Therapeutic antisense oligomers

Antisense oligomers and RNAi agents targeting specific regions of the interferon beta 1 mRNA effectively modulate IFN-pi expression to treat autoimmune and autoinflammatory conditions, addressing the need for therapeutic agents that can manage IFN-pi-related inflammation.

WO2026027518A2PCT designated stage Publication Date: 2026-02-05UNITED KINGDOM RESEARCH AND INNOVATION
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/071763
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-30
Filing Date
2025-07-29
Publication Date
2026-02-05

AI Technical Summary

Technical Problem

There is a need for therapeutic agents that can modulate interferon-pi (IFN-pi) expression, particularly for treating autoimmune or autoinflammatory conditions such as myositis, dermatomyositis, STING-associated vasculopathy with onset in infancy, systemic lupus erythematosus, psoriasis, and Sjogren’s syndrome, by targeting specific regions of the Homo sapiens interferon beta 1 mRNA.

Method used

Development of antisense oligomers and double-stranded RNAi agents that target specific regions of the Homo sapiens interferon beta 1 mRNA, including regions 5-90, 110-170, 195-245, 280-330, 360-425, 500-590, and 600-690, to modulate IFN-pi expression, either by inhibiting or upregulating its activity, and are delivered as single-stranded molecules or encoded by nucleic acid vectors.

Benefits of technology

The antisense oligomers and RNAi agents effectively reduce IFN-pi-mediated inflammation, providing therapeutic benefits for conditions like myositis, dermatomyositis, and other autoinflammatory diseases by downregulating or upregulating IFN-pi expression as needed.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000029_0001
    Figure IMGF000029_0001
  • Figure IMGF000008_0001
    Figure IMGF000008_0001
  • Figure IMGF000009_0001
    Figure IMGF000009_0001
Patent Text Reader

Abstract

The present disclosure relates to antisense oligomers that are targeted to IFN-β1. In particular, double-stranded agents that can be used for RNAi are disclosed. Also disclosed are antisense oligomers that may be used as single-stranded molecules. Methods of using said oligomers and agents for the treatment of disease and / or as anti- inflammatory medicaments are disclosed.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] THERAPEUTIC ANTISENSE OLIGOMERS

[0002] FIELD OF THE INVENTION

[0003] The present disclosure relates to antisense oligomers that are targeted to IFN-pi . In particular, double-stranded agents that can be used for RNAi are disclosed. Also disclosed are antisense oligomers that may be used as single-stranded molecules. Methods of using said oligomers and agents for the treatment of disease and / or as antiinflammatory medicaments are disclosed.

[0004] BACKGROUND OF THE INVENTION

[0005] There is a need to identify suitable therapeutic targets for the treatment of multifactorial pathologies. For instance, some diseases have autoimmune or autoinflammatory components, and there is a need to identify aspects of the immune response that can be therapeutically targeted.

[0006] In addition, there is a need for the provision of medicaments capable of treating said pathologies or for treating the immune component of said pathologies.

[0007] SUMMARY OF THE INVENTION

[0008] In a first aspect, there is provided an antisense oligomer capable of modulating expression of IFN-pi in a cell, wherein the antisense oligomer targets residues in any one of regions 5-90, 110-170, 195-245, 280-330, 360-425, 500-590, 600-690, or 705-740 of the Homo sapiens interferon beta 1 mRNA.

[0009] The antisense oligomer may be an antisense strand of a double-stranded RNAi agent further comprising a sense strand, wherein the sense stand and the antisense strand are, at least in part or completely, complementary. The double-stranded RNAi agent may comprise an antisense strand that targets residues in region 5-90, the Homo sapiens interferon beta 1 mRNA. The double-stranded RNAi agent may be capable of inhibiting expression of IFN- pi in a cell.

[0010] The antisense oligomer may be suitable for use or suitable for delivery to a patient as a single-stranded molecule and / or may be single stranded.

[0011] In a second aspect, there is provided one or more nucleic acid vectors encoding an antisense oligomer of the first aspect. For instance, there is provided one or more vectors encoding a double-stranded RNAi agent of the first aspect.

[0012] In a third aspect, there is provided a pharmaceutical composition comprising an antisense oligomer of the first aspect or a nucleic acid vector of the second aspect.

[0013] In a fourth aspect there is provided an antisense oligomer capable of inhibiting expression of interferon beta (IFN- pi) in a cell, or a nucleic acid vector encoding said antisense oligomer, for use as a medicament.

[0014] The antisense oligomer or nucleic acid vector may be used as an anti-inflammatory medicament. Thus, the antisense oligomer or nucleic acid vector can reduce IFN-pi -mediated inflammation. The subjects may have a pathological condition that is, at least in part, mediated by IFN-pi . For instance, the medicaments may be used to treat an interferonopathy or an autoinflammatory condition. In examples, the antisense oligomer or nucleic acid vector are for use in treating myositis. The myositis may have a type I IFN signature. In particular embodiments, the antisense oligomer or nucleic acid vector are for use in treating adult or juvenile dermatomyositis. Other conditions that the medicaments may be for use in treating include stimulator of interferon genes (STING)- associated vasculopathy with onset in infancy (SA VI), systemic lupus erythematosus (SLE), psoriasis, or Sjogren’s syndrome. The fourth aspect may comprise the use of an antisense oligomer as disclosed for the first aspect, one or more nucleic acid vectors, or a pharmaceutical composition as disclosed for the second aspect.

[0015] In a fifth aspect, there is provided an antisense oligomer capable of upregulating expression of interferon beta (IFN-pi) in a cell, or a nucleic acid vector encoding said antisense oligomer, for use as a medicament.

[0016] BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1. Expression of IFNB1 transcript in myoblasts treated with Poly I:C followed by siRNA targeting IFNB1. Normalised relative expression of IFNB1 with reference gene HPRT1 and control group Ing / mL Poly I:C. Immortalised myoblasts transfected with Ing / mL Poly I:C for 24 hours and then transfected with 30nM siRNA for 48 hours. Values calculated using Bio-Rad CFX Maestro software. * Indicates p-value <0.05; **<0.01, ***<0.001, ****<0.0001.

[0018] Figure 2. Expression of IFNB1 transcript (A) and concentration of secreted IFN beta protein (B) in myotubes treated with Poly I:C followed by siRNA targeting IFNB1. Differentiated myotubes transfected with Ing / mL Poly I:C for 24 hours and then transfected with 20nM siRNA for 48 hours. A) Normalised relative expression of IFNB1 with reference gene HPRT1 and control group Ing / mL Poly I:C. Values calculated using Bio-Rad CFX Maestro software. B) Concentration of IFN beta in cell media supernatant. Values calculated from 450nm absorbance readings in duplicate from two wells per group and converted to pg / mL based on an IFN beta standard curve. P-values calculated using ordinary one-way ANOVA comparing to non-targeting control siRNA group. * Indicates p-value <0.05; **<0.01, ***<0.001, ****<0.0001.

[0019] Figure 3. Expression of IFNB1 transcript in A549 lung cells treated with Poly I:C followed by siRNA targeting IFNB1. Normalised relative expression of IFNB1 with reference gene GAPDH and control group nontargeting control siRNA (NATA_D-NTC003). A549 lung adenocarcinoma cells transfected with lOOng / mL Poly I:C for 24 hours and then transfected with 50nM siRNA for 48 hours. Values calculated using Bio-Rad CFX Maestro software. Dark grey bars indicate p-value <0.05

[0020] Figure 4. Expression of IFNB1 transcript in A549 lung cells treated with Poly I:C followed by ASO targeting IFNB1. Normalised relative expression of IFNB1 with reference gene GAPDH and control group nontargeting control ASO (NATA_NTC003). A549 lung adenocarcinoma cells transfected with lOOng / mL Poly I:C for 24 hours and then transfected with 50nM ASO for 48 hours. Values calculated using Bio-Rad CFX Maestro software. Dark grey bars indicate p-value <0.05

[0021] DETAILED DESCRIPTION

[0022] The inventors have identified that there is a need for agents that are capable of modulating IFN-pi expression, for instance by downregulation. In particular, there is a need for IFN-pi -targeting agents that can be used in a therapeutic setting. The sequence of human IFN-pi mRNA may be as provided below.

[0023] ATTCTAACTGCAACCTTTCGAAGCCTTTGCTCTGGCACAACAGGTAGTAGGCGACACTGTTCGTGTTGTCAACATG ACCAACAAGTGTCTCCTCCAAATTGCTCTCCTGTTGTGCTTCTCCACTACAGCTCTTTCCATGAGCTACAACTTGC TTGGATTCCTACAAAGAAGCAGCAATTTTCAGTGTCAGAAGCTCCTGTGGCAATTGAATGGGAGGCTTGAATACTG C CT CAAGGACAGGAT GAACT T T GACAT C C CT GAGGAGAT T AAGCAGCT GCAGCAGT T C CAGAAGGAGGAC GC C GCA TTGACCATCTATGAGATGCTCCAGAACATCTTTGCTATTTTCAGACAAGATTCATCTAGCACTGGCTGGAATGAGA CTATTGTTGAGAACCTCCTGGCTAATGTCTATCATCAGATAAACCATCTGAAGACAGTCCTGGAAGAAAAACTGGA GAAAGAAGAT T T CAC CAGGGGAAAACT CAT GAGCAGT CT GCAC CT GAAAAGAT AT TAT GGGAGGAT T CT GCAT TAG CTGAAGGCCAAGGAGTACAGTCACTGTGCCTGGACCATAGTCAGAGTGGAAATCCTAAGGAACTTTTACTTCATTA ACAGACTTACAGGTTACCTCCGAAACTGAAGATCTCCTAGCCTGTGCCTCTGGGACTGGACAATTGCTTCAAGCAT TCTTCAACCAGCAGATGCTGTTTAAGTGACTGATGGCTAATGTACTGCATATGAAAGGACACTAGAAGATTTTGAA AT T T T TAT T AAAT TAT GAGT TAT T T T TAT T TAT T T AAAT T T TAT T T T GGAAAAT AAAT TAT T T T T GGT GCAAAAGT CAA ( SEQ ID NO : 263 - NM_002176 . 4 )

[0024] Using in silco prediction, the inventors have identified the below regions as preferred for targeting.

[0025] 1. NM_002176.4:5-90 Homo sapiens interferon beta 1 (IFNB1), mRNA TAACTGCAACCTTTCGAAGCCTTTGCTCTGGCACAACAGGTAGTAGGCGACACTGTTCGTGTTGTCAACATGACCA

[0026] ACAAGTGTCT ( SEQ ID NO : 255 )

[0027] 2. NM_002176.4: 110-170 Homo sapiens interferon beta 1 (IFNB1), mRNA TTGTGCTTCTCCACTACAGCTCTTTCCATGAGCTACAACTTGCTTGGATTCCTACAAAGAA ( SEQ ID NO : 256 )

[0028] 3. NM_002176.4: 195-245 Homo sapiens interferon beta 1 (IFNB1), mRNA TCCTGTGGCAATTGAATGGGAGGCTTGAATACTGCCTCAAGGACAGGATGA ( SEQ ID NO : 257 )

[0029] 4. NM_002176.4:280-330 Homo sapiens interferon beta 1 (IFNB1), mRNA GCAGTTCCAGAAGGAGGACGCCGCATTGACCATCTATGAGATGCTCCAGAA ( SEQ ID NO : 258 )

[0030] 5. NM_002176.4:360-425 Homo sapiens interferon beta 1 (IFNB1), mRNA CTAGCACTGGCTGGAATGAGACTATTGTTGAGAACCTCCTGGCTAATGTCTATCATCAGATAAACC ( SEQ ID NO : 259 )

[0031] 6. NM_002176.4:500-590 Homo sapiens interferon beta 1 (IFNB1), mRNA CTGAAAAGATATTATGGGAGGATTCTGCATTACCTGAAGGCCAAGGAGTACAGTCACTGTGCCTGGACCATAGTCA GAGTGGAAATCCTAA ( SEQ ID NO : 260 )

[0032] 7. NM_002176.4:600-690 Homo sapiens interferon beta 1 (IFNB1), mRNA ACTTCATTAACAGACTTACAGGTTACCTCCGAAACTGAAGATCTCCTAGCCTGTGCCTCTGGGACTGGACAATTGC TTCAAGCATTCTTCA ( SEQ ID NO : 261 )

[0033] 8. NM_002176.4:705-740 Homo sapiens interferon beta 1 (IFNB1), mRNA TTTAAGTGACTGATGGCTAATGTACTGCATATGAAA ( SEQ ID NO : 262 )

[0034] Thus, in a first aspect, there is provided an antisense oligomer capable of modulating expression of IFN-pi in a cell, wherein the antisense oligomer targets residues in any one of regions 5-90, 110-170, 195-245, 280-330, 360- 425, 500-590, 600-690, or 705-740 of the Homo sapiens interferon beta 1 mRNA.

[0035] The Homo sapiens interferon beta 1 mRNA may be SEQ ID NO: 263.

[0036] In examples, there is provided an antisense oligomer capable of hybridising to a region of any one of SEQ ID NOs: 255-262. The antisense oligomer may be capable of hybridising to mRNA transcribed from the Homo sapiens interferon beta 1 gene.

[0037] An “antisense oligomer”, in the context of the present disclosure, is a molecule comprising subunits that comprise moieties capable of binding to nucleobases. Hence, antisense oligomers can be designed to be capable of hybridising to specific nucleic acid sequences. The subunits may be monomers, each monomer comprising a moiety capable of binding to a nucleobase. The moieties capable of binding to a nucleobase may bind by basespecific hydrogen bonding, such as Watson-Crick base pairing. The antisense oligomer may be referred to as an antisense compound, particularly where the compound is not necessarily synthesised from monomers. The antisense oligomer may be referred to as an antisense oligonucleotide, particularly where the oligomer is composed of or substantially composed of nucleotides.

[0038] The antisense oligomer may be a nucleic acid analogue or a nucleic acid. A “nucleic acid analogue” is a compound that has an arrangement of nucleobases that mimics the arrangement of nucleobases in nucleic acids containing a 2’ deoxyribose 5’ monophosphate or ribose 5’ monophosphate backbone, wherein the nucleic acid analogue is capable of base pairing with a complementary nucleic acid. Examples of backbone moieties include amino acids as in peptide nucleic acids, glycol molecules as in glycol nucleic acids, threofuranosyl sugar molecules as in threose nucleic acids, morpholine rings and phosphorodiamidate groups as in morpholinos, and cyclohexenyl molecules as in cyclohexenyl nucleic acids. The antisense oligomers referred to herein are nucleic acid analogues.

[0039] The term “antisense” refers to molecules that are at least partially complementary to a region of a sense strand of a nucleic acid. The antisense oligomers of the present disclosure are at least partially complementary to a region of Homo sapiens IFN-pi mRNA (SEQ ID NO: 263) and may be capable of binding by hybridisation to said region. The degree of complementarity may not be exact, as long as the antisense oligomer and the mRNA can hybridise under physiological conditions. In some examples, the antisense oligomer and the mRNA may be complementary apart from 5, 4, 3, 2, or 1 mismatches. The antisense oligomer and the mRNA may be complementary apart from 3, 2, or 1 mismatches. In some examples, the antisense oligomer is perfectly complementary to a region of the mRNA. In other examples, the antisense oligomer comprises a region that is perfectly complementary to a region of the mRNA, wherein the complementary regions are of a sufficient length to allow binding by hybridisation. The antisense sequence may be varied to target other alleles of human IFN-betal or to target IFN-betal in other species. Thus, the sequence of the antisense strand may vary from a sequence recited herein but may be perfectly complementary to its target mRNA (not including any overhang sequences).

[0040] Physiological conditions are the conditions (such as temperature, pH, concentration of various ions, etc) found in natural, in vivo, situations, or conditions that correspond such a situation. For instance, the antisense oligomer may bind by hybridisation in intracellular conditions, such as the intracellular conditions of human cells. Confirmation of hybridisation in physiological conditions may be performed in vitro, for instance at a temperature, pH, and salt concentration that approximates intracellular conditions. In a particular example, the antisense oligomer may hybridise to IFN-pi mRNA at 37°C, pH 7.4, and phosphate buffered saline (e.g. containing 137 mM NaCl, 2.7 mM KC1, 10 mM Na2HPC>4, and 1.8 mM KH2PO4). In all embodiments, the degree of hybridisation is capable of modulating or downregulating expression.

[0041] Modulation or downregulation of the target gene may be calculated according to the assays and experiments disclosed in the Examples section herein. For instance, the in vitro screening in myoblasts of Example 1 or the in vitro screen in differentiated myotubes of Example 2. The target may be considered to be modulated if the change in expression is significant compared to an appropriate control (e.g. a scrambled control that does not target a gene in the experimental system). The target may be considered to be downregulated if the reduction in expression is significant compared to an appropriate control (e.g. a scrambled control that does not target a gene in the experimental system). The modulation or downregulation may be tested in human cells.

[0042] RNAi agents

[0043] In particular embodiments, the antisense oligomer of the first aspect is an antisense strand of a double-stranded RNAi agent further comprising a sense strand, wherein the sense stand and the antisense strand are, at least in part or completely, complementary. Thus, there is provided herein a double-stranded RNAi agent capable of modulating expression of IFN-pi in a cell, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand that are, at least in part or completely, complementary; and wherein the double-stranded RNAi agent targets residues in any one of regions 5-90, 110-170, 195-245, 280-330, 360-425, 500-590, 600-690, or 705- 740 of the Homo sapiens interferon p 1 mRNA (SEQ ID NO: 263). siRNA sequences identified by in silico screening are presented in Table la. The RNAi agent of the invention may comprise any of the antisense sequences presented in Table la or Table lb. The RNAi agent of the invention may comprise any of the antisense sequences presented in Table la and the paired sense sequences presented in Table la. The RNAi agent of the invention may comprise any of the antisense sequences presented in Table lb and the paired sense sequences presented in Table lb. The sequences may contain 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions compared to a sequence recited in Table la or Table lb. The sequences may contain 3, 2, 1, or no substitutions, deletions, or insertions compared to a sequence recited in Table la or Table lb. The sequences may be according to a sequence recited in Table la or Table lb apart from 3, 2, 1, or no substitutions. In particular embodiments, the sequences contain no alternations from a sequence recited in Table la or Table lb, and so comprise or are of the recited sequence.

[0044] Where a molecule is described anywhere in the present disclosure as being according to or comprising a recited SEQ ID NO “apart from” substitutions, deletions, or insertions, the molecule does not comprise further sequence changes to the recited SEQ ID NO beyond those explicitly referred to (e.g. a molecule comprising SEQ ID NO: 1 apart from one substitution will comprise a 21 base contiguous sequence that matches 20 bases of SEQ ID NO: 1).

[0045] The antisense strand may comprise a nucleobase sequence according to any one of SEQ ID NOs: 1-127 and 264 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. The antisense strand may comprise a nucleobase sequence according to any one of SEQ ID NOs: 1-127 and 264 apart from 3, 2, 1, or no substitutions, deletions, or insertions. The antisense strand may comprise a nucleobase sequence according to any one of SEQ ID NOs: 1-127 and 264 apart from 3, 2, 1, or no substitutions. In particular, the antisense sequence may be varied to target other alleles of human IFN-betal or to target IFN-betal in other species. Thus, the sequence of the antisense strand may vary from a sequence recited herein but may be perfectly complementary to its target mRNA (not including any overhang sequences).

[0046] The antisense and / or the sense strands of the RNAi agents disclosed herein may comprise an overhang, including a 5’ or a 3’ overhang. The overhang may be a 3’ overhang and may be one or two nucleotides, such as deoxythymidines. In particular embodiments, the antisense strand comprises an overhang and the sense strand does not.

[0047] In particular embodiments, the antisense strands of the RNAi agents disclosed herein comprise an overhang. In other embodiments, the antisense stand does not comprise an overhang. The overhang may be a 3 ’ overhang and may be one or two nucleobases. The overhang may comprise or may be one or two nucleotides comprising a thymine nucleobase, or analogues thereof. The overhang may comprise or may be one or two deoxythymidines. Antisense strands comprising SEQ ID NOs: 1-127 and 264 are discussed herein including the lengths and potential sequence alternations; the overhangs may be applied to any of these embodiments. For instance, the RNAi agent of the present invention may comprise an antisense strand that comprises any one of SEQ ID NOs: 1- 127 and 264 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions and a 3’ overhang that is or comprises one or two deoxythymidines. In other embodiments, the RNAi agent of the present invention may comprise an antisense strand that comprises any one of SEQ ID NOs: 1-127 and 264 and a 3’ overhang that is two deoxythymidines. In more specific embodiments, the RNAi agent of the present invention may comprise an antisense strand that is 23 nucleobases long and comprises any one of SEQ ID NOs: 1-127 and 264 and a two deoxythymidine 3’ overhang. The overhangs may also be applied to the subsets of SEQ ID NOs: 1-127 and 264 discussed herein, such as those of Tables 2 and 3.

[0048] The antisense strand may be 15 to 30, 19 to 25, 21 to 24, 21, 22, or 23 nucleobases in length and comprise any one of SEQ ID NOs: 1-127 and 264 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. The antisense strand may be 15 to 30, 19 to 25, 21 to 24, 21, 22, or 23 nucleobases in length and comprise any one of SEQ ID NOs: 1-127 and 264 apart from 3, 2, 1, or no substitutions. The antisense strand may comprise any one of SEQ ID NOs: 1-127 and 264, including or not including the aforementioned sequence variations, and an overhang. The overhang may be a 3’ overhang and / or may be one or two nucleobases. The antisense strand may be 23 nucleobases in length; comprise any one of SEQ ID NOs: 1-127 and 264, including or not including the aforementioned sequence variations; and comprise a two nucleobase 3 ’ overhang. The antisense strand may be 23 nucleobases in length; comprise any one of SEQ ID NOs: 1-127 and 264 apart from 3, 2, 1, or no substitutions; and comprise a two nucleobase 3 ’ overhang. In a particular embodiment, the antisense strand may be 23 nucleobases in length; comprise any one of SEQ ID NOs: 1-127 and 264; and comprise a two nucleobase 3’ overhang. The sense strand may comprise a nucleobase sequence according to any one of SEQ ID NOs: 128-254 and 265 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. The sense strand may comprise a nucleobase sequence according to any one of SEQ ID NOs: 128-254 and 265 apart from 3, 2, 1, or no substitutions, deletions, or insertions. The sense strand may comprise a nucleobase sequence according to any one of SEQ ID NOs: 128- 254 and 265 apart from 3, 2, 1, or no substitutions. In a particular RNAi agent, the sense strand is the pair of the antisense strand as set out in Table la or Table lb. As mentioned above, the antisense sequence may be varied to take into account alleles or species variations and so the sense sequence may be varied from a sequence recited herein but may be perfectly complementary to its paired antisense sequence (not including any overhang sequences).

[0049] The sense strand may be 15 to 30, 19 to 25, 21 to 24, 16, 19, 21, 22, or 23 nucleobases in length and comprise any one of SEQ ID NOs: 128-254 and 265 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. The sense strand may be 15 to 30, 19 to 25, 21 to 24, 21, 22, or 23 nucleobases in length and comprise any one of SEQ ID NOs: 128-254 and 265 apart from 3, 2, 1, or no substitutions. The sense strand may comprise an overhang or may not comprise an overhang. In a particular embodiment, the sense strand may be 21 nucleobases in length and be of the sequence of any one of SEQ ID NOs: 128-254 and 265.

[0050] In some embodiments, the antisense strand and / or sense strand does not comprise any additional nucleic acid sequence, or analogous nucleobases, beyond that recited in any one of SEQ ID NOs: 1-254. In other embodiments, the antisense strand and / or sense strand may comprise 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, or more nucleobases in addition to those recited in any one of SEQ ID NOs: 1-254. A portion or all of any additional nucleobases may be complementary to the target. For instance, a portion or all of the additional nucleobases may be complementary to SEQ ID NO: 263. In other embodiments, none of the additional nucleobases are complementary to SEQ ID NO: 263.

[0051] In some embodiments, the antisense strand and / or sense strand is or comprises a truncation of the sequence in any one of SEQ ID NOs: 1-254. The truncation may be at least 15, 16, 17, 18, 19, or 20 nucleobases in length. In an embodiment, the sense stand is or comprises a truncation of the sequence in any one of SEQ ID NOs: 128-254, wherein the truncation is at least 15, 16, 17, 18, 19, or 20 nucleobases in length.

[0052] The RNAi agent of the invention may comprise an antisense sequence and the paired sense sequence presented in Table la or Table lb. Thus, the antisense strand may comprise any one of SEQ ID NOs: 1-127 and 264 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions and the sense stand may comprise any one of SEQ ID NOs: 128-254 and 265 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; wherein the SEQ ID NOs of the antisense and sense strand are paired as in Table la or Table lb. The antisense strand may comprise any one of SEQ ID NOs: 1-127 and 264 apart from 3, 2, 1, or no substitutions and the sense stand may comprise any one of SEQ ID NOs: 128-254 and 265 apart from 3, 2, 1, or no substitutions; wherein the SEQ ID NOs of the antisense and sense strand are paired as in Table la or Table lb. The antisense strand may comprise any one of SEQ ID NOs: 1-127 and 264 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions and comprise a 3’ overhang and the sense strand may comprise any one of SEQ ID NOs: 128-254 and 265 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; wherein the SEQ ID NOs of the antisense and sense strand are paired as in Table la or Table lb. The antisense strand may be 23 nucleobases in length; comprise any one of SEQ ID NOs: 1-127 and 264 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; and comprise a two nucleobase 3’ overhang and the sense strand may comprise any one of SEQ ID NOs: 128-254 and 265 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; wherein the SEQ ID NOs of the antisense and sense strand are paired as in Table la or Table lb. The antisense strand may be 23 nucleobases in length; comprise any one of SEQ ID NOs: 1-127 and 264; and comprise a two nucleobase 3’ overhang and the sense strand may comprise any one of SEQ ID NOs: 128-254 and 265 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; wherein the SEQ ID NOs of the antisense and sense strand are paired as in Table la or Table lb. The antisense strand may comprise any one of SEQ ID NOs: 1-127 and 264 and the sense stand may comprise any one of SEQ ID NOs: 128-254 and 265: wherein the SEQ ID NOs of the antisense and sense strand are paired as in Table la or Table lb. The antisense strand may be 23 nucleobases in length; comprise any one of SEQ ID NOs: 1-127 and 264; and comprise a two nucleobase 3’ overhang and the sense strand may comprise any one of SEQ ID NOs: 128-254 and 265; wherein the SEQ ID NOs of the antisense and sense strand are paired as in Table la or Table lb. The antisense strand may be 23 nucleobases in length; comprise any one of SEQ ID NOs: 1-127 and 264; and comprise a two nucleobase 3’ overhang and the sense strand may be 21 nucleobases in length and be of any one of SEQ ID NOs: 128-254 and 265; wherein the SEQ ID NOs of the antisense and sense strand are paired as in Table la or Table lb. In any of these embodiments the sense and the antisense strand may partly or completely complementary, and may be completely complementary apart from any overhang sequences.

[0053] In particular embodiments, the antisense strand and the sense strand are perfectly complementary apart from overhang sequences.

[0054] The antisense strand and the sense strand may comprise any of the modifications or alterations as discussed herein. For instance, modifications to the sugar moieties, nucleobases, and / or linkages between monomers. The antisense strand and / or the sense strand may comprise the patterns of modifications in Table lb. The antisense strand and / or the sense strand may be according to any one of SEQ ID NOs: 266-359.

[0055] Table la - siRNA sequences identified by in silico screening

[0056] Table lb - Further siRNA sequences identified by in silico screening

[0057] Lower case=DNA

[0058] (mX)=2'-0me

[0059] (fX)=2'-F * = PS-Bond

[0060] Strand “A” = Antisense

[0061] Strand “S” = Sense

[0062] The sequences from Table lb were tested and the results are illustrated in Figure 3 and Table 8.

[0063] The inventors selected particular sequences from Table la for further testing. These sequences are listed in Table 2. Thus, the RNAi agent of the invention may comprise any of the antisense sequences presented in Table 2. The RNAi agent of the invention may comprise any of the antisense sequences presented in Table 2 and the paired sense sequence presented in Table 2. The sequences may contain 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions compared to a sequence recited in Table 2. The sequences may contain no more than 3, 2, 1, or no substitutions compared to a sequence recited in Table 2. In particular embodiments, the sequences contain no alternations from a sequence recited in Table 2, and so comprise or are of the recited sequence (optionally including an additional overhand). The lengths, overhangs, and modifications discussed herein are applicable to the sequences of Table 2.

[0064] Table 2 - Selected siRNA Sequences

[0065] In Figure 1 and Table 5, the results from in vitro screening of some of the sequences of Table 2 are presented. These results highlight that region 5-90 is desirable to target. This region is relevant to the RNAi agents: NATA_D4001, NATA_D4002, NATA_D4003, NATA_D4005, NATA_D4008, NATA_D4009, NATA_D4010, NATA_D4011, NATA_D4012, NATA_D4014, and NATA_D4017 (see Table 2).

[0066] Thus, in an embodiment, there is provided herein a double-stranded RNAi agent capable of inhibiting expression of IFN-pi in a cell, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand that are, at least in part or completely, complementary; and wherein the double-stranded RNAi agent targets residues in region 5-90 of the Homo sapiens interferon beta 1 mRNA (SEQ ID NO: 263).

[0067] In an embodiment, there is provided herein a double-stranded RNAi agent capable of inhibiting expression of IFN-pi in a cell, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand that are, at least in part or completely, complementary; and wherein the antisense strand can hybridise to a region of SEQ ID NO: 255.

[0068] In an embodiment, there is provided herein a double-stranded RNAi agent capable of modulating or inhibiting expression of IFN-pi in a cell, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand that are, at least in part or completely, complementary; and wherein the antisense strand is or comprises any one of SEQ ID NOs: 2 to 36 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. The antisense strand may be or may comprise any one of SEQ ID NOs: 2 to 36 apart from 3, 2, 1, or no substitutions. The antisense strand may be or may comprise any one of SEQ ID NOs: 2 to 36 (optionally including an additional overhang). The lengths, overhangs, and modifications discussed herein are appliable to these sequences. In an embodiment, there is provided herein a double-stranded RNAi agent capable of inhibiting expression of IFN-pi in a cell, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand that are, at least in part or completely, complementary; and wherein the antisense strand is or comprises any one of SEQ ID NOs: 5, 6, 7, 19, 20, 21, 22, 23, 24, 25, 26, 27, 29, 30, 32, 34, and 36 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions and the sense stand is or comprises any one of SEQ ID NOs: 132, 133, 134, 146, 147, 148, 149, 150, 151, 152, 153, 154, 156, 157, 159, 161, and 163 apart from 5, 4, 3, 2, l, or no substitutions, deletions, or insertions.

[0069] The inventors provide experimental data verifying antisense strands according to SEQ ID NOs: 5, 6, 7, 20, 23, 24,

[0070] 25, 26, 27, 29, 32, 34, and 36. All of which are targeted to region 5-90 of IFN-pi . Thus, in an embodiment, there is provided herein a double-stranded RNAi agent capable of inhibiting expression of IFN-pi in a cell, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand that are, at least in part or completely, complementary; and wherein the antisense strand is or comprises any one of SEQ ID NOs: 5, 6, 7, 20,

[0071] 23, 24, 25, 26, 27, 29, 32, 34, and 36 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. The antisense strand may be or may comprise any one of SEQ ID NOs: 5, 6, 7, 20, 23, 24, 25, 26, 27, 29, 32, 34, and 36 apart from 3, 2, 1, or no substitutions. The antisense strand may be or may comprise any one of SEQ ID NOs: 5, 6, 7, 20, 23, 24, 25, 26, 27, 29, 32, 34, and 36 (optionally including an additional overhang). In any of these embodiments the sense and the antisense strand may partly or completely complementary, and may be completely complementary apart from any overhang sequences.

[0072] The antisense strand may be 15 to 30, 19 to 25, 21 to 24, 21, 22, or 23 nucleobases in length and comprise any one of SEQ ID NOs: 5, 6, 7, 20, 23, 24, 25, 26, 27, 29, 32, 34, and 36 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. The antisense strand may comprise any one of SEQ ID NOs: 5, 6, 7, 20, 23, 24, 25, 26, 27, 29, 32, 34, and 36 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions and a 3’ overhang. The 3 ’ overhang may be one or two nucleobases. The antisense strand may be 23 nucleobases in length; comprise any one of SEQ ID NOs: 5, 6, 7, 20, 23, 24, 25, 26, 27, 29, 32, 34, and 36 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; and comprise a two nucleobase 3 ’ overhang. In a particular embodiment, the antisense strand may be 23 nucleobases in length; comprise any one of SEQ ID NOs: 5, 6, 7, 20, 23, 24, 25, 26, 27, 29, 32, 34, and 36; and comprise a two nucleobase 3’ overhang. The sense strand may comprise a nucleobase sequence according to any one of SEQ ID NOs: 132, 133, 134, 147, 150, 151, 152, 153, 154, 156, 159, 161, and 163 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. The sense strand may be 15 to 30, 19 to 25, 21 to

[0073] 24, 21, 22, or 23 nucleobases in length and comprise any one of SEQ ID NOs: 132, 133, 134, 147, 150, 151, 152, 153, 154, 156, 159, 161, and 163 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. In a particular embodiment, the sense strand may be 21 nucleobases in length and be of the sequence of any one of SEQ ID NOs: 132, 133, 134, 147, 150, 151, 152, 153, 154, 156, 159, 161, and 163.

[0074] The RNAi agent of the invention may comprise an antisense sequence and the paired sense sequence presented in Table la or Table lb. Thus, the antisense strand may comprise any one of SEQ ID NOs: 5, 6, 7, 20, 23, 24, 25,

[0075] 26, 27, 29, 32, 34, and 36 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions and the sense stand may comprise any one of SEQ ID NOs: 132, 133, 134, 147, 150, 151, 152, 153, 154, 156, 159, 161, and 163 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; wherein the SEQ ID NOs of the antisense and sense strand are paired as in Table la or Table lb. The antisense strand may comprise any one of SEQ ID NOs: 5, 6, 7, 20, 23, 24, 25, 26, 27, 29, 32, 34, and 36 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions and comprise a 3’ overhang and the sense strand may comprise any one of SEQ ID NOs: 132, 133, 134, 147, 150, 151, 152, 153, 154, 156, 159, 161, and 163 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; wherein the SEQ ID NOs of the antisense and sense strand are paired as in Table la or Table lb. The antisense strand may be 23 nucleobases in length; comprise any one of SEQ ID NOs: 5, 6, 7, 20, 23, 24, 25, 26, 27, 29, 32, 34, and 36 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; and comprise a two nucleobase 3’ overhang and the sense strand may comprise any one of SEQ ID NOs: 132, 133, 134, 147, 150, 151, 152, 153, 154, 156, 159, 161, and 163 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; wherein the SEQ ID NOs of the antisense and sense strand are paired as in Table la or Table lb. The antisense strand may be 23 nucleobases in length; comprise any one of SEQ ID NOs: 5, 6, 7, 20, 23, 24, 25, 26, 27, 29, 32, 34, and 36; and comprise a two nucleobase 3’ overhang and the sense strand may comprise any one of SEQ ID NOs: 132, 133, 134, 147, 150, 151, 152, 153, 154, 156, 159, 161, and 163 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; wherein the SEQ ID NOs of the antisense and sense strand are paired as in Table la or Table lb. The antisense strand may comprise any one of SEQ ID NOs: 5, 6, 7, 20, 23, 24, 25, 26, 27, 29, 32, 34, and 36 and the sense stand may comprise any one of SEQ ID NOs: 132, 133, 134, 147, 150, 151, 152, 153, 154, 156, 159, 161, and 163; wherein the SEQ ID NOs of the antisense and sense strand are paired as in Table la or Table lb. The antisense strand may be 23 nucleobases in length; comprise any one of SEQ ID NOs: 5, 6, 7, 20, 23, 24, 25, 26, 27, 29, 32, 34, and 36; and comprise a two nucleobase 3’ overhang and the sense strand may comprise any one of SEQ ID NOs: 132, 133, 134, 147, 150, 151, 152, 153, 154, 156, 159, 161, and 163; wherein the SEQ ID NOs of the antisense and sense strand are paired as in Table la or Table lb. The antisense strand may be 23 nucleobases in length; comprise any one of SEQ ID NOs: 5, 6, 7, 20, 23, 24, 25, 26, 27, 29, 32, 34, and 36; and comprise a two nucleobase 3’ overhang and the sense strand may be 21 nucleobases in length and be of any one of SEQ ID NOs: 132, 133, 134, 147, 150, 151, 152, 153, 154, 156, 159, 161, and 163 ; wherein the SEQ ID NOs of the antisense and sense strand are paired as in Table la or Table lb. The antisense strand and the sense strand may comprise any of the modifications or alterations as discussed herein. For instance, modifications to the sugar moieties, nucleobases, and / or linkages between monomers. In any of these embodiments the sense and the antisense strand may partly or completely complementary, and may be completely complementary apart from any overhang sequences. The antisense strand and / or the sense strand may comprise the patterns of modifications in Table lb as applied to the relevant sequence.

[0076] In an example, the SEQ ID NOs referred to in the preceding paragraph may be selected from Table 3a.

[0077] Table 3a - Particular and experimentally verified siRNAs

[0078] Positive results were also seen for NATA_D4024 (see Fig. 2A). This RNAi agent targets region 500-590. Thus, in an embodiment, there is provided herein a double-stranded RNAi agent capable of modulating expression of IFN-pi in a cell, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand that are, at least in part or completely, complementary; and wherein the double-stranded RNAi agent targets residues in region 500-590 of the Homo sapiens interferon beta 1 mRNA (SEQ ID NO: 263). In an embodiment, there is provided herein a double-stranded RNAi agent capable of modulating expression of IFN-pi in a cell, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand that are, at least in part or completely, complementary; and wherein the antisense strand is or comprises SEQ ID NO: 100 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. The antisense strand may be 15 to 30, 19 to 25, 21 to 24, 21, 22, or 23 nucleobases in length and comprise SEQ ID NO: 100 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. The antisense strand may be 15 to 30, 19 to 25, 21 to 24, 21, 22, or 23 nucleobases in length and comprise SEQ ID NO: 100 apart from 3, 2, 1, or no substitutions. The antisense strand may comprise SEQ ID NO: 100 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions and a 3’ overhang. The 3’ overhang may be one or two nucleobases. The antisense strand may be 23 nucleobases in length; comprise SEQ ID NO: 100 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; and comprise a two nucleobase 3’ overhang. In a particular embodiment, the antisense strand may be 23 nucleobases in length; comprise SEQ ID NO: 100; and comprise a two nucleobase 3’ overhang. The sense strand may comprise a nucleobase sequence according to SEQ ID NO: 227 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. The sense strand may be 15 to 30, 19 to 25, 21 to 24, 21, 22, or 23 nucleobases in length and comprise SEQ ID NO: 227 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. In a particular embodiment, the sense strand may be 21 nucleobases in length and be SEQ ID NO: 227.

[0079] Positive results were also seen for NATA_D4078 (see Fig. 3). This RNAi agent targets region 195-245. Thus, in an embodiment, there is provided herein a double-stranded RNAi agent capable of inhibiting expression of IFN- pi in a cell, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand that are, at least in part or completely, complementary; and wherein the double-stranded RNAi agent targets residues in region 195-245 of the Homo sapiens interferon beta 1 mRNA (SEQ ID NO: 257). In an embodiment, there is provided herein a double-stranded RNAi agent capable of modulating expression of IFN-pi in a cell, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand that are, at least in part or completely, complementary; and wherein the antisense strand is or comprises SEQ ID NO: 60 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. The antisense strand may be 15 to 30, 19 to 25, 21 to 24, 21, 22, or 23 nucleobases in length and comprise SEQ ID NO: 60 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. The antisense strand may be 15 to 30, 19 to 25, 21 to 24, 21, 22, or 23 nucleobases in length and comprise SEQ ID NO: 60 apart from 3, 2, 1, or no substitutions. The antisense strand may comprise SEQ ID NO: 60 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions and a 3’ overhang. The 3’ overhang may be one or two nucleobases. The antisense strand may be 23 nucleobases in length; comprise SEQ ID NO: 60 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; and comprise a two nucleobase 3’ overhang. In a particular embodiment, the antisense strand may be 23 nucleobases in length; comprise SEQ ID NO: 60; and comprise a two nucleobase 3’ overhang. The sense strand may comprise a nucleobase sequence according to SEQ ID NO: 187 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. The sense strand may be 15 to 30, 19 to 25, 21 to 24, 21, 22, or 23 nucleobases in length and comprise SEQ ID NO: 187 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. In a particular embodiment, the sense strand may be 21 nucleobases in length and be SEQ ID NO: 187. The antisense strand and the sense strand may comprise any of the modifications or alterations as discussed herein. For instance, modifications to the sugar moieties, nucleobases, and / or linkages between monomers. In any of these embodiments the sense and the antisense strand may partly or completely complementary, and may be completely complementary apart from any overhang sequences. The antisense strand and / or the sense strand may comprise the patterns of modifications in Table lb as applied to the relevant sequence.

[0080] Positive results were also seen for RNAi agents targeting 395-734. Thus, in an embodiment, there is provided herein a double-stranded RNAi agent capable of inhibiting expression of IFN-pi in a cell, wherein the doublestranded RNAi agent comprises a sense strand and an antisense strand that are, at least in part or completely, complementary; and wherein the double-stranded RNAi agent targets residues in region 395-734 of the Homo sapiens interferon beta 1 mRNA. In an embodiment, there is provided herein a double-stranded RNAi agent capable of inhibiting expression of IFN-pi in a cell, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand that are, at least in part or completely, complementary; and wherein the antisense strand is or comprises any one of SEQ ID NOs: 86, 89, 92, 93, 97, 99, 102, 103, 104, 105, 113, 114, 117, 118, 119, 123, 124, 125, and 127 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. The antisense strand may be 15 to 30, 19 to 25, 21 to 24, 21, 22, or 23 nucleobases in length and comprise any one of SEQ ID NOs: 86, 89, 92, 93, 97, 99, 102, 103, 104, 105, 113, 114, 117, 118, 119, 123, 124, 125, and 127 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. The antisense strand may be 15 to 30, 19 to 25, 21 to 24, 21, 22, or 23 nucleobases in length and comprise any one of SEQ ID NOs: 86, 89, 92, 93, 97, 99, 102, 103, 104, 105, 113, 114, 117, 118, 119, 123, 124, 125, and 127 apart from 3, 2, 1, or no substitutions. The antisense strand may comprise any one of SEQ ID NOs: 86, 89, 92, 93, 97, 99, 102, 103, 104, 105, 113, 114, 117, 118, 119, 123, 124, 125, and 127 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions and a 3’ overhang. The 3’ overhang may be one or two nucleobases. The antisense strand may be 23 nucleobases in length; comprise any one of SEQ ID NOs: 86, 89, 92, 93, 97, 99, 102, 103, 104, 105, 113, 114, 117, 118, 119, 123, 124, 125, and 127 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; and comprise a two nucleobase 3’ overhang. In a particular embodiment, the antisense strand may be 23 nucleobases in length; comprise any one of SEQ ID NOs: 86, 89, 92, 93, 97, 99, 102, 103, 104, 105, 113, 114, 117, 118, 119, 123, 124, 125, and 127; and comprise a two nucleobase 3 ’ overhang. The sense strand may comprise a nucleobase sequence according to the paired strand in Table lb apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. The sense strand may be 15 to 30, 19 to 25, 21 to 24, 21, 22, or 23 nucleobases in length and comprise the paired strand in Table lb apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. In a particular embodiment, the sense strand may be 21 nucleobases in length and be the paired strand in Table lb. The antisense strand and the sense strand may comprise any of the modifications or alterations as discussed herein. For instance, modifications to the sugar moieties, nucleobases, and / or linkages between monomers. In any of these embodiments the sense and the antisense strand may partly or completely complementary, and may be completely complementary apart from any overhang sequences. The antisense strand and / or the sense strand may comprise the patterns of modifications in Table lb as applied to the relevant sequence.

[0081] In particular embodiments, there is provided herein a double-stranded RNAi agent capable of inhibiting expression of IFN-pi in a cell, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand that are, at least in part or completely, complementary; and wherein the antisense strand is or comprises any one of SEQ ID NOs: 105, 118, 119, 123, 124, 125, and 127 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. The antisense strand may be 15 to 30, 19 to 25, 21 to 24, 21, 22, or 23 nucleobases in length and comprise any one of SEQ ID NOs: 105, 118, 119, 123, 124, 125, and 127 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. The antisense strand may be 15 to 30, 19 to 25, 21 to 24, 21, 22, or 23 nucleobases in length and comprise any one of SEQ ID NOs: 105, 118, 119, 123, 124, 125, and 127 apart from 3, 2, 1, or no substitutions. The antisense strand may comprise any one of SEQ ID NOs: 105, 118, 119, 123, 124, 125, and 127 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions and a 3’ overhang. The 3’ overhang may be one or two nucleobases. The antisense strand may be 23 nucleobases in length; comprise any one of SEQ ID NOs: 105, 118, 119, 123, 124, 125, and 127 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; and comprise a two nucleobase 3 ’ overhang. In a particular embodiment, the antisense strand may be 23 nucleobases in length; comprise any one of SEQ ID NOs: 105, 118, 119, 123, 124, 125, and 127; and comprise a two nucleobase 3’ overhang. The sense strand may comprise a nucleobase sequence according to the paired strand in Table lb apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. The sense strand may be 15 to 30, 19 to 25, 21 to 24, 21, 22, or 23 nucleobases in length and comprise the paired strand in Table lb apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. In a particular embodiment, the sense strand may be 21 nucleobases in length and be the paired strand in Table lb. The antisense strand and the sense strand may comprise any of the modifications or alterations as discussed herein. For instance, modifications to the sugar moieties, nucleobases, and / or linkages between monomers. In any of these embodiments the sense and the antisense strand may partly or completely complementary, and may be completely complementary apart from any overhang sequences. The antisense strand and / or the sense strand may comprise the patterns of modifications in Table lb as applied to the relevant sequence.

[0082] In an embodiment, there is provided herein a double-stranded RNAi agent capable of upregulating expression of IFN-pi in a cell, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand that are, at least in part or completely, complementary; and wherein the antisense strand is or comprises any one of SEQ ID NOs: 3, 28, 31, 39, 41, 59, 68, 100, 108, 110, 111, and 112 apart from 5, 4, 3, 2, 1 , or no substitutions, deletions, or insertions. The agent may comprise a sense stand that is or comprises any one of SEQ ID NOs: 130, 155, 158, 166, 168, 186, 195, 227, 235, 237, 238, and 239 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. Any of the potential sequence variations, modifications, overhangs, or other variant disclosed herein may be included in said agent.

[0083] The antisense strand and / or the sense strand may comprise one or more of a deoxyribonucleotide and / or a ribonucleotide. The antisense strand and / or the sense strand may comprise ribonucleotides apart from modifications recited herein, and so may be an RNA molecule or a modified RNA molecule.

[0084] The antisense strand and / or the sense strand of the RNAi agent may comprise a nucleoside or nucleosides that have been modified, for instance the modifications may be to the sugar moiety. In some examples, the 2 ’-position of the sugar moiety may be modified. A modification may be to any moiety that is not “-H” for DNA or not OH” for RNA. Examples of such 2’ modifications are -O-CH3, -O-CH2-CH2-O-CH3, or -F. In other examples, the 4’ position of the sugar moiety made be modified, for instance to result in a bridge between the 2’ position and the 4’ position. The antisense strand and / or the sense strand may comprise one, two, three, four, or more types of nucleoside. The antisense strand and / or the sense strand may comprise a combination of modified nucleosides and unmodified nucleosides. The antisense strand and / or the sense strand may comprise only modified nucleosides. The nucleotides of the antisense strand and / or the sense strand may all be modified in the same manner or may be modified in two or more different manners. These modifications may be applied to any of the antisense strands disclosed herein.

[0085] Monomers modified with a 2’ -O-CH3 may be referred to as 2'-O-methyl (2’OMe) nucleotides. Monomers modified with a 2’ -F may be referred to as 2'-Fluoro nucleotides. Monomers modified with a 2’ -O-CH2-CH2-O- CH3 may be referred to as 2'-O-methoxy ethyl (MOE) nucleotides. Monomers modified to comprise bridge connecting the 2’ oxygen and the 4’ cardon may be locked nucleic acid (LNA) nucleotides. The antisense strand and / or the sense strand may comprise one or more 2’OMe nucleotides, one or more 2'-Fluoro nucleotides, one or more 2'-MOE nucleotides, and / or one or more LNA nucleotides. These modifications may be applied to any of the antisense strands disclosed herein.

[0086] In a particular embodiment, the antisense strand includes 2’ -O-CH3 modifications. In an example, the antisense strand may have 2’ -O-CH3 modifications at residues 1, 3, 4, 5, 7, 10, 11, 12, 13, 15, 17, 18, 19, 20, and / or 21. These modifications may be applied to any of the antisense strands disclosed herein, and so antisense strands comprising any of SEQ ID NOs: 1-127 and 264 may have 2’ -O-CH3 modifications at residues 1, 3, 4, 5, 7, 10, 11,

[0087] 12, 13, 15, 17, 18, 19, 20, and / or 21 of SEQ ID NOs: 1-127 and 264. In particular embodiments, the antisense strand is 23 nucleobases in length; comprises any one of SEQ ID NOs: 1-127 and 264 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; comprises 2’ -O-CH3 modifications at residues 1, 3, 4, 5, 7, 10, 11, 12,

[0088] 13, 15, 17, 18, 19, 20, and 21 of the SEQ ID NO: 1-127 and 264; and comprises a two nucleobase 3’ overhang, which is optionally two deoxythymidines.

[0089] In another example, the antisense strand may have 2’ -O-CH3 modifications at residues 1, 3, 4, 5, 7, 10, 11, 12, 13, 15, 17, 18, 19, and / or 21. These modifications may be applied to any of the antisense strands disclosed herein, and so antisense strands comprising any of SEQ ID NOs: 1-127 and 264 may have 2’ -O-CH3 modifications at residues 1, 3, 4, 5, 7, 10, 11, 12, 13, 15, 17, 18, 19, and / or 21 of SEQ ID NOs: 1-127 and 264. In particular embodiments, the antisense strand is 21 nucleobases in length; comprises any one of SEQ ID NOs: 1-127 and 264 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions and comprises 2’ -O-CH3 modifications at residues 1, 3, 4, 5, 7, 10, 11, 12, 13, 15, 17, 18, 19, and 21 of the SEQ ID NO: 1-127 and 264.

[0090] The sense strand may comprise 2’ -O-CH3 modifications. In an example, the sense strand may have 2’ -O-CH3 modifications at residues 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, and / or 21. These modifications may be applied to any of the sense strands disclosed herein, and so sense strands comprising any of SEQ ID NOs: 128- 254 and 265 may have 2’ -O-CH3 modifications at residues 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, and / or 21 of SEQ ID NOs: 128-254 and 265. In particular embodiments, the sense strand is 21 nucleobases in length; comprises any one of SEQ ID NOs: 128-254 and 265 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; and comprises 2’ -O-CH3 modifications at residues 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 of the SEQ ID NO: 128-254 and 265.

[0091] In another example, the sense strand may have 2’ -O-CH3 modifications at residues 1, 2, 3, 4, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and / or 19. These modifications may be applied to any of the sense strands disclosed herein, and so sense strands comprising any of SEQ ID NOs: 128-254 and 265 may have 2’ -O-CH3 modifications at residues 1, 2, 3, 4, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and / or 19 of SEQ ID NOs: 128-254 and 265. In particular, these modifications may be applied to a sense strand that is 19 nucleobases in length. For instance, a 19-nucleobase sequence that is a truncation of any of SEQ ID NOs: 128-254 and 265. In particular embodiments, the sense strand is 19 nucleobases in length; comprises a truncation of any one of SEQ ID NOs: 128-254 and 265 and comprises 2’ -O-CH3 modifications at residues 1, 2, 3, 4, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 of the SEQ ID NO: 128-254 and 265.

[0092] In another example, the sense strand may have 2’ -O-CH3 modifications at residues 1, 2, 3, 4, 5, 9, 11, 12, 13, 14, 15, and / or 16. These modifications may be applied to any of the sense strands disclosed herein, and so sense strands comprising any of SEQ ID NOs: 128-254 and 265 may have 2’ -O-CH3 modifications at residues 1, 2, 3, 4, 5, 9, 11, 12, 13, 14, 15, and / or 16 of SEQ ID NOs: 128-254 and 265. In particular, these modifications may be applied to a sense strand that is 16 nucleobases in length. For instance, a 16-nucleobase sequence that is a truncation of any of SEQ ID NOs: 128-254 and 265. In particular embodiments, the sense strand is 16 nucleobases in length; comprises a truncation of any one of SEQ ID NOs: 128-254 and 265 and comprises 2’ -O- CH3modifications at residues 1, 2, 3, 4, 5, 9, 11, 12, 13, 14, 15, and 16 of the SEQ ID NO: 128-254 and 265.

[0093] In a particular embodiment, the antisense strand includes 2’ -F modifications. In an example, the antisense strand may have 2’ -F modifications at residues 2, 6, 8, 9, 14, and / or 16. These modifications may be applied to any of the antisense strands disclosed herein, and so antisense strands comprising any of SEQ ID NOs: 1-127 and 264 may have 2’ -F modifications at residues 2, 6, 8, 9, 14, and / or 16 of SEQ ID NOs: 1-127 and 264. In particular embodiments, the antisense strand is 23 nucleobases in length; comprises any one of SEQ ID NOs: 1-127 and 264 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; comprises 2’ -F modifications at residues 2, 6, 8, 9, 14, and 16 of SEQ ID NOs: 1-127 and 264; and comprises a two nucleobase 3’ overhang, which is optionally two deoxythymidines.

[0094] In another example, the antisense strand may have 2’ -F modifications at residues 2, 6, 8, 9, 14, 16, and / or 20. These modifications may be applied to any of the antisense strands disclosed herein, and so antisense strands comprising any of SEQ ID NOs: 1-127 and 264 may have 2’ -F modifications at residues 2, 6, 8, 9, 14, 16, and / or 20 of SEQ ID NOs: 1-127 and 264. In particular embodiments, the antisense strand is 21 nucleobases in length; comprises any one of SEQ ID NOs: 1-127 and 264 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions and comprises 2’ -F modifications at residues 2, 6, 8, 9, 14, 16, and 20 of SEQ ID NOs: 1-127 and 264.

[0095] The sense strand may comprise 2’ -F modifications. In an example, the sense strand may have 2’ -F modifications at residues 7, 9, 10, and / or 11. These modifications may be applied to any of the sense strands disclosed herein, and so sense strands comprising any of SEQ ID NOs: 128-254 and 265 may have 2’ -F modifications at residues 7, 9, 10, and / or 11 of SEQ ID NOs: 128-254 and 265. In particular embodiments, the sense strand is 21 nucleobases in length; comprises any one of SEQ ID NOs: 128-254 and 265 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; and comprises 2’ -F modifications at residues 7, 9, 10, and 11 of the SEQ ID NO: 128-254 and 265.

[0096] In another example, the sense strand may have 2’ -F modifications at residues 5, 7, 8, and / or 9. These modifications may be applied to any of the sense strands disclosed herein, and so sense strands comprising any of SEQ ID NOs: 128-254 and 265 may have 2’ -F modifications at residues 5, 7, 8, and / or 9 of SEQ ID NOs: 128- 254 and 265. In particular, these modifications may be applied to a sense strand that is 19 nucleobases in length. For instance, a 19-nucleobase sequence that is a truncation of any of SEQ ID NOs: 128-254 and 265. In particular embodiments, the sense strand is 19 nucleobases in length; comprises a truncation of any one of SEQ ID NOs: 128-254 and 265 and comprises 2’ -F modifications at residues 5, 7, 8, and 9 of the SEQ ID NO: 128-254 and 265.

[0097] In another example, the sense strand may have 2’ -F modifications at residues 6, 7, 8, and / or 10. These modifications may be applied to any of the sense strands disclosed herein, and so sense strands comprising any of SEQ ID NOs: 128-254 and 265 may have 2’ -F modifications at residues 6, 7, 8, and / or 10 of SEQ ID NOs: 128- 254 and 265. In particular, these modifications may be applied to a sense strand that is 16 nucleobases in length. For instance, a 16-nucleobase sequence that is a truncation of any of SEQ ID NOs: 128-254 and 265. In particular embodiments, the sense strand is 16 nucleobases in length; comprises a truncation of any one of SEQ ID NOs: 128-254 and 265 and comprises 2’ -F modifications at residues 6, 7, 8, and 10 of the SEQ ID NO: 128-254 and 265.

[0098] The above discussed modifications may be combined. Thus, the antisense strand and / or the sense strand may comprise one or more 2’ -O-CH3 modifications and / or one or more 2’ -F modifications. For instance, the RNAi agent may comprise any of SEQ ID NOs: 1 -127 and 264 with 2’ -O-CH3 modifications at residues 1, 3, 4, 5, 7, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 and 2’ -F modifications at residues 2, 6, 8, 9, 14, and 16 of SEQ ID NOs: 1- 127 and 264. The RNAi agent may comprise any of SEQ ID NOs: 128-254 and 265 with 2’ -O-CH3 modifications at residues 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 and 2’ -F modifications at residues 7, 9, 10, and 11 of the SEQ ID NO: 128-254 and 265. The sequence variants, lengths, and other modifications, such as overhangs, may also be applied.

[0099] In other examples, the RNAi agent may comprise any of SEQ ID NOs: 1-127 and 264 with 2’ -O-CH3 modifications at residues 1, 3, 4, 5, 7, 10, 11, 12, 13, 15, 17, 18, 19, and 21 and 2’ -F modifications at residues 2, 6, 8, 9, 14, 16, and 20 of SEQ ID NOs: 1-127 and 264. The RNAi agent may comprise a 19-nucleobase truncation of any of SEQ ID NOs: 128-254 and 265 with 2’ -O-CH3 modifications at residues 1, 2, 3, 4, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 and 2’ -F modifications at residues 5, 7, 8, and 9 of the SEQ ID NO: 128-254 and 265. The RNAi agent may comprise a 16-nucleobase truncation of any of SEQ ID NOs: 128-254 and 265 with 2’ -O-CH3 modifications at residues 1 , 2, 3, 4, 5, 9, 11, 12, 13, 14, 15, and 16 and 2’ -F modifications at residues 6, 7, 8, and 10 of the SEQ ID NO: 128-254 and 265. The sequence variants, lengths, and other modifications, such as overhangs, may also be applied.

[0100] The RNAi agent may comprise an antisense strand comprising any of SEQ ID NOs: 1-127 and 264 with 2’ -O- CH3 modifications at residues 1, 3, 4, 5, 7, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 and 2’ -F modifications at residues 2, 6, 8, 9, 14, and 16 of SEQ ID NOs: 1-127 and 264 and a sense strand comprising any of SEQ ID NOs: 128-254 and 265 with 2’ -O-CH3 modifications at residues 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 and 2’ -F modifications at residues 7, 9, 10, and 11 of the SEQ ID NO: 128-254 and 265.

[0101] The antisense strand and / or the sense strand may comprise a modification to one or more, or all, intemucleoside linkages. For instance, the antisense strand and / or the sense strand may comprise one or more, or all, phosphoro thio ate (PS) linkages. In some embodiments, the last two linkages of the 5’ end and / or the 3’ end of the antisense strand and / or the sense strand are PS linkages. In some embodiments, the last seven linkages at the 3’ end of the antisense strand are PS linkages. These linkage modifications may be applied to any of the antisense strands or sense strands disclosed herein, and so antisense strands comprising any of SEQ ID NOs: 1 -127 and 264 and sense strands comprising any of SEQ ID NOs: 128-254 and 265 may comprise one or more PS linkages. For instance, antisense strands comprising any of SEQ ID NOs: 1-127 and 264 and sense strands comprising any of SEQ ID NOs: 128-254 and 265 may have PS linkages as the last two linkages of the 5’ end and the 3’ end. In another example, antisense strands comprising any of SEQ ID NOs: 1-127 and 264 and sense strands comprising any of SEQ ID NOs: 128-254 and 265 have PS linkages as the last two linkages of the 5’ end and the last seven linkages of the 3 ’ end.

[0102] The RNAi agent may comprise an antisense strand comprising or according to any of SEQ ID NOs: 1-127 and 264 with 2’ -O-CH3 modifications at residues 1, 3, 4, 5, 7, 10, 11, 12, 13, 15, 17, 18, 19, and 21 and 2’ -F modifications at residues 2, 6, 8, 9, 14, 16, and 20 of SEQ ID NOs: 1-127 and 264; and a sense strand that is a 19- nucleobase truncation of any of SEQ ID NOs: 128-254 and 265 with 2’ -O-CH3 modifications at residues 1, 2, 3, 4, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 and 2’ -F modifications at residues 5, 7, 8, and 9 of the SEQ ID NO: 128-254 and 265; wherein the last two linkages of the 5’ end and the 3’ end of the antisense strand and the sense strand are PS linkages.

[0103] The RNAi agent may comprise an antisense strand comprising or according to any of SEQ ID NOs: 1-127 and 264 with 2’ -O-CH3 modifications at residues 1, 3, 4, 5, 7, 10, 11, 12, 13, 15, 17, 18, 19, and 21 and 2’ -F modifications at residues 2, 6, 8, 9, 14, 16, and 20 of SEQ ID NOs: 1-127 and 264; and a sense strand that is a 16- nucleobase truncation of any of SEQ ID NOs: 128-254 and 265 with 2’ -O-CH3 modifications at residues 1, 2, 3,

[0104] 4, 5, 9, 11, 12, 13, 14, 15, and 16 and 2’ -F modifications at residues 6, 7, 8, and 10 of the SEQ ID NO: 128-254 and 265; wherein the last two linkages of the 5’ end and the last seven linkages of the 3’ end of the antisense strand are PS linkages and the last two linkages of the 5’ end and the 3’ end of the sense strand are PS linkages. The antisense strand and / or the sense strand may include one or more naturally occurring nucleobase and / or one or more modified nucleobase. A modified nucleobase is a nucleobase that is capable of base pairing with a nucleobase of a nucleic acid, but is structurally different from a naturally occurring nucleobase. An example of a modified nucleobase is 5-methylcytosine. Table 3b - Alternative chemical modifications

[0105] In a particular embodiment, there is disclosed an RNAi agent capable of modulating or inhibiting expression of IFN-pi in a cell, the RNAi agent comprising: an antisense strand and a sense strand respectively comprising any of SEQ ID NOs: 1-127 and 264 and any of SEQ ID NOs: 128-254 and 265; apart from

[0106] 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; or

[0107] 3, 2, 1, or no substitutions; or no substitutions, deletions, or insertions; and wherein the antisense strand comprises one or more nucleotides with 2’ -O-CH3 modifications and / or one or more nucleotides with 2’ -F modifications; wherein the antisense strand comprises one or more PS linkages; and optionally wherein the antisense strand comprises an overhang; and wherein the sense stand comprises one or more nucleotides with 2’ -O-CH3 modifications and / or one or more nucleotides with 2’ -F modifications; wherein the sense strand comprises one or more PS linkages; wherein the antisense strand and the sense strand are partially or completely complementary.

[0108] In a particular embodiment, there is disclosed an RNAi agent capable of modulating or inhibiting expression of IFN-pi in a cell, the RNAi agent comprising: an antisense strand that: is 23 nucleobases long; comprises any one of SEQ ID NOs: 1-127 and 264 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; comprises a 3 ’ overhang that is two deoxythymidines; has 2’ -O-CH3 modifications at residues 1, 3, 4, 5, 7, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 ; has 2’ -F modifications at residues 2, 6, 8, 9, 14, and 16; and has PS linkages as the last two linkages of the 5’ end and the 3’ end; and a sense stand that is at least in part or completely, complementary to the antisense strand. The sense stand may be:

[0109] 21 nucleobases long; comprise any one of SEQ ID NOs: 128-254 and 265 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; have 2’ -O-CH3 modifications at residues 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 ; have 2’ -F modifications at residues 7, 9, 10, and 11 ; and have PS linkages as the last two linkages of the 5’ end and the 3’ end.

[0110] In a particular embodiment, there is disclosed an RNAi agent capable of modulating or inhibiting expression of IFN-pi in a cell, the RNAi agent comprising: an antisense strand that: is 21 nucleobases long; comprises any one of SEQ ID NOs: 1-127 and 264 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; has 2’ -O-CH3 modifications at residues 1, 3, 4, 5, 7, 10, 11, 12, 13, 15, 17, 18, 19, and 21 ; has 2’ -F modifications at residues 2, 6, 8, 9, 14, 16, and 20; and has PS linkages as the last two linkages of the 5’ end and the 3’ end; and a sense stand that is at least in part or completely, complementary to the antisense strand. The sense stand may be:

[0111] 19 nucleobases long; comprise a truncation of any one of SEQ ID NOs: 128-254 and 265 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; have 2’ -O-CH3 modifications at residues 1, 2, 3, 4, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19; have 2’ -F modifications at residues 5, 7, 8, and 9; and have PS linkages as the last two linkages of the 5’ end and the 3’ end.

[0112] In a particular embodiment, there is disclosed an RNAi agent capable of modulating or inhibiting expression of IFN-pi in a cell, the RNAi agent comprising: an antisense strand that: is 21 nucleobases long; comprises any one of SEQ ID NOs: 1-127 and 264 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; has 2’ -O-CH3 modifications at residues 1, 3, 4, 5, 7, 10, 11, 12, 13, 15, 17, 18, 19, and 21 ; has 2’ -F modifications at residues 2, 6, 8, 9, 14, 16, and 20; and has PS linkages as the last two linkages of the 5’ end and the last seven linkages of the 3’ end; and a sense stand that is at least in part or completely, complementary to the antisense strand. The sense stand may be:

[0113] 16 nucleobases long; comprise a truncation of any one of SEQ ID NOs: 128-254 and 265 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; have 2’ -O-CH3 modifications at residues 1, 2, 3, 4, 5, 9, 11, 12, 13, 14, 15, and 16; have 2’ -F modifications at residues 6, 7, 8, and 10; and have PS linkages as the last two linkages of the 5’ end and the 3’ end.

[0114] In a particular embodiment, there is disclosed an RNAi agent capable of modulating or inhibiting expression of

[0115] IFN-pi in a cell, the RNAi agent comprising: an antisense strand that: is 23 nucleobases long; comprises any one of SEQ ID NOs: 1-127 apart from 3, 2, 1, or no substitutions; comprises a 3 ’ overhang that is two deoxythymidines; has 2’ -O-CH3 modifications at residues 1, 3, 4, 5, 7, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 ; has 2’ -F modifications at residues 2, 6, 8, 9, 14, and 16; and has PS linkages as the last two linkages of the 5’ end and the 3’ end; and a sense stand that is at least in part or completely, complementary to the antisense strand. The sense stand may be:

[0116] 21 nucleobases long; comprise any one of SEQ ID NOs: 128-254 apart from 3, 2, 1, or no substitutions; have 2’ -O-CH3 modifications at residues 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 ; have 2’ -F modifications at residues 7, 9, 10, and 11 ; and have PS linkages as the last two linkages of the 5’ end and the 3’ end.

[0117] In a particular embodiment, there is disclosed an RNAi agent capable of inhibiting expression of IFN-pi in a cell, the RNAi agent comprising: an antisense strand and a sense strand respectively comprising: SEQ ID NOs: 5 & 132, 6 & 133, 7 & 134,

[0118] 20 & 147, 23 & 150, 24 & 151, 25 & 152, 26 & 153, 27 & 154, 29 & 156, or 32 & 159; apart from

[0119] 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; or

[0120] 3, 2, 1, or no substitutions; or no substitutions, deletions, or insertions; and wherein the antisense strand comprises 2’ -O-CH3 modifications and / or 2’ -F modifications; wherein the antisense strand comprises PS linkages; and optionally wherein the antisense strand comprises an overhang; and wherein the sense stand comprises 2’ -O-CH3 modifications; wherein the sense stand comprises 2’ -F modifications; wherein the sense strand comprises PS linkages.

[0121] In a particular embodiment, there is disclosed an RNAi agent capable of inhibiting expression of IFN-pi in a cell, the RNAi agent comprising: an antisense strand and a sense strand associated with statistical significance in any one of Figures 1, 2A, 2B, and 3; apart from

[0122] 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; or

[0123] 3, 2, 1, or no substitutions; or no substitutions, deletions, or insertions; and wherein the antisense strand comprises 2’ -O-CH3 modifications and / or 2’ -F modifications; wherein the antisense strand comprises PS linkages; and optionally wherein the antisense strand comprises an overhang; and wherein the sense stand comprises 2’ -O-CH3 modifications; wherein the sense stand comprises 2’ -F modifications; wherein the sense strand comprises PS linkages.

[0124] In a particular embodiment, there is disclosed an RNAi agent capable of inhibiting expression of IFN-pi in a cell, the RNAi agent comprising: an antisense strand and a sense strand respectively comprising: SEQ ID NOs: 5 & 132; 6 & 133; 7 & 134; or 20 & 147 each apart from 3, 2, 1, or no substitutions; and wherein the antisense strand is 23 nucleobases long; comprises a 3’ overhang that is two deoxythymidines; has 2’ -O-CH3 modifications at residues 1, 3, 4, 5, 7, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 ; has 2’ -F modifications at residues 2, 6, 8, 9, 14, and 16; and has PS linkages as the last two linkages of the 5’ end and the 3’ end; and the sense stand is 21 nucleobases long; has 2’ -O-CH3 modifications at residues 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 ; has 2’ -F modifications at residues 7, 9, 10, and 11 ; and has PS linkages as the last two linkages of the 5’ end and the 3’ end.

[0125] In an embodiment, there is provided herein a double-stranded RNAi agent capable of modulating or inhibiting expression of IFN-pi in a cell, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand that are, at least in part or completely, complementary, and wherein the antisense strand is or comprises any one of SEQ ID NOs: 266-312 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. In an embodiment, there is provided herein a double-stranded RNAi agent capable of inhibiting expression of IFN-pi in a cell, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand that are, at least in part or completely, complementary, and wherein the antisense strand is or comprises any one of SEQ ID NOs: 266-312. In some examples, the sense strand is or comprises any one of SEQ ID NOs: 313-359 apart from 5, 4, 3, 2, 1 , or no substitutions, deletions, or insertions. In some examples, the sense strand is or comprises any one of SEQ ID NOs: 313-359. The pairing of the sense and antisense strands is listed in Table lb.

[0126] Single-stranded antisense oligomer

[0127] In a particular embodiment, the antisense oligomer of the first aspect is suitable for use or suitable for delivery to a patient as a single-stranded molecule. Thus, the antisense oligomer may be a single-stranded oligomer.

[0128] In an embodiment, there is provided an antisense oligomer capable of inhibiting expression of IFN-pi in a cell, wherein the antisense oligomer targets residues in any one of regions 5-90, 110-170, 195-245, 280-330, 360-425, 500-590, 600-690, or 705-740 of the Homo sapiens interferon beta 1 mRNA (SEQ ID NO: 263), and the antisense oligomer is suitable for use or suitable for delivery to a patient as a single-stranded molecule.

[0129] The antisense oligomer may be 10-45 nucleobases, 16-25 nucleobases, 18-22 nucleobases, or 20 nucleobases in length. The antisense sequence may be varied to target other alleles of human IFN-betal or to target IFN-betal in other species. Thus, the sequence of the antisense oligomer may vary from a sequence recited herein but may be perfectly complementary to its target. The antisense oligomers in this paragraph may, in some embodiments, be 10-45 nucleobases, 16-25 nucleobases, 18-22 nucleobases, or 20 nucleobases in length.

[0130] The antisense oligomer may be a gapmer.

[0131] The antisense oligomer may comprise one or more of a deoxyribonucleotide and / or a ribonucleotide. The antisense oligomer may comprise deoxyribonucleotides apart from modifications recited herein, and so may be a modified DNA molecule. In an example, residues 6, 7, 8, 9, 10, 11, 12, 13, 14, and / or 15 are deoxy ribonucleotides.

[0132] The antisense oligomer may comprise a nucleoside or nucleosides that have been modified, for instance the modifications may be to the sugar moiety. In some examples, the 2 ’-position of the sugar moiety may be modified. A modification may be to any moiety that is not “-H” for DNA or not “-OH” for RNA. Examples of such 2’ modifications are -O-CH3, -O-CH2-CH2-O-CH3, or -F, and further examples are provided herein. In other examples, the 4’ position of the sugar moiety made be modified, for instance to result in a bridge between the 2’ position and the 4’ position. The antisense oligomer may comprise one, two, three, four, or more types of nucleoside. The antisense oligomer may comprise a combination of modified nucleosides and unmodified nucleosides. The antisense oligomer may comprise only modified nucleosides. The nucleotides of the antisense oligomer may all be modified in the same manner or may be modified in two or more different manners. These modifications may be applied to any of the antisense oligomers disclosed herein. The antisense oligomer may comprise one or more 2’OMe nucleotides, one or more 2'-Fluoro nucleotides, one or more 2'-MOE nucleotides, and / or one or more LNA nucleotides. These modifications may be applied to any of the antisense oligomers disclosed herein.

[0133] The antisense oligomer may comprise one or more of a deoxyribonucleotide, a ribonucleotide, an arabinonucleotide, a 2'-Fluoroarabinonucleotide (FANA), a 2'-O-methyl (2’OMe) nucleotide, a phosphorothioate 2'-O-methyl (PS-2’OMe) nucleotide, a 2'-O-methoxyethyl (MOE) nucleotide, a phosphorothioate 2’-O- methoxyethyl (PS-MOE) nucleotide, a phosphorodiamidate morpholino monomer, a locked nucleotide, a P-alkyl phosphonate nucleotide, a threose nucleotide, a hexitol nucleotide, a 2’ hydroxy -hexitol nucleotide, a cyclohexene nucleotide, a 3’ deoxi-DNA (2’-5’) nucleotide, a peptide nucleic acid (PNA) residue, a 2’-O,4’-C-ethylene- bridged nucleotide, or any combination thereof.

[0134] In a particular embodiment, the antisense oligomer includes 2’ -O-CH2-CH2-O-CH3 modifications. In an example, the antisense oligomer may have 2’ -O-CH2-CH2-O-CH3 modifications at residues 1, 2, 3, 4, 5, 16, 17, 18, 19, and / or 20.

[0135] The above discussed deoxyribonucleotides and modified nucleotides may be combined. Thus, the antisense oligomer may comprise one or more 2’ -O-CH2-CH2-O-CH3 modifications and / or one or more deoxy ribonucleotides.

[0136] The antisense oligomer may comprise a modification to one or more intemucleoside linkages. For instance, the antisense oligomer may comprise one or more phosphorothioate linkages. In some embodiments, all of the intemucleotide linkages within the antisense oligomer are phosphorothioate linkages. The antisense oligomer may be or may comprise an oligonucleotide phosphorothioate. The antisense oligomer may comprise one or more phosphorodiamidate linkage. In some embodiments, all of the intermonomer linkages within the antisense oligomer are phosphorodiamidate linkages. The antisense oligomer may be or may comprise a DNA oligomer, an RNA oligomer, an arabinonucleic acid (ANA) oligomer, a 2'-Fluoroarabinonucleic acid (FANA) oligomer, a 2'-O-methyl ribonucleic acid (2’OMe) oligomer, a phosphoro thio ate 2'-O-methyl ribonucleic acid (PS-2’OMe) oligomer, a 2'-O-methoxy ethyl (MOE) nucleic acid oligomer, a phosphoro thio ate 2’-O-methoxyethyl (PS-MOE) nucleic acid oligomer, a phosphorodiamidate morpholino oligomer (PMO), a locked nucleic acid (LNA) oligomer, a P-alkyl phosphonate nucleic acid (phNA) oligomer, a threose nucleic acid (TNA) oligomer, a hexitol nucleic acid (HNA) oligomer, a 2’ hydroxy-hexitol (AtNA) oligomer, a cyclohexene nucleic acid (CeNA) oligomer, a 3’ deoxi-DNA (2’-5’) oligomer, a peptide nucleic acid (PNA) oligomer, a 2’-O,4’-C-ethylene -bridged nucleic acid (ENA) oligomer, or any combination thereof.

[0137] The antisense strand and / or the sense strand may include one or more naturally occurring nucleobase and / or one or more modified nucleobase. A modified nucleobase is a nucleobase that is capable of base pairing with a nucleobase of a nucleic acid, but is structurally different from a naturally occurring nucleobase. An example of a modified nucleobase is 5-methylcytosine.

[0138] Any of the antisense oligomers of the present disclosure may be present as a pharmaceutically acceptable salt, ester, salt of said ester, or hydrate of said antisense oligomer, and references to an antisense oligomer encompass such compounds. The antisense oligomer of the present disclosure may be present as a prodrug.

[0139] Table 10 - Exemplary antisense oligomers (ASOs)

[0140] Lower case=DNA 5-me-dC 2'-MOE S-Bond

[0141] In the sequence listing, all “U”s have been replaced with “T”s as per the requirements of WIPO ST.26. The antisense oligomers of the present disclosure may comprise uracil or thymine in said positions. In some embodiments, the nucleobases are as recited above, including the respective uracils or thymines.

[0142] The antisense oligomer of the present disclosure may comprise the sequence of or may be of the sequence of any indicated in Table 10. The antisense oligomer of the present disclosure may comprise the sequence of or may be of the sequence of any one of SEQ ID NOs: 378-511 apart from one or more modifications including deletions, insertions, substitutions, and wherein the antisense oligomer is capable of modulating or inhibiting expression of IFN-pi in a cell. The antisense oligomer may be complementary to at least 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or all bases to which an antisense oligomer comprising any one of SEQ ID NOs: 378-511 is complementary .

[0143] In an embodiment, the antisense oligomer of the present disclosure may comprise the sequence or may be of the sequence of any one of SEQ ID NOs: 378-511 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. In particular, the sequence may comprise 3, 2, 1, or no substitutions. In an embodiment, the antisense oligomer of the present disclosure may comprise the sequence or may be of the sequence of any one of SEQ ID NOs: 378-511. The antisense oligomer may comprise one or more 2’OMe nucleotides, one or more 2'-Fluoro nucleotides, one or more 2'-MOE nucleotides, and / or one or more LNA nucleotides. The antisense oligomer may comprise a nucleotide comprising a 2'-O-methyl sugar moiety and / or a 2’-O-methoxyethyl sugar moiety. The antisense oligomer may comprise only 2'-O-methyl nucleotides and / or 2’-O-methoxyethyl nucleotides. The antisense oligomer may comprise one or more phosphoro thio ate linkages. In some examples, all of the linkages within the antisense oligomer are phosphoro thio ate linkages. In an embodiment, the antisense oligomer of the present disclosure may comprise a nucleobase sequence or may be of a nucleobase sequence (i.e. one of SEQ ID NOs: 378-444) that is associated with a statistically significant effect in Figure 4. In an embodiment, the antisense oligomer of the present disclosure may comprise a sequence or may be of a sequence (i.e. one of SEQ ID NOs: 445-511) that is associated with a statistically significant effect in Figure 4. In an embodiment, the antisense oligomer of the present disclosure may comprise a nucleobase sequence or may be of a nucleobase sequence (i.e. one of SEQ ID NOs: 378-444) that is associated with a statistically significant downregulation in Figure 4. In an embodiment, the antisense oligomer of the present disclosure may comprise a sequence or may be of a sequence (i.e. one of SEQ ID NOs: 445-511) that is associated with a statistically significant downregulation in Figure 4.

[0144] The antisense oligomer of the present disclosure may comprise the sequence or may be of the sequence of any one of SEQ ID NOs: 378-511, wherein one of more of the nucleobases has been substituted for a modified nucleobase. For instance, one of more of the nucleobases of any one of SEQ ID NOs: 378-511 may be replaced with a modified nucleobase that retains the base pairing capability of the replaced nucleobase. As an example, the cytosines of any one of SEQ ID NOs: 378-511 may be replaced with 5-methylcytosine. Additionally, any uracil in a sequence disclosed herein may be exchanged for a thymidine and vice versa.

[0145] The antisense oligomer may be 10-45 nucleobases, 16-25 nucleobases, 18-22 nucleobases, or 20 nucleobases in length and comprise any one of SEQ ID NOs: 378-511 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. In some embodiments, the antisense oligomer does not comprise any additional nucleic acid sequence, or analogous nucleobases, beyond that recited in any one of SEQ ID NOs: 378-511. In other embodiments, the antisense oligomer may comprise 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, or more nucleobases in addition to those recited in any one of SEQ ID NOs: 378-511. A portion or all of any additional nucleobases may be complementary to the target. For instance, a portion or all of the additional nucleobases may be complementary to SEQ ID NO: 263. In other embodiments, none of the additional nucleobases are complementary to SEQ ID NO: 263.

[0146] In some embodiments, the antisense oligomer is or comprises a truncation of the sequence in any one of SEQ ID NOs: 378-444. The truncation may be at least 15, 16, 17, 18, 19, or 20 nucleobases in length. The truncated antisense oligomer may be a gapmer. The truncated antisense oligomer may comprise RNA regions flanking a DNA region. The RNA regions may be as described (e.g. they may be 2’-MOE RNA residues). The intemucleotide linkages may be as described (e.g. all PS bonds). The DNA region may be as described (e.g. all Cs may be 5-methylcytosine).

[0147] The antisense oligomer may be a gapmer. The antisense oligomer may comprise a DNA sequence or analogue flanked by RNA sequences or analogues. The U / T residues may be U in the RNA portion and T in the DNA portion. The RNA portion may comprise 2’-MOE, 2’-OMe, LNA, and / or 2’-F nucleotide residues. The antisense oligomer may comprise a DNA region flanked by RNA regions of 1, 2, 3, 4, or 5 residues. The antisense oligomer may be 20 nucleotides in length and comprise a DNA region flanked by RNA regions of 1, 2, 3, 4, or 5 residues. The DNA region may be 10 residues. The antisense oligomer may be 20 nucleotides in length and comprise a DNA region flanked by RNA regions of 5 residues. The antisense oligomer may comprise, in order from 5’ to 3’, five RNA or modified RNA nucleotides, 10 DNA or modified DNA nucleotides, and five RNA or modified RNA nucleotides. In some examples, one, more, or all of the “C”s of the DNA portion are 5-methylcytosine. In some examples, one, more, or all of the “C”s of the RNA portion are cytosine. In some examples, all of the “C”s in the DNA portion are 5-methylcytosine and all of the “C”s in the RNA portion are cytosine.

[0148] In a particular embodiment, the antisense oligomer includes 2’ -O-CH2-CH2-O-CH3 modifications. In an example, the antisense oligomer may have 2’ -O-CH2-CH2-O-CH3 modifications at residues 1, 2, 3, 4, 5, 16, 17, 18, 19, and / or 20. These modifications may be applied to any of the antisense oligomers disclosed herein, and so antisense oligomers comprising any of SEQ ID NOs: 378-444 may have 2’ -O-CH2-CH2-O-CH3 modifications at residues 1, 2, 3, 4, 5, 16, 17, 18, 19, and / or 20 of SEQ ID NOs: 378-444. In particular embodiments, the antisense oligomer is 20 nucleobases in length; comprises any one of SEQ ID NOs: 378-444 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; comprises 2’ -O-CEI2-CEI2-O-CEI3 modifications at residues 1, 2, 3, 4, 5, 16, 17, 18, 19, and 20 of the SEQ ID NO: 378-444. The antisense oligomer may comprise 1, 2, 3, 4, or 5 residues of 2'-MOE nucleotides at the 5’ end and 1, 2, 3, 4, or 5 residues of 2'-MOE nucleotides at the 3’ end. The antisense oligomer may comprise 5 residues of 2'-MOE nucleotides at the 5’ end and the 3’ end.

[0149] The antisense oligomer may have 2’ -O-CH2-CH2-O-CH3 modifications at residues 1, 2, 3, 4, 5, 16, 17, 18, 19, and 20 and comprise DNA residues at positions 6, 7, 8, 9, 10, 11, 12, 13, 14, and 15. These modifications may be applied to any of the antisense oligomers disclosed herein, and so antisense oligomers comprising any of SEQ ID NOs: 378-444 may have 2’ -O-CEI2-CEI2-O-CEI3 modifications at residues 1, 2, 3, 4, 5, 16, 17, 18, 19, and 20 and DNA residues at positions 6, 7, 8, 9, 10, 11, 12, 13, 14, and 15. In particular embodiments, the antisense oligomer is 20 nucleobases in length; comprises any one of SEQ ID NOs: 378-444 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; comprises 2’ -O-CEI2-CEI2-O-CEI3 modifications at residues 1, 2, 3, 4, 5, 16, 17, 18, 19, and 20; and comprises DNA residues at positions 6, 7, 8, 9, 10, 11, 12, 13, 14, and 15.

[0150] In a particular embodiment, there is disclosed an antisense oligomer capable of inhibiting expression of IFN-pi in a cell, the antisense oligomer comprising any one of SEQ ID NOs: 379, 381-396, 399-421, 423, 424, 426-434, and 436-444; apart from

[0151] 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; or

[0152] 3, 2, 1, or no substitutions; or no substitutions, deletions, or insertions; and wherein the antisense oligomer comprises one, more than one, or all PS linkages; and the first five residues from the 5’ end and the last five residues at the 3’ end are residues of 2 ’-MOE, 2’-OMe, LNA, or 2’-F RNA nucleotides; the RNA residues flank a DNA region; and one, more than one, or all cytosines within the DNA region are 5-methylcytosine.

[0153] In a particular embodiment, there is disclosed an antisense oligomer capable of inhibiting expression of IFN-pi in a cell, wherein the antisense oligomer is according to any one of 379, 381-396, 399-421, 423, 424, 426-434, and 436-444; apart from

[0154] 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; or

[0155] 3, 2, 1, or no substitutions; or no substitutions, deletions, or insertions; and wherein all bonds between residues are PS linkages; and the first five residues from the 5’ end and the last five residues at the 3’ end are residues of 2 ’-MOE RNA nucleotides; the RNA residues flank a DNA region; and all cytosines within the DNA region are 5-methylcytosine. In a particular embodiment, there is disclosed an antisense oligomer capable of inhibiting expression of IFN-pi in a cell, wherein the antisense oligomer is according to any one of 446, 448-463, 466-488, 490, 491, 493-501, and 503-511 ; apart from

[0156] 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; or

[0157] 3, 2, 1, or no substitutions; or no substitutions, deletions, or insertions.

[0158] In an embodiment, there is provided an antisense oligomer capable of upregulating expression of IFN-pi in a cell, wherein the antisense oligomer comprises or is SEQ ID NO: 425 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. Any of the potential sequence variations, modifications, or other variation disclosed herein may be included in said agent. In an example, the antisense oligomer is or comprises SEQ ID NO: 492 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions. In an example, the antisense oligomer is SEQ ID NO: 492.

[0159] In a particular embodiment, there is disclosed an antisense oligomer capable of modulating or inhibiting expression of IFN-pi in a cell, the antisense oligomer comprising: any one of SEQ ID NOs: 378-444; apart from

[0160] 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; or

[0161] 3, 2, 1, or no substitutions; or no substitutions, deletions, or insertions; and wherein the antisense oligomer comprises one, more than one, or all PS linkages; and the first five residues from the 5’ end and the last five residues at the 3’ end are residues of 2 ’-MOE, 2’-OMe, LNA, or 2’-F RNA nucleotides; the RNA residues flank a DNA region; and one, more than one, or all cytosines within the DNA region are 5-methylcytosine.

[0162] In a particular embodiment, there is disclosed an antisense oligomer capable of modulating or inhibiting expression of IFN-pi in a cell, wherein the antisense oligomer is according to any one of SEQ ID NOs: 378-444; apart from

[0163] 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; or

[0164] 3, 2, 1, or no substitutions; or no substitutions, deletions, or insertions; and wherein all bonds between residues are PS linkages; and the first five residues from the 5’ end and the last five residues at the 3’ end are residues of 2 ’-MOE RNA nucleotides; the RNA residues flank a DNA region; and all cytosines within the DNA region are 5-methylcytosine.

[0165] Conjugates

[0166] The antisense oligomers of the first aspect, including the double-stranded RNAi agents and the single-stranded antisense oligomers of the present invention, may be conjugated to other molecules or moieties.

[0167] For instance, the antisense oligomers may be conjugated to ligands that target the antisense oligomers to particular tissues and / or cells. The antisense oligomer may be associated with an agent for the delivery of the antisense oligomer into cells, for instance for promoting the transfer of the antisense oligomer across a membrane. The antisense oligomer may be covalently or non-covalently bound to a peptide that promotes cell entry, such as a cell-penetrating peptide. The peptide for cellular entry may be a poly cationic peptide, may be an amphipathic peptide, may be a hydrophobic peptide, may be a stapled peptide, or may be a stitched peptide. The antisense oligomers may be conjugated to a protein (e.g. human serum albumin), a peptide (e.g. a cellpenetrating or permeating peptide), sugar moieties (e.g. a carbohydrate), a lipid, a chemical moiety, and / or modifications to the 5’ or 3’ ends of the antisense oligomer.

[0168] The antisense oligomers may be conjugated or in association with a therapeutic agent.

[0169] The association between the antisense oligomer and any of said components may be covalent or non-covalent. The antisense oligomers may be conjugated to the other moiety or molecule via a linker. The linker may be any suitable and may include peptide bonds. The linker may include a cleavage or cleavable domain.

[0170] In some examples, the antisense oligomer of the present disclosure is present in an isolated form. An isolated antisense oligomer does not comprise further nucleobases that are complementary to the target. However, the isolated antisense oligomer may be associated with additional components, as discussed above. The antisense oligomer may be purified.

[0171] Vectors

[0172] The skilled person would appreciate that suitable antisense oligomers of the first aspect, such as RNAi agents comprising only RNA nucleotides, may be expressed from a nucleic acid vector. Thus, in a second aspect, there is provided one or more nucleic acid vectors encoding an antisense oligomer of the first aspect.

[0173] Where the nucleic acid vector encodes a double-stranded agent, the antisense strand may be encoded by a first vector and the sense strand may be encoded by a second vector. Alternatively, the antisense strand and the sense strand may be encoded by a single vector.

[0174] The vector may be DNA or comprise modified nucleotides (e.g. as discussed herein). The vector may include an expression cassette. For instance, a promoter operably linked to the gene encoding the antisense strand and / or the sense strand.

[0175] The nucleic acid vector may be suitable for delivery to a human. A DNA plasmid may encode the antisense oligomer. The encoding nucleic acid may be suitable for encapsulation by a viral vector. The encoding nucleic acid may be encapsulated within a lipid nanoparticle.

[0176] In examples, a vector may encode any antisense strand described for the first aspect that comprises only RNA nucleotides. For instance, the vector may encode any antisense strand recited in one of Tables 1, 2, and 3. In other examples, one or more vectors encodes one antisense strand recited in one of Tables 1, 2, and 3 and the paired sense strand in recited in said Table. One vector may encode one antisense strand recited in one of Tables 1, 2, and 3 and the paired sense strand in recited in said Table. A first vector may encode one antisense strand recited in one of Tables 1, 2, and 3 and a second vector may encode the paired sense strand in recited in said Table.

[0177] Delivery compositions

[0178] The antisense oligomer of the first aspect or one or more nucleic acid vectors of the second aspect may be present as part of extracellular vesicle composition. For instance, the antisense oligomer or one or more nucleic acid vectors may be loaded into the lumen of an exosome or associated with a component of an exosome. The antisense oligomer or one or more nucleic acid vectors may be associated with monolayers, micelles, bilayers, lipid vesicles, or liposomes.

[0179] The antisense oligomer or one or more nucleic acid vectors may be included in a nanoparticle, for instance a lipid nanoparticle composition. The one or more nucleic acid vectors of the second aspect may be encapsulated within a viral vector. The viral vector may comprise the nucleic acid encoding the antisense oligomer or oligomers, as discussed for the second aspect, packaged within viral vector proteins.

[0180] Pharmaceutical compositions

[0181] In a third aspect, there is provided a pharmaceutical composition comprising an antisense oligomer of the first aspect or one or more nucleic acid vectors of the second aspect.

[0182] The pharmaceutical composition may comprise any of the double-stranded RNAi agents discussed in relation to the first aspect, any of the single-stranded antisense oligomers discussed in relation to the first aspect, or any of the nucleic acid vectors of the second aspect encoding said agents.

[0183] As discussed herein, the antisense oligomers and the nucleic acid vectors, may be conjugated to other molecules or moieties and may be encapsulated in delivery compositions or vectors. Thus, the pharmaceutical compositions of the third aspect may comprise these conjugations, vectors, and delivery compositions.

[0184] The pharmaceutical composition may comprise a pharmaceutically acceptable vehicle, a pharmaceutically acceptable carrier, a pharmaceutically acceptable excipient, a pharmaceutically acceptable stabilizer, or a pharmaceutically acceptable preservative, or any combination thereof. To be pharmaceutically acceptable, a substance or combination of substances must be suitable for the formulation of pharmaceutical compositions or a medicament.

[0185] The pharmaceutical composition may comprise a therapeutically effective amount of the antisense oligomer of the present disclosure. The phrases “therapeutically effective amount” and “effective amount” and the like, as used herein, indicate an amount necessary to administer to a subject, or to a cell, tissue, or organ of a subject, to achieve a therapeutic effect, such as an ameliorating or alternatively a curative effect. The effective amount is sufficient to elicit the biological or medical response of a cell, tissue, system, animal, or human that is being sought by a researcher, veterinarian, medical doctor, or clinician.

[0186] A pharmaceutical composition of the present disclosure may be formulated for administration to any subject in need thereof. A “subject”, as used herein, may be a vertebrate, mammal, or domestic animal. Most preferably, the subject is a human.

[0187] Medical uses

[0188] The present inventors have identified evidence supporting the knockdown of IFN-pi as an effective therapy for certain pathologies, such as adult or juvenile dermatomyositis.

[0189] Myositis refers to a heterogenous group of rare autoimmune conditions which result in inflammation and weakness of skeletal muscle. The myositis subtypes, dermatomyositis (DM) and juvenile dermatomyositis (TDM), have additional manifestations in the skin in the form of distinctive rashes and papules which may even occur without detectable muscle involvement (1). A type I IFN signature based on upregulation of type I IFN response genes (IRGs) may be observed across the subtypes of myositis patients but is generally more striking in DM / JDM (2-8). The type I IFN signature correlates with disease activity in both DM (3-5, 9) and TDM (4, 6). Type I IFN includes IFN alpha and IFN beta. Direct measurement of IFN beta transcripts and protein have revealed a close association with DM and TDM. The IFN signature in DM skin has been found to be highly correlated with IFNB1 transcript expression (10). Furthermore, circulating IFN beta protein levels correlate with cutaneous disease activity scores in DM patients (11).

[0190] A comparison of IFN response gene scores in TDM and mendelian autoinflammatory interferonopathies found similarities with Stimulator of Interferon Genes (STING)-associated vasculopathy with onset in infancy (SA VI), particularly with anti-MDA5 positive JDM (12). In SA VI, mutations in STING result in constitutive activation of IFN beta. Both JDM and SA VI feature vasculopathy and these IFN response gene score similarities suggest a possible shared role of IFN beta and STING pathways in pathogenesis (12).

[0191] In preliminary experiments, exogenous over-expression of the IFN beta gene Ifnbl in wild-type mice resulted in upregulation of IFN signature genes, reduced grip strength, reduced muscle force and reduced treadmill running speed compared to controls (13). Taken together, these data demonstrate a clear link between IFN beta overexpression and muscle weakness in mice which may be relevant to our understanding of the pathology of DM / JDM in humans. Notably, there is a case study of a patient receiving IFN beta treatment for multiple sclerosis who was subsequently diagnosed with DM; this was exacerbated by further IFN beta injections (14).

[0192] Other complex autoimmune diseases with an elevated type I IFN signature include systemic lupus erythematosus (SLE), psoriasis and Sjogren’s syndrome (8, 15). IFN beta is elevated in B-cells and bone marrow mesenchymal stem cells in SLE (16, 17) and in trials targeting of IFN alpha using monoclonal antibodies in SLE has been ineffective (rontalizumab) (18) or only effective for 60% of patients (sifalimumab) (19), suggesting a role for IFN beta in addition to alpha in ESLE pathology. Therefore, an approach that directly targets overexpressed IFN beta for knockdown could be applicable to other conditions with enhanced type I IFN signalling in addition to DM / JDM.

[0193] Thus, in light of these findings, in a fourth aspect there is provided an antisense oligomer capable of inhibiting expression of interferon beta (IFN-pi) in a cell, or a nucleic acid vector encoding said antisense oligomer, for use as a medicament.

[0194] There is provided a method of treatment comprising administering a therapeutically effective amount of an antisense oligomer capable of inhibiting expression of interferon beta (IFN-pi) in a cell, or a nucleic acid vector encoding said antisense oligomer, to a subject in need thereof.

[0195] There is provided use of an antisense oligomer capable of inhibiting expression of interferon beta (IFN-pi) in a cell, or a nucleic acid vector encoding said antisense oligomer, for the manufacture of a medicament.

[0196] The antisense oligomer or nucleic acid vector may be used as an anti-inflammatory medicament. Thus, the antisense oligomer or nucleic acid vector can reduce IFN-pi -mediated inflammation. The subjects may have a pathological condition that is, at least in part, mediated by IFN-pi . For instance, the medicaments may be used to treat an interferonopathy or an autoinflammatory condition.

[0197] In examples, the antisense oligomer or nucleic acid vector are for use in treating myositis. The myositis may have a type I IFN signature. In particular embodiments, the antisense oligomer or nucleic acid vector are for use in treating adult or juvenile dermatomyositis.

[0198] Other conditions that the medicaments may be for use in treating include stimulator of interferon genes (STING)- associated vasculopathy with onset in infancy (SA VI), systemic lupus erythematosus (SLE), psoriasis, or Sjogren’s syndrome.

[0199] The antisense oligomer may be as disclosed for the first aspect and the nucleic acid vector may be as disclosed for the second aspect. Thus, there is provided an antisense oligomer of the first aspect, one or more nucleic acid vectors of the second aspect, or a pharmaceutical composition of the third aspect for use as a medicament.

[0200] There is provided a method of treatment comprising administering a therapeutically effective amount of an antisense oligomer of the first aspect, one or more nucleic acid vectors of the second aspect, or a pharmaceutical composition of the third aspect to a subject in need thereof. There is provided use of an antisense oligomer of the first aspect, one or more nucleic acid vectors of the second aspect, or a pharmaceutical composition of the third aspect for the manufacture of a medicament.

[0201] Suitable RNAi agents are discussed in relation to the first aspect. Illustrative examples of RNAi agents are disclosed in Tables la, lb, 2, 3a, and 3b.

[0202] Particular examples of antisense oligomers capable of inhibiting expression of IFN-pi in a cell include the RNAi agents disclosed herein that comprise an antisense strand based on any one of SEQ ID NO: 5, 6, 7, 20, 23, 24, 25, 26, 27, 29, 34, and 36. More specific examples include double-stranded RNAi agents wherein the antisense strand is based on any one of SEQ ID NOs: 5, 6, 7, and 20. The potential modifications, sequence variations, optional overhangs, and paired sense strands that are relevant to these agents are disclosed herein.

[0203] Suitable single-stranded antisense oligomers, such as gapmers, are discussed in relation to the first aspect. Illustrative examples of antisense oligomers agents are disclosed in Table 10.

[0204] The agents and compositions disclosed herein target IFN-pi and may be used as an anti-inflammatory medicament. Thus, the antisense oligomers of the first aspect, the one or more nucleic acid vectors of the second aspect, or the pharmaceutical compositions of the third aspect can reduce IFN-pi -mediated inflammation. This is relevant to subjects with a pathological condition that is, at least in part, mediated by IFN-pi . For instance, the medicaments may be used to treat an interferonopathy or an autoinflammatory condition.

[0205] In examples, the antisense oligomers of the first aspect, the one or more nucleic acid vectors of the second aspect, or the pharmaceutical compositions of the third aspect are for use in treating myositis. The myositis may have a type I IFN signature. In particular embodiments, the antisense oligomers of the first aspect, the nucleic acid vectors of the second aspect, or the pharmaceutical compositions of the third aspect are for use in treating adult or juvenile dermatomyositis.

[0206] Other conditions that the medicaments may be for use in treating include stimulator of interferon genes (STING)- associated vasculopathy with onset in infancy (SA VI), systemic lupus erythematosus (SLE), psoriasis, or Sjogren’s syndrome. Thus, the antisense oligomers of the first aspect, the one or more nucleic acid vectors of the second aspect, or the pharmaceutical compositions of the third aspect may be for use in treating these conditions.

[0207] In some embodiments, the inflammation is caused by an external agent. For instance, immune responses can be inappropriately directed to drugs (an anti-drug immune response) and the medicaments of the present invention can be used to reduce said immune responses. Thus, the antisense oligomer of the first aspect, one or more nucleic acid vectors of the second aspect, or pharmaceutical composition of the third aspect may be for use in reducing host immune responses directed to a therapeutic agent.

[0208] In some examples, the antisense oligomers of the first aspect are capable of upregulating IFN-pi . For instance, the RNAi agents disclosed herein that comprise an antisense strand based on any one of SEQ ID NO: 28, 31, 68, 100, 108, 110, 111, and 112 (potential modifications, sequence variations, optional overhangs, and paired sense strands are also disclosed herein). These agents, nucleic acid vectors encoding said agents, and pharmaceutical compositions comprising said agents or vectors may be for use as a medicament. This is relevant to subjects with a pathological condition that benefits from IFN-pi upregulation.

[0209] Thus, in a fifth aspect, there is provided an antisense oligomer capable of upregulating expression of interferon beta (IFN-pi) in a cell, or a nucleic acid vector encoding said antisense oligomer, for use as a medicament. There is provided a method of treatment comprising administering a therapeutically effective amount of an antisense oligomer capable of upregulating expression of interferon beta (IFN-pi) in a cell, or a nucleic acid vector encoding said antisense oligomer, to a subject in need thereof.

[0210] There is provided use of an antisense oligomer capable of upregulating expression of interferon beta (IFN-pi) in a cell, or a nucleic acid vector encoding said antisense oligomer, for the manufacture of a medicament.

[0211] The antisense oligomer or nucleic acid vector of the fifth aspect may be used as a pro-inflammatory medicament. The subjects may have a pathological condition that benefits from an increase IFN-pi . For instance, the medicaments may be used to treat autoimmunity, cancer, or viral infections. The autoimmune condition may be multiple sclerosis or rheumatoid arthritis. The cancer may be a leukaemia, a lymphoma, a Kaposi sarcoma, or a melanoma. The leukaemia may be hairy cell leukaemia or chronic myelogenous leukaemia. The viral infection may be Ebola, hepatitis B, hepatitis C, human immunodeficiency virus- 1 (HIV-1) encephalitis, herpes, zoster, herpes simplex virus (HSV), or cytomegalovirus infection.

[0212] The medicaments of the present disclosure may be administered to a subject by any suitable means and in any suitable form. Suitable means for administering antisense oligomers, such as oligonucleotides, nucleic acids, and nucleic acid analogues, are known in the art. For instance, the medicaments of the present disclosure may be administered intravenously or subcutaneously.

[0213] A suitable dosing regimen may be used depending on the organism to be treated. It will be appreciated that medicaments of the present disclosure may be used in a monotherapy. Alternatively, medicaments of the present disclosure may be used as an adjunct to, or in combination with, known therapies. The medicaments of the present disclosure may be for administration before, during or after onset of the pathological condition.

[0214] A medicament of the present disclosure may be for the treatment of any subject in need thereof. The medicaments may be for the treatment of a vertebrate, mammal, or domestic animal. Most preferably, the treatment is for a human.

[0215] The terms “treat”, “treating”, “treatment” and the like, as used herein, unless otherwise indicated, refers to reversing, alleviating, inhibiting the process of, or preventing the disease, disorder or condition to which such term applies, or one or more symptoms of such disease, disorder or condition and includes the administration of any of the antisense oligomers, pharmaceutical compositions, or dosage forms described herein, to prevent the onset of the symptoms or the complications, or alleviating the symptoms or the complications, or eliminating the disease, condition, or disorder. For example, treatment is curative or ameliorating. As used herein, “preventing” means preventing in whole or in part, or ameliorating or controlling, or reducing or halting the production or occurrence of the thing or event, for example, the disease, disorder or condition, to be prevented.

[0216] The terms “administering”, “administer”, “administration” and the like, as used herein, refer to any mode of transferring, delivering, introducing, or transporting a therapeutic agent to a subject in need of treatment with such an agent.

[0217] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present specification, including definitions, will control. Throughout this specification and claims, the word “comprise,” or variations such as “comprises” or “comprising” will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. All of the features described herein (including any accompanying claims, abstract and drawings), and / or all of the steps of any method or process so disclosed, may be combined with any of the above aspects in any combination, except combinations where at least some of such features and / or steps are mutually exclusive.

[0218] For a better understanding of the invention, and to show how embodiments of the same may be carried into effect, reference will now be made to the Examples, which are not intended to limit the invention in any way.

[0219] EXAMPLES

[0220] Example 1 - In vitro screening in myoblasts

[0221] Screening of selected siRNA sequences (see Table 2) was performed using immortalised myoblasts (KM 1421 derived from paravertebral muscle of 13-year-old female). Cells were seeded at 50,000 per well of a 24-well plate, transfected with Ing / mL Poly EC using Lipofectamine 2000 for 24 hours to stimulate IFN beta production and then transfected with 30nM siRNA using Lipofectamine RNAiMAX for 48 hours. Total RNA was isolated and RTqPCR performed to assess the knockdown of IFNB1 expression normalised to the reference gene HPRT1 and compared to cells treated with Ing / mL Poly EC only.

[0222] Poly EC treatment induced an 80-fold increase in IFNB1 expression compared to the no treatment group (Figure 1, Table 5). Compared to the Poly EC group there was no change in IFNB1 expression in the non-targeting siRNA control group (NATA_D-NTC003). From our 27 siRNA panel, 10 siRNA showed knockdown of IFNB1 expression compared to the Poly EC group, 7 of which were statistically significant (p<0.05) (Figure 1, Table 5).

[0223] Table 5. Twenty-seven siRNA panel in vitro screen in myoblasts; IFNB1 transcript expression compared to Ing / mL Poly I:C with HPRT1 as reference gene

[0224] Values calculated using Bio-Rad CFX Maestro software

[0225] Example 2 - Follow-up in vitro screen in differentiated myotubes

[0226] In myogenesis during development and regeneration of muscle following injury, satellite cells (muscle precursor cells) differentiate into highly proliferative myoblasts and then fuse to form long thin multinucleated myotubes which can then organise into mature muscle fiber bundles to form functional muscle. Therefore, to screen the siRNAs in cells more closely resembling mature human muscle the myoblasts were differentiated into myotubes. Myoblasts were seeded into a 24-well plate and cultured until they were 90-100% confluent, high serum growth media was replaced with 2% horse serum differentiation media for 5 to 10 days to promote cell fusion into multinucleated myotubes.

[0227] Ten siRNAs showing a range of efficacy in myoblasts (knockdown, no change and upregulation) were selected for screening in myotubes (Table 6). Myotubes were transfected with Ing / mL Poly I:C using Lipofectamine 2000 for 24 hours to stimulate IFN beta production and then transfected with 20nM siRNA using Lipofectamine RNAiMAX for 48 hours. Total RNA was isolated and RTqPCR performed to assess the knockdown of IFNB1 expression normalised to the reference gene GAPDH and compared to cells treated with a non-targeting control siRNA.

[0228] Culture media collected from wells just prior to RNA isolation was centrifuged and supernatant from a subset of wells was used in an enzyme linked immunosorbent assay (ELISA) (Abeam ab278127) to detect secreted IFN beta protein.

[0229] Poly EC treatment induced a 246-fold increase in IFNB1 mRNA expression compared to the no treatment group (Figure 2A, Table 6). Compared to the Poly EC group there was no significant change in IFNB1 expression in the non-targeting control (NTC) siRNA group (NATA_D-NTC003). From the 10 siRNA tested, 7 siRNA showed knockdown of IFNB1 expression compared to the NTC group, 3 of which were statistically significant (p<0.05) (Figure 2, Table 6).

[0230] Supernatant from the four siRNA groups showing the highest knockdown efficacy were analysed using an ELISA and all four showed significant knockdown of IFN beta protein detected in the supernatant compared to the NTC group (Figure 2B, Table 7).

[0231] Table 6. Ten siRNA panel in vitro screen in differentiated myotubes; IFNB1 transcript expression compared to non-targeting control (NATA_D-NTC003) with GAPDH as reference gene

[0232] Values calculated using Bio-Rad CFX Maestro software

[0233] Table 7. Ten siRNA panel in vitro screen in differentiated myotubes; IFN beta concentration in cell media supernatant from wells treated with four siRNA

[0234] Each well was run in duplicate and 450nM absorbance values were converted to pg / mL concentration based on a standard curve of IFN beta. No treatment and blank were below the limit of detection for the ELISA. P-values calculated by ordinary one-way ANOVA comparing to non-targeting control siRNA (NATA_D-NTC003).

[0235] Example 3- In vitro screening of siRNAs and ASOs in A549 human lung adenocarcinoma cell line

[0236] A549 lung adenocarcinoma cells were used for screening of a larger library of 47 siRNAs, a library of 67 ASOs targeting IFNB1 and to compare selected siRNA sequences with different chemistries. Cells were seeded at 10,000 per well of a 96-well plate, transfected with lOOng / mL Poly I:C using Lipofectamine 2000 for 24 hours to stimulate IFN beta production and then transfected with 50nM siRNA or ASO using Lipofectamine RNAiMAX for 48 hours. Total RNA was isolated and RTqPCR performed to assess the knockdown of IFNB1 expression normalised to the reference gene GAPDH and compared to cells treated with non-targeting control (NTC) siRNA or ASO.

[0237] For the siRNA plates and ASO plates, Poly EC treatment induced an average of 560-fold and 566-fold increase in IFNB1 expression compared to the no treatment group, respectively (Figures 3 and 4, Tables 8 and 9).

[0238] From the 47-siRNA library, 32 siRNA showed knockdown of IFNB1 expression compared to the NTC siRNA group, 15 of which were statistically significant (p<0.05) (Figure 3, Table 8). From the selected siRNA sequences tested with different chemistries (NATA_D4001, NATA_D4002 and NATA_D4003) all except NATA_D4002v3 and NATA_D4003v3 showed knockdown of IFNB1 expression compared to the NTC siRNA group. Of these NATA_D4001v3, NATA_D4002, NATA_D4003 and NATA_D4003v2 were statistically significant (Figure 3, dark grey bars).

[0239] From the 67-ASO library, 60 ASOs showed knockdown of IFNB1 expression compared to the NTC ASO group, 38 of which were statistically significant (p<0.05) (Figure 4, Table 9).

[0240] Table 8. Forty-seven siRNA panel and selected siRNA with different chemistries in vitro screen in lung cells; IFNB1 transcript expression compared to non-targeting control siRNA (NATA_D-NTC003) with GAPDH as reference gene

[0241]

[0242] Values calculated using Bio-Rad CFX Maestro software

[0243] Table 9. Sixty-seven ASO panel in vitro screen in lung cells; IFNB1 transcript expression compared to nontargeting control ASO (NATA_NTC003) with GAPDH as reference gene

[0244] Values calculated using Bio-Rad CFX Maestro software

[0245] References

[0246] 1. Bailey EE, Fiorentino DF. Amyopathic dermatomyositis: definitions, diagnosis, and management. Curr Rheumatol Rep. 2014;16(12):465. 2. Pinal-Fernandez I, Casal-Dominguez M, Derfoul A, Pak K, Plotz P, Miller FW, et al. Identification of distinctive interferon gene signatures in different types of myositis. Neurology. 2019;93(12):el 193-e204.

[0247] 3. De Paepe B. Interferons as components of the complex web of reactions sustaining inflammation in idiopathic inflammatory myopathies. Cytokine. 2015;74(1 ):81 -7.

[0248] 4. Greenberg SA. Type 1 interferons and myositis. Arthritis Research & Therapy. 2010;12(l):S4.

[0249] 5. Greenberg SA, Pinkus JL, Pinkus GS, Burleson T, Sanoudou D, Tawil R, et al. Interferon-alpha / beta- mediated innate immune mechanisms in dermatomyositis. Ann Neurol. 2005;57(5):664-78.

[0250] 6. Salajegheh M, Kong SW, Pinkus JL, Walsh RJ, Liao A, Nazareno R, et al. Interferon-stimulated gene 15 (ISG15) conjugates proteins in dermatomyositis muscle with perifascicular atrophy. Annals of Neurology. 2010;67(l):53-63.

[0251] 7. Baechler EC, Bilgic H, Reed AM. Type I interferon pathway in adult and juvenile dermatomyositis. Arthritis Res Ther. 2011;13(6):249.

[0252] 8. Baechler EC, Bauer JW, Slattery CA, Ortmann WA, Espe KJ, Novitzke J, et al. An interferon signature in the peripheral blood of dermatomyositis patients is associated with disease activity. Mol Med. 2007; 13(1 -2): 59- 68.

[0253] 9. Wenzel J, Scheier M, Bieber T, Tilting T. Evidence for a role of type I interferons in the pathogenesis of dermatomyositis. Br J Dermatol. 2005;153(2):462-3; author reply 3-4.

[0254] 10. Wong D, Kea B, Pesich R, Higgs BW, Zhu W, Brown P, et al. Interferon and biologic signatures in dermatomyositis skin: specificity and heterogeneity across diseases. PLoS One. 2012;7(l):e29161.

[0255] 11. Huard C, Gulla SV, Bennett D V, Coyle AJ, Vleugels RA, Greenberg SA. Correlation of cutaneous disease activity with type 1 interferon gene signature and interferon p in dermatomyositis. Br J Dermatol. 2017;176(5): 1224-30.

[0256] 12. Kim H, Gunter-Rahman F, McGrath JA, Lee E, de Jesus AA, Targoff IN, et al. Expression of interferon- regulated genes in juvenile dermatomyositis versus Mendelian autoinflammatory interferonopathies. Arthritis Res Ther. 2020;22(l):69.

[0257] 13. Morales M, Parkes J, Narvesen S, Spathis R. Effect of Type I IFN on Mitochondria and Muscle Weakness in Myositis [abstract]. Arthritis Rheumatol. 2022; 74 (suppl 9).

[0258] 14. Somani AK, Swick AR, Cooper KD, McCormick TS. Severe dermatomyositis triggered by interferon beta- 1 a therapy and associated with enhanced type I interferon signaling. Arch Dermatol. 2008;144(10): 1341-9.

[0259] 15. Baechler EC, Batliwalla FM, Reed AM, Peterson EJ, Gaffney PM, Moser KL, et al. Gene expression profiling in human autoimmunity. Immunol Rev. 2006;210: 120-37.

[0260] 16. Hamilton JA, Wu Q, Yang P, Luo B, Liu S, Li J, et al. Cutting Edge: Intracellular IFN-P and Distinct Type I IFN Expression Patterns in Circulating Systemic Lupus Erythematosus B Cells. J Immunol. 2018;201(8):2203-8.

[0261] 17. Gao L, Bird AK, Meednu N, Dauenhauer K, Liesveld J, Anolik J, et al. Bone Marrow-Derived Mesenchymal Stem Cells From Patients With Systemic Lupus Erythematosus Have a Senescence-Associated Secretory Phenotype Mediated by a Mitochondrial Antiviral Signaling Protein-Interferon-P Feedback Loop. Arthritis Rheumatol. 2017;69(8): 1623-35.

[0262] 18. Kalunian KC, Merrill JT, Maciuca R, McBride JM, Townsend MJ, Wei X, et al. A Phase II study of the efficacy and safety of rontalizumab (rhuMAb interferon-a) in patients with systemic lupus erythematosus (ROSE). Ann Rheum Dis. 2016;75(1 ): 196-202.

[0263] 19. Khamashta M, Merrill JT, Werth VP, Furie R, Kalunian K, Illei GG, et al. Sifalimumab, an anti- interferon-a monoclonal antibody, in moderate to severe systemic lupus erythematosus: a randomised, doubleblind, placebo-controlled study. Ann Rheum Dis. 2016;75(l 1 ): 1909-16.

Claims

CLAIMS1. An antisense oligomer capable of modulating expression of IFN-pi in a cell, wherein the antisense oligomer targets residues in any one of regions 5-90, 110-170, 195-245, 280-330, 360-425, 500-590, 600-690, or 705-740 of Homo sapiens interferon beta 1 mRNA.

2. The antisense oligomer of claim 1, wherein the Homo sapiens interferon beta 1 mRNA is SEQ ID NO: 263.

3. The antisense oligomer of claim 1 or claim 2, wherein the antisense oligomer is an antisense strand of a double-stranded RNAi agent further comprising a sense strand, wherein the sense stand and the antisense strand are, at least in part or completely, complementary.

4. The double-stranded RNAi agent of claim 3, wherein the antisense strand targets residues in region 5-90 of the Homo sapiens interferon beta 1 mRNA.

5. The double-stranded RNAi agent of claim 3, wherein the antisense strand comprises a nucleobase sequence according to any one of SEQ ID NOs: 1-127 and 264 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; and / or the sense strand comprises a nucleobase sequence according to any one of SEQ ID NOs: 128-254 and 265 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; wherein the antisense strand and the sense strand are paired as in Table la or Table lb.

6. The double-stranded RNAi agent of claim 3, wherein the antisense strand is as recited in Table la or Table lb and wherein the sense strand is as recited in Table la or Table lb.

7. The double-stranded RNAi agent of claim 3, wherein the antisense strand comprises a nucleobase sequence according to any one of SEQ ID NOs: 5, 6, 7, 19,20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 36, 60, 68, 69, 70, 71, 72, 86, 89, 92, 93, 97, 99, 100, 101, 102, 103, 104, 105, 108, 109, 110, 111, 112, 113, 114, 117, 118, 119, 123, 124, 125, and 127 apart from 5, 4, 3, 2, 1 , or no substitutions, deletions, or insertions; and / or the sense strand comprises a nucleobase sequence according to any one of SEQ ID NOs: 132, 133, 134,146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 163, 187, 195, 196, 197, 198, 199, 213, 216, 219, 220, 224, 226, 227, 228, 229, 230, 231, 232, 235, 236, 237, 238, 239, 240, 241, 244, 245, 246, 250, 251, 252, and 254 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; wherein the antisense strand and the sense strand are paired as in Table la.

8. The double-stranded RNAi agent of claim 3, wherein the double-stranded RNAi agent is capable of inhibiting expression of IFN-pi in a cell.

9. The double-stranded RNAi agent of claim 3 or claim 8, wherein the antisense strand comprises a nucleobase sequence according to any one of SEQ ID NOs: 5, 6, 7, 20,21, 23, 24, 25, 26, 27, 29, 30, 32, 34, 36, 60, 69, 71, 86, 89, 92, 93, 97, 99, 102, 105, 109, 113, 118, 119, 123, 124, 125, and 127 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; and / or the sense strand comprises a nucleobase sequence according to any one of SEQ ID NOs: 132, 133, 134,147, 148, 150, 151, 152, 153, 154, 156, 157, 159, 161, 163, 187, 196, 198, 213, 216, 219, 220, 224, 226, 229, 232,236, 240, 245, 246, 250, 252, and 254 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; wherein the antisense strand and the sense strand are paired as in Table la.

10. The double-stranded RNAi agent of claim 3 or claim 8, whereinthe antisense strand comprises a nucleobase sequence according to any one of SEQ ID NOs: 5, 6, 7, 20, 23, 24, 25, 26, 27, and 29 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; and / or the sense strand comprises a nucleobase sequence according to any one of SEQ ID NOs: 132, 133, 134, 147, 150, 151, 152, 153, 154, and 156 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; wherein the antisense strand and the sense strand are paired as in Table la.

11. The double-stranded RNAi agent of claim 3 or claim 8, wherein the antisense strand comprises a nucleobase sequence according to any one of SEQ ID NOs: 5, 6, 7, 20, 21, 24, 25, and 32 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; and / or the sense strand comprises a nucleobase sequence according to any one of SEQ ID NOs: 132, 133, 134, 147, 148, 151, 152, and 159 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; wherein the antisense strand and the sense strand are paired as in Table la.

12. The double-stranded RNAi agent of claim 3 or claim 8, wherein the antisense strand comprises a nucleobase sequence according to any one of SEQ ID NOs: 5, 6, 7, 20, 25, and 32 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; and / or the sense strand comprises a nucleobase sequence according to any one of SEQ ID NOs: 132, 133, 134, 147, 152, and 159 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; wherein the antisense strand and the sense strand are paired as in Table la.

13. The double-stranded RNAi agent of claim 3 or claim 8, wherein the antisense strand comprises a nucleobase sequence according to any one of SEQ ID NOs: 5, 6, 7, and 20 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; and / or the sense strand comprises a nucleobase sequence according to any one of SEQ ID NOs: 132, 133, 134, and 147 apart from 5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; wherein the antisense strand and the sense strand are paired as in Table la.

14. The double-stranded RNAi agent of any one of claims 3 to 13, wherein: the antisense strand is or comprises any one of SEQ ID NOs: 1-127 apart from 3 2, 1, or no substitutions and the sense strand is or comprises SEQ ID NOs: 128-254 apart from 3 2, 1, or no substitutions; or the antisense strand is as recited in Table la and wherein the sense strand is as recited in Table la.

15. The double-stranded RNAi agent of any one of claims 3 to 14, wherein the antisense stand and / or the sense strand are 15 to 30 nucleobases in length; and / or the antisense strand is 19 to 25, 21 to 24, or 23 nucleobases in length; and / or the sense strand is 17 to 23, 19 to 22, or 21 nucleobases in length; and / or antisense stand and / or the sense strand are 21, 22, or 23 nucleobases in length.

16. The double-stranded RNAi agent of any one of claims 3 to 15, wherein the antisense strand and / or the sense strand comprises a 3’ overhang of at least one or two nucleotides or comprises a 3 ’overhang of 2 nucleotides.

17. The double-stranded RNAi agent of claim 16, wherein the 3' overhang is one or two deoxynucleotides, one or two nucleotides comprising a thymine nucleobase or analogue thereof, or one or two deoxythymidines.

18. The double-stranded RNAi agent of any one of claims 3 to 17, wherein the antisense strand is 23 nucleobases in length and two nucleobases of the antisense strand are a 3’ overhang, and the sense strand is 21 nucleobases in length.

19. The double-stranded RNAi agent of any one of claims 3 to 18, whereinthe antisense strand is 23 nucleobases in length and comprises any one of SEQ ID NOs: 1-127 and a two nucleobase 3’ overhang, and the sense strand is 21 nucleobases in length and is the sequence that is paired with the antisense strand in Table la.

20. The double-stranded RNAi agent of any one of claims 3 to 19, wherein the antisense strand and / or the sense strand comprise at least one 2'-O-methyl nucleotide.

21. The double-stranded RNAi agent of any one of claims 3 to 21, wherein the antisense strand and / or the sense strand comprise at least one 2'-fluoro nucleotide.

22. The double-stranded RNAi agent of claims 3 to 21, wherein: the antisense strand comprises -O-CH3 attached to the 2’ position of the sugar moiety of nucleotides in positions 1, 3, 4, 5, 7, 10, 11, 12, 13, 15, 17, 18, 19, and / or 21; and / or the antisense strand comprises -F attached to the 2’ position of the sugar moiety of nucleotides in positions 2, 6, 8, 9, 14, 16, and / or 20.

23. The double-stranded RNAi agent of claims 3 to 22, wherein: a) the sense strand comprises -O-CH3 attached to the 2’ position of the sugar moiety of nucleotides in positions 1, 2, 3, 4, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and / or 19; and / or the sense strand comprises -F attached to the 2’ position of the sugar moiety of nucleotides in positions 5, 7, 8, and / or 9; or b) the sense strand comprises -O-CH3 attached to the 2’ position of the sugar moiety of nucleotides in positions 1, 2, 3, 4, 5, 9, 11, 12, 13, 14, 15, and / or 16; and / or the sense strand comprises -F attached to the 2’ position of the sugar moiety of nucleotides in positions 6, 7, 8, and / or 10.

24. The double-stranded RNAi agent of claims 3 to 21, wherein the antisense strand comprises -O-CH3 attached to the 2’ position of the sugar moiety of nucleotides in positions 1, 3, 4, 5, 7, 10, 11, 12, 13, 15, 17, 18, 19, 20, and / or 21 ; and / or the sense strand comprises -O-CH3 attached to the 2’ position of the sugar moiety of nucleotides in positions 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, and / or 21.

25. The double-stranded RNAi agent of any one of claims 3 to 21 and 24, wherein the antisense strand comprises -F attached to the 2’ position of the sugar moiety of nucleotides in positions 2, 6, 8, 9, 14, and / or 16; and / or the sense strand comprises -F attached to the 2’ position of the sugar moiety of nucleotides in positions 7, 9, 10, and / or 11.

26. The double-stranded RNAi agent of any one of claims 3 to 25, wherein the antisense strand and / or the sense strand comprise at least one phosphoro thio ate intemucleotide linkage.

27. The double-stranded RNAi agent of any one of claims 3 to 26, wherein the last two linkages at the 5’ end and / or the 3’ end of the antisense strand and / or the sense strand are phosphoro thio ate intemucleotide linkages.

28. The double-stranded RNAi agent of any one of claims 3 to 27, whereinthe antisense strand comprises a nucleobase sequence according to any one of SEQ ID NOs: 1-127 and one or more nucleobase is substituted for a modified nucleobase that is capable of base pairing with the same type of nucleobase; and / or the sense strand comprises a nucleobase sequence according to any one of SEQ ID NOs: 128-254 and one or more nucleobase is substituted for a modified nucleobase that is capable of base pairing with the same type of nucleobase.

29. The double-stranded RNAi agent of any one of claims 3 to 28, wherein the antisense strand comprises any one of SEQ ID NOs: 266-312 apart from5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; or3, 2, 1, or no substitutions; or no substitutions, deletions, or insertions; and / or the sense strand comprises any one of SEQ ID NOs: 313-359 apart from5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; or3, 2, 1, or no substitutions; or no substitutions, deletions, or insertions.

30. The antisense oligomer of claim 1 or claim 2, wherein the antisense oligomer: is suitable for use or suitable for delivery to a patient as a single-stranded molecule; and / or is single stranded.

31. The antisense oligomer of any one of claims 1, 2, or 30, wherein the antisense oligomer is 10-45 nucleobases, 16-25 nucleobases, 18-22 nucleobases, or 20 nucleobases in length.

32. The antisense oligomer of any one of claims 1, 2, 30, or 31, wherein the antisense oligomer comprises at least one 2’-O-methoxyethyl nucleotide.

33. The antisense oligomer of any one of claims 1, 2, or 30 to 32, wherein the antisense oligomer comprises - O-CH2-CH2-O-CH3 attached to the 2’ position of the sugar moiety of nucleotides in positions 1, 2, 3, 4, 5, 16, 17, 18, 19, and / or 20.

34. The antisense oligomer of any one of claims 1, 2, or 30 to 33, wherein the antisense oligomer comprises at least one deoxynucleotide.

35. The antisense oligomer of any one of claims 1, 2, or 30 to 34, wherein the 2’ position of the sugar moiety of nucleotides in positions 6, 7, 8, 9, 10, 11, 12, 13, 14, and / or 15 is -H2.

36. The antisense oligomer of any one of claims 1, 2, or 30 to 35, wherein the antisense oligomer comprises at least one phosphoro thio ate intemucleotide linkage.

37. The antisense oligomer of any one of claims 1, 2, or 30 to 36, wherein all intemucleotide linkages in the antisense oligomer are phosphoro thio ate intemucleotide linkages.

38. The antisense oligomer of any one of claims 1, 2, or 30 to 37, wherein the antisense oligomer is a gapmer.

39. The antisense oligomer of any one of claims 1, 2, or 30 to 38, wherein the first five residues from the 5’ end and the last five residues at the 3’ end are residues of 2 ’-MOE, 2’- OMe, LNA, or 2’-F RNA nucleotides; the RNA residues flank a DNA region; and one, more than one, or all cytosines within the DNA region are 5-methylcytosine.

40. The antisense oligomer of any one of claims 1, 2, or 27 to 39, wherein the antisense oligomer is or comprises a nucleobase sequence of any one of SEQ ID NOs: 378-444 apart from5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; or3, 2, 1, or no substitutions; or no substitutions, deletions, or insertions.

41. The antisense oligomer of any one of claims 1, 2, or 27 to 40, wherein the antisense oligomer is or comprises any one of SEQ ID NOs: 445-511 apart from5, 4, 3, 2, 1, or no substitutions, deletions, or insertions; or3, 2, 1, or no substitutions; or no substitutions, deletions, or insertions.

42. The antisense oligomer of any one of any preceding claim, wherein the antisense oligomer is complementary to 5, 10, 15, 16, 17, 18, 19, 20, or all bases to which an antisense oligomer according to any one of SEQ ID NOs: 1-127, 264, and 378-444 is complementary.

43. The antisense oligomer of any one of any preceding claim, wherein the antisense oligomer is perfectly complementary, not including any overhangs, to a region of IFN-pi mRNA of a subject to be treated.

44. One or more nucleic acid vectors encoding a double-stranded RNAi agent of any one of claims 3 to 19.

45. A pharmaceutical composition comprising the antisense oligomer or double-stranded RNAi agent of any one of claims 1 to 43 or the one or more vectors of claim 44.

46. An antisense oligomer, double-stranded RNAi agent, one or more vectors, or pharmaceutical composition of any one of claims 1 to 45 for use as a medicament.

47. An antisense oligomer, double-stranded RNAi agent, one or more vectors, or pharmaceutical composition of any one of claims 1 to 45 for use as an anti-inflammatory medicament.

48. An antisense oligomer, double-stranded RNAi agent, one or more vectors, or pharmaceutical composition of any one of claims 1 to 45 for use in a method of treating an interferonopathy, an autoimmune condition, an autoinflammatory disease, and / or a disease with a component that is IFN-pi mediated.

49. An antisense oligomer, double-stranded RNAi agent, one or more vectors, or pharmaceutical composition of any one of claims 1 to 45 for use in a method of treating a disease with an elevated type I IFN signature.

50. An antisense oligomer, double-stranded RNAi agent, one or more vectors, or pharmaceutical composition of any one of claims 1 to 45 for use in a method of treating myositis.

51. The antisense oligomer, double-stranded RNAi agent, one or more vectors, or pharmaceutical composition for use of any one of claims 46 to 50, wherein the patient has adult or juvenile dermatomyositis.

52. The antisense oligomer, double-stranded RNAi agent, one or more vectors, or pharmaceutical composition for use of any one of claims 46 to 49, wherein the patient has SA VI, systemic lupus erythematosus (SLE), psoriasis, or Sjogren’s syndrome.

53. An antisense oligomer, double-stranded RNAi agent, one or more vectors, or pharmaceutical composition of any one of claims 1 to 45 for use in a method of treatment in combination with a therapeutic agent,wherein the antisense oligomer, double-stranded RNAi agent, or pharmaceutical composition reduces host immune responses directed to the therapeutic agent.

54. An antisense oligomer capable of inhibiting expression of interferon pi (IFN- i) in a cell, or a nucleic acid vector encoding said antisense oligomer, for use as a medicament.

55. An antisense oligomer capable of inhibiting expression of IFN- i in a cell, or a nucleic acid vector encoding said antisense oligomer, for use in a method of treating an interferonopathy, an autoimmune condition, an autoinflammatory disease, myositis, and / or a disease with a component that is IFN- i mediated; optionally wherein the disease is associated with an elevated type I IFN signature.

56. An antisense oligomer capable of inhibiting expression of IFN- i in a cell, or a nucleic acid vector encoding said antisense oligomer, for use in a method of treating adult or juvenile dermatomyositis.

57. An antisense oligomer capable of inhibiting expression of IFN- i in a cell, or a nucleic acid vector encoding said antisense oligomer, for use in a method of treatment in combination with a therapeutic agent, wherein the antisense oligomer, double-stranded RNAi agent, or pharmaceutical composition reduces host immune responses directed to the therapeutic agent.

58. The antisense oligomer or nucleic acid vector for use according to any one of claims 54 to 57, wherein the antisense oligomer is capable of hybridising to mRNA transcribed from the Homo sapiens interferon beta 1 gene, optionally wherein the mRNA is according to SEQ ID NO: 263.

59. The antisense oligomer or nucleic acid vector for use according to any one of claims 54 to 58, wherein: a) the antisense oligomer is suitable for use or suitable for delivery to a patient as a single-stranded molecule and / or is single stranded; or b) the antisense oligomer is one strand of a double-stranded RNAi agent further comprising a sense strand, wherein the sense stand and the antisense oligomer are, at least in part or completely, complementary.

60. The antisense oligomer or nucleic acid vector for use according to any one of claims 54 to 59, wherein the antisense oligomer or nucleic acid vector is present as an or as part of an antisense oligomer, double-stranded RNAi agent, one or more vectors, or pharmaceutical composition of any one of claims 1 to 45.