Antisense treatment for metabolic diseases

Abstract

An isolated or purified antisense oligomer for modifying pre-mRNA splicing or mRNA translation in one or more of the following proteins encoded by the respective gene transcript or part thereof LEPROT; and / or LEPROTL1 which has a modified backbone structure, wherein the antisense oligomer induces downregulation of the production of functional LEPROT and / or LEPROTL1 protein.

Description

Antisense treatment for metabolic diseasesTECHNICAL FIELD

[0001] The present disclosure relates to antisense oligomers for downregulating the expression of functional LEPROT I LEPROTL1 proteins. The disclosure further provides compositions comprising such antisense oligomers and methods of using the same for the treatment of metabolic diseases such as obesity.BACKGROUND ART

[0002] Leptin is an obesity-associated adipokine hormone that is known to regulate energy metabolism and reproduction and to control appetite via the leptin receptor. The leptin receptor (LEPR) is a molecule that receives and transmits signals from leptin. LEPR is involved primarily in the regulation of metabolism (including energy balance and neuroendocrine responses to food intake) but also serves roles in bone metabolism, immunity, and reproductive function. Emerging findings have demonstrated the direct and indirect biological effects of leptin in regulating cancer proliferation, metastasis, angiogenesis, wound healing, osteoarthritis, osteoporosis, bone mass and immune system regulation, and chemoresistance.

[0003] Obesity is known to be a general risk factor for cancers, without a very clear mechanistic explanation. Obesity is a result of a reduction in leptin sensitivity by cells, and this can lead to increased circulating leptin levels, which in turn stimulates some cells to proliferate. This situation is known as a dysregulation of the leptin signalling - some cells are not responding to leptin due to insensitivity, but concurrently some cells get overstimulated.

[0004] While the precise function of leptin and the leptin receptor in malignancy is still not clear, many malignancies have dysregulation of leptin signalling. This leads to augmented growth signals and accelerated metabolism. Osteosarcoma is a bone cancer of adolescence, a time of life when growth hormone levels are high. Once the primary tumour is established, leptin triggers cancer cell proliferation, migration, and invasion. Furthermore, it exerts effects on tumour- associated stromal cells (such as endothelial cells, immune cells, and fibroblasts), to enhance angiogenesis and inflammatory processes that support tumour growth. These effects are transmitted through the action of the leptin receptor (LEPR).

[0005] There is a need to modulate and regulate leptin production and sensitivity and leptin receptor activity; or at least the provision of methods to compliment the previously known methods. The present disclosure seeks to provide an improved or alternative method to modulate and regulate leptin production and sensitivity and leptin receptor activity, through manipulation of the expression of LEPROT / LEPROTL1 .

[0006] The previous discussion of the background art is intended to facilitate an understanding of the present disclosure only. The discussion is not an acknowledgement or admission that any of the material referred to is or was part of the common general knowledge as at the priority date of the application.SUMMARY OF INVENTION

[0007] Broadly, according to one aspect of the disclosure, there is provided an isolated or purified antisense oligomer (ASO) for modifying pre-mRNA splicing or mRNA translation in one or more of the following proteins encoded by the respective gene transcript or part thereof: i. LEPROT; and / or ii. LEPROTL1 to induce downregulation of the production of functional LEPROT and / or LEPROTL1 protein.

[0008] Preferably, there is provided an isolated or purified antisense oligomer for inducing the production of truncated proteins, the production of proteins lacking functional regions or a reduction in the total amount of protein produced.

[0009] Preferably, the antisense oligomer is a phosphorodiamidate morpholino oligomer (PMO) or a 2'-O-methyl phosphorothioate oligomer (2'-OMePS).

[0010] Preferably, the antisense oligomer is selected from the group comprising the sequences set forth in Table 1 and Table 2. Preferably, the antisense oligomer is selected from the list comprising: SEQ ID NO: 1-25. More preferably, the antisense oligomer used in the present disclosure is SEQ ID NO: 2, 3 and / or 20.

[0011] The disclosure extends, according to a still further aspect thereof, to cDNA or cloned copies of the antisense oligomer sequences of the disclosure, as well as to vectors containing the antisense oligomer sequences of the disclosure. The disclosure extends further also to cells containing such sequences and / or vectors.

[0012] There is also provided a method for manipulating splicing factor binding in a target protein gene transcript, the method including the step of: providing one or more of the antisense oligomers as described herein and allowing the oligomer(s) to bind to a target nucleic acid site to induce downregulation of the production of functional LEPROT and / or LEPROTL1 protein.

[0013] There is also provided a pharmaceutical, prophylactic, or therapeutic composition to treat, prevent or ameliorate the effects of dysregulation of leptin in a subject, the composition comprising:one or more antisense oligomers as described herein; and one or more pharmaceutically acceptable carriers and / or diluents to induce downregulation of the production of functional LEPROT and / or LEPROTL1 protein.

[0014] Preferably the metabolic disease is associated with dysregulation of leptin in the subject. Preferably the metabolic disease is chosen from the list comprising: obesity, Body Mass Index Quantitative Trait Locus 11 , hyperlipidaemia, and metabolic disease sequelae such as insulin resistance, type 2 diabetes and cardiovascular disease.

[0015] The subject with metabolic disease may be a mammal, including a human.

[0016] There is also provided a method to treat, prevent or ameliorate the effects of metabolic disease in a subject, comprising the step of: administering to the subject an effective amount of one or more antisense oligomers or pharmaceutical composition comprising one or more antisense oligomers as described herein to induce downregulation of the production of functional LEPROT and / or LEPROTL1 protein.

[0017] There is also provided the use of purified and isolated antisense oligomers as described herein, for the manufacture of a medicament to treat, prevent or ameliorate the effects of metabolic disease in a subject.

[0018] There is also provided a kit to treat, prevent or ameliorate the effects of metabolic disease in a subject, which kit comprises at least an antisense oligomer as described herein and combinations or cocktails thereof, packaged in a suitable container, together with instructions for its use.

[0019] Further aspects of the invention will now be described with reference to the accompanying non-limiting Examples and Drawings.BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Further features of the present invention are more fully described in the following description of several non-limiting embodiments thereof. This description is included solely for the purposes of exemplifying the present invention. It should not be understood as a restriction on the broad summary, disclosure or description of the invention as set out above. The description will be made with reference to the accompanying drawings in which:Figure 1 is an RT-PCT gel showing antisense oligonucleotides (ASOs) to LEPROT exon 2 cause LEPROT exon 2 skipping of. The figure shows the effect of four different PMOs (1 , 2, 3, 4; SEQ ID NOs: 1-4) and their combinations (12, 13, 14, 23, 24, 34) on the skipping of exon 2 of theLEPROT gene showing the PCR product from exon 1 and exon 3 primers. C, NC and ZC are controls without specific antisense; SMN (PCR amplification of SMN1) is a positive control for the RT PCR reaction.Figure 2 shows antisense oligonucleotides for LEPROT exon 2 have a concentration dependent effect on exon 2 skipping and high specificity for exon skipping. C, NC and ZC are controls without specific antisense; SMN (PCR amplification of SMN1) is a positive control for the RT-PCR reaction.Figure 3 is an RT-PCT gel showing antisense oligonucleotides to LEPROTL1 exon 2 with 20Me’ chemistry induce LEPROTL1 exon 2 skipping. The figure shows the effect of four different ASOs (1 , 2, 3, 4; SEQ ID NO: 19-22) on the skipping of exon 2 of the LEPROTL1 gene showing the PCR product from exon 1 and exon 3 primers. C is a negative control; SMN (PCR amplification of SMN1) is a positive control for the RT-PCR reaction.Figure 4 shows PMO-based antisense oligonucleotides for LEPROTL1 exon 2 have a concentration dependent effect on exon 2 skipping and high specificity for exon skipping. C is a control lane, 300, 200, 100, 350, 25 are different concentrations of the ASO in micromoles. SMN is a PCR amplification of the SMN1 gene and is used as a positive control for RT PCR reaction.Figure 5 shows antisense oligonucleotides for LEPROT exon 2 skipping induce a reduction in the expression of LEPROT protein. U2-OS cells were transfected with LEPROT PMO-based ASO 1 and ASO 2 and LEPROT protein expression was analysed using a LEPROT antibody. Both ASO1 and ASO2 completely reduced LEPROT protein expression and eliminated LEPROT immunoreactivity in the cells. Hoechst 33342 and Rhodamine Phalloidin staining are for nuclei and actin to get the background of the image.Figure 6 shows antisense oligonucleotides for LEPROTL1 exon 2 skipping induce a reduction in the expression of LEPROTL1 protein. U2-OS cells were transfected with LEPROTL1 PMO-based ASO and LEPROT protein expression was analysed using a LEPROTL1 antibody. The PMO ASO completely reduced LEPROTL1 protein expression and eliminated LEPROTL1 immunoreactivity in the cells. Hoechst 33342 and Rhodamine Phalloidin staining are for nuclei and actin to get the background of the image.Figure 7 is a graph showing the effect of decreasing LEPROT on the expression of IGF1 R using a shRNA approach. Upregulation of the LEPROT (LEPROT-OE) decreases IGF1 R expression.Figure 8 is the Western plot analysis and confirms that LEPROT shRNA increases the level of IGF1 R protein.DESCRIPTION OF INVENTIONDetailed Description of the Invention

[0021] It is known that leptin and the leptin receptor (LEPR) may be involved in the development of obesity, and the development and growth of cancers such as osteosarcoma. If the production, activity and sensitivity of leptin and the leptin receptor can be modulated, this may be beneficial in the treatment of obesity and cancers.

[0022] Leptin’s signalling is based on ligand-receptor interaction, but it has several levels of cellular regulation. The majority of LEPR proteins are expressed, but are stored intracellularly and are not accessible to the circulating leptin. Significant alterations in the leptin levels have been found for variable disease conditions. High levels of leptin have been established as a biomarker for the breast cancer recurrence and leptin has a role in breast cancer development. Leptin also stimulates migration and invasion of the colorectal and gastric cancer and increased leptin levels reflect the increased carcinogenicity.

[0023] The gene for LEPR contains an additional transcript which is generated from the same locus. This additional transcript encodes a protein called leptin receptor over-lapping transcript (LEPROT), which does not share any sequence similarity with LEPR. Mammals also have a single LEPROT homologue called leptin receptor overlapping transcript-like 1 (LEPROTL1), that has 70% amino acid sequence similarity with LEPROT and whose gene maps on chromosome 8 in humans. LEPROTL1 and LEPROT may be involved in protein trafficking. As LEPR and LEPROT are genetically linked, LEPROT regulates the LEPR protein function. As LEPROTL1 is a homolog of LEPROT, LEPROTL1 also regulates LEPR function by its molecular homology. The LEPROT family (LEPROT and LEPROTL1) encodes small proteins of 131-140 amino acids with four potential transmembrane domains. LEPROT and LEPROTL1 negatively regulate leptin receptor (LEPR) cell surface expression, and thus decreases response to leptin.

[0024] LEPROT (Leptin Receptor Overlapping Transcript) has many aliases, including Endospanin-1 , LEPR, VPS55, OBRGRP, OB-RGRP, OB-R Gene-Related Protein, Endospanin, FLJ90360, LEPR, DnaJ (Hsp40) Homolog Subfamily C Member 6, Leptin Receptor Gene Related Protein, OBR. LEPROT is transcribed from an alternate AUG within the leptin receptor gene (LEPR). The alternate start site is out of frame with the leptin receptor transcript, such that it produces a 131 amino acid protein that shares no primary sequence with LEPR.

[0025] LEPROTL1 (Leptin Receptor Overlapping Transcript Like 1) has following aliases: Endospanin-2, My047, Vps55, Leptin Receptor Overlapping Transcript-Like 1 , HSPC112.

[0026] LEPROT I LEPROTL1 are endogenous antagonists of the leptin receptor and can augment or reduce leptin signalling. LEPROT and LEPROTL1 may work cooperatively, and theirfunctions overlap completely. Increased LEPROT I LEPROTL1 negatively regulates LEPR cell surface expression and reduces the availability of LEPR, thus decreasing a cell’s response to leptin. Importantly, changes in LEPROT and LEPROTL1 expressions modified the glucose homeostasis in experimental animals. LEPROT I LEPROTL1 also negatively regulate growth hormone receptor (GHR) cell surface expression in the liver, and is believed to play a role in liver resistance to growth hormone (GH) during periods of reduced nutrient availability.Involvement in Metabolic Disease

[0027] The most famous effect of the leptin is its role in the regulation of body weight; leptin is a weight reducing hormone and has been shown to reduce obesity. At the same time, most obese individuals also display high levels of circulating leptin but do not respond appropriately. Possible mechanisms underlying this pathological state, termed leptin resistance, are impaired leptin bioavailability and transport across the blood-brain barrier, up-regulation of negative feed-back regulators of LEPR signalling, and defects in LEPR trafficking and signalling. Importantly, at steady state, most of the LEPR (endogenously expressed and transfected) proteins located inside cells, in intracellular membranes, are fully functional in terms of ligand binding, but are not accessible to the leptin. Thus, they are unable to participate in the functional response, as leptin does not penetrate the cell. Increasing the number of LEPRs exposed on the cell surface is an attractive therapeutic strategy to improve the leptin sensitivity of cells in obese patients or to modulate the leptin sensitivity in cancer patients. In general, changing the availability of the LEPR receptors may help to modify any kind of pathology where leptin responsiveness is altered. LEPROT and LEPROTL1 both modulate the availability and cell surface exposure of LEPR proteins.

[0028] LEPROT and LEPROTL1 regulate the availability of the LEPR receptor, and they both are good candidates for leptin sensitivity regulation. LEPROT is a negative regulator of the cell surface expression of LEPR, and LEPROTL1 is a homologue with a similar function.

[0029] Both LEPROT and LEPROTL1 cooperatively modulate calorie restriction-mediated (CR- mediated) liver adaptations by controlling GH sensitivity via GHR modulation. Calorie restriction has been found to induce LEPROT protein expression in skeletal muscle. LEPROT and LEPROTL1 have been identified as potential players in skeletal muscle metabolism, plasticity, and function.

[0030] Without begin held to any theory, it is believed that downregulation of the LEPROT and / or LEPROTL1 could be used to restore leptin sensitivity following dysregulation of the leptin signalling and as such offers an opportunity to treat obesity and normalise lipid metabolism.

[0031] The present disclosure provides the ASOs in Table 1 for regulating the expression of LEPROT and the ASOs in Table 2 for regulating the expression of LEPROTL1.Table 1 : Antisense oligomers of the present disclosure for downregulation of LEPROTTable 2: Antisense oligomers of the present disclosure for downregulation of LEPROTL1

[0032] Down regulation of one or more of the proteins of the present disclosure is preferably achieved by: i. translational blocking; ii. inducing exon-skipping (via the increased the production of truncated, nonsense or prematurely terminated proteins, such as proteins with pre-mature stop codons); and / or iii. down regulation of the expression of the gene through RNase-H dependent cleavage of the target mRNA.

[0033] Any of these techniques leads to a reduction in production of functional target proteins.

[0034] It is preferred that both the LEPROT and LEPROTL1 proteins are downregulated simultaneously. As they are homologues, if only one is downregulated the cell may simply increase production of the other protein. Therefore, simultaneous downregulation of both LEPROT and LEPROTL1 is likely to provide better control of expression of the LEPR protein on cells and therefore better regulation of metabolic disease.

[0035] Down regulation may also be achieved by inducing exon skipping such that the mature protein lacks a transmembrane domain, thus converting the membrane form of the protein to a soluble form of the protein. This strategy may result in the soluble form of the protein forming a decoy receptor.

[0036] The present disclosure may not affect the overall expression of the target protein, for example by blocking or removing all RNA transcripts. Rather, it may seek to increase the production of truncated, nonsense or prematurely terminated proteins. The overall production of target protein RNA molecules may not change significantly (although some change may occur). Preferably, the truncated, nonsense or prematurely terminated proteins are lacking one or more functional domains involved in the activity of the target protein.

[0037] The presence of internally truncated proteins (i.e. proteins lacking the amino acids encoded by one or more exons) is preferable. If the target protein is knocked out, there may be problems with elevation of target protein RNA transcription as the body tries to compensate for the reduction in the total amount of target protein. In contrast, the presence of an internally truncated protein (preferably lacking one or more of the features of the complete target protein), should be sufficient to prevent elevated transcription, but still provide a therapeutic advantage due to a reduction in the total amount of functional target protein.

[0038] The antisense oligomer induced exon skipping of the present disclosure need not completely or even substantially ablate the function of the target protein. Preferably, the exon skipping process results in a reduced or compromised functionality of the target protein.

[0039] Preferably the antisense oligomers target splicing sites in the target protein gene. The target site may also include some flanking sequences around the splicing sites.

[0040] The antisense oligomers may also or alternatively bind to the polyadenylation site. The target site may also be near, but not overlapping the polyadenylation site, i.e. it may instead cover sequences upstream or downstream of the polyadenylation site and in these instances the antisense oligomer may not specifically cover the polyadenylation site. Localisation to near the polyadenylation site may be sufficient to disrupt the ability of cleavage factors to bind the polyadenylation site.

[0041] According to a first aspect of the disclosure, there is provided antisense oligomers capable of binding to a selected target on a target protein gene transcript to modify pre-m RNA splicing in a target protein gene transcript or part thereof. The disclosure therefore provides an antisense oligomer selected from Table 1 and / or 2, capable of binding to a selected target on the LEPROT and / or LEPROTL1 gene transcript to modify pre-mRNA splicing.

[0042] For example, in one aspect of the disclosure, there is provided an antisense oligomer of 10 to 50 nucleotides comprising a targeting sequence complementary to a region near or within the splicing sites and / or the polyadenylation site of the target protein pre-mRNA.

[0043] Alternatively, the present disclosure may induce increased degradation of RNA via recruitment of RNase H, wherein the RNase H preferentially binds and degrades RNA bound in duplex to the DNA of the target protein gene. RNase-H recognises the DNA-RNA heteroduplex generated between mRNA and genomic DNA and cleaves the RNA strand. Antisense oligomers designed to serve as substrates for RNase-H are inhibitors of the intermediary metabolism of pre- and spliced mRNAs.

[0044] The terms "antisense oligomer" and "antisense compound" and "antisense oligonucleotide" “AON” and “ASO” are used interchangeably and refer to a sequence of cyclic subunits, each bearing a base-pairing moiety, linked by inter-subunit linkages that allow the basepairing moieties to hybridize to a target sequence in a nucleic acid (typically an RNA) by Watson- Crick base pairing, to form a nucleic acid:oligomer heteroduplex within the target sequence. The cyclic subunits are based on ribose or another pentose sugar or, in a preferred embodiment, a morpholino group (see description of morpholino oligomers below). The oligomer may have exact or near sequence complementarity to the target sequence; variations in sequence near the termini of an oligomer are generally preferable to variations in the interior. The terms “pre-RNA” and “pre- mRNA” are used interchangeably.

[0045] By “isolated” is meant material that is substantially or essentially free from components that normally accompany it in its native state. For example, an “isolated polynucleotide” or “isolated oligonucleotide,” as used herein, may refer to a polynucleotide that has been purified or removed from the sequences that flank it in a naturally occurring state, e.g., a DNA fragment that is removed from the sequences that are adjacent to the fragment in the genome. The term “isolating” as it relates to cells refers to the purification of cells (e.g., fibroblasts, lymphoblasts) from a source subject (e.g., a subject with metabolic disease). In the context of mRNA or protein, “isolating” refers to the recovery of mRNA or protein from a source, e.g., cells.

[0046] An antisense oligomer can be said to be “directed to” or “targeted against” a target sequence with which it hybridizes. In certain embodiments, the target sequence includes a region including splicing sites and / or the polyadenylation site and surrounding regions. The target sequence is typically a region including an AUG start codon of an mRNA, a Translation Suppressing Oligomer, or splice site of a pre-processed mRNA, a Splice Suppressing Oligomer (SSO). The target sequence for a splice site may include an mRNA sequence having its 5' end 1 to about 25 base pairs downstream of a normal splice acceptor junction in a pre-processed mRNA. A preferred target sequence is any region of a pre-processed mRNA that includes a splice site or is contained entirely within an exon coding sequence or spans a splice acceptor or donor site. An oligomer is more generally said to be "targeted against" a biologically relevant target, such as a protein, virus, or bacteria, when it is targeted against the nucleic acid of the target in the manner described above.

[0047] As used herein, "sufficient length" refers to an antisense oligonucleotide that is complementary to at least 8, more typically 8-30, contiguous nucleobases in a target protein pre- mRNA. In some embodiments, an antisense of sufficient length includes at least s, 9, 10, 11 , 12, 13, 14, or 15 contiguous nucleobases in the target protein pre-mRNA. In other embodiments an antisense of sufficient length includes at least 16, 17, 18, 19, 20, 21 , 22, 23, 24, or 25 contiguous nucleobases in the target protein pre-mRNA. An antisense oligonucleotide of sufficient length has at least a minimal number of nucleotides to be capable of specifically hybridizing to exon 2. Preferably an oligonucleotide of sufficient length is from about 10 to about 50 nucleotides in length, including oligonucleotides of 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39 and 40 or more nucleotides. In one embodiment, an oligonucleotide of sufficient length is from 10 to about 30 nucleotides in length. In another embodiment, an oligonucleotide of sufficient length is from 15 to about 25 nucleotides in length. In yet another embodiment, an oligonucleotide of sufficient length is from 20 to 30, or 20 to 50, nucleotides in length. In yet another embodiment, an oligonucleotide of sufficient length is from 22 to 28, 25 to 28, 24 to 29 or 25 to 30 nucleotides in length.

[0048] In certain embodiments, the antisense oligomer has sufficient sequence complementarity to a target RNA (i.e., the RNA for which splicing factor binding site selection is modulated) to block a region of a target RNA (e.g., pre-mRNA) in an effective manner. In exemplary embodiments, such blocking of target protein pre-mRNA serves to modulate or modify splicing, either by masking a binding site for a native protein that would otherwise modulate splicing and / or by altering the structure of the targeted RNA. In some embodiments, the target RNA is target pre-mRNA (e.g., target protein gene pre-mRNA).

[0049] An antisense oligomer having a sufficient sequence complementarity to a target RNA sequence to modulate splicing factor binding of the target RNA means that the antisense oligomer has a sequence sufficient to trigger the masking of a binding site for a native protein that would otherwise cause truncation of the target protein and / or alters the three-dimensional structure of the targeted RNA.

[0050] Selected antisense oligomers can be made shorter, e.g., about 12 bases, or longer, e.g., about 50 bases, and include a small number of mismatches, as long as the sequence is sufficiently complementary to effect splicing factor binding modulation upon hybridization to the target sequence, and optionally forms with the RNA antisense oligomer heteroduplex having a Tm of 45°C or greater.

[0051] Preferably, the antisense oligomer is selected from the group comprising the sequences set forth in Table 1 and Table 2. Preferably, the antisense oligomer is selected from the list comprising: SEQ ID NO: 1-25. Preferably, the antisense oligomer used in the present disclosure is chosen from the list comprising: SEQ ID NO: 1-25. Preferably the antisense oligomer induced manipulation of protein expression of the present disclosure results in the following:- LEPROT - skipping of one or more exons in the LEPROT gene to increase the production of truncated, nonsense or prematurely terminated proteins;- LEPROTL1 - skipping of one or more exons in the LEPROTL1 gene to increase the production of truncated, nonsense or prematurely terminated proteins.

[0052] In certain embodiments, the degree of complementarity between the target sequence and antisense oligomer is sufficient to form a stable duplex. The region of complementarity of the antisense oligomers with the target RNA sequence may be as short as 8-11 bases, but can be 12-15 bases or more, e.g., 10-50 bases, 10-40 bases, 12-30 bases, 12-25 bases, 15-25 bases, 12-20 bases, or 15-20 bases, including all integers in between these ranges. An antisense oligomer of about 16-17 bases is generally long enough to have a unique complementary sequence. In certain embodiments, a minimum length of complementary bases may be required to achieve the requisite binding Tm, as discussed herein.

[0053] In certain embodiments, oligonucleotides as long as 50 bases may be suitable, where at least a minimum number of bases, e.g., 10-12 bases, are complementary to the target sequence. In general, however, facilitated or active uptake in cells is optimized at oligonucleotide lengths of less than about 30 bases. For phosphorodiamidate morpholino oligomer (PMO) antisense oligomers described further herein, an optimum balance of binding stability and uptake generally occurs at lengths of 18-25 bases. Included are antisense oligomers (e.g., PMOs, PMO-X, PNAs, LNAs, 2’-OMe) that consist of about 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49 or 50 bases.

[0054] In certain embodiments, antisense oligomers may be 100% complementary to the target sequence, or may include mismatches, e.g., to accommodate variants, as long as a heteroduplex formed between the antisense oligomer and target sequence is sufficiently stable to withstand the action of cellular nucleases and other modes of degradation which may occur in vivo. Hence, certain oligonucleotides may have about or at least about 70% sequence complementarity, e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence complementarity, between the oligonucleotide and the target sequence.

[0055] Mismatches, if present, are typically less destabilizing toward the end regions of the hybrid duplex than in the middle. The number of mismatches allowed will depend on the length of the antisense oligomer, the percentage of G:C base pairs in the duplex, and the position of the mismatch(es) in the duplex, according to well understood principles of duplex stability. Although such an antisense oligomer is not necessarily 100% complementary to the target sequence, it is effective to stably and specifically bind to the target sequence, such that splicing factor binding to the target pre-mRNA is modulated.

[0056] The stability of the duplex formed between an antisense oligomer and a target sequence is a function of the binding T m and the susceptibility of the duplex to cellular enzymatic cleavage. The Tm of an oligonucleotide with respect to complementary-sequence RNA may be measured by conventional methods, such as those described by Hames et al., Nucleic Acid Hybridization, IRL Press, 1985, pp. 107-108 or as described in Miyada C. G. and Wallace R. B., 1987, Oligonucleotide Hybridization Techniques, Methods Enzymol. Vol. 154 pp. 94-107. In certain embodiments, antisense oligomers may have a binding Tm, with respect to a complementary- sequence RNA, of greater than body temperature and preferably greater than about 45°C or 50°C. Tm’s in the range 60-80°C or greater are also included.

[0057] Additional examples of variants include antisense oligomers having about or at least about 70% sequence identity or homology, e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%,96%, 97%, 98%, 99% or 100% sequence identity or homology, over the entire length of any of SEQ ID NOs: 1-8.

[0058] More specifically, there is provided an antisense oligomer capable of binding to a selected target site to modulate or modify splicing in a target protein gene transcript or part thereof. The antisense oligomer is preferably selected from those provided in Table 1 and Table 2. Preferably, the antisense oligomer is selected from the list comprising: SEQ ID NO: 1-25. Preferably, the antisense oligomer used in the present disclosure is chosen from the list comprising: SEQ ID NO: 2, 3 and / or 20.

[0059] The antisense oligomer induced splicing factor blockage of the present disclosure need not completely or even substantially reduce the amount of target protein produced.Method of Use

[0060] The disclosure further provides a method for manipulating splicing factor binding in a target protein gene transcript, the method including the step of: a) providing one or more of the antisense oligomers as described herein and allowing the oligomer(s) to bind to a target nucleic acid site to induce downregulation of the production of functional LEPROT and / or LEPROTL1 protein.

[0061] According to yet another aspect of the disclosure, there is provided a splicing factor binding modification target nucleic acid sequence for the target protein gene comprising the DNA equivalents of the nucleic acid sequences selected from the group consisting of SEQ ID NO: 1- 25, and sequences complementary thereto. Preferably the antisense oligomer induced manipulation of protein expression of the present disclosure results in the following:- LEPROT - skipping of one or more exons in the LEPROT gene to increase the production of truncated, nonsense or prematurely terminated proteins;- LEPROTL1 - skipping of one or more exons in the LEPROTL1 gene to increase the production of truncated, nonsense or prematurely terminated proteins.

[0062] Designing antisense oligomers to completely mask the splicing sites and / or the polyadenylation site may not be necessary to generate a change in the proportion of truncated, nonsense or prematurely terminated proteins. Furthermore, the inventors have discovered that size or length of the antisense oligomer itself is not always a primary factor when designing antisense oligomers. With some targets, antisense oligomers as short as 20 bases were able to induce cleavage modification, in certain cases more efficiently than other longer (eg 25 bases) oligomers directed to the same region.

[0063] More specifically, the antisense oligomer may be selected from those set forth in Table 1 and T able 2. The sequences are preferably selected from the group consisting of any one or more of any one or more of SEQ ID NOs: 1-25, and combinations or cocktails thereof. This includes sequences which can hybridise to such sequences under stringent hybridisation conditions, sequences complementary thereto, sequences containing modified bases, modified backbones, and functional truncations or extensions thereof which possess or modulate RNA processing activity in a target protein gene transcript. Preferably, the ASO used in the present disclosure is chosen from the list comprising: SEQ ID NO: 2, 3 and / or 20.

[0064] The antisense oligomer and the DNA, cDNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other. Thus, "specifically hybridisable" and "complementary" are terms which are used to indicate a sufficient degree of complementarity or pairing such that stable and specific binding occurs between the oligomer and the DNA, cDNA or RNA target. It is understood in the art that the sequence of an antisense oligomer need not be 100% complementary to that of its target sequence to be specifically hybridisable. An antisense oligomer is specifically hybridisable when binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA product, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense oligomer to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed.

[0065] Selective hybridisation may be under low, moderate or high stringency conditions, but is preferably under high stringency. Those skilled in the art will recognise that the stringency of hybridisation will be affected by such conditions as salt concentration, temperature, or organic solvents, in addition to the base composition, length of the complementary strands and the number of nucleotide base mismatches between the hybridising nucleic acids. Stringent temperature conditions will generally include temperatures in excess of 30°C, typically in excess of 37°C, and preferably in excess of 45°C, preferably at least 50°C, and typically 60°C-80°C or higher. Stringent salt conditions will ordinarily be less than 1000 mM, typically less than 500 mM, and preferably less than 200 mM. However, the combination of parameters is much more important than the measure of any single parameter. An example of stringent hybridisation conditions is 65°C and 0.1 x SSC (1 x SSC = 0.15 M NaCI, 0.015 M sodium citrate pH 7.0). Thus, the antisense oligomers of the present disclosure may include oligomers that selectively hybridise to the sequences, SEQ ID NOs: 1-25 provided in Table 1 and Table 2.

[0066] At a given ionic strength and pH, the Tm is the temperature at which 50% of a target sequence hybridizes to a complementary polynucleotide. Such hybridization may occur with“near” or “substantial” complementarity of the antisense oligomer to the target sequence, as well as with exact complementarity.

[0067] Typically, selective hybridisation will occur when there is at least about 55% identity over a stretch of at least about 14 nucleotides, preferably at least about 65%, more preferably at least about 75% and most preferably at least about 90%, 95%, 98% or 99% identity with the nucleotides of the antisense oligomer. The length of homology comparison, as described, may be over longer stretches and in certain embodiments will often be over a stretch of at least about nine nucleotides, usually at least about 12 nucleotides, more usually at least about 20, often at least about 21 , 22, 23 or 24 nucleotides, at least about 25, 26, 27 or 28 nucleotides, at least about 29, 30, 31 or 32 nucleotides, at least about 36 or more nucleotides.

[0068] Thus, the antisense oligomer sequences of the disclosure preferably have at least 75%, more preferably at least 85%, more preferably at least 86, 87, 88, 89 or 90% homology to the sequences shown in the sequence listings herein. More preferably there is at least 91 , 92, 93 94, or 95%, more preferably at least 96, 97, 98% or 99%, homology. Generally, the shorter the length of the antisense oligomer, the greater the homology required to obtain selective hybridisation. Consequently, where an antisense oligomer of the disclosure consists of less than about 30 nucleotides, it is preferred that the percentage identity is greater than 75%, preferably greater than 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95%, 96, 97, 98% or 99% compared with the antisense oligomers set out in the sequence listings herein. Nucleotide homology comparisons may be conducted by sequence comparison programs such as the GCG Wisconsin Bestfit program or GAP (Deveraux et al., 1984, Nucleic Acids Research 12, 387-395). In this way sequences of a similar or substantially different length to those cited herein could be compared by insertion of gaps into the alignment, such gaps being determined, for example, by the comparison algorithm used by GAP.

[0069] The antisense oligomer of the present disclosure may have regions of reduced homology, and regions of exact homology with the target sequence. It is not necessary for an oligomer to have exact homology for its entire length. For example, the oligomer may have continuous stretches of at least 4 or 5 bases that are identical to the target sequence, preferably continuous stretches of at least 6 or 7 bases that are identical to the target sequence, more preferably continuous stretches of at least 8 or 9 bases that are identical to the target sequence. The oligomer may have stretches of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25 or 26 bases that are identical to the target sequence. The remaining stretches of oligomer sequence may be intermittently identical with the target sequence; for example, the remaining sequence may have an identical base, followed by a non-identical base, followed by an identical base. Alternatively (or as well) the oligomer sequence may have several stretches of identical sequence (for example 3, 4, 5 or 6 bases)interspersed with stretches of less than perfect homology. Such sequence mismatches will preferably have no or very little loss of cleavage modifying activity.

[0070] The term “modulate” or “modulates” includes to “increase” or “decrease” one or more quantifiable parameters, optionally by a defined and / or statistically significant amount. The terms “increase” or “increasing,” “enhance” or “enhancing,” or “stimulate” or “stimulating” refer generally to the ability of one or antisense oligomers or compositions to produce or cause a greater physiological response (i.e., downstream effects) in a cell or a subject relative to the response caused by either no antisense oligomer or a control compound.

[0071] By "enhance" or "enhancing," or "increase" or "increasing," or "stimulate" or "stimulating," refers generally to the ability of one or antisense compounds or compositions to produce or cause a greater physiological response (i.e., downstream effects) in a cell or a subject, as compared to the response caused by either no antisense compound or a control compound. A measurable physiological response may include increased expression of a functional form of a target protein, among other responses apparent from the understanding in the art and the description herein. An "increased" or "enhanced" amount is typically a "statistically significant" amount, and may include an increase that is 1.1 , 1.2, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50 or more times (e.g., 500, 1000 times) (including all integers and decimal points in between and above 1 , e.g., 1.5, 1.6, 1.7, 1 .8, etc.) the amount produced by no antisense compound (the absence of an agent) or a control compound.

[0072] The terms “decreasing” or “decrease” refer generally to the ability of one or antisense oligomers or compositions to produce or cause a reduced physiological response (i.e., downstream effects) in a cell or a subject relative to the response caused by either no antisense oligomer or a control compound. The term "reduce" or "inhibit" may relate generally to the ability of one or more antisense compounds of the disclosure to "decrease" a relevant physiological or cellular response, such as a symptom of a disease or condition described herein, as measured according to routine techniques in the diagnostic art. Relevant physiological or cellular responses (in vivo or in vitro) will be apparent to persons skilled in the art, and may include reductions in the symptoms or pathology of metabolic disease. A "decrease" in a response may be statistically significant as compared to the response produced by no antisense compound or a control composition, and may include a 1 %, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% decrease, including all integers in between.

[0073] Relevant physiological or cellular responses (in vivo or in vitro) will be apparent to persons skilled in the art, and may include decreases in the amount of target protein. An “increased” or “enhanced” amount is typically a statistically significant amount, and may include an increase that is 1.1 , 1.2, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50 or more times (e.g., 500, 1000 times)(including all integers and decimal points in between and above 1 , e.g., 1.5, 1.6, 1.7. 1.8) the amount produced by no antisense oligomer (the absence of an agent) or a control compound. The term “reduce” or “inhibit” may relate generally to the ability of one or more antisense oligomers or compositions to “decrease” a relevant physiological or cellular response, such as a symptom of a disease or condition described herein, as measured according to routine techniques in the diagnostic art. Relevant physiological or cellular responses in vivo or in vitro') will be apparent to persons skilled in the art, and may include reductions in the symptoms or pathology of metabolic disease. A “decrease” in a response may be statistically significant as compared to the response produced by no antisense oligomer or a control composition, and may include a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% decrease, including all integers in between.

[0074] The length of an antisense oligomer may vary, as long as it is capable of binding selectively to the intended location within the pre-mRNA molecule. The length of such sequences can be determined in accordance with selection procedures described herein. Generally, the antisense oligomer will be from about 10 nucleotides in length, up to about 50 nucleotides in length. It will be appreciated, however, that any length of nucleotides within this range may be used in the method. Preferably, the length of the antisense oligomer is between 10 and 40, 10 and 35, 15 to 30 nucleotides in length or 20 to 30 nucleotides in length, most preferably about 25 to 30 nucleotides in length. For example, the oligomer may be 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length.

[0075] As used herein, an “antisense oligomer”, “AON” or “ASO” refers to a linear sequence of nucleotides, or nucleotide analogues, that allows the nucleobase to hybridize to a target sequence in an RNA by Watson-Crick base pairing, to form an oligonucleotide: RNA heteroduplex within the target sequence. The cyclic subunits may be based on ribose or another pentose sugar or, in certain embodiments, a morpholino group (see description of morpholino oligonucleotides below). Also contemplated are phosphoramidate or phosphorodiamidate morpholino oligomer (PMO); PMO-X; PPMO; thiophosphoramidate morpholinos (TMO); peptide nucleic acid (PNA); a locked nucleic acid (LNA) and derivatives including alpha-L-LNA, 2’-amino LNA, 4’-methyl LNA and 4’- O-methyl LNA; ethylene bridged nucleic acids (ENA) and their derivatives; phosphorothioate oligomer; tricyclo-DNA oligomer (tcDNA); tricyclophosphorothioate oligomer; 2’O-Methyl-modified oligomer (2’-OMe); 2’-O-methoxy ethyl (2’-MOE); 2'-O-methyl phosphorothioate oligomer (2 - OMePS); 2’-fluoro, 2’-fluroarabino (FANA); unlocked nucleic acid (UNA); hexitol nucleic acid (HNA); cyclohexenyl nucleic acid (CeNA); 2’-amino (2’-NH2); 2’-O-ethyleneamine or any combination of the foregoing as mixmers or as gapmers, among other antisense agents known in the art.

[0076] In some embodiments, the antisense oligonucleotides have the chemical composition of a naturally occurring nucleic acid molecule, i.e., the antisense oligonucleotides do not include a modified or substituted base, sugar, or inter-subunit linkage.

[0077] In a preferred embodiment, the antisense oligonucleotides of the present disclosure are non-naturally occurring nucleic acid molecules, or “oligonucleotide analogues”. For example, non- naturally occurring nucleic acids can include one or more non-natural base, sugar, and / or intersubunit linkage, e.g., a base, sugar, and / or linkage that has been modified or substituted with respect to that found in a naturally occurring nucleic acid molecule. Exemplary modifications are described below. In some embodiments, non-naturally occurring nucleic acids include more than one type of modification, e.g. sugar and base modifications, sugar and linkage modifications, base and linkage modifications, or base, sugar, and linkage modifications. For example, in some embodiments, the antisense oligonucleotides contain a non-natural (e.g. modified or substituted) base. In some embodiments, the antisense oligonucleotides contain a non-natural (e.g. modified or substituted) sugar. In some embodiments, the antisense oligonucleotides contain a non-natural (e.g. modified or substituted) inter-subunit linkage. In some embodiments, the antisense oligonucleotides contain more than one type of modification or substitution, e.g. a non-natural base and / or a non- natural sugar, and / or a non-natural inter-subunit linkage.

[0078] Thus, included are non-naturally-occurring antisense oligomers having (i) a modified backbone structure, e.g., a backbone other than the standard phosphodiester linkage found in naturally-occurring oligo- and polynucleotides, and / or (ii) modified sugar moieties, e.g., morpholino moieties rather than ribose or deoxyribose moieties. Oligonucleotide analogues support bases capable of hydrogen bonding by Watson-Crick base pairing to standard polynucleotide bases, where the analogue backbone presents the bases in a manner to permit such hydrogen bonding in a sequence-specific fashion between the oligonucleotide analogue molecule and bases in a standard polynucleotide (e.g., single-stranded RNA or single-stranded DNA). Preferred analogues are those having a substantially uncharged, phosphorus containing backbone.

[0079] One method for producing antisense oligomers is the methylation of the 2' hydroxyribose position and the incorporation of a phosphorothioate backbone produces molecules that superficially resemble RNA but that are much more resistant to nuclease degradation, although persons skilled in the art of the disclosure will be aware of other forms of suitable backbones that may be useable in the objectives of the disclosure.

[0080] To avoid degradation of pre-RNA during duplex formation with the antisense oligomers, the antisense oligomers used in the method may be adapted to minimise or prevent cleavage by endogenous RNase H. Antisense molecules that do not activate RNase H can be made in accordance with known techniques (see, e.g., U.S. Pat. No. 5,149,797). Such antisensemolecules, which may be deoxyribonucleotide or ribonucleotide sequences, simply contain any structural modification which sterically hinders or prevents binding of RNase H to a duplex molecule containing the oligonucleotide as one member thereof, which structural modification does not substantially hinder or disrupt duplex formation. Because the portions of the oligonucleotide involved in duplex formation are substantially different from those portions involved in RNase H binding thereto, numerous antisense molecules that do not activate RNase H are available. This property is highly preferred, as the treatment of the RNA with the unmethylated oligomers, either intracellular or in crude extracts that contain RNase H, leads to degradation of the pre-mRNA:antisense oligomer duplexes. Any form of modified antisense oligomers that is capable of by-passing or not inducing such degradation may be used in the present method. The nuclease resistance may be achieved by modifying the antisense oligomers of the disclosure so that it comprises partially unsaturated aliphatic hydrocarbon chain and one or more polar or charged groups including carboxylic acid groups, ester groups, and alcohol groups.

[0081] An example of antisense oligomers which when duplexed with RNA are not cleaved by cellular RNase H is 2'-O-methyl derivatives. Such 2'-O-methyl-oligoribonucleotides are stable in a cellular environment and in animal tissues, and their duplexes with RNA have higher T m values than their ribo- or deoxyribo- counterparts. Alternatively, the nuclease resistant antisense oligomers of the disclosure may have at least one of the last 3'-terminus nucleotides fluoridated. Still alternatively, the nuclease resistant antisense oligomers of the disclosure have phosphorothioate bonds linking between at least two of the last 3-terminus nucleotide bases, preferably having phosphorothioate bonds linking between the last four 3'-terminal nucleotide bases.

[0082] Modified or modulated RNA splicing may also be achieved with alternative oligonucleotide chemistry (see, e.g., U.S. Pat. No. 5,149,797). For example, the antisense oligomer may be chosen from the list comprising: phosphoramidate or phosphorodiamidate morpholino oligomer (PMO); PMO-X; PPMO; thiophosphoramidate morpholinos (TMO); peptide nucleic acid (PNA); a locked nucleic acid (LNA) and derivatives including alpha-L-LNA, 2’-amino LNA, 4’-methyl LNA and 4’-O-methyl LNA; ethylene bridged nucleic acids (ENA) and their derivatives; phosphorothioate oligomer; tricyclo-DNA oligomer (tcDNA); tricyclophosphorothioate oligomer; 2’0-Methyl-modified oligomer (2’-OMe); 2’-O-methoxy ethyl (2’-MOE); 2’-fluoro, 2’-fluroarabino (FANA); unlocked nucleic acid (UNA); hexitol nucleic acid (HNA); cyclohexenyl nucleic acid (CeNA); 2’-amino (2’-NH2); 2’-O-ethyleneamine or any combination of the foregoing as mixmers or as gapmers.

[0083] To further improve the delivery efficacy, the abovementioned modified nucleotides are often conjugated with fatty acids / lipids / cholesterol, amino acids, carbohydrates / polysaccharides,nanoparticles etc. to the sugar or nucleobase moieties. These conjugated nucleotide derivatives can also be used to construct antisense oligomers to modify cleavage factor binding. Antisense oligomer-induced splicing factor binding modification of the target protein gene transcripts have generally used either oligoribonucleotides, PNAs, 2’OMe or MOE modified bases on a phosphorothioate backbone. Although 2’OMe ASOs are used for oligo design, due to their efficient uptake in vitro when delivered as cationic lipoplexes, these compounds are susceptible to nuclease degradation and are not considered ideal for in vivo or clinical applications. When alternative chemistries are used to generate the antisense oligomers of the present disclosure, the uracil (II) of the sequences provided herein may be replaced by a thymine (T).

[0084] For example, such antisense molecules may be oligonucleotides wherein at least one, or all, of the inter-nucleotide bridging phosphate residues are modified phosphates, such as methyl phosphonates, methyl phosphorothioates, phosphoromorpholidates, phosphoropiperazidates and phosphor amidates. For example, every other one of the internucleotide bridging phosphate residues may be modified as described. In another non-limiting example, such antisense molecules are molecules wherein at least one, or all, of the nucleotides contain a 2' lower alkyl moiety (e.g., Ci-C4, linear or branched, saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl, propyl, 1 -propenyl, 2-propenyl, and isopropyl). For example, every other one of the nucleotides may be modified as described.

[0085] Specific examples of antisense oligonucleotides useful in this disclosure include oligonucleotides containing modified backbones or non-natural inter-subunit linkages.

[0086] Oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. Modified oligonucleotides that do not have a phosphorus atom in their inter-nucleoside backbone can also be considered to be oligonucleosides.

[0087] In other antisense molecules, both the sugar and the inter-nucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleo-bases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.

[0088] Modified oligonucleotides may also contain one or more substituted sugar moieties. Oligonucleotides may also include nucleobase (often referred to in the art simply as "base") modifications or substitutions. Oligonucleotides containing a modified or substituted base includeoligonucleotides in which one or more purine or pyrimidine bases most commonly found in nucleic acids are replaced with less common or non-natural bases.

[0089] Purine bases comprise a pyrimidine ring fused to an imidazole ring; adenine and guanine are the two purine nucleobases most commonly found in nucleic acids. These may be substituted with other naturally-occurring purines, including but not limited to Ns-methyladenine, N2- methylguanine, hypoxanthine, and 7-methylguanine.

[0090] Pyrimidine bases comprise a six-membered pyrimidine ring; cytosine, uracil, and thymine are the pyrimidine bases most commonly found in nucleic acids. These may be substituted with other naturally-occurring pyrimidines, including but not limited to 5-methylcytosine, 5- hydroxymethylcytosine, pseudouracil, and 4-thiouracil. In one embodiment, the oligonucleotides described herein contain thymine bases in place of uracil.

[0091] Other modified or substituted bases include, but are not limited to, 2,6-diaminopurine, orotic acid, agmatidine, lysidine, 2-thiopyrimidine (e.g. 2-thiouracil, 2-thiothymine), G-clamp and its derivatives, 5-substituted pyrimidine (e.g. 5-halouracil, 5-propynyluracil, 5-propynylcytosine, 5- aminomethyluracil, 5-hydroxymethyluracil, 5-aminomethylcytosine, 5-hydroxymethylcytosine, Super T), 7-deazaguanine, 7-deazaadenine, 7-aza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8- aza- 7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, Super G, Super A, and N4- ethylcytosine, or derivatives thereof; N2-cyclopentylguanine (cPent-G), N2-cyclopentyl-2- aminopurine (cPent-AP), and N2-propyl-2-aminopurine (Pr-AP), pseudouracil or derivatives thereof; and degenerate or universal bases, like 2,6-difluorotoluene or absent bases like abasic sites (e.g. 1 -deoxyribose, 1 ,2- dideoxyribose, 1-deoxy-2-O-methylribose; or pyrrolidine derivatives in which the ring oxygen has been replaced with nitrogen (azaribose)). Examples of derivatives of Super A, Super G and Super T can be found in U.S. Patent 6,683, 173 (Epoch Biosciences). cPent-G, cPent-AP and Pr-AP were shown to reduce immunostimulatory effects when incorporated in siRNA (Peacock H. et al. J. Am. Chem. Soc. 2011 , 133, 9200). Pseudouracil is a naturally occurring isomerized version of uracil, with a C-glycoside rather than the regular N- glycoside as in uridine. Pseudouridine -containing synthetic mRNA may have an improved safety profile compared to uridine-containing mPvNA (see WO 2009127230).

[0092] Certain modified or substituted nucleo-bases are particularly useful for increasing the binding affinity of the antisense oligonucleotides of the disclosure. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2- aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C and are presently preferred base substitutions, even more particularly when combined with 2'-0-methoxyethyl sugar modifications.

[0093] In some embodiments, modified or substituted nucleo-bases are useful for facilitating purification of antisense oligonucleotides. For example, in certain embodiments, antisense oligonucleotides may contain three or more (e.g., 3, 4, 5, 6 or more) consecutive guanine bases. In certain antisense oligonucleotides, a string of three or more consecutive guanine bases can result in aggregation of the oligonucleotides, complicating purification. In such antisense oligonucleotides, one or more of the consecutive guanines can be substituted with inosine. The substitution of inosine for one or more guanines in a string of three or more consecutive guanine bases can reduce aggregation of the antisense oligonucleotide, thereby facilitating purification.

[0094] In one embodiment, another modification of the antisense oligonucleotides involves chemically linking to the oligonucleotide one or more moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyls' tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1 ,2-di-O-hexadecyl-rac- glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety.

[0095] In another non-limiting example, such antisense oligomers are molecules wherein at least one, or all, of the nucleotides contain a 2’ lower alkyl moiety (such as, for example, C1-C4, linear or branched, saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl, propyl, 1 -propenyl, 2- propenyl, and isopropyl). For example, every other one of the nucleotides may be modified as described.

[0096] While the antisense oligomers described above are a preferred form of the antisense oligomers of the present disclosure, the present disclosure includes other oligomeric antisense molecules, including but not limited to oligomer mimetics such as are described below.

[0097] Another preferred chemistry is the phosphorodiamidate morpholino oligomer (PMO) oligomeric compounds, which are not degraded by any known nuclease or protease. These compounds are uncharged, do not activate RNase H activity when bound to a RNA strand and have been shown to exert sustained cleavage factor binding modulation after in vivo administration (Summerton and Weller, Antisense Nucleic Acid Drug Development, 7, 187-197).

[0098] Modified oligomers may also contain one or more substituted sugar moieties. Oligomers may also include nucleobase (often referred to in the art simply as "base") modifications or substitutions. Certain nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the disclosure. These include 5-substituted pyrimidines, 6- azapyrimidines, and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5- propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown toincrease nucleic acid duplex stability by 0.6-1.2°C, even more particularly when combined with 2'-O-methoxyethyl sugar modifications. In one embodiment, at least one pyrimidine base of the oligonucleotide comprises a 5-substituted pyrimidine base, wherein the pyrimidine base is selected from the group consisting of cytosine, thymine and uracil. In one embodiment, the 5- substituted pyrimidine base is 5-methylcytosine. In another embodiment, at least one purine base of the oligonucleotide comprises an N-2, N-6 substituted purine base. In one embodiment, the N- 2, N-6 substituted purine base is 2, 6-diaminopurine.

[0099] In one embodiment, the antisense oligonucleotide includes one or more 5-methylcytosine substitutions alone or in combination with another modification, such as 2'-O-methoxyethyl sugar modifications. In yet another embodiment, the antisense oligonucleotide includes one or more 2, 6-diaminopurine substitutions alone or in combination with another modification.

[0100] In some embodiments, the antisense oligonucleotide is chemically linked to one or more moieties, such as a polyethylene glycol moiety, or conjugates, such as an arginine-rich cell penetrating peptide that enhance the activity, cellular distribution, or cellular uptake of the antisense oligonucleotide. In one exemplary embodiment, the arginine-rich polypeptide is covalently coupled at its N-terminal or C-terminal residue to the 3' or 5' end of the antisense compound. Also in an exemplary embodiment, the antisense compound is composed of morpholino subunits and phosphorus-containing inter-subunit linkages joining a morpholino nitrogen of one subunit to a 5' exocyclic carbon of an adjacent subunit.

[0101] In another aspect, the disclosure provides expression vectors that incorporate the antisense oligonucleotides described above, e.g., the antisense oligonucleotides of SEQ ID NOs: 1-126. In some embodiments, the expression vector is a modified retrovirus or non-retroviral vector, such as an adeno-associated viral vector.

[0102] Another modification of the oligomers of the disclosure involves chemically linking to the oligomer one or more moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the oligomer. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-S- tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl- rac- glycerol or triethylammonium 1 ,2-di-O-hexadecyl-rac-glycero-3-H- phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, myristyl, or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety.

[0103] Cell penetrating peptides have been added to phosphorodiamidate morpholino oligomers to enhance cellular uptake and nuclear localization. Different peptide tags have been shown to influence efficiency of uptake and target tissue specificity, as shown in Jearawiriyapaisarn et al. (2008), Mol. Ther. 169, 1624-1629. The terms "cell penetrating peptide"and "CPP" are used interchangeably and refer to cationic cell penetrating peptides, also called transport peptides, carrier peptides, or peptide transduction domains. The peptides, as shown herein, have the capability of inducing cell penetration within 100% of cells of a given cell culture population and allow macromolecular translocation within multiple tissues in vivo upon systemic administration.

[0104] It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an oligomer. The present disclosure also includes antisense oligomers that are chimeric compounds. "Chimeric" antisense oligomers or "chimeras," in the context of this disclosure, are antisense oligomers, particularly oligomers, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligomer compound. These oligomers typically contain at least one region wherein the oligomer is modified so as to confer upon the oligomer or antisense oligomer increased resistance to nuclease degradation, increased cellular uptake, and an additional region for increased binding affinity for the target nucleic acid.

[0105] The activity of antisense oligomers and variants thereof can be assayed according to routine techniques in the art. For example, isoform forms and expression levels of surveyed RNAs and proteins may be assessed by any of a wide variety of well-known methods for detecting isoforms and / or expression of a transcribed nucleic acid or protein. Non-limiting examples of such methods include RT-PCR of isoforms of RNA followed by size separation of PCR products, nucleic acid hybridization methods e.g., Northern blots and / or use of nucleic acid arrays; fluorescent in situ hybridization to detect RNA transcripts inside cells; nucleic acid amplification methods; immunological methods for detection of proteins; protein purification methods; and protein function or activity assays.

[0106] RNA expression levels can be assessed by preparing RNA / cDNA (i.e., a transcribed polynucleotide) from a cell, tissue or organism, and by hybridizing the RNA / cDNA with a reference polynucleotide, which is a complement of the assayed nucleic acid, or a fragment thereof. cDNA can, optionally, be amplified using any of a variety of polymerase chain reaction or in vitro transcription methods prior to hybridization with the complementary polynucleotide; preferably, it is not amplified. Expression of one or more transcripts can also be detected using quantitative PCR to assess the level of expression of the transcripTI(s).

[0107] The present disclosure provides antisense oligomer modified splicing factor binding of the target protein gene transcript, clinically relevant oligomer chemistries and delivery systems to direct reduction of full-length target protein gene transcript to therapeutic levels. Substantial changes in the amount of target protein RNA are achieved by:1) oligomer refinement in vitro using cell lines, through experimental assessment of (i) modification of splicing factor binding target motifs, (ii) antisense oligomer length and development of oligomer cocktails, (iii) choice of chemistry, and (iv) the addition of cellpenetrating peptides (CPP) to enhance oligomer delivery; and2) detailed evaluation of a novel approach to decrease target protein gene transcripts.

[0108] As such, it is demonstrated herein that processing of target protein RNA can be manipulated with specific antisense oligomers. In this way functionally significant decreases in the amount of the target protein can be obtained, thereby reducing the pathology of metabolic disease.

[0109] The antisense oligomers used in accordance with this disclosure may be conveniently made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). One method for synthesising oligomers on a modified solid support is described in U.S. Pat. No. 4,458,066.

[0110] Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligomers such as the phosphorothioates and alkylated derivatives. In one such automated embodiment, diethyl- phosphoramidites are used as starting materials and may be synthesized as described by Beaucage, et al., (1981) Tetrahedron Letters, 22:1859-1862.

[0111] The antisense oligomers of the disclosure are synthesised in vitro and do not include antisense compositions of biological origin, or genetic vector constructs designed to direct the in vivo synthesis of antisense oligomers. The molecules of the disclosure may also be mixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and / or absorption.

[0112] Also included are vector delivery systems that are capable of expressing the oligomeric, targeting sequences of the present disclosure, such as vectors that express a polynucleotide sequence comprising any one or more of SEQ ID NOs: 1-25, as described herein. By "vector" or "nucleic acid construct" is meant a polynucleotide molecule, preferably a DNA molecule derived, for example, from a plasmid, bacteriophage, yeast or virus, into which a polynucleotide can be inserted or cloned. A vector preferably contains one or more unique restriction sites and can be capable of autonomous replication in a defined host cell including a target cell or tissue or a progenitor cell or tissue thereof, or be integrable with the genome of the defined host such that the cloned sequence is reproducible. Accordingly, the vector can be an autonomously replicating vector, i.e., a vector that exists as an extra-chromosomal entity, thereplication of which is independent of chromosomal replication, e.g., a linear or closed circular plasmid, an extra-chromosomal element, a mini-chromosome, or an artificial chromosome. The vector can contain any means for assuring self-replication. Alternatively, the vector can be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated.Method of Treatment

[0113] The antisense oligomers of the present disclosure also can be used as a prophylactic or therapeutic, which may be utilised for the purpose of treatment of a disease. Accordingly, in one embodiment the present disclosure provides antisense oligomers that bind to a selected target in the target protein RNA to modify splicing of the RNA as described herein, in a therapeutically effective amount, admixed with a pharmaceutically acceptable carrier, diluent, or excipient.

[0114] An "effective amount" or "therapeutically effective amount" refers to an amount of therapeutic compound, such as an antisense oligomer, administered to a mammalian subject, either as a single dose or as part of a series of doses, which is effective to produce a desired therapeutic effect.

[0115] The disclosure therefore provides a pharmaceutical, prophylactic, or therapeutic composition to treat, prevent or ameliorate the effects of metabolic disease in a subject, the composition comprising: a) one or more antisense oligomers as described herein, and b) one or more pharmaceutically acceptable carriers and / or diluents to induce downregulation of the production of functional LEPROT and / or LEPROTL1 protein.

[0116] Preferably, the antisense oligomer used in the present disclosure is chosen from the list comprising:• SEQ ID NO: 1-25; or• SEQ ID NO: 2, 3 and / or 20.

[0117] Preferably the antisense oligomer induced manipulation of protein expression of the present disclosure results in the following:LEPROT - skipping of one or more exons in the LEPROT gene to increase the production of truncated, nonsense or prematurely terminated proteins;LEPR0TL1 - skipping of one or more exons in the LEPROTL1 gene to increase the production of truncated, nonsense or prematurely terminated proteins.

[0118] The composition may comprise about 1 nM to 1000 nM of each of the desired antisense oligomer(s) of the disclosure. Preferably, the composition may comprise about 1 nM to 500 nM, 10 nM to 500 nM, 50 nM to 750 nM, 10 nM to 500 nM, 1 nM to 100 nM, 1 nM to 50 nM, 1 nM to 40 nM, 1 nM to 30 nM, 1 nM to 20 nM, most preferably between 1 nM and 10 nM of each of the antisense oligomer(s) of the disclosure.

[0119] The composition may comprise about 1 nm, 2nm, 3nm, 4nm, 5nm, 6nm, 7nm, 8nm, 9nm, 10nm, 20nm, 50nm, 75nm, 100nm, 150nm, 200nm, 250nm, 300nm, 350nm, 400nm, 450nm, 500nm, 550nm, 600nm, 650nm, 700nm, 750nm, 800nm, 850nm, 900nm, 950nm or 1000nm of each of the desired antisense oligomer(s) of the disclosure.

[0120] The present disclosure further provides one or more antisense oligomers adapted to aid in the prophylactic or therapeutic treatment, prevention or amelioration of symptoms of metabolic disease in a form suitable for delivery to a subject.

[0121] The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similarly untoward reaction, such as gastric upset and the like, when administered to a subject. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Suitable pharmaceutical carriers are described in Martin, Remington's Pharmaceutical Sciences, 18th Ed., Mack Publishing Co., Easton, PA, (1990).Pharmaceutical Compositions

[0122] In a form of the disclosure there are provided pharmaceutical compositions comprising therapeutically effective amounts of one or more antisense oligomers of the disclosure together with pharmaceutically acceptable diluents, preservatives, solubilizers, emulsifiers, adjuvants, and / or carriers. Such compositions include diluents of various buffer content (e.g. Tris- HCI, acetate, phosphate), pH and ionic strength and additives such as detergents and solubilizing agents (e.g. Tween 80, Polysorbate 80), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g. Thimersol, benzyl alcohol) and bulking substances (e.g., lactose, mannitol). The material may be incorporated into particulate preparations of polymeric compounds such as polylactic acid, polyglycolic acid, etc. or into liposomes. Hylauronic acid may also be used. Such compositions may influence the physical state, stability, rate of in vivo release, and rate of in vivoclearance of the present proteins and derivatives. See, for example, Martin, Remington's Pharmaceutical Sciences, 18th Ed. (1990, Mack Publishing Co., Easton, PA 18042) pages 1435- 1712 that are herein incorporated by reference. The compositions may be prepared in liquid form, or may be in dried powder, such as a lyophilised form.

[0123] It will be appreciated that pharmaceutical compositions provided according to the present disclosure may be administered by any means known in the art. Preferably, the pharmaceutical compositions for administration are administered by injection, orally, topically or by the pulmonary or nasal route. The antisense oligomers may be delivered by intravenous, intraarterial, intraperitoneal, intramuscular or subcutaneous routes of administration. The appropriate route may be determined by one of skill in the art, as appropriate to the condition of the subject under treatment. Vascular or extravascular circulation, the blood or lymph system, and the cerebrospinal fluid are some non-limiting sites where the antisense oligomer may be introduced. Direct CNS delivery may be employed, for instance, intracerebral ventricular or intrathecal administration may be used as routes of administration.

[0124] As the present ASOs are used for the treatment of metabolic disease, an injectable, nasal delivery or oral delivery route is preferred.

[0125] Nasal delivery may be a preferred choice as actives delivered via this route move quickly to the blood-brain barrier (BBB) and are preferably able to cross through. Furthermore, nasally delivered actives are not subject to first pass metabolism. It would be advantageous for the antisense oligomers of the present disclosure to quickly reach the brain in therapeutically effective concentrations. Formulations for nasal administration include those in which the oligomers of the disclosure are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Lipids and liposomes include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DM PC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DM PG) and cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA). For nasal or other administration, oligomers of the disclosure may be encapsulated within liposomes or may form complexes thereto, to cationic liposomes. Alternatively, oligomers may be complexed to lipids, to cationic lipids. Fatty acids and esters, pharmaceutically acceptable salts thereof, and their uses are further described in U.S. Pat. No. 6,287,860 and / or U.S. patent application Ser. No. 09 / 315,298 filed on May 20, 1999.

[0126] The antisense oligomers described herein may also be delivered via an implantable device. Design of such a device is an art-recognized process, with, e.g., synthetic implant design described in, e.g., U.S. Pat. No. 6,969,400.

[0127] For ease of delivery and subject compliance, orally delivered compositions may be preferred. Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavouring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. Oral formulations are those in which oligomers of the disclosure are administered in conjunction with one or more penetration enhancers surfactants and chelators. Surfactants include fatty acids and / or esters or salts thereof, bile acids and / or salts thereof. Bile acids / salts and fatty acids and their uses are further described in U.S. Pat. No. 6,287,860. In some embodiments, the present disclosure provides combinations of penetration enhancers, for example, fatty acids / salts in combination with bile acids / salts. An exemplary combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. Oligomers of the disclosure may be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. Oligomer complexing agents and their uses are further described in U.S. Pat. No. 6,287,860. Oral formulations for oligomers and their preparation are described in detail in US 6,887,906 and / or US 20030027780.

[0128] Delivery by injection may be a preferred choice as actives delivered via this route do not undergo first pass metabolism and can move to the BBB. It would be advantageous for the antisense oligomers of the present disclosure to quickly reach the brain in therapeutically effective concentrations.

[0129] Compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.

[0130] The delivery of a therapeutically useful amount of antisense oligomers may be achieved by methods previously published. For example, intracellular delivery of the antisense oligomer may be via a composition comprising an admixture of the antisense oligomer and an effective amount of a block copolymer. An example of this method is described in US patent application US20040248833. Other methods of delivery of antisense oligomers to the nucleus are described in Mann CJ et al. (2001) Proc, Natl. Acad. Science, 98(1) 42-47, and in Gebski et al. (2003) Human Molecular Genetics, 12(15): 1801-1811. A method for introducing a nucleic acid molecule into a cell by way of an expression vector either as naked DNA or complexed to lipid carriers, is described in US 6,806,084.

[0131] It may be desirable to deliver the antisense oligomer in a colloidal dispersion system. Colloidal dispersion systems include macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixedmicelles, and liposomes or liposome formulations. These colloidal dispersion systems can be used in the manufacture of therapeutic pharmaceutical compositions.

[0132] Liposomes are artificial membrane vesicles, which are useful as delivery vehicles in vitro and in vivo. These formulations may have net cationic, anionic, or neutral charge characteristics and have useful characteristics for in vitro, in vivo and ex vivo delivery methods. It has been shown that large unilamellar vesicles can encapsulate a substantial percentage of an aqueous buffer containing large macromolecules. RNA and DNA can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form (Fraley, et al., Trends Biochem. Sci. 6:77, 1981).

[0133] In order for a liposome to be an efficient gene transfer vehicle, the following characteristics should be present: (1) encapsulation of the antisense oligomer of interest at high efficiency while not compromising their biological activity; (2) preferential and substantial binding to a target cell in comparison to non-target cells; (3) delivery of the aqueous contents of the vesicle to the target cell cytoplasm at high efficiency; and (4) accurate and effective expression of genetic information (Mannino, et al., Biotechniques, 6:682, 1988). The composition of the liposome is usually a combination of phospholipids, particularly high phase-transition-temperature phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used. The physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations. Cationic liposomes are positively charged liposomes which are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH-sensitive or negatively charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells.

[0134] Liposomes also include “sterically stabilized” liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. Liposomes and their uses are further described in U.S. 6,287,860.

[0135] The antisense oligomers described herein may also be delivered via an implantable device. Design of such a device is an art-recognized process, with, e.g., synthetic implant design described in, e.g., US 6,969,400, the contents of which are incorporated in their entirety by reference herein.

[0136] Antisense oligomers can be introduced into cells using art-recognized techniques (e.g., transfection, electroporation, fusion, liposomes, colloidal polymeric particles and viral and non-viral vectors as well as other means known in the art). The method of delivery selected will depend at least on the cells to be treated and the location of the cells and will be apparent to the skilled artisan. For instance, localization can be achieved by liposomes with specific markers on the surface to direct the liposome, direct injection into tissue containing target cells, specific receptor-mediated uptake, or the like.

[0137] As known in the art, antisense oligomers may be delivered using, for example, methods involving liposome-mediated uptake, lipid conjugates, polylysine-mediated uptake, nanoparticle-mediated uptake, and receptor-mediated endocytosis, as well as additional non- endocytic modes of delivery, such as microinjection, permeabilization (e.g., streptolysin-0 permeabilization, anionic peptide permeabilization), electroporation, and various non-invasive non-endocytic methods of delivery that are known in the art (refer to Dokka and Rojanasakul, Advanced Drug Delivery Reviews 44, 35-49, incorporated by reference in its entirety).

[0138] The antisense oligomer may also be combined with other pharmaceutically acceptable carriers or diluents to produce a pharmaceutical composition. Suitable carriers and diluents include isotonic saline solutions, for example phosphate-buffered saline. The composition may be formulated for parenteral, intramuscular, intravenous, subcutaneous, intraocular, oral, or transdermal administration.

[0139] The routes of administration described are intended only as a guide since a skilled practitioner will be able to readily determine the optimum route of administration and any dosage for any particular animal and condition.

[0140] Multiple approaches for introducing functional new genetic material into cells, both in vitro and in vivo have been attempted (Friedmann (1989) Science, 244:1275-1280). These approaches include integration of the gene to be expressed into modified retroviruses (Friedmann (1989) supra; Rosenberg (1991) Cancer Research 51(18), suppl.: 5074S-5079S); integration into non-retrovirus vectors (Rosenfeld, et al. (1992) Cell, 68:143-155; Rosenfeld, et al. (1991) Science, 252:431-434); or delivery of a transgene linked to a heterologous promoter-enhancer element via liposomes (Friedmann (1989), supra; Brigham, et al. (1989) Am. J. Med. Sci., 298:278-281 ; Nabel, et al. (1990) Science, 249:1285-1288; Hazinski, et al. (1991) Am. J. Resp. Cell Molec. Biol., 4:206-209; and Wang and Huang (1987) Proc. Natl. Acad. Sci. (USA), 84:7851-7855); coupled to ligand-specific, cation-based transport systems (Wu and Wu (1988) J. Biol. Chem., 263:14621-14624) or the use of naked DNA, expression vectors (Nabel et al. (1990), supra); Wolff et al. (1990) Science, 247:1465-1468). The Brigham et al. group (Am. J. Med. Sci. (1989) 298:278-281 and Clinical Research (1991) 39 (abstract)) have reported in vivo transfection only of lungs of mice following either intravenous or intratracheal administration of a DNA liposomecomplex. An example of a review article of human gene therapy procedures is: Anderson, Science (1992) 256:808-813; Barteau et al. (2008), Curr Gene Ther; 8(5):313-23; Mueller et al. (2008). Clin Rev Allergy Immunol; 35(3):164-78; Li et al. (2006) Gene Then, 13(18): 1313-9; Simoes et al. (2005) Expert Opin Drug Deliv; 2(2):237-54.

[0141] The antisense oligomers of the disclosure encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, as an example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the disclosure, pharmaceutically acceptable salts of such pro-drugs, and other bioequivalents.

[0142] The term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of the compounds of the disclosure: i.e. salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. For oligomers, preferred examples of pharmaceutically acceptable salts include but are not limited to (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine. The pharmaceutical compositions of the present disclosure may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and mucous membranes, as well as rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols (including by nebulizer, intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Oligomers with at least one 2'-O-methoxyethyl modification are believed to be particularly useful for oral administration. Preferably, the antisense oligomer is delivered via the subcutaneous or intravenous route.

[0143] The pharmaceutical formulations of the present disclosure, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s).In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.Administration

[0144] The antisense oligomer may be administered at regular intervals for a short time period, e.g., daily for two weeks or less. However, in some cases the oligomer is administered intermittently over a longer period of time. Administration may be followed by, or concurrent with, administration of an antibiotic or other therapeutic treatment. The treatment regimen may be adjusted (dose, frequency, route, etc.) as indicated, based on the results of immunoassays, other biochemical tests and physiological examination of the subject under treatment.

[0145] Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the subject. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligomers, and can generally be estimated based on EC50s found to be effective in in vitro and in vivo animal models. In general, dosages may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the subject undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligomer is administered in maintenance doses, once or more daily, to once every 20 years.

[0146] An effective in vivo treatment regimen using the antisense oligomers of the disclosure may vary according to the duration, dose, frequency and route of administration, as well as the condition of the subject under treatment (i.e., prophylactic administration versus administration in response to localized or systemic infection). Accordingly, such in vivo therapy will often require monitoring by tests appropriate to the particular type of disorder under treatment, and corresponding adjustments in the dose or treatment regimen, in order to achieve an optimal therapeutic outcome.

[0147] Treatment may be monitored, e.g., by general indicators of disease known in the art. As used herein, “treatment” of a subject (e.g. a mammal, such as a human) or a cell is any type of intervention used in an attempt to alter the natural course of the individual or cell. T reatment includes, but is not limited to, administration of a pharmaceutical composition, and may be performed either prophylactically or subsequent to the initiation of a pathologic event or contactwith an etiologic agent. Treatment includes any desirable effect on the symptoms or pathology of metabolic disease, and may include, for example, minimal changes or improvements in one or more measurable markers of the metabolic disease being treated. Also included are “prophylactic” treatments, which can be directed to reducing the rate of progression of the metabolic disease being treated, delaying the onset of the metabolic disease, or reducing the severity of its onset. “Treatment” or “prophylaxis” does not necessarily indicate complete eradication, cure, or prevention of the disease or condition, or associated symptoms thereof.

[0148] A "subject," as used herein, includes any animal that exhibits a symptom, or is at risk for exhibiting a symptom, which can be treated with an antisense compound of the disclosure, or any of the symptoms associated with the condition (e.g. metabolic disease). Suitable subjects include laboratory animals (such as mouse, rat, rabbit, or guinea pig), farm animals, and domestic animals or pets (such as a cat or dog). Non-human primates and, preferably, human subjects, are included.

[0149] The efficacy of an in vivo administered antisense oligomers of the disclosure may be determined from biological samples (tissue, blood, urine etc.) taken from a subject prior to, during and subsequent to administration of the antisense oligomer. Assays of such samples include (1) monitoring the presence or absence of heteroduplex formation with target and nontarget sequences, using procedures known to those skilled in the art, e.g., an electrophoretic gel mobility assay; (2) monitoring the amount of a mutant RNA in relation to a reference normal RNA or protein as determined by standard techniques such as RT-PCR, Northern blotting, ELISA or Western blotting.

[0150] Intranuclear oligomer delivery is a major challenge for antisense oligomers. Different cell-penetrating peptides (CPP) localize PMOs to varying degrees in different conditions and cell lines, and novel CPPs have been evaluated by the inventors for their ability to deliver PMOs to the target cells. The terms CPP or “a peptide moiety which enhances cellular uptake” are used interchangeably and refer to cationic cell penetrating peptides, also called “transport peptides”, “carrier peptides”, or “peptide transduction domains”. The peptides, as shown herein, have the capability of inducing cell penetration within about or at least about 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of cells of a given cell culture population and allow macromolecular translocation within multiple tissues in vivo upon systemic administration. CPPs are well-known in the art and are disclosed, for example in US 20100016215, which is incorporated by reference in its entirety.

[0151] The present disclosure therefore provides antisense oligomers of the present disclosure in combination with cell-penetrating peptides for manufacturing therapeutic pharmaceutical compositions.

[0152] According to a still further aspect of the disclosure, there is provided one or more antisense oligomers as described herein for use in an antisense oligomer-based therapy. Preferably, the therapy is for metabolic disease.

[0153] More specifically, the antisense oligomer may be selected from the group consisting of any one or more of SEQ ID NOs: 1-25, and combinations or cocktails thereof. This includes sequences which can hybridise to such sequences under stringent hybridisation conditions, sequences complementary thereto, sequences containing modified bases, modified backbones, and functional truncations or extensions thereof which possess or modulate pre-RNA processing activity in a target protein gene transcript. More preferably, the antisense oligomer used in the present disclosure is chosen from the list comprising: SEQ ID NO: 2, 3 and / or 20.

[0154] Preferably the antisense oligomer induced manipulation of protein expression of the present disclosure results in the following:- LEPROT - skipping of one or more exons in the LEPROT gene to increase the production of truncated, nonsense or prematurely terminated proteins;- LEPROTL1 - skipping of one or more exons in the LEPROTL1 gene to increase the production of truncated, nonsense or prematurely terminated proteins.

[0155] The disclosure extends also to a combination of two or more antisense oligomers capable of binding to a selected target to modify splicing of a target protein gene transcript. The combination may be a cocktail of two or more antisense oligomers, a construct comprising two or more or two or more antisense oligomers joined together for use in an antisense oligomer-based therapy.

[0156] The disclosure provides a method to treat, prevent or ameliorate the effects of metabolic disease, comprising the step of: a) administering to the subject an effective amount of one or more antisense oligomers or pharmaceutical composition comprising one or more antisense oligomers as described herein to induce downregulation of the production of functional LEPROT and / or LEPROTL1 protein.

[0157] The therapy may be used to develop non-functional, truncated or nonsense target proteins, or to reduce target protein expression. The decrease in levels of target protein is preferably achieved by decreasing the amount of full-length transcript level through exon skipping by binding splicing sites, modifying pre-mRNA splicing factor binding and / or modifying mRNA translation in the target protein gene transcript or part thereof.

[0158] Alternatively, the present disclosure may induce increased degradation of RNA via recruitment of RNase H, wherein the RNase H preferentially binds and degrades RNA bound in duplex to the DNA of the target protein gene.

[0159] The reduction in target protein will preferably lead to a reduction in the quantity, duration or severity of the symptoms of metabolic disease.

[0160] According to another aspect of the disclosure there is provided the use of one or more antisense oligomers as described herein in the manufacture of a medicament for the modulation or control of metabolic disease.

[0161] The disclosure also provides for the use of purified and isolated antisense oligomers as described herein, for the manufacture of a medicament for treatment of metabolic disease.

[0162] There is provided the use of purified and isolated antisense oligomers as described herein for the manufacture of a medicament to treat, prevent or ameliorate the effects of metabolic disease.

[0163] Preferably, the antisense oligomer used in the present disclosure is chosen from the list comprising:• SEQ ID NO: 1-25; or• SEQ ID NO: 2, 3 and 20.

[0164] Preferably the antisense oligomer induced manipulation of protein expression of the present disclosure results in the following:- LEPROT - skipping of one or more exons in the LEPROT gene to increase the production of truncated, nonsense or prematurely terminated proteins;- LEPROTL1 - skipping of one or more exons in the LEPROTL1 gene to increase the production of truncated, nonsense or prematurely terminated proteins.

[0165] The disclosure extends, according to a still further aspect thereof, to cDNA or cloned copies of the antisense oligomer sequences of the disclosure, as well as to vectors containing the antisense oligomer sequences of the disclosure. The disclosure extends further also to cells containing such sequences and / or vectors.

[0166] The disclosure also provides kits to treat, prevent or ameliorate metabolic disease in a subject, which kit comprises at least an isolated or purified antisense oligomer for modifying pre-mRNA splicing factor binding or mRNA translation in a target protein gene transcript or part thereof, packaged in a suitable container, together with instructions for its use.

[0167] In a preferred embodiment, the kits will contain at least one antisense oligomer as described herein or as shown in Table 1 and Table 2 (SEQ ID NOs: 1-25), or a cocktail of antisense oligomers, as described herein. The kits may also contain peripheral reagents such as buffers, stabilizers, etc.

[0168] There is therefore provided a kit to treat, prevent or ameliorate metabolic disease in a subject, which kit comprises at least an antisense oligomer described herein as SEQ ID NOs: 1-25, the antisense oligomers of Table 1 and Table 2 and combinations or cocktails thereof, packaged in a suitable container, together with instructions for its use.

[0169] There is also provided a kit to treat, prevent or ameliorate metabolic disease in a subject which kit comprises at least an antisense oligomer selected from the group consisting of any one or more of SEQ ID NOs: 1-25, and combinations or cocktails thereof, packaged in a suitable container, together with instructions for its use.

[0170] The components of the kit may also be provided in dried or lyophilized forms. When reagents or components are provided as a dried form, reconstitution generally is by the addition of a suitable solvent. The kit can additionally contain a suitable solvent for reconstitution of the lyophilized components. Individual components of the kit may be packaged in separate containers. Irrespective of the number or type of containers, the kits of the disclosure also may comprise, or be packaged with, an instrument for assisting with the injection / administration or placement of the ultimate complex composition within the body of an animal. Such an instrument may be an inhalant, syringe, pipette, forceps, measured spoon, eye dropper or any such medically approved delivery vehicle.

[0171] Notices in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, may be provided in the kit, such notices reflecting approval by the agency of manufacture, use or sale for human administration.

[0172] When the components of the kit are provided in one or more liquid solutions, the liquid solution can be an aqueous solution, for example a sterile aqueous solution. For in vivo use, the expression construct may be formulated into a pharmaceutically acceptable syringeable composition. In this case the container means may itself be an inhalant, syringe, pipette, eye dropper, or other such like apparatus, from which the formulation may be applied to an affected area of the animal, such as the skin, injected into an animal, or even applied to and mixed with the other components of the kit.

[0173] Those of ordinary skill in the field should appreciate that applications of the above method have wide application for identifying antisense oligomers suitable for use in the treatment of many other diseases.

[0174] The antisense oligomers of the present disclosure may also be used in conjunction with alternative therapies, such as drug therapies.

[0175] The present disclosure therefore provides a method of treating, preventing or ameliorating the effects of metabolic disease, wherein the antisense oligomers of the present disclosure and administered sequentially or concurrently with another alternative therapy associated with treating, preventing or ameliorating metabolic disease.

[0176] The alternative therapy may be chosen from the list comprising: insulin and insulin mimetics; agents that increase insulin release (amylin mimetics such as pramlintide; sodium glucose transporter 2 inhibitors such as canagliflozin; incretin mimetics [GLP-1 agonists] such as exenatide or liraglutide; dipeptidyl-peptidase 4 inhibitors such as saxagliptin, sitagliptin or linagliptin; sulfonylureas such as glyburide, glipizide, glimepiride, chlorpropamide, tolazamide, gliquidone, glibenclamide, gliclazide, acetohexamide or tolbutamide; glinides such as nateglinide or repaglinide); agents that decrease absorption of sugar from the intestines (for example acarbose, voglibose, and miglitol); agents that prevent reabsorption of filtered glucose by the kidney (for example dapagliflozin and canagliflozin); agents that make the body more sensitive to insulin (for example metformin, ciglitazone, troglitazone, rosiglitazone and pioglitazone); dietary modifications in conjunction with regular exercise; surgery to increase weight loss.General

[0177] Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. The invention includes all such variation and modifications. The invention also includes all of the steps, features, formulations and compounds referred to or indicated in the specification, individually or collectively and any and all combinations or any two or more of the steps or features.

[0178] Each document, reference, patent application or patent cited in this text is expressly incorporated herein in their entirety by reference, which means that it should be read and considered by the reader as part of this text. That the document, reference, patent application or patent cited in this text is not repeated in this text is merely for reasons of conciseness.

[0179] Any manufacturer’s instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference, and may be employed in the practice of the invention.

[0180] The present invention is not to be limited in scope by any of the specific embodiments described herein. These embodiments are intended for the purpose ofexemplification only. Functionally equivalent products, formulations and methods are clearly within the scope of the invention as described herein.

[0181] The invention described herein may include one or more range of values (eg. Size, displacement and field strength etc). A range of values will be understood to include all values within the range, including the values defining the range, and values adjacent to the range which lead to the same or substantially the same outcome as the values immediately adjacent to that value which defines the boundary to the range. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. Hence “about 80 %” means “about 80 %” and also “80 %”. At the very least, each numerical parameter should be construed in light of the number of significant digits and ordinary rounding approaches.

[0182] Throughout this specification, unless the context requires otherwise, the word “comprise” or variations such as “comprises” or “comprising”, will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. It is also noted that in this disclosure and particularly in the claims and / or paragraphs, terms such as “comprises”, “comprised”, “comprising” and the like can have the meaning attributed to it in U.S. Patent law; e.g., they can mean “includes”, “included”, “including”, and the like; and that terms such as “consisting essentially of’ and “consists essentially of’ have the meaning ascribed to them in U.S. Patent law, e.g., they allow for elements not explicitly recited, but exclude elements that are found in the prior art or that affect a basic or novel characteristic of the invention.

[0183] Other definitions for selected terms used herein may be found within the detailed description of the invention and apply throughout. Unless otherwise defined, all other scientific and technical terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which the invention belongs. The term “active agent” may mean one active agent, or may encompass two or more active agents.

[0184] The following examples serve to more fully describe the manner of using the abovedescribed invention, as well as to set forth the best modes contemplated for carrying out various aspects of the invention. It is understood that these methods in no way serve to limit the true scope of this invention, but rather are presented for illustrative purposes.EXAMPLES

[0185] Further features of the present invention are more fully described in the following nonlimiting Examples. This description is included solely for the purposes of exemplifying the present invention. It should not be understood as a restriction on the broad description of the invention as set out above.Example 1Design and synthesis of antisense oligonucleotides

[0186] Eighteen ASOs targeting the LEPROT transcript and seven ASOs targeting the LEPROTL1 transcript were designed and synthesised as shown in Table 1. The AOs were ordered from commercial suppliers.Cell culture and transfection of ASOs into cellsTransfection with Lipofectamine 3000 (2'0 MePS or MOE chemistry)

[0187] Cells were seeded and grown at 37°C / 5% CO2 for 24 hours. Transfection reagent was prepared by mixing Lipofectamine 3000 (L3K) and AOs. According to the manufacturer’s protocol, 3 pl of L3K was used per 1 ml of transfection sample volume. To make transfection solution, two different solutions were prepared individually in two separate tubes: AO solution and delivery complex solution. AO solution was made in a volume of 100 pl according to the required concentration of AO. For screening purpose 200, 100 and 50 nM concentrations of each AO were used. Similarly, delivery complex was made in the volume of 100 pl by adding 3 pl of L3K in 97 pl of OptiMEM. AO solution and delivery complex solution were mixed and incubated for 10 minutes in room temperature. Finally, 800 pl of OptiMEM was added to bring the final volume of 1000 pl. Cells were taken out of incubator, growth media was aspirated from the wells and 500 pl of the transfection solution were added slowly in duplicate wells of 24 well plate. Cells were incubated at 37°C for 24 hours prior to harvesting for RNA analysis.Transfection with Neon® (PMO chemistry)

[0188] Lyophilised PMOs were resuspended in sterile filtered water at the final concentration of 5 mM. PMOs (at concentrations 25, 10 and 1 pm) were delivered into Saos-2 cells using the Neon® Transfection System and 10 pl Kit following the manufacturer’s protocol. In brief, cells were trypsinised, counted and washed with PBS, centrifuging for 3 min at 1 rcf. Washed cells were resuspended in Resuspension Buffer R, with 3x105 cells in 10 pl of buffer per treatment. To a separate tube, 10 pl of cell mixture and PMO were mixed before being drawn into a 10 pl Neon® tip using a Neon® Pipette. The pipette and tip were then placed into Neon® tube containing 3 ml of Electrolytic Buffer E and electroporated with a protocol optimised for Saos-2 consisting of 3 pulses at 1300 volts 10 milliseconds (ms) apart. Transfected cells were plated to 6 well plates containing DM EM with 5% FCS.RNA extraction and RT-PCRRNA was extracted from transfected cells using Direct-zol™ RNA M inPrep Plus with TRI reagent (Zymo Research) as per the manufacturer’s instructions. The human LEPROT exon-2 skippingproducts (product size: 280 bp) and non-skipping products (product size: 350 bp), and human LEPROTL1 exon-2 skipping products (product size: 280 bp) and non-skipping products (product size: 350 bp), were amplified using SuperScript® III one-step RT-PCR kit (Thermo Fisher Scientific) with human primers as indicated below. Briefly, the conditions were 55°C, 30 minutes; 94°C, 2 minutes followed by 25 cycles of 94°C for 40 seconds, 56°C 1 minute and 68°C 1 minute. The PCR products were then separated on a 2% agarose gel in Tris-acetate-EDTA buffer and visualized with Fusion Fx gel documentation system. Densitometry was performed by Imaged software.SequencingBandstab technique was performed following the guidelines from Anthony and James (1992). The bandstab samples were then amplified with the primer set below using AmpliTaq Gold® DNA Polymerase kit (Thermo Fisher Scientific). Briefly, the conditions were: 55°C 30 min, 94°C 2min, followed by 25 cycles of 94°C 40s, 56°C 1 min and 68°C 1 min. PCR products were confirmed by 2% agarose gel and sent to AGRF (Australian Genome Research Facility) for Sanger sequencing using both the forward primer and reverse primers mentioned below.

[0189] PCR primers were designed for exon 1 and exon 3 to detect the skipping of exon 2.RTPCR primers for LEPROT:Exon 1 Fwd AGACATGGCGGGCGTTAAA (SEQ ID NO: 26)Exon 3 Rev ACAGCCACACGAGCAAGAAT (SEQ ID NO: 27)RTPCR primers for LEPROTL1 :Exon 1 Fwd CACTTCCGGGTGTTGTCTGG (SEQ ID NO: 28Exon 3 Rev AAAGCTGACACGACAATGCC (SEQ ID NO: 29)Immunohistochemical staining

[0190] Immunohistochemical staining for LEPROT or LEPROTL1 was performed. Hoechst 33342 and Rhodamine Phalloidin were used to stain the background of the cells.

[0191] Fix cells using 400 pL of 4% paraformaldehyde (pH 7.4) for 10 min at 37°C. Remove paraformaldehyde solution and wash the cells 3 times with 500 pL of 1X PBS. Add 400 pL of 0.1% Triton X-100 in 1X PBS and incubate the cells at room temperature for 15 min. Remove T riton-X-100 and wash the cells three times with 500 pL of 1X PBS. Add 500 pL of 2% BSA in 1X PBS and incubate the cells at room temperature for 60 min. Add the desired concentration of primary antibody diluted in 500 pL of 0.1% BSA to the cells and incubate for 3 hours at room temperature or overnight at 4°C. Remove primary antibody solution and wash the cells three timeswith 500 pL of 1X PBS. Add the desired concentration of fluorescent dye-labeled secondary antibody along with a compatible counterstain for the cytoskeleton (e.g., rhodamine phalloidin) and nucleus (DAPI) diluted in 500 pL of 0.1% BSA and incubate for 45 min at room temperature protected from light. Wash the cells three times with 500 pL of 1X PBS-T. Air-dry the coverslip / chamber slide and add the mounting medium (containing antifade agent).

Claims

CLAIMS1. An isolated or purified antisense oligomer for modifying pre-mRNA splicing or mRNA translation in one or more of the following proteins encoded by the respective gene transcript or part thereof: i) LEPROT; and / or ii) LEPROTL1 which has a modified backbone structure, wherein the antisense oligomer induces downregulation of the production of functional LEPROT and / or LEPROTL1 protein.

2. The antisense oligomer of claim 1 that is selected from the group comprising: a) the sequences set forth in Table 1 and Table 2; b) SEQ ID NO: 1-25; or c) SEQ ID NO: 2, 3 and / or 20.

3. The antisense oligomer of claim 1 or 2, for inducing the production of truncated proteins, the production of proteins lacking functional regions or a reduction in the total amount of protein produced.

4. The antisense oligomer of any one of claims 1 to 3, wherein: a) the antisense oligomer contains one or more nucleotide positions subject to an alternative chemistry or modification chosen from the list comprising: (i) modified sugar moieties; (ii) oligomeric mimetic chemistry; b) the antisense oligomer is further modified by: (i) chemical conjugation to a moiety; and / or (ii) tagging with a cell penetrating peptide; and / or c) if an uracil (II) is present in the antisense oligomer, the uracil (II) of the antisense oligomer is replaced by a thymine (T).

5. The antisense oligomer of any one of claims 1 to 4, that is a phosphorodiamidate morpholino oligomer (PMO) or a 2'-O-methyl phosphorothioate oligomer (2'-OMePS), 2’-O-M ethoxyethyl RNA oligomer (2’-O-MOE) or 2’-O-M ethyl RNA oligomer (2’-OMe).

6. A cDNA copy of the antisense oligomer sequences of any one of claims 1 to 5.

7. A vector containing the antisense oligomer sequences of claim 1 or cDNA of claim 6.

8. Cells containing the antisense oligomer sequences of any one of claims 1 to 5, the cDNA of claim 6, or the vector of claim 7.

9. A method for manipulating splicing factor binding in a target protein gene transcript, the method including the step of: a) providing one or more of the antisense oligomers of claim 1 and allowing the oligomer(s) to bind to a target nucleic acid site to induce downregulation of the production of functional LEPROT and / or LEPROTL1 protein.

10. A pharmaceutical, prophylactic, or therapeutic composition to treat, prevent or ameliorate the effects of dysregulation of leptin in a subject, the composition comprising: a) one or more antisense oligomers of any one of claims 1 to 5; and b) one or more pharmaceutically acceptable carriers and / or diluents to induce downregulation of the production of functional LEPROT and / or LEPROTL1 protein.11.The method of claim 9, or composition of claim 10, wherein the metabolic disease is associated with dysregulation of leptin in the subject.

12. The method of claim 9, or composition of claim 10, wherein the metabolic disease is chosen from the list comprising: obesity, Body Mass Index Quantitative Trait Locus 11 , hyperlipidaemia, and metabolic disease sequelae.

13. A method to treat, prevent or ameliorate the effects of metabolic disease in a subject, comprising the step of: a) administering to the subject an effective amount of one or more antisense oligomers or pharmaceutical composition comprising one or more antisense oligomers of any one of claims 1 to 5, to induce downregulation of the production of functional LEPROT and / or LEPROTL1 protein.

14. The use of purified and isolated antisense oligomers of any one of claims 1 to 5, for the manufacture of a medicament to treat, prevent or ameliorate the effects of metabolic disease in a subject.

15. A kit to treat, prevent or ameliorate the effects of metabolic disease in a subject, which kit comprises at least an antisense oligomer of any one of claims 1 to 5, packaged in a suitable container, together with instructions for its use.

Images