Spheroid having therapeutic effect on limb ischemia and manufacturing method therefor
A spheroid of CD10 positive skeletal muscle progenitor cells and induced mesenchymal stem cells addresses the limitations of conventional treatments by improving vascular remodeling and muscle regeneration, enhancing blood reperfusion and capillary density in lower limb ischemia.
Patent Information
- Application Number
- PCT/KR2025/010778
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-22
- Filing Date
- 2025-07-22
- Publication Date
- 2026-01-29
AI Technical Summary
Conventional treatments for critical limb ischemia, such as drug therapy and revascularization, face limitations like restenosis and failure to reestablish circulation at the microvascular level, while mesenchymal stem cells (MSCs) have practical clinical limitations including heterogeneity, limited yields, and decreased function when cultured in vitro.
A spheroid composed of CD10 positive and CD24 negative skeletal muscle progenitor cells and induced mesenchymal stem cells, positive for CD44, CD73, CD90, or CD105, is developed to inhibit premature differentiation, enhancing vascular remodeling and skeletal muscle regeneration.
The spheroid improves blood reperfusion, capillary density, muscle regeneration, and limb preservation by inducing cell cycle activity of vascular endothelial cells, offering a promising cell therapy for treating lower limb ischemia.
Smart Images

Figure KR2025010778_29012026_PF_FP_ABST
Abstract
Description
Spheroids having a therapeutic effect on lower extremity ischemia and a method for producing the same
[0001] The present invention relates to a spheroid composed of skeletal muscle progenitor cells and induced mesenchymal stem cells, which has a lower limb ischemia treatment effect, and a method for producing the same.
[0002] Critical limb ischemia (CLI) is a life-threatening clinical condition caused by peripheral vascular occlusion due to conditions such as diabetes or arteriosclerosis, resulting in severe ischemia in the lower extremities. This can lead to pain, skin ulcers, necrosis, and, in severe cases, limb amputation. Conventional treatments include drug therapy and revascularization procedures (e.g., stents, bypass grafts). However, these methods have limitations, making it difficult to achieve a fundamental therapeutic effect due to problems such as restenosis or failure to reestablish circulation at the microvascular level.
[0003] Against this backdrop, cell therapy-based regenerative medicine approaches are attracting attention as a new alternative. In particular, mesenchymal stem cells (MSCs) have been reported to contribute to the regeneration of damaged tissue and restoration of blood flow in ischemic environments through their immunomodulatory properties, anti-inflammatory effects, angiogenesis induction, and growth factor secretion. While various clinical trials have demonstrated the therapeutic potential of adult-derived MSCs, MSCs face practical clinical limitations, including heterogeneity between patients, limited yields, and decreased function when cultured in vitro.
[0004] Skeletal Muscle Progenitor Cells (SKMPs) play a central role in myofiber regeneration and muscle function restoration, enabling regenerative capacity in damaged tissues and functional recovery of perivascular tissues. However, SKMPs obtained directly from adult tissues are limited in number and have low proliferative capacity, making mass production difficult. Furthermore, long-term maintenance can lead to problems such as decreased differentiation potential.
[0005] To address these issues, induced pluripotent stem cells (iPSCs) are attracting attention as a cell source. iPSCs are considered an ideal cell therapy resource due to their exceptional self-renewal capacity, ability to induce differentiation into various somatic cells, and ability to create patient-specific cells. Recently, various studies have been conducted to derive skeletal muscle progenitor cells or mesenchymal cells from iPSCs and apply them to therapeutic applications. However, the optimal differentiation method and application strategy to maximize therapeutic efficacy have not yet been clearly established.
[0006] In particular, skeletal muscle progenitor cells (SKMPs) directly derived from iPSCs have great potential as therapeutic cells, but issues such as survival rate in ischemic environments, direct contribution to angiogenesis, and immunological stability have been raised. In addition, although iMSCs can induce angiogenesis and tissue regeneration by secreting various growth factors and cytokines, their tissue fusion ability and long-term colonization efficiency may be limited when used alone.
[0007] Accordingly, there is a growing need for multifunctional therapeutic cells or complex cell therapeutic compositions that can simultaneously induce vascular remodeling and skeletal muscle regeneration, and for this purpose, a strategy that complementarily utilizes the functional advantages of each cell type is required.
[0008] The purpose of the present invention is to provide a spheroid comprising skeletal muscle progenitor cells and induced mesenchymal stem cells, and inhibiting premature differentiation of the skeletal muscle progenitor cells.
[0009] In addition, another object of the present invention is to provide a pharmaceutical composition for preventing or treating lower extremity ischemia.
[0010] In addition, another object of the present invention is to provide a cell therapy agent for preventing or treating lower extremity ischemia.
[0011] In addition, another object of the present invention is to provide a pharmaceutical composition for improving lower extremity ischemia.
[0012] In addition, another object of the present invention is to provide a method for producing a spheroid.
[0013] In addition, another object of the present invention is to provide a method for preventing or treating lower extremity ischemia.
[0014] In order to achieve the above purpose, the present invention provides a spheroid comprising a CD10 positive and CD24 negative skeletal muscle progenitor cell and an induced mesenchymal stem cell positive for at least one selected from the group consisting of CD44, CD73, CD90 and CD105, and inhibiting premature differentiation of the skeletal muscle progenitor cell.
[0015] In addition, in order to achieve the other purpose mentioned above, the present invention provides a pharmaceutical composition for preventing or treating lower extremity ischemia, which comprises skeletal muscle progenitor cells that are CD10 positive and CD24 negative and induced mesenchymal stem cells that are positive for at least one selected from the group consisting of CD44, CD73, CD90 and CD105, and comprises a spheroid that suppresses premature differentiation of the skeletal muscle progenitor cells.
[0016] In addition, in order to achieve the above another object, the present invention provides a cell therapy for preventing or treating lower extremity ischemia, which comprises skeletal muscle progenitor cells that are CD10 positive and CD24 negative and induced mesenchymal stem cells that are positive for at least one selected from the group consisting of CD44, CD73, CD90 and CD105, and a spheroid that suppresses premature differentiation of the skeletal muscle progenitor cells.
[0017] In addition, in order to achieve the above-mentioned another object, the present invention provides an over-the-counter pharmaceutical composition for improving lower extremity ischemia, which comprises skeletal muscle progenitor cells that are CD10 positive and CD24 negative and induced mesenchymal stem cells that are positive for at least one selected from the group consisting of CD44, CD73, CD90 and CD105, and comprises a spheroid that suppresses early differentiation of the skeletal muscle progenitor cells.
[0018] In addition, in order to achieve the above another object, the present invention provides a method for producing a spheroid, comprising the steps of producing CD10-positive and CD24-negative skeletal muscle progenitor cells; producing induced mesenchymal stem cells positive for at least one selected from the group consisting of CD44, CD73, CD90, and CD105; and mixing the skeletal muscle progenitor cells and the induced mesenchymal stem cells and inducing cell-to-cell aggregation to form a spheroid; wherein the spheroid is characterized in that it suppresses early differentiation of the skeletal muscle progenitor cells.
[0019] In addition, to achieve the above-described other object, the present invention provides a method for preventing or treating lower extremity ischemia, comprising the step of administering to a subject a spheroid comprising CD10-positive and CD24-negative skeletal muscle progenitor cells and at least one induced mesenchymal stem cell positive for CD44, CD73, CD90, and CD105, and suppressing premature differentiation of the skeletal muscle progenitor cells.
[0020] According to the present invention, spheroids composed of skeletal muscle progenitor cells (SKMP) and induced mesenchymal stem cells (iMSC) suppressed the early differentiation of SKMP, exhibited wider distribution within tissues and induced myofiber fusion compared to administration of SKMP alone, and showed significant effects such as improved blood reperfusion, capillary density, muscle regeneration, and limb preservation rate in a lower limb ischemia model. It was confirmed that the spheroids of the present invention can contribute to vascular regeneration by inducing cell cycle activity of vascular endothelial cells, and thus the spheroids of the present invention can be usefully utilized as cell therapy agents or over-the-counter drugs for preventing and treating lower limb ischemia.
[0021] Figures 1 to 4 illustrate the results of confirming stem cell- and skeletal muscle lineage-specific gene expression in iPSC-derived SKMP. Figure 1 shows the results of confirming OCT4 expression, Figure 2 shows the results of confirming MYF5 expression, Figure 3 shows the results of confirming MYOD expression, and Figure 4 shows the results of confirming MYOG expression.
[0022] Figure 5 shows the results of confirming the morphological changes and muscle lineage marker expression characteristics before and after differentiation of SKMP derived from iPSCs. In Figure 5, the white bar represents a size of 100 μm.
[0023] Figures 6 to 10 are the results of analyzing the changes in expression of skeletal muscle-specific genes over time during differentiation induction by SKMP, and evaluating whether differentiation and progenitor cell maintenance were achieved. Figure 6 shows the results of confirming RAX2 expression, Figure 7 shows the results of confirming MYF5 expression, Figure 8 shows the results of confirming MYOG expression, Figure 9 shows the results of confirming MYH6 expression, and Figure 10 shows the results of confirming MYH7 expression.
[0024] Figure 11 shows the results of confirming the expression of markers of neural crest stem cells derived from iPSCs and the expression of mesenchymal stem cell-specific markers of iMSCs derived therefrom. In Figure 11, the white bar represents a size of 100 μm.
[0025] Figure 12 shows the results of examining changes in the expression of specific markers over time during the differentiation process of neural crest stem cells derived from iPSCs. In Figure 12, the white bar represents a size of 200 μm.
[0026] Figures 13 to 15 show the results of flow cytometry analysis to determine whether or not mesenchymal stem cell surface antigens are expressed and co-expressed in iMSCs derived from neural crest stem cells. Figure 13 shows the results of verifying the reliability of flow cytometry by confirming non-specific binding through a negative control (isotype control), and Figure 14 shows the results of verifying the MSC phenotype of iMSCs by individually evaluating the expression rate for each single surface marker, CD44, CD73, CD90, and CD105, and Figure 15 shows the results of analyzing the co-expression of CD44 / CD73 and CD90 / CD105, confirming that the derived iMSCs simultaneously express a combination of typical markers of mesenchymal stem cells.
[0027] Figures 16 to 18 show the results of real-time evaluation of the effects of SKMP and iMSC on the cell cycle progression of vascular endothelial cells (iPSC-EC) using the FUCCI reporter system. Figure 16 shows the results of visually comparing the cell cycle states (G1: red, S / G₂ / M: green) of vascular endothelial cells according to the passage of time (0, 12, 24 hours) under each condition (Control, SKMP, iMSC), and Figure 17 shows the results of quantitatively analyzing the ratio of cells that entered the S / G₂ / M phase according to the passage of time under each condition to evaluate the cell cycle promoting effect of SKMP, and Figure 18 shows the results of statistically comparing the G1 exit ratio under each condition after 24 hours to confirm that the division-inducing effect of SKMP on vascular endothelial cells is significant. In Figure 16, the white bar represents a size of 100 μm.
[0028] Figure 19 shows the results of visual confirmation of intercellular mixing and spatial distribution through fluorescent images of single or composite spheroids composed of SKMP and iMSC. In Figure 19, the white bar represents a size of 100 μm.
[0029] Figures 20 to 22 show the results of visually and quantitatively evaluating the effects of SKMP, iMSC, and composite spheroid administration on blood flow reperfusion in a severe lower limb ischemia model using LDPI. Figure 20 shows the results of visually comparing the status of blood flow reperfusion in the lower limb over time in each experimental group (Control, iMSC, SKMP, Mix), Figure 21 shows the results of evaluating the degree of blood flow recovery in the cell therapy group by quantitatively analyzing the blood flow ratio between the ischemic side and the healthy side from day 0 to day 28, and Figure 22 shows the results of comparing the statistical significance of the blood flow reperfusion level between each experimental group as of day 28.
[0030] Figures 23 to 26 are qualitative and quantitative evaluations of the effects of administration of SKMP, iMSC, and composite spheroids on limb preservation rate, inhibition of necrosis progression, and muscle mass recovery in a severe lower limb ischemia model. Figure 23 shows the results of a visual comparison of the necrosis and preservation states by photographing the appearance of the lower limbs observed on the 28th day in each experimental group, Figure 24 shows the results of quantifying the grade of lower limb damage in each experimental group, Figure 25 shows the results of a visual comparison of the presence or absence of muscle atrophy and the degree of recovery in each experimental group through the appearance of ischemic muscles, and Figure 26 shows the results of a quantitative analysis of muscle mass in each experimental group.
[0031] Figures 27 and 28 show the effects of SKMP, iMSC, and composite spheroid administration on intratissue capillary density in a model of severe limb ischemia. Figure 27 visually compares capillary formation and cell distribution by observing the vascular endothelial cell marker CD31 and the fluorescent signals of transplanted cells in the tissues of each experimental group, while Figure 28 quantitatively analyzes the number of capillaries per unit area. In Figure 27, the white bar represents a size of 50 μm.
[0032] Figures 29 to 31 show the results of confirming the effects of SKMP, iMSC, and composite spheroids on fusion into myofibers and muscle regeneration. Figure 29 shows the results of visually confirming whether transplanted cells fused into myofibers in each experimental group, Figure 30 shows the results of analyzing the contribution of SKMP to myofiber fusion by quantifying the number of GFP+ (iSKMP) or RFP+ (iMSC) cells fused into myofibers in each experimental group, and Figure 31 shows the results of comparing the participation of SKMP in muscle regeneration and the distribution characteristics of iMSC in the surrounding matrix by quantitatively analyzing the number of GFP+ and RFP+ cells existing outside the myofibers in each experimental group. In Figure 29, the white bar in the left drawing represents a size of 100 μm, and the white bar in the right drawing represents a size of 200 μm.
[0033] Figures 32 to 34 show the results of confirming the distribution and engraftment range of transplanted cells in vivo after administration of SKMP, iMSC, and composite spheroids. Figure 32 shows the results of visualizing the distribution patterns of GFP+ (iSKMP) and RFP+ (iMSC) cells in the quadriceps femoris and gastrocnemius in each experimental group using full-length and high-magnification images, Figure 33 shows the results of evaluating the tissue invasiveness of SKMP and the dispersion characteristics in the Mix group by quantifying the distribution areas of GFP+ and RFP+ cells in the quadriceps femoris area, and Figure 34 shows the results of comparing the engraftment range of each cell group and the tissue diffusion effect of spheroids by quantifying the distribution areas of GFP+ and RFP+ cells in the gastrocnemius area. In Figure 32, the white bar in the left drawing represents a size of 1000 μm, and the white bars in the middle and right drawings represent a size of 100 μm.
[0034] Figures 35 to 37 show the results of confirming the effects of SKMP, iMSC, and composite spheroids on blood vessel formation in transplanted lower extremity tissues. Figure 35 shows the results of visually comparing the degree of blood vessel formation by observing the distribution of GFP+ (iSKMP), RFP+ (iMSC) cells and the vascular endothelial cell marker CD31 in quadriceps femoris and gastrocnemius tissues, Figure 36 shows the results of comparing the angiogenic effect by quantifying the capillary density of each experimental group based on the CD31-positive area in quadriceps femoris, and Figure 37 shows the results of quantitative analysis of the CD31-positive area in gastrocnemius. In Figure 35, the white bar represents a size of 500 μm.
[0035] Figure 38 compares the tissue engraftment and distribution patterns of SKMP in the SKMP-only transplant group and the composite spheroid transplant group, evaluating the effect of iMSCs on the tissue invasiveness and proliferation of SKMP. In Figure 38, the white bar represents a size of 200 μm.
[0036] Hereinafter, the present invention will be described in more detail.
[0037] The present invention provides a spheroid comprising a CD10 positive and CD24 negative skeletal muscle progenitor cell and an induced mesenchymal stem cell positive for at least one selected from the group consisting of CD44, CD73, CD90 and CD105, and inhibiting premature differentiation of the skeletal muscle progenitor cell.
[0038] The above spheroid is a structure in which cells are aggregated in a three-dimensional spherical shape, and the spheroid of the present invention is characterized in that CD10 positive and CD24 negative skeletal muscle progenitor cells and induced mesenchymal stem cells positive for at least one selected from the group consisting of CD44, CD73, CD90, and CD105 are uniformly mixed and stably coexist within one spheroid.
[0039] In the present invention, the CD10 positive and CD24 negative skeletal muscle progenitor cells and the induced mesenchymal stem cells positive for at least one selected from the group consisting of CD44, CD73, CD90 and CD105 may be mixed at a cell number ratio of 1 to 3:1, preferably at a cell number ratio of 1 to 2:1, and more preferably at a cell number ratio of 2:1.
[0040] The spheroid of the present invention may have a diameter of 50 to 200 μm, preferably a diameter of 100 to 200 μm, and more preferably a diameter of 100 to 150 μm.
[0041] In general, when the spheroid is larger than 200 μm, there is a high possibility that hypoxia and necrosis will be induced in the center. The range of 100 to 150 μm is a size within the limits of osmosis and oxygen supply, and corresponds to a particle size that can be sufficiently injected with a general injection needle of 30G or larger. Therefore, the spheroid of the present invention can be delivered into muscle or ischemic tissue through a non-invasive injection method. In addition, this size range is small enough to induce close contact between cells, while maintaining a sufficient number of cells so that paracrine signaling, fusion, and regenerative factor secretion between cells can occur smoothly. If the size of the spheroid is too small, the functional cell population will be insufficient, and if it is too large, central necrosis and differentiation imbalance may be induced.
[0042] In addition, the spheroid of the present invention can treat hindlimb ischemia, and is characterized by increasing at least one selected from the group consisting of blood flow reperfusion, capillary density, muscle fiber fusion, and limb salvage rate, which are reduced due to hindlimb ischemia.
[0043] Furthermore, the spheroids of the present invention are characterized by increasing the cell cycle activity of vascular endothelial cells. Therefore, the formation of new vascular endothelial cells can be increased, thereby inducing expansion of capillary structures and neovascularization, thereby improving blood flow reperfusion and tissue regeneration.
[0044] In addition, the spheroid of the present invention is characterized by inducing muscle cell fusion and muscle remodeling within skeletal muscle tissue.
[0045] In particular, the spheroids of the present invention are characterized by improved tissue dispersion and infiltration capabilities compared to CD10-positive and CD24-negative skeletal muscle progenitor cells alone. In addition, the spheroids of the present invention are characterized by being superior to CD10-positive and CD24-negative skeletal muscle progenitor cells alone in at least one selected from the group consisting of improved blood flow reperfusion, improved limb preservation rate and inhibition of necrosis, recovery of ischemic muscle mass, increased capillary density, increased contribution to muscle fiber fusion and regeneration, decreased proportion of non-muscle cell area, increased engraftment and distribution range in tissue, and promotion of angiogenesis.
[0046] Therefore, the present invention provides a pharmaceutical composition for preventing or treating lower extremity ischemia, which comprises skeletal muscle progenitor cells that are CD10 positive and CD24 negative and induced mesenchymal stem cells that are positive for at least one selected from the group consisting of CD44, CD73, CD90 and CD105, and comprises a spheroid that inhibits premature differentiation of the skeletal muscle progenitor cells.
[0047] In the present invention, "prevention" refers to any action that inhibits or delays lower extremity ischemia by administering the composition of the present invention, and "improvement" refers to any action that at least reduces a parameter related to the condition being treated, such as the severity of symptoms. In addition, "treatment" refers to any action that improves or beneficially alters symptoms caused by lower extremity ischemia by administering the composition of the present invention.
[0048] The pharmaceutical composition of the present invention can be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, and sterile injection solutions, respectively, according to conventional methods. Carriers, excipients, and diluents that can be included in the pharmaceutical composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. When formulated, it is prepared using diluents or excipients such as fillers, bulking agents, binders, wetting agents, disintegrating agents, and surfactants that are commonly used. Solid preparations for oral administration include tablets, pills, powders, granules, and capsules, and these solid preparations are prepared by mixing the spheroid of the present invention with at least one excipient, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, oral solutions, emulsions, and syrups, and in addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspending agents can include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases can include witepsol, macrogol, Tween 61, cocoa butter, laurin, and glycerogelatin.
[0049] The dosage of the pharmaceutical composition of the present invention will vary depending on the age, sex, and body weight of the subject to be treated, the specific disease or pathological condition to be treated, the severity of the disease or pathological condition, the route of administration, and the prescriber's judgment. Determining the dosage based on these factors is within the skill of those skilled in the art, and the dosage typically ranges from 0.01 mg / kg / day to approximately 2000 mg / kg / day. A more preferred dosage is 0.1 mg / kg / day to 1000 mg / kg / day. Administration may be administered once daily or in multiple divided doses. The above dosage does not limit the scope of the present invention in any way.
[0050] The pharmaceutical composition of the present invention can be administered to mammals, such as mice, livestock, and humans, via various routes. In the present invention, "administration" means providing a predetermined composition of the present invention to a subject via any suitable method. The pharmaceutical composition of the present invention can be administered via various routes, including oral or parenteral administration.
[0051] In addition to the spheroid according to the present invention, the pharmaceutical composition of the present invention may additionally include any compound or natural extract that has already been verified as safe and is known to have a preventive or therapeutic effect on lower extremity ischemia, in order to increase or enhance the preventive, improving or therapeutic effect on lower extremity ischemia.
[0052] In addition, the pharmaceutical composition of the present invention can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers for the treatment of lower extremity ischemia.
[0053] In addition, the present invention provides a cell therapy for preventing or treating lower extremity ischemia, comprising skeletal muscle progenitor cells that are CD10 positive and CD24 negative and induced mesenchymal stem cells that are positive for at least one selected from the group consisting of CD44, CD73, CD90, and CD105, and a spheroid that suppresses premature differentiation of the skeletal muscle progenitor cells.
[0054] The term "cell therapy agent" used in the present invention refers to a drug (as defined by the US FDA) used for the purposes of treatment, diagnosis, and prevention by separating, culturing, and manufacturing cells and tissues from an individual through special manipulation, and by proliferating and selecting living autologous, allogeneic, or xenogeneic cells in vitro to restore the function of cells or tissues, or by changing the biological characteristics of cells through other methods.
[0055] The specific description of the cell therapy agent of the present invention is the same as the description of the above pharmaceutical composition.
[0056] In addition, the present invention provides an over-the-counter pharmaceutical composition for improving lower extremity ischemia, comprising skeletal muscle progenitor cells that are CD10 positive and CD24 negative and induced mesenchymal stem cells that are positive for at least one selected from the group consisting of CD44, CD73, CD90, and CD105, and a spheroid that suppresses premature differentiation of the skeletal muscle progenitor cells.
[0057] In the present invention, the above "quasi-drug" means a fiber, rubber product or similar product used for the purpose of treating, alleviating, managing or preventing a disease of humans or animals; a product that has a weak effect on the human body or does not directly affect the human body, is not an apparatus or machine and similar product; and a product corresponding to one of the preparations used for sterilization, insecticide and similar purposes for preventing infection. It means a product used for the purpose of diagnosing, treating, alleviating, managing or preventing a disease of humans or animals, excluding products that are not apparatuses, machines or devices; and products used for the purpose of exerting a pharmacological effect on the structure and function of humans or animals, excluding products that are not apparatuses, machines or devices; and also includes external skin preparations and personal hygiene products.
[0058] When the spheroid of the present invention is incorporated into an over-the-counter drug for the purpose of preventing or improving ischemia, the spheroid may be used as is or in combination with other over-the-counter drug ingredients, and may be appropriately used according to conventional methods. The amount of active ingredient mixed may be appropriately determined depending on the intended use.
[0059] The over-the-counter drug of the present invention is not particularly limited thereto, but may be manufactured and used in the form of, for example, a cream, lotion, aerosol, shampoo, gel, or pack.
[0060] In the case of creams, ointments, shampoos, gels or packs, bases such as white petrolatum, yellow petrolatum, lanolin, bleached beeswax, cetanol, stearyl alcohol, stearic acid, hydrogenated oils, gelling hydrocarbons, polyethylene glycol, liquid paraffin, squalane, etc.; solvents and solubilizing agents such as oleic acid, isopropyl myristate, glycerin triisooctanoate, crotamiton, diethyl sebacate, diisopropyl adipate, hexyl laurate, fatty acids, fatty acid esters, aliphatic alcohols, vegetable oils, etc.; antioxidants such as tocopherol derivatives, L-ascorbic acid, dibutylhydroxytoluene, butylhydroxyanisole, etc.; preservatives such as parahydroxybenzoate esters, etc.; moisturizers such as glycerin, propylene glycol, sodium hyaluronate, etc. Surfactants such as polyoxyethylene derivatives, glycerin fatty acid esters, sucrose fatty acid esters, sorbitan fatty acid esters, propylene glycol fatty acid esters, and lecithin; thickeners such as carboxyvinyl polymers, xanthan gum, carboxymethylcellulose, carboxymethylcellulose sodium salts, hydroxypropylcellulose, and hydroxypropylmethylcellulose.
[0061] In the case of aerosols, bases such as white petrolatum, yellow petrolatum, lanolin, bleached beeswax, cetanol, stearyl alcohol, stearic acid, hydrogenated oils, gelling hydrocarbons, polyethylene glycol, liquid paraffin, and squalane used in the preparation of ointments, creams, gels, suspensions, emulsions, solutions, and lotions; solvents and solubilizing agents such as oleic acid, isopropyl myristate, diisopropyl adipate, isopropyl sebacate, glycerin triisooctanoate, crotamiton, diethyl sebacate, hexyl laurate, fatty acids, fatty acid esters, aliphatic alcohols, and vegetable oils; antioxidants such as tocopherol derivatives, L-ascorbic acid, dibutylhydroxytoluene, and butylhydroxyanisole; preservatives such as parahydroxybenzoic acid esters; Humectants such as glycerin, propylene glycol, and sodium hyaluronate; surfactants such as polyoxyethylene derivatives, glycerin fatty acid esters, sucrose fatty acid esters, sorbitan fatty acid esters, propylene glycol fatty acid esters, and lecithin; thickeners such as carboxyvinyl polymers, xanthan gum, carboxymethylcellulose, carboxymethylcellulose sodium salts, hydroxypropylcellulose, and hydroxypropylmethylcellulose; In addition, various stabilizers, buffers, coagulants, suspending agents, emulsifiers, fragrances, preservatives, solubilizers, and other suitable additives can be blended. In addition, stabilizers, preservatives, absorption promoters, pH adjusters, and other suitable additives can be blended as needed.
[0062] For the pharmaceutical product of the present invention, a more specific description is the same as the description for the above pharmaceutical composition.
[0063] In addition, the present invention provides a method for producing a spheroid, comprising the steps of producing CD10-positive and CD24-negative skeletal muscle progenitor cells; producing induced mesenchymal stem cells positive for at least one selected from the group consisting of CD44, CD73, CD90, and CD105; and mixing the skeletal muscle progenitor cells and the induced mesenchymal stem cells and inducing cell-to-cell aggregation to form a spheroid; wherein the spheroid is characterized in that it suppresses premature differentiation of the skeletal muscle progenitor cells.
[0064] The step of producing the CD10 positive and CD24 negative skeletal muscle progenitor cells may further include the steps of differentiating induced pluripotent stem cells (iPSCs) into paraxial mesoderm; inducing cells differentiated into the paraxial mesoderm into somites and myotomes; and selecting CD10 positive and CD24 negative cells from among the cells induced into somites and myotomes, thereby obtaining CD10 positive and CD24 negative skeletal muscle progenitor cells.
[0065] The step of differentiating iPSCs into paraxial mesoderm in the above method aims to precisely induce iPSCs into the mesoderm lineage, the origin of muscle cells, and specifically, into the "paraxial mesoderm," which can differentiate into skeletal muscle. By mimicking developmentally important signaling pathways during muscle development through WNT activation (CHIR99021) and TGF-β inhibition (SB431542), nonspecific differentiation into non-muscle mesoderm or other lineages was prevented.
[0066] In the step of inducing the lateral axis mesoderm cells of the above method into somites and myotomes, somites are the source of tissues that differentiate into skeletal muscle, cartilage, dermis, etc. during the actual developmental process, and among them, myotomes are the compartments that directly produce skeletal muscle progenitor cells. This step is the point where the commitment to the skeletal muscle-only lineage occurs, and the expression of skeletal muscle transcription factors such as MYF5 and MYOD is induced in earnest, and a muscle-specific transcription program is activated by inhibition of the BMP and TGF-β pathways and treatment with muscle-related growth factors such as IGF / HGF, thereby inducing stable induction into SKMP.
[0067] CD10 of the above method + / CD24 - In the step of selecting cells to obtain SKMP, CD10 + / CD24 - Through selection, a safe cell population specific to the skeletal muscle lineage was secured by excluding unnecessary undifferentiated cells.
[0068] In addition, in the step of producing CD10 positive and CD24 negative skeletal muscle progenitor cells of the present invention, the induced pluripotent stem cells (iPSCs) are characterized in that they are derived from umbilical cord blood.
[0069] In addition, the step of producing induced mesenchymal stem cells that are positive for at least one selected from the group consisting of CD44, CD73, CD90, and CD105 may further include the steps of: inducing induced pluripotent stem cells (iPSCs) into cranial neural crest; selecting CD271-positive cells from the cranial neural crest-induced cells; and subculturing the CD271-positive cells at least four times to obtain induced mesenchymal stem cells that are positive for at least one selected from the group consisting of CD44, CD73, CD90, and CD105.
[0070] In the step of inducing the above-mentioned induced pluripotent stem cells (iPSCs) into the cranial neural crest, the neural crest, especially the cranial neural crest, is a lineage with the ability to differentiate into various cell types such as cartilage, nerve, muscle, and mesenchyme from an embryological perspective, and it has been reported that the cranial neural crest-derived mesenchymal stem cells have excellent immunomodulatory ability, regenerative ability, and angiogenic ability. The present invention controlled the direction of differentiation to selectively induce the cranial neural crest lineage from iPSCs through signal control such as WNT activation (CHIR99021), TGFβ inhibition (SB431542), BMP inhibition (DMH1), and top-down method (BMP4).
[0071] In the step of selecting CD271-positive cells among the cells induced by the two neural crest lines, CD271 (p75NTR) is a typical surface marker of neural crest and mesenchymal lineages, and can identify a cell population with high differentiation potential into mesenchymal stem cells. Therefore, the above step is a purification step to selectively secure a subpopulation with high functional homogeneity and regenerative capacity among the entire cell population, and is intended to prevent heterogeneous differentiation or the inclusion of non-standard cell populations.
[0072] The step of obtaining iMSCs by subculturing the CD271-positive cells at least four times is a step in the process of conversion and stabilization from neural crest to mesenchymal stem cells (MSCs). CD271 + The cells were gradually converted to a typical iMSC phenotype that highly expressed key MSC markers such as CD44, CD73, CD90, and CD105, and elimination of any residual neural crest characteristics that may initially appear was also achieved.
[0073] In addition, in the step of producing induced mesenchymal stem cells that are positive for at least one selected from the group consisting of CD44, CD73, CD90 and CD105 of the present invention, the induced pluripotent stem cells (iPSCs) are characterized in that they are derived from umbilical cord blood.
[0074] In the present invention, the CD10 positive and CD24 negative skeletal muscle progenitor cells and the induced mesenchymal stem cells positive for at least one selected from the group consisting of CD44, CD73, CD90 and CD105 may be mixed at a cell number ratio of 1 to 3:1, preferably at a cell number ratio of 1 to 2:1, and more preferably at a cell number ratio of 2:1.
[0075] In the manufacturing method of the present invention, the intercellular aggregation may be achieved through a spheroid-based three-dimensional cell culture technology.
[0076] The above spheroid-based 3D cell culture technology can be applied without limitation to any technology known in the art for producing spheroids. For example, it may be a micro-well-based spheroid culture technology, a low-adhesion plate, or a matrix embedding culture method, and preferably a micro-well-based spheroid culture technology, but is not limited thereto.
[0077] In addition, the spheroid of the present invention manufactured through the above manufacturing method may have a diameter of 50 to 200 μm, preferably a diameter of 100 to 200 μm, and more preferably a diameter of 100 to 150 μm.
[0078] In addition, the spheroid of the present invention can treat hindlimb ischemia, and is characterized by increasing at least one selected from the group consisting of blood flow reperfusion, capillary density, muscle fiber fusion, and limb salvage rate, which are reduced due to hindlimb ischemia.
[0079] In addition, the present invention provides a method for preventing or treating lower extremity ischemia, comprising administering to a subject a spheroid comprising CD10-positive and CD24-negative skeletal muscle progenitor cells and at least one induced mesenchymal stem cell positive for CD44, CD73, CD90, and CD105, and inhibiting premature differentiation of the skeletal muscle progenitor cells.
[0080] The above-mentioned entity is preferably a mammal, including a human, and includes all patients who are being treated, have been treated, or need to be treated for the prevention or treatment of lower extremity ischemia, and may also include patients who have undergone surgical operation for the treatment of lower extremity ischemia.
[0081]
[0082] Throughout this specification, '%' used to indicate the concentration of a particular substance means (w / w)% for solid / solid, (w / v)% for solid / liquid, and (v / v)% for liquid / liquid, unless otherwise stated.
[0083] The terminology used in this specification is intended to appropriately express preferred embodiments of the present invention, and may vary depending on the intent of the user or operator, or the customs of the field to which the present invention pertains. Therefore, the definitions of these terms should be determined based on the contents of this specification as a whole. Throughout this specification, when a part is said to "include" a certain component, unless specifically stated otherwise, this does not mean that other components are excluded, but rather that other components may be included.
[0084] Unless otherwise defined, all technical terms used in this invention have the same meaning as commonly understood by those skilled in the art. While preferred methods and samples are described herein, similar or equivalent methods are also included within the scope of the present invention. The contents of all publications cited as references herein are incorporated herein by reference.
[0085] Hereinafter, the present invention will be described in detail with reference to the attached drawings, using exemplary embodiments. However, the following exemplary embodiments are provided as illustrative examples of the present invention. If a detailed description of a technology or configuration well known to those skilled in the art is judged to unnecessarily obscure the gist of the present invention, such detailed description may be omitted, and the present invention is not limited thereby. The present invention is capable of various modifications and applications within the scope of the following claims and equivalents interpreted therefrom.
[0086]
[0087] Example 1. Production of 3D spheroids
[0088] 1-1. Obtaining skeletal muscle progenitor cells (SKMPs) derived from induced pluripotent stem cells
[0089] For the production of SKMPs, a three-step differentiation technique was performed. First, basal media for differentiation was prepared by adding 5% (v / v) horse serum (Horse Serum, Gibco, 26050088), 50 μg / mL AA2P (L-Ascorbic acid 2-phosphate sesquimagnesium salt hydrate, Sigma, A8960), 10 μg / mL insulin (Insulin, WELGENE, LS038-01), 1 μM dexamethasone (Dexamethasone, Sigma, D4902), and 10 ng / mL EGF (Epidermal Growth Factor, Peprotech, 100-15) to IMDM-based culture medium.
[0090]
[0091] Stage 1 differentiation
[0092] Paraaxial mesoderm was induced by inhibiting WNT activation and TGFβ signaling pathway in cells.
[0093] For this purpose, induced pluripotent stem cells (induced pluripotent stem cell lines CMC11, CMC-hiPSC-011, Parental cells: umbilical cord blood) were seeded at 1 × 10 in a 6-well standard plate coated with matrigel using a culture medium containing 3 μM CHIR99021 (Selleckchem, S2924) and 2 μM SB431542 (Selleckchem, S1067) added to the above basal medium. 4 cell / cm 2 Cells were seeded at a seeding density of 100 μg / mL and cultured for 5 days. The culture medium was replaced every 24, 48, and 48 h. During the initial 24-h culture, 10 μM Y-27632 (Selleckchem, S1049) was added to ensure cell survival.
[0094] Stage 2 differentiation
[0095] In addition, both the BMP and TGFβ signaling systems of the cells were inhibited, and muscle differentiation factors were added to induce somites and myotomes.
[0096] For this purpose, 20 ng / mL HGF (Peprotech, 100-39H), 20 ng / mL bFGF (Peprotech, 100-18B), 10 ng / mL IGF-1 (Peprotech, 100-11), 2 μM SB431542 (Selleckchem, S1067), and 500 nM LDN193189 (Selleckchem, S7507) were added to the basal medium. Using this, the cells induced to the lateral axis mesoderm were cultured. On the 5th day, the cells induced to somite and myotome were obtained and counted, and then 2 × 10 were seeded in the same differentiation medium in a 100 mm or 75T flask coated with Matrigel. 4 cell / cm 2 After seeding at the seeding density, the cells were cultured for an additional 10 days (days 5–15). The culture medium was replaced once every 24 hours and then every 48 hours thereafter. During the initial 24-hour culture, 10 μM Y-27632 was added to ensure cell survival.
[0097] Stage 3 differentiation
[0098] CD24 in cells cultured on day 15 after differentiation induction - Wow CD10 + Magnetic-Activated Cell Sorting (MACS) was performed to recover cells.
[0099] Specifically, CD24 was detected in cells induced by the above eradication using a negative selection technique using CD24 capture microbeads. - Cells were obtained and then positively selected using CD10 capture microbeads to identify CD10 +SKMPs were secured.
[0100] The above-selected CD24 - Wow CD10 + SKMPs cells were maintained and proliferated for approximately 96 hours in the differentiation medium used in Step 2 above, then harvested and cryopreserved to produce a passage 1 stock for future studies. During the initial 24-hour culture, 10 μM Y-27632 was added to ensure cell survival.
[0101]
[0102] 1-2. Obtaining mesenchymal stem cells (MSCs) derived from induced pluripotent stem cells
[0103] To obtain mesenchymal stem cells derived from induced pluripotent stem cells, a differentiation technique via the cranial neural crest lineage was used.
[0104] For this purpose, a differentiation basal medium was first prepared by adding N-2 (1X) to DMEM / F12 culture medium.
[0105]
[0106] Step 1 Neural Crest Induction
[0107] To induce cranial neural crest, a top-down inhibition strategy of the BMP signaling pathway was combined with a dual SMAD inhibition and WNT activation technique.
[0108] 1 × 10 in a 6-well standard plate coated with Matrigel 4 cell / cm 2Induced pluripotent stem cells (induced pluripotent stem cell lines CMC11, CMC-hiPSC-011, parental cells: cord blood) seeded at a cell seeding density were cultured for 24 hours, and differentiation was induced for an additional 7 days by adding 1 μM CHIR99021, 2 μM SB431542, 1 μM DMH1, and 15 ng / mL BMP4 to the differentiation basal medium. The differentiation medium was replaced every 24 hours.
[0109] MACS was performed to recover the CD271-high cell population from differentiated cells on the 7th day of culture. Using neural crest stem cell capture microbeads (CD271), positively selected CD271 cells were identified by flow cytometry to secure the top 10% expression group (FACSAria Fusion, BD).
[0110] The cells were transferred to a fibronectin-coated culture dish and 2 × 10 4 cell / cm 2 Amplification / maintenance culture was initiated by seeding cells at the cell seeding density (passage 1). The secured CD271 + To expand the cells, they were cultured in differentiation basal medium containing 20 ng / mL bFGF, 20 ng / mL EGF, and 2 μM SB431542, and the medium was replaced every 24 hours. During the initial 24-hour culture, 10 μM Y-27632 was added to ensure cell survival.
[0111] In the present invention, MSC differentiation was induced by maintaining and culturing CD271-positive cells of passage 4.
[0112] iMSC differentiation induction
[0113] 1 × 10 CD271 positive cells in passage 4 4 cell / cm 2Cells were seeded at the seeding density and cultured for 24 hours, and MSC differentiation was induced using a culture medium containing 10% FBS added to alpha-MEM medium. The culture medium was replaced every 48 hours and subcultured every 96 hours. Cells that reached the final subculture stage 4 were defined as MSCs and cryopreserved for use.
[0114] It was confirmed through flow cytometry that the obtained MSCs expressed the cell surface markers CD44, CD73, CD90, and CD105 (FACSCanto II, BD).
[0115]
[0116] 1-3. Manufacturing of SKMP and MSC-based 3D complex cell spheroids
[0117] SKMPs (passage 1) of Example 1-1 above were dispensed onto Matrigel-coated culture dishes and cultured for expansion using skeletal muscle growth media (Promocell, C-23060). In addition, 20 ng / mL of bFGF was added to the medium to promote proliferation.
[0118] In addition, the MSCs (passage 4) of Example 1-2 were cultured on a fibronectin-coated culture dish using a medium containing 5 ng / mL bFGF to promote proliferation.
[0119] Based on the two types of amplified cells, a microcavity technique (Elplasia® 24-well Black / Clear Round Bottom Ultra-Low Attachment, Microcavity Plate (Corning, 4441)) was introduced to form spheroids of an administerable size (scale) and three experimental groups were formed: Experimental group 1 (single SKMP spheroid (3 × 10 6 dog cells)), 2 experimental groups (single MSC spheroids (3 × 10 6dog cells)), 3 experimental groups (SKMP + MSC composite spheroids (2:1 cell number ratio, composition = SKMP: 2 × 10 6 + MSC: 1 × 10 6 , total 3 × 10 6 Dog cells)).
[0120] For spheroid culture, 5% FBS and 20 ng / mL bFGF were added to skeletal muscle growth medium and cultured for 3 days. As a result, aggregates (spheroids) with a size of approximately 100–150 μm formed in a 24-well plate were recovered and administered.
[0121]
[0122] Example 2. Confirmation of SKMP gene expression
[0123] Skeletal muscle progenitor cell-derived undifferentiated iPSCs and passage 1 SKMP cells prepared using the same as in Example 1 were cultured, and then the expression of OCT4, a pluripotent stem cell-specific gene, and MYF5, MYOD, and MYOG, muscle progenitor cell-specific genes, was confirmed through qRT-PCR to evaluate the stemness and muscle lineage specificity of the SKMP of the present invention. For this purpose, the primers in Table 1 below were used.
[0124] Gene name sequence (5'→3') direction sequence number OCT4CCTGAAGCAGAAGAGGATCACC forward 1AAAGCGGCAGATGGTCGTTTGG reverse 2MYF5CAGTCCTGTCTGGTCCAGAAAG forward 3GTCCACTATGTTGGATAAGCAATC reverse 4MYOD1CTCCAACTGCTCCGACGGCAT forward 5ACAGGCAGTCTAGGCTCGACAC reverse 6MYOGAGTGCCATCCAGTACATCGAGC forward 7AGGCGCTGTGAGAGCTGCATTC reverse 8
[0125] As a result, as shown in Figures 1 to 4, the mRNA expression of OCT4, a stem cell marker, was high in iPSC, but was significantly reduced in SKMP, confirming that the SKMP of the present invention is a differentiated cell lineage without stem cell properties (p < 0.001).
[0126] On the other hand, the mRNA expression of MYF5, MYOD, and MYOG, which are transcription factors of the skeletal muscle lineage, was significantly increased in SKMP, clearly confirming that the SKMP of the present invention is a precursor cell specific to the skeletal muscle lineage (p < 0.001).
[0127]
[0128] Example 3. Confirmation of morphological changes and molecular marker expression patterns of SKMP before and after differentiation induction.
[0129] Furthermore, the morphological and molecular characteristics of SKMPs produced from iPSCs through a three-step differentiation and cell selection process according to the present invention were confirmed before and after differentiation induction using phase-contrast microscopy and immunofluorescence staining. Immunofluorescence staining was performed using a known method, and the antibodies used for this purpose were MyoD1 (D8G3) XP® Rabbit mAb #13812 and MYH3 (eMyHC) Antibody (F1.652): sc-53091.
[0130] As a result, as shown in Figure 5, iPSCs prior to differentiation induction were distributed in a spindle-shaped or oval mononuclear form, and no cell fusion was observed. In addition, immunofluorescence staining of cells in this state revealed that the cells were positive (green fluorescence) for the muscle progenitor cell marker MYOD1(), but did not express eMyHC (embryonic Myosin Heavy Chain, red fluorescence), a marker of differentiated muscle cells (left).
[0131] In addition, SKMPs were exposed to high-density conditions (cultured for more than 6 days) and a culture medium containing 5% horse serum to induce differentiation, and this was confirmed by phase-contrast microscopy and immunofluorescence staining. As can be seen in the phase-contrast image, the cells fused with each other to form long, multinucleated myotubule structures. Immunofluorescence analysis of this showed that eMyHC (red), which was not observed before differentiation, was widely expressed, and a fusion signal was observed in the yellow area overlapping with MYOD1 (green). In addition, DAPI staining clearly confirmed multinucleated structures with multiple nuclei within a single cell, visually demonstrating that SKMPs possess the ability to differentiate and fuse into skeletal muscle cells.
[0132]
[0133] Example 4. Confirmation of changes in the expression of skeletal muscle-specific genes over time after SKMP induction of differentiation.
[0134] In addition, the SKMP of the present invention was divided into a pre-differentiation group, a 3-day differentiation-induced group, and a 6-day differentiation-induced group, and changes in gene expression over time were evaluated using quantitative PCR (qPCR) analysis. To this end, differentiation was performed for 3 or 6 days using the same method as in Example 3, and the following primers were used for qPCR analysis. For this purpose, the primers in Table 2 below were used.
[0135] Gene name sequence (5'→3') direction sequence number PAX7GTGCCCTCAGTGAGTTCGAT forward 9GTTTGGCCTTCTTTTCGCCG reverse 10MYH6GGAAGACAAGGTCAACAGCCTG forward 11TCCAGTTTCCGCTTTGCTCGCT reverse 12MYH7GGAGTTCACACGCCTCAAAGAG forward 13TCCTCAGCATCTGCCAGGTTGT reverse 14
[0136] As a result, as shown in Figures 6 to 10, it was confirmed that various skeletal muscle-specific genes, such as an early muscle marker (MYF5), a differentiation marker (MYOG), and contractile protein genes (MYH6, MYH7), were gradually and significantly expressed over time after differentiation induction.
[0137] In particular, the expression of PAX7 and MYF5 increased simultaneously on the 6th day of differentiation, confirming that some cells can still maintain muscle progenitor cell characteristics or remain in a satellite cell-like state.
[0138] Such an expression pattern demonstrates that the SKMP of the present invention possesses not only the ability to differentiate into skeletal muscle cells but also the ability to maintain a certain level of progenitor cell properties.
[0139]
[0140] Example 5. Confirmation of the iMSC differentiation induction process after induction of neural crest stem cells from iPSCs.
[0141] After inducing neural crest stem cells from iPSCs, the iMSC differentiation induction process was confirmed through immunofluorescence staining and flow cytometry (FACS). The antibodies used for this purpose were PAX7 Monoclonal Antibody (DSHB) (product code: PAX7, https: / / dshb.biology.uiowa.edu / PAX7), Sox10 (D5V9L) Rabbit mAb #8935, and TFAP2 (AP-2α) (C83E10) Rabbit mAb #3215. Additionally, for immunofluorescence staining, FITC Mouse Anti-Human CD44 (BD, 560977), BV421 Mouse Anti-Human CD73 (BD, 562431), APC Mouse Anti-Human CD90 (BD, 561971), BV421 Mouse Anti-Human CD105 (BD, 566265) were used.
[0142] As a result, as shown in Fig. 11, the cell status at the neural crest induction stage was confirmed (immunofluorescence staining image at the top). The cells were stained positive for three representative neural crest markers, Pax7, TFAP2, and Sox10, respectively, confirming that the induced cells possess typical gene expression characteristics of the neural crest lineage.
[0143] In addition, as a result of quantitative analysis of the surface marker expression of iMSCs induced to differentiate from neural crest stem cells (FACS graph below), it was confirmed that mesenchymal stem cell-specific surface proteins such as CD44, CD73, CD90, and CD105 were all positively expressed at more than 90%, confirming that neural crest-derived cells were effectively converted into an MSC-like phenotype according to the method of the present invention.
[0144]
[0145] Example 6. Confirmation of changes in marker expression over time during neural crest induction.
[0146] The expression patterns of cell markers observed on days 5, 6, or 7 during the neural crest induction process based on iPSCs were confirmed through immunofluorescence staining. The antibodies used for this purpose were Sox10 (D5V9L) Rabbit mAb #89356, Pax3 monoclonal antibody (DSHB), and p75NTR (D4B3) XP® Rabbit mAb #8238.
[0147] As a result, as shown in Fig. 12, the co-expression of Sox10 (cyan) and Pax7 (magenta) was analyzed (top). On day 5, Pax7 was predominantly expressed, while Sox10 expression was observed locally. On day 6, Sox10 and Pax7 were co-expressed, with some overlapping regions observed, confirming that the induction process toward the neural crest lineage was in progress. On day 7, the expression of Sox10 increased widely, while the expression of Pax7 was restricted to some regions, confirming that the cell population had acquired more mature neural crest stem cell characteristics.
[0148] In addition, as a result of analyzing the co-expression of p75NTR (light green) and Pax3 (magenta) (bottom), on day 5, Pax3 was expressed in many cells, and p75NTR was observed sporadically. On day 6, the expression of p75NTR increased, and partial overlap with Pax3 was observed, confirming that neural crest characteristics were being strengthened. On day 7, strong expression of p75NTR was observed in a wide range, and the expression of Pax3 decreased, visually confirming that the transition from early progenitor cell characteristics to neural crest stem cell identity was successfully induced over time. Through this, it was confirmed that the neural crest induction system of the present invention stepwise induces Sox10 + / p75NTR + It was confirmed that differentiation into neural crest stem cells can be effectively induced.
[0149]
[0150] Example 7. Confirmation of surface antigen expression of iMSCs derived from neural crest stem cells.
[0151] Surface antigen expression of iMSCs derived from neural crest stem cells was confirmed by flow cytometry. The antibodies used for this purpose were FITC Mouse Anti-Human CD44 (BD, 560977), BV421 Mouse Anti-Human CD73 (BD, 562431), APC Mouse Anti-Human CD90 (BD, 561971), and BV421 Mouse Anti-Human CD105 (BD, 566265).
[0152] The results are shown in Figs. 13 to 15, where Fig. 13 shows the isotype control, Fig. 14 shows the expression of single markers based on individual antibodies, and Fig. 15 shows the results of evaluating the co-expression of representative mesenchymal stem cell (MSC) markers. The three dot plots from the upper left are the isotype control results for the FITC, BV421, and APC fluorescence channels, respectively. In all cases, the positive cell ratio was less than 1% (0.044%, 0.79%, and 0.080%), confirming that non-specific binding was very low. As a result of confirming the expression of CD44, CD73, CD105, and CD90, 99.9%, 100.0%, 99.9%, and 99.8% of cells were positive, respectively, confirming that iMSCs express major MSC markers at almost all levels. Furthermore, when CD44 and CD73 were co-stained, 99.9% of all cells simultaneously expressed both markers, and 99.7% were double positive for CD90 and CD105, clearly confirming that the induced iMSCs of the present invention highly satisfies the phenotype of typical mesenchymal stem cells. Therefore, it was confirmed that neural crest-derived iMSCs strongly express all key MSC markers, including CD44, CD73, CD90, and CD105.
[0153]
[0154] Example 8. Evaluation of the effects of SKMP and iMSC on cell cycle progression and mitogenic responsiveness of vascular endothelial cells (iPSC-EC).
[0155] To evaluate the effects of the SKMP and iMSC of the present invention on the cell cycle progression and mitotic responsiveness of vascular endothelial cells (iPSC-EC), vascular endothelial cells (iPSC-EC) expressing the FUCCI reporter system (ref: https: / doi.org / 10.1016 / j.molcel.2017.10.001), which can visualize the cell cycle status in real time, were produced (Fig. 7B). The FUCCI system exhibits red fluorescence (RFP) when the cell nucleus is arrested in the G1 phase and green fluorescence (GFP) when it enters the S / G₂ / M phase, allowing for real-time observation of cell mitotic activity without invasive treatment of the cells.
[0156] To manufacture the above FUCCI reporter system, first, transposon-based transduction using a Fucci gene expression plasmid vector was performed on iPSCs (induced pluripotent stem cell lines CMC11, CMC-hiPSC-011, parental cells: umbilical cord blood) (Vector information = https: / / dnaconda.riken.jp / search / RDB_clone / RDB18 / RDB18220.html), and then cells expressing the Fucci gene were selected through puromycin treatment. Afterwards, the expression level was confirmed through flow cytometry, and only cells with the same expression were captured and made into cell lines. The Fucci-iPSC constructed as above were differentiated into vascular endothelial cells (FUCCI-iPSC-EC) according to a known method (https: / / www.pnas.org / doi / 10.1073 / pnas.1702295114) and used in the study.
[0157] FUCCI-iPSC-ECs were cultured in normal proliferation medium (endothelial growth media 2) and then pretreated with basal media without mitogens for 24 h to arrest the cell cycle (starvation). Then, for each experimental group (SKMP, MSC, Control), the same number of cells (1 × 10⁴ cells / cm²) were seeded into transwell inserts, and the arrested FUCCI-iPSC-ECs were placed at the bottom to design the transwell inserts to transmit only paracrine signals without direct cell-to-cell contact. Based on this, live-cell imaging (Lionheart FX, Agilent) was performed at 5-minute intervals for 24 h to track cell cycle changes in vascular endothelial cells under each condition.
[0158] The fluorescence changes of FUCCI-iPSC-ECs at 0, 12, and 24 hours in the three experimental groups (Control, SKMP, and MSC) confirmed through this are shown in Figures 16 to 18. In the Control group, most of the cells maintained a red fluorescence (RFP, G1 phase) state throughout all time points, indicating that cell cycle progression was inhibited, and the MSC co-culture group similarly showed almost no division-inducing effect. On the other hand, in the SKMP co-culture group, the proportion of cells exhibiting green fluorescence (GFP, S / G₂ / M phase) gradually increased after 12 hours, and at 24 hours, a significantly large number of cells were observed to have entered the division phase. These results are also clearly confirmed in the quantitative analysis graph at the lower right, and at 24 hours, less than about 5% of the cells exited the G1 phase (S / G₂ / M phase) in the Control and MSC groups, but more than about 25% of the cells in the SKMP group entered the S / G₂ / M phase. Through this, we confirmed that SKMP can secrete a paracrine factor that induces cell cycle progression of vascular endothelial cells even under a starvation environment.
[0159]
[0160] Example 9. Confirmation of cell composition and mixing degree of spheroids composed of SKMP and iMSC.
[0161] The spatial structure and intercellular mixing state during the formation of three-dimensional spheroids by SKMP and iMSC were visually confirmed using fluorescence and phase contrast images.
[0162] As a result, as shown in Figure 19, the SKMP-only spheroids and iMSC-only spheroids, respectively, showed green fluorescence (GFP) or red fluorescence (RFP) evenly throughout the entire area including the center, confirming that they formed a stable spheroid structure as a single cell group.
[0163] In addition, the composite spheroid formed by mixing the SKMP and MSC of the present invention at a cell number ratio of 2:1 had both GFP and RFP signals, and a yellow series signal was confirmed in the area where the fluorescent signals overlapped, confirming that the two cells were successfully mixed (co-localized) within the same spheroid.
[0164] That is, it was confirmed that SKMP and MSC stably aggregated into a single structure without mutual exclusion even under co-culture conditions.
[0165]
[0166] Example 10. Confirmation of the therapeutic effect of spheroids composed of SKMP and iMSCs on severe lower limb ischemia.
[0167] 10-1. Preparation of an animal model of lower extremity ischemia
[0168] For this purpose, 8-week-old, 20-25 g male Balb / c nude mice (Orientbio, Korea) were anesthetized, and the proximal superficial epigastric artery and its aortic bifurcation toward the common femoral artery were ligated, and the distal and proximal ends of the aorta were occluded with a double-knotted suture (7-0 silk). An animal model was prepared by incising the intervening 2-3 mm artery to induce limb ischemia. The experimental groups were divided into PBS (Control), SKMP (3 × 10 6 dog cells), iMSCs (3 × 10 6 dog cells), SKMP+MSC composite spheroids (3 × 10 6 (dog cells) were injected into the two intramuscular sites of the inner hind limbs in a volume of approximately 40 μL per shot.
[0169]
[0170] 10-2. Confirmation of the effect on blood flow reperfusion
[0171] The effects of iSKMP, iMSC, and spheroids composed of SKMP and iMSC on blood reperfusion were evaluated in a model of critical limb ischemia.
[0172] Blood perfusion of the hindlimbs was monitored using a laser Doppler perfusion imaging (LDPI) system (Moore instruments, Devon, UK) on days 0, 3, 7, 14, 21, and 28 after surgery. Digital images were analyzed to quantify blood flow from the knee joint to the toes, and the perfusion rate was normalized to the ratio of the ischemic hindlimb to the healthy hindlimb and expressed as “blood perfusion ratio (%).”
[0173] The status of blood flow reperfusion over time is visually represented in Figures 20 to 22. In Figure 20, red indicates high blood flow, and blue indicates low blood flow. As a result, in the Control group (untreated), blood flow recovery was limited throughout the entire period, and the iMSC-only treatment group also showed a relatively weak reperfusion response. On the other hand, the SKMP (iSKMP) group showed gradual blood flow recovery from day 7, and in particular, the spheroid-administered group (Mix) showed the most marked blood flow recovery throughout the entire period. By day 28, blood flow was extensively restored in most tissues. This trend was clearly reflected in the quantitative data in the graph, with the perfusion ratio of the Mix group being the highest at approximately 60% on day 28, followed by approximately 40% for iSKMP, approximately 30% for iMSC, and less than 20% for Control (Figure 21). In addition, according to the statistical analysis table (Tukey's multiple comparisons test) (Fig. 22), there were statistically significant differences (p < 0.001, p = 0.02) between Control and Mix, and between Control and iSKMP, and the Mix group showed a significant effect advantage over iMSC (p = 0.003). On the other hand, there was no statistically significant difference between iSKMP and iMSC, or between iSKMP and Mix.
[0174]
[0175] 10-3. Check the limb salvage rate and the extent of recovery of damaged muscle mass.
[0176] The preservation rate of the lower extremities and the degree of recovery of damaged muscle mass in each experimental group were compared and analyzed, and are shown in Figs. 23 to 26. Specifically, the percentage of five conditions (limb loss, foot necrosis, tip necrosis, toe necrosis, or limb salvage) was quantified on the 28th day after cell transplantation. At this time, the limb loss score was graded as total limb loss (5), limb loss (4), foot necrosis (3), tip necrosis (2), foot necrosis (1), or limb salvage (0). As a result of photographing the actual lower extremity condition in each experimental group, foot or toe necrosis and lower extremity amputation were observed in the Control and iMSC groups, but it was confirmed that good lower extremity structure with almost no damaged tissue was preserved in the iSKMP group and especially the Mix group (Fig. 23). Quantitative results also showed that the Mix group had the highest limb preservation rate and the lowest necrosis rate, and the iSKMP group also showed significant recovery, whereas the iMSC group did not show a significant difference from the Control group (Fig. 24). In addition, when the degree of ischemic muscle mass recovery was confirmed, the Control group showed an atrophied muscle shape, and the iMSC group showed a similar level. On the other hand, the iSKMP group showed a clear recovery of muscle mass, and the Mix group showed the thickest and healthiest muscle mass (Fig. 25). In the quantitative graph, the Mix group had the highest muscle mass among all experimental groups, and statistically, it showed a significantly superior effect compared to the Control and iMSC groups (Fig. 26).
[0177]
[0178] 10-4. Checking capillary density within the tissue
[0179] The capillary density in the tissues of each experimental group was compared through immunofluorescence staining and quantitative analysis, and the results are shown in Figures 27 and 28. For this purpose, the following antibodies were used: Human / Mouse / Rat CD31 / PECAM-1 Antibody (AF3628), Anti-Laminin (LAMA1) antibody (L9393).
[0180] As a result of simultaneously observing the expression of vascular endothelial cell markers CD31 (white), iMSC (red), iSKMP (green), and cell nuclei (DAPI, blue), it was confirmed that in the Control group, CD31 signals were sparsely observed and capillary density was low, and in the iMSC group, the vascular structure increased somewhat centered on the iMSC injection site, but the density was limited. On the other hand, in the iSKMP group, CD31-positive signals increased significantly around the injected cells, indicating an improvement in capillary density. In particular, CD31 was distributed more widely in the Mix group, confirming that a dense capillary structure was formed throughout the tissue (Fig. 27).
[0181] In addition, based on these immunofluorescence results, the number of capillaries per unit area (㎟) was quantified, and a significant increase in density was confirmed in all experimental groups compared to the Control, and in particular, the Mix group showed the highest level with a density of approximately 750 vessels / mm² or more (Fig. 28). The statistical analysis results also demonstrated that the Mix group induced a significantly higher capillary density than the Control, iMSC, and iSKMP groups (the symbols *, #, and $ indicated indicate significant differences from other groups, respectively).
[0182] Therefore, we confirmed that iSKMP alone, and especially iSKMP+iMSC 3D spheroids, can strongly induce neovascularization in ischemic tissues.
[0183]
[0184] 10-5. Confirmation of the effect on fusion and regeneration of myofibers
[0185] Whether SKMP, iMSC, or 3D spheroids participated in fusion and regeneration into myofibers was evaluated through immunofluorescence staining and quantitative analysis, and is shown in Figures 29 to 31.
[0186] The structure of muscle tissue was visualized centered on laminin (white), a component of the outer membrane of muscle fibers, and the distribution of cell nuclei (DAPI, blue), iMSCs (RFP+, red), and iSKMP (GFP+, green) were observed simultaneously (Fig. 29). As a result, in the iMSC only group, red fluorescent (RFP+) cells were mainly present outside the muscle fibers, so they were observed as unfused non-muscle (non-myofiber) cells. In the iSKMP only group, GFP+ cells were confirmed to have fused into many muscle fibers, and in the Mix group, a wider range of muscle fibers showed GFP+ fluorescence, confirming that cell fusion and muscle remodeling occurred more strongly.
[0187] In addition, the number of myofibers with GFP+ (iSKMP) and RFP+ (iMSC) fluorescence was quantified in each experimental group. The Mix group observed the highest number of GFP+ myofibers, and a significant number was also confirmed in the iSKMP group (Fig. 30). In contrast, the iMSC group showed almost no RFP+ myofibers, and no GFP+ myofibers were present either. This suggests that SKMP can actually fuse with myofibers and contribute to tissue regeneration.
[0188] The number of fluorescent cells (RFP+, GFP+) present in the non-muscle region (non-muscle cell region) was confirmed. The number of RFP+ cells existing as non-muscle cells was very high in the iMSC group, whereas the presence of these non-muscle cells was significantly reduced in the iSKMP and Mix groups (Fig. 31). This indicates that iMSCs exist as a surrounding matrix rather than in myofiber fusion and are not directly involved in regeneration, whereas SKMP contributes substantially to muscle regeneration.
[0189] Through this, it was confirmed that in the spheroid of the present invention, SKMP contributes to direct muscle regeneration through fusion with muscle fibers, and iMSCs, lacking this fusion ability, instead contribute to indirect regeneration by existing as a surrounding matrix.
[0190]
[0191] 10-6. Confirmation of persistence and distribution in the body
[0192] After transplanting iMSC (RFP+), SKMP (GFP+), or spheroid (Mix) into an ischemic limb model, the extent to which the transplanted cells remained and were distributed in the transplanted muscle tissue was confirmed through immunofluorescence staining and quantitative analysis, and the results are shown in Figures 32 to 34.
[0193] Whole tissue slides of transplanted fluorescent cells (RFP+: red, GFP+: green) were examined at high magnification in the quadriceps femoris (Quadriceps M) and gastrocnemius M regions, respectively. In the iMSC group, RFP+ cells were mainly observed, and they were mainly scattered on the periphery or outside of the muscle tissue. On the other hand, in the iSKMP group, GFP+ cells were widely distributed and deeply infiltrated into the muscle tissue in both the quadriceps femoris and gastrocnemius. In particular, in the Mix group, both RFP+ and GFP+ cells were present, but GFP+ cells were strongly distributed over a wider area, and in some areas, areas where the two fluorescences were mixed were also confirmed (Fig. 32).
[0194] The GFP+ and RFP+ cell areas in the quadriceps femoris and gastrocnemius muscles were quantified per unit area (mm²). In both groups, the iSKMP and Mix groups showed significantly higher tissue distribution areas of GFP+ cells than the iMSC group. In particular, GFP+ cells in the Mix group were most widely distributed in the quadriceps femoris. On the other hand, RFP+ cells were observed in both the iMSC and Mix groups, but in the Mix group, they were relatively smaller than GFP+ cells (Figs. 33 and 34).
[0195] This suggests that SKMP has excellent engraftment and tissue infiltration ability within muscle tissue after transplantation, which means that SKMP in the spheroid of the present invention actively contributes to engraftment and distribution within tissue.
[0196]
[0197] 10-7. Confirmation of angiogenic effect
[0198] After transplanting iMSCs (RFP+), SKMPs (GFP+), or spheroids (Mix) into an ischemic lower limb model, the contribution of the transplanted cells to blood vessel formation was evaluated in the quadriceps M and gastrocnemius M regions through immunofluorescence staining and quantitative analysis, and the results are shown in Figures 35 to 37.
[0199] As a result of examining the spatial distribution and capillary structure within the muscle tissue into which each cell was transplanted, in the iMSC group, red fluorescent (RFP+) cells were distributed in a limited area, and the blood vessel density was also relatively low. In the iSKMP group, green fluorescent (GFP+) cells were spread over a wider area, and CD31 positive signals were confirmed in a wide area, confirming active blood vessel formation. In the Mix group, both fluorescences were observed, and in particular, CD31 signals were confirmed abundantly throughout the tissue, confirming the strongest improvement in blood vessel density (Fig. 35).
[0200] In addition, capillary density (% of capillaries per total area) was quantitatively calculated based on the CD31-positive area in the quadriceps femoris and gastrocnemius. As a result, the Mix group showed the highest vascular density in both sites, which was a significant increase compared to the iMSC or iSKMP alone groups (Figs. 36 and 37). In particular, the Mix group showed a statistically significant increase in vascular density (p<0.05 or higher) in both the quadriceps femoris and gastrocnemius, confirming that it strongly induced angiogenesis.
[0201] Therefore, we confirmed that the 3D spheroids of iMSCs and iSKMP were more effective in angiogenesis (especially increasing capillary density) in muscle tissue than either alone.
[0202]
[0203] 10-8. Confirmation of angiogenic effect
[0204] The engraftment distribution of SKMP cells in the SKMP single transplant group and the spheroids of the present invention was confirmed through immunofluorescence staining and is shown in Figure 38. In Figure 38, green fluorescence represents iSKMP cells (GFP+) and blue fluorescence represents cell nuclei (DAPI).
[0205] As a result, in the SKMP-only transplantation group, GFP+ iSKMP cells were aligned along the muscle fiber structure at the interface and were confirmed to have engrafted in a relatively constant and limited range. This suggests that when SKMP is transplanted alone, it exists locally aligned near specific tissue boundaries or blood vessels. On the other hand, in the spheroid transplantation group (Mix group), GFP-expressing cells were distributed in an irregular and diffuse form over a much wider area and were observed to have deeply penetrated into the tissue. This suggests that the iMSCs included in the spheroids of the present invention enhanced the motility or retention of SKMP cells in the tissue.
[0206] Therefore, the spheroid of the present invention showed a more significant effect of improving the tissue-wide dispersion, engraftment, or infiltration ability of cells compared to SKMP transplantation alone.
[0207]
[0208] As described above, specific embodiments of the present invention have been described in detail. However, those skilled in the art who understand the spirit of the present invention will be able to easily suggest other inventions that are backwards or other embodiments included within the scope of the spirit of the present invention by adding, changing, or deleting other components within the scope of the same spirit. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention is indicated by the scope of the claims described below rather than the detailed description described above, and all changes or modified forms derived from the meaning and scope of the claims and their equivalent concepts should be interpreted as being included in the scope of the present invention.
Claims
1. A spheroid comprising a CD10 positive and CD24 negative skeletal muscle progenitor cell and an induced mesenchymal stem cell positive for at least one selected from the group consisting of CD44, CD73, CD90, and CD105, and which suppresses early differentiation of the skeletal muscle progenitor cell.
2. In paragraph 1, A spheroid, wherein the CD10 positive and CD24 negative skeletal muscle progenitor cells and the induced mesenchymal stem cells positive for at least one selected from the group consisting of CD44, CD73, CD90 and CD105 are mixed in a cell number ratio of 1 to 3:
1.
3. In paragraph 1, A spheroid having a diameter of 50 to 200 μm.
4. In paragraph 1, The above spheroid is a spheroid that treats hindlimb ischemia.
5. In paragraph 1, The spheroid is a spheroid that increases at least one selected from the group consisting of blood flow reperfusion, capillary density, muscle fiber fusion, and limb salvage rate reduced by lower limb ischemia.
6. In paragraph 1, The above spheroid is a spheroid that increases the cell cycle activity of vascular endothelial cells.
7. In paragraph 1, The above spheroid is a spheroid that induces muscle cell fusion and muscle remodeling within skeletal muscle tissue.
8. In paragraph 1, The above spheroids are spheroids having enhanced tissue dispersal and infiltration capabilities compared to CD10 positive and CD24 negative skeletal muscle progenitor cells alone.
9. A pharmaceutical composition for preventing or treating lower extremity ischemia, comprising skeletal muscle progenitor cells that are CD10 positive and CD24 negative and induced mesenchymal stem cells that are positive for at least one selected from the group consisting of CD44, CD73, CD90, and CD105, and comprising a spheroid that suppresses early differentiation of the skeletal muscle progenitor cells.
10. A cell therapy agent for preventing or treating lower extremity ischemia, comprising skeletal muscle progenitor cells that are CD10 positive and CD24 negative and induced mesenchymal stem cells that are positive for at least one selected from the group consisting of CD44, CD73, CD90, and CD105, and comprising a spheroid that suppresses early differentiation of the skeletal muscle progenitor cells.
11. A pharmaceutical composition for improving lower extremity ischemia, comprising skeletal muscle progenitor cells that are CD10 positive and CD24 negative and induced mesenchymal stem cells that are positive for at least one selected from the group consisting of CD44, CD73, CD90, and CD105, and a spheroid that suppresses early differentiation of the skeletal muscle progenitor cells.
12. Step of producing CD10 positive and CD24 negative skeletal muscle progenitor cells; A step of producing induced mesenchymal stem cells that are positive for at least one selected from the group consisting of CD44, CD73, CD90, and CD105; and A method for producing a spheroid, comprising: a step of mixing the skeletal muscle progenitor cells and induced mesenchymal stem cells and inducing cell-to-cell aggregation to form a spheroid; wherein the spheroid suppresses early differentiation of the skeletal muscle progenitor cells.
13. In paragraph 12, The step of producing the CD10 positive and CD24 negative skeletal muscle progenitor cells is as follows: A step of differentiating induced pluripotent stem cells (iPSCs) into paraxial mesoderm; A step of inducing cells differentiated into the lateral mesoderm into somites and myotomes; and A method for producing a spheroid, further comprising the step of selecting CD10 positive and CD24 negative cells among the cells induced by the above-mentioned somites and myoblasts, thereby obtaining CD10 positive and CD24 negative skeletal muscle progenitor cells.
14. In paragraph 13, A method for producing a spheroid, wherein the above induced pluripotent stem cells (iPSCs) are derived from umbilical cord blood.
15. In paragraph 12, The step of producing induced mesenchymal stem cells that are positive for at least one selected from the group consisting of CD44, CD73, CD90 and CD105 is as follows: Step of inducing induced pluripotent stem cells (iPSCs) into cranial neural crest; A step of selecting CD271 positive cells derived from the two neural crests; and A method for producing a spheroid, further comprising a step of obtaining induced mesenchymal stem cells that are positive for at least one selected from the group consisting of CD44, CD73, CD90, and CD105 by subculturing the CD271-positive cells at least four times.
16. In paragraph 15, A method for producing a spheroid, wherein the above induced pluripotent stem cells (iPSCs) are derived from umbilical cord blood.
17. In paragraph 12, A method for producing a spheroid, wherein the above skeletal muscle progenitor cells and induced mesenchymal stem cells are mixed at a cell number ratio of 1 to 3:
1.
18. In paragraph 12, A method for producing a spheroid, wherein the above intercellular aggregation is achieved through a spheroid-based three-dimensional cell culture technology.
19. In paragraph 18, A method for producing a spheroid, wherein the above spheroid-based 3D cell culture technology is a micro-well based spheroid culture technology, a low-adhesion plate, or a matrix embedding culture method.
20. In paragraph 12, A method for producing a spheroid, wherein the spheroid has a diameter of 50 to 200 μm.
21. In paragraph 12, A method for producing a spheroid, wherein the above spheroid has a lower limb ischemia treatment effect.
22. A method for preventing or treating lower extremity ischemia, comprising administering to a subject a spheroid comprising skeletal muscle progenitor cells that are CD10 positive and CD24 negative and induced mesenchymal stem cells that are positive for at least one of CD44, CD73, CD90, and CD105, and suppressing premature differentiation of the skeletal muscle progenitor cells.
Citation Information
Patent Citations
Treatment of peripheral vascular disease using postpartum-derived cells
CN105106239A
Methods for Generating Skeletal Muscle Progenitor Cells
US20210139854A1
Skeletal muscle augmentation utilizing muscle-derived progenitor compositions, and treatments thereof
US20210145892A1