethyl groups include 1-ethoxyethyl and 1-(isopropoxy)ethyl groups. Examples of halogenated ethyl groups include 2,2,2-trichloroethyl groups. Examples of methyl groups substituted with 1 to 3 aryl groups include benzyl, α-naphthylmethyl, β-naphthylmethyl, diphenylmethyl, triphenylmethyl, α-naphthyldiphenylmethyl, and 9-anthrylmethyl groups. Examples of the "methyl group substituted by 1 to 3 aryl groups in which the aryl ring is substituted with a lower alkyl group, a lower alkoxy group, a halogen atom, or a cyano group" include 4-methylbenzyl, 2,4,6-trimethylbenzyl, 3,4,5-trimethylbenzyl, 4-methoxybenzyl, 4-methoxyphenyldiphenylmethyl, 4,4'-dimethoxytriphenylmethyl, 2-nitrobenzyl, 4-nitrobenzyl, 4-chlorobenzyl, 4-bromobenzyl, 4-cyanobenzyl, etc. Examples of the lower alkoxycarbonyl group include a methoxycarbonyl, ethoxycarbonyl, t-butoxycarbonyl, isobutoxycarbonyl, etc.Examples of "aryl groups substituted with a halogen atom, a lower alkoxy group, or a nitro group" include a 4-chlorophenyl group, a 2-fluorophenyl group, a 4-methoxyphenyl group, a 4-nitrophenyl group, and a 2,4-dinitrophenyl group. Examples of "lower alkoxycarbonyl groups substituted with a halogen atom or a tri-lower alkylsilyl group" include a 2,2,2-trichloroethoxycarbonyl group and a 2-trimethylsilylethoxycarbonyl group. Examples of alkenyloxycarbonyl groups include a vinyloxycarbonyl group and an aryloxycarbonyl group. Examples of "aralkyloxycarbonyl groups in which the aryl ring may be substituted with a lower alkoxy or a nitro group" include a benzyloxycarbonyl group, a 4-methoxybenzyloxycarbonyl group, a 3,4-dimethoxybenzyloxycarbonyl group, a 2-nitrobenzyloxycarbonyl group, and a 4-nitrobenzyloxycarbonyl group.

[0060] In one embodiment, examples of "protecting groups for hydroxyl groups in nucleic acid synthesis" include, for example, aliphatic acyl groups, aromatic acyl groups, methyl groups substituted with 1 to 3 aryl groups, "methyl groups substituted with 1 to 3 aryl groups in which the aryl ring is substituted with lower alkyl, lower alkoxy, halogen, or cyano group," and silyl groups. Alternatively, in one embodiment, examples of "protecting groups for hydroxyl groups in nucleic acid synthesis" include, for example, acetyl groups, benzoyl groups, benzyl groups, p-methoxybenzoyl groups, dimethoxytrityl groups, monomethoxytrityl groups, tert-butyldiphenylsilyl groups, tert-butyldimethylsilyl (TBDMS) groups, [(triisopropylsilyl)oxy]methyl (TOM) groups, [(2-nitrobenzyl)oxy]methyl (NBOM) groups, bis(acetoxy) groups, and the like. 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl (4-MABOM) group.

[0061] In one embodiment, examples of the protecting group for a "hydroxyl group protected with a protecting group for nucleic acid synthesis" include an aliphatic acyl group, an aromatic acyl group, a "methyl group substituted with 1 to 3 aryl groups," an "aryl group substituted with a halogen atom, a lower alkoxy group, or a nitro group," a lower alkyl group, and a lower alkenyl group. Alternatively, in one embodiment, examples of the protecting group for a "hydroxyl group protected with a protecting group for nucleic acid synthesis" include a benzoyl group, a benzyl group, a 2-chlorophenyl group, a 4-chlorophenyl group, and a 2-propenyl group.

[0062] In one embodiment, the "protecting group for an amino group in nucleic acid synthesis" is, for example, an acyl group, preferably a benzoyl group.

[0063] In one embodiment, examples of the "protecting group" of the "phosphate group protected with a protecting group in nucleic acid synthesis" include a lower alkyl group, a lower alkyl group substituted with a cyano group, an aralkyl group, an "aralkyl group in which the aryl ring is substituted with a nitro group or a halogen atom," and an "aryl group substituted with a lower alkyl group, a halogen atom, or a nitro group." Alternatively, examples of the "protecting group" of the "phosphate group protected with a protecting group in nucleic acid synthesis" include a 2-cyanoethyl group, a 2,2,2-trichloroethyl group, a benzyl group, a 2-chlorophenyl group, and a 4-chlorophenyl group.

[0064] In one embodiment, the "protecting group" of the "mercapto group protected by a protecting group for nucleic acid synthesis" includes, for example, an aliphatic acyl group and an aromatic acyl group, preferably a benzoyl group.

[0065] As used herein, the term "salt thereof" refers to a salt of a specific compound. Examples of such salts include metal salts such as alkali metal salts (e.g., sodium salt, potassium salt, and lithium salt), alkaline earth metal salts (e.g., calcium salt and magnesium salt), aluminum salt, iron salt, zinc salt, copper salt, nickel salt, and cobalt salt; inorganic salts (e.g., ammonium salt), t-octylamine salt, dibenzylamine salt, morpholine salt, glucosamine salt, phenylglycine alkyl ester salt, ethylenediamine salt, N-methylglucamine salt, guanidine salt, diethylamine salt, triethylamine salt, dicyclohexylamine salt, N,N'-dibenzylethylenediamine salt, chloroprocaine salt, procaine salt, diethanolamine salt, N-benzyl-phenethylamine salt, piperazine salt, tetrahydrofuran ... Examples of suitable salts include amine salts, such as organic salts like methylammonium salts and tris(hydroxymethyl)aminomethane salts; inorganic acid salts like hydrohalogen salts like hydrofluoride, hydrochloride, hydrobromide and hydroiodide, nitrate, perchlorate, sulfate and phosphate; organic acid salts like lower alkanesulfonates like methanesulfonate, trifluoromethanesulfonate and ethanesulfonate, arylsulfonates like benzenesulfonate and p-toluenesulfonate, acetate, malate, fumarate, succinate, citrate, tartrate, oxalate and maleate; and amino acid salts like glycine salt, lysine salt, arginine salt, ornithine salt, glutamate and aspartate.

[0066] As used herein, the term "pharmaceutically acceptable cation" means a cation that is unlikely to wholly or partially interfere with the purpose of the use of the conjugate of the present invention, for example, in a pharmaceutical application, and includes, for example, a hydrogen ion, a sodium ion, a potassium ion, an ammonium ion, etc.

[0067] As used herein, the term "pharmaceutically acceptable anion" means an anion that is unlikely to wholly or partially interfere with the purpose of the use of the conjugate of the present invention, for example, in a pharmaceutical application, and includes, for example, chloride ion, bromide ion, hydroxide ion, acetate ion, carbonate ion, phosphate ion, etc.

[0068] As used herein, the term "nucleoside" includes "nucleosides" in which a purine or pyrimidine base is bound to a sugar, as well as "nucleosides" in which a sugar is bound to an aromatic heterocyclic ring or aromatic hydrocarbon ring other than purine or pyrimidine that can substitute for a purine or pyrimidine base. Natural nucleosides are also referred to as "natural nucleosides." Modified, non-natural nucleosides are also referred to as "modified nucleosides," and nucleotides in which the sugar moiety is modified are particularly referred to as "sugar-modified nucleosides." "Nucleotide" refers to a compound in which a phosphate group is bound to the sugar of a nucleoside. "Nucleosides" and "nucleotides" include those of DNA and RNA, respectively.

[0069] As used herein, the term "oligonucleotide" refers to a polymer of "nucleotides" in which 2 to 50 identical or different "nucleosides" are linked by phosphodiester bonds or other bonds, and includes both natural and non-natural oligonucleotides. Non-natural oligonucleotides preferably include sugar derivatives in which the sugar moiety is modified; thioate derivatives in which the phosphodiester moiety is thioated; esters in which the terminal phosphate moiety is esterified; and amides in which the amino group on the purine base is amidated, and more preferably sugar derivatives in which the sugar moiety is modified. An "oligonucleotide" may be composed of natural or modified nucleosides, or may be a mixture of natural and modified nucleosides.

[0070] The linkage between sugars (internucleoside linkage) in an oligonucleotide may be a phosphodiester (D-oligo) linkage found in natural nucleic acids, or an artificially modified linkage (e.g., phosphorothioate (S-oligo), methylphosphonate (M-oligo), boranophosphonate, etc.). Any linkage known in the art may be used. S-oligo (phosphorothioate) has a PS backbone in which the oxygen atom of the phosphate group of the internucleoside phosphodiester linkage is replaced with a sulfur atom. This modification is incorporated into an oligonucleotide according to known methods. An antisense oligonucleotide (ASO) having one or more of these modifications in the oligonucleotide is also called an S-oligo type (phosphorothioate type). The linkages in the oligonucleotide may all be the same, or may contain different linkages. Preferably, the oligonucleotide of the present invention comprises a D-oligo and / or an S-oligo.

[0071] Nucleotide modifications known in the art can also be used. Known nucleotide modifications include sugar modifications and nucleic acid base modifications. Such nucleic acid modifications can be performed based on methods known in the art.

[0072] Examples of nucleic acid base modifications include 5-methylcytosine, 5-hydroxymethylcytosine, and 5-propynylcytosine.

[0073] Examples of sugar modifications include substitution at the 2' position of the sugar and a bridge structure between the 4' and 2' positions of the sugar. Examples of substitution at the 2' position of the sugar include 2'-F, 2'-OCH 3 (2'-OMe), 2'-OCH 2 CH 2 OCH 3 (2'-MOE), etc. The bridge structure between the 4'- and 2'-sugar positions will be described later.

[0074] (Conjugate) The conjugate of the present invention has the following formula (I):

[0075]

[0076] where Lk is a linker moiety, NCA is a nucleic acid moiety, and Lg is a ligand moiety.

[0077] (Ligand Moiety) In the conjugate of the present invention, Lg (ligand moiety) in (I) above is a group represented by the following formula (II):

[0078]

[0079] (In formula (II), * 1 is a bond with Lk, and A 1 is a sulfur atom or an oxygen atom, R 1 and R 2 are each independently: (i) a hydrogen atom; (ii) an alkyl group having 1 to 9 carbon atoms which may be branched and which may be substituted with at least one group selected from the group consisting of an alkyl group having 1 to 3 carbon atoms which may be branched, an alkoxy group having 1 to 3 carbon atoms which may be branched, an alkylthio group having 1 to 3 carbon atoms which may be branched, a hydroxyl group, a nitro group, and a halogen atom; or R 1 and R 2 are taken together to form a phenyl or thiophene ring which may be substituted with a halogen atom).

[0080] In one embodiment, Lg (ligand moiety) is a group represented by the following formula (II-1):

[0081]

[0082] (In formula (II-1), * 1 is a bond with Lk, and A 1 is a sulfur atom or an oxygen atom, R 3is a group selected from the group consisting of a hydrogen atom, an optionally branched alkyl group having 1 to 3 carbon atoms, an optionally branched alkoxy group having 1 to 3 carbon atoms, an optionally branched alkylthio group having 1 to 3 carbon atoms, a hydroxyl group, a nitro group, and a halogen atom), preferably a group represented by the following formula (II-1′):

[0083]

[0084] (In formula (II-1'), * 1 , A 1 , and R 3 are each independently the same as defined in formula (II-1) above).

[0085] Examples of groups represented by formula (II-1) or (II-1′) include the following:

[0086]

[0087] In one embodiment, Lg is a group represented by the following formula (II-2):

[0088]

[0089] (In formula (II-2), * 1 is a bond with Lk, and A 1 is a sulfur atom or an oxygen atom, R 3 is a group selected from the group consisting of a hydrogen atom, an optionally branched alkyl group having 1 to 3 carbon atoms, an optionally branched alkoxy group having 1 to 3 carbon atoms, an optionally branched alkylthio group having 1 to 3 carbon atoms, a hydroxyl group, a nitro group, and a halogen atom), preferably a group represented by the following formula (II-2′):

[0090]

[0091] (In formula (II-2'), * 1 , A 1 , and R 3 are each independently the same as defined in formula (II-2) above).

[0092] Examples of the group represented by formula (II-2) or (II-2') include the following:

[0093]

[0094] In one embodiment, Lg is a group represented by the following formula (II-3):

[0095]

[0096] (In formula (II-3), * 1 is a bond with Lk, and A 1 is a sulfur atom or an oxygen atom).

[0097] Examples of the group represented by formula (II-3) include the following:

[0098]

[0099] In the present invention, from the viewpoint of the possibility of delivering nucleic acid medicines to various organs or tissues such as the spleen, it is more preferable that Lg in the above formula (I) is a group represented by any one of the following formulas (II-4):

[0100]

[0101] (In formula (II-4), * 1 is a bond to Lk).

[0102] In the conjugates of the present invention, the ligand moiety (Lg) is linked to the nucleic acid moiety (NCA) via a linker moiety (Lk).

[0103] (Linker Moiety) In the conjugate of the present invention, Lk (linker moiety) in (I) above is a group represented by the following formula (III):

[0104]

[0105] (In formula (III), * 2 and * 3 is a bond, and X i is an oxygen atom or a sulfur atom, and X ii + is a pharmaceutically acceptable cation, and Y is —(CH 2 ) m - or - (CH 2 OCH2 ) n -, wherein m and n are each independently an integer of 1 to 40.

[0106] (Nucleic acid moiety) In the conjugate of the present invention, the NCA (nucleic acid moiety) in the above formula (I) can be any molecule as long as it is composed of nucleic acid, for example, an oligonucleotide. The NCA may be an oligonucleotide that is desired to be delivered to a target organ and function. Examples of oligonucleotides include those that suppress the expression of target genes and those that regulate the expression of target genes.

[0107] Such oligonucleotides include nucleic acid medicines.Oligonucleotides can be single-stranded or double-stranded, and include, for example, siRNA, miRNA, antisense oligonucleotides (ASO), and nucleic acid aptamers.Antisense oligonucleotides can form double-stranded oligonucleotides together with the sequence that can bind to target sequence.

[0108] The oligonucleotide is, for example, an 8-50 base oligonucleotide consisting of a sequence capable of binding to a target sequence in a target gene. The length of the oligonucleotide is, for example, 8 bases or more, 9 bases or more, 10 bases or more, 11 bases or more, 12 bases or more, 13 bases or more, 14 bases or more, or 15 bases or more, and 50 bases or less, 40 bases or less, 30 bases or less, 25 bases or less, or 20 bases or less.

[0109] In the present invention, when the oligonucleotide is a double-stranded oligonucleotide, the second strand is an oligonucleotide consisting of a sequence capable of binding to a first strand oligonucleotide consisting of a sequence capable of binding to a target sequence in a target gene. This second strand is, for example, 8 to 60 bases, 8 or more bases, 9 or more bases, 10 or more bases, 11 or more bases, 12 or more bases, 13 or more bases, 14 or more bases, or 15 or more bases, and 60 or less bases, 50 or less bases, 40 or less bases, 30 or less bases, 25 or less bases, or 20 or less bases. The length of the second strand may be the same as that of the first strand, or may be one or several bases shorter than the first strand, as long as it binds to the first strand, or may be longer than the first strand by adding one or several bases to one or both sides of the site binding to the first strand. In this specification, "one or several bases" means 1 to 10, 1 to 5, 1 to 3, or 1 or 2 bases. The preferred length of the second strand depends on the length of the first strand, and can be, for example, 50% or more, 60% or more, 70% or more, 50-100%, 60-100%, or 70-100% of the length of the first strand.

[0110] The term "binding" of an oligonucleotide to a target sequence means that multiple different single-stranded oligonucleotides or nucleic acids can form a double-stranded or more stranded nucleic acid due to the complementarity of the nucleic acid bases. Preferably, it means that a double-stranded nucleic acid can be formed. The melting temperature (T m ) is not particularly limited.

[0111] The melting temperature (T m ) can be determined, for example, as follows: Buffer (8.1 mM Na 2 HPO 4 , 2.68 mM KCl, 1.47 mM KH 2 P.O. 4The oligonucleotide and the target RNA are mixed in equimolar amounts in a 200-well plate (pH 7.2), heated at 95°C for 5 minutes, and then slowly cooled to room temperature to allow annealing and form a double-stranded nucleic acid. The temperature of the double-stranded nucleic acid is heated from 20°C to 95°C at a heating rate of 0.5°C / min, and the change in absorbance (A) at 260 nm with temperature (T) is measured. A graph of dA / dT vs. T is created from the measurement results, and the temperature at which the value of dA / dT is maximized in this graph, i.e., the temperature at which the change in A due to T is maximized, is defined as the T of the double-stranded nucleic acid. m Let's say.

[0112] Melting temperature (T m ) is, for example, 40°C or higher, preferably 50°C or higher.

[0113] As used herein, "complementary" refers to two different single-stranded oligonucleotides or nucleic acids that are in a pairing relationship capable of forming a double-stranded nucleic acid. Preferably, the base sequences of the double-stranded regions are completely complementary, but one or several mismatches may be present, as long as the double-stranded nucleic acid can be formed and the desired function (e.g., expression suppression or regulation) can be exerted. "One or several mismatches" refers to 1 to 4, preferably 1 to 3, and more preferably 1 or 2 mismatches, depending on the length of the oligonucleotide. The oligonucleotide of the present invention preferably has 80% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more complementarity to the base sequence of the double-stranded region. Alternatively, it may have complete (100%) complementarity.

[0114] Oligonucleotides include both natural DNA-containing oligonucleotides (unmodified oligonucleotides) and chemically modified DNA-containing oligonucleotides. Such modifications can change the activity of oligonucleotides, for example, can increase the affinity for target nucleic acids or increase the resistance to nucleic acid degrading enzymes (nucleases). Increasing the affinity of oligonucleotides for targets allows the use of shorter oligonucleotides.

[0115] An oligonucleotide may contain at least one sugar-modified nucleoside at any position, the sugar-modified nucleoside having a bridging moiety, e.g., as described below, between the 2' and 4' positions of the sugar ring.

[0116] In one embodiment, the oligonucleotide of the present invention comprises at least one nucleoside structure represented by the following formula (IV) as a sugar-modified nucleoside:

[0117]

[0118] (In formula (IV), * represents a bond, BASE represents a purin-9-yl group which may have one or more optional substituents selected from Group α, or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more optional substituents selected from Group α, said Group α consisting of a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected with a protecting group for nucleic acid synthesis, and a halogen atom, and A is one of the following:

[0119]

[0120] is a divalent group represented by R 25 represents a hydrogen atom, an alkyl group having 1 to 7 carbon atoms which may be branched or cyclic, an alkenyl group having 2 to 7 carbon atoms which may be branched or cyclic, an aryl group having 3 to 12 carbon atoms which may have one or more optional substituents selected from the α group and which may contain a heteroatom, an aralkyl group having an aryl moiety having 3 to 12 carbon atoms which may have one or more optional substituents selected from the α group and which may contain a heteroatom, or a protecting group for an amino group in nucleic acid synthesis; 26 and R 27are each independently a hydrogen atom; an alkyl group having 1 to 7 carbon atoms which may be substituted with an aryl group having 3 to 12 carbon atoms which may contain a heteroatom and which may be branched or cyclic; or an aralkyl group having an aryl moiety having 3 to 12 carbon atoms which may contain a heteroatom; or R 26 and R 27 are combined, -(CH 2 ) s - wherein s is an integer from 2 to 5; 28 and R 29 are each independently a group selected from the group consisting of a hydrogen atom; a hydroxyl group; an alkyl group having 1 to 7 carbon atoms, which may be branched or cyclic; an alkoxy group having 1 to 7 carbon atoms, which may be branched or cyclic; an amino group; and an amino group protected with a protecting group for nucleic acid synthesis; or R 28 and R 29 are combined together, = C(R 37 ) R 38 [In the formula, R 37 and R 38 each independently represents a hydrogen atom, a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, an amino group, a linear or branched chain alkoxy group having 1 to 6 carbon atoms, a linear or branched chain alkylthio group having 1 to 6 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or a linear or branched chain alkylamino group having 1 to 6 carbon atoms; R 30 and R 31 are each independently a hydrogen atom, an alkyl group having 1 to 7 carbon atoms which may be branched or cyclic, an alkoxy group having 1 to 7 carbon atoms which may be branched or cyclic, or a linear or branched alkylthio group having 1 to 6 carbon atoms; 32 represents a hydrogen atom, an alkyl group having 1 to 7 carbon atoms which may be branched or cyclic, an alkoxy group having 1 to 7 carbon atoms which may be branched or cyclic, or a linear or branched alkylthio group having 1 to 6 carbon atoms; R 33is a hydrogen atom, a hydroxyl group, an alkyl group having 1 to 7 carbon atoms which may be branched or cyclic, an alkoxy group having 1 to 7 carbon atoms which may be branched or cyclic, an amino group, or an amino group protected by a protecting group for nucleic acid synthesis; R 34 represents a hydrogen atom, an alkyl group having 1 to 7 carbon atoms which may be branched or cyclic, a protecting group for an amino group, or

[0121]

[0122] (wherein * is a bond and t is an integer of 2 to 5), or -(C=(NHR 39 ) + )-NR 40 R 41 [In the formula, R 39 , R 40 and R 41 each independently represents a hydrogen atom, an optionally branched or cyclic alkyl group having 1 to 7 carbon atoms, a protecting group for an amino group, or

[0123]

[0124] (wherein * is a bond, and t is an integer of 2 to 5) 35 and R 36 are each independently a group selected from the group consisting of a hydrogen atom; a hydroxyl group; an alkyl group having 1 to 7 carbon atoms, which may be branched or cyclic; an alkoxy group having 1 to 7 carbon atoms, which may be branched or cyclic; an amino group; and an amino group protected with a protecting group for nucleic acid synthesis; m is an integer of 0 to 2, n is an integer of 0 to 1, and R 34 is a hydrogen atom, an alkyl group having 1 to 7 carbon atoms which may be branched or cyclic, or a protecting group for an amino group, or

[0125]

[0126] (wherein * is a bond and t is an integer of 2 to 5), then u is 1, and R 29 and R 30 each independently represents a hydrogen atom, an optionally branched or cyclic alkyl group having 1 to 7 carbon atoms, a protecting group for an amino group, or

[0127]

[0128] (wherein * is a bond and t is an integer from 2 to 5), or R 34 -(C=(NHR 39 ) + )-NR 40 R 41 In the case where X is an oxygen atom, a sulfur atom, or an amino group, Y is an oxygen atom or a sulfur atom, and Z is - is a pharmaceutically acceptable anion).

[0129] In the above formula (IV), "BASE" is, for example, a purine base (i.e., a purine-9-yl group) or a pyrimidine base (i.e., a 2-oxo-1,2-dihydropyrimidin-1-yl group). These bases may have one or more optional substituents selected from the α group consisting of a hydroxyl group, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, and a halogen atom.

[0130] Specific examples of the above "BASE" include an adeninyl group, a guaninyl group, a cytosinyl group, a uracinyl group, and a thyminyl group, as well as a 6-aminopurin-9-yl group, a 2,6-diaminopurin-9-yl group, a 2-amino-6-chloropurin-9-yl group, a 2-amino-6-fluoropurin-9-yl group, a 2-amino-6-bromopurin-9-yl group, a 2-amino-6-hydroxypurin-9-yl group, a 6-amino-2-methoxypurin-9-yl group, a 6-amino-2-chloropurin-9-yl group, a 6-amino-2-fluoropurin-9-yl group, a 2,6-dimethoxypurin-9-yl group, a 2,6-dichloropurin-9-yl group, a 6-mercaptopurin-9-yl group, Examples thereof include a 2-oxo-4-amino-1,2-dihydropyrimidin-1-yl group, a 4-amino-2-oxo-5-fluoro-1,2-dihydropyrimidin-1-yl group, a 4-amino-2-oxo-5-chloro-1,2-dihydropyrimidin-1-yl group, a 2-oxo-4-methoxy-1,2-dihydropyrimidin-1-yl group, a 2-oxo-4-mercapto-1,2-dihydropyrimidin-1-yl group, a 2-oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl group, a 2-oxo-4-hydroxy-5-methyl-1,2-dihydropyrimidin-1-yl group, and a 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl group.

[0131] Alternatively, from the viewpoint of introduction into nucleic acid medicines, "BASE" has the following structural formula:

[0132]

[0133] and 2-oxo-4-hydroxy-5-methyl-1,2-dihydropyrimidin-1-yl, 2-oxo-4-amino-1,2-dihydropyrimidin-1-yl, 6-aminopurin-9-yl, 2-amino-6-hydroxypurin-9-yl, 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl, and 2-oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl groups. Furthermore, it is preferred that the hydroxyl and amino groups constituting the "BASE" group are protected by protecting groups during oligonucleotide synthesis.

[0134] The oligonucleotides of the present invention can be synthesized by conventional methods using the sugar-modified nucleosides and natural nucleosides described above, and can be easily synthesized, for example, using a commercially available automated nucleic acid synthesizer (e.g., manufactured by Applied Biosystems, Gene Design, etc.). Examples of synthesis methods include solid-phase synthesis using phosphoramidites and solid-phase synthesis using hydrogen phosphonates. For example, these methods are disclosed in Tetrahedron Letters, 1981, vol. 22, pp. 1859-1862, WO 2011 / 052436, WO 2014 / 046212, WO 2015 / 125783, etc.

[0135] In the conjugate of the present invention, when the nucleic acid portion (NCA) is composed of an oligonucleotide, the ligand portion (Lg) can be bound to at least one of the 3'-end and 5'-end of the oligonucleotide via a linker portion (Lk). When the oligonucleotide in the conjugate of the present invention is a double-stranded oligonucleotide, the ligand portion (Lg) is preferably bound to the second strand via the linker portion (Lk). More preferably, the linker portion (Lk) is bound to the 3'-end and / or 5'-end of the second strand.

[0136] In the conjugate of the present invention, the 3' or 5' end of the oligonucleotide to which the ligand moiety (Lg) is not bound via the linker moiety (Lk) may be further modified. Modifications known in the art can be used to enable tracking of the oligonucleotide, improve the pharmacokinetics or pharmacodynamics of the oligonucleotide, or enhance the stability or binding affinity of the oligonucleotide. Examples of groups that can be used for such modifications include hydroxyl protecting groups, reporter molecules, cholesterol, phospholipids, dyes, and fluorescent molecules. Furthermore, in the conjugate of the present invention, the 3' or 5' end of the oligonucleotide to which the ligand moiety (Lg) is not bound via the linker moiety (Lk) may contain a phosphate ester moiety. As used herein, the term "phosphate ester moiety" refers to a terminal phosphate group, including phosphate esters and modified phosphate esters. The phosphate ester moiety may be located at either end, but is preferably located at the 5'-terminal nucleoside. For example, a group represented by the formula: -O-P(=O)(OH)OH or a modified group thereof (e.g., one or more of O and OH may be substituted with H, O, OR', S, N(R') (wherein R' is H, an amino-protecting group, or a substituted or unsubstituted alkyl), or alkyl) may be used. The 5' or 3' end may each independently contain 1 to 3 substituted or unsubstituted phosphate ester moieties.

[0137] (Specific Example of Conjugate) The conjugate of the present invention has, for example, a structure represented by the following formula (I-1) among the structures represented by the above formula (I):

[0138]

[0139] (In formula (I-1), NCA is a nucleic acid moiety, and A 1 is a sulfur atom or an oxygen atom, R 3 is a group selected from the group consisting of a hydrogen atom, an optionally branched alkyl group having 1 to 3 carbon atoms, an optionally branched alkoxy group having 1 to 3 carbon atoms, an optionally branched alkylthio group having 1 to 3 carbon atoms, a hydroxyl group, a nitro group, and a halogen atom;i is an oxygen atom or a sulfur atom, and X ii + is a pharmaceutically acceptable cation, and Y is —(CH 2 ) m - or - (CH 2 OCH 2 ) n -, wherein m and n are each independently an integer of 1 to 40.

[0140] Alternatively, the conjugate of the present invention has, for example, a structure represented by the following formula (I-2) among the structures represented by the above formula (I):

[0141]

[0142] (In formula (I-2), NCA is a nucleic acid moiety, and A 1 is a sulfur atom or an oxygen atom, R 3 is a group selected from the group consisting of a hydrogen atom, an optionally branched alkyl group having 1 to 3 carbon atoms, an optionally branched alkoxy group having 1 to 3 carbon atoms, an optionally branched alkylthio group having 1 to 3 carbon atoms, a hydroxyl group, a nitro group, and a halogen atom; i is an oxygen atom or a sulfur atom, and X ii + is a pharmaceutically acceptable cation, and Y is —(CH 2 ) m - or - (CH 2 OCH 2 ) n -, wherein m and n are each independently an integer of 1 to 40.

[0143] Alternatively, the conjugate of the present invention has, for example, a structure represented by the following formula (I-3) among the structures represented by the above formula (I):

[0144]

[0145] (In formula (I-3), NCA is a nucleic acid moiety, and A 1 is a sulfur atom or an oxygen atom, and X iis an oxygen atom or a sulfur atom, and X ii + is a pharmaceutically acceptable cation, and Y is —(CH 2 ) m - or - (CH 2 OCH 2 ) n -, wherein m and n are each independently an integer of 1 to 40.

[0146] (Method for synthesizing a conjugate) The conjugate of the present invention can be synthesized, for example, by adding a compound constituting the linker moiety (Lk) to a nucleic acid moiety (NCA) (e.g., an oligonucleotide) in advance during automated synthesis on a solid phase, in addition to a nucleic acid molecule capable of constituting an oligonucleotide as a material for the synthesis, thereby pre-adding the linker moiety (Lk) to the nucleic acid moiety (NCA). A ligand compound can be reacted with the nucleic acid moiety having the linker moiety thus obtained (hereinafter also referred to as a linker-attached nucleic acid moiety) to synthesize a conjugate in which the ligand moiety (Lg) and the nucleic acid moiety (NCA) are integrated via the linker moiety (Lk).

[0147] Here, when the linker moiety of the linker-attached nucleic acid moiety has an amino group at the end of the linker moiety, the linker-attached nucleic acid moiety can react with a ligand compound having a carboxy group (—COOH) to obtain a conjugate.

[0148] The ligand compound having a carboxy group is not necessarily limited, but examples thereof include compounds represented by the following formula (V):

[0149]

[0150] (In formula (V), A 1 is a sulfur atom or an oxygen atom, R 1 and R 2are each independently: (i) a hydrogen atom; (ii) an alkyl group having 1 to 9 carbon atoms which may be branched and which may be substituted with at least one group selected from the group consisting of an alkyl group having 1 to 3 carbon atoms which may be branched, an alkoxy group having 1 to 3 carbon atoms which may be branched, an alkylthio group having 1 to 3 carbon atoms which may be branched, a hydroxyl group, a nitro group, and a halogen atom; or R 1 and R 2 are taken together to form a phenyl or thiophene ring which may be substituted with a halogen atom).

[0151] In one embodiment, the ligand compound is a compound represented by the following formula (V-1):

[0152]

[0153] (In formula (V-1), A 1 is a sulfur atom or an oxygen atom, R 3 is a group selected from the group consisting of a hydrogen atom, an optionally branched alkyl group having 1 to 3 carbon atoms, an optionally branched alkoxy group having 1 to 3 carbon atoms, an optionally branched alkylthio group having 1 to 3 carbon atoms, a hydroxyl group, a nitro group, and a halogen atom), and preferably a compound represented by the following formula (V-1′):

[0154]

[0155] (In formula (V-1'), A 1 , and R 3 are each independently the same as defined in formula (V-1) above).

[0156] In one embodiment, the ligand compound is a compound represented by the following formula (V-2):

[0157]

[0158] (In formula (V-2), A 1is a sulfur atom or an oxygen atom, R 3 is a group selected from the group consisting of a hydrogen atom, an optionally branched alkyl group having 1 to 3 carbon atoms, an optionally branched alkoxy group having 1 to 3 carbon atoms, an optionally branched alkylthio group having 1 to 3 carbon atoms, a hydroxyl group, a nitro group, and a halogen atom), and preferably a compound represented by the following formula (V-2'):

[0159]

[0160] (In formula (V-2'), A 1 and R 3 are each independently the same as defined in formula (V-2) above).

[0161] In one embodiment, the ligand compound is a group represented by the following formula (V-3):

[0162]

[0163] (In formula (V-3), A 1 is a sulfur atom or an oxygen atom).

[0164] In the present invention, from the viewpoint of the possibility of delivering nucleic acid medicines to various organs or tissues such as the spleen, it is more preferable that the ligand compound represented by formula (V) above is a compound represented by any one of formulas (V-4) below:

[0165]

[0166] When the linker moiety of the above-mentioned linker-attached nucleic acid moiety has an amino group at the end of the linker moiety, the conjugate of the present invention can be synthesized from the linker-attached nucleic acid moiety and a ligand compound having a carboxy group, for example, through an amidation reaction known to those skilled in the art.

[0167] The conjugate of the present invention can, for example, transfer the nucleic acid moiety to a specific organ, allowing the nucleic acid moiety to exert its function. The conjugate of the present invention is useful for delivering nucleic acid drugs to organs or tissues such as the spleen, kidney, large intestine, and stomach. This makes it possible to treat or prevent diseases in the organs or tissues.

[0168] (Pharmaceutical Composition) The pharmaceutical composition of the present invention comprises the conjugate described above.

[0169] The administration method and dosage form of the pharmaceutical composition of the present invention are not particularly limited, and any administration method and dosage form known in the art can be used.

[0170] The pharmaceutical compositions of the present invention can be administered by various methods depending on the type of local or systemic treatment and the area to be treated. Administration methods may include, for example, topical (e.g., ophthalmic, intravaginal, rectal, intranasal, and transdermal), oral, or parenteral. Parenteral administration includes intravenous injection or infusion, subcutaneous, intraperitoneal, or intramuscular injection, and pulmonary administration via the airways by aspiration or inhalation.

[0171] When the pharmaceutical composition of the present invention is administered topically, dosage forms such as transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders may be used.

[0172] Examples of compositions for oral administration include powders, granules, suspensions or solutions in water or non-aqueous media, capsules, powders, tablets, etc. Compositions for parenteral administration include sterile aqueous solutions containing buffers, diluents and other suitable additives.

[0173] The pharmaceutical composition of the present invention can be obtained by mixing an effective amount of the "nucleic acid portion" in the conjugate with various pharmaceutical additives suitable for the dosage form, such as excipients, binders, wetting agents, disintegrants, lubricants, diluents, etc., as needed. In the case of an injection, it can be formulated by sterilization together with an appropriate carrier.

[0174] The individual to be administered is preferably a mammal, more preferably a human, a pet animal such as a monkey, a dog, or a cat, or a livestock animal such as a cow or a pig, and even more preferably a human. The effective dose depends on the individual to be administered, and can be determined arbitrarily depending on the type, sex, age, weight, symptoms, etc. of the individual, as well as the method, route, frequency, etc. of administration.

[0175] The present invention will be described below with reference to examples, but the present invention is not limited to these examples.

[0176] Example 1 Preparation of Conjugates by Amidation with Carboxylic Acid Ligands (1) Reagents The ASOs with the following sequences were used to prepare the conjugates.

[0177]

[0178] The ligand compound (carboxylic acid ligand) of the following structure was used to prepare the conjugate.

[0179]

[0180] (2) Small-scale synthesis of conjugate: To an N,N-dimethylformamide (DMF) solution (100 μL) of the ligand compound (1-5 mg, 10 μmol, 1 equivalent), a DMF solution (100 μL, 7.5 μmol, 0.75 equivalent) of 150 mM N,N,N',N'-tetramethyl-O-(N-succinimidyl)uronium tetrafluoroborate (TSTU) and N,N-diisopropylethylamine (DIPEA, 3.4 μL, 20 μmol, 2 equivalents) were added, and the mixture was stirred overnight at 50°C. DMF (300 μL) was added to the reaction solution, and a 15 mM DMF solution of the resulting product (activated ester) was prepared. ASO(NH) with an amino linker was added. 2 _ASO1, NH 2To a 12 mM aqueous solution of _ASO2 (25 μL, 300 nmol, 1 equivalent), a 15 mM activated ester DMF solution (60 μL, 900 nmol, 3 equivalents) and DIPEA (5 μL, excess) were added and stirred at 50°C for 1 hour. Then, a 15 mM activated ester DMF solution (60 μL, 900 nmol, 3 equivalents) was added, and the mixture was stirred at 50°C for 1 hour. This procedure was repeated twice. Next, 3 M aqueous sodium acetate solution (2 μL) and ethanol (150 μL) were added to the reaction solution, and the mixture was centrifuged. The supernatant was removed, and the precipitate was dissolved in 0.1 M aqueous triethylammonium acetate solution (200 μL). Subsequently, a conjugate in which the ligand and ASO were linked via a linker was obtained by reverse-phase HPLC purification. The purity and structure were confirmed by reversed-phase HPLC analysis (Shimadzu Corporation) and MALDI-TOF-MS measurement (BRUKER DALTONICS).

[0181] The reversed-phase HPLC purification conditions were as follows: Column: Waters XBridge (R) Oligonucleotide BEH C18 OBD TM Prep Column (2.5 μm, 10 mm × 50 mm) Mobile phase A: 0.1 M aqueous triethylammonium acetate solution Mobile phase B: methanol (10-60%, linear gradient over 25 minutes) Temperature: 50°C Flow rate: 3 mL / min

[0182] (2) Large-scale synthesis of conjugates (in vivo) Amino-linked ASO(NH 2 _ASO2, NH 2 _ASO2 (PS), NH 2A 15 mM activated ester DMF solution (400 μL, 6.0 μmol, 5 equivalents) and DIPEA (20 μL, excess) were added to a 12 mM aqueous solution of _ASO3 (100 μL, 1.2 μmol, 1 equivalent), and the mixture was stirred at 50°C for 1 hour. Next, 3 M aqueous sodium acetate solution (40 μL) and ethanol (800 μL) were added to the reaction mixture, followed by centrifugation. The supernatant was removed, and the precipitate was dissolved in 0.1 M aqueous triethylammonium acetate solution (500 μL). Subsequently, a conjugate in which the ligand and ASO were linked via a linker was obtained by reverse-phase HPLC purification. The purity and structure were confirmed by reverse-phase HPLC analysis (Shimadzu Corporation) and MALDI-TOF-MS analysis (BRUKER DALTONICS).

[0183] The reversed-phase HPLC purification conditions were as follows: Column: Nacalai Tesque, COSMOSIL (R) 5C18-MS-II Packed Column (5 μm, 20 mm × 250 mm) Mobile phase A: 0.1 M triethylammonium acetate aqueous solution Mobile phase B: Methanol (20-80%, 30 min linear gradient) Temperature: 50°C Flow rate: 7 mL / min

[0184] The yield of the produced conjugate and the results of MALDI-TOF-MS measurement are shown in the table below.

[0185]

[0186] In the table, the numbers in the carboxylic acid ligand column correspond to the numbers assigned to the structural formulas of the above ligand compounds, and the names of the ASOs used as amidation raw materials correspond to the ASOs listed in Table 1.

[0187] The HPLC charts of each conjugate after purification are shown in Figures 1 to 21. The HPLC purification conditions are as follows: Column: Waters XBridge (R) Oligonucleotide BEH C18 2.5 μm (4.6 × 50 mm) Gradient: 10-70% methanol in 0.1 M TEAA buffer (pH 7.0) for 30 min Flow rate: 1.0 mL / min Column temperature: 50 °C

[0188] Test Example 1: In Vitro Screening (Cell Experiment) (Cell Culture and ASO Treatment Method) Each cell line listed in Tables 3 and 4 below was seeded onto a 96-well half-well plate (Corning, 3885) at the cell number indicated in the table and cultured for 24 hours. Ligand-conjugated ASO was then prepared at the concentrations indicated in the table. Unconjugated ASO1 (an ASO without a ligand or linker attached, known as "naked ASO") was used as a negative control for comparison. Additionally, a positive control consisted of cells treated with a mixture of an oligonucleotide intracellular delivery reagent (Lipoctoamine 3000) and naked ASO. In this experiment, two rounds of screening (first and second screening) were conducted to select promising carboxylic acid ligands with a certain level of antisense activity enhancement and reproducibility of results. These were then subjected to in vivo activity evaluation, as described below.

[0189]

[0190]

[0191] (Method for evaluating antisense activity) One-Glo TM Expression of the firefly luciferase gene was assessed using the + Tox Luciferase Reporter and Cell Viability Assay (Promega, E7110). TM One-Glo (prepared as a solution of 0.05 μL of GF-AFC substrate in 10 μL of assay buffer per well) was added to each well, and the solution in the well was mixed for 30 seconds. The well was then incubated at 37°C for 50 minutes under a 5% carbon dioxide atmosphere. The resulting fluorescence was measured using a plate reader (380-400 nm Ex / 505 nm Em). Then, 50 μL of One-Glo TM (One-Glo TM Substrates and One-Glo TMA solution of Naked ASO and Buffer (prepared as a mixture) was added to each well and incubated at room temperature for 3 minutes in the dark. Luminescence was measured using a plate reader, and the effect of the ligand was evaluated using the relative luminescence intensity (antisense activity) calculated by setting the luminescence intensity when cells were treated with naked ASO using the intracellular delivery reagent as 0 (positive control) and the luminescence intensity when cells were treated with naked ASO alone as 1 (negative control).

[0192] (In Vitro Screening Results) Two criteria were established for determining the efficacy of ligand conjugates in the first screening. Ligands meeting one or more criteria were selected as potential hits with the ability to improve antisense activity. The first criterion for a hit ligand was a relative luminescence intensity of less than 0.8. The second criterion for a hit ligand was a relative luminescence intensity between 0.8 and 1.0, which was significantly attenuated compared to naked ASO (p<0.05). As a result, of the conjugates with the 12 ligand compounds (carboxylic acid ligands) evaluated, conjugates with seven ligand compounds (carboxylic acid ligands 1, 5, 6, 7, 8, 9, and 10) were selected as hit conjugates. Subsequently, the reproducibility and concentration dependence of antisense activity were confirmed in a second screening. The final selection criteria for promising ligand conjugates were those that showed significantly reduced luminescence intensity (p<0.05) compared to naked ASO at ASO concentrations of 160 nM and 640 nM. As a result, a total of seven ASOs conjugated with carboxylic acid ligands 1, 5, 6, 7, 8, 9, and 10 were identified as promising ligands with higher antisense activity than naked ASO.

[0193] Test Example 2: In vivo activity and kinetic evaluation (animal experiment) To evaluate organ selectivity and activity, ligand-conjugated ASO was administered to mice according to the procedure described below, and the expression level of the target gene Malat1 in each organ 72 hours after administration was analyzed by real-time PCR.

[0194] (Initial screening of ASO administration) Mice (Balb / c, female, 5 weeks old, 5 animals) were purchased from Japan SLC Co., Ltd. and transported to the animal testing facility. After an acclimation period of at least 5 to 7 days, a saline solution of conjugated ASO prepared to 20 μmol (approximately 100 μg) per mouse was administered once into the tail vein. As a control, a saline solution of unconjugated ASO2 (ASO not bound to a ligand or linker: "naked ASO") prepared to 20 μmol (approximately 100 μg) per mouse was administered once into the tail vein. Saline was used as a negative control.

[0195] (ASO administration dose dependency test, and sequence / linker structure dependency test) Mice (Balb / c, female, 5 weeks old, 7 animals) were purchased from Japan SLC Co., Ltd. and transported to the animal testing facility. After an acclimation period of at least 5 to 7 days, a saline solution of conjugated ASO prepared at 100, 300, or 1000 μg per mouse was administered once into the tail vein. As comparison controls, unconjugated ASO2 and ASO3 (ASOs not bound to a ligand or linker: "naked ASO") were administered once into the tail vein in saline at 100 or 1000 μg per mouse. Saline was used as a negative control.

[0196] (Organ Harvesting) 72 hours after ASO administration, mice were anesthetized by intraperitoneal administration of a triple anesthetic mixture (medetomidine, midazolam, and butorphanol). After laparotomy, the mice were euthanized by exsanguination through incision of the abdominal aorta. 25-50 mg of organ fragments were harvested and placed in 2 mL tubes of 96-well Collection Microtubes (Qiagen) containing 500 μL of RNAprotect Tissue Reagent (Thermo) per tube. The organ fragments were stored immersed in the reagent at −30°C.

[0197] Total RNA was extracted from the collected organs using the MagMAX mirVana Total RNA Isolation Kit (Thermo; hereafter referred to as the mirVana kit). The 96-well collection microtubes containing the organs were centrifuged (1,000 × g, 3 minutes, 4°C) to remove the RNAprotect Tissue Reagent. The lysis buffer (supplemented with 0.7% 2-mercaptoethanol) provided with the mirVana kit and one stainless steel bead (5 mm diameter, QIAGEN) were added to each tube. The organ homogenates were then homogenized five or more times at room temperature at 30 Hz for 2 minutes using a TissueLyser II (QIAGEN).

[0198] Total RNA was extracted and purified from organ homogenates according to the mirVana kit protocol. The process was automated using a KingFisher Flex (Thermo). The nucleic acid concentration of each RNA sample was determined using the Quant-iT RiboGreen RNA Assay Kit (Thermo). Reverse transcription products were prepared from approximately 10 ng of total RNA using the High-Capacity cDNA Reverse Transcription Kit (Thermo). Reverse transcription reactions were performed according to the kit protocol. Real-time PCR was performed on each reverse transcription product using PowerUp SYBR Green Master Mix (Thermo). Internal PCR controls used were 18S rRNA for lung samples, b2-microglobulin (B2m) for spleen samples, and b-Actin (Actb) for brain samples. Gapdh was used as an internal PCR control for other organs. PCR reactions were performed using a StepOnePlus real-time PCR system (Thermo) with 45 cycles of heat treatment at 95°C for 20 seconds, followed by thermal denaturation at 95°C for 3 seconds and extension at 60°C for 30 seconds. Malat1 expression levels were analyzed by comparing the Ct values ​​obtained from the amplification curves of Malat1 and Gapdh (ΔΔCt method).

[0199] The PCR primer sequences used are as follows: Mouse Malat1 forward: ACATTCCTTGAGGTCGGCAA (SEQ ID NO: 4) Mouse Malat1 reverse: CACCCGCAAAGGCCTACATA (SEQ ID NO: 5) Mouse Gapdh forward: TCACCACCATGGAGAAGGC (SEQ ID NO: 6) Mouse Gapdh reverse: GCTAAGCAGTTGGTGGTGCA (SEQ ID NO: 7) Mouse Actb forward: GGCACCACACCTTCTACAATG (SEQ ID NO: 8) Mouse Actb reverse: GGGGGTGTTGAAGGTCTCAAAC (SEQ ID NO: 9) Mouse B2m forward: ACAGTTCCACCCGCCTCACATT (SEQ ID NO: 10) Mouse B2m reverse: TAGAAAGACCAGTCCTTGCTGAAG (SEQ ID NO: 11) Mouse 18S rRNA forward: GTAACCCGTTGAACCCCATT (SEQ ID NO: 12) Mouse 18S rRNA reverse: CCATCCAATCGGTAGTAGCG (SEQ ID NO: 13)

[0200] (Initial Screening Analysis Results) In this study, liver, kidney, spleen, pancreas, heart, lung, stomach, colon, brain, skeletal muscle, mammary gland, and skin (a total of 12 organs) were analyzed. The results are shown in Figures 22-1 and 22-2. ASO2 conjugated with carboxylic acid ligand 1 significantly enhanced Malat1 RNA knockdown in the spleen (significance levels of 1% and 5%). ASO2 conjugated with carboxylic acid ligand 8 and ASO2 conjugated with carboxylic acid ligand 10 significantly enhanced Malat1 RNA knockdown in the spleen and pancreas (significance levels of 1% and 5%). These results demonstrate that at least carboxylic acid ligands 1, 8, and 10, when conjugated to ASO, promote ASO cellular uptake and enhance target gene suppression not only in vitro but also in vivo (particularly in the spleen or pancreas).

[0201] (Analysis Results: Dose-Dependent Test, and Sequence / Linker Structure-Dependent Test) In this test, the liver, spleen, and kidney (a total of three organs) were analyzed. These results are shown in Figures 23, 24, and 25. ASO2 conjugated with carboxylic acid ligands 8 and 10 did not exhibit a greater inhibitory effect than naked ASO. On the other hand, ASO2 conjugated with carboxylic acid ligand 1 exhibited dose-dependent inhibition of Malat1 RNA expression, with significant differences observed in the spleen and kidney in the high-dose group compared to the saline-administered group (significance levels of 1% and 5%) (Figure 23). Of these, knockdown in the 1000 μg / individual group significantly enhanced the inhibitory effect of naked ASO at the same dose by approximately 50% (significance level of 5%). Furthermore, in the group administered 1000 μg / individual of ASO3 or ASO2(PS) conjugated with carboxylic acid ligand 1, a significantly greater inhibitory effect was observed in the spleen than that of the same dose of naked ASO (significance level 1%) (Figures 24 and 25). ASO3 is an antisense nucleic acid with a nucleotide sequence different from that of ASO2. ASO2(PS) is an antisense nucleic acid with a linker H 2 N (CH 2 ) 6 It differs from ASO2 (where the bond between the carboxylate and the carboxyl groups is a phosphorothioate bond). These results demonstrate that, by conjugating with ASO, at least carboxylic acid ligand 1 promotes the cellular uptake of ASO in vivo and enhances the suppression of target gene expression, regardless of the ASO sequence or linker structure.

[0202] The present invention is useful, for example, in pharmaceutical development and manufacturing.

Claims

1. A compound of the following formula (I): wherein Lk is a linker moiety, NCA is a nucleic acid moiety, and Lg is a conjugate represented by the following formula (II): (In formula (II), * 1 is a bond with Lk, and A 1 is a sulfur atom or an oxygen atom, R 1 and R 2 are each independently: (i) a hydrogen atom; (ii) an alkyl group having 1 to 9 carbon atoms which may be branched and which may be substituted with at least one group selected from the group consisting of an alkyl group having 1 to 3 carbon atoms which may be branched, an alkoxy group having 1 to 3 carbon atoms which may be branched, an alkylthio group having 1 to 3 carbon atoms which may be branched, a hydroxyl group, a nitro group, and a halogen atom; or R 1 and R 2 and R are taken together to form a phenyl or thiophene ring which may be substituted with a halogen atom.

2. Lg in the formula (I) is represented by the following formula (II-1): (In formula (II-1), * 1 is a bond with Lk, and A 1 is a sulfur atom or an oxygen atom, R 3 is a group selected from the group consisting of a hydrogen atom, an optionally branched alkyl group having 1 to 3 carbon atoms, an optionally branched alkoxy group having 1 to 3 carbon atoms, an optionally branched alkylthio group having 1 to 3 carbon atoms, a hydroxyl group, a nitro group, and a halogen atom.

3. Lg in the formula (I) is the following formula (II-2) or (II-3): (In formulas (II-2) and (II-3), * 1 is a bond with Lk, and A 1 is a sulfur atom or an oxygen atom, R 3 is a group selected from the group consisting of a hydrogen atom, an optionally branched alkyl group having 1 to 3 carbon atoms, an optionally branched alkoxy group having 1 to 3 carbon atoms, an optionally branched alkylthio group having 1 to 3 carbon atoms, a hydroxyl group, a nitro group, and a halogen atom.

4. Lg in the formula (I) is represented by the following formula (II-4): (In formula (II-4), * 1 The conjugate according to claim 1 , wherein L is a group represented by the formula (I) 5. Lk in the formula (I) is the following formula (III): (In formula (III), * 2 and * 3 is a bond, and X i is an oxygen atom or a sulfur atom, and X ii + is a pharmaceutically acceptable cation, and Y is —(CH 2 ) m - or - (CH 2 OCH 2 ) n 2. The conjugate of claim 1, comprising a structure represented by: -, wherein m and n are each independently an integer of 1 to 40.

6. The formula (I) is the following formula (I-1): (In formula (I-1), NCA is a nucleic acid moiety, and A 1 is a sulfur atom or an oxygen atom, R 3 is a group selected from the group consisting of a hydrogen atom, an optionally branched alkyl group having 1 to 3 carbon atoms, an optionally branched alkoxy group having 1 to 3 carbon atoms, an optionally branched alkylthio group having 1 to 3 carbon atoms, a hydroxyl group, a nitro group, and a halogen atom; i is an oxygen atom or a sulfur atom, and X ii + is a pharmaceutically acceptable cation, and Y is —(CH 2 ) m - or - (CH 2 OCH 2 ) n 2. The conjugate of claim 1, wherein m and n are each independently an integer of 1 to 40.

7. The formula (I) is the following formula (I-2): (In formula (I-2), NCA is a nucleic acid moiety, and A 1 is a sulfur atom or an oxygen atom, R 3 is a group selected from the group consisting of a hydrogen atom, an optionally branched alkyl group having 1 to 3 carbon atoms, an optionally branched alkoxy group having 1 to 3 carbon atoms, an optionally branched alkylthio group having 1 to 3 carbon atoms, a hydroxyl group, a nitro group, and a halogen atom; i is an oxygen atom or a sulfur atom, and X ii + is a pharmaceutically acceptable cation, and Y is —(CH 2 ) m - or - (CH 2 OCH 2 ) n 2. The conjugate of claim 1, wherein m and n are each independently an integer of 1 to 40.

8. The formula (I) is the following formula (I-3): (In formula (I-3), NCA is a nucleic acid moiety, and A 1 is a sulfur atom or an oxygen atom, and X i is an oxygen atom or a sulfur atom, and X ii + is a pharmaceutically acceptable cation, and Y is —(CH 2 ) m - or - (CH 2 OCH 2 ) n 2. The conjugate of claim 1, wherein m and n are each independently an integer of 1 to 40.

9. The conjugate of claim 1, wherein the NCA in formula (I) is an oligonucleotide.

10. The conjugate of claim 9, wherein the oligonucleotide is an antisense oligonucleotide, siRNA, miRNA, or a nucleic acid aptamer.

11. A pharmaceutical composition comprising a conjugate according to any one of claims 1 to 10.

12. The pharmaceutical composition according to claim 11, which is used for drug delivery to the spleen.

Citation Information

Patent Citations

  • Targeted Nucleic Acid Conjugate Compositions

    JP2019513770A

  • Benzimidazoles that enhance the activity of oligonucleotides

    US20190343868A1

  • Targeted intracellular delivery of oligonucleotides via conjugation with small molecule ligands

    WO2011126937A1

  • Oligonucleotides containing a ligand at a nucleobase, 2' position, or 3' position

    WO2025038971A1

  • LIGANDS FOR EXTRAHEPATIC DELIVERY OF siRNA

    WO2025087397A1