Sirna for inhibiting cideb gene expression, and modifier and use thereof

Abstract

The present invention belongs to the technical field of biomedicine. Provided are an siRNA for inhibiting the CIDEB gene expression, and a modifier and the use thereof. The double-stranded RNA molecule is any one of 196 siRNAs. The siRNA comprises a sense strand and an antisense strand that at least partially form a double-stranded region, wherein the sense strand comprises a nucleic acid sequence selected from any one of the odd-numbered sequences from sequences 1-392. The provided siRNA can efficiently degrade CIDEB mRNA and significantly reduce the level of the CIDEB protein. The siRNA can be used in the preparation of a new drug for treating NAFLD / NASH, including, but not limited to, fatty liver, NAFLD, NASH, and intrahepatic cholestasis.

Description

A siRNA for inhibiting CIDEB gene expression and its modifications and applications

[0001] Priority Statement

[0002] This disclosure claims priority to Chinese invention patent application CN2024110437390, filed on July 31, 2024, which is incorporated herein by reference in its entirety. Technical Field

[0003] This disclosure belongs to the field of biomedical technology, specifically relating to an siRNA for inhibiting CIDEB gene expression, its modifications, and applications. Background Technology

[0004] The CIDE (Cell death inducing DNA fragmentation factor-like effector) family of proteins, composed of Cidea, Cideb, and Cidec / Fsp27, are endoplasmic reticulum and lipid droplet-related proteins and important regulators of lipid homeostasis. Among them, CIDEB is most highly expressed in human hepatocytes and is commonly found on the surface of lipid droplets and other intracellular membranes. It helps increase the volume of lipid droplets, intracellular fat storage structures, to achieve fat accumulation. After discovering a protective association between CIDEB and liver disease through exome sequencing and other methods, scientists investigated the mechanism of protective mutations by silencing the CIDEB gene in human cells to mimic loss-of-function mutations. The results showed that CIDEB gene mutations reduce lipid droplet volume, thereby inhibiting fat accumulation in hepatocytes. Therefore, researchers believe that therapies that mimic protective mutations by blocking CIDEB expression or function may help prevent or treat non-alcoholic steatohepatitis (NASH) and other forms of liver disease.

[0005] Non-alcoholic fatty liver disease (NAFLD), commonly known as fatty liver, is a chronic liver disease characterized by steatosis of hepatocytes. It is often associated with metabolic syndrome and includes simple fatty liver, NASH, NASH-related liver fibrosis, cirrhosis, and liver cancer. Approximately 20% to 40% of NASH patients may progress to cirrhosis or even liver cancer.

[0006] S-adenosylmethionine (ADE) is currently the only approved drug globally for the treatment of NASH and intrahepatic cholestasis of pregnancy. Side effects of this drug include allergic reactions, gastrointestinal discomfort, and liver damage. NASH patients urgently need new and effective treatment options to prevent NASH progression and maintain and restore liver function. The development of RNAi drugs targeting CIDEB is currently in the preclinical stage, and there is an urgent need to develop potent, highly specific, and low-side-effect drugs for the treatment of NAFLD / NASH to address unmet clinical needs. Summary of the Invention

[0007] The technical problem to be solved by this disclosure is to provide siRNA that targets CIDEB mRNA, can efficiently degrade CIDEB mRNA, and significantly reduce CIDEB protein levels. The technical problem to be solved is not limited to the described technical subject matter; other technical subject matter not mentioned herein will be clearly understood by those skilled in the art through the following description.

[0008] To solve the above-mentioned technical problems, this disclosure provides the following technical solutions:

[0009] This disclosure provides a double-stranded RNA molecule, which is any one of 196 siRNAs, wherein the siRNA comprises a sense strand and an antisense strand that at least partially form a double-stranded region, and the sense strand comprises a nucleotide sequence that is any odd-numbered sequence from sequence 1 to 392.

[0010] In the above-mentioned double-stranded RNA molecule, the siRNA includes a sense strand and an antisense strand that form the double-stranded region, wherein the sense strand includes a nucleotide sequence that is any odd-numbered sequence from sequence 1 to 392.

[0011] In the above-mentioned double-stranded RNA molecules, the length of the double-stranded region is 15-30bp, 23-27bp, 21-23bp, 19-21bp, 17-25bp, or 17-23bp.

[0012] Furthermore, the length of the double-stranded region is 17-21bp, 17bp, 19bp, 20bp, or 21bp.

[0013] In the above-mentioned double-stranded RNA molecule, the length of the sense strand does not exceed 30 nucleotides, and / or the length of the antisense strand does not exceed 30 nucleotides.

[0014] In the above double-stranded RNA molecule, the length of the sense strand does not exceed 21 nucleotides, and / or the length of the antisense strand does not exceed 21 nucleotides.

[0015] Optionally, the length of the sense strand is 21 nucleotides, and the length of the antisense strand is no more than 21 nucleotides; or, the length of the sense strand is 19 nucleotides, and the length of the antisense strand is no more than 21 nucleotides.

[0016] In the above-mentioned double-stranded RNA molecule, the sense strand and the antisense strand do not contain a 3' overhang, or at least one of the sense strand and the antisense strand contains a 3' overhang with at least one nucleotide, or at least one of the strands contains a 3' overhang with at least two nucleotides.

[0017] Optionally, the sense strand and the antisense strand are completely complementary double-stranded nucleotide sequences; for example, the sense strand and the antisense strand are completely complementary double-stranded nucleotide sequences of 21 bp in length.

[0018] Optionally, the antisense strand includes a 3' overhang of 2 nucleotides. For example, the length of the sense strand is 19 nucleotides, and the length of the antisense strand is no more than 21 nucleotides, with 2 nucleotides overhanging at the 3' end of the antisense strand.

[0019] In the above-mentioned double-stranded RNA molecule, the antisense strand includes a sequence whose nucleotide sequence is any even numbered sequence from 1 to 392.

[0020] In the above-mentioned double-stranded RNA molecules, the nucleotide sequences of the sense strand of the 196 siRNAs are either any odd-numbered sequence from Sequence 1 to 392 or sequences that have more than 90% identity with any odd-numbered sequence, and / or the nucleotide sequences of the antisense strands are either any even-numbered sequence from Sequence 1 to 392 or sequences that have more than 90% identity with any even-numbered sequence.

[0021] The nucleotide sequences of the sense strands of the 196 siRNAs are numbered n, and the nucleotide sequences of the antisense strands of the 196 siRNAs are numbered n+1, where n is any odd number from 1 to 392.

[0022] The nucleotide sequences of the positive strand of the 196 siRNAs also include sequences that have more than 90% identity with any of the sequences indicated by odd numbers in sequences 1-392;

[0023] The nucleotide sequences of the antisense strands of the 196 siRNAs also include sequences that have more than 90% identity with any of the even-numbered sequences shown in sequences 1-392.

[0024] This disclosure also provides double-stranded RNA molecule modifiers, which are compounds containing modified nucleotides obtained by modifying at least one nucleotide of the aforementioned double-stranded RNA molecule.

[0025] In the above-mentioned double-stranded RNA molecule modifications, at least one nucleotide in the sense strand or antisense strand of the double-stranded RNA molecule modification is a modified nucleotide.

[0026] In the above-mentioned double-stranded RNA molecule modifications, the modified nucleotide is a compound formed by replacing the 2' hydroxyl group of the ribosyl group of the nucleotide with other groups, or a compound formed by modifying the bases on the nucleotide.

[0027] In the above-mentioned double-stranded RNA molecule modification, the double-stranded RNA molecule modification further includes linking the modified nucleotides through thiophosphate groups.

[0028] In the above-mentioned double-stranded RNA molecule modifications, the modified nucleotide is selected from at least one of the following groups: 2'-methoxy-modified nucleotides, 2'-fluorine-modified nucleotides, nucleotides containing phosphate thioester groups, deoxy-nucleotides, 2'-deoxy-nucleotides, 3'-terminal deoxy-thymidine (dT) nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides (LNA), non-locked nucleotides, configuration-restricted nucleotides, restricted ethyl nucleotides, base-free nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, etc. Nucleotides modified with 2'-C-alkyl, 2'-hydroxy, 2'-methoxyethyl, 2'-O-alkyl, morpholinonucleotides, nucleotides containing non-natural bases, tetrahydropyran-modified nucleotides, 1,5-dehydrohexyl-modified nucleotides, cyclohexenyl-modified nucleotides, glycerol nucleotides (GNA), open-ring nucleotides (UNA), nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphates, and nucleotides containing 5'-phosphate mimics.

[0029] In an optional embodiment, each nucleotide of the positive strand is independently selected from 2'-methoxy modified nucleotides, 2'-fluoro modified nucleotides, or deoxyribonucleotides, and at least 2-11 2'-fluoro modified nucleotides are present at positions 3-19 of the positive strand in the direction from the 5' end to the 3' end.

[0030] Optionally, the positive strand contains at least 2-5 2'-fluorinated nucleotides at positions 3-19, following the direction from the 5' end to the 3' end.

[0031] Optionally, the positive strand contains at least 2, 3, 4, 5 or 10 2'-fluorinated nucleotides in positions 3-19, following the direction from the 5' end to the 3' end.

[0032] Optionally, the nucleotide site in the positive strand that is 2'-fluorinated is selected from one or more of the 3rd, 5th, 7th, 8th, 9th, 10th, 11th, 13th, 15th, 17th or 19th positions.

[0033] In an optional implementation, the length and nucleotide modifications of the positive strand, following the direction from the 5' end to the 3' end, are selected from any of the following:

[0034] (a1) The positive strand is 19 nt in length, and the modification method corresponding to each nucleotide is as follows:

[0035] mmmmmmfffmmmmmmmmmm;

[0036] (b1) The positive strand is 19 nt in length, and the modification method corresponding to each nucleotide is as follows:

[0037] mmmmfmfffmmmmmmmmmmmm;

[0038] (c1) The positive strand is 19 nt in length, and the modification method corresponding to each nucleotide is as follows:

[0039] mmfmfmfffmfmfmfmfmf;

[0040] (d1) The positive strand is 19 nt in length, and the modification method corresponding to each nucleotide is as follows:

[0041] mmmmmmff-(d)-mmmmmmmmmm;

[0042] (e1) The positive strand is 21 nt in length, and the modification method corresponding to each nucleotide is as follows:

[0043] mmmmmmfmfffmmmmmmmmmmmm;

[0044] Where m is a 2'-methoxy modified nucleotide, f is a 2'-fluoro modified nucleotide, and d is deoxyribonucleic acid.

[0045] In an optional embodiment, the antisense strand is 21 nt in length, oriented from the 5' end to the 3' end, and the nucleotide modifications of the antisense strand are selected from any of the following:

[0046] (a2)mfmmmfmmmmmmmfmfmmmmmmm;

[0047] (b2)mfmmmfmffmmmmfmfmmmmmmm;

[0048] (c2)mfmfmfmfmfmmmfmfmfmfmmm;

[0049] Where m is a 2'-methoxy modified nucleotide, f is a 2'-fluoro modified nucleotide, and d is deoxyribonucleic acid.

[0050] In an optional embodiment, the double-stranded RNA molecule modification, following the direction from the 5' end to the 3' end, contains the following optional combinations of sense and antisense strands:

[0051] (A) The positive strand is 19 nt in length, and the modification method corresponding to each nucleotide is as follows:

[0052] mmmmmmfffmmmmmmmmmm;

[0053] The antisense strand is 21 nt in length, and the modification method for each nucleotide is as follows:

[0054] mfmmmfmmmmmmmfmfmmmmm;

[0055] (B) The positive strand is 19 nt in length, and the modification method corresponding to each nucleotide is as follows:

[0056] mmmmfmfffmmmmmmmmmmmm;

[0057] The antisense strand is 21 nt in length, and the modification method for each nucleotide is as follows:

[0058] mfmmmfmffmmmmfmfmmmmm;

[0059] (C) The positive strand is 19 nt in length, and the modification method corresponding to each nucleotide is as follows:

[0060] mmmmfmfffmmmmmmmmmmmm;

[0061] The antisense strand is 21 nt in length, and the modification method for each nucleotide is as follows:

[0062] mfmmmfmmmmmmmfmfmmmmm;

[0063] (D) The positive strand is 19 nt in length, and the modification method corresponding to each nucleotide is as follows:

[0064] mmfmfmfffmfmfmfmfmf;

[0065] The antisense strand is 21 nt in length, and the modification method for each nucleotide is as follows:

[0066] mfmfmfmfmfmmmfmfmfmfmmm;

[0067] (E) The positive strand is 19 nt in length, and the modification method corresponding to each nucleotide is as follows:

[0068] mmmmmmff-(d)-mmmmmmmmmm;

[0069] The antisense strand is 21 nt in length, and the modification method for each nucleotide is as follows:

[0070] mfmmmfmmmmmmmfmfmmmmm

[0071] (G) The positive strand is 21 nt in length, and the modification method for each nucleotide is as follows:

[0072] mmmmmmfmfffmmmmmmmmmmmm;

[0073] The antisense strand is 21 nt in length, and the modification method for each nucleotide is as follows:

[0074] mfmmmfmmmmmmmfmfmmmmm;

[0075] Where m is a 2'-methoxy modified nucleotide, f is a 2'-fluoro modified nucleotide, and d is deoxyribonucleic acid.

[0076] In an optional embodiment, the 5'-terminal nucleotide of the antisense strand of the double-stranded RNA molecule modification contains a phosphate ester or a derivative thereof.

[0077] Optionally, the phosphate ester or its derivative is selected from vinyl phosphate esters (such as (E)-vinyl phosphate ester), alkylated derivatives of vinyl phosphonates, arylated derivatives of vinyl phosphonates, halogenated derivatives of vinyl phosphonates, hydroxylated derivatives of vinyl phosphonates, aminated derivatives of vinyl phosphonates, carboxylated derivatives of vinyl phosphonates, thiolated derivatives of vinyl phosphonates, silanized derivatives of vinyl phosphonates, borated derivatives of vinyl phosphonates, or metal complex derivatives of vinyl phosphonates.

[0078] Optionally, the 3'-end and / or 5'-end of the positive strand of the double-stranded RNA molecule modification is further linked with an invab (5'-5' linked or 3'-3' linked invab).

[0079] Alternatively, when invab is connected to the 5' end of the justice chain, the structure is as follows: It can also be modified with thiophosphates (invab): When invab is connected at the 3' end of the justice chain, it is as follows:

[0080] In the above-mentioned double-stranded RNA molecule modifications, a ligand is also attached to any nucleotide at the 3'-end or 5'-end of the positive strand or in the middle of the positive strand.

[0081] In the above-mentioned double-stranded RNA molecule modifications, the ligand is a small molecule, antibody, polypeptide, protein, or aptamer.

[0082] In the above-mentioned double-stranded RNA molecule modifications, the small molecules include glycoligands, such as N-acetylgalactosamine (GalNAc) or its derivatives.

[0083] Optionally, the derivatives include, but are not limited to, sulfated, phosphorylated, acetylated, or alkylated forms of GalNAc.

[0084] Optionally, the glycoligand is a multivalent form of GalNAc, which is covalently linked to a small nucleic acid molecule via a multivalent linker arm.

[0085] Optionally, the multivalent connecting arm is selected from:

[0086] Optionally, the ligand is L96 as shown in the following formula:

[0087] Optionally, the ligand is attached to the 3'-terminus of the justice chain.

[0088] Optionally, when the 3'-end of the positive strand is attached with an inverse abase-free nucleotide (invab), L96 and invab are coupled via a phosphate ester ((invab)-L96: ) or thiophosphate ((invab)s-L96: )connect.

[0089] Optionally, the double-stranded RNA molecule modification is linked to a ligand, with the structure shown below:

[0090] Where X is O or S.

[0091] Optionally, the double-stranded RNA molecule modification is linked to a ligand, with the structure shown below:

[0092] This disclosure also provides a composition for inhibiting CIDEB gene expression, wherein the active ingredient of the composition is a double-stranded RNA molecule or a double-stranded RNA molecule modification as described in any of the foregoing embodiments.

[0093] The use of the double-stranded RNA molecule described in any of the foregoing embodiments, or the double-stranded RNA molecule modified according to any of the foregoing embodiments, or the composition described in any of the foregoing embodiments, in any of the following:

[0094] (D1) Application in the preparation of compositions that inhibit CIDEB gene expression;

[0095] (D2) Application in suppressing CIDEB gene expression;

[0096] (D3) Application in the treatment of diseases related to the CIDEB gene target;

[0097] (D4) Application in the preparation of compositions for treating diseases related to the CIDEB gene target;

[0098] (D5) Application in the preparation of dimer siRNA.

[0099] This disclosure also provides a dimer siRNA comprising any one antisense strand of the double-stranded RNA molecule or double-stranded RNA molecule modification described in any of the above embodiments.

[0100] Optionally, the dimer siRNA further comprises a second siRNA, wherein the sense strand of the second siRNA is covalently linked to the sense strand of the siRNA in any embodiment of this disclosure.

[0101] Optionally, the dimer siRNA comprises any one antisense strand and a perfectly or partially complementary sense strand from any of the double-stranded RNA molecules or double-stranded RNA molecule modifications described in any of the above embodiments.

[0102] Optionally, the dimer siRNA comprises the double-stranded RNA molecule or double-stranded RNA molecule modification described in any of the above embodiments.

[0103] Optionally, the positive strand of the dimer siRNA is conjugated with at least one ligand.

[0104] Optionally, the ligand comprises N-acetylgalactosamine (GalNAc) or a derivative thereof.

[0105] Optionally, the ligand is one or more GalNAc derivatives attached via a monovalent, divalent, trivalent, or tetravalent ligand head.

[0106] Optionally, the ligand is L96.

[0107] Optionally, the ligand is conjugated to the 3' end of the positive strand of one of the siRNAs.

[0108] This disclosure also provides the use of the above-mentioned unmodified double-stranded RNA molecules or modified double-stranded RNA molecules in the preparation of dimer siRNA.

[0109] This disclosure also provides a composition for inhibiting CIDEB gene expression, wherein the active ingredient of the composition is the double-stranded RNA molecule or double-stranded RNA molecule modification described in any of the foregoing embodiments.

[0110] The above composition further includes a pharmaceutically acceptable carrier.

[0111] The composition may be a pharmaceutical composition or a kit.

[0112] The pharmaceutical composition described above also comprises an unbuffered solution.

[0113] The unbuffered solution in the pharmaceutical composition described above is physiological saline or water.

[0114] The pharmaceutical composition described above also includes a buffer solution.

[0115] The buffer solution in the pharmaceutical composition described above comprises acetate, citrate, alcohol-soluble gluten, carbonate, or phosphate, or any combination thereof.

[0116] The buffer solution in the drug composition described above is phosphate-buffered saline (PBS).

[0117] In the above compositions, the compositions comprise lipid formulations, nanoformulations, or lipid-containing vesicles.

[0118] In the above composition, the lipid formulation is an LNP formulation, the nano-formulation is polymer nanoparticles, and the lipid-containing vesicles are exosomes, preferably artificially modified exosomes.

[0119] This disclosure also provides a cell comprising the double-stranded RNA molecule described in any of the foregoing embodiments, the double-stranded RNA molecule modification described in any of the foregoing embodiments, and / or the composition described in any of the foregoing embodiments.

[0120] This disclosure also provides a method for inhibiting the expression of the CIDEB gene in cells, the method comprising:

[0121] (a) Contact the cells with the aforementioned double-stranded RNA molecule, the aforementioned double-stranded RNA molecule modification, and / or the aforementioned composition.

[0122] (b) Maintain the cells produced in step (a) for a period of time sufficient for the degradation of the CIDEB gene mRNA transcript to suppress CIDEB gene expression in the cells.

[0123] In the above method, the cells are 293T cells or Hep3B cells.

[0124] In the above method, the expression of the CIDEB gene is suppressed by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 100%.

[0125] In the above method, the CIDEB gene target-related diseases can be diseases caused by abnormal CIDEB gene expression.

[0126] In the above method, the disease caused by abnormal CIDEB gene expression can be a disease caused by upregulation of CIDEB gene expression.

[0127] In the above method, the diseases caused by the upregulation of CIDEB gene expression include, but are not limited to, liver diseases. These liver diseases include non-alcoholic fatty liver disease (NAFLD), simple fatty liver, non-alcoholic steatohepatitis (NASH), hepatitis, liver fibrosis, cirrhosis, alcoholic steatohepatitis (ASH), alcoholic fatty liver disease (ALD), HCV-related cirrhosis, drug-induced liver injury, hepatocellular necrosis, chronic fibrotic liver disease, or liver cancer.

[0128] Furthermore, the pharmaceutically acceptable carrier may be an excipient, stabilizer, suspending agent, or diluent, as is well known to those skilled in the art.

[0129] In this disclosure, "modified nucleotide" includes nucleotides or nucleotide analogs formed by replacing the 2'-hydroxyl group of the ribosyl group with another group, or nucleotides in which the bases on the nucleotide are modified bases. "Methoxy-modified nucleotide" refers to nucleotides formed by replacing the 2'-hydroxyl group of the ribosyl group with a methoxy group. "Fluoro-modified nucleotide" refers to nucleotides formed by replacing the 2'-hydroxyl group of the ribosyl group with fluorine.

[0130] In this disclosure, "nucleotide analogue" refers to a group that can replace a nucleotide in nucleic acids, but whose structure differs from that of adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. Examples include isonucleotides, bridged nucleic acids (BNAs), or acyclic nucleotides.

[0131] In this disclosure, "invab" (inverted abasic) is a reverse-abasic nucleotide (or reverse-debasic nucleotide, or inverted abasic nucleotide) introduced into DNA or RNA. Specifically, invab involves inserting a debasic nucleotide into a nucleic acid strand in an "inverted" manner (5'-5' linkage or 3'-3' linkage). Debasication refers to the removal of a base from the nucleotide, leaving only the deoxyribose or ribose portion. This inverted structure causes the 5' and 3' carbons of the sugar ring to be linked in the opposite direction to those of a normal nucleotide. The phosphate group remains linked to the 5' and 3' carbons of the sugar ring, but due to the inversion of the sugar ring, the phosphate backbone is oriented in the opposite direction to that of a normal nucleotide. When invab is linked to the 5' end, the structure is as follows: It can also be modified with thiophosphates (invab): When invab is connected at the 3' end, it is as follows:

[0132] In one embodiment of this disclosure, a "fluorinated nucleotide" refers to a nucleotide formed by replacing the hydroxyl group at the 2' position of the ribosyl group with fluorine, having the structure shown in formula (1). The non-fluorinated nucleotide is independently selected from nucleotides or nucleotide analogs formed by replacing the hydroxyl group at the 2' position of the ribosyl group with a non-fluorinated group.

[0133] In one embodiment of this disclosure, the nucleotide formed by replacing the hydroxyl group at the 2' position of the ribosome with a non-fluorinated group is well known to those skilled in the art. These nucleotides may be selected from one of the following: 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-amino modified nucleotides, 2'-substituted amino modified nucleotides, and 2'-deoxynucleotides.

[0134] In one embodiment of this disclosure, the 2'-alkoxy modified nucleotide is a 2'-methoxy (2'-OMe) modified nucleotide, as shown in Formula (2), i.e., methoxy modified; the 2'-substituted alkoxy modified nucleotide may be, for example, a 2'-O-methoxyethyl (2'-MOE) modified nucleotide, as shown in Formula (3); the 2'-amino (2'-NH2) modified nucleotide is shown in Formula (4); and the 2'-deoxynucleotide (DNA) is shown in Formula (5).

[0135] In one embodiment of this disclosure, the nucleotide analogue refers to a group that can replace a nucleotide in a nucleic acid, but whose structure differs from that of adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide.

[0136] In one embodiment of this disclosure, the nucleotide analog may be an isonucleotide, a bridged nucleotide, or an acyclic nucleotide.

[0137] In one embodiment of this disclosure, the bridged nucleic acid (BNA) refers to a restricted or inaccessible nucleotide. The BNA may contain a bridging structure with a "fixed" C3'-endoglucan condensation of a five-membered, six-membered, or seven-membered ring. Typically, the bridge is incorporated into the 2'-, 4'-position of the ribose to provide a 2',4'-BNA nucleotide.

[0138] In one embodiment of this disclosure, the BNA may be LNA, ENA, cET BNA, etc., wherein LNA is as shown in formula (6), ENA is as shown in formula (7), and cET BNA is as shown in formula (8).

[0139] In one embodiment of this disclosure, the phosphate group having the modifying group is a thiophosphate group having the structure shown in formula (9). In one embodiment of this disclosure, the nucleotide linked to the thiophosphate group is shown in formula (10).

[0140] In one embodiment of this disclosure, the VP-modified nucleotide is a vinyl phosphate ester modified. In one embodiment of this disclosure, the VP-modified and methoxy-modified nucleotide, namely the nucleotide modified with 5'-(E)-vinyl-2'-methoxy-modified phosphonate group (5'-(E)-VP-2'-OMe), is as shown in formula (11).

[0141] VPAms are shown in Equation (12), VPUms are shown in Equation (13), VPGms are shown in Equation (14), and VPCms are shown in Equation (15):

[0142] The advantage of this disclosure lies in that it provides siRNAs that are highly efficient at degrading CIDEB mRNA and significantly reducing CIDEB protein levels, screened against CIDEB mRNA. Following this, novel drugs for the treatment of NAFLD / NASH will be developed, including but not limited to fatty liver, NAFLD, NASH, and intrahepatic cholestasis. Detailed Implementation

[0143] The present disclosure will now be described in further detail with reference to specific embodiments. The embodiments given are merely illustrative of the present disclosure and are not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the present disclosure in any way.

[0144] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0145] In the methods for preparing siRNA as described in this disclosure, unless otherwise specified, nucleoside monomer refers to the modified or unmodified RNA phosphoramidites (sometimes also called nucleoside phosphoramidites) used in phosphoramidite solid-phase synthesis, depending on the type and sequence of nucleotides in the desired siRNA. Phosphoramidite solid-phase synthesis is a method known to those skilled in the art for the synthesis of siRNA. All nucleoside monomers used in this disclosure are commercially available.

[0146] It is worth noting that the raw materials used in this disclosure are all commercially available products, and their sources are not specifically limited.

[0147] The following sources of raw materials are provided as examples:

[0148] Table 1 shows the experimental reagents, consumables, and instruments used in the following examples.

[0149] The meanings of the abbreviations for nucleotide monomers used in the nucleic acid sequence listing are shown in Table 2.

[0150] Table 2

[0151] In the quantitative experiments in the following examples, three replicate experiments were set up, and the average value of the results was taken.

[0152] The following examples involve three positive control siRNA products derived from Table 6 of patent document WO2023034837A2: AD-1699964.1 (page 197, the sense and antisense strands correspond to nucleotide sequences 1595 and 2043 in the patent document, respectively), AD-1700369.1 (page 201, the sense and antisense strands correspond to nucleotide sequences 1699 and 2147 in the patent document, respectively), and AD1700555.1 (page 204, the sense and antisense strands correspond to nucleotide sequences 1752 and 2200 in the patent document, respectively).

[0153] Example 1: Design and Modification of siRNA

[0154] CIDEB mRNA refers to mRNA with the sequence shown in GeneBank registration numbers NM_001393338.1, NM_014430.4, NM_001318807.3, NM_001393334.1, NM_001393335.1, NM_001393336.1, NM_001393337.1, NM_001393339.1, or NM_001393340.1.

[0155] In this embodiment, siRNA was designed using the mRNA sequence shown in NM_001393338.1 (submission date: 12-JUN-2024, URL: https: / / www.ncbi.nlm.nih.gov / nuccore / NM_001393338.1 / ). The siRNA is a double-stranded RNA composed of a sense strand and an antisense strand. Specific information is shown in the table below.

[0156] Table 3 Unmodified siRNA

[0157] In Table 3, column 1 is the siRNA number, column 2 is the siRNA positive strand (19 nucleotides in length), column 3 is the siRNA positive strand sequence number, column 4 is the siRNA antisense strand (21 nucleotides in length), and column 5 is the siRNA antisense strand sequence number.

[0158] Based on the siRNAs shown in Table 3, this disclosure obtained modified siRNAs with different modifications through different modification modes. The specific modification methods of the M1 modification mode are as follows:

[0159] M1 Modification Mode:

[0160] The modifications of the 19 nucleotides in the 5'-3' strand of the positive chain are as follows:

[0161] ms-ms-mmmmfffmmmmmmmmmm

[0162] That is, the nucleotides at positions 1-6 and 10-19 of the positive chain are 2'-methoxy modified nucleotides, the nucleotides at positions 7-9 are 2'-fluorinated modified nucleotides, and the nucleotides at positions 1 and 2, as well as positions 2 and 3, are linked by thiophosphate groups.

[0163] The modifications of the 21 nucleotides in the 5'-3' antisense strand are as follows:

[0164] ms-fs-mmmfmmmmmmmmfmfmm-ms-ms-m

[0165] That is, the nucleotides at positions 1, 3-5, 7-13, 15, and 17-21 of the antisense strand are nucleotides modified with 2'-methoxy groups, the nucleotides at positions 2, 6, 14, and 16 are nucleotides modified with 2'-fluoride groups, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups.

[0166] The naming convention for modified siRNA is "siRNA number before modification" + "modification pattern". For example, the modified CID-36 obtained by modifying the sense and antisense strands of CID-36 with M1 is named "CID-36M1" or simply "36M1".

[0167] Example 2: Detection of the on-target activity of modified siRNA used to inhibit CIDEB

[0168] The experimental procedure is as follows:

[0169] Step 1: Construct the detection plasmid CIDEB-psiCHECK2

[0170] Using psiCHECK TM -2(Promega TMsiRNA detection plasmids were constructed using vectors, and four different fragments of the hCIDEB gene (as shown in Table 4) were cloned into psiCHECK. TM By subtracting the Xho I / Not I sites from the vector, four detection plasmids for hCIDEB siRNA were obtained (as shown in Table 4).

[0171] Table 4. Target gene sequence of psiCHECK2 plasmid

[0172] Step 2: Cell Culture and Transfection

[0173] Experimental group: siRNA was added to each well of a 96-well plate at a rate of 5 μL per well (three final concentrations were set for each siRNA molecule: 1 nM, 0.1 nM, and 0.01 nM). Opti-MEM containing 20 ng of the aforementioned detection plasmids (psiCHECK2TM-hCIDEB-1, psiCHECK2TM-hCIDEB-2, psiCHECK2TM-hCIDEB-3, and psiCHECK2TM-hCIDEB-4) was added to each well at a rate of 12.5 μL per well. TM Add Opti-ME M at a rate of 32.5 μL per well. TM Furthermore, Lipofectamine was added at a rate of 0.3 μL per well. TM 2000 (purchased from) After incubating the sample (product number 11668-019) at room temperature (22°C) for 15 minutes, a mixture was obtained. A solution containing 1×10⁻⁶ ppm was added to the mixture at a rate of 50 μL per well. 4 DMEM complete medium for 293T cells (purchased from Transgen) The sample (product number FI101-01) was incubated at 37℃ for 24 hours and used for subsequent dual-luciferase assay.

[0174] Table 5. Correspondence between psiCHECK2 plasmid and siRNA

[0175] Step 3: Dual-luciferase assay

[0176] The dual-luciferase assay kit (purchased from Prometheus) was used. Dilute the 5× lysis buffer (product number E2940) with water to a final 1× lysis buffer. Take the cells obtained from step two, discard the supernatant, and irrigate each well with PBS buffer (purchased from [unspecified source]). After diluting and washing twice with the sample (product code SH30256.01), 50 μL of 1× lysis buffer was added to each well of each cell plate, and the plates were lysed at room temperature (22℃) for 20 min to obtain lysed cell plates. 30 μL of lysis buffer per well was then added to each well of an opaque 96-well detection plate. The dual-luciferase assay kit was used, and substrate 1 and substrate 2 were prepared according to the instructions. 30 μL of each substrate was added to each well of the opaque 96-well detection plate. After each addition of substrate, the results were obtained using a multi-functional microplate reader to measure the luciferase levels of firefly and Renilla luciferase.

[0177] The renin luminescence values ​​in each well were normalized using firefly luminescence values, with the formula R = renin luminescence / firefly luminescence. The luminescence ratio for each test group or control group was the average of the luminescence ratios from its three culture wells. Compared to the control group, the degree of inhibition of CID mRNA levels by each siRNA was expressed as a percentage, with inhibition rate % = (1 - R). 实验组 / R MOCK组 )×100%.

[0178] The test results are shown in the table below.

[0179] Table 6. Target activity results of M1-modified siRNA

[0180] Example 3: Detection experiment of M1-modified siRNA for inhibiting CIDEB in Hep3B cells.

[0181] Experimental methods:

[0182] Hep3B cells were purchased from the Cell Bank of the Chinese Academy of Sciences Type Culture Collection Committee.

[0183] Step 1. Cell transfection

[0184] In Example 2, a subset of the siRNAs selected were used as experimental groups, with each group containing siRNAs at concentrations of 1 nM, 0.1 nM, and 0.01 nM. MOCK and BLANK were used as controls. The MOCK group received only interfering reagents without any additional sequences; the BLANK group contained only cells.

[0185] The transfection reagent Lipofectamine RNAiMAX was used. Perform siRNA transfection. Prepare the transfection complex according to the manufacturer's instructions. For example, to prepare a single-well transfection complex: dilute the siRNA with 25 μL of opti-MEM and mix gently to prepare the siRNA dilution solution; mix 25 μL of opti-MEM with 0.25 μL of Lipofectamine RNAiMAX transfection reagent to prepare the transfection reagent dilution solution. Mix the two dilution solutions and gently incubate at room temperature for 10-20 minutes, then add to the corresponding wells of the cell plate. 48 hours after transfection, discard the cell culture medium in each well, add 50 μL of cell lysis buffer (Suzhou Genomics Co., Ltd.) to each well, incubate for 5 minutes until lysis is complete, then add 5 μL of stop solution to each well to obtain the final lysis product.

[0186] Step 2. RT-qPCR detection

[0187] 1. RNA template preparation and instrumental detection

[0188] DNase I was added to the cell lysis products to remove genomic DNA, and then an RNA template was obtained. The reaction system was prepared according to the table below, and the prepared reaction system was used for real-time PCR on an LC480 fluorescence quantitative PCR instrument.

[0189] Table 7. RT-qPCR probe method reaction system

[0190] Table 8. RT-qPCR reaction procedure

[0191] 2. Result Calculation

[0192] The relative quantification of the target gene CIDEB in each test group was performed using the comparison Ct(ΔΔCt) method, as follows:

[0193] ΔCt(test group) = Ct(target gene in test group) – Ct(internal reference gene in test group, GAPDH).

[0194] ΔCt(control group) = Ct(target gene in control group) – Ct(internal reference gene in control group, GAPDH).

[0195] ΔCt(test group) = ΔCt(test group) - ΔCt(control group average).

[0196] ΔCt(control group) = ΔCt(control group) - ΔCt(control group average).

[0197] Wherein, ΔCt (control group mean) is the arithmetic mean of ΔCt (control group) for each sample in the control group; thus, each sample in the test group and the control group corresponds to a ΔCt value.

[0198] Using the control group as a baseline, the expression level of CIDEB mRNA in the test group was normalized, and the expression level of CIDEB mRNA in the control group was defined as 100%.

[0199] The relative expression level of CIDEB mRNA in the test group was 2. -ΔΔCt (Test group) × 100%.

[0200] CIDEB inhibition rate = 1 - relative expression level of CIDEB mRNA in the test group.

[0201] In this embodiment, the siRNA selected in Example 2 was subjected to the above experiment in two batches, and the detection results are shown in Tables 9 and 10:

[0202] Table 9. CIDEB mRNA inhibition effect of the first batch of siRNAs

[0203] Table 10. CIDEB mRNA inhibition effect of the second batch of siRNA

[0204] Example 4: In vivo animal experiments with M1-modified siRNA

[0205] Based on the in vitro screening results of each siRNA in Examples 2 and 3, some M1-modified siRNAs were selected, and L96 was conjugated to the 3' end of the positive strand to obtain M1-modified siRNAs with L96 conjugated. The name of the L96-conjugated siRNA is the naked sequence number + M1G. For example, the siRNA with naked sequence number CID-36, which is modified with M1 and has L96 conjugated to the 3' end of the positive strand, is then numbered CID-36M1G.

[0206] In vivo screening of siRNA conjugated with L96 was performed on mice of the C57-hCIDEB heterozygous strain, aged 6-8 weeks. One male and one female mouse were selected from each group. The mice were administered the drug at a dose of 3 mpk / mouse via subcutaneous injection on Day 0. On Day 14, the mice were sacrificed and liver samples were collected for qPCR to detect the knockdown of hCIDEB gene expression (method as in Example 3). The experimental results are shown in Table 11.

[0207] Table 11. Inhibition rate of siRNA after L96 conjugation

[0208] Example 5: In vivo effects of modified siRNA

[0209] Based on the in vivo screening results of each siRNA in Table 11, some siRNAs were selected and modified using the following M1VP modification mode to obtain M1VP modified siRNAs.

[0210] M1VP Modification Mode:

[0211] The modifications of the 19 nucleotides in the 5'-3' strand of the positive chain are as follows:

[0212] ms-ms-mmmmfffmmmmmmmmmm

[0213] That is, the nucleotides at positions 1-6 and 10-19 of the positive chain are 2'-methoxy modified nucleotides, the nucleotides at positions 7-9 are 2'-fluorinated modified nucleotides, and the nucleotides at positions 1 and 2, as well as positions 2 and 3, are linked by thiophosphate groups.

[0214] The modifications of the 21 nucleotides in the 5'-3' antisense strand are as follows:

[0215] VPms-fs-mmmfmmmmmmmmfmfmm-ms-ms-m

[0216] That is, the nucleotide at position 1 of the antisense strand is a nucleotide modified with 2'-methoxy and 5'-(E)-vinyl phosphate, i.e., the modified nucleotide is, the nucleotides at positions 3-5, 7-13, 15 and 17-21 are nucleotides modified with 2'-methoxy, the nucleotides at positions 2, 6, 14 and 16 are nucleotides modified with 2'-fluoride, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups.

[0217] According to the M1VP modification mode, the unmodified siRNA in Example 1 is modified to obtain M1VP modified siRNA. The name of the modified siRNA is "siRNA number before modification" + "modification mode". For example, the unmodified siRNA named CID-36 is modified with M1VP to obtain the modified siRNA named CID-36M1VP.

[0218] Furthermore, for M1VP-modified siRNA, L96 is conjugated to the 3' end of the positive strand to obtain L96-conjugated M1VP-modified siRNA. The name of the L96-conjugated siRNA is "pre-modification siRNA number" + "M1GVP". For example, if the pre-modification siRNA is CID-36, after M1VP modification and L96 conjugation to the 3' end of the positive strand, it is named CID-36M1-GVP.

[0219] Using AD-1699964.1 and AD-1700369.1 as positive controls, in vivo screening of siRNAs conjugated with L96 and M1VP modifications was conducted in animals. Six- to eight-week-old C57-hCIDEB heterozygous mice were divided into groups of four (two males and two females). The drug dosages were set at 1 mpk and 3 mpk. Administration was performed on Day 0, and liver samples were collected by sacrifice on Day 14 / 28 for qPCR detection. Detailed experimental data are shown in Table 12. Data for each group are presented as a summary, separately for males and females, and separately for dose-effect (1 / 3 mpk) and time-effect (Day 14 / 28).

[0220] Table 12. Screening of CIDEB mRNA inhibitory effect in animal experiments with M1 modification 1 / 3 mpk-Day 14 / 28

[0221] Example 6: RNA-seq off-target verification experiment

[0222] Referring to the experimental results of Example 5, a subset of siRNAs were selected and transfected into Hep3B cells with 10 nM siRNA. Cell samples were then harvested, and total RNA was extracted from the transfected cells using the Trizol method, following the experimental procedures outlined in Example 3. RNA sequencing (RNA-seq) was performed to analyze the differences in transcript expression levels among the experimental groups, in order to examine the off-target effects of different siRNAs. The sequencing data volume for each sample was 6 G, and the results are shown in Table 13.

[0223] Table 13. Results of RNA-seq off-target validation experiments

[0224] Example 7: In vivo effects of siRNAs with different modifications

[0225] The siRNA from Example 1 was modified using the following different modification patterns, the specific modification patterns are as follows:

[0226] M2 Modification Mode:

[0227] The modifications of the 19 nucleotides in the 5'-3' strand of the positive chain are as follows:

[0228] ms-ms-mmfmfffmmmmmmmmmm

[0229] That is, the nucleotides at positions 1-4, 6 and 10-19 of the positive chain are 2'-methoxy modified nucleotides, the nucleotides at positions 5 and 7-9 are 2'-fluorinated modified nucleotides, and the nucleotides at positions 1 and 2, and positions 2 and 3 are linked by thiophosphate groups.

[0230] The modifications of the 21 nucleotides in the 5'-3' antisense strand are as follows:

[0231] ms-fs-mmmfmffmmmmfmfmm-ms-ms-m

[0232] That is, the nucleotides at positions 1, 3-5, 7, 10-13, 15, and 17-21 of the antisense strand are nucleotides modified with 2'-methoxy groups, the nucleotides at positions 2, 6, 8, 9, 14, and 16 are nucleotides modified with 2'-fluoride groups, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups.

[0233] M3 Editing Mode:

[0234] The modifications of the 19 nucleotides in the 5'-3' strand of the positive chain are as follows:

[0235] ms-ms-mmfmfffmmmmmmmmmm

[0236] That is, the nucleotides at positions 1-4, 6 and 10-19 of the positive chain are 2'-methoxy modified nucleotides, the nucleotides at positions 5 and 7-9 are 2'-fluorinated modified nucleotides, and the nucleotides at positions 1 and 2, and positions 2 and 3 are linked by thiophosphate groups.

[0237] The modifications of the 21 nucleotides in the 5'-3' antisense strand are as follows:

[0238] ms-fs-mmmfmmmmmmmmfmfmm-ms-ms-m

[0239] That is, the nucleotides at positions 1, 3-5, 7-13, 15, and 17-21 of the antisense strand are nucleotides modified with 2'-methoxy groups, the nucleotides at positions 2, 6, 14, and 16 are nucleotides modified with 2'-fluoride groups, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups.

[0240] M4 Editing Mode:

[0241] The modifications of the 19 nucleotides in the 5'-3' strand of the positive chain are as follows:

[0242] ms-ms-fmfmfffmfmfmfmfmf

[0243] That is, the nucleotides at positions 1-2, 4, 6, 10, 12, 14, 16, and 18 of the positive chain are 2'-methoxy modified nucleotides, the nucleotides at positions 3, 5, 7-9, 11, 13, 15, 17, and 19 are 2'-fluorinated modified nucleotides, and the nucleotides at positions 1 and 2, as well as positions 2 and 3, are linked by thiophosphate groups.

[0244] The modifications of the 21 nucleotides in the 5'-3' antisense strand are as follows:

[0245] ms-fs-mfmfmfmfmmmfmfmf-ms-ms-m

[0246] That is, the nucleotides at positions 1, 3, 5, 7, 9, 11-13, 15, 17, and 19-21 of the antisense strand are nucleotides modified with 2'-methoxy groups, the nucleotides at positions 2, 4, 6, 8, 10, 14, 16, and 18 are nucleotides modified with 2'-fluoride groups, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups.

[0247] M5 Editing Mode:

[0248] The modifications of the 19 nucleotides in the 5'-3' strand of the positive chain are as follows:

[0249] ms-ms-mmmmff-(d)-mmmmmmmmmm

[0250] That is, the nucleotides at positions 1-6 and 10-19 of the positive chain are 2'-methoxy modified nucleotides, the nucleotides at positions 7 and 8 are 2'-fluorinated modified nucleotides, the nucleotide at position 9 is a deoxyribonucleotide, and the nucleotides at positions 1 and 2, as well as the nucleotides at positions 2 and 3, are linked by thiophosphate groups.

[0251] The modifications of the 21 nucleotides in the 5'-3' antisense strand are as follows:

[0252] ms-fs-mmmfmmmmmmmmfmfmm-ms-ms-m

[0253] That is, the nucleotides at positions 1, 3-5, 7-13, 15, and 17-21 of the antisense strand are nucleotides modified with 2'-methoxy groups, the nucleotides at positions 2, 6, 14, and 16 are nucleotides modified with 2'-fluoride groups, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups.

[0254] M6 Modification Mode:

[0255] The modifications of the 21 nucleotides in the 5'-3' strand of the positive chain are as follows:

[0256] (invab)-ms-ms-mmmmfmfffmmmmmmmmmm-(invab)

[0257] That is, the nucleotides at positions 1-6, 8, and 12-21 of the positive strand are 2'-methoxy modified nucleotides, the nucleotides at positions 7 and 9-11 are 2'-fluorinated modified nucleotides, the nucleotides at positions 1 and 2, 2 and 3, and 20 and 21 are linked by thiophosphate groups, and inverse invab nucleotides are linked at the 5' and 3' ends of the positive strand.

[0258] The modifications of the 21 nucleotides in the 5'-3' antisense strand are as follows:

[0259] ms-fs-mmmfmmmmmmmmfmfmm-ms-ms-m

[0260] That is, the nucleotides at positions 1, 3-5, 7-13, 15, and 17-21 of the antisense strand are nucleotides modified with 2'-methoxy groups, the nucleotides at positions 2, 6, 14, and 16 are nucleotides modified with 2'-fluoride groups, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups.

[0261] M7 Modification Mode:

[0262] The modifications of the 21 nucleotides in the 5'-3' strand of the positive chain are as follows:

[0263] (invab)smmmmmmfmfffmmmmmmmmmm-ms-(invab)

[0264] That is, the nucleotides at positions 1-6, 8, and 12-21 of the positive strand are 2'-methoxy modified nucleotides, and the nucleotides at positions 7 and 9-11 are 2'-fluorinated modified nucleotides. Furthermore, inverse invab nucleotides are linked at the 5' and 3' ends of the positive strand. The 5' invab nucleotide is linked to the nucleotide at position 1 via a phosphate thioester, and the 3' invab nucleotide is linked to the nucleotide at position 21 via a phosphate thioester.

[0265] The modifications of the 21 nucleotides in the 5'-3' antisense strand are as follows:

[0266] ms-fs-mmmfmmmmmmmmfmfmm-ms-ms-m

[0267] That is, the nucleotides at positions 1, 3-5, 7-13, 15, and 17-21 of the antisense strand are nucleotides modified with 2'-methoxy groups, the nucleotides at positions 2, 6, 14, and 16 are nucleotides modified with 2'-fluoride groups, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups.

[0268] Examples of M2-M10 modified siRNAs are shown in the table below:

[0269] Table 14. Exemplary modified siRNAs

[0270] Furthermore, based on the M2-M6 modification, 5'-(E)-VP((E)-vinyl phosphate) is added to the 5' end of the antisense chain: Modification yields nucleotides with 5'-(E)-VP and 2'-methoxy modified nucleotides at the 5' end. The siRNA modified with (E)-VP at the 5' end of the antisense strand is numbered as the corresponding modified siRNA number followed by VP. That is, the siRNA using the M2-M6 modification mode is further modified with 5'-(E)-VP at the 5' end of the antisense strand, and the corresponding number is M2VP-M10VP. For example, the siRNA numbered CID-36M2 is further coupled with (E)-VP at the 5' end of the antisense strand and numbered CID-36M2VP.

[0271] The exemplary M2-M6 modified siRNA sequences after further 5' end coupling with (E)-VP are shown in the table below:

[0272] Table 15. Examples of siRNA modified with VP under different modification modes

[0273] After L96 is conjugated to the 3' end of the positive strand of the modified siRNA, L96-conjugated siRNAs are obtained. The siRNAs conjugated with L96 are numbered by adding "G" to the corresponding modification number. For example, siRNA numbered CID-36M2, after L96 conjugation to the 3' end of the positive strand, is numbered CID-36M2G. siRNA numbered CID-36M2VP, after L96 conjugation to the 3' end of the positive strand, is numbered CID-36M2GVP.

[0274] Examples of siRNAs with different L96 modification patterns coupled to the 3' end of the positive strand are as follows:

[0275] Table 16. Examples of siRNAs coupled with L96 under different modification modes.

[0276] Based on the in vivo pharmacological screening results after M1 modification and the off-target validation results of RNA-seq, a subset of siRNAs were selected and modified using different modification methods such as M1-M6. Simultaneously, L96 and VP modifications were coupled as described above. Then, using AD-1699964.1 as a positive control, C57-hCIDEB heterozygous mice were selected and grouped into groups of two for initial screening. On Day 0, the drug was administered at a dose of 3 mpk per mouse. On Day 14, liver samples were collected for qPCR detection. The experimental results are shown in Table 17.

[0277] Table 17. Inhibition effect of different modified siRNAs on CIDEB mRNA in animal experiments on 3mpk-Day 14.

[0278] Example 8: In vitro experiments with siRNAs with different modifications

[0279] Experimental Methods: The transfection and detection methods were the same as in Example 3, with AD-1700369-G, MOCK, and BLANK as controls. The MOCK group received only the interfering reagent without any sequence; the BLANK group received only cells. siRNA concentration gradients were set as follows: 10 nM, 3.33 nM, 1.11 nM, 0.3704 nM, 0.1235 nM, 0.0412 nM, 0.0137 nM, 0.0046 nM, 0.0015 nM, and 0.0005 nM. Using Grapdhpad software, the X-axis was set to log(concentration), and the Y-axis to the inhibition rate. The IC50 was fitted using nonlinear regression. 50 The curve, whose equation is "Y = Bottom + (Top - Bottom) / (1 + 10^(LogIC)". 50 -X)×HillSlope))”. In the formula, Bottom is the minimum inhibition rate, Top is the maximum inhibition rate, HillSlope is the slope of the curve, and LogIC50 is the IC50. 50 The logarithm of the half-inhibitory concentration. IC50 of partial siRNAs. 50 The test results are shown in the table below:

[0280] Table 18. IC50 of different modified siRNAs 50 Test results

[0281] Example 9: In vivo screening of modified siRNA for inhibiting CIDEB in animals

[0282] A subset of siRNAs from Example 8 were selected and administered to C57-hCIDEB heterozygous mice at doses of 1 mpk and 3 mpk, via single subcutaneous administration of L96- and VP-modified siRNAs. Saline was used as a control group. On days 14 and 28 post-administration, mice were sacrificed, liver samples were collected, liver mRNA was extracted, and analyzed using RT-qPCR. The RT-qPCR detection procedure was as described in Example 4. The results are shown in Table 19.

[0283] Table 19. Screening of CIDEB mRNA inhibitory effects by different modified siRNAs in 1 / 3mpk-Day 14 / 28 animal experiments.

[0284] The present disclosure has been described in detail above. Those skilled in the art will recognize that the present disclosure can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments are given in this disclosure, it should be understood that further modifications can be made to the present disclosure. In summary, in accordance with the principles of this disclosure, this application is intended to include any changes, uses, or improvements to the present disclosure, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

A double-stranded RNA molecule, wherein, The double-stranded RNA molecule is an siRNA comprising a sense strand and an antisense strand forming at least in part a double-stranded region, the sense strand comprising a nucleotide sequence that is any of the odd-numbered sequences in SEQ ID NO: 1-392, and the antisense strand comprising a nucleotide sequence that is any of the even-numbered sequences in SEQ ID NO: 1-392. The double stranded RNA molecule according to claim 1, wherein The double-stranded RNA molecule comprises a sense strand and an antisense strand selected from any one of the following groups: (1) sense strand: UAACAAAAACAUUUCCAAU (379) antisense strand: AUUGGAAAUGUUUUUGUUAGU (380) (2) sense strand: ACUAACAAAAACAUUUCCAAU (391) antisense strand: AUUGGAAAUGUUUUUGUUAGU (392) (3) sense strand: ACUGCUGAAUGGAGUGCUA (71) antisense strand: UAGCACUCCAUUCAGCAGUAG (72) (4) sense strand: CAGACAGUACAGGCUAGAU (343) antisense strand: AUCUAGCCUGUACUGUCUGCA (344) (5) sense strand: AUAUGUUGCUGGGAAUUUC (263) antisense strand: GAAAUUCCCAGCAACAUAUGG (264) (6) sense strand: CUAUGACAGCAUCAAAUUU (301) antisense strand: AAAUUUGAUGCUGUCAUAGUC (302) (7) sense strand: AGGUCAGUAUCUAAUAUAA (9) antisense strand: UUAUAUUAGAUACUGACCUGA (10) (8) sense strand: UGACAGCAUCAAAUUUCAG (307) antisense strand: CUGAAAUUUGAUGCUGUCAUA (308) A double-stranded RNA molecule modification, wherein the double-stranded RNA molecule modification is a compound containing modified nucleotides obtained by modifying at least one nucleotide of the double-stranded RNA molecule of claim 1 or 2. The double stranded RNA molecule modification of claim 3, wherein, The modified nucleotides are selected from at least one of the group consisting of: 2'-methoxy modified nucleotides, 2'-fluoro modified nucleotides, deoxy-nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides (LNA), non-locked nucleotides, conformationally restricted nucleotides, constrained ethyl nucleotides, abasic nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-hydroxyl-modified nucleotides, 2'-methoxyethyl modified nucleotides, 2'-O-alkyl-modified nucleotides, morpholino nucleotides, nucleotides comprising non-natural bases, tetrahydropyran modified nucleotides, 1,5-anhydrohexitol modified nucleotides, cyclohexenyl modified nucleotides, glycerol nucleotides (GNA), unlocked nucleotides (UNA), nucleotides comprising methylphosphonate groups, nucleotides comprising 5'-phosphate esters, and nucleotides comprising 5'-phosphate ester mimics. The double-stranded RNA molecule modification according to claim 3 or 4, wherein, The double stranded RNA molecule modification, in the 5' end to 3' end direction, comprises the following optional sense and antisense strand combinations: (A) the sense strand is 19 nt in length, and each nucleotide corresponds to the following modification: m-m-m-m-m-m-m-f-f-f-m-m-m-m-m-m-m-m-m-m-m; the antisense strand is 21 nt in length, and each nucleotide corresponds to the following modification: m-f-m-m-m-f-m-m-m-m-m-m-m-f-m-f-m-m-m-m-m; (B) the sense strand is 19 nt in length, and each nucleotide corresponds to the following modification: m-m-m-m-f-m-f-f-f-m-m-m-m-m-m-m-m-m-m-m; the antisense strand is 21 nt in length, and each nucleotide corresponds to the following modification: m-f-m-m-m-f-m-f-f-m-m-m-m-f-m-f-m-m-m-m-m; (C) the sense strand is 19 nt in length, and each nucleotide corresponds to the following modification: m-m-m-m-f-m-f-f-f-m-m-m-m-m-m-m-m-m-m-m; the antisense strand is 21 nt in length, and each nucleotide corresponds to the following modification: m-f-m-m-m-f-m-m-m-m-m-m-m-f-m-f-m-m-m-m-m; (D) the sense strand is 19 nt in length, and each nucleotide corresponds to the following modification: m-m-f-m-f-m-f-f-f-m-f-m-f-m-f-m-f-m-f; the antisense strand is 21 nt in length, and each nucleotide corresponds to the following modification: m-f-m-f-m-f-m-f-m-f-m-m-m-f-m-f-m-f-m-m-m; (E) the sense strand is 19 nt in length, and each nucleotide corresponds to the following modification: m-m-m-m-m-m-f-f-(d)-m-m-m-m-m-m-m-m-m-m-m; the antisense strand is 21 nucleotides in length, and each of the nucleotides is modified as follows: m-f-m-m-m-f-m-m-m-m-m-m-m-f-m-f-m-m-m-m-m; (F) the sense strand is 19 nucleotides in length, and each of the nucleotides is modified as follows: m-m-m-m-m-m-f-f-(d)-m-m-m-m-m-m-m-m-m-m-m; the antisense strand is 21 nucleotides in length, and each of the nucleotides is modified as follows: m-f-m-m-m-f-m-m-m-m-m-m-m-f-m-f-m-m-m-m-m; (G) the sense strand is 21 nucleotides in length, and each of the nucleotides is modified as follows: m-m-m-m-m-m-f-m-f-f-f-m-m-m-m-m-m-m-m-m-m; the antisense strand is 21 nucleotides in length, and each of the nucleotides is modified as follows: m-f-m-m-m-f-m-m-m-m-m-m-m-f-m-f-m-m-m-m-m; (H) the sense strand is 21 nucleotides in length, and each of the nucleotides is modified as follows: m-m-m-m-m-m-f-m-f-f-f-m-m-m-m-m-m-m-m-m-m; the antisense strand is 21 nucleotides in length, and each of the nucleotides is modified as follows: m-f-m-m-m-f-m-m-m-m-m-m-m-f-m-f-m-m-m-m-m; wherein m is a 2'-methoxy modified nucleotide, f is a 2'-fluoro modified nucleotide, and d is a deoxyribonucleic acid. The double-stranded RNA molecule modification of any one of claims 3-5, wherein, The 5'-terminal nucleotide of the antisense strand of the double-stranded RNA molecule modification is a 5'-phosphate or a derivative-modified nucleotide; Optionally, the phosphate or its derivative is selected from a vinylphosphonate, an alkylated derivative of a vinylphosphonate, an arylated derivative of a vinylphosphonate, a halogenated derivative of a vinylphosphonate, a hydroxylated derivative of a vinylphosphonate, an aminated derivative of a vinylphosphonate, a carboxylated derivative of a vinylphosphonate, a thioated derivative of a vinylphosphonate, a silylated derivative of a vinylphosphonate, a boronated derivative of a vinylphosphonate, or a metal complexed derivative of a vinylphosphonate; Optionally, the phosphate or its derivative is selected from an (E)-vinylphosphonate. The double-stranded RNA molecule modification of any one of claims 3-6, wherein, The 3'-terminal and / or 5'-terminal of the sense strand of the double-stranded RNA molecule modification is optionally linked with an inverted abasic nucleotide. The double-stranded RNA molecule modification according to any one of claims 3-7 is selected from any one of the following groups of sense and antisense strands: (1) sense strand: (invab)AmsCmsUmAmAmCmAfAmAfAfAfCmAmUmUmUmCmCmAmAmUm(invab) (403) antisense strand: AmsUfsUmGmGmAfAmAmUmGmUmUmUmUfUmGfUmUmAmsGmsUm (404); (2) sense: (invab) AmsCmsUmAmAmCmAfAmAfAfAfCmAmUmUmUmCmCmAmAmUm (invab) (403) antisense: VPAmsUfsUmGmGmAfAmAmUmGmUmUmUmUfUmGfUmUmAmsGmsUm (410); (3) sense: UmsAmsAmCmAmAmAfAfA(d)CmAmUmUmUmCmCmAmAmUm (401) antisense: AmsUfsUmGmGmAfAmAmUmGmUmUmUmUfUmGfUmUmAmsGmsUm (402); (4) sense: UmsAmsAmCmAmAmAfAfA(d)CmAmUmUmUmCmCmAmAmUm (401) antisense: VPAmsUfsUmGmGmAfAmAmUmGmUmUmUmUfUmGfUmUmAmsGmsUm (409); (5) sense: CmsAmsGmAmCfAmGfUfAfCmAmGmGmCmUmAmGmAmUm (397) antisense: AmsUfsCmUmAmGfCmCmUmGmUmAmCmUfGmUfCmUmGmsCmsAm (398); (6) sense: CmsAmsGmAmCfAmGfUfAfCmAmGmGmCmUmAmGmAmUm (397) antisense: VPAmsUfsCmUmAmGfCmCmUmGmUmAmCmUfGmUfCmUmGmsCmsAm (407); (7) sense: CmsUmsAmUmGfAmCfAfGfCmAmUmCmAmAmAmUmUmUm (399) antisense: AmsAfsAmUmUmUfGmAfUfGmCmUmGmUfCmAfUmAmGmsUmsCm (400); 2) sense: CmsUmsAmUmGfAmCfAfGfCmAmUmCmAmAmAmUmUmUm (399) antisense: VPAmsAfsAmUmUmUfGmAfUfGmCmUmGmUfCmAfUmAmGmsUmsCm (408); (8) sense: (invab) sCmCmAmUmAmUmGfUmUfGfCfUmGmGmGmAmAmUmUmUmCms (invab) (405) antisense: GmsAfsAmAmUmUfCmCmCmAmGmCmAmAfCmAfUmAmUmsGmsGm (406); or (9) sense: (invab) sCmCmAmUmAmUmGfUmUfGfCfUmGmGmGmAmAmUmUmUmCms (invab) (405) Antisense strand: VPGmsAfsAmAmUmUfCmCmCmAmGmCmAmAfCmAfUmAmUmsGmsGm (411) The double-stranded RNA molecule modification of any one of claims 3-8, wherein, optionally, the sugar ligand is a multivalent form of GalNAc covalently linked to the small nucleic acid molecule via a multivalent linker arm; optionally, the sugar ligand is a multivalent form of GalNAc covalently linked to the small nucleic acid molecule via a multivalent linker arm; Optionally, the ligand is selected from L96 of the following formula: A composition for inhibiting the expression of a CIDEB gene, wherein, The effective component of the composition is the double-stranded RNA molecule of claim 1 or 2 or the double-stranded RNA molecule modifier of any one of claims 3-9. The double-stranded RNA molecule of claim 1 or 2 or the double-stranded RNA molecule modifier of any one of claims 3-9 or the composition of claim 10 is used in any one of the following: (D1) for preparing a composition for inhibiting the expression of a CIDEB gene; (D2) for inhibiting the expression of a CIDEB gene; (D3) for treating a disease related to a CIDEB gene target; (D4) for preparing a composition for treating a disease related to a CIDEB gene target; (D5) for preparing a dimeric siRNA. The use according to claim 11, wherein The disease related to the CIDEB gene target includes a liver disease; optionally, the liver disease includes non-alcoholic fatty liver disease (NAFLD), simple fatty liver, non-alcoholic steatohepatitis (NASH), hepatitis, liver fibrosis, liver cirrhosis, alcoholic steatohepatitis (ASH), alcoholic fatty liver disease (ALD), HCV-related cirrhosis, drug-induced liver injury, and hepatocyte necrosis, chronic fibro-inflammatory liver disease, or liver cancer.

Images