Methods for reducing bioburden of a sensor electrode
Radiation-based disinfection of EAB sensors, conducted under controlled conditions, effectively reduces bioburden while maintaining aptamer functionality, addressing the limitations of existing methods by ensuring pathogen elimination and detection efficiency.
Patent Information
- Application Number
- PCT/AU2025/050804
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-29
- Filing Date
- 2025-07-29
- Publication Date
- 2026-02-05
AI Technical Summary
Existing disinfection methods for electrochemical aptamer-based (EAB) sensors, such as those using CIDEX™ OPA or ethanol, are inadequate as they either damage aptamers or fail to effectively eliminate infectious agents, and the process is complex and costly.
Exposing the aptamer-functionalized sensor electrodes to controlled amounts of radiation, such as gamma, electron beam, or ultraviolet light, while maintaining low water content and humidity, effectively reduces bioburden without impairing the aptamers' ability to detect target analytes.
The method achieves significant pathogen reduction while preserving at least 40-100% of the aptamer's target analyte detection capability, offering a simpler and more effective alternative to traditional disinfection methods.
Smart Images

Figure AU2025050804_05022026_PF_FP_ABST
Abstract
Description
[0001] METHODS FOR REDUCING BIOBURDEN OF A SENSOR ELECTRODE.
[0002] FIELD
[0003]
[0001] , The present disclosure relates generally to the field of aptamer-based sensors used in detecting a target analyte. More particularly, the disclosure is directed to methods for disinfecting or sterilizing aptamer-based sensors in preparation for application to an animal subject.
[0004] BACKGROUND
[0005]
[0002] . Electrochemical sensors have been proven to be useful in the real time detection of target analytes in diverse media including air, water, process intermediates, and biological fluids. In such sensors, a biological or a chemical analyte recognition element is applied to an electrically conductive element to form a working electrode. Upon interrogation of the sensor by application of a potential, a current is produced. A feature of the current may be used to determine the amount of analyte in the test fluid.
[0006]
[0003] , Electrochemical aptamer-based (EAB) sensors are showing increasing promise in industry and medicine. In an EAB sensor, the working electrode is coated with a plurality of aptamers that specifically recognise a target analyte. The aptamer may be a biological polymer such as DNA or RNA, or an analogue such as PNA or XNA. A redox reporter (such as methylene blue) is typically covalently linked to the aptamer. The detection of a target analyte manifests as a conformational change in the aptamer upon analyte binding. The conformational change in turn alters the accessibility of the redox reporter to the working electrode surface, thereby producing an analyte-induced change in the level of electron transport between the redox reporter and the electrode. The change in speed of electron transport contributes to a change in Faradaic current that is detected by a potentiostat.
[0007]
[0004] , One application proposed for E AB sensors is for the real time monitoring of a target analyte in a subject. For example, an exogenous agent such as a drug may be monitored to ensure that a minimum effective amount is present in the body. Endogenous species such as glucose may be monitored to guide insulin administration and food intake to maintain blood sugar levels within an acceptable range. A vast range of further medical and veterinary applications for EAB sensors await to be exploited.
[0008]
[0005] , A key advantage of EAB sensors is the ability to form the working electrode comprising the aptamers (and optionally other sensor electrodes such as a counter electrode and a reference electrode) into a needle or a microneedle or a wire capable of penetrating the skin. Thus, the working electrode may be inserted through the skin such that the aptamers contact a biological fluid such as the interstitial fluid (ISF) or blood. This allows for the real time in situ continuous monitoring of target analyte in the ISF or blood.
[0009]
[0006] , In other applications, the working electrode does not pierce the skin, but is nevertheless inserted into the subject. For example, a blunt electrode may be introduced into the body by a catheter extending through a cannula inserted into a vein. As another example, a blunt electrode may be inserted in the urethra, bladder, trachea, rectum or other space within the body.
[0010]
[0007] , Where a medical device may introduce an infectious agent into the subject, regulatory bodies such as the United States Food and Drug Administration (FDA) and the European Medicines Agency (EMA) mandate validated disinfection steps in manufacturing processes. Given that EAB sensor electrodes may be introduced into the body of a subject, appropriate disinfection will therefore be required before these sensors are in general use.
[0011]
[0008] , Many disinfection methods rely on damaging the nucleic acids of infectious agents. For example, ethylene oxide gas and vaporized hydrogen peroxide damage DNA and RNA by oxidative mechanisms. Other methods rely on radiation exposure to directly destroy nucleic acids in infectious agents. For example, high energy gamma irradiation physically damages DNA and RNA molecules leading to complete loss of function. As will be immediately appreciated, aptamers used in EAB sensors will certainly be susceptible to destruction in any disinfection method reliant on damaging nucleic acid.
[0012]
[0009] , In light of the above, it will come as no surprise that prior art methods for disinfection of EAB sensors avoid any method reliant on nucleic acid damage. Chung et al (ECS Sens Plus. 2022 Mar; 1(1): 011604) recognises the problem of sterilization methods targeting DNA, and proposes the use of CIDEX™ OPA (0.55% ortho-phthalaldehyde). This disinfectant exerts its antimicrobial effect by cross-linking amine groups of protein, whilst apparently leaving genetic material unaffected. Whilst shown to be effective in disinfection of EAB sensors, CIDEX™ is far from ideal. Removal of CIDEX™ from the device (or at least neutralization) should be substantially complete, this adding to complexity and cost of manufacture. Although some CIDEX™ may remain on the device, it has the propensity to stain tissues of the subject. A further disadvantage is that the device must be exposed to CIDEX™ for an extended period of time for sufficient reduction in the infectious agents concerned.
[0013]
[0010] , Other relatively gentle disinfection methods include exposure to ethanol at concentrations at or above 70%. A problem with ethanol is that it is not sufficiently efficacious against bacterial and fungal spores and some viruses.
[0014] [Oi l], It is an aspect of the present disclosure to provide an improvement in prior art methods for disinfecting EAB sensors. It is a further aspect of the present disclosure to provide a useful alternative to prior art methods for disinfecting EAB sensors.
[0015]
[0012] , The discussion of documents, acts, materials, devices, articles and the like is included in this specification solely for the purpose of providing a context for the present disclosure. It is not suggested or represented that any or all of these matters formed part of the prior art base or were common general knowledge in the field relevant to the present disclosure as it existed before the priority date of each claim of this application.
[0016] SUMMARY
[0017]
[0013] , In a first aspect, but not necessarily the broadest aspect, there is provided a method of reducing the bioburden of an analyte recognition element, or a sensor working electrode functionalized with an analyte recognition element, the method comprising the step of exposing the analyte recognition element or the sensor working electrode with an amount of radiation.
[0018]
[0014] , In one embodiment of the first aspect, the amount of radiation is an amount of gamma radiation, electron beam radiation, x-ray radiation, microwave radiation, or ultraviolet light radiation.
[0019]
[0015] , In one embodiment of the first aspect, the amount of radiation is sufficient so to effect at least about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 logic kill of a pathogen capable of infecting a human or a non-human animal, or a model of the pathogen.
[0016] , In one embodiment of the first aspect, the pathogen is selected from: a bacterium or a spore thereof, a fungus or a spore thereof, a mycobacterium, a mycoplasma, a virus, a protozoa, and a parasite.
[0020]
[0017] , In one embodiment of the first aspect, the pathogen or model thereof is selected from: Staphylococcus aureus, Salmonella choleraesuis, Pseudomonas aeruginosa, Trichophyton mentagrophyte, Mycobacterium bovis (BCG), Adenovirus, Coxsackie Type B-3 virus, Cytomegalovirus, Herpes Simplex Virus Type 1 & 2 (HSV1 & HSV2), HIV-1, Human Coronavirus, Poliovirus, Rhinovirus, Vaccinia virus (Wyeth) Pass, Clostridium sporogenes spores and Bacillus subtilis spores.
[0021]
[0018] , In one embodiment of the first aspect, the amount of radiation allows for preservation of at least about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%,
[0022] 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%,
[0023] 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%,
[0024] 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%,
[0025] 95%, 96%, 97%, 98%, 99%, or 100% of the target analyte detecting ability of the analyte recognition element or the sensor working electrode.
[0026]
[0019] , In one embodiment of the first aspect, the amount of radiation is an amount of ionizing radiation, the amount of ionizing radiation being: (i) at least about 1 kGy, 2 kGy,
[0027] 3 kGy, 4 kGy, 5 kGy, 6 kGy, 7 kGy, 8 kGy, 9 kGy 10 kGy, 11 kGy, 12 kGy, 13 kGy, 14 kGy, 15 kGy, 16 kGy, 17 kGy, 18 kGy, 19 kGy, 20 kGy, 21 kGy, 22 kGy, 23 kGy, 24 kGy,
[0028] 25 kGy, 26 kGy, 27 kGy, 28 kGy, 29 kGy, 30 kGy, 31 kGy, 32 kGy, 33 kGy 34 kGy, 35 kGy, 36 kGy, 37 kGy, 38 kGy, 39 kGy, 40 kGy, 41 kGy, 42 kGy, 43 kGy, 44 kGy, 45 kGy,
[0029] 46 kGy, 47 kGy, 48 kGy, 49 kGy, or 50 kGy; or (ii) less than about 1 kGy, 2 kGy, 3 kGy,
[0030] 4 kGy, 5 kGy, 6 kGy, 7 kGy, 8 kGy, 9 kGy 10 kGy, 11 kGy, 12 kGy, 13 kGy, 14 kGy, 15 kGy, 16 kGy, 17 kGy, 18 kGy, 19 kGy, 20 kGy, 21 kGy, 22 kGy, 23 kGy, 24 kGy, 25 kGy,
[0031] 26 kGy, 27 kGy, 28 kGy, 29 kGy, 30 kGy, 31 kGy, 32 kGy, 33 kGy 34 kGy, 35 kGy, 36 kGy, 37 kGy, 38 kGy, 39 kGy, 40 kGy, 41 kGy, 42 kGy, 43 kGy, 44 kGy, 45 kGy, 46 kGy,
[0032] 47 kGy, 48 kGy, 49 kGy, or 50 kGy.
[0020] , In one embodiment of the first aspect, the amount of radiation is an amount of ultraviolet light radiation the amount of ultraviolet light radiation being at least about 2,000 pW s / cm2.
[0033]
[0021] , In one embodiment of the first aspect, the amount of radiation is sufficient for disinfection or sterilization.
[0034]
[0022] , In one embodiment of the first aspect, the method comprises the step of removing and / or excluding water or another solvent from the analyte recognition element and / or the sensor working electrode and / or the environment about the sensor working electrode prior to exposure to an amount of radiation.
[0035]
[0023] , In one embodiment of the first aspect, the step of removing and / or excluding water or another solvent comprises any one or more of: air drying, drying under a vacuum, spray drying, lyophilization, heating, centrifugation, exposure to a desiccant, and water or another solvent displacement.
[0036]
[0024] , In one embodiment of the first aspect, the analyte recognition element or the sensor working electrode has a controlled water or other solvent level, and / or the exposure to an amount of radiation is performed in a humidity controlled gaseous environment.
[0037]
[0025] , In one embodiment of the first aspect, the water or other solvent level is less than about 70%, 60%, 50%, 40%, 30%, 20%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% , 1% or 0.1% by weight; or the humidity is less than about 70%, 60%, 40%, 40%, 30%, 20%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% , 1% or 0.1% relative humidity.
[0038]
[0026] . In one embodiment of the first aspect, the step of exposure to an amount of radiation is performed:
[0039]
[0027] , during, after or about a step of functionalizing or preparing to functionalize the working electrode with the analyte recognition element; or
[0040]
[0028] , during, after or about a step of drying the analyte recognition element or drying the working electrode functionalized with the analyte recognition element.
[0041]
[0029] , In one embodiment of the first aspect, the step of functionalizing or preparing to functionalize the working electrode comprises:
[0042] (a) associating an analyte recognition element with (i) another analyte recognition element, or (ii) a surface of the working electrode; or
[0043] (b) synthesising an analyte recognition element in situ on the working electrode.
[0030] , In one embodiment of the first aspect, the step of associating the analyte recognition element with another analyte recognition element comprises reducing the average distance between each of the analyte recognition elements.
[0044]
[0031] , In one embodiment of the first aspect, the step of associating the analyte recognition element with a surface of the working electrode comprises (i) immobilizing the analyte recognition element on the surface of the electrode, preferably by linking the analyte recognition element to a surface of the electrode, more preferably by forming a covalent bond between the analyte recognition element and the surface of the electrode.
[0045]
[0032] , In one embodiment of the first aspect, the functionalizing comprises treating the electrode to inhibit non-specific binding of the analyte recognition element or a target analyte to a surface of the electrode.
[0046]
[0033] , In one embodiment of the first aspect, inhibition of non-specific binding of the analyte recognition element causes the one of the plurality of aptamers to stand proud of the surface of the electrode.
[0047]
[0034] , In one embodiment of the first aspect, the step of treating comprises exposing the surface of the electrode to one or more agents capable of blocking or passivating the electrode surface, the one or more agents typically capable of self-assembly into a monolayer.
[0048]
[0035] , In one embodiment of the first aspect, the functionalizing comprises the association with methylene blue or a functional equivalent thereof or another redox reporter with the analyte recognition element, or the sensor working electrode analyte recognition element.
[0049]
[0036] , In a second aspect, there is provide a method of producing a working electrode of an analyte recognition element-based sensor, the method comprising the steps of:
[0050] (c) functionalizing an electrode with an analyte recognition element, and
[0051] (d) exposing the functionalized electrode to an amount of radiation sufficient to reduce burden at a time when: the analyte recognition element (i) is proximal to another analyte recognition element, or a redox reporter, or a blocking agent, or a passivating agent, or (ii) has a low water or another solvent content, or (iii) is in a humidity-controlled gaseous environment; or the electrode (i) has a low water or another solvent content, or (ii) is in a humidity-controlled gaseous environment.
[0037] , In a third aspect, there is provided a method of reducing the bioburden of a packaged analyte recognition element-based sensor, the method comprising:
[0052] (e) sealing an analyte recognition element-based sensor inside a sealable packet in a humidity-controlled gaseous environment, and
[0053] (f) exposing the sealed packet to an amount of radiation sufficient to reduce the bioburden on the sensor.
[0054]
[0038] , In one embodiment of the first or second or third aspect, the analyte recognition element is an aptamer.
[0055]
[0039] , In one embodiment of the first or second or third aspect, the electrode is a wire, a needle, or a microneedle; and the sensor is an electrochemical sensor.
[0056]
[0040] , In a fourth aspect, there is provided a packet having sealed therein an analyte recognition element-based sensor produced according to the method of any embodiment of the second aspect.
[0057] BRIEF DESCRIPTION OF THE FIGURES
[0058]
[0041] , FIG. 1, FIG. IB, FIG. 1C. FIG. ID, FIG. IE, and FIG. IF is each a flow diagram showing various timings of irradiating an aptamer or an aptamer-functionalized working electrode in a workflow for producing a sensor.
[0059]
[0042] , FIG. 2 is graph of current vs potential pursuant to cyclic voltammetry applied to sensors having a working electrode functionalized with a vancomycin-specific aptamer. Control (CHI blue, CH2 green ); E-beam irradiated (CH7 purple, CH8 brown).
[0060]
[0043] , FIG. 3 is graph of current vs potential for sensors having a working electrode functionalized with a vancomycin-specific aptamer. Control (CHI blue, CH2 yellow), E- beam irradiated (remaining CH5, 6, 7, 8).
[0061]
[0044] , FIG. 4 is a graph of current vs potential pursuant to square wave voltammetry (100Hz) applied to sensors having a working electrode functionalized with a vancomycinspecific aptamer. Control (CHI dark blue, CH2 yellow), E-beam irradiated (remaining CH3, 4, 5, 6, 7, 8).
[0062]
[0045] , FIG. 5 is a graph of % signal gain vs frequency for sensors having a working electrode functionalized with a vancomycin-specific aptamer. The % signal gain is the increase in single obtained upon exposure of the working electrode to 200 pM vancomycin. Control (blue), E-beam irradiated (pink).
[0063]
[0046] , FIG. 6 is a graph of KDM (300Hz / 100Hz) versus vancomycin concentration for sensors having a working electrode functionalized with a vancomycin-specific aptamer. Control (blue), E-beam irradiated (pink).
[0064]
[0047] , FIG. 7 is a graph of current vs potential pursuant to cyclic voltammetry applied to sensors having a working electrode functionalized with a vancomycin-specific aptamer. Control (blue); E-beam irradiated (pink).
[0065]
[0048] , FIG. 8 is a graph of current vs potential pursuant to cyclic voltammetry applied to sensors having a working electrode functionalized with a phenylalanine-specific aptamer. Control (blue); E-beam irradiated (pink).
[0066]
[0049] , FIG. 9 is a graph of current vs potential for sensors having a working electrode functionalized with a vancomycin-specific aptamer. A % signal gain value was determined upon exposure to 500 pM vancomycin. Control (blue) showed a 32% signal gain. E-beam irradiated (pink) showed a 32% signal gain.
[0067]
[0050] , FIG. 10 is a graph of current vs potential for sensors having a working electrode functionalized with a phenylalanine-specific aptamer. A % signal gain value was determined upon exposure to 2500 pM phenylalanine. Control (blue) showed a 42% signal gain. E-beam irradiated (pink) showed a 27% signal gain.
[0068]
[0051] , FIG. 11 is a graph of % signal gain vs frequency for sensors having a working electrode functionalized with a vancomycin-specific aptamer. The % signal gain is the increase in signal obtained upon exposure of the working electrode to 500 pM vancomycin. Control (blue), E-beam irradiated (pink).
[0069]
[0052] , FIG. 12 is a graph is a graph of % signal gain vs frequency for sensors having a working electrode functionalized with a phenylalanine-specific aptamer. The % signal gain is the increase in signal obtained upon exposure of the working electrode to 500 pM vancomycin. Control (blue), E-beam irradiated (pink).
[0070]
[0053] , FIG. 13 is a graph of KDM (10Hz / 200Hz) versus vancomycin concentration for sensors having a working electrode functionalized with a vancomycin-specific aptamer. Control (blue), E-beam irradiated (pink).
[0054] , FIG. 14 is a graph of KDM (10Hz / 200Hz) versus phenylalanine concentration for sensors having a working electrode functionalized with a vancomycin-specific aptamer. Control (blue), E-beam irradiated (pink).
[0071]
[0055] , FIG. 15 is a graph of current vs potential pursuant to cyclic voltammetry applied to sensors having a working electrode functionalized with a vancomycin-specific aptamer. Aptamers stored at room temperature (RT) and freshly prepared aptamers yielded virtually identical curves.
[0072]
[0056] , FIG. 16 is a graph of current vs potential pursuant to cyclic voltammetry applied to sensors having a working electrode functionalized with a vancomycin-specific aptamer. Irradiated aptamers (green) show a markedly different voltammogram to the RT control aptamers (remainder voltammograms).
[0073]
[0057] , FIG. 17 is a graph of current vs potential pursuant to square wave voltammetry (200 Hz) applied to sensors having a working electrode functionalized with a vancomycinspecific aptamer in the presence of 200 pM vancomycin, or no vancomycin. RT control (yellow), E-beam irradiated (pink).
[0074]
[0058] , FIG. 18 is a graph is a graph of % signal gain vs frequency for sensors having a working electrode functionalized with a vancomycin-specific aptamer in the presence of 200 pM vancomycin. RT Control (blue), E-beam irradiated (pink), fresh control (black)
[0075]
[0059] , FIG. 19 is a graph of KDM (10Hz / 200Hz) versus vancomycin concentration for sensors having a working electrode functionalized with a vancomycin-specific aptamer. RT Control (blue), E-beam irradiated (pink), fresh control (black).
[0076]
[0060] , FIG. 20 is a graph of frequency response (i.e. frequency versus gain) of a working electrode functionalised with a vancomycin sensitive DNA aptamer showing that gain for E-beam exposed electrodes was equivalent to those that were exposed to Cidex™,
[0077]
[0061] , FIG. 21 is a series of graphs, each plotting sensor gain against interrogation wave frequency demonstrating the various effects of storage, E-beam irradiation, and humidity on sensor responsiveness to analyte.
[0078]
[0062] , FIG. 22 is a graph showing the negative effect of the sterilizing agent chlorine dioxide on a vancomycin-sensitive working electrode.
[0079]
[0063] . FIG. 23 is a graph showing the negative effect of the sterilizing agent ethylene oxide on a vancomycin-sensitive working electrode.
[0064] , Unless otherwise indicated herein, features of the drawings labelled with the same numeral are taken to be the same features, or at least functionally similar features, when used across different drawings.
[0080]
[0065] , The drawings are not prepared to any particular scale or dimension and are not presented as being a completely accurate presentation of the various embodiments.
[0081] DETAILED DESCRIPTION AND PREFERRED EMBODIMENTS
[0082]
[0066] , After considering this description it will be apparent to one skilled in the art how the disclosure is implemented in various alternative embodiments and alternative applications. However, although various embodiments of the present disclosure will be described herein, it is understood that these embodiments are presented by way of example only, and not limitation. As such, this description of various alternative embodiments should not be construed to limit the scope or breadth of the present disclosure. Furthermore, statements of advantages or other aspects apply to specific exemplary embodiments, and not necessarily to all embodiments, or indeed any embodiment covered by the claims.
[0083]
[0067] , Throughout the description and the claims of this specification the word "comprise" and variations of the word, such as "comprising" and "comprises" is not intended to exclude other additives, components, integers or steps.
[0084]
[0068] , Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present disclosure. Thus, appearances of the phrases “in one embodiment” or “in an embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment, but may.
[0085]
[0069] , As used herein, the term “analyte recognition element” includes any molecule(s) that specifically interact with a target analyte of interest, the interaction causing a discernible change in the molecule(s). An analyte recognition element may be a polymer, and may comprise from about 5 to about 100 monomers, or from about 15 to about 50 monomers.
[0086]
[0070] , An aptamer is an exemplary form of analyte recognition element. Aptamers are small (usually from 20 to 60 nucleotides) RNA or DNA oligonucleotides formed from a single strand and able to bind a target analyte with high affinity and specificity. Aptamers may be considered as nucleotide analogues of antibodies, but aptamer production is an in vitro cell- free process that is significantly easier and cheaper than the production of antibodies by cell culture or in vivo methods. Aptamers typically comprise a polynucleotide sequence that promotes the assumption of 3 -dimensional shapes in the form of helices and singlestranded loops. Indeed, the specificity of aptamer binding is dictated not by the primary polynucleotide sequence, but instead by its 3 -dimensional structure, at least inpart. In some circumstances, binding will be influenced by hydrophobic interactions, hydrogen bonding, Van der Waals forces, base-stacking, and intercalation.
[0087]
[0071] , An analyte recognition element may be a biological molecule or an analogue thereof. An exemplary analyte recognition element may be comprised of DNA, RNA, PNA, XNA. Single-stranded and double-stranded arrangements are contemplated.
[0088]
[0072] , An analyte recognition element may comprise a non-natural nucleic acid. As used herein, the term “non-natural nucleic acid” is intended to include a polymer that is biosimilar to a natural nucleic acid polymer such as DNA or RNA, but having a chemical structure that is altered and not found in nature. As a result of the altered structure, the non- natural nucleic acid may be more resistant than a natural nucleic acid against degradation (such as cleavage of a chemical bond) occasioned by nucleases found in biological fluids such as blood and the ISF.
[0089]
[0073] , A non-natural nucleic acid may derive from a naturally occurring nucleic acid, but having had an alteration to its chemical structure such that the chemical structure is considered non-natural. More typically, the non-natural nucleic acid will be synthesised de novo in an altered form.
[0090]
[0074] , A non-natural nucleic acid molecule useful in the context of the present disclosure may be an altered form of an aptamer. The non-natural nucleic acid may be an oligomer having a non-natural backbone, being a molecular analogue to DNA or RNA. Examples of non-natural backbone oligomers include, but are not limited, to 2'-fluoroarabinoside nucleic acid (FANA), 2'-O-methyl RNA, locked nucleic acid (LNA), and threose nucleic acid (TNA). Collectively, these non-natural backbone oligomers are referred to as xeno nucleic acids (XNAs).
[0075] , Apart from the altered chemical structure which confirms stability in biological fluids, a non-natural nucleic acids may share one or more general features of aptamers such as length, base sequence (primary structure), secondary structure and tertiary structure.
[0091]
[0076] , One method of identifying aptamers useful in the context of the present disclosure is to use a method of the prior art (such as SELEX) to identify a natural DNA or RNA aptamer, and optionally to then modify the identified aptamer so as to have a non-natural chemical structure. Alternatively, methods such as SELEX may be adapted by the use enzymes configured to synthesise and amplify non-natural nucleic acids in the first instance.
[0092]
[0077] , An analyte recognition element may be a protein. The protein may in the form of a peptide, optionally having a length of between 10 and 100 amino acids or longer. The protein may be in the form of a monomer, dimer, trimer, tetramer or higher. Antibodies, antibody fragments (such as Fab fragments) and antibody-like molecules may be useful, whether polyclonal or monoclonal.
[0093]
[0078] , As for polynucleotides, proteins may be subject to modification. For example, backbone modification may be used to improve proteolytic stability of the peptide. Backbone modification includes the substitution of L-amino acids by D-amino acids , insertion of methyl-amino acids , and the incorporation of P-amino acids and peptoids. Introducing these non-natural amino acids into the peptide sequence, particularly at a proteolysis site, is an effective strategy for improving resistance to proteases or other deleterious factors.
[0094]
[0079] . Side chain modifications may be achieved by replacing the natural amino acids with their analogues during peptide synthesis, to improve their binding affinity and target selectivity. Variants of natural amino acid analogues such as homoarginine, benzyloxytyrosine, and P-phenylalanine are commonly commercially available, and can be conveniently used to chemically modify the peptide side chain during peptide synthesis.
[0095]
[0080] , The weak forces in proteins, such as hydrogen bonds, van der Waals forces, and intramolecular hydrophobic interactions may not be adequate for a stable secondary structure conformation. Additional modifications of the backbone, N- or C-termini, or sidechains for stabilization of secondary structures may be pursued.
[0081] , Cyclization is another potentially useful protein modification technique that can include various strategies, such as head-to-tail, backbone-to-side chain, and side chain-to- side chain cyclization. Cyclization can increase proteolytic stability, and allows mimicking and stabilization of the secondary structure.
[0096]
[0082] , The present disclosure is predominantly addressed to aptamers as an exemplary form of analyte recognition element. It will be understood that unless a contrary interpretation is suggested by the context of use, the term aptamer is only used for convenience as a representative species of the genus analyte recognition element.
[0097]
[0083] , In one aspect, the present disclosure provides a method of reducing the bioburden of an analyte recognition element, or a sensor working electrode functionalized with an analyte recognition element, the method comprising the step of exposing the analyte recognition element or the sensor working electrode with an amount of radiation.
[0098]
[0084] , The present disclosure is predicated at least in part on the surprising discovery that an aptamer-based sensor may be exposed to an amount of radiation sufficient to reduce bioburden, and even to the level of reduction required for disinfection or sterilization of a medical device, and yet remain able to usefully function in the detection of a target analyte. This finding is entirely contradictory to the accepted mode of action of radiation in destroying biological materials, and especially genetic material such as DNA and RNA to inactivate infectious agents such as bacteria, viruses and fungi. Such destruction would be expected to render any analyte-sensing aptamer of the sensor inoperable. As demonstrated experimentally in the Examples herein, DNA aptamers remain usefully functional in analyte sensing after irradiation by an electron beam in an amount capable of reducing bioburden, so long as irradiation occurs in a low water environment and / or after the electrode is functionalized with aptamer.
[0099]
[0085] , Before deciding to assess the usefulness of radiation to reduce bioburden in aptamer-based sensors, studies were performed on alternative sterilization means including chlorine dioxide (Example 7 herein), ethylene oxide (Example 8 herein), and ozone (Example 9 herein). Each of these agents essentially destroyed the ability of the aptamerbased electrochemical sensor to detect analyte (vancomycin). These negative findings dissuaded the inventors from any expectation that radiation would be successful. Against that background, significant doses of radiation delivered under certain conditions were found to have only a marginal impact on sensor operation (see Examples 1 to 5 herein)
[0100]
[0086] , Without wishing to be limited by theory in any way, it is proposed that any one or more of the following processes may be protective of the aptamers.
[0101]
[0087] . One possibility is that the absence of water, or low levels of water about the aptamer during irradiation limits the generation of water-originating radical species (such as hydroxyl species) capable of inducing DNA damage. Shorter aptamers may be able to associate with only a limited number of water molecules given the lack of any significant tertiary structure. Thus, a working electrode that has been functionalised with an aptamer may be subjected to a drying step to remove a significant amount of water before irradiation. The drying step may remove water from the electrode surface (i.e. the metal surface with which the aptamers are associated), the environment about the aptamers immediately above the electrode surface, and also the environment about the functionalised electrode. Typically, the dried working electrode will be assembled with other components to form a complete sensor product, which is sealed in a packet under a controlled humidity environment so as to prevent the reintroduction of water about the electrode. The sealed packet is then subjected to irradiation.
[0102]
[0088] , While water is a typical solvent used in the preparation of aptamer-functionalised electrodes, other solvents may be the origin of damaging radicals. For example, alcohols have a hydroxyl group (like water) and may be excluded from the environment about the aptamer so as to limit damage thereto.
[0103]
[0089] , Water and other solvents may be removed or excluded from about an aptamer, or an aptamer-functionalized electrode by any suitable means that does materially effect the aptamer in any adverse way. For example, heat may be used to evaporate water molecules, however the heat energy should not be so intense so as to destroy DNA. In combination with heat, a vacuum may be applied to remove evaporated water molecules.
[0104]
[0090] , Once an electrode and its environment is sufficiently dry, steps may be taken to ensure that water remains excluded. For example, the electrode may be maintained under vacuum and in the presence of a desiccant. As another example, the electrode may be sealed, and optionally vacuum sealed, in a packing that is substantially impermeable to water molecules. The requirement for low humidity conditions may cease once irradiation has been performed.
[0105]
[0091] . Another possibility for the resilience of aptamers to irradiation may be that the close juxtaposition of aptamers to each other (such as occurs on the surface of a functionalised electrode) is protective. Another possibility is that the use of passivation agents which cause the aptamers stand proud of the electron surface are protective. Yet a further possibility is that the electrode itself provides a ready sink for particles (such high energy electrons, or beta particles, emitted by an electron beam irradiator). Another possibility is that protection against damage is provided by a redox reporter species (such as methylene blue) attached to an aptamer. In any event, the present specification provides clear evidence that irradiation of an electrode timed in relation to functionalization preserves a useful proportion of analyte-binding capability of the aptamers used for functionalization.
[0106]
[0092] , Again without wishing to be limited by theory, the unexpected resilience of aptamers to irradiation may be due at least in part to the limited lengths of aptamers. Aptamers comprising less than about 150 nucleotide bases provide less opportunity for DNA damage (strand breaks / nucleotide damage / dimers etc). By comparison, microbial genomes are significantly longer and therefore more prone to damage by irradiation.
[0107]
[0093] , A further possible explanation for the resilience of aptamers may be that the stem and loop structures that are characteristic of many aptamers capable of specific interaction with an analyte resist damage by irradiation.
[0108]
[0094] , Radiation may be provided in preparation for functionalization of the electrode to form a working electrode. For example, the aptamers may be in solution about the electrode but not yet thiol-bonded to the electrode surface when radiation exposure occurs. Alternatively, the aptamers may be bonded to the electrode surface but no passivation of the electrode has occurred when radiation exposure commences. As another alternative, radiation may be provided before any post passivation process has occurred.
[0109]
[0095] , Radiation may be provided only after all functionalization processes are complete. Alternatively, radiation exposure may commence before functionalization, and end before or after functionalization is complete. As a further alternative, radiation exposure may commence during functionalization or end during or after functionalization is complete.
[0096] , As used herein, unless a contrary meaning in indicated contextually, the term “functionalization” and variants thereof means the process of treating an electrode that is incapable of useful operation as a working electrode when utilized in a sensor apparatus to detect a target analyte so as to become capable of doing so. In some cases, the aptamers may be pre-formed (by a synthesis method) and bonded to the electrode surface. In other cases, the aptamers are synthesised base-by-base in situ on the electrode surface. Other methods of functionalization known at present or to be devised in the future are included in the scope of the term.
[0110]
[0097] , In the functionalization of an electrode of an aptamer-based sensor, the aptamers are typically associated in some manner with the electrode such that a redox reporter of the aptamers is sufficiently proximal to the electrode surface to allow for electrons to transfer between the surface and reporter. The association typically results in immobilization of the aptamer on the electrode surface.
[0111]
[0098] , In the process of being associated with the electrode surface, the aptamers are often present in dilute solution at first instance, with the distance between aptamer molecules being relatively large. As the aptamers are associated with the electrode surface, the average distance between aptamer molecules decreases until a minimum average distance is achieved. When associated with the electrode surface, the aptamers are typically densely packed so as to provide for useful analyte sensitivity. The decrease in inter-aptamer distance and / or immobilization on the electrode surface may protect the aptamer against radiation-induced damage
[0112]
[0099] , In some embodiment, an aptamer is already associated with a redox reporter species during the process of associating with the electrode. In that regard, the association of redox reporter with the aptamer may be considered preparatory to electrode functionalization.
[0113]
[0100] , In other embodiments, the redox reporter is associated with the aptamer subsequent to the aptamer being associated with the electrode surface and may therefore be considered a part of the functionalization process proper.
[0114]
[0101] , More detailed disclosure of exemplary processes associated with electrode functionalization is provided below. It is not represented that any or all of the processes discussed are required for functionalization.
[0102] , Functionalization may include the formation of a thiol monolayer on the electrode surface, typically a gold (Au) surface. Aptamers may be efficiently immobilized in high- density monolayers. An array of immobilization techniques are available: (streptavidinbiotin interactions, electrodeposition, physisorption, and chemisorption. Many immobilization methods rely on the chemisorption of thiols [(R-SH), disulfides (R-S-S- R) and sulfides (R-S-R)] to gold. Thiols strongly adsorb onto metal surfaces such as gold, silver, platinum, and copper. The sulphur groups naturally adsorb onto the metal surface from solution to form a monomolecular layer, termed a “self-assembled monolayer” (SAM). Gold is preferred because of its inertness and ability to form defined crystal structures, which in turn facilitate the generation of SAMs.
[0115]
[0103] , Monolayer formation commences with diffusion-controlled physisorption, followed by the chemisorption of the molecules, and finally the crystallization process. The physisorbed state on gold is disordered with only van der Waals forces providing the adsorption. In chemisorption, the sulfur loses the mercaptan hydrogen atom and bonds coordinatively with three gold atoms to form a strong covalent bond. In crystallization, the molecules align through tail-tail interactions to provide highly ordered and orientated monomolecular layers.
[0116]
[0104] , The monolayers, however, are imperfect having various types of disorders such as pin holes. Factors influencing the ordering of the monolayer include substrate quality, temperature, solvent, and adsorption time. A time of 2 to 12 h may be used for long-chain alkanethiols, whereas over 24 h may be required for short-chain alkanethiols. The size of the terminal groups may be important, whereby smaller groups such as -NH2 and -H) exhibit little influence, with larger groups such as -COOH and ferrocene reducing packing density and order of the monolayer.
[0117]
[0105] , Aptamers may be immobilized by direct thiolation or via short thiolated linkers. A simple and effective method of aptamer immobilization on gold surfaces is by way of covalent linkage via a thiol group. This method may be used in combination with either straightforward approaches, such as passivating with alkanethiols or dithiols. Low- molecular weight linkers, such as cysteamine, 3 -mercaptopropionic acid, 3,3'- dithiodipropionic acid, Lomant’s Reagent, aromatic thiols, or trithiaadamantane, may be used that also rely on the formation of self-assembled monolayers of thiolated compounds.
[0106] , As an alternative to thiol linkage, nitrogen strongly interacts with gold and accordingly nitrogen-based functional groups may be used to immobilize aptamers. Exemplary embodiments use a poly(thymine) tag to absorb capture DNA probes on gold surfaces. Moreover, gold itself may be modified by electrochemical deposition to, for example, graft diazonium salts onto a gold electrode surface by way of cyclic voltammetry. Alternatively, electrodeposition of reduced graphene oxide on gold by the application of a DC voltage may be used.
[0118]
[0107] , Immobilization strategies typically rely on a strong interaction between thiol and gold. Generally, the aptamer is directly labelled with a thiol group, or via an alkyl chain or poly(thymine) linker. Thiolated aptamers do not only bind to gold surfaces via Au-S bonds, but via nonspecific absorption through interactions with multiple nitrogen atoms. This approach may restrict the accessibility of the analyte to the aptamer which may be overcome by a passivation method in which mercaptohexanol (MCH) is added after immobilization of the aptamers. MCH displaces the nonspecifically adsorbed parts of the aptamers and orientates them upright so as to extend outwardly from the electrode surface. Accordingly, an organized binary self-assembled monolayer is obtained to provide higher aptamer density and improved analyte accessibility. These ssDNA / alkanethiol monolayers have been extensively characterized to confirmed the upright orientation.
[0119]
[0108] , Aptamers and mercaptohexanol may be simultaneously co-immobilized in the course of electrode functionalization. By modulating the ratio, surface density of the DNA can be controlled to optimize the sensor performance (a high density being generally preferred to increase sensitivity however not so high as to prevent incorrect folding and steric hindrance.
[0120]
[0109] , Besides mercaptohexanol, alkanethiols of different lengths may be used, the length of the linker between the aptamer and its thiol label may be adjusted to allow optimum folding, target binding, useful charge transfer kinetics, and prevention of biofouling (longer alkyl chains better resisting biofouling).
[0121]
[0110] , An aptamer may be thiol-labelled at either the 5' or the 3' end, although 5' is generally preferred. Aptamers may be linked to thiol via a C5 linker to provide enough spacing for aptamer folding and target analyte binding in combination with MCH, a C6 alkanethiol.
[0111] . As an alternative to direct immobilization of thiolated aptamers, short linkers may be assembled on the electrode via Au-S chemistry, providing an attachment means for the aptamers. For example, 3 -mercaptopropionic acid (MPA) may be used as an intermediate linker, to which carboxylic group the aminated aptamer is bound using EDC / NHS chemistry.
[0122]
[0112] , The reaction of carboxylic acids and primary amines may be exploited in electrode functionalization. Amide bonds are preferred for stable immobilization given their poor reactivity. The most common reaction strategy for this purpose is a carbodiimide-mediated process using 1 -ethyl-3 -(-3 -dimethylaminopropyl) carbodiimide hydrochloride (EDC)
[0040] , as depicted in Figure 4. EDC reacts with carboxylic acid groups to form an active O- acylisourea intermediate that is, just like EDC itself, water-soluble. O-acylisourea can be easily displaced by nucleophilic attack from primary amino groups, which form an amide bond with the original carboxyl group and release EDC as a byproduct. To improve the yield of the reaction, N-hydroxysuccinimide (NHS) or its water-soluble analogue Sulfo- NHS is used in a second reaction step that leads to the formation of more stable intermediates and allows the conjugation to primary amines at physiologic pH
[0040] , NHS binds to the carboxylic group, forming an NHS ester and releasing EDC. With the binding of the primary amine, NHS is released and an amide bond between the carboxylic acid and the amide is formed.
[0123]
[0113] , In some embodiment of the method, aptamers are synthesised base-by-base on the surface of the electrode by solid phase synthesis. In such embodiments, radiation may be provided before the course is complete or after synthesis is complete.
[0124]
[0114] , The above description of electrode functionalization and that in the Examples is not intended as an exhaustive review of the methods available to the skilled artisan.
[0125]
[0115] , In the present methods, the plurality of aptamers and / or the electrode is exposed to an amount of radiation. The amount of radiation for the exposure may be determined by reference to whether disinfection is required (relatively low amounts) or sterilization is the aim (elative high amounts). The amount of radiation may also be determined according to susceptibility of the target infectious agent(s).
[0126]
[0116] , As discussed in the Background section herein, a key problem in the commercial application of aptamer based sensors for use in medical devices is the regulatory requirement for disinfection of sterilisation by some validated method. For example, where an aptamer-based sensor comprises electrodes which pierce the skin FDA mandates category A or Category B sterilization, either of which may be achieved by exposure of the device to a sufficient amount of radiation. However, it would expected that any efficacious amount of radiation would damage an aptamer-based working electrode to the point that sensitivity for the target analyte is materially negatively impacted. In the present methods, and given the benefit of present specification, the amount of radiation may be determined by an informed empirical approach, or even by trial and error.
[0127]
[0117] , In one approach, an amount of radiation providing a mandated log reduction for a target infectious agent is used, with an assessment then being made of any damage caused to the aptamers. Damage may be determined directly by analysis of the aptamers, or indirectly by determining any reduction of sensitivity. Should the damage determined be insufficient to materially affect sensitivity of the electrode, the amount of a radiation tested may be that used in actual commercial electrode production. In the event that the damage is sufficiently deleterious to operability, the amount of radiation may be titrated downwardly to determine an amount that is an effective compromise between log reduction and electrode sensitivity.
[0128]
[0118] , According to the present methods, some significant reduction in electrode sensitivity may be unavoidable in order to achieve a mandated log reduction in infectious agent. In such circumstances, the amount of radiation may be maintained but with an increase in aptamer density on the electrode. In addition or alternatively, the aptamer may be modified so as to increase affinity for the target analyte (for example by targeted mutagenesis, truncation or elongation) or indeed replaced altogether by a higher affinity aptamer.
[0129]
[0119] , The radiation may take the form of ionizing radiation such as gamma rays provided by cobalt-60, or by e-beam radiation provided by an electron accelerator. Lower energy radiation such as UV-C (being ultraviolet radiation emitted in the wavelength range 280 nm-100 nm)
[0130]
[0120] , The radiation may take the form of micro waves. Even microwaves produced by a domestic appliance (2.45 GHz) completely inactivate bacterial cultures, mycobacteria, viruses, and G. stearothermophilus spores within 60 seconds to 5 minutes depending on the challenge organism.
[0131]
[0121] , Apparatus for the delivery of radiation is sterilization and disinfection protocols for medical devices are known to the skilled artisan, and having the benefit of the benefit specification may be implemented in the present methods. For example, e-beam sterilizing apparatus suitable for medical devices are provided by Wasik Associates (Dracut, MA, United States). Gamma irradiation is more typically outsourced to a dedicated service provider such as Sterigenics (Charlotte, NC, United States).
[0132]
[0122] , It will be convenient to implement the present disclosure as a terminal sterilization method in relation to a working electrode or a complete sensor production process. Thus, methods are provided whereby a completed working electrode or sensor is exposed to an amount of radiation. A completed working electrode is already functionalized, and a completed sensor comprises an already functionalized working electrode and in terminal sterilization methods radiation exposure is therefore effected after functionalization.
[0133]
[0123] , The exposure to radiation may be performed before, during or after a packaging step. Preferably, the packaging completely surrounds and seals the working electrode or sensor so as to prevent ingress of an infectious agent. Exposure to the packaging and packaging contents to a sterilizing amount of radiation inactivates infectious agents to the desired level, with no new agents being capable of entering the packaging and contaminating the contents.
[0134]
[0124] , In some methods of the disclosure, the working electrode may be irradiated either alone or in combination with a counter electrode and / or a reference electrode. Other components of the aptamer-based sensor may be irradiated separately (and possibly receiving a different amount of radiation). Some components of the sensor may be treated, disinfected or sterilised by means other than irradiation, such as by chemical means, ozone, ethylene oxide, vaporized hydrogen peroxide, dry heat, wet heat, chlorine dioxide, vaporized peractetic acid, and nitrogen dioxide. Choice of a particular disinfection or sterilization means for a certain component may be guided by the propensity of the material(s) concerned to degrade or be otherwise detrimentally affected.
[0125] , Reference is made to the flow diagrams of FIG. 1 showing three non-limiting alternatives for the use of radiation in relation to a packaged aptamer-functionalized working electrode.
[0135]
[0126] , In FIG. 1A, the method is for the preparation of a working electrode that may be packaged and stored for later use in the manufacture of a sensor. The functionalized working electrode is sealed in a package configured to prevent ingress of infectious agents, with the package and enclosed working electrode being sterilised by radiation.
[0136]
[0127] , In FIG. IB, a functionalized working electrode is irradiated, and instead of being packaged it is assembled with other components to produce a sensor. The sensor is then packaged. This arrangement may be used where, for example, the other sensor components are not suitable for irradiation or do not require irradiation.
[0137]
[0128] , In FIG. 1C, a functionalized working electrode is assembled with other sensor components to produce a sensor. The sensor is packaged, and subject to terminal sterilization by irradiation. This arrangement is generally preferred in the field of medical device sterilization given the ability to ensure the substantial absence of infectious agents in the packaged product.
[0138]
[0129] , An EAB sensor potentially useful in the context of the present disclosure may be of the voltametric, chronoamperometric, or impedimetric type. In a voltametric sensor, a potential waveform is applied to the sensor interface, and the resulting current response is recorded. In chronometric approaches, a step potential is applied and the resulting timeevolving current response is recorded. In impedimetric sensing, a sinusoidal potential waveform is applied and the resulting sinusoidal current response is recorded.
[0139]
[0130] , EAB sensors are typically of the voltammetric type, with the aptamer (or nonnatural nucleic acid of the present disclosure) being bound to the working electrode. Gold is often used as the probe surface for the working electrode. The aptamer has an associated redox-active species which acts as a reporter. The redox reporter is often methylene blue. Upon target (e.g., drug) binding, the aptamer undergoes a conformational change, bringing the redox reporter more proximal to the working electrode surface. This increase in proximity increases electron transfer from the redox reporter to the electrode. The increase in speed of electron transfer contributes to a change in Faradaic current that is detected by a potentiostat. EAB sensors are typically incorporated into a circuit having a reference electrode. The reference electrode is the site of a known chemical reaction that has a known redox potential. For example, a reference electrode based on the silver-silver chloride (Ag|AgCl) redox pair has a fixed and known potential forming the point against which the redox potential of the working electrode is measured. Also typically included in the circuit is a counter electrode which functions as a cathode or an anode to the working electrode. Because current does not pass through the reference electrode (due to an impedance of the potentiostat), any current generated is attributed to the working and counter electrodes. Current is measured as a function of potential of the interrogating electrode versus the reference electrode. The difference in potential produces the current in the circuit thereby generating an output signal. The signal quantifies target binding depending on electron transfer that is ideally stoichiometrically proportional to target binding.
[0140]
[0131] , The present apparatus, when assembled, is particularly suitable for use as a wearable apparatus, allowing measurements to be performed whilst the subject is undergoing normal activities and / or over a prolonged period of time. The wearable apparatus may be a collar, a bracelet or other suitable jewellery piece, a watch, a garment, a strap, an adhesive, or a patch. A person skilled in the art would appreciate that means may be provided to assist adhering and / or securing the wearable apparatus, when in use, to a subject, e.g., micro-anchors, or the like.
[0141]
[0132] , The wearable apparatus may comprise a housing structure comprising one or more other components, such as electronics processing unit. The electronics processing unit is configured to be in direct or indirect electrical communication with at least one conductive element (such as an electrode), and generally will include any one or more of a power source, a data processing unit, an analog front-end, and a wireless transmitter.
[0142]
[0133] , The housing structure may be configured to encase, at least partially, the apparatus, where the electrodes (such as microneedles) are exposed from a plane of the housing structure. The electrodes may be protected by a protective cover, which may be removed to expose the protruding electrodes before use.
[0143]
[0134] , The apparatus may further comprise means for monitoring temperature or pH of the bodily fluid where validity of an output is dependent thereon, or where adjustment to operation or output is possible.
[0135] , The housing structure may be configured to encase and be coupled to the apparatus by any appropriate mechanism. For example, electromagnetic coupling, mechanical coupling, adhesive coupling, magnetic coupling, or the like. In some embodiments, the coupling mechanism enables the apparatus and the housing structure to be attached and detached, which would enable the housing structure and its other components to be reusable, while the apparatus can be discarded and replaced with another apparatus as necessary.
[0144]
[0136] , The wearable apparatus may further comprise a computer program product executable as a software application, resident on a mobile communication apparatus in communication with the electronics processing unit, wherein the computer program product is able to control one or more of (i) detection of electrochemical measurements conducted at the electrode-based platform, (ii) data analysis, (iii) data transmission, (iv) apparatus configuration, and (v) apparatus power management. Examples of suitable mobile communication apparatus include, but are not limited to, smartphones, smartwatches, tablets, smartglasses, laptops or other personal computers.
[0145]
[0137] , In some embodiments, the apparatus itself comprises a processor with program instructions configured to drive onboard functions such as voltammetry, and transmitting output to a remote apparatus via a wireless module, such as a Bluetooth™ module.
[0146]
[0138] , The working electrode or any other electrode may be a wire, a needle, or a microneedle, which contact the ISF, blood or any other relevant bodily material of a subject. Microneedles are preferred for transdermal applications where piercing of the skin is necessary to contact the ISF.
[0147]
[0139] , Electrodes used in the context of the present disclosure can be fabricated in a range of various shapes and geometries, although their specific geometry for transdermal applications be optimised to breach the stratum corneum for reliable skin penetration. The present apparatus may be configured to be urged into the skin of a subject to facilitate the electrodes breaching the stratum corneum and to penetrate through the skin layers. For nonhuman applications, the stratum corneum may be replaced by an analogous, or even a nonanal ogous layer on the surface of the subject.
[0140] , Generally, each electrode will have the shape of a protruding pointed structure extending from the mount. Typically, the electrodes will extend generally perpendicular from the mount.
[0148]
[0141] , The protruding structure of each electrode can be of any needle-type shape. For example, protruding structure may taper smoothly from a base to form a pointed tip (e.g., cone shape), may have multiple lateral sides extending from a base that converge to form a pointed tip (e.g., pyramid shape or triangular prism), be tapered in just one dimension, or have a base with curved sides of relatively constant diameter, which is segmented to form a pointed tip (e.g., a segment of a cylindrical shape). Typically, the pointed tip will be sharp. The electrode may or may not include shape changes along its length. Further, any edge or side of the shape may be bevelled, curved, or rounded.
[0149]
[0142] , In some embodiments, the shape of the electrode tip is a cone, or a pyramid such as a triangular pyramid, square pyramid, or hexagonal pyramid. In other embodiments, the shape of the electrode tip is a tetrahedron or a triangular prism. In further embodiments, it may take the shape of a rocket, turret, arrowhead, spike, or spear.
[0150]
[0143] , It will be appreciated that a range of other shapes could be used. For example, the shape may a circular or an elliptical cylinder, which is truncated. Any of the other shapes described herein may or may not be truncated. The term “truncated”, as used in this context, may refer to a shape cut on a plane parallel to the base, which may be referred to as a parallel-truncated shape or more specifically, a frustum, or a shape cut at an angle relative to an axis of the electrode, which may be referred to as an angular-truncated shape. For angular-truncated shapes, the angle of truncation relative to an axis of the shape will be at least about 50° and no more than about 75°. It will be appreciated that the same or different shapes could be provided on a single EAB sensor.
[0151]
[0144] , The exterior wall of the microneedle may have a smooth or rough surface, and can include surface features, such as raised portions, etchings, serrations, anchors, barbs, or the like, which may assist engaging a biological tissue once the electrodes have breached the stratum corneum to secure them within the subject. It will be appreciated that the ability of an EAB sensor to remain in situ is particularly beneficial, as this ensures that continuous measurements over a prolonged period of time are made at the same site within the subject. Furthermore, constraining the location in which measurements are performed ensures more accurate longitudinal monitoring. In some embodiments, the EAB sensor is configured to remain in situ for at least one minute, at least one hour, at least about 8 hours, at least about 18 hours, at least one day (about 24 hours), at least about 3 days, at least about 4 days, or at least one week. In some applications it may be necessary or desirable to remain in situ for one month or more.
[0152]
[0145] , It will be appreciated that the size of the electrodes, and their arrangement on the mount, may vary depending upon the intended application.
[0153]
[0146] , The electrodes may be of a length at least greater than the thickness of the stratum corneum and to penetrate the skin layers to a depth of at least 100 pm, to be positioned in a biological tissue to contact a bodily fluid of a subject. In some embodiments, the length will be at least about 10% greater than the thickness of the stratum corneum, at least about 20% greater than the thickness of the stratum corneum, at least about 50% greater than the thickness of the stratum corneum, at least about 75% greater than the thickness of the stratum corneum, or at least about 100% greater than the thickness of the stratum corneum. In some embodiments, the length is less than about 1500 pm, less than about 1000 pm, less than about 500 pm, greater than about 100 pm, greater than about 50 pm, greater than about 20 pm, or greater than about 10 pm. In other embodiments, the length is between about 100 pm and about 1000 pm.
[0154]
[0147] , In some embodiments, the electrodes have a tiered arrangement and thus would not all be of the same length.
[0155]
[0148] , The base width of the electrodes may be at least less than about 50% of the length, less than about 25% of the length, less than about 20% of the length, less than about 15% of the length, less than about 10% of the length, or less than about 5% of the length. In some embodiments, the base width is at least about 100 pm but no more than about 400 pm. In other embodiments, the diameter is about 200 pm, or about 300 pm.
[0156]
[0149] , The present disclosure will now be more fully described by reference to the following non-limiting examples.
[0157] EXAMPLE 1: E-BEAM IRRADIATION OF APTAMER-BASED ELECTRODE FUNCTIONALIZED WITH VANCOMYCIN-SPECIFIC APTAMER OF 28 BASES
[0158]
[0150] , Working electrodes for an EAB sensor were produced using a vancomycin-specific ss DNA aptamer having the following sequence: GCGAGGGTACCGCTTAAAGTGGGTCGGC
[0159]
[0151] , The preparation protocol included electrochemical cleaning of gold electrodes in 0.5
[0160] M NaOH for cyclic voltammetry, as follows:
[0161] Estart = -1.0 V; Eswitch = -1.6 V vs Ag|AgCl v = 1 V s’1
[0162] 200 cycles with Estep = 2 mV
[0163]
[0152] , Electrochemical treatment followed in 0.5 M H2SO4:
[0164]
[0153] , For cyclic voltammetry:
[0165] Estart = 0 V; Eswitch = +1.6 V; Efmai= -0.2 V vs Ag|AgCl v = 100 mV s'1
[0166]
[0154] , Cycle until reproducible voltammograms are obtained:
[0167] Estep 1 mV
[0168] Electrodes were washed 3 times with 1 mL of nuclease free H2O.
[0169]
[0155] , Electrode functionalization was performed according to the following method:
[0170] 2 pL of 10 mM tris(2-carboxyethyl)phosphine hydrochloride (TCEP) was added to
[0171] 2 pL of 100 pM DNA-aptamer for vancomycin [5ThioMC6- D / VancomycinDNA / 3MeBIN] and kept in the dark for 1 h. Solution was pipetted in / out 5 times.
[0172] Adjusted [5ThioMC6-D / VancomycinDNA / 3MeBIN] to 500 nM using PBS lx + 2 mM MgCb. Solution was pipetted in / out 5 times.
[0173] Electrodes were kept immersed in individual solutions for 1 hour in the dark.
[0174] Incubation followed in in 20 mM 6-mercapto- 1 -hexanol in PBS lx + 2 mM MgCF overnight at room temperature and in the dark.
[0175] Electrodes rinsed for 10 minutes in PBS lx + 50 mM HEPES Solution.
[0176]
[0156] , The working electrodes (n=12) produced in accordance with the protocol above were air dried and exposed to electron-beam radiation in an amount of 15kGy. Control working electrodes (n=4) were not irradiated.
[0177]
[0157] , The irradiated working electrodes and controls were each connected to E AB sensor circuitry including a potentiostat a counter electrode, and a reference electrode.
[0158] , Interrogation in the absence of target analyte (vancomycin) was performed by cyclic voltammetry. The resultant voltammograms for the control and test electrodes are shown at FIG. 2 showing comparable levels of SAM coverage on each electrode surface.
[0178]
[0159] , Each of the test and control working electrodes were again interrogated by cyclic voltammetry to demonstrate, as a quality control check, that for all electrodes aptamer DNA was retained on the surface and were properly responsive in terms of the ability of the methylene blue redox reporter to evoke a current in the working electrode (see FIG. 3).
[0179]
[0160] , FIG. 4 shows a comparison of baseline currents produced by interrogation at
[0180] 100Hz, and in the absence of vancomycin. The output demonstrates that working electrodes exposed to e-beam radiation provide comparable baseline peaks to those that were not irradiated.
[0181]
[0161] , FIG. 5 shows a comparison of % signal gain as a function of frequency in the presence of 200 pM vancomycin. As will be noted, graphs for non- irradiated and irradiated working electrodes demonstrate very similar profiles. In some instances the % signal gain was higher for irradiated versus non-irradiated electrodes.
[0182]
[0162] , FIG. 6 shows the results of an experiment using square wave voltammetry at two different frequencies to enable drift correction in an approach called kinetic differential measurements (KDM). KDM utilises the difference between relative SWV measurements taken at two frequencies to subtractively correct for drift. In turn, KDM values may be converted into estimated analyte concentration by fitting to a Hill-Langmuir equation. For this experiment, square wave voltammetry was performed at 30 Hz and 10 Hz across a range of vancomycin concentrations, and KDM values determined for each. It will be noted that the KDM values determined for the irradiated electrodes fall within the range of KDM values determined for non-irradiated electrodes.
[0183]
[0163] , Collectively, the data shown at FIG. 1 through FIG. 6 demonstrate that EAB sensors having a working electrode functionalized with a 28-mer aptamer specific for vancomycin remain functional after irradiation by E-beam (15kGy). Signal gain upon exposure to vancomycin is maintained for irradiated sensors. Overall, sensor performance is not seriously impacted by 15kGy E-beam exposure when compared to non-irradiated control sensors. EXAMPLE 2: E-BEAM IRRADIATION OF APTAMER-BASED ELECTRODE FUNCTIONALIZED WITH (I) VANCOMYCIN- SPECIFIC APTAMER OF 45 BASES, AND (II) PHENYLALANINE- SPECIFIC APTAMER OF 38 BASES.
[0184]
[0164] , Experiments similar to those described in Example 1 were performed in relation to electrodes functionalized with a second species of vancomycin-specific aptamer (a 45-mer, compared with the 28-mer of Example 1) and also an aptamer specific for phenylalanine (38-mer).
[0185]
[0165] , Test electrodes were irradiated as for Example 1, with control electrodes remaining non-irradiated.
[0186]
[0166] , FIG. 7 shows a voltammogram pursuant to cyclic voltammetry for the vancomycinspecific electrode in the absence of vancomycin for both test and control electrodes. The test and control voltammograms are comparable indicating a similar levels of SAM coverage.
[0187]
[0167] , FIG. 8 shows a voltammogram pursuant to cyclic voltammetry for the phenylalanine-specific electrode in the absence of phenylalanine for both test and control electrodes. The comparable voltammograms indicates similar levels of SAM coverage.
[0188]
[0168] , Both test and control vancomycin-specific electrodes were assessed for signal gain upon addition of vancomycin at 500pM. The result is shown in FIG. 9, evidencing a 30% signal gain for the non-irradiated control electrode, and a comparable 32% signal gain for the irradiated electrode.
[0189]
[0169] , Test and control phenylalanine-specific electrodes were assessed for signal gain upon addition of phenylalanine at 2500pM. The result is shown in FIG. 10, evidencing a 42% signal gain for the non-irradiated control electrode, and a 27% signal gain for the irradiated electrode. While the signal gain for the test electrode was lower than that for the control, the signal gain evidenced in the control is nevertheless indicative of a workable electrode.
[0190]
[0170] , FIG. 11 shows a comparison of % signal gain as a function of frequency for the irradiated vancomycin-specific aptamer in the presence of 500pM vancomycin, compared to the control electrode. The non-irradiated and irradiated electrodes demonstrate similar profiles. In the majority of cases, the % signal gain was found to be higher for irradiated versus non-irradiated electrodes.
[0171] , FIG. 12 shows a comparison of % signal gain as a function of frequency for the irradiated phenylalanine-specific aptamer in the presence of 500pM phenylalanine, compared to the control electrode. The non-irradiated and irradiated electrodes demonstrate similar sigmoidal profiles, albeit with the irradiation DNA sample having a less pronounced profile.
[0191]
[0172] , Similar to the experiment in Example 1, KDM was measured for test and control electrodes across a range of vancomycin concentrations. Reference is made to FIG. 13 showing that both test and control electrodes responded to each increase in vancomycin concentration.
[0192]
[0173] , KDM was measured for test and control electrodes for the phenylalanine-specific electrode across a range of phenylalanine concentrations. The results are shown in FIG. 14 showing that for both irradiated and non-irradiated electrodes, a measurable increase in KDM was noted for each increase in vancomycin centration. An exception is seen for one of the test electrodes where KDM decreased to sub-zero at the 500 pM concentration of phenylalanine. In any event, the data overall supports that irradiated electrodes function well as working electrodes across a range of target concentrations.
[0193]
[0174] , Collectively, the data of FIG. 7 through to FIG. 14 demonstrate the following.
[0194] Irradiation causes some damage to the SAM on the electrode surface. Methylene blue peaks are present showing that aptamer DNA is present on sensor surface post-irradiation. The electrodes also retain response to target after irradiation.
[0195]
[0175] , Both irradiated vancomycin- and phenylalanine specific electrodes show a signal gain that is reduced when compared with non-irradiated controls, however percentage signal gain is adequate to produce a functional EAB sensor.
[0196]
[0176] , Some reduction in KDM response for aptamers of both specificities were seen post
[0197] E-beam exposure.
[0198]
[0177] , Even considering the differences in response noted after irradiation, irradiated aptamers specific for vancomycin and phenylalanine were each able to detect increasing concentrations of analyte.
[0199] EXAMPLE 3: ASSESSMENT OF THE EFFECT OF RADIATION ON APTAMER DNA NOT ATTACHED TO ELECTRODE SURFACE.
[0178] , This experiment was carried out to investigate if aptamer DNA could be E-beam treated without attachment to a sensor surface and remain functional.
[0200]
[0179] , A stock preparation of ss DNA aptamer (vancomycin-specific 28-mer as described in Example 1) was prepared and divided into two samples. The first sample “RT Control” was maintained at room temperature (“RT”) for the duration of the experiment to control for degradation occurring over the travel time between Applicant’s laboratory and a remote E-beam treatment facility. The second sample “E-beam DNA” was couriered to a remote E-beam treatment facility and dosed with 15kGy.
[0201]
[0180] , Each of the RT Control and E-beam DNA samples were then used to functionalize a batch of working electrodes. A further set of electrodes were functionalized using a freshly prepared stock of ss aptamer DNA (“Fresh Control”).
[0202]
[0181] , FIG. 15 shows a voltammogram generated by cyclic voltammetry of a series of electrodes functionalized with RT DNA, and a series of electrode functionalized with Fresh Control DNA. The resultant graphs were virtually identical indicating little to no degradation of DNA occurred in the time period required to transport samples between the laboratory and the E-beam treatment facility.
[0203]
[0182] , FIG. 16 shows a voltammogram generated by cyclic voltammetry of a series of electrodes functionalized with RT Control DNA, and a series of electrode functionalized with E-beam DNA. No target analyte (vancomycin) was present. The resultant graphs show the SAM on the electrode surface for the E-beam DNA sample was heavily damaged, as compared with the RT control.
[0204]
[0183] , Interrogation of the electrodes by square wave voltammetry (200 Hz) in the presence of 200 pM vancomycin or absence of vancomycin shows a 150% gain in current output for the RT control DNA upon exposure to target, with the E-beam DNA sample showing a gain increase of only 23% (see FIG. 17).
[0205]
[0184] , Reference is made to FIG. 18 showing a signal gain frequency map for RT control,
[0206] E-beam DNA and fresh control DNA samples in the presence of 200 pM vancomycin. As expected, electrodes functionalized with freshly prepared aptamer DNA showed a similar profile to those functionalized with RT control. In contrast, the E-beam DNA electrodes demonstrated an almost linear profile, demonstrating the effect of irradiation of aptamer DNA that is not immobilised on an electrode.
[0185] , FIG. 19 shows the effect of aptamer immobilization on KDM response to increasing vancomycin concentration. Freshly prepared and RT control aptamer DNA exhibited similar responses to an increase in concentration. By contrast, an electrode functionalized with aptamer DNA that was previously irradiated by E-beam showed a response that was attenuated by around 75%.
[0207]
[0186] , Overall, the data of Example 3 demonstrate that 15kGy E-beam exposure of aptamer DNA prior to functionalization leads to a heavily damaged sensor. Specifically, cyclic voltammetry shows that radiation exposure significantly damaged the SAM. Response upon exposure to target is maintained for E-beam exposed electrodes, but % signal gain is significantly reduced when compared to controls (-23% vs. 150% signal gain). Overall sensor performance is seriously impacted by DNA exposed to 15kGry E- beam when compared to non-irradiated control DNA. (-75% drop in KDM response).
[0208]
[0187] , These results indicate that DNA attachment to sensor surface prior to E-beam exposure may be a factor in retaining sensor performance post-irradiation.
[0209] EXAMPLE 4: COMPARISON BETWEEN CIDEX™ AND E-BEAM EXPOSED APTAMER FUNCTIONALISED WORKING ELECTRODE OF ELECTROCHEMICAL SENSOR
[0210]
[0188] , In this comparative example, the frequency response of a working electrode functionalised with a vancomycin sensitive DNA aptamer to target (500pm vancomycin) was determined after Cidex™ exposure, E-beam exposure (about 15 kGy), or no treatment. Eight electrodes were used for each of the groups. The working electrodes were air dried before exposure in all cases. Reference is made to FIG. 20, showing the results of the study, with the error bars representing 1 standard deviation. It will be noted that gain for E-beam exposed electrodes was equivalent to those that were exposed to Cidex™, and also untreated electrodes.
[0211] EXAMPLE 5: EFFECT OF HUMIDITY DURING E-BEAM EXPOSURE ON SENSOR RESPONSE TO TARGET
[0212]
[0189] , Working electrodes were prepared in two batches (designated WE-25.0058 and
[0213] WE-25.0059). Electrodes were produced from roughened soft gold needles. Electrodes were first cleaned, followed by a 1 hr incubation with lOOmM TCEP, Diluted to 500nM DNA with PBS, 2.5hr incubation in V-A295 at 5°C, 5mM MCH incubation for 16 Hrs, 50mM HEPES Rinse for 10 minutes. V-A295 is a vancomycin sensitive aptamer.
[0214]
[0190] , Electrode surface area measurements were taken before functionalization: WE-
[0215] 25.0058 = 0.8401 cm2(per needle); WE-25.0059 = 0.8025 cm2(per needle)
[0216]
[0191] , Each batch of electrodes was made up of 5 paddles containing 16 Working electrodes per paddle. 1 paddle was tested on Day 0 as a control with 1 each of the remaining 4 paddles per experimental condition. PBS + 0.7mM MgC12 + 40mM HEPES at 35° C, 16 replicates per condition.
[0217]
[0192] , For low humidity conditions, functionalised electrodes were packaged into a pouch
[0218] (150 mm x 230 mm) with 5 x Pharmakeep™20 combined oxygen absorber and desiccant to maintain relative humidity at <10%.
[0219]
[0193] , For high humidity conditions, functionalised electrodes were packaged into a pouch
[0220] (150 mm x 230 mm) with Integra Boost™ humidity control pack to maintain relative humidity at 62%.
[0221]
[0194] , E-beam irradiation was performed so as to provide a total dose of between 12.66 to
[0222] 14.65 kGy.
[0223]
[0195] , Except for control electrodes, all electrodes subject to experimental manipulation were stored for 10 days post fabrication before testing. Storage conditions were as follows: irradiated (10% relative humidity or 62% relative humidity) and non- irradiated (10% relative humidity or 62% relative humidity) Control electrodes were however tested directly after fabrication.
[0224]
[0196] , For testing, electrodes were interrogated in a 16 channel test station in accordance with the following:
[0225] 1. 15x SWV Pre-scans: 30, 100 Hz
[0226] 2. Extended CV + 5Hz QC
[0227] 3. Frequency Map at 0 mg / L
[0228] 4. SWV Titration: 10, 30, 50, 100, 200, 300 Hz -Repeat at 12 concentrations (0, 0.15, 0.4, 0.7, 1.5, 3, 15, 45, 140, 540, 870 mg / L)
[0229] 5. Frequency Map at 870 mg / L
[0230] 6. Extended CV + 5Hz QC
[0231] 7. 40x SWV Drift: 10, 30, 50, 100, 200, 300 Hz
[0197] , Reference is made to FIG. 21 showing frequency responses to vancomycin of the two electrode batches under different experimental conditions, compared to control electrodes. The “stored sample” refers to <10% relative humidity, and without irradiation.
[0232]
[0198] , It will be noted that frequency responses are degraded in some electrodes upon storage at <10% RH., leading to a lack of reproducibility amongst a batch (see “Control” versus “Stored”). Little if any degradation is seen for electrodes subject to irradiation only (see “Stored” versus “Stored + E-beam”). Moderate degradation in response is seen where electrodes are subject to humid conditions only, and without irradiation (see “Stored” versus “Stored + Humidity”). Significant degradation in response is seen where irradiation is performed in a high humidity (62%) environment (see “Stored” versus “Stored + E-beam + Humidity”).
[0233]
[0199] , Dimensionless Kinetic (DK) analysis was performed for control and test electrodes. DK is the difference in peak currents with weighting based on the frequencies chosen divided by the average of those weighted peak currents as shown in the following formula:
[0234] The results of that analysis are tabulated below:
[0235]
[0200] , These results demonstrate that storage alone leads to a slight reduction in working electrode reactivity to vancomycin. The addition of E-beam treatment or humidity has a minor negative effect on reactivity. For electrodes subject to storage+E-beam+humidity batch, the significantly lower DK values are evident of marked variability between each of the electrodes in this same batch, indicating that damage has been done to the electrodes causing them to now react very differently from each other.
[0236] EXAMPLE 6: SELECTION OF RADIATION DOSE FOR SUFFICIENT INACTIVATION OF AN INFECTIOUS AGENT WHILE RETAINING SUFFICIENT SENSITIVITY OF AN APTAMER-FUNCTIONALIZED WORKING ELECTRODE.
[0237]
[0201] , Relevant or model infectious agents are selected according to any regulatory requirement or other guidance available taking account of the end use of the sensor utilizing the functionalized working electrode. The infectious agent may be a human pathogen selected from the following list: the pathogen or model thereof is selected from: Staphylococcus aureus, Salmonella choleraesuis, Pseudomonas aeruginosa, Trichophyton mentagrophyte, Mycobacterium bovis (BCG), Adenovirus, Coxsackie Type B-3 virus, Cytomegalovirus, Herpes Simplex Virus Type 1 & 2 (HSV1 & HSV2), HIV-1, Human Coronavirus, Poliovirus, Rhinovirus, Vaccinia virus (Wyeth) Pass, Clostridium sporogenes spores and Bacillus subtilis spores. The infectious agent has a known titre as assessed by an infectivity assay.
[0238]
[0202] , A functionalized working electrode is prepared by immobilization of an aptamer on the gold surface of an electrode. An immobilization method disclosed herein may be used.
[0239]
[0203] , The functionalized electrode is spiked with an infectious agent, and exposed to an amount of radiation. An irradiation method disclosed herein may be used.
[0240]
[0204] , After irradiation, the working electrode may be tested for sensitivity to a target analyte. For example, % signal increase after addition of target analyte may be determined according to a method described herein.
[0241]
[0205] , The irradiated working electrode is then washed, with the wash being subjected to an infectivity assay to yield a post-irradiation titre. A log reduction value is then calculated by reference to the pre-irradiation (spiked) titre.
[0242]
[0206] , If necessary, further radiation doses and / or radiation types are tested as above until an irradiation protocol is identified that achieves sufficient log reduction of infectious agent while preserving sufficient operability of the working electrode with regards to target analyte detection. Where the actual or expected bioburden is low, radiation doses as low as 5 kGy or less may be used.
[0243] EXAMPLE 7: NEGATIVE EFFECT OF CHLORINE DIOXIDE ON SENSOR FUNCTION
[0244]
[0207] , A batch of working electrodes functionalised with a vancomycin sensitive aptamer was prepared. The electrodes were treated with Cidex™ (1 min), chlorhexidine (0.5% in ethanol) (2 mins), or chlorine dioxide foam (Tristel Duo™) (2 mins), followed by 2 x 3 sec rinse in HEPES. The treated sensors were tested against increasing concentrations of vancomycin. Results are shown in FIG. 22, demonstrating that sensitivity to vancomycin is preserved for Cidex™ and chlorhexidine treatment, but completely destroyed for sensors treated with chlorine dioxide.
[0245] EXAMPLE 8: NEGATIVE EFFECT OF ETHYLENE OXIDE ON SENSOR FUNCTION
[0246]
[0208] , A batch of working electrodes functionalised with a vancomycin sensitive aptamer was prepared. A group of electrodes was treated with ethylene oxide gas followed by a 10 min rinse in HEPES. A control group of electrodes was not treated. The treated and control electrodes were tested against increasing concentrations of vancomycin. Results are shown in FIG. 23, demonstrating that sensitivity to vancomycin at lower to moderate concentrations is completely destroyed for working electrodes treated with ethylene oxide. Some diminished reactivity to vancomycin at high concentrations is evident.
[0247] EXAMPLE 9: NEGATIVE EFFECT OF OZONE ON SENSOR FUNCTION
[0248]
[0209] , A batch of working electrodes functionalised with a vancomycin sensitive aptamer was prepared. The electrodes were treated with ozone. The treated and control electrodes were tested against 200 pm vancomycin. Results demonstrated that % signal change (peak current, across a square wave voltage sweep at 200 Hz) was either 112.10% or 152.84% for the control replicates, with ZERO % signal change detected for the ozone treated electrodes demonstrating that sensitivity to vancomycin is completely destroyed for working electrodes treated with ozone.
[0249]
[0210] , Those skilled in the art will appreciate that the disclosure described herein is susceptible to further variations and modifications other than those specifically described. It is understood that the disclosure comprises all such variations and modifications which fall within the spirit and scope of the present disclosure.
[0250]
[0211] , Accordingly, the spirit and scope of the present disclosure is not to be limited by the foregoing examples, but is to be understood in the broadest sense allowable by law.
Claims
CLAIMS:
1. A method of reducing the bioburden of an analyte recognition element, or a sensor working electrode functionalized with an analyte recognition element, the method comprising the step of exposing the analyte recognition element or the sensor working electrode with an amount of radiation.
2. The method of claim 1, wherein the amount of radiation is an amount of gamma radiation, electron beam radiation, x-ray radiation, microwave radiation, or ultraviolet light radiation.
3. The method of claim 1 or claim 2, wherein the amount of radiation is sufficient so to effect at least about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 logic kill of a pathogen capable of infecting a human or a non-human animal, or a model of the pathogen.
4. The method of claim 3, wherein the pathogen is selected from: a bacterium or a spore thereof, a fungus or a spore thereof, a mycobacterium, a mycoplasma, a virus, a protozoa, and a parasite.
5. The method of claim 3 or claim 4, wherein the pathogen or model thereof is selected from: Staphylococcus aureus, Salmonella choleraesuis, Pseudomonas aeruginosa, Trichophyton mentagrophyte, Mycobacterium bovis (BCG), Adenovirus, Coxsackie Type B-3 virus, Cytomegalovirus, Herpes Simplex Virus Type 1 & 2 (HSV1 & HSV2), HIV-1, Human Coronavirus, Poliovirus, Rhinovirus, Vaccinia virus (Wyeth) Pass, Clostridium sporogenes spores and Bacillus subtilis spores.
6. The method of any one of claims 1 to 5, wherein the amount of radiation allows for preservation of at least about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%,51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%,67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%,83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,99%, or 100% of the target analyte detecting ability of the analyte recognition element or the sensor working electrode.
7. The method of any one of claims 1 to 6, wherein where the amount of radiation is an amount of ionizing radiation, the amount of ionizing radiation being: (i) at least about 1 kGy, 2 kGy, 3 kGy, 4 kGy, 5 kGy, 6 kGy, 7 kGy, 8 kGy, 9 kGy 10 kGy, 11 kGy, 12 kGy, 13 kGy, 14 kGy, 15 kGy, 16 kGy, 17 kGy, 18 kGy, 19 kGy, 20 kGy, 21 kGy, 22 kGy, 23 kGy, 24 kGy, 25 kGy, 26 kGy, 27 kGy, 28 kGy, 29 kGy, 30 kGy, 31 kGy, 32 kGy, 33 kGy 34 kGy, 35 kGy, 36 kGy, 37 kGy, 38 kGy, 39 kGy, 40 kGy, 41 kGy, 42 kGy, 43 kGy, 44 kGy, 45 kGy, 46 kGy, 47 kGy, 48 kGy, 49 kGy, or 50 kGy; or (ii) less than about 1 kGy, 2 kGy, 3 kGy, 4 kGy, 5 kGy, 6 kGy, 7 kGy, 8 kGy, 9 kGy 10 kGy, 11 kGy, 12 kGy, 13 kGy, 14 kGy, 15 kGy, 16 kGy, 17 kGy, 18 kGy, 19 kGy, 20 kGy, 21 kGy, 22 kGy, 23 kGy, 24 kGy, 25 kGy, 26 kGy, 27 kGy, 28 kGy, 29 kGy, 30 kGy, 31 kGy, 32 kGy, 33 kGy 34 kGy, 35 kGy, 36 kGy, 37 kGy, 38 kGy, 39 kGy, 40 kGy, 41 kGy, 42 kGy, 43 kGy, 44 kGy, 45 kGy, 46 kGy, 47 kGy, 48 kGy, 49 kGy, or 50 kGy .
8. The method of any one of claims 1 to 7, wherein where the amount of radiation is an amount of ultraviolet light radiation the amount of ultraviolet light radiation being at least about 2,000 pW s / cm2.
9. The method of any one of claims 1 to 8, wherein the amount of radiation is sufficient for disinfection or sterilization.
10. The method of any one of claims 1 to 9, comprising the step of removing and / or excluding water or another solvent from the analyte recognition element and / or the sensor working electrode and / or the environment about the sensor working electrode prior to exposure to an amount of radiation.
11. The method of claim 10, wherein the step of removing and / or excluding water or another solvent comprises any one or more of: air drying, drying under a vacuum, spray drying, lyophilization, heating, centrifugation, exposure to a desiccant, and water or another solvent displacement.
12. The method of any one of claims 1 to 10, wherein the analyte recognition element and / or the sensor working electrode and / or the environment about the sensor working electrode has a controlled water or other solvent level, and / or the exposure to an amount of radiation is performed in a humidity controlled gaseous environment.
13. The method of claim 11, wherein the water or other solvent level is less than about 70%, 60%, 50%, 40%, 30%, 20%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% , 1% or 0.1% by weight; or the humidity is less than about 70%, 60%, 40%, 40%, 30%, 20%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% , 1% or 0.1% relative humidity.
14. The method of any one of claims 1 to 13, wherein the step of exposure to an amount of radiation is performed:(i) during, after or about a step of functionalizing or preparing to functionalize the working electrode with the analyte recognition element; or(ii) during, after or about a step of drying the analyte recognition element or drying the working electrode functionalized with the analyte recognition element.
15. The method of claim 14, wherein the step of functionalizing or preparing to functionalize the working electrode comprises:(a) associating an analyte recognition element with (i) another analyte recognition element, or (ii) a surface of the working electrode; or(b) synthesising an analyte recognition element in situ on the working electrode.
16. The method of claim 15, wherein the step of associating the analyte recognition element with another analyte recognition element comprises reducing the average distance between each of the analyte recognition elements.
17. The method of claim 15 or claim 16, wherein the step of associating the analyte recognition element with a surface of the working electrode comprises (i) immobilizing the analyte recognition element on the surface of the electrode, preferably by linking the analyterecognition element to a surface of the electrode, more preferably by forming a covalent bond between the analyte recognition element and the surface of the electrode.
18. The method of any one of claims 15 to 17, wherein the functionalizing comprises treating the electrode to inhibit non-specific binding of the analyte recognition element or a target analyte to a surface of the electrode.
19. The method of claim 18, wherein inhibition of non-specific binding of the analyte recognition element causes the one of the plurality of aptamers to stand proud of the surface of the electrode.
20. The method of claim 18 or claim 19, wherein the step of treating comprises exposing the surface of the electrode to one or more agents capable of blocking or passivating the electrode surface, the one or more agents typically capable of self-assembly into a monolayer.
21. The method of any one of claims 15 to 20, wherein the functionalizing comprises the association with methylene blude or a functional equivalent thereof or another redox reporter with the analyte recognition element, or the sensor working electrode analyte recognition element.
22. A method of producing a working electrode of an analyte recognition element-based sensor, the method comprising the steps of: functionalizing an electrode with an analyte recognition element, and exposing the functionalized electrode to an amount of radiation sufficient to reduce bioburden at a time when: the analyte recognition element (i) is proximal to another analyte recognition element, or a redox reporter, or a blocking agent, or a passivating agent, or (ii) has a low water or another solvent content, or (iii) is in a humidity-controlled gaseous environment; or the electrode (i) has a low water or another solvent content, or (ii) is in a humidity-controlled gaseous environment.
23. A method of reducing the bioburden of a packaged analyte recognition element-based sensor, the method comprising: sealing an analyte recognition element-based sensor inside a sealable packet in a humidity-controlled gaseous environment, and exposing the sealed packet to an amount of radiation sufficient to reduce the bioburden on the sensor.
24. The method of any one of claims 1 to 23, wherein the analyte recognition element is an aptamer.
25. The method of any one of claims 1 to 24 wherein the electrode is a wire, a needle, or a microneedle; and the sensor is an electrochemical sensor.
26. A packet having sealed therein an analyte recognition element-based sensor produced according to the method of any one of claims 23 to 25.
Citation Information
Patent Citations
Aptamer protective material and biosensor
WO2024145480A2
Aptamer-based analyte monitoring system
WO2025144429A2
AU2022341988A1