Guide RNAS for editing serpina1, and compositions and methods relating thereto

Abstract

The present disclosure provides gRNAs for editing SERPINA1 and combinations of such gRNAs, nucleic acids encoding such gRNAs, vectors comprising such nucleic acids, RNPs comprising such gRNAs and endonucleases, pharmaceutical compositions comprising any of the foregoing, and kits comprising any of the foregoing. The present disclosure further provides methods related to such gRNAs, including methods of manufacturing, methods of effecting SERPINA1 gene editing, and methods of preventing, treating, or ameliorating a symptom of a target disease, disorder, or condition such as A1ATD.

Description

GUIDE RNAS FOR EDITING SERPINA1, AND COMPOSITIONS AND METHODS RELATING THERETO CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to: U.S. Provisional Application No.63 / 678,331, filed on August 1, 2024, entitled “GUIDE RNAS FOR EDITING SERPINA1, AND COMPOSITIONS AND METHODS RELATING THERETO”, the disclosure of which is hereby incorporated by reference in their entirety. REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (2957415_002613_SL.xml; Size: 241,685 bytes; and Date of Creation: July 22, 2025) is herein incorporated by reference in its entirety. FIELD OF THE INVENTION

[0003] The present disclosure relates to gene editing or nucleic acid editing. For example, the present disclosure relates to editing of SERPINA1, and compositions and methods relating thereto. BACKGROUND OF THE INVENTION

[0004] The SERPINA1 gene encodes the alpha-1 antitrypsin (A1AT) protein, a serine protease inhibitor belonging to the serpin superfamily whose targets include elastase, plasmin, thrombin, trypsin, chymotrypsin, and plasminogen activator. A1AT is primarily produced in the liver but also in the bone marrow, by lymphocytic and monocytic cells in lymphoid tissue, and by the Paneth cells of the gut. A1AT circulates through the blood and protects the lungs and liver from inflammation and damage by inhibiting enzymes such as the neutrophil elastase.

[0005] Over 200 SERPINA1 variants have been identified to date, many of which cause the quantitative and / or qualitative changes in A1AT responsible for A1AT deficiency (A1ATD)-associated lung and liver diseases and conditions, including emphysema, chronic obstructive pulmonary disease (COPD), neonatal cholestasis, cirrhosis, and an increased risk of hepatocellular carcinoma. The “Z allele”, which has the c.1096G>A mutation (G-to-A mutation at nucleotide 1096 in exon 5 of SERPINA1 coding strand; rs28929474) to cause Glu366Lys (commonly referred to as E366K and also annotated as Glu342Lys or E342K) in A1AT, is most commonly associated with severe A1ATD, and individuals who are homozygous for the Z allele (“PI*ZZ”) have a high risk of such lung and lover diseases.

[0006] Currently, therapeutic options for A1ATD are limited and are mainly for managing symptoms and complications. For treating A1ATD-associated lung diseases, patients may receive inhaled medications (e.g., corticosteroids and bronchodilators), antibiotics, pulmonary rehabilitation, and / oroxygen therapy, and in severe cases lung transplant. Augmentation therapy (weekly infusion of A1AT) slows but does not reverse disease progression and is a life-long treatment. Patients with A1ATD- associated liver diseases may receive symptomatic care routine for chronic liver diseases, but in severe cases liver transplant is the only option. There is a need for more effective and efficient therapies. SUMMARY OF THE INVENTION

[0007] The present disclosure relates to editing of SERPINA1. The present disclosure provides, among others, gRNAs, polynucleotides, vectors, compositions, and methods related to such gene editing.

[0008] In one aspect, the present disclosure provides guide RNAs (gRNAs). The gRNAs may be for editing SERPINA1 via a programmable endonuclease, nickase, or a derivative thereof, such as but not limited to a Cas protein (e.g., Cas nuclease or Cas nickase). SERPINA1 to be edited may include a SERPINA1 rs28929474(A) allele. gRNAs according to the present disclosure may comprise at least one CRISPR RNA (crRNA) comprising a spacer region which may be at least 17 nucleotides in length. In some cases, the spacer region may be 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 nucleotides in length. In certain cases, the spacer region may be 19 or 20 nucleotides in length. In certain cases, the spacer region may be or 21 or 22 nucleotides in length.

[0009] In some embodiments, the spacer region may comprise or consist of: (a) the polynucleotide of SEQ ID NO: 3, 2, 4, 16, 21, 1, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, or 22.

[0010] In some embodiments, the spacer region may comprise or consist of: (b) a polynucleotide comprising one or more (optionally one, two, or three) mutations (e.g., one or more substitutions, or one or more deletions or additions at the 5’-end) relative to the polynucleotide of SEQ ID NO: 3, 2, 4, 16, 21, 1, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 20, or 22.

[0011] In certain embodiments, said mutations may be at any nucleotide position(s) other than the 4th to the 7th nucleotide positions from the 3’-end of the polynucleotide of SEQ ID NO: 3, 2, 4, 16, 21, 1, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, or 22, respectively. In certain embodiments, said mutations may be at any nucleotide position(s) other than the 1st to the 12th nucleotide positions from the 3’-end of the polynucleotide of SEQ ID NO: 3, 2, 4, 16, 21, 1, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, or 22, respectively.

[0012] In some embodiments, the spacer region may comprise or consist of: (c) a polynucleotide comprising at least the 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides from the 3’-end of SEQ ID NO: 3, 2, or 4.

[0013] In certain embodiments, the spacer region may hybridize with or the spacer region may be fully complementary to (or essentially complementary to, except for one, two, three, or four mismatches) the target sequence or the polynucleotide chain or molecule (e.g., SEQ ID NO: 103, 102, 104, 116, 121, 101, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 117, 118, 119, 120, or 122).In certain embodiments, the spacer region may hybridize with or the spacer region may be fully complementary to (or essentially complementary to, except for one, two, three, or four mismatches) a target polynucleotide complementary to a 17-30 nucleotide span adjacent to (e.g., immediately upstream of) any of the PAMs underlined (solid) in FIG.1A).

[0014] In some embodiments, the polynucleotide sequence of the spacer region may comprise or consists of SEQ ID NO: 202, 201, or 203.

[0015] In some embodiments, the spacer region may comprise or consists of a polynucleotide comprising one or more (optionally one, two, or three) mutations (e.g., one or more substitutions, deletions, or additions at the 5’-end) relative to the polynucleotide of SEQ ID NO: 202, 201, or 203, said mutations optionally at any nucleotide position(s) other than the 5th, optionally other than the 1st to 7th, such as the 9th, 20th, and / or 21st nucleotide position from the 3’-end of the polynucleotide of SEQ ID NO: 202, 201, or 203, respectively.

[0016] In some embodiments, the spacer region may comprise a polynucleotide comprising at least the 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides from the 5’-end of SEQ ID NO: 201.

[0017] In some embodiments, the spacer region may be capable of specifically or selectively hybridizing with a target polynucleotide chain or molecule (e.g., SEQ ID NO: 302, 301, or 303). In certain embodiments, the spacer region may hybridize with or the spacer region may be fully complementary to (or essentially complementary to, except for one, two, three, or four mismatches) a target polynucleotide complementary to a 17-30 nucleotide span adjacent to (e.g., immediately downstream of) any of the PAM nucleotides underlined (dotted) in FIG.1A.

[0018] In certain embodiments, the seed region (e.g., the 1st to the 12th nucleotides counting from the 3’-end of the spacer region when Cas9 is used, or approximately the 1st to the 7th nucleotides counting from the 5’-end of the spacer region when Cas12a is used) may be fully complementary to the target sequence, and the non-seed region (e.g., the 13th nucleotide counting from the 3’-end of the spacer region to the 5’-end of the spacer region when Cas9 is used, or approximately the 14 nucleotides counting from the 3’-end of the spacer region when Cas12a is used) may have one or more (e.g., one, two, or three) mismatches relative to the target or the target sequence. In particular embodiments, the one or more mismatches may be at the 19th and / or 20th nucleotide(s) counting from the 3’-end of the spacer region, e.g., when Cas9 is used. In particular embodiments, the one or more mismatches may be at the 9th, 10th, 11th, 18th, 19th, 20th, and / or 21st nucleotide(s) counting from the 5’-end of the spacer region, e.g., when Cas12a is used.

[0019] In particular embodiments, the seed region (e.g., the 1st to the 12th nucleotides counting from the 3’-end of the spacer region when Cas9 is used, or approximately the 1st to the 7th nucleotides counting from the 5’-end of the spacer region when Cas12a is used) may be fully complementary to the target sequence containing rs28929474(A) (i.e., target sequence containing at position 94,378,610 (on Assembly GRCh38.p14) an A (adenine) if the target sequence is in the coding strand, and a T (thymine) if the target sequence is in the non-coding strand) but have one mismatch to thecorresponding sequence span of the rs28929474(G) allele (i.e., the span containing at position 94,378,610 (on Assembly GRCh38) a G (guanine) if the target sequence is in the coding strand, and a C (cytosine) if the target sequence is in the non-coding strand), and the non-seed region (e.g., the 13th nucleotide counting from the 3’-end of the spacer region to the 5’-end of the spacer region when Cas9 is used, or approximately the 14 nucleotides counting from the 3’-end of the spacer region when Cas12a is used) may have one or more (e.g., one, two, or three) but the same number of mismatches relative to the target sequence of the rs28929474(A) allele and the corresponding sequence span of the rs28929474(G) allele. In particular embodiments, the one or more mismatches may be at the 19th and / or 20th nucleotide(s) counting from the 3’-end of the spacer region, e.g., when Cas9 is used. In particular embodiments, the one or more mismatches may be at the 9th, 19th, 20th, and / or 21st nucleotide(s) counting from the 5’-end of the spacer region, e.g., when Cas12a is used. Without wishing to be bound by theory, one or two mismatches especially in the non-seed region may tend to be tolerated (hybridization with the target may not be lost) if there is no mismatch in the seed region, while having a second mismatch on top of a mismatch in the seed region, even if the second mismatch is in the non-seed region, may dramatically reduce or abrogate hybridization, and therefore such a gRNA having a seed region fully complementary to the target sequence containing rs28929474(A) but have a mismatch relative to the corresponding sequence of the rs28929474(G) allele and a non-seed region having one or two mismatches may have enhanced selectivity to the rs28929474(A) allele over the rs28929474(G) allele.

[0020] In some cases, the polynucleotide sequence of the spacer region may comprise or consist of SEQ ID NO: 3, 2, 4, 16, or 21.

[0021] In some cases, the spacer region may comprise or consist of the polynucleotide of X1X2CTGACCATCGACAAGAAA (SEQ ID NO: 53) (X1 is any of A, T, C, or G, optionally A, C, or G; and X2 is any of A, T, C, or G, optionally A, T, or C). In certain cases, X1 may be A, C, or G. In certain cases, X2 may be A, T, or C. In particular cases, the spacer region may have one mismatch relative to the target or the target sequence, which may be at X1 or X2.

[0022] In some cases, the polynucleotide sequence of the spacer region may comprise or consist of the polynucleotide sequence of X1X2GCTGACCATCGACAAGAA (SEQ ID NO: 52) (X1 is any of A, T, C, or G, optionally A, T, or C; and X2 is any of A, T, C, or G, optionally A, C, or G). In certain cases, X1 may be A, T, or C. In certain cases, X2 may be A, C, or G. In particular cases, the spacer region may have one mismatch relative to the target or the target sequence, which may be at X1 or X2.

[0023] In some cases, the polynucleotide sequence of the spacer region may comprise or consist of the polynucleotide sequence of X1X2CAGTCCCTTTCTTGTCGA (SEQ ID NO: 54) (X1 is any of A, T, C, or G, optionally A, C, or G); and X2 is any of A, T, C, or G, optionally A, C, or G). In certain cases, X1 may be A, C, or G. In certain cases, X2 may be A, C, or G. In particular cases, the spacerregion may have one mismatch relative to the target or the target sequence, which may be at X1 or X2.

[0024] In some cases, the polynucleotide sequence of the spacer region may comprise or consist of SEQ ID NO: 202.

[0025] In some cases, the spacer region may comprise or consist of the polynucleotide sequence of TTGTCGATGGTCAGCACAX1X2X3(SEQ ID NO: 251) (X1is any of A, T, C, or G, optionally A, T, or C; X2is any of A, T, C, or G, optionally A, T, or G; and X3is any of A, T, C, or G, optionally A, T, or G).

[0026] In some embodiments, the isolated gRNA may be capable of specifically or selectively hybridizing with a target polynucleotide chain or molecule comprising SEQ ID NO: 103, 102, 104, 116, 121, 101, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 117, 118, 119, 120, or 122 and / or a target polynucleotide complementary to a 17-30 nucleotide span adjacent to (e.g., immediately upstream of) any of the PAMs underlined (solid) in FIG.1A.

[0027] In particular embodiments, the spacer region may comprise the polynucleotide sequence of SEQ ID NO: 3, 2, 4, 16, 21, X1X2CTGACCATCGACAAGAAA (SEQ ID NO: 53) (X1 is any of A, T, C, or G, optionally A, C, or G; and X2 is any of A, T, C, or G, optionally A, T, or C); X1X2GCTGACCATCGACAAGAA (SEQ ID NO: 52) (X1 is any of A, T, C, or G, optionally A, T, or C; and X2 is any of A, T, C, or G, optionally A, C, or G); or X1X2CAGTCCCTTTCTTGTCGA (SEQ ID NO: 54) (X1 is any of A, T, C, or G, optionally A, C, or G; and X2 is any of A, T, C, or G, optionally A, C, or G).

[0028] In some embodiments, the isolated gRNA may be capable of specifically or selectively hybridizing with a target polynucleotide chain or molecule comprising SEQ ID NO: 301, 302, or 303 and / or a target polynucleotide complementary to a 17-30 nucleotide span adjacent to (e.g., immediately downstream of) any of the PAMs underlined (dotted) in FIG.1A.

[0029] In particular cases, the polynucleotide sequence of the spacer region may comprise or consist of SEQ ID NO: 202 or the spacer region may comprise or consist of the polynucleotide of TTGTCGATGGTCAGCACAX1X2X3(SEQ ID NO: 251) (X1is any of A, T, C, or G, optionally A, T, or C; X2is any of A, T, C, or G, optionally A, T, or G; and X3is any of A, T, C, or G, optionally A, T, or G).

[0030] In some embodiments, the isolated gRNA may be (a) a single guide RNA (sgRNA) comprising (i) a crRNA comprising the spacer region and a crRNA backbone and (ii) a trans- activating CRISPR RNA (tracrRNA) in a single strand. In certain embodiments, the crRNA and the tracrRNA may be linked via a linker optionally comprising 5’-GAA-3’. In certain embodiments, the gRNA may comprise the spacer region followed by a sgRNA backbone comprising any of SEQ ID NOS: 85-88. In certain embodiments, the sgRNA backbone may be followed by one or more uracils, further optionally 1-10 uracils.

[0031] In some embodiments, the isolated gRNA may be (b) a duplex guide RNA (dgRNA) (i.e., a duplex of two RNA fragments forming a gRNA) formed by hybridization between (i) a crRNA comprising the spacer region and a crRNA backbone and (ii) a tracrRNA. In certain embodiments, the crRNA backbone and the tracrRNA may comprise SEQ ID NOS: 89 and 90, respectively, or SEQ ID NOS: 91 and 92, respectively.

[0032] In some embodiments, the isolated gRNA may comprise a crRNA comprising (a) the spacer region and (b) a repeat region, optionally wherein the repeat region is at the 5’-end of the spacer region, the repeat region comprising (b-1) an optional 5’-end nucleotide, optionally comprising UAAUU or AAUU, (b-2) a first stem nucleotide, optionally comprising UCUAC, (b-3) a loop nucleotide, optionally comprising UCUU, UAAGU, UGUU, UUUU, UAUU, UGUUU, UUCG, or UUU, (b-4) a second stem nucleotide which is reverse complementary to the first stem nucleotide, optionally comprising GUAGA, and (b-5) an optional 3’-end nucleotide, optionally comprising U, further optionally wherein the repeat nucleotide comprises any one of SEQ ID NOS: 191-196.

[0033] In some embodiments, the isolated gRNA may be synthetic or recombinant.

[0034] In certain embodiments, the isolated gRNA may be a synthetic sgRNA comprising at least one chemical modification. In particular embodiments, the at least one chemical modification may comprise 2'-O-methylation further optionally at the first three and last three bases and / or one or more 3’ phosphorothioate bonds, optionally between the first three and last two bases.

[0035] In some embodiments, the programmable endonuclease, nickase, or derivative thereof may be or may comprise (a) a Cas endonuclease, optionally a Cas9 endonuclease, optionally comprising any one of SEQ ID NOS: 140-151, optionally SEQ ID NO: 140, or a variant thereof.

[0036] In some embodiments, the programmable endonuclease, nickase, or derivative thereof may be or may comprise (a) a Cas endonuclease, optionally a Cas12a endonuclease, optionally comprising any one of SEQ ID NOS: 210-215, 220-221, and 222-225, optionally SEQ ID NO: 210, or a variant thereof.

[0037] In some embodiments, the programmable endonuclease, nickase, or derivative thereof may be or may comprise (b) a Cas nickase, optionally a Cas9 nickase.

[0038] In certain embodiments, the Cas9 nickase may comprise the substitution D10A relative to a wildtype Cas9 (e.g., wildtype SpCas9 or SaCas9).

[0039] In certain embodiments, the Cas9 nickase may comprise one or more of the substitutions D839A, H840A, N854A, and N863A, relative to a wildtype Cas9 (e.g., wildtype SpCas9 or SaCas9).

[0040] In some cases, a Cas9 nickase may further comprise one or more of the substitutions L1111R, D1135V or D1135E, G1218R, E1219F, A1322R, R1335Q or R1335E, T1337R.

[0041] In some cases, a Cas9 nickase may be a circular permutation variant of any of the nickases disclosed herein.

[0042] In particular cases, the Cas9 nickase may comprise any one of SEQ ID NO: 158-169, optionally SEQ ID NO: 160, or a variant thereof.

[0043] In some embodiments, the programmable endonuclease, nickase, or derivative thereof may be, may comprise, or may be derived from: a Class 2 Cas protein and / or a type II Cas protein, such as Cas9, optionally Streptococcus pyogenes (SpCas9), Staphylococcus aureus Cas9 (SaCas9), Streptococcus thermophilus (StCas9), Neisseria meningitidis (NmCas9), Francisella novicida (FnCas9), Campylobacter jejuni (CjCas9), Streptococcus canis (ScCas9), Staphylococcus auricularis (SauriCas9), or any engineered variants thereof, optionally SaCas9-HF, SpCas9-HF1, KKHSaCas9, eSpCas9, HypaCas9, FokI-Fused dCas9, xCas9, SpRY (variant of SpCas9), or SpG (variant of SpCas9).

[0044] In some embodiments, the programmable endonuclease, nickase, or derivative thereof may be, may comprise, or may be derived from: a Class 2 Cas protein and / or a type V Cas protein, such as Cas12a, optionally Cas12a of Acidaminococcus sp. (AsCas12a), Lachnospiraceae bacterium (LbCas12a), Francisella novicida (FnCas12a), Moraxella bovoculi (MbCas12a), Coprococcus eutactus (CeCas12a), Butyrivibrio fibrisolvens (BfCas12a), Eubacterium rectale (ErCas12a), or any engineered variants thereof, optionally AsCas12a Ultra, enAsCas12a, enAsCas12a-Hifi, enAsCas12a Ultra, enAsCas12a-Hifi Ultra, or LbCas12a Ultra, or MAD7.

[0045] Any of the gRNAs disclosed herein may be used in combination or alone (i.e., without another gRNA). Therefore, in one aspect, the present disclosure also provides combinations of isolated gRNAs and compositions comprising such gRNA combinations.

[0046] In some embodiments, such a composition may comprise any one or more of the isolated gRNAs disclosed above or herein. In certain embodiments, a gRNA disclosed herein may be combined with another gRNA. In certain embodiments, two or more gRNAs disclosed herein may be combined. In certain embodiments, when a composition comprises two gRNAs, the two gRNAs may be capable of hybridizing with the opposite strands (one gRNA with the coding strand and the other gRNA with the non-coding strand) of SERPINA1. In certain embodiments, when a composition comprises two gRNAs, the two gRNAs may be capable of hybridizing with the same strand (both gRNAs with the coding strand, or both gRNAs with the non-coding strand) of SERPINA1.

[0047] In one aspect, the present disclosure provides polynucleotides encoding any of the one or more isolated gRNAs disclosed herein. In some embodiments, the polynucleotide may be a DNA. In some embodiments, the polynucleotide may be an RNA.

[0048] In one aspect, the present disclosure provides vectors comprising a polynucleotide or polynucleotides encoding any of the one or more isolated gRNAs disclosed herein. The polynucleotide or polynucleotides may be operably linked to one or more regulatory sequences. The vector may be any substance, compounds, or compositions which may carry a polynucleotide.

[0049] In some embodiments, the vectors may be selected from: compounds, such as calcium phosphate, polycations, cationic lipids, phospholipids, organic and nonorganic polymers, dendrimers, organic and nonorganic nanoparticles and nanobeads, and any combinations thereof; lipid-based compositions capable of carrying a nucleic acid molecule, such as liposomes and lipid nanoparticles(LNPs); plasmids; virus-like particles (VLPs); and viral vectors, such as retroviral, lentiviral, and adenoviral vectors.

[0050] In one aspect, the present disclosure also provides ribonucleoproteins (RNPs). An RNP according to the present disclosure may comprise: (a) any of the isolated gRNAs disclosed herein complexed with (b) a programmable endonuclease, nickase, or derivative thereof. The programmable endonuclease, nickase, or derivative thereof may comprise of those disclosed herein.

[0051] In some embodiments, the programmable endonuclease, nickase, or derivative thereof may be a Cas nuclease. In certain embodiments, the programmable endonuclease, nickase, or derivative thereof may be a Cas9 nuclease. In certain embodiments, the programmable endonuclease, nickase, or derivative thereof may be a Cas12a nuclease.

[0052] In some embodiments, the programmable endonuclease, nickase, or derivative thereof may be a Cas nickase. In certain embodiments, the programmable endonuclease, nickase, or derivative thereof may be a Cas9 nickase. In particular embodiments, the programmable endonuclease, nickase, or derivative thereof may be a Cas9 D10A nickase.

[0053] In one aspect, the present disclosure further provide isolated oligodeoxynucleotides (ODNs) and polynucleotides encoding ODNs.

[0054] In some embodiments, the ODN may comprise a coding, single-stranded ODN (ODN) comprising or consisting of a 5’-homology arm, G (guanine), and a 3’ homology arm in the direction from the 5’-end to the 3’-end.

[0055] In certain embodiments, the 5’-homology arm may be at least 10, about 10-100, about 15-90, about 20-80, about 30-70, about 40-60, or about 60 nucleotides in length. In certain embodiments, the 5’-homology arm may comprise a polynucleotide corresponding to the first to at least the 10th, at least about 20th, at least about 25th, at least about 30th, at least about 35th, at least about 40th, at least about 45th, at least about 50th, at least about 55th, or about 60th nucleotides counting from the 3’-end of SEQ ID NO: 183. In certain embodiments, the 5’-homology arm may comprise one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) mutations relative to said polynucleotide.

[0056] In certain embodiments, the 3’-homology arm may be at least 10, about 10-100, about 15-90, about 20-80, about 30-70, about 40-60, or about 60 nucleotides in length. In certain embodiments, the 3’-homology arm may comprise a polynucleotide corresponding to the first to at least the 10th, at least about 20th, at least about 25th, at least about 30th, at least about 35th, at least about 40th, at least about 45th, at least about 50th, at least about 55th, or about 60th nucleotides counting from the 5’-end of SEQ ID NO: 184. In certain embodiments, the 3’-homology arm may comprise one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) mutations relative to said polynucleotide, wherein the first based of the 3’-homology arm may be A (adenine) and the second base of the 3’-homology arm may be A (adenine) or G (guanine).

[0057] In some embodiments, the ODN may comprise a non-coding ssODN which may be a reverse complement of the coding ODN disclosed above or herein.

[0058] In some embodiments, the ODN may comprise a double-stranded ODN (dsODN) comprising a coding strand comprising or consisting of a 5’-homology arm, G (guanine), and a 3’ homology arm according to as described above or herein and a non-coding strand which may be a reverse complement of the coding strand.

[0059] In some embodiments, the ODN may be about 20-200, about 30-180, about 40-160, about 60- 140, about 80-120, about 120 or 121 nucleotides in length.

[0060] In some embodiments, a coding ssODN or the coding strand of a dsODN may have at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 181.

[0061] In some embodiments, a non-coding ssODN or the non-coding strand of a dsODN may have at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 182.

[0062] In certain embodiments, when the 5’-homology arm comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) mutations relative to the polynucleotide corresponding to the first to at least the 10th, at least about 20th, at least about 25th, at least about 30th, at least about 35th, at least about 40th, at least about 45th, at least about 50th, at least about 55th, or about 60th nucleotides counting from the 3’-end of SEQ ID NO: 183, at least one of the one or more mutations may be a silent mutation and / or a PAM-altering mutation (e.g., a 5’-NGG-3’ or 5’-TTTN-3’ PAM-altering mutation).

[0063] In some cases, the 5’-homology arm may comprise a polynucleotide corresponding to the first to at least the 10th, at least about 20th, at least about 25th, at least about 30th, at least about 35th, at least about 40th, at least about 45th, at least about 50th, at least about 55th, or about 60th nucleotides counting from the 3’-end of SEQ ID NO: 173 (X1, X2, X3, X4, X5, X6, X7, and X8 are individually any of A, T, C, or G; X9 is A or G; and X10 is any of A, T, C, or G), or may comprise one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) mutations relative to said polynucleotide.

[0064] In some cases, the 5’-homology arm may comprise a polynucleotide corresponding to the first to at least the 10th, at least about 20th, at least about 25th, at least about 30th, at least about 35th, at least about 40th, at least about 45th, at least about 50th, at least about 55th, or about 60th nucleotides counting from the 3’-end of SEQ ID NO: 273, or may comprise one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) mutations relative to said polynucleotide.

[0065] In some cases, the 5’-homology arm may comprise a polynucleotide corresponding to the first to at least the 10th, at least about 20th, at least about 25th, at least about 30th, at least about 35th, at least about 40th, at least about 45th, at least about 50th, at least about 55th, or about 60th nucleotides counting from the 3’-end of SEQ ID NO: 283 (X1, X2, X3, X4, X5, X6, X7, and X8 = individually any of A, T, C, or G; X9 = A or G; X10 = individually any of A, T, C, or G), or comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) mutations relative to said polynucleotide.

[0066] In certain embodiments, when the 3’-homology arm comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) mutations relative to the polynucleotide corresponding to the first to at least the 10th, at least about 20th, at least about 25th, at least about 30th, at least about 35th, at least about 40th, at least about 45th, at least about 50th, at least about 55th, or about 60th nucleotides counting from the 5’-end of SEQ ID NO: 184, at least one of the one or more mutations may be a silent mutation and / or a PAM-altering mutation (e.g., a 5’-NGG-3’ or 5’-TTTN-3’ PAM-altering mutation).

[0067] In some cases, the 3’-homology arm may comprise a polynucleotide corresponding to the first to at least the 10th, at least about 20th, at least about 25th, at least about 30th, at least about 35th, at least about 40th, at least about 45th, at least about 50th, at least about 55th, or about 60th nucleotides counting from the 5’-end of SEQ ID NO: 174 (X11, X12, and X13 are individually any of A, T, C, or G; X14 is A or G; X15 and X16 are individually any of A, T, C, or G; X17 is any of A, T, or C; and X18 is any of A, T, C, or G), or may comprise one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) mutations relative to said polynucleotide.

[0068] In some cases, the 3’-homology arm may comprise a polynucleotide corresponding to the first to at least the 10th, at least about 20th, at least about 25th, at least about 30th, at least about 35th, at least about 40th, at least about 45th, at least about 50th, at least about 55th, or about 60th nucleotides counting from the 5’-end of SEQ ID NO: 274 (X1 is G or A; and X2 is C or T), or comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) mutations relative to said polynucleotide.

[0069] In some cases, the 3’-homology arm may comprise a polynucleotide corresponding to the first to at least the 10th, at least about 20th, at least about 25th, at least about 30th, at least about 35th, at least about 40th, at least about 45th, at least about 50th, at least about 55th, or about 60th nucleotides counting from the 5’-end of SEQ ID NO: 284 (X1 is G or A; X2, X3, and X4 are individually any of A, T, C, or G; X5 is C or T; X6 is A or G; X7 and X8 are individually any of A, T, C, or G; X9 is any of A, T, or C; X10 is any of A, T, C, or G), or comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) mutations relative to said polynucleotide.

[0070] In some embodiments, a coding ssODN or the coding strand of a dsODN may have at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 171, 181, 271, 281, or 61.

[0071] In some embodiments, a non-coding ssODN or the non-coding strand of a dsODN may have at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 172, 182, 272, 282, or 62.

[0072] In another aspect, the present disclosure provides compositions.

[0073] In some embodiments, a composition according to the present disclosure may comprise (i) an RNP which comprises (a) any of the isolated gRNAs disclosed above or herein complexed with (b) aprogrammable endonuclease, nickase, or derivative thereof. Such a composition may optionally further comprise a pharmaceutically acceptable carrier and / or excipient.

[0074] In some embodiments, a composition according to the present disclosure may comprise (a) any of the isolated gRNAs disclosed above or herein or a polynucleotide encoding said gRNA; and (b) a programmable endonuclease, nickase, or derivative thereof, or a polynucleotide encoding said programmable endonuclease, nickase, or derivative thereof. Such a composition may optionally further comprise a pharmaceutically acceptable carrier and / or excipient.

[0075] In certain embodiments, (a) the spacer region may comprise the polynucleotide of SEQ ID NO: 3, 2, 4, X1X2CTGACCATCGACAAGAAA (SEQ ID NO: 53) (X1 is any of A, T, C, or G, optionally A, C, or G; and X2 is any of A, T, C, or G, optionally A, T, or C), X1X2GCTGACCATCGACAAGAA (SEQ ID NO: 52) (X1 is any of A, T, C, or G, optionally A, T, or C; and X2 is any of A, T, C, or G, optionally A, C, or G), or X1X2CAGTCCCTTTCTTGTCGA (SEQ ID NO: 54) (X1 is any of A, T, C, or G, optionally A, C, or G; and X2 is any of A, T, C, or G, optionally A, C, or G) and / or specifically or selectively binds to a SERPINA1 rs28929474(A) allele, optionally over a SERPINA1 rs28929474(G) allele; and / or (b) the programmable endonuclease, nickase, or derivative thereof may be a nuclease which recognizes 5-NGG-3’, optionally a Cas9 nuclease or a derivative thereof, further optionally a Cas9 nuclease comprising SEQ ID NO: 160.

[0076] In some embodiments, (a) the spacer region may comprise the polynucleotide of SEQ ID NO: 202 or TTGTCGATGGTCAGCACAX1X2X3(SEQ ID NO: 251) (X1is any of A, T, C, or G, optionally A, T, or C; X2is any of A, T, C, or G, optionally A, T, or G; and X3is any of A, T, C, or G, optionally A, T, or G); and / or specifically or selectively binds to a SERPINA1 rs28929474(A) allele, optionally over a SERPINA1 rs28929474(G) allele; and / or (b) the programmable endonuclease, nickase, or derivative thereof is a nuclease which recognizes 5-TTTN-3’, optionally a Cas12a nuclease or a derivative thereof, further optionally a Cas12a nuclease comprising any one of SEQ ID NOS: 210-215.

[0077] In some embodiments, a composition according to the present disclosure may comprise (I) (i) a first RNP comprising (a) a first gRNA according to the present disclosure complexed with (b) a first programmable endonuclease, nickase, or derivative thereof; or (ii) (a) a first gRNA according to the present disclosure or a polynucleotide encoding said first gRNA; and (b) a first programmable endonuclease, nickase, or derivative thereof or a polynucleotide encoding said first programmable endonuclease, nickase, or derivative thereof, wherein the first gRNA and the first programmable endonuclease, nickase, or derivative thereof are capable of forming a first RNP; and (II) (i) a second RNP comprising (a) a second gRNA according to the present disclosure complexed with (b) a second programmable endonuclease, nickase, or derivative thereof; or (ii) (a) a second gRNA according to the present disclosure or a polynucleotide encoding said second gRNA; and (b) a second programmable endonuclease, nickase, or derivative thereof or a polynucleotide encoding said second programmable endonuclease, nickase, or derivative thereof, wherein the second gRNA and the secondprogrammable endonuclease, nickase, or derivative thereof are capable of forming a second RNP. Such a composition may optionally further comprise a pharmaceutically acceptable carrier and / or excipient.

[0078] In certain embodiments, when SERPINA1 is encoded in a double-stranded polynucleotide comprising a coding strand and a non-coding strand, the first programmable endonuclease, nickase, or derivative thereof may be a first nickase, the second programmable endonuclease, nickase, or derivative thereof may be a second nickase, and the first RNP and the second RNP may be capable of inducing a single-stranded break (SSB) in opposite strands of the SERPINA1-encoding, double- stranded polynucleotide.

[0079] In some cases, (i) the first RNP may be capable of inducing a SSB in the coding strand and the second RNP may be capable of inducing a SSB in the non-coding strand.

[0080] In certain cases, the first gRNA may bind to the coding strand and the first nickase when complexed with the first gRNA may be capable of inducing a SSB in the coding strand, and the second gRNA may bind to the non-coding strand and the second nickase when complexed with the second gRNA may be capable of inducing a SSB in the non-coding strand;

[0081] In certain cases, the first gRNA may bind to the non-coding strand and the first nickase when complexed with the first gRNA may be capable of inducing a SSB in the coding strand, and the second gRNA may bind to the coding strand and the second nickase when complexed with the second gRNA may be capable of inducing a SSB in the non-coding strand;

[0082] In certain cases, the first gRNA may bind to the non-coding strand and the first nickase when complexed with the first gRNA may be capable of inducing a SSB in the coding strand, and the second gRNA may bind to the non-coding strand and the second nickase when complexed with the second gRNA may be capable of inducing a SSB in the non-coding strand; or

[0083] In certain cases, the first gRNA may bind to the coding strand and the first nickase when complexed with the first gRNA may be capable of inducing a SSB in the coding strand, and the second gRNA may bind to the coding strand and the second nickase when complexed with the second gRNA may be capable of inducing a SSB in the non-coding strand; or

[0084] In some cases, (ii) the first RNP may be capable of inducing a SSB in the non-coding strand and the second RNP may be capable of inducing a SSB in the coding strand.

[0085] In certain cases, the first gRNA may bind to the non-coding strand and the first nickase when complexed with the first gRNA may be capable of inducing a SSB in the non-coding strand, and the second gRNA may bind to the coding strand and the second nickase when complexed with the second gRNA may be capable of inducing a SSB in the coding strand;

[0086] In certain cases, the first gRNA may bind to the coding strand and the first nickase when complexed with the first gRNA may be capable of inducing a SSB in the non-coding strand, and the second gRNA may bind to the non-coding strand and the second nickase when complexed with the second gRNA may be capable of inducing a SSB in the coding strand;

[0087] In certain cases, the first gRNA may bind to the coding strand and the first nickase when complexed with the first gRNA may be capable of inducing a SSB in the non-coding strand, and the second gRNA may bind to the coding strand and the second nickase when complexed with the second gRNA may be capable of inducing a SSB in the coding strand; or

[0088] In certain cases, the first gRNA may bind to the non-coding strand and the first nickase when complexed with the first gRNA may be capable of inducing a SSB in the non-coding strand, and the second gRNA may bind to the non-coding strand and the second nickase when complexed with the second gRNA may be capable of inducing a SSB in the coding strand.

[0089] In certain embodiments, (I) the first gRNA may comprise a first spacer region comprising the polynucleotide of SEQ ID NO: 16, 3, 2, 13, 15, 19, 20, or 22, X1X2CTGACCATCGACAAGAAA (SEQ ID NO: 53) (X1 is any of A, T, C, or G, optionally A, C, or G; and X2 is any of A, T, C, or G, optionally A, T, or C), or X1X2GCTGACCATCGACAAGAA (SEQ ID NO: 52) (X1 is any of A, T, C, or G, optionally A, T, or C; and X2 is any of A, T, C, or G, optionally A, C, or G); and (II) the second gRNA may comprise a first spacer region comprising the polynucleotide of SEQ ID NO: 21, 4, 1, 5, 6, 7, 8, 9, 10, 11, 12, 14, 17, 18, or X1X2CAGTCCCTTTCTTGTCGA (SEQ ID NO: 54) (X1 is any of A, T, C, or G, optionally A, C, or G; and X2 is any of A, T, C, or G, optionally A, C, or G).

[0090] In particular embodiments, the first nickase and the second nickase may be individually a Cas9 nickase which comprises the substitution D10A relative to a wildtype Cas9 (e.g., wildtype SpCas9 or SaCas9). In some cases, such a nickase may further comprise one or more of the substitutions L1111R, D1135V or D1135E, G1218R, E1219F, A1322R, R1335Q or R1335E, T1337R, and / or may be a circular permutation variant thereof. In some cases, a nickase may comprise any one of SEQ ID NO: 158-166. In certain cases, a nickase may comprise SEQ ID NO: 160, or a variant thereof.

[0091] In particular embodiments, the first nickase and the second nickase may be individually a Cas9 nickase which comprises one or more of the substitutions D839A, H840A, N854A, and N863A, relative to a wildtype Cas9 (e.g., wildtype SpCas9 or SaCas9). In some cases, such a nickase may further comprise one or more of the substitutions L1111R, D1135V or D1135E, G1218R, E1219F, A1322R, R1335Q or R1335E, T1337R, and / or may be a circular permutation variant thereof. In some cases, a nickase may comprise any one of SEQ ID NO: 167-169, or a variant thereof.

[0092] In some embodiments, a composition according to the present disclosure may further comprise an isolated ODN or a polynucleotide encoding said ODN. In certain embodiments, the ODN may be a ssODN or a dsODN. In particular embodiments, the ODN may be optionally any of the ODNs described above or herein.

[0093] In some embodiments, a composition according to the present disclosure may comprise a pharmaceutically acceptable carrier which is a lipid-based TCV which comprises at least one ionizable cationic lipid.

[0094] In certain embodiments, the at least one ionizable cationic lipid may comprise, may essentially consist of, or may consist of a lipid selected from the group consisting of N,N-dimethyl- 2,3-dioleyloxy)propylamine (DODMA), 1,2-dioleoyl-3-dimethylammonium propane (DODAP), 1,2- Dilinoleoyl-3-dimethylaminopropane (DLinDAP), N,N-dimethyl-2,2-di-(9Z,12Z)-9,12-octadecadien- 1-yl-1,3-dioxolane-4-ethanamine (KC2), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4- (dimethylamino)butanoate (MC3), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N- distearyl-N,N-dimethylammonium bromide (DDAB), N-(1-(2,3-dioleoyloxy)propyl)-N,N,N- trimethylammonium chloride (DOTAP), N-(1-(2,3-dioleyloxyl)propyl)-N,N,N-trimethylammonium chloride (DOTMA), 1,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2- Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2-Dilinoleylcarbamoyloxy-3- dimethylaminopropane (DLin-C-DAP), 1,2-Dilinoleyoxy-3-(dimethylamino)acetoxypropane (DLin- DAC), 1,2-Dilinoleyoxy-3-morpholinopropane (DLin-MA), 1,2-Dilinoleylthio-3- dimethylaminopropane (DLin-S-DMA), 1-Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin- 2-DMAP), 1,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2- Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAR.Cl), 1,2-Dilinoleyloxy-3-(N- methylpiperazino)propane (DLin-MPZ), or 3-(N,N-Dilinoleylamino)-1,2-propanediol (DLinAP), 3- (N,N-Dioleylamino)-1,2-propanedio (DOAP), 1,2-Dilinoleyloxo-3-(2-N,N- dimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLin-K-DMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or analogs thereof, (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3 aH- cyclopenta[d][1,3]dioxol-5-amine (ALNY-100), N-(2,3-dioleyloxyl)propyl-N,N-N-triethylammonium chloride (DOTMA); 1,2-Dioleyloxy-3-trimethylaminopropane chloride salt (DOTAP.Cl); 3.beta.-(N- (N′,N′-dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol), N-(1-(2,3-dioleyloxyl)propyl)-N-2- (sperminecarboxamido)ethyl)-N,N-dimethyl-ammonium trifluoracetate (DOSPA), dioctadecylamidoglycyl carboxyspermine (DOGS), and N-(1,2-dimyristyloxyprop-3-yl)-N,N- dimethyl-N-hydroxyethyl ammonium bromide (DMRIE), and any combinations thereof. In particular embodiments, the at least one ionizable cationic lipid may comprise, may essentially consist of, or may consist of DODMA.

[0095] In certain embodiments, in addition to the at least one ionizable cationic lipid, the TCV may further comprise at least one helper lipid. In some cases, the at least one helper lipid may comprise, may essentially consist of, or may consist of a lipid selected from the group consisting of dioleoylphosphatidylethanolamine (DOPE), distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE),distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, l-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), and any combinations thereof. In particular embodiments, the at least one helper lipid may comprise, may essentially consist of DOPE and / or DSPC.

[0096] In certain embodiments, in addition to the at least one ionizable cationic lipid, the TCV may further comprise at least one phospholipid. In some cases, the at least one phospholipid may comprise, may essentially consist of, or may consist of a lipid selected from the group consisting of distearoylphosphatidylcholine (DSPC), dioleoyl phosphatidylethanolamine (DOPE), dipalmitoylphosphatidylcholine (DPPC), phosphocholine (DOPC), dimyristoylphosphatidylcholine (DMPC), phosphatidylcholine (PLPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DAPC), phosphatidylethanolamine (PE), egg phosphatidylcholine (EPC), dilauryloylphosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), 1-myristoyl-2-palmitoyl phosphatidylcholine (MPPC), 1-palmitoyl-2-myristoyl phosphatidylcholine (PMPC), 1-palmitoyl-2-stearoyl phosphatidylcholine (PSPC), 1,2-diarachidoyl-sn-glycero-3-phosphocholine (DBPC), 1-stearoyl-2- palmitoyl phosphatidylcholine (SPPC), 1,2-dieicosenoyl-sn-glycero-3-phosphocholine (DEPC), palmitoyloleoyl phosphatidylcholine (POPC), lysophosphatidyl choline, dilinoleoylphosphatidylcholine distearoylphophatidylethanolamine (DSPE), dimyristoyl phosphatidylethanolamine (DMPE), dipalmitoyl phosphatidylethanolamine (DPPE), palmitoyloleoyl phosphatidylethanolamine (POPE), lysophosphatidylethanolamine, and any combinations thereof. In particular embodiments, the at least one phospholipid may comprise, may essentially consist of, or may consist of DSPC.

[0097] In certain embodiments, in addition to the at least one ionizable cationic lipid, the TCV may further comprise at least one cholesterol or cholesterol derivative. In some cases, the at least one cholesterol or cholesterol derivative may comprise, may essentially consist of, or may consist of a cholesterol or cholesterol derivative selected from the group consisting of cholesterol, N,N-dimethyl- N-ethylcarboxamidocholesterol (DC-Chol), 1,4-bis(3-N-oleylamino-propyl)piperazine, imidazole cholesterol ester (ICE), and any combinations thereof. In particular embodiments, the at least one cholesterol or cholesterol derivative may comprise, may essentially consist of, or may consist of a cholesterol.

[0098] In certain embodiments, in addition to the at least one ionizable cationic lipid, the TCV may further comprise at least one PEG or PEG-lipid.

[0099] In some cases, the at least one PEG-lipid may comprise, may essentially consist of, or may consist of a PEG-lipid selected from the group consisting of PEG-myristoyl diglyceride (PEG-DMG) (e.g., 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (Avanti® Polar Lipids (Birmingham, AL)), which is a mixture of 1,2-DMG PEG2000 and 1,3-DMG PEG2000 (e.g., in about 97:3 ratio)), PEG-phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g.,PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines, PEG-modified 1,2-diacyloxypropan-3- amines, and any combinations thereof.

[0100] In some cases, the PEG may have a molecular weight of about 1500 to about 5000. In certain cases, the PEG may have a molecular weight of about 2000 to about 4000. In certain cases, the PEG may have a molecular weight of about 1800 to about 2200. In certain cases, the PEG may have a molecular weight of about 2800 to about 4300. In particular cases, the PEG may comprise, may essentially consist of, or may consist of PEG2000 or PEG4000.

[0101] In some cases, the at least one PEG-lipid may comprise, may essentially consist of, or may consist of a non-ionizable cationic lipid conjugated to a PEG.

[0102] In certain cases, the non-ionizable cationic lipid conjugated to a PEG may comprise, may essentially consist of, or may consist of PEG-DOPE (such as PEG2000-DOPE) and / or cholesterol (or cholesterol derivative)-PEG (such as PEG4000-cholesterol or PEG2000-cholesterol). In certain cases, PEG4000-cholesterol may be present at about 0.5-1 mol%, optionally about 0.75 mol%, relative to the total lipid content of the TCV.

[0103] In particular embodiments, the at least one PEG-lipid may comprise, may essentially consist of, or may consist of PEG-DMG. In some cases, the PEG-DMG may comprise, may essentially consist of, or may consist of PEG4000-DMG. In certain cases, PEG4000-DMG may be present at about 0.5-1 mol%, optionally about 0.75 mol%, relative to the total lipid content of the TCV.

[0104] In certain embodiments, in addition to the at least one ionizable cationic lipid, the TCV may further comprise any combinations of at least one helper lipid, at least one phospholipid, at least one cholesterol or cholesterol derivative, and / or at least one PEG or PEG-lipid, e.g., as described above.

[0105] In certain embodiments, the TCV may be substantially, essentially, or entirely free of destabilizing agents.

[0106] In certain embodiments, the amount of the at least one ionizable cationic lipid relative to the total components of the TCV may be about 20 mol% to about 50 mol%, about 20 mol% to about 40 mol%, about 20 mol% to about 30 mol%, about 15 mol% to about 25 mol%, about 18 mol% to about 22 mol%, about 19 mol% to about 21 mol%, about 19.5 mol% to about 20.5 mol%, about 19.8 mol% to about 20.2 mol%, about 20 mol%, about 25 mol% to about 35 mol%, about 28 mol% to about 32 mol%, about 29 to about 31 mol%, about 29.5 mol% to about 30.5 mol%, about 29.8 mol% to about 30.2 mol%, about 30 mol%. In particular embodiments, the amount of the at least one ionizable cationic lipid relative to the total components of the TCV may be about 20 mol% to about 30 mol%.

[0107] In certain embodiments, when the TCV comprises at least one helper lipid, the amount of the at least one helper lipid relative to the total components of the TCV may be about 10 mol% to about 60 mol%, about 10 mol% to about 50 mol%, about 10 mol% to about 40 mol%, about 20 mol% to about 40 mol%, about 20 mol% to about 30 mol%, about 25 mol% to about 35 mol%, about 28 mol% to about 32 mol%, about 29 mol% to about 31 mol%, about 29.5 mol% to about 30.5 mol%, about 29.8 mol% to about 30.2 mol%, about 30 mol%, about 15 mol% to about 25 mol%, about 18 mol% toabout 22 mol%, about 19 mol% to about 21 mol%, about 19.5 mol% to about 20.5 mol%, about 19.8 mol% to about 20.2 mol%, about 20 mol%. In particular embodiments, the amount of the at least one helper lipid relative to the total components of the TCV may be about 20 mol% to about 30 mol%.

[0108] In certain embodiments, when the TCV comprises at least one phospholipid, the amount of the at least one phospholipid relative to the total components of the TCV may be about 5 mol% to about 65 mol%, about 5 mol% to about 55 mol%, about 5 mol% to about 45 mol%, about 5 mol% to about 35 mol%, about 5 mol% to about 25 mol%, about 5 mol% to about 15 mol%, about 8 mol% to about 12 mol%, about 9 mol% to about 11 mol%, about 9.5 mol% to about 10.5 mol%, about 9.8 mol% to about 10.2 mol%, or about 10 mol%. In particular embodiments, the amount of the at least one phospholipid relative to the total components of the TCV may be about 10 mol%.

[0109] In certain embodiments, when the TCV comprises at least one cholesterol or cholesterol derivative, the amount of the at least one cholesterol or cholesterol derivative relative to the total components of the TCV may be about 20 mol% to about 60 mol%, about 25 mol% to about 55 mol%, about 30 mol% to about 50 mol%, about 35 mol% to about 45 mol%, about 38 mol% to about 42 mol%, about 39 mol% to about 41 mol%, about 39.5 mol% to about 40.5 mol%, about 39.8 mol% to about 40.2 mol%, or about 40 mol%, or about 39%. In particular embodiments, the amount of the at least one cholesterol or cholesterol derivative relative to the total components of the TCV may be about 39 mol% to about 40 mol%.

[0110] In certain embodiments, when the TCV comprises at least one PEG or PEG-lipid, the amount of the at least one PEG or PEG-lipid relative to the total components of the TCV may be about 0%, about 0.1 mol% to about 15 mol%, about 0.1 mol% to about 10 mol%, about 0.1 mol% to about 5 mol%, 0.1 mol% to about 4 mol%, 0.1 mol% to about 3 mol%, 0.1 mol% to about 2 mol%, 0.5 mol% to about 1.5 mol%, 0.8 mol% to about 1.2 mol%, 0.9 mol% to about 1.1 mol%, or about 1 mol%. In certain embodiments, the amount of the at least one PEG or PEG-lipid relative to the total components of the TCV may be about 1 mol% to about 10 mol%, about 1 mol% to about 5 mol%, or about 2, 3, 4, or 5 mol%. In particular embodiments, the amount of the at least one PEG or PEG-lipid relative to the total components of the TCV may be about 0.5 mol% to about 1.5 mol%, or about 1 mol%.

[0111] In particular embodiments, the TCV may comprise, may essentially consist of, or may consist of (i) at least one ionizable cationic lipid, which optionally comprises or is DODMA; (ii) at least one helper lipid, which optionally comprises or is DOPE; (iii) at least one phospholipid, which optionally comprises or is DSPC; and (iv) at least one cholesterol or cholesterol derivative.

[0112] In some cases, the amounts of the at least one ionizable cationic lipid, the at least one helper lipid, the at least one phospholipid, and the at least one cholesterol or cholesterol derivative, relative to the total components of the TCV, may be about 30 mol%, about 20 mol%, about 10 mol%, and about 40 mol%, respectively, about 20 mol%, about 30 mol%, about 10 mol%, and about 40 mol%, respectively, or about 25 mol%, about 25 mol%, about 10 mol%, and about 40 mol%, respectively.

[0113] In particular embodiments, the TCV may comprise, may essentially consist of, or may consist of (i) at least one ionizable cationic lipid, which optionally comprises or is DODMA; (ii) at least one helper lipid, which optionally comprises or is DOPE; (iii) at least one phospholipid, which optionally comprises or is DSPC; (iv) at least one cholesterol or cholesterol derivative; and (v) at least one PEG or PEG-lipid, which optionally comprises or is PEG-DMG.

[0114] In some cases, the amounts of the at least one ionizable cationic lipid, the at least one helper lipid, the at least one phospholipid, the at least one cholesterol or cholesterol derivative, and the at least one PEG or PEG-lipid, relative to the total components of the TCV, may be about 30 mol%, about 20 mol%, about 10 mol%, about 39 mol%, and about 1 mol%, respectively, about 20 mol%, about 30 mol%, about 10 mol%, about 39 mol%, and about 1 mol%, respectively, or about 25 mol%, about 25 mol%, about 10 mol%, about 39 mol%, and about 1 mol%, respectively.

[0115]

[0116] In yet another aspect, the present disclosure provides methods of manufacturing a composition according to the present disclosure.

[0117] In some embodiments, a composition to be manufactured may comprise: (A) (i) an RNP according to the present disclosure and optionally (ii) an isolated ODN or a polynucleotide encoding said ODN, optionally wherein the ODN is a ssODN or a dsODN, optionally any of the ODNs described herein; and (B) a pharmaceutically acceptable carrier comprising a lipid-based TCV, e.g., any of the lipid-based TCVs described herein.

[0118] Such a manufacturing method may comprise: (a) providing an aqueous solution comprising the lipid-based TCV, optionally wherein the pH of the aqueous solution is about 2 to about 6.5, further optionally about 3 to about 6, about 4 to about 5, about 3.5 to about 5, about 3.5 to about 4.5, or about 4; and (b) mixing (i) the RNP and optionally (ii) the isolated ODN, with the aqueous solution under conditions suitable for encapsulation.

[0119] In some embodiments, a composition to be manufactured may comprise: (A) (i) a first RNP, (ii) a second RNP, and optionally (iii) an isolated ODN or a polynucleotide encoding said ODN, optionally wherein the ODN is a ssODN or a dsODN, optionally any of the ODNs described herein; and (B) a pharmaceutically acceptable carrier comprising a lipid-based TCV, e.g., any of the lipid- based TCVs described herein.

[0120] Such a manufacturing method may comprise: (a) providing an aqueous solution comprising the lipid-based TCV, optionally wherein the pH of the aqueous solution is about 2 to about 6.5, further optionally about 3 to about 6, about 4 to about 5, about 3.5 to about 5, about 3.5 to about 4.5, or about 4; and (b) mixing (i) the first RNP, (ii) the second RNP, and optionally (ii) the isolated ODN, with the aqueous solution under conditions suitable for encapsulation.

[0121] In yet another aspect, the present disclosure provides methods of editing SERPINA1, optionally an rs28929474(A) allele thereof, in one or more target cells. The method may comprise contacting the target cell with any of the compositions described herein.

[0122] In some embodiments, contacting may be in vitro, ex vivo, or in vivo.

[0123] In some embodiments, the one or more target cells may comprise mammalian, optionally human, non-human primate, monkey, horse, cow, sheep, goat, pig, rabbit, dog, cat, or rodent (mouse, rat, guinea pig, hamster) cells. In some embodiments, the one or more target cells may comprise (ii) non-mammalian, optionally bacterial, yeast, fungal, protozoa, plant, insect, amphibian, reptile, fish, or bird (such as chicken) cells.

[0124] In some embodiments, the one or more target cells may comprise a liver cell, a bone marrow cell, a lymphocyte, a monocytic cell, a cell in a lymphoid tissue, a Paneth cell of the gut, a germ cell, an oocyte, an ovum, a spermatocyte, a sperm, a fertilized egg, an embryo, and / or a stem cell. In particular embodiments, the one or more target cells may comprise a liver cell.

[0125] In some embodiments, the method may be for correcting rs28929474(A), optionally to rs28929474(G), and / or reducing expression of SERPINA1 rs28929474(A) and / or of mutant alpha-1 antitrypsin (A1AT) protein comprising Glu366Lys.

[0126] In yet another aspect, the present disclosure provides methods of editing SERPINA1, optionally an rs28929474(A) allele thereof, in one or more target cells in a subject. The method may comprise administering any of the compositions described herein to the subject.

[0127] In some embodiments, the one or more target cells may comprise a liver cell, a bone marrow cell, a lymphocyte, a monocytic cell, a cell in a lymphoid tissue, a Paneth cell of the gut, a germ cell, an oocyte, an ovum, a spermatocyte, a sperm, a fertilized egg, an embryo, and / or a stem cell. In particular embodiments, the one or more target cells may comprise a liver cell.

[0128] In some embodiments, the subject may be a mammal, optionally a human, a non-human primate, a monkey, a horse, a cow, sheep, a goat, a pig, a dog, a cat, a rabbit, a rodent (mouse, rat, guinea pig, hamster), a rat, or a mouse. In some embodiments, the subject may be a non-mammalian vertebrate, optionally a amphibian, reptile, fish, or bird such as chicken. In particular embodiments, the subject may be a human.

[0129] In some embodiments, the administering may be locally administering, optionally by inhalation or administering to the liver, bone marrow, lymphoid tissue, gut, ovary, testis, eye, ear, nose (optionally intranasally), skin (optionally transdermally or epicutaneously), mucosa, skin, or vagina. In particular embodiments, the administering may be by inhalation or administering to the liver.

[0130] In some embodiments, the administering may be parenterally administering, optionally by injection (optionally intravenous, intramuscular, subcutaneous, intradermal, intrathecal, intra-arterial, intraarticular, intraosseous, intraparenchymal, or intraperitoneal administration) or by inhalation. In particular embodiments, the administering may be by intravenous injection.

[0131] In some embodiments, the administering may be enterally administering, optionally orally, sublingually, buccally, or rectally.

[0132] In some embodiments, the administering may be effected two or more times, optionally about 3-5 times, optionally about once a week, about every 2 weeks, or about every 3 weeks, about once a month, about every 3 months, about every 6 months, or about once per year.

[0133] In some embodiments, the method may be for correcting rs28929474(A), optionally to rs28929474(G), and / or reducing expression of SERPINA1 rs28929474(A) and / or of mutant alpha-1 antitrypsin (A1AT) protein comprising Glu366Lys.

[0134] In some embodiments, the method may be for preventing or treating A1AT deficiency (A1ATD) and / or an A1ATD-associated lung and / or liver disease(s) and / or condition(s). In certain embodiments, the A1ATD-associated lung and / or liver disease(s) and / or condition(s) may comprise or may be one or more selected from emphysema, chronic obstructive pulmonary disease (COPD), bronchiectasis, neonatal cholestasis, cirrhosis, hepatocellular carcinoma, liver failure, lung failure, and / or panniculitis.

[0135] In yet another aspect, the present disclosure provides methods of preventing or treating A1AT deficiency (A1ATD) and / or an A1ATD-associated lung and / or liver disease(s) and / or condition(s) in a subject. The method may comprise administering any of the compositions described herein to the subject.

[0136] In some embodiments, the A1ATD-associated lung and / or liver disease(s) and / or condition(s) may comprise or may be one or more selected from emphysema, chronic obstructive pulmonary disease (COPD), bronchiectasis, neonatal cholestasis, cirrhosis, hepatocellular carcinoma, liver failure, lung failure, and / or panniculitis.

[0137] In some embodiments, the subject may be a mammal, optionally a human, a non-human primate, a monkey, a horse, a cow, sheep, a goat, a pig, a dog, a cat, a rabbit, a rodent (mouse, rat, guinea pig, hamster), a rat, or a mouse. In some embodiments, the subject may be a non-mammalian vertebrate, optionally a amphibian, reptile, fish, or bird such as chicken. In particular embodiments, the subject may be a human.

[0138] In some embodiments, the administering may be locally administering, optionally by inhalation or administering to the liver, bone marrow, lymphoid tissue, gut, ovary, testis, eye, ear, nose (optionally intranasally), skin (optionally transdermally or epicutaneously), mucosa, skin, or vagina. In particular embodiments, the administering may be by inhalation or administering to the liver.

[0139] In some embodiments, the administering may be parenterally administering, optionally by injection (optionally intravenous, intramuscular, subcutaneous, intradermal, intrathecal, intra-arterial, intraarticular, intraosseous, intraparenchymal, or intraperitoneal administration) or by inhalation. In particular embodiments, the administering may be by intravenous injection.

[0140] In some embodiments, the administering may be enterally administering, optionally orally, sublingually, buccally, or rectally.

[0141] In some embodiments, the administering may be effected two or more times, optionally about 3-5 times, optionally about once a week, about every 2 weeks, or about every 3 weeks, about once a month, about every 3 months, about every 6 months, or about once per year.

[0142] In some embodiments, the method may be for correcting rs28929474(A), optionally to rs28929474(G), and / or reducing expression of SERPINA1 rs28929474(A) and / or of mutant alpha-1 antitrypsin (A1AT) protein comprising Glu366Lys.

[0143] In a further aspect, the present disclosure provides kits.

[0144] In some embodiments, a kit may comprise: (A) (I) any one or more of the RNPs described herein; and (II) optionally an isolated ODN or a polynucleotide encoding said ODN, optionally wherein the ODN is a ssODN or a dsODN, optionally any of the ODNs described herein; and (III) any of the lipid-based TCVs described herein; and (B) a label, optionally comprising an instruction for use in a method of manufacturing described herein.

[0145] In some embodiments, a kit may comprise: (A) any of the compositions described herein; and (B) a label, optionally comprising an instruction for use in any of the methods of editing SERPINA1, optionally an rs28929474(A) allele thereof, in one or more target cells, any of the methods of editing SERPINA1, optionally an rs28929474(A) allele thereof, in one or more target cells in a subject described herein, and / or any of the methods of preventing or treating A1AT deficiency (A1ATD) and / or an A1ATD-associated lung and / or liver disease(s) and / or condition(s) in a subject described herein.

[0146] Any of the isolated gRNAs described herein, any of the polynucleotides described herein, any of the vectors described herein, any of the RNPs described herein, any of the isolated ODNs or polynucleotides encoding such an ODN described herein, or any of the compositions described herein may be for use in medicine, and in some embodiments, may be for use in preventing or treating an A1ATD-associated lung and / or liver disease(s) and / or condition(s), optionally emphysema, chronic obstructive pulmonary disease (COPD), bronchiectasis, neonatal cholestasis, cirrhosis, hepatocellular carcinoma, liver failure, lung failure, and / or panniculitis, optionally according to any of the methods of editing and / or of preventing or treating described herein.

[0147] Also provided herein includes use of any of the isolated gRNAs described herein, any of the polynucleotides described herein, any of the vectors described herein, any of the RNPs described herein, any of the isolated ODNs or polynucleotides encoding such an ODN described herein, or any of the compositions described herein in preventing or treating A1AT deficiency (A1ATD) and / or an A1ATD-associated lung and / or liver disease(s) and / or condition(s), optionally according to any of the methods of editing and / or of preventing or treating described herein.

[0148] Further provided herein includes use of any of the isolated gRNAs described herein, any of the polynucleotides described herein, any of the vectors described herein, any of the RNPs described herein, any of the isolated ODNs or polynucleotides encoding such an ODN described herein, or any of the compositions described herein in the manufacture of a medicament, optionally wherein themedicament is for preventing or treating an A1ATD-associated lung and / or liver disease(s) and / or condition(s), optionally according to any of the methods of editing and / or of preventing or treating described herein.

[0149] In some embodiments, the A1ATD-associated lung and / or liver disease(s) and / or condition(s) may comprise or may be one or more selected from emphysema, chronic obstructive pulmonary disease (COPD), bronchiectasis, neonatal cholestasis, cirrhosis, hepatocellular carcinoma, liver failure, lung failure, and / or panniculitis. BRIEF DESCRIPTION OF THE DRAWINGS

[0150] FIG.1A provides exemplary coding and non-coding strand sequences (SEQ ID NOS: 41 and 42, respectively) of part of human SERPINA1, corresponding to positions 94,378,771 to 94,378,449 (Assembly GRCh38.p14, NC_000014.9), containing the G-to-A mutation at rs28929474 at position 94,378,610 (c.1096G>A, also referred to as the Z allele or PI*Z allele or the rs28929474(A) allele). The sequence span corresponds to part of intron 4 and part of exon 5 up to the stop codon (the intron- exon border shown as a vertical, dashed line). The c.1096G>A mutation (position 94,378,610) is shown with a downward filled arrow. The resulting codon “AAG” encoding lysine (instead of glutamic acid) is shown in a box. Also provided are 5’-NGG-3’ PAMs (solid underline) and 5’-TTTN- 3’ PAMs (dotted underline) contained in the sequence span, which may be used in gene editing for example by Cas9-gRNA complexes and Cas12a-gRNA complexes, respectively.

[0151] In some cases, for use with a Cas9 protein, a fully complementary gRNA may be designed to have a spacer region corresponding to the sequence, e.g., of at least 17 nucleotides (e.g., 17, 18, 19, 20, 21, 22, 23, 24, etc) in length, that is immediately upstream of each of the PAMs with a solid underline. The bracketed number shown at the 3’ end (right side in the coding strand, left side in the non-coding strand) of a solid underline for a 5’-NGG-3’ PAM corresponds to the name of a gRNA disclosed herein which may mediate gene editing via the indicated PAM, e.g., when used with a Cas9 (e.g., the gRNAs named “SERPINA1_3A” and “SERPINA1_3G” (or a variant thereof) complexed with a Cas9 may recognize the PAM with a solid underline appended with [3], the gRNA named “SERPINA1_21” (or a variant thereof) complexed with a Cas9 may recognize the PAM with a solid underline appended with

[0021] , etc).

[0152] In some cases, for use with a Cas12a protein, a fully complementary gRNA may be designed to have a spacer region corresponding to the sequence, e.g., of at least 19 nucleotides (e.g., 19, 20, 21, 22, 23, 24, 25, 26, etc) in length, that is immediately downstream of each of the PAM with a dotted underline. The bracketed number shown at the 5’ end (left side in the coding strand, right side in the non-coding strand) of a dashed underline for a 5’-TTTN-3’ PAM corresponds to the name of a gRNA disclosed herein which may mediate gene editing via the indicated PAM, e.g., when used with a Cas12a (e.g., the gRNAs named “SERPINA1_1A_Cas12a” and “SERPINA1_1G_Cas12a” (or avariant thereof) complexed with a Cas12a may recognize the PAM with a dashed underline appended with [1], the gRNA named “SERPINA1_2_Cas12a” (or a variant thereof) complexed with a Cas12a may recognize the PAM with a dashed underline appended with

[0021] , etc).

[0153] FIG.1B provides exemplary templates which may be used to induce a rs28929474 A>G correction at position 94,378,610. In the top panel, a 121 base-long template of the forward orientation (i.e., same orientation as the coding strand) (SEQ ID NO: 181) which is fully homologous to the coding strand of the wildtype allele, and a 121 base-long template of the reverse orientation (i.e., same orientation as the non-coding strand) (SEQ ID NO: 182) which is fully homologous to the non-coding strand of the wildtype allele are shown. Both templates encompass 60 base upstream and downstream of the rs28929474 base (position 94,378,610, shown with a downward filled arrow). The position corresponding to the intron 4-exon 5 border is shown as a dotted line. Positions corresponding to the 5’-NGG-3’ PAMs contained in the span, which may be used in gene editing for example by Cas9-gRNA complexes, are shown with solid underlines, some with bracketed numbers (corresponding to gRNA names disclosed herein to be used with Cas9) appended at the 3’ end. For each PAM, 5’-NGG-3’ PAM-altering (i.e., no longer 5’-NGG-3’ once mutated) silent mutation options, if any, are shown (with single-headed arrow).

[0154] In the bottom panel, a 121 base-long template of the forward orientation with variations allowing all possible 5’-NGG-3’ PAM-altering silent mutations considered in the top panel (and the original base homologous to the wildtype allele base) (SEQ ID NO: 171), and a 121bp-long template of the reverse orientation with variegations allowing all possible 5’-NGG-3’ PAM-altering silent mutations considered in the top panel (SEQ ID NO: 172) are provided. Although not explicitly shown in FIG.1B, one or more 5’-TTTN-3’ or 5’-TTTV-3’ PAM-altering (i.e., no longer 5’-TTTN-3’ or 5’- TTTV-3’ once mutated) silent mutations may also be incorporated. For rs28929474 A>G correction, any variant of such templates may be used, including SEQ ID NOS: 171 and / or 172 and / or elongated variants thereof or truncated variants thereof, including but not limited to those containing at least 10- 603’ bases of the 5’ homology arm of SEQ ID NO: 171 (i.e. at least 10-603’ bases of SEQ ID NO: 173), followed by G, followed by at least 10-605’ bases of the 3’ homology arm of SEQ ID NO: 171 (i.e. at least 10-605’ bases of SEQ ID NO: 174) and / or those containing at least 10-603’ bases of the 5’ homology arm of SEQ ID NO: 172 (i.e. at least 10-603’ bases of SEQ ID NO: 175), followed by C, followed by at least 10-605’ bases of the 3’ homology arm of SEQ ID NO: 172 (i.e. at least 10-60 5’ bases of SEQ ID NO: 176), or, in some cases, mutated variants (which may contain silent mutations, missense mutations, and / or, in certain cases, nonsense mutations) of any of the foregoing.

[0155] FIG.1C provides exemplary templates which may be used to induce rs28929474 A>G correction at position 94,378,610. In the top panel, a 121 base-long template of the forward orientation (i.e., same orientation as the coding strand) (SEQ ID NO: 181) which is fully homologous to the coding strand of the wildtype allele, and a 121 base-long template of the reverse orientation (i.e., same orientation as the non-coding strand) (SEQ ID NO: 182) which is fully homologous to thenon-coding strand of the wildtype allele are shown. Both templates encompass 60 base upstream and downstream of the rs28929474 base (position 94,378,610, shown with a downward filled arrow). The position corresponding to the intron 4-exon 5 border is shown as a dotted line. Positions corresponding to the 5’-TTTN-3’ PAMs contained in the span, which may be used in gene editing for example by Cas12a-gRNA complexes, are shown with dotted underlines. The bracketed numbers appended at the 3’ end of the dotted underline correspond to the names of gRNAs disclosed herein to be used with Cas12a. For each PAM, 5’-TTTN-3’ PAM-altering (i.e., no longer 5’-TTTN-3’ once mutated) silent mutation options, if any, are shown (with single-headed arrow).

[0156] In the bottom panel, a 121 base-long template of the forward orientation with variegations allowing all possible 5’-TTTN-3’ PAM-altering silent mutations considered in the top panel (and the original base homologous to the wildtype allele base) (SEQ ID NO: 271), and a 121bp-long template of the reverse orientation with variegations allowing all possible 5’-TTTN-3’ PAM-altering silent mutations considered in the top panel (SEQ ID NO: 272) are provided. Although not explicitly shown in FIG.1C, one or more 5’-NGG-3’ PAM-altering (i.e., no longer 5’-NGG-3’ once mutated) silent mutations may also be incorporated. For rs28929474 A>G correction, any variant of such templates may be used, including SEQ ID NOS: 271 and / or 272 and / or elongated variants thereof or truncated variants thereof, including but not limited to those containing at least 10-603’ bases of the 5’ homology arm of SEQ ID NO: 271 (i.e. at least 10-603’ bases of SEQ ID NO: 273), followed by G, followed by at least 10-605’ bases of the 3’ homology arm of SEQ ID NO: 271 (i.e. at least 10-605’ bases of SEQ ID NO: 274) and / or those containing at least 10-603’ bases of the 5’ homology arm of SEQ ID NO: 272 (i.e. at least 10-603’ bases of SEQ ID NO: 275), followed by C, followed by at least 10-605’ bases of the 3’ homology arm of SEQ ID NO: 272 (i.e. at least 10-605’ bases of SEQ ID NO: 276), or, in some cases, mutated variants (which may contain silent mutations, missense mutations, and / or, in certain cases, nonsense mutations) of any of the foregoing.

[0157] FIG.1D provides further exemplary templates which may be used to induce rs28929474 A>G correction at position 94,378,610. In the top panel, a 121 base-long template of the forward orientation (i.e., same orientation as the coding strand) (SEQ ID NO: 181) which is fully homologous to the coding strand of the wildtype allele, and a 121 base-long template of the reverse orientation (i.e., same orientation as the non-coding strand) (SEQ ID NO: 182) which is fully homologous to the non-coding strand of the wildtype allele are shown. Both templates encompass 60 base upstream and downstream of the rs28929474 base (position 94,378,610, shown with a downward filled arrow). The position corresponding to the intron 4-exon 5 border is shown as a dotted line. Positions corresponding to the 5’-NGG-3’ PAMs contained in the span, which may be used in gene editing for example by Cas9-gRNA complexes, are shown with solid underlines, some with bracketed numbers (corresponding to gRNA names disclosed herein to be used with Cas9) appended at the 3’ end. Positions corresponding to the 5’-TTTN-3’ PAMs contained in the span, which may be used in gene editing for example by Cas12a-gRNA complexes, are shown with dotted underlines. The bracketednumbers appended at the 3’ end of the dotted underline correspond to the names of gRNAs disclosed herein to be used with Cas12a. For each PAM, 5’-NGG-3’ PAM-altering (i.e., no longer 5’-NGG-3’ once mutated) or 5’-TTTN-3’ PAM-altering (i.e., no longer 5’-TTTN-3’ once mutated) silent mutation options, if any, are shown (with single-headed arrow).

[0158] In the bottom panel, a 121 base-long template of the forward orientation with variegations allowing all possible 5’-NGG-3’ PAM-altering and 5’-TTTN-3’ PAM-altering silent mutations considered in the top panel (and the original base homologous to the wildtype allele base) (SEQ ID NO: 281), and a 121bp-long template of the reverse orientation with variegations allowing all possible 5’-NGG-3’ PAM-altering and 5’-TTTN-3’ PAM-altering silent mutations considered in the top panel (SEQ ID NO: 282) are provided. Although not explicitly shown in FIG.1D, one or more other silent mutations may also be incorporated. For rs28929474 A>G correction, any variant of such templates may be used, including SEQ ID NOS: 281 and / or 282 and / or elongated variants thereof or truncated variants thereof, including but not limited to those containing at least 10-603’ bases of the 5’ homology arm of SEQ ID NO: 281 (i.e. at least 10-603’ bases of SEQ ID NO: 283), followed by G, followed by at least 10-605’ bases of the 3’ homology arm of SEQ ID NO: 281 (i.e. at least 10-605’ bases of SEQ ID NO: 284) and / or those containing at least 10-603’ bases of the 5’ homology arm of SEQ ID NO: 282 (i.e. at least 10-603’ bases of SEQ ID NO: 285), followed by C, followed by at least 10-605’ bases of the 3’ homology arm of SEQ ID NO: 282 (i.e. at least 10-605’ bases of SEQ ID NO: 286), or, in some cases, mutated variants (which may contain silent mutations, missense mutations, and / or, in certain cases, nonsense mutations, as appropriate) of any of the foregoing.

[0159] FIG.1E provides exemplary SERPINA1 gene editing selective for the rs28929474(A) allele (top) over the rs28929474(G) allele (bottom), using gRNAs “SERPINA1_2A”, “SERPINA1_3A”, and “SERPINA1_4A” and variants thereof (variant gRNAs “SERPINA1_2Av”, “SERPINA1_3Av”, and “SERPINA1_4Av”, respectively). Exemplary coding and non-coding strand sequences (SEQ ID NOS: 47 and 48, respectively) of SERPINA1 rs28929474(A) (top) and coding and non-coding strand sequences (SEQ ID NOS: 49 and 50, respectively) of SERPINA1 rs28929474(G) (bottom) and of the span encompassing 15 bp upstream and downstream of position 94,378,610 (downward filled arrow, the position of rs28929474) according to Assembly GRCh38.p14 are shown. Also provided are 5’- NGG-3’ PAMs (which may be recognized by Cas9-gRNA complexes) for respective gRNAs shown with solid underlines with bracketed numbers appended at the 3’ end corresponding to the gRNA names.

[0160] The left (top and bottom) panels compare alignment of the spacer region of the gRNA “SERPINA1_2Av” (SEQ ID NO: 52) with the target or the target sequence (SEQ ID NO: 102) of the rs28929474(A) allele (top) vs the corresponding target or the corresponding target sequence (SEQ ID NO: 132) of the rs28929474(G) allele (bottom). The center (top and bottom) panels compare alignment of the spacer region of the gRNA “SERPINA1_3Av” (SEQ ID NO: 53) with the target or the target sequence (SEQ ID NO: 103) of the rs28929474(A) allele (top) vs the corresponding targetor the corresponding target sequence (SEQ ID NO: 133) of the rs28929474(G) allele (bottom). The right (top and bottom) panels compare alignment of the spacer region of the gRNA “SERPINA1_4Av” (SEQ ID NO: 54) with the target or the target sequence (SEQ ID NO: 104) of the rs28929474(A) allele (top) vs the corresponding target or the corresponding target sequence (SEQ ID NO: 134) of the rs28929474(G) allele (bottom). For each of “SERPINA1_2Av”, “SERPINA1_3Av”, and “SERPINA1_4Av”, the panels show that the seed region is fully complementary to (the PAM- proximal segment of) the respective target sequence of the rs28929474(A) allele (top) but has a mismatch (upward open arrow) relative to (the PAM-proximal segment of) the respective corresponding target sequence of the rs28929474(G) allele (bottom) at position 94,378,610. Optionally, the non-seed region may have one, two, or more mismatches relative to (the PAM-distal segment of) both the respective target and the respective corresponding target sequences (the panels show potential mismatches occurring at amino acids shown with “X”, but in some cases one or more mismatches may occur at any position(s) in the non-seed region, and in some cases there may be no mismatches in the non-seed region).

[0161] FIG.1F provides exemplary SERPINA1 gene editing selective for the rs28929474(A) allele (top) over the rs28929474(G) allele (bottom), using gRNAs “SERPINA1_1A_Cas12a” and variants thereof. Exemplary coding and non-coding strand sequences (SEQ ID NOS: 247 and 248, respectively) of SERPINA1 rs28929474(A) (top) and coding and non-coding strand sequences (SEQ ID NOS: 249 and 250, respectively) of SERPINA1 rs28929474(G) (bottom) and of the span encompassing 20 bp upstream and 15 bp downstream of position 94,378,610 (downward filled arrow, the position of rs28929474) according to Assembly GRCh38.p14 are shown. Also provided are 5’- TTTN-3’ PAMs (which may be recognized by Cas12a-gRNA complexes) for the gRNA shown with dotted underlines with bracketed numbers appended at the 5’ end corresponding to the gRNA name.

[0162] The right (top and bottom) panels compare alignment of the spacer region of the gRNA “SERPINA1_1Av_Cas12a” (SEQ ID NO: 251) with the target or the target sequence (SEQ ID NO: 301) of the rs28929474(A) allele (top) vs the corresponding target or the corresponding target sequence (SEQ ID NO: 331) of the rs28929474(G) allele (bottom). The seed region of “SERPINA1_1Av_Cas12a” is fully complementary to (the PAM-proximal segment of) the target or the target sequence of the rs28929474(A) allele (top) but has a mismatch (upward open arrow) relative to (the PAM-proximal segment of) the respective corresponding target sequence of the rs28929474(G) allele (bottom) at position 94,378,610. Optionally, the non-seed region may have one, two, three or more mismatches relative to (the PAM-distal segment of) both the respective target and the respective corresponding target sequences (the panels show potential mismatches occurring at amino acids shown with “X”, but in some cases one or more mismatches may occur at any position(s) in the non-seed region, and in some cases there may be no mismatches in the non-seed region).

[0163] FIG.2A provides a schematic of SERPINA1 editing strategy using Cas9 nuclease and a rs28929474(A) allele-selective gRNA, SERPINA1_2A, 3A, or 4A. In the top, the coding and non-coding SERPINA1 rs28929474(A) allele sequences (SEQ ID NOS: 43 and 44, respectively) of a 120- bp span around rs28929474(A) (position 94,378,610, shown with a downward filled arrow) are shown. The 5’-NGG-3’ PAMs which may be recognized by Cas9 complexed with “SERPINA1_2A”, “SERPINA1_3A”, and “SERPINA1_4A” are shown with underlines appended with [2], [3], and [4], respectively. The sequence corresponding to the spacer region of “SERPINA1_2A”, “SERPINA1_3A”, and “SERPINA1_4A” are shown with double-headed arrows (SEQ ID NOS: 2, 3, and 4, respectively). The positions of double-strand breaks (DSBs) induced by Cas9 complexed with “SERPINA1_2A”, “SERPINA1_3A”, and “SERPINA1_4A” are shown with open triangles appended with [2], [3], and [4], respectively. Exemplary templates of the forward orientation (i.e., same orientation as the coding strand) and the reverse orientation (i.e., same orientation as the non-coding strand) having the sequence of (SEQ ID NOS: 61 and 62, respectively), which may be used (e.g., as a ssODN or dsODN) for inducing A>G correction, are also shown. When a DSB (at the positions of two open triangles appended with [2], two open triangles appended with [3], or two open triangles appended with [4]) is created, the template may mediate A>G correction by HDR (shown with two dashed “X” marks). Additionally, when HDR does not occur and a non-sense mutation is created, SERPINA1 may be inactivated, e.g., via nonsense-mediated mRNA decay (NMD). In the bottom, the coding and non-coding SERPINA1 rs28929474(G) allele sequences (SEQ ID NOS: 45 and 46, respectively) of a 120-bp span around rs28929474(G) (position 94,378,610, shown with a downward filled arrow) are shown. The 5’-NGG-3’ PAMs which may be recognized (if it was the rs28929474(A) allele) by Cas9 complexed with “SERPINA1_2A”, “SERPINA1_3A”, and “SERPINA1_4A” are shown with underlines appended with [2], [3], and [4], respectively. The rs28929474(G) base creates a mismatch in the seed region of “SERPINA1_2A”, “SERPINA1_3A”, and “SERPINA1_4A”, and thus these gRNAs would not bind to the rs28929474(G) allele.

[0164] FIGS.2B-2D provide exemplary results from Example 1-1. GM11423 cells, which are homozygous for rs28929474(A), were untreated or treated with (i) RNPs of Cas9 nuclease and a gRNA targeting an off-target gene (GFP) (“sgGFP” having the spacer region of SEQ ID NO: 31) or (ii) RNPs of Cas9 and a gRNA targeting SERPINA1 rs28929474(A) allele (“SERPINA1_2A”, “SERPINA1_3A”, or “SERPINA1_4A” having the spacer region of SEQ ID NO: 2, 3, or 4, respectively), with or without an A>G correction template (SERPINA1 A>G HDR 120bp_F (“Template-F”) or SERPINA1 A>G HDR 120bp_R (“Template-R”) of SEQ ID NO: 61 or 62, respectively). Exemplary results of SERPINA1 editing efficiency measured by TIDE (FIG.2B), SERPINA1 HDR efficiency measured by TIDER (FIG.2C), and percentages of HDR-corrected and non-corrected (i.e., Z-allele) SERPINA1 transcripts measured using dPCR (FIG.2D), upon treatments with different RNPs are shown.

[0165] FIG.2E provides exemplary results from Example 1-3. Hepatocyte-like cells (HLCs) differentiated from A1ATD hPSCs, which are homozygous for rs28929474(A), were untreated or treated with (i) RNPs of Cas9 nuclease and a negative control sgRNA (Cas9 off-target negativecontrol) or (ii) RNPs of Cas9 nuclease and a gRNA targeting SERPINA1 rs28929474(A) allele (“SERPINA1_2A” or “SERPINA1_3A” having the spacer region of SEQ ID NO: 2 or 3, respectively), with or without an A>G correction template (SERPINA1 A>G HDR 120bp_F (“Template-F”) of SEQ ID NO: 61). Exemplary results of normalized levels of secreted A1AT protein measured by ELISA upon treatments with different RNPs are shown.

[0166] FIG.2F provides a schematic of SERPINA1 editing strategy using Cas9 nuclease and SERPINA1_16 gRNA. The coding and non-coding SERPINA1 rs28929474(A) allele sequences (SEQ ID NOS: 43 and 44, respectively) of a 120-bp span around rs28929474(A) (position 94,378,610, shown with a downward filled arrow) are shown. The 5’-NGG-3’ PAMs which may be recognized by Cas9 complexed with “SERPINA1_16” is shown with an underline appended with

[0016] . The sequence corresponding to the spacer region of “SERPINA1_16” is shown with double-headed arrows (SEQ ID NO: 16). The positions of double-strand breaks (DSBs) induced by Cas9 complexed with “SERPINA1_16” are shown with open triangles appended with

[0016] . Exemplary templates of the forward orientation (i.e., same orientation as the coding strand) and the reverse orientation (i.e., same orientation as the non-coding strand) having the sequence of (SEQ ID NOS: 61 and 62, respectively), which may be used (e.g., as a ssODN or dsODN) for inducing A>G correction, are also shown. When a DSB (at the positions of two open triangles appended with

[0016] ) is created, the template may mediate A>G correction by HDR (shown with two dashed “X” marks). Additionally, when HDR does not occur and a non-sense mutation is created, SERPINA1 may be inactivated, e.g., via nonsense- mediated mRNA decay (NMD).

[0167] FIG.2G provides exemplary results from Example 1-5. HLCs differentiated from healthy control hPSCs, homozygous for rs28929474(G), were untreated or treated with (i) RNPs of Cas9 nuclease and a gRNA targeting an off-target gene (GFP) (“sgGFP” having the spacer region of SEQ ID NO: 31) or (ii) RNPs of Cas9 and a gRNA targeting SERPINA1 (“SERPINA1_16” having the spacer region of SEQ ID NO: 16), with or without an A>G correction template (SERPINA1 A>G HDR 120bp_F (“Template-F”) of SEQ ID NO: 61). Exemplary results of percentages of transcript expression from the allele in which HDR occurred (“HDR corrected”) or did not occur (“M allele”) measured using dPCR are shown.

[0168] FIG.3A provides a schematic of SERPINA1 editing strategy using Cas9 nickase and a set of two gRNAs, SERPINA1_16 and SERPINA1_21. The coding and non-coding SERPINA1 rs28929474(A) allele sequences (SEQ ID NOS: 43 and 44, respectively) of a 120-bp span around rs28929474(A) (position 94,378,610, shown with a downward filled arrow) are shown. The 5’-NGG- 3’ PAMs which may be recognized by Cas9 nickase complexed with “SERPINA1_16” and “SERPINA1_21” are shown with underlines appended with

[0016] and

[0021] , respectively. The sequences corresponding to the spacer regions of “SERPINA1_16” and “SERPINA1_21” are shown with double-headed arrows (SEQ ID NOS: 16 and 21, respectively). The position of the single-strand break (SSB) induced by Cas9 D10A nickase complexed with “SERPINA1_16” or “SERPINA1_21” isshown with an open triangle appended with

[0016] or

[0021] , respectively. Exemplary templates of the forward orientation (i.e., same orientation as the coding strand) and the reverse orientation (i.e., same orientation as the non-coding strand) having the sequence of SEQ ID NOS: 61 and 62, respectively, which may be used (e.g., as a ssODN or dsODN) for inducing A>G correction, are also shown. When one or both of the SSBs (at the positions of open triangles appended with

[0016] and

[0021] ) is / are created, the template may mediate A>G correction by HDR (shown with two dashed “X” marks). Additionally, when HDR does not occur and a non-sense mutation is created, SERPINA1 may be inactivated, e.g., via nonsense-mediated mRNA decay (NMD).

[0169] FIG.3B provides exemplary results from Example 2-1. HEK293T cells, which are homozygous for rs28929474(G), were treated with (i) 1:1 ratio of RNPs of Cas9 D10A nickase and gRNA SERPINA1_16 (spacer region of SEQ ID NO: 16) and RNPs of Cas9 D10A nickase and gRNA SERPINA1_21 (spacer region of SEQ ID NO: 21) (“SERPINA1_16+21”), (ii) RNPs of Cas9 D10A nickase and gRNA SERPINA1_16 (at the same RNP amount as the total RNP amount of (i)) (“2x gRNA SERPINA1_16”), (iii) RNPs of Cas9 D10A nickase and gRNA SERPINA1_21 (at the same RNP amount as the total RNP amount of (i)) (“2x gRNA SERPINA1_21”), or (iv) RNPs of Cas9 D10A nickase and a gRNA targeting an off-target gene GFP having (spacer region of SEQ ID NO: 31) (at the same RNP amount as the total RNP amount of (i)) (“2x sgGFP”), with or without an A>G correction template (SERPINA1 A>G HDR 120bp_F (“Template-F”) or SERPINA1 A>G HDR 120bp_R (“Template-R”) of SEQ ID NO: 61 or 62, respectively). Exemplary results of SERPINA1 editing efficiency (left) and SERPINA1 HDR efficiency (right), upon treatments with different RNPs are shown.

[0170] FIGS.3C-3D provide exemplary results from Example 2-2. GM11423 cells, which are homozygous for rs28929474(A), were untreated or treated with (i) 1:1 ratio of RNPs of Cas9 D10A nickase and gRNA SERPINA1_16 (spacer region of SEQ ID NO: 16) and RNPs of Cas9 D10A nickase and gRNA SERPINA1_21 (spacer region of SEQ ID NO: 21) (“SERPINA1_16+21”), (ii) RNPs of Cas9 D10A nickase and gRNA SERPINA1_16 (at the same RNP amount as the total RNP amount of (i)) (“2x gRNA SERPINA1_16”), (iii) RNPs of Cas9 D10A nickase and gRNA SERPINA1_21 (at the same RNP amount as the total RNP amount of (i)) (“2x gRNA SERPINA1_21”), or (iv) RNPs of Cas9 D10A nickase and a gRNA targeting an off-target gene GFP having (spacer region of SEQ ID NO: 31) (at the same RNP amount as the total RNP amount of (i)) (“2x sgGFP”), with or without an A>G correction template (SERPINA1 A>G HDR 120bp_F (“Template-F”) or SERPINA1 A>G HDR 120bp_R (“Template-R”) of SEQ ID NO: 61 or 62, respectively). Exemplary results of SERPINA1 editing efficiency (FIG.3C left) and SERPINA1 HDR efficiency (FIGS.3C right), relative SERPINA1 expression (FIG.3D left) and percentages of HDR- corrected and non-corrected (i.e., Z-allele) SERPINA1 transcripts (FIG.3D right), upon treatments with different RNPs are shown.

[0171] FIG.3E provides exemplary results from Example 2-2. HLCs from healthy hPSCs were untreated or treated with (i) 1:1 ratio of RNPs of Cas9 D10A nickase and gRNA SERPINA1_16 (spacer region of SEQ ID NO: 16) and RNPs of Cas9 D10A nickase and gRNA SERPINA1_21 (spacer region of SEQ ID NO: 21) (“SERPINA1_16+21”), (ii) RNPs of Cas9 D10A nickase and gRNA SERPINA1_16 (at the same RNP amount as the total RNP amount of (i)) (“2x gRNA SERPINA1_16”), (iii) RNPs of Cas9 D10A nickase and gRNA SERPINA1_21 (at the same RNP amount as the total RNP amount of (i)) (“2x gRNA SERPINA1_21”), or (iv) RNPs of Cas9 D10A nickase and a gRNA targeting an off-target gene (at the same RNP amount as the total RNP amount of (i)) (“2x Negative Control”), with or without an A>G correction template (SERPINA1 A>G HDR 120bp_F (“Template-F”) or SERPINA1 A>G HDR 120bp_R (“Template-R”) of SEQ ID NO: 61 or 62, respectively). Exemplary results of SERPINA1 editing efficiency (left) and percentages of HDR- corrected and non-corrected (i.e., M allele) SERPINA1 transcripts (right), upon treatments with different RNPs with or without a template are shown.

[0172] FIG.3F provides exemplary results from Example 2-6. HLCs from A1ATD hPSCs were untreated or treated with (i) 1:1 ratio of RNPs of Cas9 D10A nickase and gRNA SERPINA1_16 (spacer region of SEQ ID NO: 16) and RNPs of Cas9 D10A nickase and gRNA SERPINA1_21 (spacer region of SEQ ID NO: 21) (“SERPINA1_16+21”), (ii) RNPs of Cas9 D10A nickase and gRNA SERPINA1_16 (at the same RNP amount as the total RNP amount of (i)) (“2x gRNA SERPINA1_16”), (iii) RNPs of Cas9 D10A nickase and gRNA SERPINA1_21 (at the same RNP amount as the total RNP amount of (i)) (“2x gRNA SERPINA1_21”), or (iv) RNPs of Cas9 D10A nickase and a gRNA targeting an off-target gene (at the same RNP amount as the total RNP amount of (i)) (“2x Negative Control”), with or without an A>G correction template (SERPINA1 A>G HDR 120bp_F (“Template-F”) or SERPINA1 A>G HDR 120bp_R (“Template-R”) of SEQ ID NO: 61 or 62, respectively). Exemplary results of normalized levels of secreted A1AT protein measured by ELISA upon treatments with different RNPs are shown.

[0173] FIG.4A provides exemplary results from Example 3-1. Ai14 mice received an IV tail vein injection of 200 µL containing TCVs (DODMA / DOPE / DSPC / Cholesterol = 30 / 20 / 10 / 40 mole %) encapsulating RNPs of Cas9-gRNA (LaRo and LoxP). Mice were perfused 7 days later, and immunohistochemistry (IHC) was performed on liver sections to amplify tdTomato signal. Top image was taken at 4x magnification and shows a cross-section of the entire liver. White boxes highlight the regions of the bottom images which were taken at 10x magnification.

[0174] FIG.4B provides exemplary results from Example 3-2. Ai14 mice received an IV tail vein injection of 150 µL containing TCVs (DODMA / DOPE / DSPC / Cholesterol / PEG-lipid = 30 / 20 / 10 / 38.5 / 1.5 mole %) encapsulating RNPs of Cas9-gRNA (LaRo and LoxP). Mice were perfused 7 days later, and IHC was performed on liver sections to amplify tdTomato signal. Left and right images from separate liver sections were taken at 10x magnification.

[0175] FIG.5A provides a schematic of SERPINA1 editing strategy using Cas12a nuclease and a SERPINA1-targeting gRNA (SERPINA1_1_Cas12a, which is rs28929474(A) allele-specific, or SERPINA1_2_Cas12a).

[0176] In the top, the coding and non-coding SERPINA1 rs28929474(A) allele sequences (SEQ ID NOS: 43 and 44, respectively) of a 120-bp span around rs28929474(A) (position 94,378,610, shown with a downward filled arrow) are shown. The 5’-TTTN-3’ PAMs which may be recognized by Cas12a complexed with “SERPINA1_1A_Cas12a” and “SERPINA1_2_Cas12a” are shown with dotted underlines appended with [1] and [2], respectively. The sequences corresponding to the spacer regions of “SERPINA1_1A_Cas12a” and “SERPINA1_2_Cas12a” are shown with double-headed arrows (SEQ ID NOS: 201 and 202, respectively). The approximate positions of staggered double- strand breaks (DSBs) induced by Cas12a complexed with “SERPINA1_1A_Cas12a” and “SERPINA1_2_Cas12a” are shown with open triangles appended with [1] and [2], respectively. Exemplary templates of the forward orientation (i.e., same orientation as the coding strand) and the reverse orientation (i.e., same orientation as the non-coding strand) having the sequence of (SEQ ID NOS: 61 and 62, respectively), which may be used (e.g., as a ssODN or dsODN) for inducing A>G correction, are also shown. When a DSB (at the positions of two open triangles appended with [1] or two open triangles appended with [2] is created, the template may mediate A>G correction by HDR (shown with two dashed “X” marks). Additionally, when HDR does not occur and a non-sense mutation is created, SERPINA1 may be inactivated, e.g., via nonsense-mediated mRNA decay (NMD).

[0177] In the bottom, the coding and non-coding SERPINA1 rs28929474(G) allele sequences (SEQ ID NOS: 45 and 46, respectively) of a 120-bp span around rs28929474(G) (position 94,378,610, shown with a downward filled arrow) are shown. The 5’-TTTN-3’ PAMs which may be recognized (if it was the rs28929474(A) allele) by Cas12a complexed with “SERPINA1_1A_Cas12a” and “SERPINA1_2_Cas12a” are shown with dotted underlines appended with [1] and [2], respectively. The rs28929474(G) base creates a mismatch in the seed region of “SERPINA1_1A_Cas12a”, and thus “SERPINA1_1A_Cas12a” would not bind to the rs28929474(G) allele efficiently.

[0178] FIG.5B provides exemplary results from Example 4-1. GM11423 cells, which are homozygous for rs28929474(A), were untreated or treated with (i) RNPs of Cas12a nuclease and a negative control gRNA (“Off-target”) or (ii) RNPs of Cas12a and a SERPINA1-targeting gRNA (“SERPINA1_2_Cas12a”, having the spacer region of SEQ ID NO: 202), with or without an A>G correction template (SERPINA1 A>G HDR 120bp_F (“Template-F”) or SERPINA1 A>G HDR 120bp_R (“Template-R”) of SEQ ID NO: 61 or 62, respectively). Exemplary results of SERPINA1 editing efficiency measured by TIDE (left), relative SERPINA1 expression measured by qPCR (center), and percentages of HDR-corrected and non-corrected (i.e., Z-allele) SERPINA1 transcripts measured using dPCR (right), upon treatments with different RNPs are shown.

[0179] FIG.5C provides exemplary results from Example 4-2. GM11423 cells, which are homozygous for rs28929474(A), were untreated or treated with (i) RNPs of Cas12a nuclease and a negative control gRNA (“Off-target”) or (ii) RNPs of Cas12a and a SERPINA1-targeting gRNA (“SERPINA1_2_Cas12a”, having the spacer region of SEQ ID NO: 202), at different Cas12a:gRNA ratios of 1:0.5, 1:1.2, 1:2, 1:4, 1:8, and 1:16. Exemplary results of SERPINA1 editing efficiency measured by TIDE are shown. DETAILED DESCRIPTION OF THE INVENTION

[0180] The present disclosure provides, among other things, gRNAs, combinations of gRNAs (dual gRNAs), polynucleotides, vectors, RNPs, combinations of RNPs (dual RNPs) compositions, kits, and methods (of manufacturing, gene editing, and preventing and treating) relating to SERPINA1 gene editing. SERPINA1 may be edited using one gRNA (single-guide approach), two gRNAs (dual-guide approach), or more than two gRNAs. gRNAs, gRNA combinations, polynucleotides, and vectors

[0181] In one aspect, the present disclosure provides gRNAs for SERPINA1 gene editing.

[0182] Certain mutations in SERPINA1 can lead to A1ATD (such as rs28929474(A), which results in Glu366Lys in A1AT and thereby reductions in functional A1AT levels and A1AT accumulation in the liver). Correction of such a mutation to restore functional A1AT levels and / or editing of mutated SERPINA1 to reduce A1AT accumulation in the liver may prevent or treat A1ATD.

[0183] In some embodiments, a programmable nuclease (e.g., any Cas proteins disclosed herein, such as a Cas nuclease or a Cas nuclease) complexed with a gRNA which hybridizes via the spacer region (contained in the gRNA) with a target sequence proximal to (e.g., within about 200 nt upstream or downstream from) the nucleotide position of rs28929474(A) may be used for such gene editing and / or correction.

[0184] In some embodiments, such a target sequence may be contained in the sequence span shown as SEQ ID NOS: 41 and 42 in FIG.1A. In certain embodiments, a target sequence may be the sequence (e.g., of about 17-30 nt, such as 18, 19, 20, 21, 22, 23, 24, or 25 nt) immediately adjacent to a PAM segment (comprising a PAM in one of the strands of the PAM segment) in the sequence span shown in FIG.1A. Although FIG.1A particularly points out 5’-NGG-3’ and 5’-TTTN-3’ PAMs, such a PAM may also encompass other PAMs used by programable nucleases such as Cas protein. In certain embodiments, a target sequence may be the sequence (e.g., of about 17-25 nt, such as 18, 19, 20, 21, 22, or 23 nt) immediately downstream of a PAM segment (which contains a PAM shown with a solid underline) in the strand not containing the PAM in FIG.1A. In particular embodiments, the target sequence may be SEQ ID NO: 103, 102, 104, 116, 121, 101, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 117, 118, 119, 120, or 122. In certain embodiments, a target sequence may be the sequence (e.g., of about 18-30 nt, such as 19, 20, 21, 22, 23, 24, or 25 nt) immediately upstream of a PAM segment (which contains a PAM shown with a dotted underline) in the strand not containing thePAM in FIG.1A. In particular embodiments, the target sequence may be SEQ ID NO: 301, 302, or 303.

[0185] In some embodiments, a gRNA according to the present disclosure may comprise a spacer region which hybridizes with any of the foregoing target sequences.

[0186] In some embodiments, a gRNA may comprise a spacer region having the same sequence as the sequence (e.g., of about 17-30 nt, such as 18, 19, 20, 21, 22, 23, 24, or 25 nt) immediately adjacent to the PAMs shown in FIG.1A. In certain embodiments, the sequence of a spacer region may be the same as the sequence (e.g., of about 17-25 nt, such as 18, 19, 20, 21, 22, or 23 nt) immediately upstream of the PAMs shown with solid underlines in FIG.1A (which may be used with, e.g., a Cas9 protein). In certain embodiments, the sequence of a spacer region may be the same as the sequence (e.g., of about 18-30 nt, such as 19, 20, 21, 22, 23, 24, or 25 nt) immediately downstream of the PAMs shown with dotted underlines in FIG.1A (which may be used with, e.g., a Cas12a protein).

[0187] In some embodiments, a gRNA may have a spacer region of 15 or more nucleotides in length, such as between 15-30, 16-25, 18-22, 18, 19, 20, or 21 nucleotides. In certain embodiments, a gRNA may have a spacer region of 20 nucleotides. For example, such a gRNA may be used with a Cas9 protein. In some embodiments, a gRNA may have a spacer region of 18 or more nucleotides in length, such as between 18-30, 19-25, 20-23, 20, 21, 22, or 23 nucleotides. In certain embodiments, a gRNA may have a spacer region of 21 nucleotides. For example, such a gRNA may be used with a Cas12a protein. The spacer region may have any numbers of nucleotides in length, as long as the spacer region specifically binds to a target sequence.

[0188] A spacer region may comprise or consist of a seed region and a non-seed region, wherein stricter complementarity to the target sequence is required in the seed region than the non-seed region. In some embodiments, a spacer region may comprise a seed region of about 7, 8, 9, 10, 11, or 12 nucleotides in length. The remaining region of the spacer region may be the non-seed region.

[0189] In certain embodiments, e.g., for a gRNA which is to be used with a Cas9 protein, the seed region may be 12, 11, 10, 9, 8, or 7 nucleotides in length. Therefore, if the spacer region is 20 nucleotides in length the non-seed region may be about 13, 12, 11, 10, 9, or 8 nucleotides in length, if the spacer region is 19 nucleotides in length the non-seed region may be about 12, 11, 10, 9, 8, or 7 nucleotides in length, and if the spacer region is 21 nucleotides in length, the non-seed region may be about 14, 13, 12, 11, 10, or 9 nucleotides in length. In particular embodiments, a spacer region may comprise a seed region of about 12 nucleotides in length and a non-seed region of about 8 nucleotides in length.

[0190] In certain embodiments, e.g., for a gRNA which is to be used with a Cas12a protein, the seed region may be 7, 6, 5, or 4 nucleotides in length. If the spacer region is 21 nucleotides in length, the non-seed region may be about 14, 15, 16, or 17 nucleotides in length, and if the spacer region is 20 nucleotides in length, the non-seed region may be about 13, 14, 15, or 16 nucleotides in length. Inparticular embodiments, a spacer region may comprise a seed region of about 7 nucleotides in length and a non-seed region of about 14 nucleotides in length.

[0191] In certain embodiments, the polynucleotide sequence of a spacer region may comprise one or more (e.g., one, two, or three) mutations relative to any of the sequences of the foregoing spacer regions. Such a mutation may be a transition, a transversion, a deletion, or an insertion (e.g., at the 5’- end for example in a gRNA for Cas9, or at the 3’-end for example in a gRNA for Cas12a). In some cases, the mutation may be in the non-seed region of the spacer region.

[0192] In some embodiments, a gRNA which specifically and / or selectively hybridizes with the rs28929474(A) allele (the coding or non-coding sequence) may be used.

[0193] In certain embodiments, the spacer region of SEQ ID NO: 3, 2, 4, or 20 or a variant comprising one or more mutations relative to SEQ ID NO: 3, 2, 4, or 20 may be used. Such a mutation may be a transition, a transversion, a deletion, or an insertion (e.g., at the 5’-end). In some cases, the mutation may be in the non-seed region of the spacer region. In certain cases, the one or more mutations may be at 19 nt and / or 20 nt counting from the 3’-end of the spacer region. In certain cases, the seed region of the spacer region is capable of hybridizing with a SERPINA1 target sequence at the rs28929474(A) position. In such cases, the seed region has one mismatch relative to the rs28929474(A) allele at the rs28929474(G) position. In particular cases, the spacer region does not have a mismatch in the seed region. In particular embodiments, the spacer region may comprise: X1X2CTGACCATCGACAAGAAA (SEQ ID NO: 53) (X1is any of A, T, C, or G, optionally A, C, or G; and X2is any of A, T, C, or G, optionally A, T, or C ); X1X2GCTGACCATCGACAAGAA (SEQ ID NO: 52) (X1is any of A, T, C, or G, optionally A, T, or C; and X2is any of A, T, C, or G, optionally A, C, or G ); or X1X2CAGTCCCTTTCTTGTCGA (SEQ ID NO: 54) (X1is any of A, T, C, or G, optionally A, C, or G; and X2is any of A, T, C, or G, optionally A, C, or G). In certain embodiments, at least one of X1and X2in each spacer region may create a mismatch. In particular embodiments, either one of X1and X2in each spacer region may create a mismatch. See FIG.1E.

[0194] In certain embodiments, the spacer region of SEQ ID NO: 201, 202, or 203, or a variant comprising one or more mutations relative to SEQ ID NO: 201, 202, or 203 may be used. Such a mutation may be a transition, a transversion, a deletion, or an insertion (e.g., at the 3’-end). In some cases, the mutation may be in the non-seed region of the spacer region. In certain cases, the one or more mutations may be at 9 nt, and / or at 20 and / or 21 nt counting from the 5’-end of the spacer region. In certain cases, the seed region of the spacer region is capable of hybridizing with a SERPINA1 target sequence at the rs28929474(A) position. In such cases, the seed region has one mismatch relative to the rs28929474(A) allele at the rs28929474(G) position. In particular cases, the spacer region does not have a mismatch in the seed region. In particular embodiments, the spacer region may comprise: TTGTCGATGGTCAGCACAX1X2X3(SEQ ID NO: 251) (X1is any of A, T, C, or G, optionally A, T, or C; X2is any of A, T, C, or G, optionally A, T, or G; and X3is any of A, T, C, or G, optionally A, T, or G). In certain embodiments, at least one of X1and X2in each spacer regionmay create a mismatch. In particular embodiments, either one of X1and X2in each spacer region may create a mismatch. See FIG.1F.

[0195] In some embodiments, one or more gRNA disclosed herein may be comprised in a composition. The present disclosure also provides combinations of two or more gRNAs for SERPINA1 gene editing. Any gRNA combinations which comprises at least one gRNA described herein are encompassed by the present disclosure. In some embodiments, any such gRNA combinations may be contained in a composition. In certain embodiments, when two gRNAs are used in combination, the two gRNAs may hybridize with target sequences within SERPINA1 that are in the opposite strands. In certain embodiments, when two gRNAs are used in combination, the two gRNAs may hybridize with target sequences within SERPINA1 that are in the same strands but are not overlapped. In certain embodiments, when two gRNAs are used in combination, the two gRNAs may hybridize with target sequences within SERPINA1 such that, when Cas proteins are used in combination, the two PAMs (or the 5’-ends thereof) are apart from each other by about 1-120 nt, about 1-100 nt, about 1-80 nt, about 1-60 nt, about 1-40 nt, about 1-30 nt, or 1-20 nt.

[0196] In some embodiments, one gRNA may be used for editing SERPINA1 (single-guide approach). In some embodiments, two gRNAs may be used in combination for editing SERPINA1 (dual-guide approach).

[0197] In some embodiments, more than two gRNAs may be used together for editing SERPINA1. In certain embodiments, at least one of the gRNAs may be specific to or selective for the rs28929474(A) allele (e.g., gRNA comprising a spacer region of SEQ ID NO: 3, 2, 4, 20, 53, 52, or 54, or 202). In particular embodiments, both of the gRNAs may be specific to or selective for the rs28929474(A) allele. In certain embodiments, neither of the gRNAs may be specific to or selective for the rs28929474(A) allele.

[0198] In some embodiments, the gRNA may be a sgRNA.

[0199] In one aspect, the present disclosure also provides polynucleotides encoding one or more gRNAs disclosed herein.

[0200] In some embodiments, the polynucleotide may be in any form, e.g., a DNA, RNA, a DNA- RNA hybrid, or chemically modified nucleic acid molecule.

[0201] In some embodiments, the polynucleotide may be for recombinantly expressing the gRNA(s) encoded therein. In some embodiments, the polynucleotide may be for synthesizing (e.g., chemically synthesizing) the gRNA(s) encoded therein. In some embodiments, the polynucleotide may be for amplifying gRNA-encoding polynucleotides.

[0202] In another aspect, the present disclosure provides vectors comprising one or more polynucleotides encoding one or more gRNAs disclosed herein.

[0203] In some embodiments, a vector may comprise a compound, which may be an inorganic compound, an organic compound, or a hybrid thereof, or a composition. In certain embodiments, a vector may comprise calcium phosphate, polycations, cationic lipids, and / or phospholipids. In certainembodiments, a vector may comprise organic and nonorganic polymers, dendrimers, organic and nonorganic nanoparticles and nanobeads. In certain embodiments, a vector may comprise a lipid- based composition, such as a liposome, a lipid nanoparticle (LNP), or any of the lipid-based TCVs described herein. In certain embodiments, a vector may comprise a virus-like particles (VLP). In certain embodiments, a vector may comprise a plasmid. In certain embodiments, a vector may comprise a viral vector, such as a retroviral, lentiviral, or adenoviral vector. In certain embodiments, a vector may be an expression vector. In particular embodiments, a polynucleotide contained may comprise a gRNA-encoding sequence which is operably linked to a regulatory sequence such as a promoter sequence. RNPs

[0204] In one aspect, the present disclosure provides RNPs, particularly complexes of a programable nuclease and a gRNA, which may be used for editing SERPINA1.

[0205] The programable nuclease may be any programable nuclease which is capable of mediating an intended gene editing effect via the gRNA with which the programable nuclease is complexed with, such as but not limited to any of the programable nucleases disclosed herein.

[0206] In some embodiments, a programable nuclease may be a Cas protein. In certain embodiments, a programable nuclease may be a Cas9 protein, such as a Cas9 nuclease or nickase. In some cases, the Cas9 nickase may have an inactivated RuvC domain. In some cases, the Cas9 nickase may have an inactivated HNH domain. In particular embodiments, a programable nuclease may be a SpCas9 protein, such as a SpCas9 nuclease or nickase. In some cases, the SpCas9 nuclease may have the sequence of SEQ ID NO: 140 or a sequence having at least 90%, 95%, 98%, or 99% sequence identity thereto while maintaining the endonuclease activities on both target and non-target strands. In some cases, the SpCas9 nickase may be SpCas9 D10A nickase or any SpCas9 nickase containing D10A including those disclosed herein. In particular cases, the SpCas9 D10A nickase may have the sequence of SEQ ID NO: 160 or a D10A-containing sequence having at least 90%, 95%, 98%, or 99% sequence identity thereto while maintaining the nickase activities on the target strand. In some cases, the SpCas9 nickase may be a SpCas9 nickase containing D839A, H840A, and / or N863A, including those disclosed herein. In particular cases, the SpCas9 nickase containing D839A, H840A, and / or N863A may have the sequence of SEQ ID NO: 169, 167, or 168, respectively, or a sequence containing D839A, H840A, and / or N863A, respectively and having at least 90%, 95%, 98%, or 99% sequence identity SEQ ID NO: 169, 167, or 168, respectively, while maintaining the nickase activities on the non-target strand. In particular embodiments, a programable nuclease may be a SaCas9 protein, such as a SaCas9 nuclease or nickase. In some cases, the SaCas9 nickase may be SaCas9 D10A nickase or any SaCas9 nickase containing D10A including those disclosed herein. In particular cases, the SaCas9 D10A nickase may have the sequence of SEQ ID NO: 158 or a D10A-containing sequence having at least 90%, 95%, 98%, or 99% sequence identity thereto while maintaining the nickase activities on the target strand.

[0207] In certain embodiments, a programable nuclease may be a Cas12a protein, such as a Cas12a nuclease or nickase. In particular embodiments, a programable nuclease may be a AsCas12a protein, such as a AsCas12a nuclease or nickase. In some cases, the AsCas protein may comprise any one of SEQ ID NOS: 210-215, or a sequence having at least 90%, 95%, 98%, or 99% sequence identity thereto. In particular embodiments, a programable nuclease may be a LbCas12a protein, such as a LbCas12a nuclease or nickase. In some cases, the AsCas protein may comprise any one of SEQ ID NOS: 220-221, or a sequence having at least 90%, 95%, 98%, or 99% sequence identity thereto. In particular embodiments, a programable nuclease may be a FnCas12a protein, such as a FnCas12a nuclease or nickase. In some cases, the AsCas protein may comprise SEQ ID NO: 222, or a sequence having at least 90%, 95%, 98%, or 99% sequence identity thereto.

[0208] The gRNA may be any of those described herein.

[0209] In some embodiments, the gRNA may be a sgRNA.

[0210] In some embodiments, a gRNA may have a spacer region of about 17-23 nt (e.g., 19, 20, 21 nt) in length having the spacer region which hybridizes with any of the targets of SEQ ID NO: 101- 122 or 301-303.

[0211] In some embodiments, the polynucleotide sequence of the seed region of the spacer region may be fully complementary to a target sequences elected from SEQ ID NO: 101-122 or 301-303 (particularly, the PAM-proximal segment of the target sequence). In certain embodiments, the polynucleotide sequence of the seed region of the spacer region may be fully complementary to the target sequences of SEQ ID NO: 103, 102, or 104, or 202 (particularly, the PAM-proximal segment of the target sequence). In such an embodiments, the polynucleotide sequence of the seed region may have a mismatch relative to SEQ ID NO: 133, 132, or 134, or 302, respectively (particularly, the PAM-proximal segment of the target sequence), at the rs28929474 SNP position.

[0212] In some embodiments, the sequence of the non-seed region of the spacer region may be fully complementary to the target polynucleotides of SEQ ID NO: 101-122 or 301-303 (particularly, the PAM-distal segment of the target sequence).

[0213] In certain embodiments, the sequence of the spacer region may be fully complementary to a target polynucleotide selected from SEQ ID NO: 101-122 or 301-303 (particularly, the PAM-distal segment of the target sequence).

[0214] In certain embodiments, the sequence of the spacer region may be fully complementary to the target polynucleotides of SEQ ID NO: 101-122 or 301-303. In particular embodiments, the spacer region may have the sequence of SEQ ID NO: 3, 2, 4, 16, 21, 1, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 20, or 22, 201, 202, or 203, or a truncated version thereof, particularly those truncated at the PAM- distal end, i.e., the 5’-end (for SEQ ID NOS: 3, 2, 4, 16, 21, 1, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 20, or 22) or the 3’-end (SEQ ID NO: 201, 202, or 203), e.g., by 1, 2, or 3 nt.

[0215] In some embodiments, the sequence of the non-seed region of the spacer region may have one or more mismatches relative to a target polynucleotide selected from SEQ ID NO: 101-122(particularly, the PAM-distal segment of the target sequence). In certain embodiments, the mismatch may be at 19 or 20 nt away from the 3’-end of the spacer region.

[0216] In some embodiments, the sequence of the non-seed region of the spacer region may have one or more mismatches relative to a target polynucleotide selected from SEQ ID NO: 301-303 (particularly, the PAM-distal segment of the target sequence). In certain embodiments, the mismatch may be at 9 nt and / or 20 and / or 21 nt away from the 5’-end of the spacer region.

[0217] In particular embodiments, the spacer region may have the sequence of SEQ ID NO: 53, 52, or 54, or 251.

[0218] The RNP may be a complex of any of the aforementioned gRNAs and any of the programable endonuclease, nickase, or derivative thereof which as a complex is capable of editing SERPINA1.

[0219] In some embodiments, one RNP may be used for editing SERPINA1 (single-guide approach).

[0220] In certain embodiments, the gRNA contained in an RNP may be a sgRNA comprising the spacer region of SEQ ID NO: 3, 2, 4, 20, 53, 52, or 54, and the gRNA may be a Cas9 nuclease such as SpCas9 nuclease. In certain embodiments, the gRNA contained in an RNP may be a sgRNA comprising the spacer region of SEQ ID NO: 251, and the gRNA may be a Cas12a nuclease such as AsCas12a nuclease.

[0221] In some embodiments, two RNPs may be used in combination for editing SERPINA1 (dual- guide approach). In some embodiments, more than two gRNAs may be used together for editing SERPINA1. When two or more RNPs are used, the two or more RNPs may comprise: a first RNP comprising a first gRNA (which comprises a first spacer region) complexed with a first programable endonuclease, nickase, or derivative thereof; and a second RNP comprising a second gRNA (which comprises a second spacer region) complexed with a second programable endonuclease, nickase, or derivative thereof.

[0222] In certain embodiments, the first and second programable endonuclease, nickase, or derivative thereof are the same or essentially the same programable endonuclease, nickase, or derivative thereof. In certain embodiments, the first and second programable endonuclease, nickase, or derivative thereof are different programable endonucleases, nickases, or derivatives thereof.

[0223] In certain embodiments, the first and second RNPs may be capable of cleaving opposite strands of SERPINA1. In certain embodiments, the first and second RNPs may be capable of cleaving the same strands of SERPINA1.

[0224] In certain embodiments, at least one of the first and second RNPs may be capable of causing editing in a manner specific to or selective for the rs28929474(A) allele. In particular embodiments, the at least one of the gRNAs may comprise the spacer region of SEQ ID NO: 3, 2, 4, 20, 53, 52, or 54. In particular embodiments, the programable endonuclease, nickase, or derivative thereof complexed with the at least one of the gRNAs may be a nickase such as a Cas9 nickase such as one containing an inactivated RuvC domain or an inactivated HNH domain, for example derived from SpCas9 or SaCas9.

[0225] In certain embodiments, both of the first and second RNPs may be capable of causing editing in a manner specific to or selective for the rs28929474(A) allele. In particular embodiments, the first and second spacer regions may comprise a spacer region individually selected from SEQ ID NO: 3, 2, 4, 20, 53, 52, or 54. For example, the first and second spacer regions may comprise the spacer region of SEQ ID NOS: 3 (or 53) and 2 (or 52), respectively, 2 (or 52) and 3 (or 53), respectively, 3 (or 53) and 4 (or 54), respectively, 4 (or 54) and 3 (or 53), respectively, 4 (or 54) and 2 (or 52), respectively, or 2 (or 52) and 4 (or 54), respectively. In particular embodiments, the first and second programable endonucleases, nickases, or derivatives thereof may individually be a nickase such as a Cas9 nickase such as one containing an inactivated RuvC domain or an inactivated HNH domain, for example derived from SpCas9 or SaCas9.

[0226] In certain embodiments, neither of the two RNPs may be capable of causing editing in a manner specific to or selective for the rs28929474(A) allele. In particular embodiments, the first and second spacer regions may comprise a spacer region individually selected from SEQ ID NO: 16, 21, 1, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, or 22. For example, the first and second spacer regions may comprise the spacer regions of SEQ ID NOS: 16 and 21, respectively, or 21 and 16, respectively. In particular embodiments, the first and second programable endonucleases, nickases, or derivatives thereof may individually be a Cas9 nickase such as SpCas9 nickase.

[0227] In certain embodiments, the first and second gRNAs hybridize with opposite strands of SERPINA1. In some cases, the first and second programable endonucleases, nickases, or derivatives thereof may be nickases having the same specificity regarding which strand to nick relative to the respective target strands (i.e., both nickases may cut the strand same as the target strand, or both nickases may cut the strand same as the non-target strand). In certain cases, the first and second programable endonucleases, nickases, or derivatives thereof may respectively be a nickase containing an inactivated RuvC domain. In certain cases, the first and second programable endonucleases, nickases, or derivatives thereof may respectively be a nickase containing an inactivated HNH domain, or vice versa.

[0228] In certain embodiments, the first and second gRNAs hybridize with same strands of SERPINA1. In some cases, the first and second programable endonucleases, nickases, or derivatives thereof may be nickases having the opposite specificity regarding which strand to nick relative to the respective target strands (i.e., one nickase may cut the strand same as the target strand, and the other nickase may cut the strand same as the non-target strand). In certain cases, the first programable endonuclease, nickase, or derivative thereof may be a nickase containing an inactivated RuvC domain and second programable endonuclease, nickase, or derivative thereof may be a nickase containing an inactivated HNH domain, or vice versa.

[0229] In some embodiments, a RNP may be formed by mixing a solution comprising a gRNA and a solution comprising a Cas protein at an approximately equimolar ratio. In certain embodiments, the mixing may be for about 5 minutes. In certain embodiments, the solution comprising a gRNA mayhave a pH of about 6 to 8, about 6.5 to 7.5, or optionally about 7. In certain embodiments, the solution comprising a Cas protein may have a pH of about 6 to 8, about 6.5 to 7.5, or optionally about 7. In certain embodiments, the resulting solution comprising a RNP may comprise a pH of about 6 to 8, about 6.5 to 7.5, or optionally about 7.

[0230] Any of the RNPs (one RNP, two RNPs, more than two RNPs, etc) may be comprised in a composition. Cas9

[0231] In certain embodiments, the Cas protein is a Cas9 nuclease or a variant thereof. In particular embodiments, the Cas protein is a Cas9 protein of Streptococcus pyogenes (SpCas9), Staphylococcus aureus Cas9 (SaCas9), Streptococcus thermophilus (StCas9), Neisseria meningitidis (NmCas9), Francisella novicida (FnCas9), Campylobacter jejuni (CjCas9), Streptococcus canis (ScCas9), or Staphylococcus auricularis (SauriCas9), or any engineered variants thereof, optionally SaCas9-HF, SpCas9-HF1, KKHSaCas9, eSpCas9, HypaCas9, FokI-Fused dCas9, xCas9, SpRY (variant of SpCas9), or SpG (variant of SpCas9), optionally comprising any one of SEQ ID NOS: 140-151.

[0232] In certain embodiments, the Cas protein is a Cas12a nuclease or a variant thereof. In particular embodiments, the Cas protein is Cas12a of Acidaminococcus sp. (AsCas12a), Lachnospiraceae bacterium (LbCas12a), Francisella novicida (FnCas12a), Moraxella bovoculi (MbCas12a), Coprococcus eutactus (CeCas12a), Butyrivibrio fibrisolvens (BdCas12a), Eubacterium rectale (ErCas12a), or any engineered variants thereof. In particular embodiments, the Cas12a may be AsCas12a Ultra, enAsCas12a, enAsCas12a-Hifi, enAsCas12a Ultra, enAsCas12a-Hifi Ultra, or LbCas12a Ultra, or MAD7, optionally comprising any one of SEQ ID NOS: 210-215, 220-221, and 222-225. Nickases

[0233] In some embodiments, the programable endonuclease, nickase, or derivative thereof is a nickase, such as a Cas nickase. Nickases cause a SSB instead of a DSB. A nickase may be derived from any nucleases, such as but not limited to any of the Cas9 nucleases disclosed herein (e.g., SpCas, SaCas, etc) and any of other nucleases disclosed herein.

[0234] Many Cas nucleases cause a DSB via two different domains, one which cuts a target strand and the other which cuts a non-target strand. Nickases may be generated by inactivating one of such two different domains. For example, a Cas9 endonuclease induces a DBS via the HNH domain which cuts the target strand (the strand which a gRNA binds to) and the RuvC domain which cuts the non- target strand (the strand which a gRNA does not bind to). Therefore, a Cas9 nickase may be generated by inactivating either the HNH domain or the Ruv domain of a Cas9 endonuclease.

[0235] D839, H840, N854, and N863 are individually known to be important in cutting a target strand, and amino acid substitutions at one or more of these positions may inactivate the HNH domain. Therefore, in some cases, a Cas9 nickase comprising a substitution at one or more of D839, H840, N854, and N863, e.g., one or more of D839A, H840A, N854A, and N863A, may be used tocause a SSB in a non-target strand but not in a target strand. In certain cases, a Cas9 nickase comprising D839A, comprising H840A, comprising N863A, comprising H840A + N863A, comprising D839A + H840A, comprising D839A + N863A, comprising N854 A + N863A, or comprising D839A + H840A + N863A may be used. In particular cases, a Cas9 nickase comprising SEQ ID NO: 167, 168, or 169 may be used.

[0236] D10 has a key role in cutting a non-target strand, and the substitution D10A inactivates the RuvC domain. Therefore, in some cases, a Cas9 nickase comprising a substitution at D10, e.g., D10A, may be used to cause a SSB in the target strand but not in a non-target strand. In particular cases, a Cas9 nickase comprising SEQ ID NO: 160 may be used.

[0237] Additional substitutions at L1111, D1135, G1218, E1219, A1322, R1335, T1337, such as but not limited to L1111R, D1135V or D1135E, G1218R, E1219F, A1322R, R1335Q or R1335E, T1337R may also be incorporated to any Cas nickases (or nuclease) disclosed herein. For example, D1135V + R1335Q + T1337R, D1135E + R1335Q + T1337R, D1135V + G1218R + R1335E + T1337R, or L1111R + D1135V + G1218R + E1219F + A1322R + R1335V + T1337R may be incorporated. In some cases, a Cas9 nickase comprising SEQ ID NO: 161, 162, 163, or 166 may be used.

[0238] In some cases, a circular permutation variant of any of the Cas9 nickases described herein may be used. A circular permutation variant is a variant protein or protein complex which has a different amino acid order (e.g., different domain order) relative to a parent protein or protein complex but overall retain a similar three-dimensional shape and / or function. In certain cases, a circular permutation Cas9 nickase of SEQ ID NO: 164 or 165 may be used. Cas-derived proteins

[0239] In some embodiments, a Cas-derived protein (a Cas derivative) may be derived from any appropriate Cas proteins (e.g., Cas9, Cas12a, etc) of any appropriate species including but not limited to any of the Cas and variants thereof described herein. In some embodiments, the Cas-derived protein may be or may comprise a Cas nickase, a Cas-derived protein capable of creating a single-strand break at a target DNA site rather than a double-strand break.

[0240] In certain embodiments, a Cas nickase may be a variant of a Cas protein, in which one of the nuclease domains of the parent domain is catalytically disabled / dead, e.g., an amino acid alteration. For example, in case of SpCas9 (wild-type sequence comprises SEQ ID NO: 140), D10A and H840A substitutions inactivates both of the nuclease domains of SpCas9, resulting in a catalytically dead SpCas9 and either D10A or H840A substitution inactivates one of the nuclease domains of SpCas9, resulting in a SpCas9 nickase. In particular embodiments, a SpCas9 nickase, “Cas9n” or “nCas9” may comprise SEQ ID NO: 160. The N-terminal “M” residue is not included in SEQ ID NOS: 160 and 167, so D10A and / or H840A appear at positions 9 and / or 839, respectively, in SEQ ID NOS: 160 and 167), and N863A and / or D839A appear at positions 862 and / or 838, respectively, in SEQ ID NOS: 168 and 169). SpCas9 endonucleases of another species origin may be altered similarly to produce a catalytically dead Cas9 and a Cas9 nickase by incorporating the corresponding substitution(s). Incertain embodiments, any other Cas9 nickases, including VQR-SpCas9 nickase (SEQ ID NO: 161), EQR-SpCas9 nickase (SEQ ID NO: 162), VRER-SpCas9 nickase (SEQ ID NO: 163), CP1028- SpCas9 (SEQ ID NO: 164), CP1041-SpCas9 (SEQ ID NO: 165), SpCas9-NG (SEQ ID NO: 166), SaCas9 nickase (SEQ ID NO: 158), or SaCas9-KKH (SEQ ID NO: 159), or a variant thereof, such as a Cas9 of another species origin but comprising one or more or all of the corresponding substitutions contained in the aforementioned Cas nickases, may also be used. Templates and polynucleotides

[0241] In one aspect, the present disclosure provides templates, such as DNA templates, which may be used for inducing correction from adenine to guanine at the rs28929474 position, and polynucleotides encoding such templates. Templates may be designed to be highly homologous (e.g., higher than 75% homology, higher than 80% homology, etc) to the sequence of one strand of (or highly complementary (e.g., higher than 75% complementarity, higher than 80% complementarity, etc) to the sequence of the other strand of) the target region so that the template may hybridize with the target region, while containing a specific base for introducing a mutation in the sequence to be added.

[0242] In some embodiments, such a template may a oligo-DNA and may be single-stranded (a ssODN) or double-stranded (a dsODN).

[0243] An ssODN may be: a coding ssODN, which is highly homologous to the coding strand (i.e., highly complementary to the non-coding strand) of the target region of SERPINA1; or a non-coding ssODN, which is highly homologous to the non-coding strand (i.e., highly complementary to the coding strand) of the target region of SERPINA1.

[0244] A coding ssODN according to the present disclosure may comprise a 5’-homology arm, a guanine (“G” base), and a 3’-homology arm, so that the ssODN may hybridize with the cleaved non- coding strand of the target region based on the high complementarity to the non-coding strand and during a repair process a new coding strand extended from the ssODN contains a “G” base is instead of the “A” base at the rs28929474 position.

[0245] SEQ ID NO: 183 is an exemplary 5’-homology arm sequence of 60 nt in length for a coding ssODN, which is fully homologous to the 60-nt sequence of the SERPINA1 coding strand immediately upstream of the rs28929474 position.

[0246] In some embodiments, a 5’-homology arm may comprise a polynucleotide corresponding to the first nucleotide to at least the 10th nucleotide (or up to any nucleotide which may be between 10th to 60th, between 10th to 50th, between 10th to 40th, between 10th to 30th, or between 10th to 20th nucleotides) counting from the 3’-end of SEQ ID NO: 183.

[0247] In some embodiments, a 5’-homology arm may comprise a polynucleotide which has one or more mutations relative to any of the foregoing 5’-homology arm sequences and / or have at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto. In certain embodiments,one or more of such mutations may be a silent mutation or a PAM-altering mutation. In particular embodiments, one or more of such mutations may be a PAM-altering, silent mutation. In some cases, such a PAM-altering, silent mutation may be any of those depicted in FIG.1B, 1C, or 1D. In certain cases a 5’-homology arm of a coding ssODN may have a 5’-homology arm sequence corresponding the first nucleotide to at least the 10th nucleotide (or up to any nucleotide which may be between 10th 60th, between 10th to 50th, between 10th to 40th, between 10th to 30th, or between 10th to 20th nucleotides counting from the 3’-end of SEQ ID NO: 173, 273, or 283, or a sequence which has one or more mutations relative to such a 5’-homology arm sequence.

[0248] SEQ ID NO: 184 is an exemplary 3’-homology arm sequence of 60 nt in length for a coding ssODN, which is fully homologous to the 60-nt sequence of the SERPINA1 coding strand immediately downstream of the rs28929474 position.

[0249] In some embodiments, a 3’-homology arm may comprise a polynucleotide corresponding to the first nucleotide to at least the 10th nucleotide (or up to any nucleotide which may be between 10th to 100th, between 10th to 80th, between 10th 70th, between 10th to 60th, between 10th to 50th, between 10th to 40th, between 10th to 30th, or between 10th to 20th nucleotides counting from the 5’- end of SEQ ID NO: 184.

[0250] In some embodiments, a 3’-homology arm may comprise a polynucleotide which has one or more mutations relative to any of the foregoing 3’-homology arm sequences and / or have at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto. In certain embodiments, one or more of such mutations may be a silent mutation or a PAM-altering mutation. In particular embodiments, one or more of such mutations may be a PAM-altering, silent mutation. In some cases, such a PAM-altering, silent mutation may be any of those depicted in FIG.1B, 1C, or 1D. In certain cases a 3’-homology arm of a coding ssODN may have a 3’-homology arm sequence corresponding the first nucleotide to at least the 10th nucleotide (or up to any nucleotide which may be between 10th 60th, between 10th to 50th, between 10th to 40th, between 10th to 30th, or between 10th to 20th nucleotides counting from the 5’-end of SEQ ID NO: 174, 274, or 284, or a sequence which has one or more mutations relative to such a 3’-homology arm sequence.

[0251] A non-coding ssODN according to the present disclosure may comprise a 5’-homology arm, a cytosine (“C” base), and a 3’-homology arm, so that the ssODN may hybridize with the cleaved coding strand of the target region based on the high complementarity to the coding strand and during a repair process a new non-coding strand extended from the ssODN contains a “C” base is instead of the “T” base at the rs28929474 position. During DNA replication, a new coding strand produced from the new non-coding strand as a replication template will now contain a “G” base is instead of the “A” base at the rs28929474 position.

[0252] SEQ ID NO: 185 is an exemplary 5’-homology arm sequence of 60 nt in length for a coding ssODN, which is fully homologous to the 60-nt sequence of the SERPINA1 non-coding strand immediately upstream of the rs28929474 position.

[0253] In some embodiments, a 5’-homology arm may comprise a polynucleotide corresponding to the first nucleotide to at least the 10th nucleotide (or up to any nucleotide which may be between 10th to 100th, between 10th to 80th, between 10th 70th, between 10th to 60th, between 10th to 50th, between 10th to 40th, between 10th to 30th, or between 10th to 20th nucleotides counting from the 3’- end of SEQ ID NO: 185.

[0254] In some embodiments, a 5’-homology arm may comprise a polynucleotide which has one or more mutations relative to any of the foregoing 5’-homology arm sequences and / or have at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto. In certain embodiments, one or more of such mutations may be a silent mutation or a PAM-altering mutation. In particular embodiments, one or more of such mutations may be a PAM-altering, silent mutation. In some cases, such a PAM-altering, silent mutation may be any of those depicted in FIG.1B, 1C, or 1D. In certain cases a 5’-homology arm of a coding ssODN may have a 5’-homology arm sequence corresponding the first nucleotide to at least the 10th nucleotide (or up to any nucleotide which may be between 10th 60th, between 10th to 50th, between 10th to 40th, between 10th to 30th, or between 10th to 20th nucleotides counting from the 3’-end of SEQ ID NO: 175, 275, or 285, or a sequence which has one or more mutations relative to such a 5’-homology arm sequence.

[0255] SEQ ID NO: 186 is an exemplary 3’-homology arm sequence of 60 nt in length for a non- coding ssODN, which is fully homologous to the 60-nt sequence of the SERPINA1 coding strand immediately downstream of the rs28929474 position.

[0256] In some embodiments, a 3’-homology arm may comprise a polynucleotide corresponding to the first nucleotide to at least the 10th nucleotide (or up to any nucleotide which may be between 10th to 100th, between 10th to 80th, between 10th 70th, between 10th to 60th, between 10th to 50th, between 10th to 40th, between 10th to 30th, or between 10th to 20th nucleotides counting from the 5’- end of SEQ ID NO: 186.

[0257] In some embodiments, a 3’-homology arm may comprise a polynucleotide which has one or more mutations relative to any of the foregoing 3’-homology arm sequences and / or have at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto. In certain embodiments, one or more of such mutations may be a silent mutation or a PAM-altering mutation. In particular embodiments, one or more of such mutations may be a PAM-altering, silent mutation. In some cases, such a PAM-altering, silent mutation may be any of those depicted in FIG.1B, 1C, or 1D. In certain cases a 3’-homology arm of a coding ssODN may have a 3’-homology arm sequence corresponding the first nucleotide to at least the 10th nucleotide (or up to any nucleotide which may be between 10th60th, between 10th to 50th, between 10th to 40th, between 10th to 30th, or between 10th to 20th nucleotides counting from the 5’-end of SEQ ID NO: 176, 276, 286, or a sequence which has one or more mutations relative to such a 3’-homology arm sequence.

[0258] In any of the aforementioned coding and non-coding templates, the 5’- and 3’-homology arms may individually be any length as long as the template hybridizes to the target region as intended.

[0259] In some embodiments, the 5’- and 3’-homology arms may individually be any length such as at least 10 nt, between 10-100 nt, between 10-60 nt. In certain embodiments, the 5’- and 3’-homology arms may individually be about 40 nt, 50 nt, or 60 nt in length. The 5’- and 3’-homology arms may or may not have the same length.

[0260] In any of the aforementioned templates, the template may individually be any length as long as the template hybridizes to the target region as intended.

[0261] In some embodiments, the ssODN may be any length such as at least 20 nt, about 20-200 nt, about 20-120 nt, about 60 nt, about 70 nt, about 80 nt, about 90 nt, about 100 nt, about 110 nt, or about 120 nt in length. In certain embodiments, the ssODN may be about 80 nt, about 85 nt, about 90 nt, about 95 nt, about 100 nt, about 105 nt, about 110 nt, about 115 nt, or about 120 nt in length.

[0262] A dsODN according to the present disclosure may comprise a coding strand having a sequence comprising or consisting of the sequence of a coding ssODN disclosed herein hybridized with a non-coding strand having a sequence comprising or consisting of the sequence of a non-coding ssODN disclosed herein. Compositions

[0263] In one aspect, the present disclosure provides compositions, which may be used for editing SERPINA1 and / or inducing correction from adenine to guanine at the rs28929474 position in SERPINA1.

[0264] In some embodiments, a composition may comprise any one or more of the RNPs disclosed herein. In certain embodiments, a composition may comprise one RNP. In certain embodiments, a composition may comprise two or more of the RNPs disclosed herein. In such an embodiments, the two or more of the RNPs may comprise a first RNP and a second RNP. In particular embodiments, the first and second RNPs may be according to any of the combinations of two RNPs disclosed herein.

[0265] In some embodiments, a composition may comprise: any one or more of the gRNAs disclosed herein or a polynucleotide encoding any one or more of the gRNAs disclosed herein; and any one or more of the programable nucleases disclosed herein or a polynucleotide encoding any one or more of the programable nucleases disclosed herein. Such a combination of the gRNA and the programable nuclease may be capable of forming any one or more of the RNPs disclosed herein.

[0266] In certain embodiments, a composition may comprise one gRNA (or a polynucleotide encoding one gRNA) and one programable nuclease (or a polynucleotide encoding one programable nuclease). In certain embodiments, a composition may comprise two or more gRNAs (or polynucleotides encoding two or more gRNA) and two or more programable nucleases (or apolynucleotide encoding two or more programable nucleases). In such an embodiment, the two or more gRNAs may comprise a first gRNA and a second gRNA, and the two or more programable nucleases may comprise a first programable nuclease and a second programable nuclease. The first gRNA and the first programable nuclease may be capable of forming a first RNP, and the second gRNA and the second programable nuclease may be capable of forming a second RNP. In particular embodiments, the first and second RNPs may be according to any of the combinations of two RNPs disclosed herein.

[0267] In some embodiments, a composition may further comprise any of the templates disclosed herein or a polynucleotide encoding any of the templates disclosed herein.

[0268] In some embodiments, a pharmaceutically acceptable carrier and / or excipient may also be comprised in a composition. In certain embodiments, the pharmaceutically acceptable carrier and / or excipient may comprise a lipid-based transfection competent vesicle (TCV).

[0269] TCVs

[0270] In some embodiments, an RNP (or a gRNA (or a polynucleotide encoding) and a programable nuclease, nickase, or a variant thereof (or a polynucleotide encoding)) or two or more RNPs comprising a first RNP (or a first gRNA (or a polynucleotide encoding) and a first programable nuclease, nickase, or a variant thereof (or a polynucleotide encoding)) and a second RNP (or a second gRNA (or a polynucleotide encoding) and a second programable nuclease, nickase, or a variant thereof (or a polynucleotide encoding)), and optionally a template, may be comprised in a composition with or may be comprised in or encapsulated in a lipid-based TCV including any of those described herein.

[0271] In particular embodiments, the TCV may comprise an ionizable cationic lipid, a helper lipid, a phospholipid, and cholesterol (or its derivative), e.g., at about 30:20:10:40, 30:10:20:40, 20:30:10:40, or 20:10:30:40 mol%. In particular embodiments, the TCV may comprise DODMA, DOPE, DSPC, and cholesterol, e.g., at about 30:20:10:40, 30:10:20:40, 20:30:10:40, or 20:10:30:40 mol%. In some cases, the TCV may contain a PEG-conjugated lipid (“PEG-lipid), e.g., at 0.5-2 mol% or about 0.5, 1, or 1.5 mol%. In particular embodiments, the TCV may comprise an ionizable cationic lipid, a helper lipid, a phospholipid, cholesterol (or its derivative), and a PEG-lipid, e.g., at about 30:20:10:30:1, 30:20:10:30.5:0.5, 30:10:20:39:1, 30:10:20:39.5:0.5, 20:30:10:39:1, 20:30:10:39.5:0.5, 20:10:30:39:1 or 20:10:30:39.5:1 mol%.

[0272] In particular embodiments, the TCV does not contain a permanently cationic lipid. In particular embodiments, the TCV does not contain a permanently anionic lipid. In particular embodiments, the ethanol concentration of the composition may be 5% (v / v) or below, preferably 0.5% (v / v) or below.

[0273] In particular embodiments, the composition may be substantially, essentially, or entirely free of ethanol.

[0274] In some embodiments, TCVs may be stored at a freezing temperature. In some embodiments, when a TCV is prepared, a cryoprotectant may be added. In some embodiments, a cryoprotectant may comprise a sugar-based molecule. Non-limiting examples of cryoprotectants include sucrose, trehalose, and a combination thereof.

[0275] In some embodiments, the TCV may further comprise at least one cryoprotectant. In certain embodiments, the at least one cryoprotectant may be or may comprise a sugar-based molecule, e.g., a sugar molecule or a derivative thereof. In particular embodiments, the at least one cryoprotectant may be sucrose, trehalose, or a combination thereof. In a particular embodiment, the at least one cryoprotectant may be sucrose.

[0276] In some embodiments, a pharmaceutical composition according to the present disclosure may comprise at least one cryoprotectant. In certain embodiments, the cryoprotectant in a pharmaceutical composition may be the cryoprotectant comprised in the TCV contained in the pharmaceutical composition.

[0277] In some embodiments, the TCV, which may comprise at least one cryoprotectant, may be stable at a freezing temperature, optionally at about -20℃ or about -80℃, optionally for at least about one week, at least about two weeks, at least about three weeks, at least about a month, at least about two months, at least about four months, at least about five months, at least about 6 months, at least about 9 months, at least about a year, or at least about two year, or longer, or about one week to about two year, about two weeks to about a year, about three weeks to about nine month, about one to about six months, about one to five months, about one to four months, about one to three months, or about one to two months.

[0278] In some embodiments, the concentration of the at least one cryoprotectant contained in the TCV or pharmaceutical composition may be about 1% to about 40 %, about 3% to about 30%, about 5% to about 30%, about 10% to about 20%, or about 15%.

[0279] Additional agents

[0280] In some embodiments, the composition may further comprise one or more additional agents. In certain embodiments, the one or more agents may be or may include alpha1-proteinase inhibitor or alpha1-antitripsin, such as PROLASTIN®, ARALAST®, and / or ZEMAIRA®.

[0281] In certain embodiments, the one or more additional agents may be or may include a medication used to treat a chronic lung disease, emphysema, chronic obstructive pulmonary disease (COPD), bronchiectasis, a chronic liver disease, neonatal cholestasis, cirrhosis, hepatocellular carcinoma or an increased risk thereof, liver failure, lung failure, and / or panniculitis.

[0282] In certain embodiments, the one or more additional agents may be or may include a bronchodilator and / or an anticholinergic medication, such as but not limited to albuterol, formoterol, salmeterol, vilanterol, titotropium, glycopyrrolate, indacaterol, arformoterol, levalbuterol, olodaterol, revefenacin, aclidinium, theophylline, tiotropium bromide, and ipratropium bromide.

[0283] In certain embodiments, the one or more additional agents may be or may include a steroid (e.g., inhaled steroid or oral steroid) such as but not limited to budesonide, fluticasone, flunisolide, mometasone, ciclesonide, beclomethasone, prednisone, hydrocortisone, prednisolone, methylprednisolone, and dexamethasone.

[0284] In certain embodiments, the one or more additional agents may be or may include a phosphodiesterase-4 inhibitor such as but not limited to apremilast, crisaborole, and roflumilast.

[0285] In certain embodiments, the one or more additional agents may be or may include an antibiotic, such as but not limited to penicillin antibiotics such as amoxicillin optionally with clavulanic acid, macrolides such as azithromycin and erythromycin, and tetracyclines such as doxycycline.

[0286] In certain embodiments, the one or more additional agents may be or may comprise any combination of the foregoing additional agents.

[0287] In certain embodiments, the one or more agents may be or may comprise an antiviral agent, such as but not limited to entecavir, lamivudine, telbivudine, glecaprevir, pibrentasvir, sofosbuvir, velpatasvir, and voxilaprevir. In certain embodiments, the one or more agents may be or may comprise an interferon. In certain embodiments, the one or more agents may be or may comprise methionine.

[0288] In certain embodiments, the one or more additional agents may be or may include medications for gastroesophageal reflux such as antacids, H2 blockers, and proton-pump inhibitors.

[0289] In certain embodiments, the one or more additional agents may be or may include diuretics such as spironolactone, furosemide, triamterene, chlorothiazide, and ethacrynic acid. In certain embodiments, the one or more additional agents may be or may include ademetionine, metadoxine, and / or ursodiol. In certain embodiments, the one or more additional agents may be or may include an antihypertensive drug such as but not limited to microzide, spironolactone, furosemide, chlorthalidone, torsemide, and ethacrynic acid

[0290] In certain embodiments, the one or more additional agents may be or may include a nonsteroidal anti-inflammatory drug (NSAID) such as aspirin or ibuprofen.

[0291] In certain embodiments, the one or more additional agents may be or may comprise any combination of the foregoing additional agents . Methods of manufacturing

[0292] Production of lipid-based TCVs

[0293] A lipid-based TCV according to the present disclosure may be prepared by any appropriate method. In some embodiments, a TCV may be prepared by (a) generating a first solution by dissolving all lipid components of the TCV in ethanol; (b) providing a second solution, which is aqueous; (c) combining the first and second solutions; and (d) removing ethanol, optionally by dialysis or evaporation.

[0294] In some embodiments, the lipid components in (a) may comprise an ionizable cationic lipid, a helper lipid, a phospholipid, and cholesterol (or its derivative), e.g., at about 30:20:10:40, 30:10:20:40, 20:30:10:40, or 20:10:30:40 mol%. In some embodiments, the lipid components in (a) may comprise an ionizable cationic lipid, a helper lipid, a phospholipid, cholesterol (or its derivative), and a PEG-lipid, e.g., at about 30:20:10:39:1, 30:20:10:39.5:0.5, 30:10:20:39:1, 30:10:20:39.5:0.5, 20:30:10:39:1, 20:30:10:39.5:0.5, 20:10:30:39:1 or 20:10:30:39.5:1 mol%.

[0295] In some embodiments, the first solution in step (a) may contain the TCV’s lipid components at about 20-35 mM. In some embodiments, the second solution in step (b) may contain sodium acetate and / or sodium citrate, which optionally may be at about 25 mM. In some embodiments, the pH of the second solution in step (b) may be about 4. In some embodiments, the combining in step (c) may be by gentle mixing (optionally repeated manual reciprocation of the TCV-generating fluid in a pipette), micromixing optionally using a staggered herringbone micromixer (SHM), T-junction or Y-junction mixing, or extrusion. In a particular embodiment, the removing in step (d) is by dialysis.

[0296] Production of RNPs

[0297] An RNP according to the present disclosure may be generated by any appropriate method. In some embodiments, the RNP may be formed by mixing a Cas protein and a gRNA at an approximately equimolar ratio, optionally for about 5 minutes.

[0298] Cargo encapsulation by TCVs

[0299] In some embodiments wherein the TCV comprise a RNP as a cargo, the RNP encapsulation by TCVs may be performed by any appropriate methods. In some embodiments, the encapsulation may be performed by (i) providing an aqueous solution comprising the TCV; and (ii) mixing the at least one RNP with the aqueous solution, wherein mixing is effected under conditions suitable for the at least one RNP to be encapsulated within the TCV. In some embodiments, the aqueous solution in step (i) may have the pH of about 3 to about 8, optionally about 4 to about 7.5. When a template is also included in the cargo, the at least one RNP and a template may be mixed together with the aqueous solution in step (ii).

[0300] In some embodiments, a first RNP and a second RNP of dual RNPs according to the present disclosure, may be comprised in the same composition.

[0301] In certain embodiments, the composition may comprise TCVs encapsulating both the first RNP and the second RNP, i.e., the first and second RNPs may be encapsulated by the same TCV. In such cases, the first and second RNPs may be added to an aqueous solution comprising TCVs to allow for encapsulation. When a template is also included in the cargo, the first and second RNPs and a template may be mixed together with the aqueous solution of TCVs.

[0302] In certain embodiments, the composition may comprise first TCVs encapsulating the first RNPs but not the second RNPs and second TCVs encapsulating the second RNPs but not the first RNPs. In such cases, the first RNPs may be added to an aqueous solution comprising TCVs to allow for encapsulation of the first RNP, and the second RNPs may be added to an aqueous solutioncomprising TCVs to allow for encapsulation of the second RNP. Once encapsulated, the encapsulated first RNPs and the encapsulated second RNP may be combined to provide a composition. When a template is also included in the cargo, the RNP and a template may be mixed together with the aqueous solution of TCVs.

[0303] In some embodiments, when one or more RNPs and a template is encapsulated in the same TCV, the ratio between the total RNPs and the template may be about 4:1, about 3:1, about 2:1, about 1:1, about 1:2, about 1:3, or about 1:4 mol%. In certain embodiments, the RNP:template ratio may be about 2:1.

[0304] In some embodiments wherein the TCV comprise a nucleic acid molecule (not RNPs) as a cargo, the nucleic acid molecule encapsulation by TCVs may be performed by any appropriate methods. In some embodiments, the encapsulation may be performed by: (i) providing an aqueous solution comprising the TCV; and (ii) mixing the nucleic acid molecule with the aqueous solution, wherein mixing is effected under conditions suitable for the at least one nucleic acid molecule to be encapsulated within the TCV. In some embodiments, the aqueous solution in step (i) may have the pH of about 3 to about 8, optionally about 4 to about 7.5. Methods of editing SERPINA1 and / or of preventing or treating A1ATD and A1ATD-associated lung and / or liver disease(s) and / or condition(s) in a subject

[0305] In one aspect, methods of editing SEPINA1 in one or more target cells are provided herein. The method may comprise contacting one or more target cells with any of the compositions (or with any of the RNPs or any of the gRNAs (or a polynucleotide encoding) and any of the programable nucleases, nickases, or derivatives thereof (or a polynucleotide encoding) for editing SEPINA1 according to the present disclosure.

[0306] In some embodiments, a target cell may be contacted (e.g., transfected) with an RNP according to the present disclosure. In some embodiments, a target cell may be contacted with a gRNA (or a polynucleotide encoding) according to the present disclosure and a programable nuclease, nickase, or derivative thereof (or a polynucleotide encoding) according to the present disclosure. In certain embodiments, a target cell may be contacted with both a gRNA (or a polynucleotide encoding) and a programable nuclease, nickase, or derivative thereof (or a polynucleotide encoding) together (or at the same time). In certain embodiments, a target cell may be contacted with a gRNA (or a polynucleotide encoding) and a programable nuclease, nickase, or derivative thereof (or a polynucleotide encoding)) separately (e.g., contained in a separate composition, at separate time points, etc). In some embodiments, a target cell may be further contacted with a template (or a polynucleotide encoding) according to the present disclosure.

[0307] In some embodiments, a target cell may be contacted with two RNPs (a first RNP comprising a first gRNA and a first programable nuclease, nickase, or derivative thereof and a second RNP comprising a second gRNA and a second programable nuclease, nickase, or derivative thereof) according to the present disclosure. In certain embodiments, a target cell may be contacted with boththe first RNP and the second RNP together (e.g., contained in the same composition, or separate compositions but contacted at the same timepoint, etc). In certain embodiments, a target cell may be contacted with the first RNP and the second RNP separately (e.g., contained in a separate composition, at separate timepoints, etc). In some embodiments, a target cell may be further (at the same time or at separate time points) contacted with a template (or a polynucleotide encoding) according to the present disclosure. In particular embodiments, a target cell may be contacted with the first RNP, the second RNP, and the template at the same time. In particular embodiments, the first RNP, the second RNP, and the template are contained in the same composition.

[0308] In some embodiments, a target cell may be contacted with a first gRNA (or a polynucleotide encoding), a first programable nuclease, nickase, or derivative thereof, a second gRNA (or a polynucleotide encoding), and a second programable nuclease, nickase, or derivative thereof (or a polynucleotide encoding) according to the present disclosure. In some embodiments, a target cell may be further (at the same time or at separate time points) contacted with a template (or a polynucleotide encoding) according to the present disclosure. In particular embodiments, a target cell may be contacted with the first RNP, the second RNP, and the template at the same time. In particular embodiments, the first RNP, the second RNP, and the template are contained in the same composition.

[0309] In certain embodiments, a target cell may be contacted with both the first gRNA (or a polynucleotide encoding) and the first programable nuclease, nickase, or derivative thereof (or a polynucleotide encoding) together (e.g., contained in the same composition, or separate compositions but contacted at the same timepoint, etc). In certain embodiments, a target cell may be contacted with the first gRNA (or a polynucleotide encoding) and the first programable nuclease, nickase, or derivative thereof (or a polynucleotide encoding) separately (e.g., contained in a separate composition, at separate timepoints, etc). In certain embodiments, a target cell may be contacted with both the second gRNA (or a polynucleotide encoding) and the second programable nuclease, nickase, or derivative thereof (or a polynucleotide encoding) together (e.g., contained in the same composition, or separate compositions but contacted at the same timepoint, etc). In certain embodiments, a target cell may be contacted with the second gRNA (or a polynucleotide encoding) and the second programable nuclease, nickase, or derivative thereof (or a polynucleotide encoding) separately (e.g., contained in a separate composition, at separate timepoints, etc).

[0310] In some embodiments, one gRNA (or a polynucleotide encoding a gRNA) may be used (comprised in the composition), which may be referred to herein as a “single-guide approach”. In certain embodiments, the gRNA complexed with a programable nuclease or a derivative thereof may cause a DSB. In some embodiments, two different gRNAs (a first gRNA and a second gRNA) (or polynucleotides encoding two different gRNAs) may be used (comprised in the composition), which may be referred to herein as a “dual-guide approach”. In certain embodiments, the first gRNA may be complexed with a first programable nuclease, nickase, or a derivative thereof to form a first RNP, and the second gRNA may be complexed with a second programable nuclease, nickase, or a derivativethereof to form a second RNP, wherein the first and second RNPs may be capable of cleaving opposite strands of a polynucleotide encoding SEPINA1.

[0311] In some embodiments, an rs28929474(A) allele of SEPINA1 may be edited. In some embodiments, an rs28929474(A) allele and another allele such as an rs28929474(G) allele of SEPINA1 may be edited.

[0312] In some embodiments, the editing may be specific to or selective for rs28929474(A). In certain embodiments, a gRNA specific to or selective for an rs28929474(A) allele may be used (comprised in the composition). In certain embodiments, two or more gRNAs, at least one of which may be specific to or selective for an rs28929474(A) allele, may be used (comprised in the composition). In certain embodiments, two gRNAs, both of which may be specific to or selective for an rs28929474(A) allele, may be used (comprised in the composition).

[0313] In some embodiments, the editing may promote alteration of the adenine (A) base at rs28929474. In some embodiments, the editing may promote A>G correction at rs28929474 by HDR. In some embodiments, the editing may inactivate SEPINA1 by non-sense mediated decay. In some embodiments, the editing may promote G>G correction at rs28929474 by HDR and inactivate SEPINA1 via non-sense mediated decay. In some embodiments, the editing may reduce expression of SERPINA1 rs28929474(A). In some embodiments, the editing may reduce expression of mutant alpha-1 antitrypsin (A1AT) protein comprising Glu366Lys.

[0314] In any of such embodiments, a template which may promote A>G correction at rs28929474 may be used (comprised in the composition).

[0315] In some embodiments, the one or more target cells may be a cell of a vertebrate. In some embodiments, the cells may be mammalian, optionally human, non-human primate, monkey, horse, cow, sheep, goat, pig, rabbit, dog, cat, or rodent (mouse, rat, guinea pig, hamster). In some embodiments, the cells may be non-mammalian, optionally bacterial, yeast, fungal, protozoa, plant, insect, amphibian, reptile, fish, or bird such as chicken. In particular embodiments, the cells may be human or non-human primate cells.

[0316] In some embodiments, the one or more target cells may be or may comprise a liver cell. In some embodiments, the one or more target cells may be or may comprise a bone marrow cell, a lymphocyte, a monocytic cell, a cell in a lymphoid tissue, or a Paneth cell of the gut, or a combination of any of the foregoing. In certain embodiments, the one or more target cells may be or may comprise a germ cell, an oocyte, an ovum, a spermatocyte, a sperm, a fertilized egg, an embryo, and / or a stem cell.

[0317] In some embodiments, the contacting may be in vitro or ex vivo. In certain embodiments, the method may be to evaluate the effect of A>G correction at rs28929474. In certain embodiments, the method may be to evaluate the potential therapeutic efficacy of A>G correction at rs28929474. In certain embodiments, the method may be to evaluate the effect of inactivation of SEPINA1. In certain embodiments, the method may be to prepare cells for therapeutic / clinical use (e.g., to be administeredor transplanted in a subject). In certain embodiments, cells prepared by a method of editing as disclosed herein may be for administration to a subject, e.g., a subject comprising at least one rs28929474(A) allele. In some cases, the method may further comprise administering at least one of the one or more target cells to a subject. In certain cases, the one or more target cells may be or comprise a liver cell and / or the administering may be into the liver. In certain cases, the one or more target cells may be or comprise a germ cell, an oocyte, an ovum, a spermatocyte, a sperm, a fertilized egg, an embryo, and / or a stem cell and / or the administering may be into a reproductive system / organ.

[0318] In certain embodiments, the contacting may comprise placing the cell and the composition (or with any of the RNPs or any of the gRNAs (or a polynucleotide encoding) and any of the programable nucleases, nickases, or derivatives thereof (or a polynucleotide encoding)) for editing SEPINA1 according to the present disclosure in a cell culture. In certain embodiments, the contacting may comprise injecting (e.g., microinjecting) the cell the composition (or with any of the RNPs or any of the gRNAs (or a polynucleotide encoding) and any of the programable nucleases, nickases, or derivatives thereof (or a polynucleotide encoding)) for editing SEPINA1 according to the present disclosure in a cell culture.

[0319] In some embodiments, the contacting may be in vitro in vivo, i.e., the method is for editing SERPINA1 in one or more target cells in a subject. In such embodiments, the contacting may be or may comprise administering the any of the compositions (or with any one or more of the RNPs or any one or more of the gRNAs (or a polynucleotide encoding) and any one or more of the programable nucleases, nickases, or derivatives thereof (or a polynucleotide encoding)) for editing SEPINA1 according to the present disclosure to a subject. Any of such methods may be according to any of the methods of preventing or treating A1ATD or an A1ATD-associated lung and / or liver disease(s) and / or condition(s) described herein. Subject

[0320] In certain embodiments, the subject may be a vertebrate. In certain embodiments, the subject may be a mammal, optionally a human, a non-human primate, a monkey, a horse, a cow, sheep, a goat, a pig, a dog, a cat, a rabbit, a rodent (mouse, rat, guinea pig, hamster), a rat, or a mouse. In certain embodiments, the subject may be a non-mammalian vertebrate, optionally a amphibian, reptile, fish, or bird such as chicken. In particular embodiments, the subject may be a human.

[0321] In certain embodiments, a subject may have A1ATD and / or an A1ATD-associated lung and / or liver disease(s) and / or condition(s). Exemplary A1ATD-associated lung and / or liver disease(s) and / or condition(s) may comprise a chronic lung disease, emphysema, chronic obstructive pulmonary disease (COPD), bronchiectasis, a chronic liver disease, neonatal cholestasis, cirrhosis, hepatocellular carcinoma or an increased risk thereof, liver failure, lung failure, and / or panniculitis.

[0322] In particular embodiments, the subject may have a SERPINA1 rs28929474(A) allele (or 2). In particular embodiments, the subject may be a patient with A1ATD. In particular embodiments, thesubject may be an animal model of A1ATD, such as a rodent model of A1ATD, a non-human primate model of A1ATD, etc. Administration route

[0323] In certain embodiments, the administering may be via any appropriate route. In some cases, local administration may be used, such as but not limited to inhalation or administration to the liver, bone marrow, lymphoid tissue, gut, ovary, testis, eye, ear, nose (optionally intranasally), skin (optionally transdermally or epicutaneously), mucosa, skin, or vagina. In some cases, parenteral administration may be used, such as but not limited to injection (optionally intravenous, intramuscular, subcutaneous, intradermal, intrathecal, intra-arterial, intraarticular, intraosseous, intraparenchymal, or intraperitoneal administration) or inhalation, optionally via an inhalation device or nebulizer. In some cases, enteral and / or mucosal administration may be used, such as but not limited to oral, sublingual, buccal, intranasal, vaginal or rectal administration. Dosing regimen

[0324] In certain embodiments, the administration may occur once. In certain embodiments, the administration may occur twice or more, such as twice, three time, four times, five times, or 2-10, 2- 15, or 2-30 times. In certain embodiments, the administration may be repeated at any appropriate intervals, such as but not limited to every day, every other day, twice per week, every week, every 2- 10 weeks, every month, or every 2-12 months, or more.

[0325] The composition for administration may comprise any amounts of cargo (e.g., one or more RNPs and a template) sufficient for effecting sufficient gene editing and / or gene expression alteration. In some embodiments, the pharmaceutical composition may comprise per mL about 300 pmol to about 30000 pmol, optionally about 500 to about 10000 pmol, about 1000 to about 5000 pmol, about 2000 to about 4000 pmol, about 2500 to about 3000 pmol, or about 2700 pmol of the RNP or the nucleic acid molecule. In particular embodiments, the pharmaceutical composition may comprise about 2700 pmol of the RNP or the nucleic acid molecule per mL.

[0326] With regard to any of the embodiments relating to methods of editing in vivo herein, in certain embodiments, the administration may be for preventing or treating A1AT deficiency (A1ATD) and / or an A1ATD-associated lung and / or liver disease(s) and / or condition(s). In certain embodiments, the method may be to test the effect of editing SERPINA1, optionally the rs28929474(A) allele, e.g., the effect of inactivating SERPINA1, optionally the rs28929474(A) allele, reducing the expression of the mutated A1AT, etc. In certain embodiments, the method may be to evaluate the potential therapeutic efficacy of any of the methods disclosed herein. Methods of preventing or treating A1ATD and A1ATD-associated lung and / or liver disease(s) and / or condition(s) in a subject

[0327] In one aspect, methods of preventing or treating A1ATD and / or an A1ATD-associated lung and / or liver disease(s) and / or condition(s) in a subject are provided herein. The method may compriseadministering to a subject any of the compositions (or with any of the RNPs or any of the gRNAs (or a polynucleotide encoding) and any of the programable nucleases, nickases, or derivatives thereof (or a polynucleotide encoding)) for editing SEPINA1 according to the present disclosure. Any of such methods may be according to any of the methods of editing SEPINA1 in one or more target cells in subject in vivo described herein.

[0328] In some embodiments, such an administration may be for preventing or treating A1ATD and / or an A1ATD-associated lung and / or liver disease(s) and / or condition(s). In some cases, the administration may prevent the onset of A1ATD. In some cases, the administration may prevent A1ATD. In some cases, the administration may prevent a symptom of A1ATD before manifestation of such a symptom. In some cases, the administration may slow progression of A1ATD. In some cases, the administration may treat A1ATD. In some cases, the administration may ameliorate a symptom of A1ATD. In some cases, the administration may reverse a lung symptom of A1ATD. Exemplary lung symptoms include but are not limited to chronic cough, shortness of breath and wheezing. In some cases, the administration may reverse a liver symptom of A1ATD. Exemplary liver symptoms include but are not limited to tiredness, loss of appetite, weight loss, swelling of the feet or belly, yellowish discoloration of the skin (jaundice) or white part of the eyes, vomiting of blood, or blood in stools.

[0329] In some embodiments, a subject may be administered an RNP according to the present disclosure. In some embodiments, a subject may be administered a gRNA (or a polynucleotide encoding) according to the present disclosure and a programable nuclease, nickase, or derivative thereof (or a polynucleotide encoding) according to the present disclosure. In certain embodiments, a subject may be administered both a gRNA (or a polynucleotide encoding) and a programable nuclease, nickase, or derivative thereof (or a polynucleotide encoding) together (or at the same time). In certain embodiments, a subject may be administered a gRNA (or a polynucleotide encoding) and a programable nuclease, nickase, or derivative thereof (or a polynucleotide encoding) separately (e.g., contained in a separate composition, at separate time points, etc). In some embodiments, a subject may be further administered a template (or a polynucleotide encoding) according to the present disclosure.

[0330] In some embodiments, a subject may be administered two RNPs (a first RNP comprising a first gRNA and a first programable nuclease, nickase, or derivative thereof and a second RNP comprising a second gRNA and a second programable nuclease, nickase, or derivative thereof) according to the present disclosure. In certain embodiments, a subject may be administered both the first RNP and the second RNP together (e.g., contained in the same composition, or separate compositions but contacted at the same timepoint, etc). In certain embodiments, a subject may be administered the first RNP and the second RNP separately (e.g., contained in a separate composition, at separate timepoints, etc). In some embodiments, a subject may be further administered (at the same time or at separate time points) a template (or a polynucleotide encoding) according to the present disclosure. In particular embodiments, a subject may be administered the first RNP, the second RNP,and the template at the same time. In particular embodiments, the first RNP, the second RNP, and the template are contained in the same composition.

[0331] In some embodiments, a subject may be administered a first gRNA (or a polynucleotide encoding), a first programable nuclease, nickase, or derivative thereof, a second gRNA (or a polynucleotide encoding), and a second programable nuclease, nickase, or derivative thereof (or a polynucleotide encoding) according to the present disclosure. In some embodiments, a subject may be further administered (at the same time or at separate time points) a template (or a polynucleotide encoding) according to the present disclosure. In particular embodiments, a subject may be administered the first RNP, the second RNP, and the template at the same time. In particular embodiments, the first RNP, the second RNP, and the template are contained in the same composition.

[0332] In certain embodiments, a subject may be administered both the first gRNA (or a polynucleotide encoding) and the first programable nuclease, nickase, or derivative thereof (or a polynucleotide encoding) together (e.g., contained in the same composition, or separate compositions but contacted at the same timepoint, etc). In certain embodiments, a subject may be administered the first gRNA (or a polynucleotide encoding) and the first programable nuclease, nickase, or derivative thereof (or a polynucleotide encoding) separately (e.g., contained in a separate composition, at separate timepoints, etc). In certain embodiments, a subject may be administered both the second gRNA (or a polynucleotide encoding) and the second programable nuclease, nickase, or derivative thereof (or a polynucleotide encoding) together (e.g., contained in the same composition, or separate compositions but contacted at the same timepoint, etc). In certain embodiments, a subject may be administered the second gRNA (or a polynucleotide encoding) and the second programable nuclease, nickase, or derivative thereof (or a polynucleotide encoding) separately (e.g., contained in a separate composition, at separate timepoints, etc).

[0333] In some embodiments, one gRNA (or a polynucleotide encoding a gRNA) may be used (comprised in the composition), which may be referred to herein as a single-guide approach. In certain embodiments, the gRNA complexed with a programable nuclease or a derivative thereof may cause a DSB. In some embodiments, two different gRNAs (a first gRNA and a second gRNA) (or polynucleotides encoding two different gRNAs) may be used (comprised in the composition), which may be referred to herein as a dual-guide approach. In certain embodiments, the first gRNA may be complexed with a first programable nuclease, nickase, or a derivative thereof to form a first RNP, and the second gRNA may be complexed with a second programable nuclease, nickase, or a derivative thereof to form a second RNP, wherein the first and second RNPs may be capable of cleaving opposite strands of a polynucleotide encoding SEPINA1.

[0334] Additional agents

[0335] In some embodiments, the subject may be further administered one or more additional agents, such as but not limited to those disclosed as additional agents herein.

[0336] In certain embodiments, the one or more additional agents may be or may include alpha1- proteinase inhibitor or alpha1-antitripsin, such as PROLASTIN®, ARALAST®, and / or ZEMAIRA®.

[0337] In certain embodiments, the one or more additional agents may be or may include a medication used to treat a chronic lung disease, emphysema, chronic obstructive pulmonary disease (COPD), bronchiectasis, a chronic liver disease, neonatal cholestasis, cirrhosis, hepatocellular carcinoma or an increased risk thereof, liver failure, lung failure, and / or panniculitis.

[0338] Exemplary additional agents to be administered may include: a broncodilator and / or an anticholinergic medication, such as albuterol, formoterol, salmeterol, vilanterol, titotropium, glycopyrrolate, indacaterol, arformoterol, levalbuterol, olodaterol, revefenacin, aclidinium, theophylline, tiotropium bromide, and ipratropium bromide; a steroid (e.g., inhaled steroid or oral steroid) such as budesonide, fluticasone, flunisolide, mometasone, ciclesonide, beclomethasone, prednisone, hydrocortisone, prednisolone, methylprednisolone, and dexamethasone; a phosphodiesterase-4 inhibitor such as apremilast, crisaborole, and roflumilast; an antibiotic, such as penicillin antibiotics such as amoxicillin optionally with clavulanic acid, macrolides such as azithromycin and erythromycin, and tetracyclines such as doxycycline; or any combination of the foregoing additional agents.

[0339] In certain embodiments, the one or more additional agents may be or may include: an antiviral agent, such as entecavir, lamivudine, telbivudine, glecaprevir, pibrentasvir, sofosbuvir, velpatasvir, and voxilaprevir; an interferon; methionine; medications for gastroesophageal reflux such as antacids, H2 blockers, and proton-pump inhibitors; diuretics such as spironolactone, furosemide, triamterene, chlorothiazide, and ethacrynic acid; ademetionine, metadoxine, and / or ursodiol; an antihypertensive drug such as but not limited to microzide, spironolactone, furosemide, chlorthalidone, torsemide, and ethacrynic acid; a nonsteroidal anti-inflammatory drug (NSAID) such as aspirin or ibuprofen; or any combination of the foregoing additional agents .

[0340] Any of the one or more such additional agents disclosed herein may be used in combination.

[0341] Any of the one or more such additional agents disclosed herein may be administered to the patient together with the composition (or with any of the RNPs or any of the gRNAs (or a polynucleotide encoding) and any of the programable nucleases, nickases, or derivatives thereof (or a polynucleotide encoding)) for editing SEPINA1 according to the present disclosure. In certain embodiments, such one or more additional agents may be contained in the composition. In certain embodiments, such one or more additional agents may be contained in a separate composition. In certain embodiments, any of such one or more additional agents may be administered to the patient separately (e.g., at separate timepoints) from the composition (or with any of the RNPs or any of the gRNAs (or a polynucleotide encoding) and any of the programable nucleases, nickases, or derivatives thereof (or a polynucleotide encoding)) for editing SEPINA1 according to the present disclosure. DEFINITIONS

[0342] All references cited herein, including patent documents and non-patent documents, are hereby incorporated by reference in their entirety. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such disclosure by virtue of prior invention.

[0343] Although various embodiments and examples of the present invention have been described referring to certain molecules, compositions, methods, or protocols, it is to be understood that the present invention is not limited to the particular molecules, compositions, methods, or protocols described herein, as theses may vary. It is also to be understood that the terminology used in the description is for the purpose of describing the particular versions or embodiments only and is not intended to limit the scope of the present invention which will be limited only by the appended claims.

[0344] It should be understood that, unless clearly indicated otherwise, in any methods disclosed or claimed herein that comprise more than one step, the order of the steps to be performed is not restricted by the order of the steps specifically cited.

[0345] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0346] It must also be noted that, unless the context clearly dictates otherwise, the singular forms “a,” “an,” and “the” as used herein and in the appended claims include plural refence. Thus, the reference to “a cell” refers to one or more cells and equivalents thereof known to those skilled in the art, and so forth. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by a person of skilled in the art.

[0347] The term “about” or “approximately” means within a statistically meaningful range of a value. Such a range can be within an order of magnitude, preferably within 50%, more preferably within 20%, still more preferably within 10%, and even more preferably within 5% of a given value or range. The allowable variation encompassed by the term “about” or “approximately” depends on the particular system under study, and can be readily appreciated by one of ordinary skill in the art.

[0348] In the specification above and in the appended claims, all transitional phrases such as “comprising,” “including,” “having,” “containing,” “involving,” “composed of,” and the like are to be understood to be open-ended, namely, to mean including but not limited to. Only the transitional phrases “consisting of” and “consisting essentially of” shall be closed or semi-closed transitional phrases, respectively.

[0349] An “allele” refers to one of two or more versions of nucleic acid sequence that arise by a mutation (e.g., at one or more given nucleotide position(s).

[0350] Alpha-1 antitrypsin (A1AT) is a serine protease inhibitor belonging to the serpin superfamily whose targets include elastase, plasmin, thrombin, trypsin, chymotrypsin, and plasminogen activator. A1AT is primarily produced in the liver but also in the bone marrow, by lymphocytic and monocytic cells in lymphoid tissue, and by the Paneth cells of the gut. A1AT produced in the liver is secreted intoand circulates through the blood and protects the lungs and liver from inflammation and damage by inhibiting proteases such as the neutrophil elastase.

[0351] A1AT deficiency (A1ATD, also referred to as AATD) is a genetic disorder primarily caused by mutations in the SERPINA1 gene which lead to insufficient or dysfunctional A1AT protein. One notable mutation is the G>A transition at nucleotide 1096 in exon 5 of the SERPINA1 gene (c.1096G>A), also known as rs28929474(A) or the Z-allele, which results in a substitution of lysine for glutamic acid at codon 342 of A1AT (E342K) and is the most common and severe variant associated with A1ATD. Individuals homozygous for the Z allele (PI*ZZ) often experience significant reductions in functional A1AT levels. E342K results in abnormal folding and a poorly secreted A1AT protein that accumulates within hepatocytes, leading to a reduction of A1AT in the bloodstream and in the lungs. Therefore, A1ATD is often referred to as a gain-of-function liver disease and a loss-of- function pulmonary disease. The reduced levels of circulating A1AT pose a higher risk of developing lung diseases such as emphysema and chronic obstructive pulmonary disease (COPD), typically manifesting between the ages of 20 and 50. Additionally, E342K can cause liver complications, including neonatal cholestasis, cirrhosis, and an increased risk of hepatocellular carcinoma. Diagnosis of A1ATD involves blood tests to measure A1AT levels, genetic testing to identify the E342K-causing mutation, and assessments of lung and liver function. Current treatment options include augmentation therapy with intravenous A1AT to slow lung disease progression, standard COPD treatments, and management of liver disease, potentially including liver transplantation in severe cases.

[0352] The term “cargo” or “cargo molecule” as used herein is one or more materials carried by and / or encapsulated by / in a TCV according to the present disclosure. In some embodiments, the combination of materials carried by a TCV may be collectively referred to as a “cargo”. For example, a TCV may carry a combination of a Cas protein (such as a Cas9 nuclease or a Cas9 nickase) or a variant thereof or another nuclease or nickase protein and a guide RNA (such as one comprising a sequence fully or nearly complementary to (e.g., having one or two mismatches relative to) a target sequence) as a cargo.

[0353] The term “cholesterol derivative” as used herein, in its broadest sense, encompasses any derivatives of cholesterol. Non-limiting examples of cholesterol derivatives include: DC-Chol (N,N- dimethyl-N-ethylcarboxamidocholesterol), 1,4-bis(3-N-oleylamino-propyl)piperazine (Gao, et al. Biochem. Biophys. Res. Comm.179, 280 (1991); Wolf et al. BioTechniques 23, 139 (1997); U.S. Pat. No.5,744,335), or imidazole cholesterol ester (ICE) (US20210220273A1).

[0354] “Clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated (Cas)” or “CRISPR / Cas systems” are a class of genome-editing tools that target desired genomic or nucleic acid sites in cells. A CRISPR / Cas system involves at least one Cas protein (including Cas nucleases, nickases, and variants thereof) and a gRNA. Typically, the Cas protein may recognize a protospacer adjacent motif (PAM) sequence or a protospacer flanking sequence (PFS) specific to the Cas protein in the target gene or regulatory region of a target gene (coding or non-coding strand) andif the gRNA is able to hybridize with a target comprising a target sequence in the target gene proximal to the PAM segment, the Cas protein may mediate editing of the target gene in both strands or one particular strand (depending on the Cas) at a specific nucleotide position (again depending on the Cas) relative to the PAM or PFS site. For example, the PAM for Cas9 is 5’-NGG-3’ (where “N” can be any nucleotide). When a Cas9 protein edits a double stranded DNA, the PAM is found in the non-target strand. A typical Type II CRISPR / Cas system may use a Cas9 nuclease that is targeted to a target segment of a nucleic acid by complexing with a guide RNA that hybridizes to an approximately 17- 24-nucleotide DNA sequence immediately adjacent to a PAM segment (immediately downstream of the PAM segment in the target strand) comprising a 5’-NGG-3’ motif recognized by Cas9 (thus, a segment comprising for example a (N)20NGG sequence). This results in a double-strand break (DSB) between the third and fourth nucleotides upstream of the NGG motif (upstream of the PAM segment in the non-target strand and downstream of the PAM segment in the target strand). For example, the PAM of Cas12a may be 5’TTTN-3’ (where “N” can be any nucleotide) or “5’-YTTN-3’ (where “Y” can be C or T). When a Cas12a protein edits a double stranded DNA, the PAM is found in the non- target strand. A typical class II Type V CRISPR / Cas system may use a Cas12a nuclease that is target to a target segment of a nucleic acid by complexing with a guide RNA that hybridizes approximately 18-26-nucleotide DNA sequence immediately adjacent to a PAM segment (immediately upstream of the PAM segment in the target strand) comprising a 5’-TTTN-3’ motif recognized by Cas12a. This results in staggered DSBs, a break in the target strand approximately between the 23rd and the 24th nucleotides, or approximately at the 23rd nucleotide, downstream of the 5’-TTTN-3’ and a break in the non-target strand approximately between the 18th and 19th nucleotides upstream of the PAM segment, creating 5’-overhangs. The double strand break instigates either non-homologous end- joining (NHEJ), which typically leads to the introduction of one or more nucleotide insertions or deletions resulting in frameshift mutations (e.g., causing nonsense-mediated mRNA decay (NMD)), or homology-directed repair (HDR), which can be exploited with the use of an exogenously introduced double-stranded or single-stranded DNA template to knock in or correct a mutation in the target nucleic acid.

[0355] The term “Cas protein” is used in its broad sense to encompass any native Cas nucleases including Cas9, Cas12a or Cpf1, Cas12b or C2c1, Cas12c or C2c3, Cas12c, Cas12d, Cas12e, Cas12f or Cas14, Cas12g, Cas12h, Cas12i, Cas12j, Cas12k, Cas12, Cas13, Cas13a or C2c2, Cas13b or C2c4, Cas13c or C2c7, Cas13d, Cas1, Cas2, Cas3, Cas4, Cas 5, Cas 6, Cas7, Cas8, Cas8a2, Cas8b, Cas8c, Cas10, or Cas11, of any species, and any variants thereof. If a Cas protein has a nuclease activity, the Cas protein is a “Cas nuclease”, regardless of whether it has a native sequence or a variant sequence. Native Cas nucleases may recognize a PAM or PFS sequence specific to the Cas protein in a target nucleic acid molecule, and if the gRNA is able to hybridize with a target strand of a target segment adjacent to the PAM or PFS segment containing the PAM or PFS sequence (in some cases the PAM or PFS sequence may be in the non-target strand), the Cas protein may mediate cleavage of the targetnucleic acid at a specific nucleotide position, e.g., at about 2-6 nucleotides away from the PAM or PFS. Variants of native Cas nucleases may be for example modified to alter protein functions of Cas nucleases, such as the nuclease activities (for example, nuclease activity may be entirely inactivated, or partially inactivated or inhibited (for instance, only the RuvC domain or the HNH domain is inactivated or inhibited (e.g., Cas9 D10A, Cas9 D839A, Cas9 H840A, and Cas9 N863A nickases)) and / or specific base editing activities are added (e.g., base editors (BEs))) and / or PAM or PFS requirements (e.g., the PAM or PFS sequence itself and / or the strictness of the requirement) are altered. For example, a “Cas9 protein” may comprise any native Cas9 nuclease sequence (e.g., of any species) or a variant thereof (the variant is a Cas9 nuclease if the nuclease activity is maintained, and the variant is a Cas9 nickase if the nuclease activity on one but not both strands is inhibited), and similarly “a Cas12a protein” may comprise any native Cas12a nuclease sequence (e.g., of any species) or a variant thereof (the variant is a Cas12a nuclease if the nuclease activity is maintained, and the variant is a Cas12a nickase if the nuclease activity on one but not both strands is inhibited).

[0356] Any appropriate Cas protein or Cas proteins may be used in the invention disclosed herein.

[0357] In some cases, a Cas protein which may be used for gene editing according to the present disclosure may be Cas9 of different bacterial species such as Streptococcus pyogenes (SpCas9 (e.g., SEQ ID NO: 140), which recognizes the PAM sequence of 5’-NGG-3’), Staphylococcus aureus Cas9 (SaCas9, which recognizes the PAM sequence of 5’-NNGRRT-3’), Streptococcus thermophilus (StCas9, which recognizes the PAM sequence of 5’-NGGNG-3’), Neisseria meningitidis (NmCas9, which recognizes the PAM sequence of 5’-NNNNGATT-3’), Francisella novicida (FnCas9, which recognizes the PAM sequence of 5’-NG-3’), Campylobacter jejuni (CjCas9, which recognizes the PAM sequence of 5’-NNNNACA-3’), Streptococcus canis (ScCas9, which recognizes the PAM sequence of 5’-NNGG-3’), Staphylococcus auricularis (SauriCas9, which recognizes the PAM sequence of 5’-NNG-3’), which are collectively referred to as Cas9 nuclease herein, or any engineered variants thereof, including but not limited to SaCas9-HF, SpCas9-HF1, KKHSaCas9, eSpCas9, HypaCas9, FokI-Fused dCas9, xCas9, SpRY (variant of SpCas9), SpG (variant of SpCas9), or any of SpCas9 variants 1 through 11 (SEQ ID NOS: 141-151) or any variants of the foregoing.

[0358] In some cases, a Cas protein which may be used for gene editing according to the present disclosure may be a Cas12 protein such as: Cas12a of different bacterial species such as Acidaminococcus sp. (AsCas12a, which recognizes the PAM sequence of 5’-TTTN-3’), Lachnospiraceae bacterium (LbCas12a, which recognizes the PAM sequence of 5’-TTTN-3’), Francisella novicida (FnCas12a, which recognizes the PAM sequence of 5’-TTTN-3’), Moraxella bovoculi (MbCas12a, which recognizes the PAM sequence of 5’-TTTN-3’), Coprococcus eutactus (CeCas12a, which recognizes the PAM sequence of 5’-TTTN-3’), or Butyrivibrio fibrisolvens (BfCas12a, which recognizes the PAM sequence of 5’-TTTN-3’), Eubacterium rectale (ErCas12a, which recognizes the PAM sequence of 5’-YTTN-3’ (Y indicates C or T)), or any variants thereof, such as AsCas12a Ultra, enAsCas12a, enAsCas12a-Hifi, enAsCas12a Ultra, enAsCas12a-Hifi Ultra,or LbCas12a Ultra, or MAD7, which are collectively referred to as Cas12a nuclease herein; Cas12b of different bacterial species such as of Bacillus hisashii (BhCas12b, which recognizes the PAM sequence of 5’-TTTN-3’, 5’-ATTN’3’, 5’-GTTN-3’) or of Alicyclobacillus acidophilus (AacCasb, which recognizes the PAM sequence of 5’-TTN-3’), which are collectively referred to as Cas12b nuclease herein, or any variants thereof; Cas12f, which recognizes the PAM sequence of 5’-TTTN-3’ or any variants thereof such as Un1Cas12f1, which recognizes the PAM sequence of 5’-TTTN-3’ or CasMINI, which recognizes the PAM sequence of 5’-TTTR-3’; or Cas12j, which recognizes the PAM sequence of 5’-TTN-3’, or any variants thereof. In some cases, a Cas12a protein may be AsCas12a having the sequence of SEQ ID NO: 210 or a derivative thereof, such as one having any one of SEQ ID NOS: 211-215. In some cases, a Cas12a protein may be LbCas12a having the sequence of SEQ ID NO: 220 or a derivative thereof, such as one having SEQ ID NO: 221. In some cases, a Cas12a protein may be FnCas12a, MbCas12a, CeCas12a, or BfCas12, or MAD7 such as one having SEQ ID NO: 222, 223, 224, or 225.

[0359] The term “complementary” or “complementarity” means that a nucleic acid can form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick. For example, A-T, A-U, and C-G are complementary base pairs, while other pairs such as A-C, A-G, C-T, G-T, U-C, U-G are not complementary base pairs. A percent complementarity indicates the percentage of residues in a nucleic acid molecule that can form hydrogen bonds with a second nucleic acid sequence.

[0360] Complementarity / alignment between any two or more polynucleotide sequences (e.g., between a template and another polynucleotide or between a gRNA and a target) may be analyzed or determined for example using Blast®N or Nucleotide BLAST® or CLUSTAL software (e.g., https: / / www.ebi.ac.uk / Tools / msa / clustalo / ). In certain cases, a complementarity / alignment analysis using Blast®N or Nucleotide BLAST®may give “no significant alignment”, e.g., defined by e-value < 0.05. In some cases, complementarity may be analyzed by a heterodimer analysis. In some cases, complementarity may be analyzed by calculating the delta G value for a dimer (hypothetical dimer) of the isolated ODN and an about 120-nt, about 100-nt, about 90 nt, about 85-nt, about 80-nt, about 75- nt, or about 70-nt sequence of the target gene of interest encompassing the target sequence or a reverse complement thereof. In certain cases, the delta G value may be about -100 kcal / mol or higher, about -80 kcal / mol or higher, about -60 kcal / mol or higher, about -50 kcal / mol or higher, about -40 kcal / mol or higher, about -30 kcal / mol or higher, about -20 kcal / mol or higher, about -18 kcal / mol or higher, about -16 kcal / mol or higher, about -15 kcal / mol or higher, about -14 kcal / mol or higher, about -12 kcal / mol or higher, or about -10 kcal / mol or higher, because, without wishing to be bound by theory, such delta G values would indicate that such a hypothetical dimer would unlikely form.

[0361] The phrase “gene editing” is used herein in its broadest sense and refers to altering the sequence of a target nucleic acid molecule and encompasses editing of a gene sequence as well as editing of a nucleic acid region that is not necessarily a gene, such as but not limited to a regulatoryregion of a gene, including a promoter region outside a gene. Altering of the nucleic acid sequence by gene editing includes removal of one or more bases or a polynucleotide segment, addition of one or more bases or a polynucleotide segment, or replacing one or more bases with different bases. The nucleic acid to be edited may for example be a double stranded nucleic acid or a single stranded nucleic acid, and may for example be a DNA or an RNA molecule.

[0362] “Guide RNA” or “gRNA”, as used herein in relation to the CRISPR / Cas gene editing, refers to a piece of an RNA fragment that binds to a target nucleic acid sequence and guide a Cas protein to the specific site of gene editing. In CRISPR / Cas gene editing, a gRNA may comprise or consist of: (A) a crispr RNA (crRNA), which comprises a crRNA repeat sequence and a spacer region or (B) a crispr RNA (crRNA), which comprises a spacer region, and a trans-activating crispr RNA (tracrRNA), which serves as a binding scaffold for the Cas nuclease. In (B), a gRNA may comprise the two parts (crRNA and tracrRNA) linked forming a single molecule, or a gRNA may be a complex of a crRNA molecule and a tracrRNA molecule. Therefore, a gRNA may be a single RNA fragment (“sgRNA”) or may be a hybrid of two RNA fragments (“dgRNA”) (e.g., one comprising a crRNA and one comprising tracrRNA) that binds to a target nucleic acid sequence and guide a Cas endonuclease protein to the specific site of a target nucleic acid (e.g., in a gene or a genome) to allow for Cas- mediated editing (e.g., cleavage) of a target nucleic acid molecule. In some embodiments, the spacer region may comprise a GC content in the range of 40-80%. In some embodiments, the spacer region may have a length of 17-24 nucleotides. In particular embodiments, the spacer region may have a length of 19 or 20 nucleotides. In particular embodiments, the spacer region may have a length of 21 or 22 nucleotides. In some embodiments, one gRNA may be used to achieve intended gene editing (“single-guide” or “single-gRNA” approach). In some embodiments, two different gRNAs having different spacer regions (different spacer region sequences) may be used to achieve intended gene editing (“dual-guide” or “dual-gRNA” approach).

[0363] In some embodiments, a gRNA to be used with a Cas protein (e.g., Cas9 nuclease or Cas9 nickase) may be dgRNA comprising: (I) a crispr RNA (crRNA), which comprises (i) a spacer region of about 15-75 nucleotides that is complementary to or comprising one or more mismatches relative to the target nucleic acid sequence and (ii) a crRNA flagpole sequence; and (II) a trans-activating crispr RNA (tracrRNA), which comprises (i) a tracrRNA flagpole sequence and (ii) tracrRNA endonuclease binding domain, which serves as a binding scaffold for the Cas protein, wherein the crRNA and tracrRNA hybridize with each other via the flagpole sequences. In some embodiments, a gRNA may be sgRNA comprising (I) a crRNA linked to (II) a tracrRNA as a single polynucleotide.

[0364] In some embodiments, the dgRNA and sgRNA (e.g., ones which may be used with Cas9 or Cas9 variants) may have the following structures: dgRNA crRNA (polynucleotide 1 having a crRNA):[spacer region]-[crRNA flagpole]-[(optional) crRNA first flagpole extension]-[(optional) crRNA second flagpole extension] * the sequence of [crRNA flagpole sequence]-[(optional) crRNA first flagpole extension]-[(optional) crRNA second flagpole extension] may be referred to herein as “crRNA backbone sequence”. tracrRNA (polynucleotide 2 having a tracrRNA): [(optional) tracrRNA first extension]-[tracrRNA flagpole sequence]-[tracrRNA endonuclease binding domain] sgRNA (having a crRNA linked to a tracrRNA) [spacer region]-[crRNA flagpole]-[(optional) crRNA first flagpole extension]-[(optional) linker]- [(optional) tracrRNA first extension]-[tracrRNA flagpole]-[tracrRNA endonuclease binding domain] * the sequence of [crRNA flagpole]-[(optional) crRNA first flagpole extension]-[(optional) linker]- [(optional) tracrRNA first extension]-[tracrRNA flagpole]-[tracrRNA endonuclease binding domain] may be referred to herein as “sgRNA backbone sequence”.

[0365] In some embodiments, the crRNA flagpole may comprise SEQ ID NO: 80 or 81. In some embodiments, the optional crRNA first flagpole extension may comprise 5’-UGCUG-3’. In some embodiments, the optional crRNA second flagpole extension may comprise 5’-UUUUG-3’. In some embodiments, the optional tracrRNA first extension may comprise CAGCA. In some embodiments, the tracrRNA flagpole may comprise SEQ ID NO: 82 or 83. In some embodiments, the tracrRNA endonuclease binding domain may comprise SEQ ID NO: 84. In some embodiments, the tracrRNA endonuclease binding domain may further comprise or may be followed by one or more uracil bases, e.g., 5’-U-3’, 5’-UU-3’, 5’-UUU-3’, 5’-UUUU-3’, 5’-UUUUU-3’, 5’-UUUUUU-3’, 5’-UUUUUUU- 3’, or 5’-UUUUUUUU-3’.

[0366] In certain embodiments, the crRNA flagpole may comprise SEQ ID NO: 80. In certain embodiments, the tracrRNA flagpole may comprise SEQ ID NO: 82. In certain embodiments, the crRNA flagpole may comprise SEQ ID NO: 81 and the tracrRNA flagpole may comprise SEQ ID NO: 83. In some embodiments, the optional linker which links a crRNA and tracrRNA in a sgRNA may comprise or consist of 5’-GAAA-3’.

[0367] In some embodiments, a sgRNA may comprise a sgRNA backbone sequence (the sequence which is placed 3’ to a spacer region in a sgRNA) of any of SEQ ID NOS: 85-88. In certain embodiments, the sgRNA backbone sequence may be followed by one or more uracils. In particular embodiments, the sgRNA backbone sequence may be followed by 1-10 uracils, such as 3 uracils, 4 uracils, 5 uracils, 6 uracils, 7 uracils, or 8 uracils.

[0368] In some embodiments, a dgRNA may comprise (I) a crRNA comprising a crRNA backbone sequence (the sequence which is placed 3’ to a spacer region in a crRNA) comprising SEQ ID NO: 89 and (II) a tracrRNA comprising SEQ ID NO: 90. In some embodiments, a dgRNA may comprise (I) a crRNA comprising a sgRNA backbone sequence (the sequence which is placed 3’ to a spacer region in a crRNA) comprising SEQ ID NO: 91 and (II) a tracrRNA comprising SEQ ID NO: 92.

[0369] When a Cas9 protein is used, in some embodiments, the spacer region may comprise a GC content in the range of 40-80%, and in some embodiments, and the spacer region may have a length of 15-24 nucleotides, such as 19, 20, or 21 nucleotides.

[0370] In some embodiments, a gRNA (e.g., one which may be used with Cas12a or Cas12a variants) may comprise a CRISPR RNA (crRNA), which comprises (I) a crRNA repeat sequence linked to (II) a spacer region of about 15-75 nucleotides that is complementary to or nearly complementary to (i.e., comprising some mismatches such as one, two, three, or four mismatches relative to) the target nucleic acid sequence. In certain embodiments, the gRNA may comprise the crRNA repeat nucleotide and the spacer region in the direction from the 5’ to the 3’. In certain embodiments, the crRNA may comprise (i) an optional 5’-end sequence, (ii) a first stem sequence, (iii) a loop sequence, (iv) a second stem sequence, and (v) an optional 3’-end sequence. The first and second stem sequences may be reverse complementary to each other and with the loop sequence may form a hairpin-like structure (which may be recognized, e.g., by Cas12a or Cas12a variants). In certain embodiments, the first stem sequence may comprise UCUAC, and the second stem sequence may comprise GUAGA. In certain embodiments, the loop sequence may comprise UCUU, UAAGU, UGUU, UUUU, UAUU, UGUUU, UUCG, or UUU. In certain embodiments, the optional 5’-end sequence may comprise UAAUU or AAUU. In certain embodiments, the optional 3’-end sequence may comprise U. In particular embodiments, the repeat sequence may comprise (i) an optional 5’-end sequence comprising UAAUU, (ii) a first stem sequence comprising UCUAC, (iii) a loop sequence comprising UCUU, (iv) a second stem sequence comprising GUAGA, and (v) an optional 3’-end sequence comprising U. In particular embodiments, the crRNA repeat sequence may comprise any one of SEQ ID NOS: 191- 196.

[0371] A spacer region of a gRNA may be any appropriate length, which may depend on which Cas protein is to be used with. For Cas9 proteins, while the most frequently used spacer region length is 20 nt, a longer or shorter spacer region may also be used. In some embodiments, a gRNA longer than 20 nt may be used. For example, Ran et al. demonstrated that longer gRNAs are commonly cleaved to a shorter length so that the spacer region is e.g., 20 nt and thus the complementarity in the segment in excess of 20 nt may not be important, i.e., may or may not be complementary to a target sequence (Ran et al., Cell.2013 Sep 12;154(6):1380-9.). In some embodiments, a gRNA shorter than 20 nt may be used. For example, Fu et al. demonstrated that truncated (i.e., < 20 nt) gRNAs, as short as 17, 18, or 19 nt, may also target the same target as a corresponding 20 nt-long gRNA and in some cases may have decreased off-target effects (Fu et al. Nat Biotechnol.2014 March; 32(3): 279–284.). For Cas12a proteins, while the most frequently used spacer region length is 21 nt, a longer or shorter spacer region such as but not limited to 20, 22, 23, 24, or 25 nt may also be used.

[0372] A spacer region of a gRNA may or may not comprise a mismatch relative to the target nucleic acid sequence. In some cases, a mismatch at a particular position may reduce gRNA specificity to the target or the target sequence. Generally, the spacer region of a gRNA may be comprised of a seedregion and a non-seed region, wherein stricter complementarity between the spacer region and the target polynucleotide is required in the seed region than in the non-seed region. When a gRNA mediates gene editing with a Cas protein in a PAM- or PFS-dependent manner, the seed region of the gRNA may bind to the PAM- or PFS-proximal target segment, and the non-seed region of the gRNA may hybridize with the PAM- or PFS-distal target segment.

[0373] In some embodiments, for example when a Cas9 protein is used, the seed region may be about 12 nucleotides in length and hybridize with the target strand of the PAM-proximal target segment of about 12 nucleotides in length (immediately downstream of the PAM segment in the target strand), and the non-seed region may be about 8 nucleotides in length and hybridize with the target strand of the PAM-distal target segment of about 8 nucleotides in length (13-20 nucleotides downstream of the PAM segment in the target strand). For example, in the context of SpCas9, Cong et al demonstrated that complementarity at up to 11 nt from the 3’-end of a spacer region is more important than that at a more upstream region (Cong et al., Science.2013 February 15; 339(6121): 819–823.). Again in the context of SpCas9, Zheng et al demonstrated that the core sequence which is from the 4thto the 7thnt from the 3’-end is more sensitive to target mismatch compared to the rest of the spacer region (Zheng et al., Sci Rep.2017 Jan 18;7:40638.). Therefore, in some embodiments, the polynucleotide sequence of a gRNA spacer region may comprise a mismatch relative to its target sequence outside of such core positions.

[0374] In some embodiments, for example when a Cas12a protein is used, the seed region may be about 5, 6, 7, or 8 nucleotides, such as 7 nucleotides, in length and hybridize with the target strand of the PAM-proximal target segment of about 5, 6, 7, or 8 nucleotides, such as 7 nucleotides, in length (immediately upstream of the PAM segment in the target strand), and the non-seed region may be about 16, 15, 14, or 13 nucleotides, such as 14 nucleotides, in length and hybridize with the target strand of the PAM-distal target segment of about 16, 15, 14, or 13 nucleotides, such as 14 nucleotides, in length (e.g., 8-21 nucleotides upstream of the PAM segment in the target strand). In the context of AsCas12a, Zhang et al demonstrated that complementarity at up to 7 nt from the 5’-end of a spacer region is more important than complementarity at a more downstream region, and also that complementarity at the 9th-11th nucleotides (from the 5’-end of a spacer region) may be less strictly required, and 18th-21st nucleotides (at the 3’-end of the spacer region) may least strictly be required (Zhang et al., NatCommun.2021 Jun 23;12(1):3908.).

[0375] gRNA modifications

[0376] A gRNA according to the present disclosure may or may not comprise one or more modifications. In some embodiments, the modification may be selected from the group consisting of: 2′-O—C1-4alkyl such as 2′-O-methyl (2′-oMe), 2′-deoxy (2′-H), 2′-O—C1-3alkyl-O—C1-3alkyl such as 2′-methoxyethyl (2′-MOE), 2′-fluoro (2′-F), 2′-amino (2′-NH2), 2′-arabinosyl (2′-arabino) nucleotide, 2′-F-arabinosyl (2′-F-arabino) nucleotide, 2′-locked nucleic acid (LNA) nucleotide, 2′- unlocked nucleic acid (ULNA) nucleotide, a sugar in 1 form (1-sugar), and 4′-thioribosyl nucleotide.In some embodiments, the modification is an internucleotide linkage modification selected from the group consisting of: phosphorothioate, phosphonocarboxylate, thiophosphonocarboxylate, alkylphosphonate, and phosphorodithioate. In some embodiments, the modification is selected from the group consisting of: 2-thiouracil (2-thioU), 2-thiocytosine (2-thioC), 4-thiouracil (4-thioU), 6- thioguanine (6-thioG), 2-aminoadenine (2-aminoA), 2-aminopurine, pseudouracil, hypoxanthine, 7- deazaguanine, 7-deaza-8-azaguanine, 7-deazaadenine, 7-deaza-8-azaadenine, 5-methylcytosine (5- methylC), 5-methyluracil (5-methylU), 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5,6- dehydrouracil, 5-propynylcytosine, 5-propynyluracil, 5-ethynylcytosine, 5-ethynyluracil, 5-allyluracil (5-allylU), 5-allylcytosine (5-allylC), 5-aminoallyluracil (5-aminoallylU), 5-aminoallyl-cytosine (5- aminoallylC), an abasic nucleotide, Z base, P base, Unstructured Nucleic Acid (UNA), isoguanine (isoG), isocytosine (isoC), and 5-methyl-2-pyrimidine. In particular embodiments, a gRNA may comprise (i-1) 2'-O-methylation further optionally at first three and last three bases and / or (i-2) one or more 3’ phosphorothioate bonds, further optionally between first three and last two bases.

[0377] DNA templates

[0378] In one aspect, when the CRISPR / Cas system is used for gene editing and when a gene knock- in or gene sequence correction (e.g., deletion of one or more particular nucleic acids) is desired, a DNA template (or simply referred to as a template or a repair template) comprising a desired mutation or sequence may further be provided so that a gene knock-in or gene sequence correction is effected based on the template sequence via the cells’ endogenous DNA mechanisms. When a Cas9 nuclease (e.g., a SpCas9 nuclease) is used, the Cas9 nuclease provides a double-strand break (DSB) in the target gene between the third and fourth nucleotides upstream (5’ side) of the 5’-NGG-3’ and, if a template having homology arms is provided, homology-directed repair (HDR) will take place. When Cas12a is used, Cas12a provides a staggered DSB at a PAM distal site (e.g., between the 17thand 18thnt, between the 18thand 19thnt, or between the 19thand 20thnt from the PAM segment in the non- target strand, and between the 22nd and 23rd nt, between the 23rd and 24th nt, or between the 24th and 25th nt from the PAM segment in the target strand) on the DNA with a several nt overhang (e.g., 4, 5, or 6 nt) and, if a template having homology arms is provided, HDR will take place. In some embodiments, a template may be a single-stranded oligodeoxyribonucleotide (ssODN) or double- stranded oligodeoxyribonucleotide (dsODN).

[0379] In some embodiments, a template comprises or consists of a 5’ homology arm, an optional central region (which may for example be a single base or a single base pair), and a 3’ homology arm. In some embodiments, a template may be approximately centered with respect to the DSB position. In some embodiments, the DSB position may be in the optional central region. In some embodiments, a template may be approximately centered with respect to the position at which a correction (the nucleotide position at which a base is to be altered / mutated / deleted / inserted or a sequence is to be inserted / deleted / altered). In some embodiments, a homology arm may be designed to hybridize with positions less than about 30, about 25, about 20, about 20, about 15, or about 10 nt away from theDSB position. In particular embodiments, a homology arm may be designed to hybridize with positions about 10, about 8, about 6, about 4, about 3, about 2, or about 1 nt away from the DSB position.

[0380] In some embodiments, a template may comprise a total length of approximately 20-5000 nt. In some embodiments, the total length may be about 20-2000 nt, about 20-1000 nt, about 20-500 nt, about 30-200 nt, about 40-180 nt, about 50-160 nt, about 60-140 nt, or about 80-120 nt. In certain embodiments, the total length may be about 100-140 nt, about 110-130 nt, or about 120 nt. In certain embodiments, the total length may be about 60-120 nt, about 70 nt-100 nt, about 75-85 nt, or about 80 nt. In particular embodiments, the total length may be about 80 nt, about 100 nt, or about 120 nt. In particular cases, the total length may be as about 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, or 85 nt in length. In particular cases, the total length may be as about 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, or 125 nt in length.

[0381] Any appropriate size of a homology arm may be used. In some embodiments, the 5’ and 3’ homology arms may have the same or similar nucleotide lengths (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nt difference). In some embodiments, the 5’ and 3’ homology arms may not have the same or similar nucleotide lengths (e.g., differ by 5 or more nt, 10 or more nt, or 15 or more nt, by about 5-40 nt, about 5-30 nt, about 5-20 nt, about 5-10 nt, about 10 nt, about 15 nt, or about 20 nt). In some embodiments, the size of a homology arm may be approximately 10-2500 nucleotides (nt), about 15- 1000 nt, about 20-500 nt, or about 20-100 nt. In particular embodiments, the size of a homology arm may be about 30-80 nt, about 40-70 nt, or about 60 nt. In particular embodiments, the size of each homology arm may be about 10-80 nt, about 20-60 nt, or about 40 nt. In some embodiments, the 5’ and 3’ homology arms may significantly differ in length. In some embodiments, 5’ and / or 3’ homology arms may be 100% complementary to the corresponding sequence in the original DNA sequence before gene editing or may have one or more (a few, for example, 2, 3, 4, or 5) mutations (e.g., silent mutation) relative to the corresponding sequence in the original DNA sequence before gene editing.

[0382] In some embodiments, a template may have one or more mutations at one or more of the PAM positions, i.e., “PAM-altering mutation”. In certain embodiments, the correction via the template alters a PAM sequence to a non-PAM sequence that is not recognized by the same Cas protein (e.g., nuclease, nickase, etc) used for the correction. In some cases, such a mutation(s) helps prevent or reduce Cas-mediated cleavage of the template itself and / or of the DNA molecule post HDR. In case of a ssODN, such a mutation may be within the PAM bases or the reverse (or antisense) bases, i.e., the opposite strand) and / or at one or more of the 5’-neighbouring bases of the PAM (or the 3’- neighbouring bases of the reverse (or antisense) sequences corresponding to the PAM). In some embodiments, a ssODN may comprise complementarity to the gRNA strand. In some cases, any appropriate templates containing one or more PAM-altering and / or silent mutations, such as any of those templates disclosed herein, may be used.

[0383] In some embodiments, template sequences may be defined based on % complementarity to another sequence, e.g., an exemplary template sequence, a target gene sequence, the sequence of a fully complementary template sequence, etc.

[0384] The term “helper lipid” or “structural lipid” as used herein refers to a type of lipid that may be comprised in a TCV in addition to an ionizable cationic lipid. In some embodiments, a helper lipid may be a non-cationic lipid and may be neutral, zwitterionic, or anionic lipid. In some embodiments, a helper lipid may be a lipid that carries a net negative charge at a selected pH, such as physiological pH. Without wishing to be bound by theory, helper lipids in TCVs in general are used to provide particle stability and / or biocompatibility and / or to enhance cargo delivery efficiency. Non-limiting helper lipids include, but are not limited to dioleoylphosphatidylethanolamine (DOPE), distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N- maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, l-stearoyl-2-oleoyl- phosphatidyethanolamine (SOPE), or a mixture thereof. In some embodiments, a helper lipid is dioleoylphosphatidylethanolamine (DOPE).

[0385] The term “ionizable cationic lipid” as used herein, refers to any lipid that carries a net neutral charge at about physiological pH but is capable of becoming positively charged at a lower pH, e.g., pH below 7, below about 6.5, below about 6, below about 5.5, below about 5, or below about 4.5, typically below about 6, or between about 5 and 6.5, between about 5 and 6, or between about 5.5 and 6. Without wishing to be bound by theory, a net neutral charge helps toxicity, and positive charges under a low pH may be useful in forming a complex with a negatively charged cargo such as a nucleic acid molecule and / or protein. Becoming positive charges under as the pH decreases may also help release of the cargo from an endosome once in a cell (endosomal escape), e.g., by taking protons in an endosome thereby destabilizing and bursting the endosome. Examples of ionizable cationic lipids may include, for example, N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), 6-((2- hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4-hydroxybutyl)hexan-1-aminium (ALC- 0315), 8-[(2-hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino]-octanoic acid, 1-octylnonyl ester (SM-102), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N- dimethylammonium bromide (DDAB), N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(1-(2,3-dioleyloxyl)propyl)-N,N,N-trimethylammonium chloride (DOTMA), 1,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-Dilinolenyloxy-N,N- dimethylaminopropane (DLenDMA), 1,2-Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin- C-DAP), 1,2-Dilinoleyoxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-Dilinoleyoxy-3-morpholinopropane (DLin-MA), 1,2-Dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1,2- Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-Linoleoyl-2-linoleyloxy-3- dimethylaminopropane (DLin-2-DMAP), 1,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAR.Cl), 1,2- Dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N,N-Dilinoleylamino)-1,2- propanediol (DLinAP), 3-(N,N-Dioleylamino)-1,2-propanedio (DOAP), 1,2-Dilinoleyloxo-3-(2-N,N- dimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLin-K-DMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or analogs thereof, (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3 aH- cyclopenta[d][1,3]dioxol-5-amine (ALNY-100), N,N-dimethyl-2,2-di-(9Z,12Z)-9,12-octadecadien-1- yl-1,3-dioxolane-4-ethanamine (KC2), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4- (dimethylamino)butanoate (MC3), or a mixture thereof.

[0386] Additional examples of ionizable cationic lipids include, but are not limited to, N-(2,3- dioleyloxyl)propyl-N,N-N-triethylammonium chloride (“DOTMA”); 1,2-Dioleyloxy-3- trimethylaminopropane chloride salt (“DOTAP.Cl”); 3β-(N-(N′,N′-dimethylaminoethane)- carbamoyl)cholesterol (“DC-Chol”), N-(1-(2,3-dioleyloxyl)propyl)-N-2- (sperminecarboxamido)ethyl)-N,N-dimethyl-ammonium trifluoracetate (“DOSPA”), dioctadecylamidoglycyl carboxyspermine (“DOGS”), 1,2-dioleoyl-3-dimethylammonium propane (“DODAP”), and N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium bromide (“DMRIE”), and mixtures thereof. Additionally, a number of commercial preparations of cationic lipids can be used, such as, e.g., LIPOFECTIN (available from GIBCO / BRL), and LIPOFECTAMINE (available from GIBCO / BRL).

[0387] “Lipid-based TCVs” as used in are TCVs that comprise at least one lipid and encompass lipid nanoparticles. In some embodiments, a lipid-based TCV may comprise at least one ionizable cationic lipid. In some embodiments, a lipid-based TCV may comprise at least one helper lipid. In some embodiments, a lipid-based TCV may comprise at least one phospholipid. In some embodiments, a lipid-based TCV may comprise at least one cholesterol (or cholesterol derivative). In some embodiments, a lipid-based TCV may comprise, essentially consist of, or consist of at least one ionizable cationic lipid, at least one helper lipid, at least one phospholipid, and at least one cholesterol (or cholesterol derivative), and optionally polyethyleneglycol (PEG) or PEG-lipid. Exemplary TCVs include but not are limited to those described in Applicant’s WO2020077007A1. In some embodiments, a lipid-based TCV may comprise, essentially consist of, or consist of an ionizable cationic lipid, one or more phospholipids, and cholesterol, the ratio of which are about 20:30:10:40 in mol %. In some embodiments, a lipid-based TCV may comprise, essentially consist of, or consist of an ionizable cationic lipid, one or more phospholipids, cholesterol, and PEG-lipid, the ratio of which are about 20:30:10:39:1 in mol %. TCVs may be generated using gentle mixing such as repeated manual reciprocation of the TCV-generating fluid in a pipette, micromixing optionally using staggeredherringbone micromixer (SHM) or T-junction or Y-junction mixing, or extrusion methods, or other TCV-mixing methods as desired.

[0388] The term “mismatch” as used herein in relation to two hybridizing or potentially hybridizing nucleic acid strands (e.g., an RNA and a DNA, an RNA and an RNA, or a DNA and a DNA, such as a gRNA and a target sequence (a target having a target sequence), or a template and a target gene, etc) means that at a given nucleotide position the base pair is not complementary.

[0389] The term “mutation” or “point mutation” as used herein in relation to nucleic acid or nucleotide sequence means a change in a nucleotide in a DNA or RNA molecule. A mutation may be a change from a nucleotide to another nucleotide or deletion of a nucleotide or an insertion of a nucleotide. When a mutation causes replacement of a nucleotide with another nucleotide in an open reading frame, the mutation may cause an amino acid substitution (“missense mutation”) or appearance of an early stop codon (“nonsense mutation”) leading to a shorter protein product or may not cause any changes in the protein product (“silent mutation”). When a mutation causes insertion or deletion of a nucleotide in an open reading frame, unless the number of insertion or deletion is divisible by three, the mutation changes the grouping of the codons to be read (“frame shift mutation”), causing dramatic changes in the protein sequence. Replacement of a nucleotide to another nucleotide may be either: transversion (change from a purine (A or G) to a pyrimidine (T or C), or from a pyrimidine (T or C) to a purine (A or G)); or transition (change from a purine to another purine (A to G or G to A), or from a pyrimidine to another pyrimidine (T to C or C to A)). In some cases, a mismatch in a non-seed region in an allele-selective gRNA according to the present disclosure may be generated by a transversion in the non-seed region. In some cases, a mismatch in a non-seed region in an allele-selective gRNA according to the present disclosure may be generated by a transition.

[0390] The term “nuclease” as used herein refers to an enzyme capable of catalyzing the cleavage of phosphodiester bonds between nucleotides of nucleic acids, such as Cas nucleases.

[0391] The terms “nucleic acid”, “nucleic acid molecule”, and “polynucleotide” are used interchangeably herein and encompass any compounds that comprise a polymer of nucleotides linked via a phosphodiester bond. Exemplary nucleic acids include but are not limited to RNA and DNA molecules, including molecules comprising cDNA, genomic DNA, synthetic DNA, and DNA or RNA molecules containing nucleic acid analogs. Nucleic acid molecules can have any three-dimensional structure. A nucleic acid molecule can be double-stranded or single-stranded (e.g., a sense strand (i.e., coding strand) and / or an antisense strand (i.e., non-coding strand)). Other non-limiting examples of nucleic acid molecules include genes, gene fragments, exons, introns, messenger RNA (mRNA), transfer RNAs, ribosomal RNAs, siRNAs, micro-RNAs, tracrRNAs, crRNAs, guide RNAs, ribozymes, cDNA, template DNAs, ssODNs, dsODNs, recombinant polynucleotides, branched polynucleotides, nucleic acid probes and nucleic acid primers. A nucleic acid molecule may contain unconventional or modified nucleotides. The terms “polynucleotide sequence” and “nucleic acidsequence” as used herein interchangeably refer to the sequence of a polynucleotide molecule. The nomenclature for nucleotide bases as set forth in 37 CFR § 1.822 is used herein.

[0392] The term “phospholipid” as used herein refers to any lipid comprising a phosphate group. Non-limiting examples of suitable phospholipids include: distearoylphosphatidylcholine (DSPC), dioleoyl phosphatidylethanolamine (DOPE), dipalmitoylphosphatidylcholine (DPPC), phosphocholine (DOPC), dimyristoylphosphatidylcholine (DMPC), phosphatidylcholine (PLPC), 1,2- distearoyl-sn-glycero-3-phosphocholine (DAPC), phosphatidylethanolamine (PE), egg phosphatidylcholine (EPC), dilauryloylphosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), 1-myristoyl-2-palmitoyl phosphatidylcholine (MPPC), 1-palmitoyl-2-myristoyl phosphatidylcholine (PMPC), 1-palmitoyl-2-stearoyl phosphatidylcholine (PSPC), 1,2-diarachidoyl- sn-glycero-3-phosphocholine (DBPC), 1-stearoyl-2-palmitoyl phosphatidylcholine (SPPC), 1,2- dieicosenoyl-sn-glycero-3-phosphocholine (DEPC), palmitoyloleoyl phosphatidylcholine (POPC), lysophosphatidyl choline, dilinoleoylphosphatidylcholine distearoylphophatidylethanolamine (DSPE), dimyristoyl phosphatidylethanolamine (DMPE), dipalmitoyl phosphatidylethanolamine (DPPE), palmitoyloleoyl phosphatidylethanolamine (POPE), lysophosphatidylethanolamine, and combinations thereof. In one embodiment, the phospholipid is distearoylphosphatidylcholine (DSPC).

[0393] The term “polyethyleneglycol-lipid” or “PEG-lipid” as used herein refers to any lipid modified or conjugated to one or more polyethyleneglycol (PEG) molecules. Without wishing to be bound by theory, containing PEG or a PEG-lipid in a TCV may help maintain TCV particle size (keep a TCV from getting too big) and / or help maintain particle stability in vivo. Some examples of PEG- lipids that are useful in the present invention may have a variety of “anchoring” lipid portions to secure the PEG to the surface of the lipid-based TCVs. Non-limiting examples of suitable PEG-lipids include PEG-myristoyl diglyceride (PEG-DMG) (e.g., 1,2-dimyristoyl-rac-glycero-3- methoxypolyethylene glycol-2000 (Avanti® Polar Lipids (Birmingham, AL)), which is a mixture of 1,2-DMG PEG2000 and 1,3-DMG PEG2000 (e.g., in about 97:3 ratio)), PEG- phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG-CerC20) which are described in U.S. Pat. No.5,820,873, incorporated herein by reference, PEG- modified dialkylamines, and PEG-modified 1,2-diacyloxypropan-3-amines. Particular examples include PEG-modified diacylglycerols and dialkylglycerols.

[0394] The phrase “pharmaceutically acceptable” refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an unintended and intolerable response such as an allergic response, when administered to a human. In some embodiments, the term “pharmaceutically acceptable”, as used herein, means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.

[0395] The term “polymorphism” as used herein refers to the presence of a genetic variation within a population. A polymorphic variation may for example be a variation due to one or more mutations, asingle nucleotide polymorphism (SNP), an insertion of one or more nucleotides, and / or a deletion of one or more nucleotides. A polymorphic variation may be a wild-type variation or a variation which may be considered as a mutant. In some cases, a polymorphism may be a variation which is associated with another genomic variant or another polymorphism (i.e., is a part of or forming a haplotype).

[0396] The phrase “programmable endonuclease” as used herein refers to an endonuclease which is capable of exerting its endonuclease activity in a manner specific to a desired target region of a target gene. The “programmability”, i.e., the ability of conferring target region-specificity, may be provided by a gRNA comprising a target region-specific sequence (e.g., a spacer region) and the gRNA may guide the endonuclease to the target region. Exemplary programmable endonuclease may include but not be limited to Cas endonucleases, TnpB enzymes, and TnpB enzymes.

[0397] The term “promoter” of a gene refers to a region of a nucleic acid molecule typically upstream of (but sometimes within) a gene in the nucleic acid where sequences which promote transcription of the gene is contained and / or where proteins relevant for promoting expression of the gene (e.g., RNA polymerase and transcription factors) bind to initiate transcription of that gene. The resulting transcription produces an RNA molecule such as an mRNA. A promoter may comprise or be comprised of a core promoter, a proximal promoter, and a distal promoter. A core promoter is a promoter segment containing the minimal polynucleotide sequence that directs accurate initiation of transcription, including the TSS of the gene. A core promoter can extend between the -35 position and the +35 position with respect to the TSS (the TSS position as +1). A proximal promoter is a promoter segment upstream, typically immediately upstream, of a core promoter and typically contains primary regulatory elements. A proximal promoter may extend to about 250 nucleotides upstream of the TSS or may be up to about 250 nt in length. A distal promoter is a promoter segment upstream, typically immediately upstream, of a proximal promoter and is a segment which may contain sequences which may regulate expression of the gene. A promoter may be about 100-1000 nt long or longer. The impact on transcription of the gene may be smaller at nucleotide positions more upstream from the TSS.

[0398] The term “protospacer adjacent motif segment” or “PAM segment” refers to the segment in a target gene or a regulatory region of a target gene, regardless of an allele, which contains and corresponds to (i.e., has the same nucleotide length as) a PAM or a PAM sequence (the sequence of a PAM) recognized by a Cas protein of interest. When the target gene or the regulatory region is encoded by a double stranded nucleic acid molecule, PAM segment” refers to the segment of the strand having the PAM or the PAM sequence and the corresponding segment in the other strand. A PAM or PAM sequence may comprise one or more nucleic acid bases. When the target gene or the regulatory region is encoded by a double stranded nucleic acid molecule, the PAM sequence may be present in either strand of the PAM segment (the target or non-target strand). In case of gene editing of a double stranded nucleic acid molecule by, e.g., Cas9 and Cas12a proteins, the PAM sequence may be found in the non-target strand. A PAM segment is adjacent to, and typically immediately adjacentto, a target segment. In case of gene editing of a double stranded nucleic acid molecule by Cas9 proteins, a target segment is immediately downstream (in the target strand) of a PAM segment, and in case of gene editing of a double stranded nucleic acid molecule by Cas12a proteins, a target segment is immediately upstream (in the target strand) of a PAM segment.

[0399] The term “protospacer adjacent motif-proximal target segment” or “PAM-proximal target segment” refers to the segment within a target segment which is proximal to a PAM segment. In case of gene editing of a double stranded nucleic acid molecule by Cas9 proteins, a PAM-proximal target segment is immediately downstream (in the target strand) of a PAM segment, and in case of gene editing of a double stranded nucleic acid molecule by Cas12a proteins, a PAM-proximal target segment is immediately upstream (in the target strand) of a PAM segment.

[0400] The term “protospacer adjacent motif-distal target segment” or “PAM-distal target segment” refers to the segment within a target segment which is distal to a PAM segment. In case of gene editing of a double stranded nucleic acid molecule by Cas9 proteins, a PAM-distal target segment is immediately downstream (in the target strand) of a PAM-proximal segment, and in case of gene editing of a double stranded nucleic acid molecule by Cas12a proteins, a PAM-distal target segment is immediately upstream (in the target strand) of a PAM segment.

[0401] The term “ribonucleoprotein”, “RNP”, or “RNP complex” as used herein refers to a complex of one or more RNA molecules and an RNA-binding protein. In the context of the CRISPR / Cas system, an RNP may be a complex of a gRNA and a Cas nuclease. The gRNA may be an RNA fragment containing a crRNA portion and a tracrRNA portion linked to each other or be a complex formed between a crRNA molecule and a tracrRNA molecule.

[0402] The “serpin family A member 1” gene, also known as the "SERPINA1", “A1A”, “AAT”, “PI1”, “A1AT”, “NIF”, “PRO2275”, or “alpha1AT” gene, is a gene that encodes the alpha-1 antitrypsin (A1AT) protein. In humans, the gene (described with the gene symbol “SERPINA1”) is located on chromosome 14, with gene location 14q32.13 at nucleotide positions 94,390,635 to 94,376,747 (according to Gene Assembly GRCh38.p14), which encodes 5 exons including non- coding exon 1 (NCBI, Gene ID: 5265). For example, wildtype SERPINA1 may have the polynucleotide sequence provided as NCBI Reference Sequence: NC_000014.9. Various polymorphisms such as SNPs in SERPINA1 are known, some of which are associated with A1ATD (e.g., rs28929474(A)). For example, positions 94,378,771 to 94,378,449 (positions according to Assembly GRCh38.p14) of the coding and non-coding strands of SERPINA1 rs28929474(A) may comprise the polynucleotide sequence of SEQ ID NOS: 41 and 42, respectively; and the coding and non-coding strands of a 120-nucleotide span around the rs28929474(A) SNP position (60 nucleotides upstream to 59 nucleotide downstream of rs28929474(A)) may comprise the polynucleotide sequence of SEQ ID NOS: 43 and 44, respectively. The corresponding coding and non-coding strands of the 120-nucleotide span around rs28929474(G) may comprise the polynucleotide sequence of SEQ ID NOS: 45 and 46, respectively.

[0403] A “single nucleotide polymorphism (SNP)” is a genomic variant at a single nucleotide position in the genome. Different nucleic acid base at a given nucleotide position gives rise to different alleles regarding said nucleotide position. Various SNPs have been associated with diseases, disorders, and conditions, and some SNPs are associated with and / or considered to be the cause of certain monogenic diseases.

[0404] “Single-stranded oligo DNA nucleotides” or “ssODN” as used herein refers to a short DNA fragment of a single strand comprising a particular polynucleotide that may be useful for some of the embodiments disclosed herein. In some embodiments, ssODN may be used as part of CRISPR / Cas- mediated gene editing disclosed herein and may function as a DNA template (may also referred to as a DNA repair template, a repair template, or a template) to mediate a knock-in of a sequence of interest through the Cas9-mediated double-strand break site. Such a knock-in may be via homology-directed repair (HDR). In some embodiments, a ssODN may have homology to the strand that initiates repair in the direction of a desired modification. In some embodiments, a ssODN may comprise (i) a central region comprising one or more desired nucleic acids, sandwiched by (ii) a 5’ homology arm and (iii) a 3’ homology arm. Such a homology arm may comprise approximately 20-2500 nucleotides (nt).5’ and 3’ homology arms often have the same or similar nucleotide lengths (e.g., 0 or 1 to 10 nt difference), but 5’ and 3’ homology arms that significantly differ in length may also be used as long as the ssODN is capable of mediating an intended gene repair.5’ and / or 3’ homology arms may be 100% complementary to the corresponding sequence in the original DNA sequence before gene editing or may have one or more (a few) mutations (e.g., silent mutation) relative to the corresponding sequence in the original DNA sequence before gene editing. In some embodiments, ssODN may have one or more mutations at the PAM sequence (or its reverse (or antisense) sequence of to the PAM sequence, i.e., the opposite strand) and / or at one or more of the 5’-neighbouring bases of the PAM (or the 3’- neighbouring bases of the reverse (or antisense) sequence corresponding to the PAM). In some cases, such a mutation(s) helps prevent or reduce Cas-mediated cleavage of the ssODN itself or of a gene- edited DNA molecule. In some embodiments, a ssODN may comprise complementarity to the gRNA strand. In some embodiments, a ssODN may comprise a total length of approximately 40-5000 nucleotides (nt). As a DNA repair template, a double-stranded ODN (dsODN) may also be used instead. In such a case, one of the strands of the template may comprise the same sequence as a desired ssODN and the other strand have a sequence complementary (or essentially complementary) thereto.

[0405] The term “spacer region” as used herein refers to the region of a gRNA which binds to a target sequence or target of the gRNA, or in other words a gRNA region having a polynucleotide sequence which allows the gRNA to bind to the intended target of the gRNA. The polynucleotide sequence of a spacer region is typically complementary to or have some mismatches relative to the target sequence (the polynucleotide sequence of the target). A spacer region typically comprises a “seed region” and “non-seed region” and stricter complementarity to the target sequence is usuallyneeded in the seed region compared to the non-seed region. In other words, a mismatch in a seed region is less tolerated than a mismatch in a non-seed region. Therefore, a mismatch in a seed region may often abrogate or dramatically inhibit binding to a target sequence or a target having a target sequence, while a mismatch in a non-seed region may perhaps reduce but perhaps may not completely abrogate binding to a target sequence or a target having a target sequence.

[0406] When Cas protein-mediated gene editing is PAM or PFS dependent, typically, a seed region binds to a PAM- or PFS-proximal target segment and a non-seed region binds to a PAM- or PFS-distal target segment, and thus stricter complementarity may be required for binding to a gRNA in the PAM- or PFS-proximal target segment than in the PAM- or PFS-proximal target segment. In case of Cas9- mediated gene editing of a double stranded nucleic acid molecule, a seed region may be downstream of a non-seed region. In case of Cas12a-mediated gene editing of a double stranded nucleic acid molecule, a seed region may be upstream of a non-seed region. In case of Cas13a-mediated gene editing of a single stranded nucleic acid molecule, a seed region may be upstream of a non-seed region.

[0407] When Cas protein-mediated gene editing is PAM or PFS independent (e.g., certain cases with Cas13a, Cas13b, or Cas14), a seed region (i.e., a region within a spacer region which has stricter complementarity requirement) may be located in the middle of a spacer region, flanked by two non- seed regions (e.g., a 5’ non-seed region and a 3’ non-seed region).

[0408] A “subject” as used herein, which may be interchangeably referred to as “patient”, “individual”, or “animal”, refers to a vertebrate including members of the mammalian species, such as canine, feline, lupine, mustela, rodent (racine, murine, etc.), equine, bovine, ovine, caprine, porcine species, and primates including humans. In specific embodiments, the subject is a human. In some embodiments, a subject may have or have a risk of developing a target disease. In specific embodiments, a subject may have or have a risk of developing SCD.

[0409] The term “target allele” as used herein refers to an allele (e.g., of a target gene) a gRNA according to the present disclosure preferentially hybridizes with or is intended to preferentially hybridize with over another allele (e.g., of the target gene). Said another allele may be referred to as a “non-target allele”. For example, when a gRNA preferentially hybridizes to or is designed to preferentially hybridize to the rs28929474(A) allele over rs28929474(G) allele of SERPINA1, the rs28929474(A) allele is a target allele and the rs28929474(G) allele is a non-target allele of the gRNA.

[0410] The term “target cut site” as used herein refers to site(s) or the nucleotide position(s) to be cleaved by a given programable nuclease such as a Cas protein. The position of a target cut site may be determined based on the Cas (which Cas is used, which determines the PAM sequences to be recognized) and the PAM segment location, along with the polynucleotide sequence of the gRNA spacer region. The site of cleavage is typically between two nucleotide positions, and the target cut site may be specified for example as “at the 5’ (end)” of a given nucleotide position, as “at the 3’(end)” of a given nucleotide position, or as “between” two given nucleotide positions. When a target cut site is in a given nucleic acid segment, the cut site may be anywhere from the 5’-end of the segment to the 3’-end of the segment including both the 5’- and 3’-ends. When a target cut site is up to a given nucleotide position, the cut site may be anywhere up to the farther end (5’ or 3’ end depending on the orientation) of the base at the given nucleotide position, i.e., up to the 5’-end if counting from the 3’ side, and up to the 3’-end if counting from the 5’ side.

[0411] The term “target cell” as used herein refers to a cell in which a gRNA and / or CRISPR / Cas system (e.g., an RNP) according to the present disclosure is intended to function. A gRNA and / or CRISPR / Cas system (e.g., an RNP) may be comprised in a carrier such as a TCV engineered to specifically carry its cargo in a target cell, for example via one or more targeting moiety on the surface.

[0412] The term “target disease”, as used herein, which may be used interchangeably with “target disorder” or “target condition”, refers to a disease, disease, or condition that a gRNA and / or CRISPR / Cas system (e.g., an RNP) according to the present disclosure is intended to treat, prevent, or ameliorate a symptom of. A gRNA and / or CRISPR / Cas system (e.g., an RNP) according to the present disclosure may be carried into a target cell, thereby altering a target gene or target gene expression and thus prevent, treat, or ameliorate a symptom of a target disease.

[0413] The term “target gene” or “target gene of interest” as used herein is a gene (including the gene itself and in some cases a polynucleotide region that regulates or potentially regulates the expression of the gene such as a promoter, an enhancer, and / or a repressor of the gene) whose sequence is to be altered (e.g., disrupted, partially or entirely removed, or partially or entirely replaced with an intended sequence), whose expression is to be altered (e.g., reduced or diminished or, in some cases, completely abrogated, or upregulated), or whose function is to be altered (e.g., loss of function, gain of function, etc) by a gRNA and / or CRISPR / Cas system (e.g., an RNP) according to the present disclosure. A “target gene” may be encoded by any nucleic acid molecule, e.g., double stranded or single stranded, and a DNA or an RNA. In general, “target gene” may be any gene of interest in a target cell. The sequence of “target gene” encompasses the coding and non-coding strand sequences of the gene.

[0414] The term “target region” as used herein refers to an approximate sequence span (including both the coding and non-coding strands) within a target gene of about 1-120 nt (or about 1-100 nt or about 1-80 nt) which includes the nucleotide position(s) to be cleaved (“target cut site(s)” (typically between two nucleotide positions)) by a given programable nuclease (one position in case of a blunt- ended DBS (e.g., by Cas9) and two positions in case of a staggered DBS (e.g., by Cas12a)) and the sequence upstream of the target cut site (e.g., about 1-80 nt upstream) and the sequence downstream of the target cut site (e.g., about 1-80 nt downstream). The target sequence (to be targeted by a gRNA used with the Cas nuclease) may be fully included in the target region, e.g., of about 20-160 nt.

[0415] The term “target strand” refers to the strand (of a target gene or a regulatory region of a target gene of an allele of interest (e.g., first allele)) to which a gRNA of interest binds. When the target gene or the regulatory region is encoded by a double stranded nucleic acid, the term “non-target strand” refers to the opposite strand of (typically complementary to) the target strand. When there is another allele (e.g., second allele), a “corresponding target strand” is the strand (of a target gene or a regulatory region of a target gene of another allele (e.g., second allele)) which corresponds to (i.e., has the same nucleotide positions as) the target strand of the allele of interest (e.g., first allele) regardless of whether or how much the gRNA of interest actually binds to the corresponding target strand, and a “corresponding non-target strand” is the strand (of a target gene or a regulatory region of a target gene of another allele (e.g., second allele)) which corresponds to (i.e., has the same nucleotide positions as) the non-target strand of the allele of interest (e.g., first allele). If the target strand is a coding strand, the corresponding target strand is also a coding strand. If the target strand is a non-coding strand, the corresponding target strand is also a non-coding strand.

[0416] The term “target segment” as used herein refers to the segment of a target gene or a regulatory region of a target gene of an allele of interest (e.g., a first allele) to which a given gRNA selectively hybridizes to (including the target strand and, when present, a non-target strand of the target gene), and, when there is another allele (e.g., a second allele), also encompasses the corresponding segment (i.e., having the same nucleotide positions as the segment of a target gene or a regulatory region of a target gene of an allele of interest) of the allele (including the corresponding target strand and, when present, a corresponding non-target strand).

[0417] The term “target sequence”, “target nucleic acid sequence”, or “target polynucleotide sequence” as used herein is the sequence of a polynucleotide that a gRNA according to the present disclosure may or is designed to interact or hybridize with (also referred to as a target or a target polynucleotide)) to alter the target gene. Therefore, a “target sequence” is the sequence of the target strand of the target segment of an allele of interest (e.g., “first allele”) a gRNA according to the present disclosure hybridizes with, and thus the target or target polynucleotide may comprise a “target sequence”. When there is another allele (e.g., “second allele), the sequence of the corresponding target strand of the target segment is a “corresponding target sequence”, and thus a corresponding target or a corresponding target polynucleotide may comprise a “corresponding target sequence”.

[0418] The term “therapeutically effective amount / dose” refers to the quantity of a TCV or a pharmaceutical composition comprising such a TCV or its cargo that is sufficient to provide a therapeutic effect (which may be based on, e.g., the number or percentage of target cells in which the intended target gene alteration occurred, the overall change in the target gene expression, the amelioration of one or more symptom, the number or percentage of target cells exhibiting an intended phenotype such as morphology, etc) upon administration to a subject.

[0419] The term “transfection competent vesicle” or “TCV” as used herein, in its broadest sense, encompasses any vesicles which allows for transfection of a cell by carrying one or more cargoes,such as but not limited to a nucleic acid molecule (e.g., a DNA or an RNA) and / or a nucleic acid molecule complexed with a protein or peptide (e.g., an RNP), into the cell. Examples of TCVs include but are not limited to: lipid-based compositions capable of carrying a nucleic acid molecule, such as liposomes and lipid nanoparticles (LNPs); virus-like particles (VLPs); and nanoparticles. In some embodiments, a TCV may be according to any of the lipid-based TCVs described herein. In some embodiments, a TCV may comprise a targeting moiety (e.g., antibody or antibody fragment such as a Fab fragment), which allows the TCV to carry its cargo preferentially into a target cell.

[0420] As used herein, the term "treat," "treatment," or "treating" generally refers to the clinical procedure for reducing or ameliorating the progression, severity, and / or duration of a disease or of a condition, or for ameliorating one or more conditions or symptoms (preferably, one or more discernible ones) of a disease. In specific embodiments, the effect of the “treatment” may be evaluated by the amelioration of at least one measurable physical parameter of a disease, resulting from the administration of one or more therapies. The parameter may be, for example, gene expression profiles, the number of disease-affected cells, the percentage or frequency of disease-affected cells among the cells of the same lineage, disease-associated marker levels, and / or the presence or absence or levels of certain cytokines or chemokines or other disease-associated molecules and may not necessarily be discernible by the patient. In some embodiments "treat", "treatment," or "treating" may result in and / or be evaluated based on the inhibition of the progression of a disease, either physically by, e.g., stabilization of a discernible symptom, physiologically by, e.g., stabilization of a physical parameter, or both. In some embodiments the terms "treat", "treatment" and "treating" refer to the reduction or stabilization of cancerous tissue or cells. Additionally, the terms “treat,” and “prevent” as well as words stemming therefrom, as used herein, do not necessarily imply 100% or complete cure or prevention. Rather, there are varying degrees of treatment effects or prevention effects of which one of ordinary skill in the art recognizes as having a potential benefit or therapeutic effect. In this respect, the inventive methods can provide any amount of any level of treatment or prevention effects of a disease in a mammal. Furthermore, the treatment or prevention provided by the inventive method can include treatment or prevention of one or more conditions or symptoms of the disease being treated or prevented. Also, for purposes herein, “prevention” can encompass delaying the onset of the disease, or a symptom or condition thereof.

[0421] The term “upstream” as used herein in relation to a nucleotide position means the 5’ side of a reference, e.g., a reference nucleotide position. When the term is used in the context of a single stranded nucleic acid molecule or a particular strand of a double stranded nucleic acid molecule, “upstream” means the 5’ side of a reference. When the term is used in the context of a gene-encoding double stranded nucleic acid molecule, “upstream” means the 5’ side of a reference and the 5’ is in the direction according to the coding strand. Similarly, the term “downstream” as used herein in relation to a nucleotide position means the 3’ side of a reference, e.g., a reference nucleotide position. When the term is used in the context of a single stranded nucleic acid molecule or a particular strand of adouble stranded nucleic acid molecule, “downstream” means the 3’ side of a reference. When the term is used in the context of a gene-encoding double stranded nucleic acid molecule, “downstream” means the 3’ side of a reference and the 3’ is in the direction according to the coding strand.

[0422] The term “vector” as used herein, in its broadest sense, encompasses any materials capable of carrying one or more cargoes, such as but not limited to a nucleic acid molecule (e.g., a DNA or an RNA) and / or a nucleic acid molecule complexed with a protein or peptide (e.g., an RNP), into a cell. Examples of vectors include but are not limited to: compounds, such as calcium phosphate, polycations, cationic lipids, phospholipids, organic and nonorganic polymers, dendrimers, organic and nonorganic nanoparticles and nanobeads, and any combinations thereof; lipid-based compositions capable of carrying a nucleic acid molecule, such as liposomes and lipid nanoparticles (LNPs) or any of lipid-based TCVs described herein; plasmids; virus-like particles (VLPs); and viral vectors, such as retroviral, lentiviral, and adenoviral vectors.

[0423] As will be understood by one having ordinary skill in the art, for any and all purposes, such as in terms of providing a written description, all ranges disclosed herein also encompass any and all possible sub-ranges and combinations of sub-ranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as “up to,” “at least,” “greater than,” “less than,” and the like include the number recited and refer to ranges which can be subsequently broken down into sub-ranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 articles refers to groups having 1, 2, or 3 articles. Similarly, a group having 1-5 articles refers to groups having 1, 2, 3, 4, or 5 articles, and so forth.

[0424] While in the above set forth preferred construction, specific elements have been recited in order to adequately illustrate the principles of this invention, it will be apparent to those skilled in the art that alterations and modifications in the construction and arrangement of the system may be made without thereby departing from the spirit of said invention. Changes of form, of details of construction and materials may be made without thereby departing from the spirit of invention set forth, which shall be limited only by the scope of the appended claims / Examples are provided below to illustrate the present invention. These examples are not meant to constrain the present invention to any particular application or theory of operation. EXAMPLES Materials and Methods gRNAs

[0425] Guide RNAs were designed by Applicant and synthesized by Integrated DNA Technologies (IDT) as Alt-R™ CRISPR-Cas9 single gRNAs (sgRNAs; tracrRNA + crRNA) or Alt-R™ A.s. Cas12a crRNAs. Alt-R™ CRISPR-Cas9 sgRNAs include 2'-O-methyl modifications and phosphorothioate linkages at the first and last 3 bases. gRNAs used included those shown in Tables 1 and 2 and other gRNAs specifically mentioned in Examples. Table 1: Exemplary Cas9 gRNA spacer regions targeting either the G allele, the A allele, or both G and A alleles at SERPINA1 rs28929474. Spacer region Spacer region sequence gRNA nameTargettaken from (coding (+) SEQ ID ll l di t ndSERPINA1_20A AAGAAAGGGACTGAAGCTGC 20 A + SERPINA1_20G GAGAAAGGGACTGAAGCTGC 30 G +SERPINA1_3A, SERPINA1_4A, and SERPINA1_20A were designed to bind / target the A allele at rs28929474 in A1ATD patient-derived cell lines. Table 2: Exemplary Cas12a gRNA spacer regions targeting either the G allele, the A allele, or both G and A alleles at SERPINA1 rs28929474. Spacer region Spacer region sequence taken ) -)

[0426] All single-stranded DNA oligonucleotide (ssODN) templates were synthesized by IDT as Alt- R™ HDR Donor Oligos. Alt-R™ HDR modified oligos include 2 phosphorothioate (PS) linkages and also an IDT proprietary end-blocking modification at each end to provide increased stability. Template sequences used included those shown in Table 3. Table 3: Exemplary ssODN sequences for correction of c.1096G>A transition by HDR. Template sequence 5’-3’ Template sequence Template corresponds to (coding (+) orCAATTGTCAGCACAGCCTTAT GCACTGCCTGGAGGGGAGAG AAGCAGAGACACGTTGTpoint mutations (underlined) in coding sequence for easier detection of HDR. Cas proteins

[0427] Cas9 nuclease was ordered from ThermoFisher Scientific (TrueCutTMS.p. Cas9 v2, Cat. # A36499). Cas9 D10A nickase was ordered from IDT (Alt-RTMS.p. Cas9 D10A Nickase V3, Cat#1081063). Cas12a nuclease was ordered from IDT (Alt-R™ A.s. Cas12a (Cpf1) Ultra, Cat#10007804). Lipids

[0428] 1,2-dioleyloxy-3-dimethylaminopropane (DODMA), 1,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE), and 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) were obtained from Avanti Polar Lipids (Alabaster, AL). Cholesterol was obtained from Sigma-Aldrich (St. Louis, MO, Cat#C3045). DMG-PEG 2000 (referred to as PEG-lipid herein after) was obtained from Avanti Polar Lipids (Alabaster, AL, Cat# 880151). DODMA / DOPE / DSPC / Cholesterol lipids were mixed at the ratio 30 / 20 / 10 / 40 mole %, or, when PEG-lipid was used, DODMA / DOPE / DSPC / Cholesterol / PEG-lipid were mixed at the ratio 30 / 20 / 10 / 38.5 / 1.5 mole %. TCV formation

[0429] Ethanolic solutions of the following lipids were prepared at 10 mM: DODMA, DOPE, DSPC, and cholesterol mixed at the ratio 30 / 20 / 10 / 40 mole % or DODMA, DOPE, DSPC, Cholesterol, and PEG-lipid mixed at the ratio 30 / 20 / 10 / 38.5 / 1.5 mole %. The solution of lipids was then mixed with an aqueous solution of 25 mM sodium acetate, pH 4, through an Ignite microfluidic mixer (Cat#NIN0001, Precision Nanosystems, Vancouver, Canada) at a total flow rate of 20 mL / min and a ratio of 3:1 v / v (aqueous / lipid mixture). The resultant solution was dialyzed 1:1000 in aqueous solution of 25 mM sodium acetate, pH 4 overnight at 4˚C. Following dialysis, empty LNPs were concentrated using the Amicon (Cat#UFC801008, Sigma-Aldrich) centrifugation filter and the final lipid concentration was adjusted to 10 mM (molar concentrations for a TCV herein are the concentration of total lipid components of the TCV), as assessed by cholesterol assay (Cat#CA97000- 018, WAKO, Richmond, VA). RNP formation and TCV encapsulation

[0430] The following protocol was used unless otherwise specified.

[0431] Single-guide approach (with or without template)

[0432] For preparation of TCV-encapsulated, Cas9-based RNPs for the single-guide approach (e.g., used at a final concentration of 100 nM RNP in each well of a 24-well plate), 10 µL of 10 µM Cas9 nuclease was mixed with 10 µL of 10 µM gRNA and incubated for 5 minutes at ambient temperature to form the RNP. When a template was used, 5 µL of 10 µM template was mixed with the RNP andincubated for 5 minutes at room or ambient temperature. Subsequently, 16.66 µL of 10 mM TCVs was added to the RNP or, when a template was used, the RNP + template mixture, mixed briefly by pipette, and incubated for at least 5 minutes at ambient temperature prior to use. For treatment of hepatocyte-like cells, the same mixing protocol was used with 5 µL of 5 µM Cas9, 5 µL of 10 µM SERPINA1 gRNA, 2.5 µL of 10 µM template and 8.33 µL of 10 mM TCVs containing 1.5% DMG- PEG.

[0433] For preparation of TCV-encapsulated, Cas12a-based RNPs, 10 µL of 10 µM Cas12a was mixed with 10 µL of 12 µM gRNA and incubated for 5 minutes at an ambient temperature to form the RNP. When a template was used, 5 µL 10 µM template was mixed with the RNP and incubated for 5 minutes at ambient temperature. Subsequently, 16.66 µL of 10 mM TCVs was added to each of the RNP complexes, mixed briefly by pipette, and incubated for at least 5 minutes at ambient temperature.

[0434] Dual-guide approach (with or without template)

[0435] For preparation of encapsulated TCV-RNPs for the dual-guide approach (e.g., used at a final concentration of 100 nM RNP in each well of a 24-well plate), 5 µL of 10 µM Cas9 D10A nickase was mixed with 5 µL of each 10 µM gRNA separately (the mixture of nickase and one gRNA was prepared, and separately the mixture of nickase and the other gRNA was prepared) and incubated for 5 minutes at ambient temperature to form the RNPs. When a template DNA was used, 2.5 µL of 10 µM template was mixed with each RNP complex separately and incubated for 5 minutes at room or ambient temperature. Subsequently, 8.33 µL of 10 mM TCVs was added to each of the RNP or, when a template was used, the RNP + template mixture, mixed briefly by pipette, incubated for at least 5 minutes at ambient temperature, then both TCV-encapsulated RNPs were combined in a culture medium at a 1:1 ratio prior to use. For treatment of hepatocyte-like cells, the same mixing protocol was used with 5 µL of 5 µM Cas9, 5 µL of 10 µM gRNA, 2.5 µL of 10 µM template and 8.33 µL of 10 mM TCVs containing 1.5% DMG-PEG. Cell culture

[0436] HEK293 cells

[0437] HEK293 cells were grown in DMEM (Gibco, Cat#11960) supplemented with 10% FBS (Gibco, Cat#12483020), 1% GlutaMAX (Gibco, Cat#35050061), 1mM Sodium pyruvate (Gibco, Cat#11360070) and 1% penicillin / streptomycin (Gibco, Cat#15140122).

[0438] GM11423 cells

[0439] A1ATD patient-derived fibroblasts (GM11423) were acquired from the Coriell Institute for Medical Research. This line is homozygous for G>A transition at nucleotide 1096 in exon 5 of the SERPINA1 gene (“c.1096G>A”) resulting in a substitution of lysine for glutamic acid at codon 342 of A1AT (Glu342Lys (E342K)). GM11423 fibroblasts were grown in grown in DMEM supplemented with 15% FBS, 1% GlutaMAX and 1% penicillin / streptomycin.

[0440] Human induced pluripotent stem cells (hPSCs)

[0441] Human induced pluripotent stem cells (hPSCs) from a healthy control individual (GM02149; Coriell Institute for Medical Research) and a patient with A1ATD homozygous for the SERPINA1 c.1096G>A mutation (PiZZ1, Boston University) were maintained in mTeSRTMPlus (StemCell Tech, Cat#100-0267) complete medium on 6-well plates coated with on Corning® Matrigel® (Cat#354277). Cells were adapted to 8 µg / mL CellAdhereTMLaminin-521(StemCell Tech, Cat#77003) coated plate 6 - 8 days before differentiation.

[0442] Differentiation of hPSCs into the hepatocyte-like cells (HLCs) was performed by employing STEMdiff™ hepatocyte kit (StemCell Tech, Cat#100-0520) according to the manufacturer’s instructions. Briefly, one day before differentiation, hPSCs were dissociated into single cells using Gentle Cell Dissociation Reagent (StemCell Tech, Cat#100-0485), and 6 × 105cells were seeded per well of a 24-well plate coated with CellAdhere™ Laminin-521 in mTeSRTM Plus complete medium supplemented with 10 µM Y-27632 (StemCell Tech, Cat#72302). After 24 hours, cell monolayers should be ≥ 80% confluent before proceeding to differentiation.

[0443] On day 1, cells were cultured with STEMdiff™ Definitive Endoderm Basal medium with Supplements MR and CJ for 24 hours. On day 2 - 4, cells were cultured in STEMdiff Definitive Endoderm Basal medium with Supplement CJ, with daily medium change. From day 5, cells were cultures in STEMdiff™ Hepatic Progenitor medium for 5 days, with daily medium change. From day 10, cells were cultured in STEMdiff™ Hepatocyte medium, with medium changed every 2 days. The differentiated HLCs could be maintained for up to 21 days. Gene expression analysis by qPCR was performed to assess DE, hepatic progenitors and hepatocytes formation. HLCs maturation was evaluated by measuring secreted A1AT into the culture media using an ELISA (Aviva Systems Biology, Cat#OKIA00048).

[0444] Cell treatments

[0445] For treatment on HEK293, cells were seeded at a density of 50,000 cells / mL on day 0. Twenty-four hours after seeding (day 1) cells were treated with TCV-RNP formulations as described below.

[0446] For treatment of GM11423 fibroblasts, cells were seeded at a density of 80,000 cells / mL on day 0 and were immediately or on the same day treated with TCV-RNP formulations as described below.

[0447] For treatment of HLCs, cells were differentiated as described above. On day 14, TCV-RNP formulations were mixed fresh culture media and applied to the cells as described. DNA / RNA extraction

[0448] DNA and RNA were extracted from cell pellets using the E.Z.N.A. DNA / RNA kit (Omega Bio-Tek, Cat# R6731-01) according to the manufacturer’s protocol. SERPINA1 editing and HDR efficiency

[0449] Genomic DNA was extracted and regions flanking target sites were amplified by PCR using primers listed in Table 4 and sent for Sanger sequencing. Percent SERPINA1 editing efficiency wasassessed using either TIDE (http: / / shinyapps.datacurators.nl / tide / ) or DECODR analytical tools. Percent SERPINA1 HDR efficiency was assessed using TIDER (http: / / shinyapps.datacurators.nl / tider / ) analytical tools. Table 4: Primers for amplification and sequencing of SERPINA1 editing Target Orientation Primer sequence SEQ ID NO: Forward ACTAAAGGCGACCAATGAACAAC 70

[0450] cDNA was generated from RNA using SuperScript™ IV VILO™ Master Mix (Invitrogen, Cat#11756050). Sample cDNA was then mixed with TaqMan™ Fast Advanced Master Mix (Applied Biosystems, Cat#4444556) and TaqMan assays for SERPINA1 (Hs00165475_m1) and IPO8 (as a reference gene) (Hs00914057_m1), and transcript expression of both SERPINA1 / IPO8 was quantified in duplex by qPCR on a QuantStudio™ 3 Real-Time PCR System. SERPINA1 digital PCR (dPCR)

[0451] Custom nonfluorescent quencher-minor groove binder (NFQ-MGB) probes specifically designed to target the SERPINA1 c.1096G>A mutation (Z-allele) and the corresponding region of HDR correction (SERPINA1 c.1096G (M-allele)) were synthesized by Applied Biosystems (Table 5). The FAM™ dye-labeled probe was designed to detect the HDR-corrected sequence (corrected using the template sequence shown in Table 3), while the VIC™ dye-labeled probe targeted the Z- or M- allele sequence. Two sets of primers were designed to couple with the respective probes (IDT; Table 5), amplifying the cDNA region containing either the Z- or M-allele or the HDR correction for SERPINA1 expression analysis. The assay was duplexed to include both sets of primers and probes in the same dPCR reaction mix to simultaneously detect and quantify the HDR-corrected and Z- or M- alle expression. Data analysis software (QuantStudio Absolute Q digital PCR software) was used to quantify the number of positive chambers for each probe, indicating the abundance of HDR-corrected versus non-corrected transcripts in the samples. The results are presented as a stacked bar graph, illustrating the proportional contributions of HDR-corrected and non-corrected transcripts relative to the total SERPINA1 expression. Table 5: Primers and probes for dPCR assay to measure HDR SEQ N O i t ti S (5’ 3’) ID :SERPINA1_ PiZ_VIC probe Forward (VIC)CATCGACAAGAAAGG(NFQ- 74 MGB) SERPINA1 HDR FAM Forward (FAM)AATTGATGAGAAGGGA(NF 75

[0452] Levels of A1AT protein secreted from HLCs in the culture media were measured using an enzyme-linked immunosorbent assay (ELISA) (Aviva Systems Biology, Cat# OKIA00048) according to the manufacturer’s protocols. Briefly, culture media from healthy control (GM02149) HLCs were diluted at 1:100, and media from PiZZ HLCs were diluted at 1:20. A1AT concentrations were measured in the diluted samples using ELISA and then multiplied by the corresponding dilution factor to calculate the absolute concentration of A1AT in the original, undiluted media. Normalized concentrations of A1AT were calculated based on absolute concentrations of A1AT relative to SERPINA1 transcript levels. Example 1: SERPINA1 rs28929474(A) gene editing – single-guide approach with Cas9 nuclease

[0453] SERPINA1 rs28929474(A) allele-selective gRNAs designed according to the present disclosure were evaluated in a single-guide approach. The editing strategy for this Example is exemplified in FIG.2A with gRNAs SERPINA1_2A, 3A, and 4A. Example 1-1: Editing and correction efficiency with rs28929474(A)-selective gRNAs (SERPINA1_2A, 3A, or 4A) in GM11423 cells.

[0454] GM11423 cells were seeded at a density of 80,000 cells / mL and TCVs (DODMA / DOPE / DSPC / Cholesterol = 30 / 20 / 10 / 40 mole %) encapsulating RNPs of Cas9 nuclease and a gRNA targeting either an off-target gene GFP (negative control sgRNA “sgGFP” having the spacer region of SEQ ID NO: 31) or SERPINA1 rs28929474(A) allele (“SERPINA1_2A”, “SERPINA1_3A”, or “SERPINA1_4A” having the spacer region of SEQ ID NO: 2, 3, or 4, respectively) (Table 1), with or without an A>G correction template (SERPINA1 A>G HDR 120bp_F (“Template-F”) or SERPINA1 A>G HDR 120bp_R (“Template-R”) of SEQ ID NO: 61 or 62, respectively) (Table 3), were added to culture media at a final RNP concentration of 100 nM (2:1 RNP to template stoichiometry, when a template was used (i.e., 1:1:0.5 Cas9:gRNA:template stoichiometry)). Treatments were left on cells for 24 hours, followed by a media change. The cells were subsequently cultured for an additional 48 hours prior to harvest.

[0455] Genomic DNA and RNA were extracted from the same cell pellet to quantify SERPINA1 editing efficiency and HDR efficiency. SERPINA1 editing efficiency was quantified by TIDE analyses. SERPINA1 HDR efficiency was quantified by TIDER analyses, and percent HDR-correctedSERPINA1 compared to non-corrected SERPINA1 (i.e., Z-allele) transcripts was also quantified by dPCR.

[0456] FIG.2B shows exemplary SERPINA1 editing efficiency with gRNA SERPINA1_2A (One- way ANOVA: p<0.0001. *p<0.05, **p<0.01, ****p<0.0001) (left), gRNA SERPINA1_3A (One-way ANOVA: p<0.0001. *p<0.05, **p<0.01, ****p<0.0001) (center), or gRNA SERPINA1_4A (One-way ANOVA: p=0.0010. *p<0.05, **p<0.01) (right)), measured by TIDE.

[0457] FIG.2C shows exemplary SERPINA1 HDR efficiency with gRNA SERPINA1_2A (One-way ANOVA: p=0.5530) (left), gRNA SERPINA1_3A (One-way ANOVA: p=0.0125. **p<0.01) (center), or gRNA SERPINA1_4A (One-way ANOVA: p=0.7545) (right)), measured by TIDER.

[0458] FIG.2D shows exemplary percentages of HDR-corrected and non-corrected (i.e., Z-allele) SERPINA1 transcripts with gRNA SERPINA1_2A (left) or gRNA SERPINA1_3A (right)), measured using dPCR. Example 1-2: Impact on A1AT protein levels by editing with rs28929474(A)-selective gRNAs (SERPINA1_2A, 3A, or 4A).

[0459] GM11423 cells are seeded, e.g., at a density of 80,000 cells / mL and TCVs encapsulating RNPs of Cas9 nuclease and a gRNA targeting either an off-target gene GFP (“sgGFP” having the spacer region of SEQ ID NO: 31) or SERPINA1 rs28929474(A) allele (“SERPINA1_2A”, “SERPINA1_3A”, or “SERPINA1_4A” having the spacer region of SEQ ID NO: 2, 3, or 4, respectively) (Table 1), with or without an A>G correction template (SERPINA1 A>G HDR 120bp_F (“Template-F”) or SERPINA1 A>G HDR 120bp_R (“Template-R”) of SEQ ID NO: 61 or 62, respectively) (Table 3), are added to culture media, e.g., at a final RNP concentration of 100 nM (2:1 RNP to template stoichiometry, when a template was used). Treatments are left on cells for 24 hours, followed by a media change. The cells are subsequently cultured for an additional 48 hours, and the cells and supernatants are harvested.

[0460] The cells and supernatants are collected. The cells are washed and lysed. The lysates and supernatants are subjected to western blot analyses to quantify A1AT protein levels. The supernatants are subjected to enzyme-linked immunosorbent assay (ELISA) to measure the secretion of A1AT protein. Example 1-3: Impact on A1AT protein secretion by editing with rs28929474(A)-selective gRNAs (SERPINA1_2A or 3A) in A1ATD HSCs.

[0461] A1ATD human pluripotent stem cells (PSCs) homozygous for the SERPINA1 c.1096G>A mutation (Z-allele) were seeded at a density of 1x106cells / mL and differentiated to HLCs for 14 days. On day 14, TCVs encapsulating RNPs of Cas9 nuclease and either a negative control sgRNA (Cas9 off-target negative control) or a gRNA targeting SERPINA1 rs28929474(A) allele (“SERPINA1_2A” or “SERPINA1_3A” having the spacer region of SEQ ID NO: 2 or 3, respectively) (Table 1), with orwithout an A>G correction template (SERPINA1 A>G HDR 120bp_F (“Template-F”) of SEQ ID NO: 61) (Table 3), were added to culture media at a final RNP concentration of 50 nM (0.5:1:0.5 Cas9 to gRNA to template stoichiometry, when a template was used). Treatments are left on cells for 24 hours, followed by a media change. The cells and culture media were harvested on day 18 of differentiation.

[0462] Genomic DNA and RNA were extracted from the same cell pellet to quantify SERPINA1 editing efficiency, relative expression, and HDR levels. Secreted A1AT levels in the culture media were measured by ELISA and normalized based on SERPINA1 transcript levels.

[0463] FIG.2E shows exemplary, normalized levels of secreted A1AT protein. Example 1-4: Impact on A1AT protein functions by editing with rs28929474(A)-selective gRNAs (SERPINA1_2A, 3A, or 4A).

[0464] Hepatocyte-like cells (HLCs) derived from human induced pluripotent stem cells (iPSCs) are seeded, and TCVs encapsulating RNPs of Cas9 nuclease and a gRNA targeting either an off-target gene GFP (“sgGFP” having the spacer region of SEQ ID NO: 31) or SERPINA1 rs28929474(A) allele (“SERPINA1_2A”, “SERPINA1_3A”, or “SERPINA1_4A” having the spacer region of SEQ ID NO: 2, 3, or 4, respectively) (Table 1), with or without an A>G correction template (SERPINA1 A>G HDR 120bp_F (“Template-F”) or SERPINA1 A>G HDR 120bp_R (“Template-R”) of SEQ ID NO: 61 or 62, respectively) (Table 3), are added to culture media, e.g., at a final RNP concentration of 100 nM (2:1 RNP to template stoichiometry, when a template is used). The cells are incubated in the presence of the treatments.

[0465] The cells and supernatants are collected. The cells are washed and lysed. The lysates and supernatants are evaluated for the ability of the corrected A1AT protein to inhibit neutrophil elastase.

[0466] Next, gRNAs SERPINA1_16 was evaluated in a single-guide approach. The editing strategy for this Example is exemplified in FIG.2F. Example 1-5: HDR efficiency in HLCs from healthy hPSCs (gRNAs SERPINA1_16).

[0467] GM02149 healthy control hPSCs were seeded at a density of 400,000 cells / mL and differentiated to HLCs for 14 days. TCVs (DODMA / DOPE / DSPC / Cholesterol = 30 / 20 / 10 / 40 mole %) encapsulating RNPs of Cas9 nuclease and a sgRNA targeting an off-target gene GFP (“sgGFP” having the spacer region of SEQ ID NO: 31) or SERPINA1 (“SERPINA1_16” having the spacer region of SEQ ID NO: 16) (Table 1), with or without an A>G correction template (SERPINA1 A>G HDR 120bp_F (“Template-F”) or SERPINA1 A>G HDR 120bp_R (“Template-R”) of SEQ ID NO: 61 or 62, respectively) (Table 3), were added to culture media at a final RNP concentration of 50 nM (when a template was used (i.e., 0.5:1:0.5 Cas9:gRNA:template stoichiometry)). Treatments were left on cells for 24 hours, followed by a media change, and cells were harvested on day 18 of differentiation.

[0468] Genomic DNA and RNA were extracted from the same cell pellet to quantify SERPINA1 editing efficiency by TIDE analyses, relative expression by qPCR, and HDR levels using dPCR. Note that GM02149 hPSCs are derived from a healthy control individual not carrying the Z-allele. Therefore, HDR was quantified utilizing the additional mutations incorporated in the template (see the additional point mutations (including those underlined) in the template in Table 3 and SERPINA1_HDR_FAM probe sequence in Table 5) relative to the wild-type SERPINA1 M-allele.). Culture media was collected to measure secreted A1AT levels.

[0469] FIG.2G shows exemplary % SERPINA1 transcripts in which HDR has occurred compared to M-allele transcripts, measured using dPCR (One-way ANOVA: p=0.0003. Tukey’s multiple comparison test: ***p<0.001) (left). Example 1-6: Impact on A1AT protein levels and functions by editing with gRNAs SERPINA1_16.

[0470] GM11423 cells are seeded, e.g., at a density of 80,000 cells / mL. Alternatively, HLCs derived from human induced pluripotent stem cells (iPSCs) homozygous or heterozygous for the Z-allele are prepared and seeded are prepared and seeded. TCVs encapsulating RNPs of Cas9 nuclease and a gRNA targeting either an off-target gene (e.g., “sgGFP” having the spacer region of SEQ ID NO: 31) or SERPINA1 rs28929474(A) allele (“SERPINA1_2A”, “SERPINA1_3A”, or “SERPINA1_4A” having the spacer region of SEQ ID NO: 2, 3, or 4, respectively) (Table 1), with or without an A>G correction template (SERPINA1 A>G HDR 120bp_F (“Template-F”) or SERPINA1 A>G HDR 120bp_R (“Template-R”) of SEQ ID NO: 61 or 62, respectively) (Table 3), are added to culture media, e.g., at a final RNP concentration of 100 nM (2:1 RNP to template stoichiometry, when a template was used). Treatments are left on cells for 24 hours, followed by a media change. The cells are subsequently cultured for an additional 48 hours, and the cells and supernatants are harvested.

[0471] The cells and supernatants are collected. The cells are washed and lysed. The lysates and supernatants are subjected to western blot analyses to quantify A1AT protein levels. The supernatants are subjected to enzyme-linked immunosorbent assay (ELISA) to measure the secretion of A1AT protein.

[0472] When cells are treated with RNPs of a SERPINA1-targeting gRNA and Cas9, e.g., when a template is used, an increase of secreted A1AT protein, and / or improved A1AT functions, are observed. Example 1-7: In vivo editing of SERPINA1 with a single gRNA (e.g., SERPINA1_2A, SERPINA1_3A, SERPINA1_4A, or SERPINA1_16, etc) and Cas9 nuclease.

[0473] RNPs of Cas9 nuclease and a gRNA targeting SERPINA1 (e.g., SERPINA1_2A, SERPINA1_3A, SERPINA1_4A, or SERPINA1_16, having the spacer region of SEQ ID NO: 2, 3, 4, or 16, respectively, or any of the SERPINA1-targeting gRNAs disclosed herein; or a negative control gRNA), with or without an A>G correction template (e.g., SERPINA1 A>G HDR 120bp_F (“Template-F”) or SERPINA1 A>G HDR 120bp_R (“Template-R”) of SEQ ID NO: 61 or 62,respectively; or any of the templates disclosed herein) (Tables 1 and 3) (e.g., at 0.5:1, 1:1, 1:2, 1:3, 1:4, 1:5, or 1:6 Cas9 to gRNA stoichiometry, and when a template is used 0.5:1:0.5, 1:1:0.5, 1:2:0.5, 1:3:0.5, 1:4:0.5, 1:5:0.5, or 1:6:0.5 Cas9 to gRNA to template stoichiometry) are encapsulated in TCVs.

[0474] RNPs are prepared by mixing a gRNA solution (e.g., 60 µL of 10 µM gRNA) with a Cas9 nuclease solution (e.g., 60 µL of 10 µM Cas9 nuclease), followed by incubation (e.g., for 5 minutes at an ambient temperature). TCV encapsulation (TCV-RNP formation) is performed by adding TCVs (e.g., 100 µL of 10 mM TCVs (DODMA / DOPE / DSPC / Cholesterol = 30 / 20 / 10 / 40 mole %)) to the RNPs (e.g., 1 : 1 : 1.66 stoichiometry of gRNA: Cas9: TCV) and briefly mixing by pipette, followed by incubation (e.g., for at least 5 minutes at ambient temperature prior to use). TCV-RNPs are then dialyzed in PBS at pH 7 or a physiological pH overnight (e.g., with a Pur-A-Lyzer Maxi 3500 dialysis cartridge obtained from Sigma-Aldrich (St. Louis, MO, Cat# PURD35050)) and concentrated, e.g., ~3x using Amicon 2mL Ultra Centrifugal Filter with a 50 kDa MWCO obtained from MilliporeSigma (Burlington, MA, Cat# UFC205024). Exemplary calculations are per animal.

[0475] Mice heterozygous or homozygous for the human Z-allele (as e.g., a transgene or knock-in) (e.g., an A1ATD transgenic mouse model, such as C57BL / 6J-Tg(SERPINA1*E366K)1Mlb / J (“PI*Z mice”)) receive intrahepatic or intravenous administration (e.g., via the tail vein) of the TCV-RNP formulations.

[0476] In some mice, blood is collected longitudinally at baseline and periodically afterwards, such as 1, 3, 7, and 14 days post treatment to measure circulating human A1AT levels by ELISA In some mice, about seven days post TCV-RNP administration, mice are terminally anesthetized (e.g., using 2,2,2-Tribromoethanol) and perfused transcardially (e.g., with ice cold PBS for 4 min followed by 4% paraformaldehyde (PFA) in PBS for 4 min). Peripheral tissues including the liver are collected. The liver tissue samples are sectioned and IHC is performed (e.g., using an antibody specific for wildtype A1AT and / or an antibody specific for mutant (E342K) A1AT.

[0477] In a separate cohort of mice, mice are terminally anaesthetized and sacrificed. Peripheral tissues including the liver are collected. The liver is is snap frozen for molecular analysis (eg. DNA, RNA and protein levels). Hepatocytes are obtained from another part of the liver tissue samples and expression and / or secretion of wildtype A1AT and / or mutant (E342K) A1AT is quantified (e.g., by flow cytometry). Hepatocytes are cultured and supernatants are collected. Part of the hepatocytes are washed and lysed. The lysates are subjected to western blot analyses and / or enzyme-linked immunosorbent assay (ELISA) to quantify A1AT protein (wildtype and / or mutant) levels. The lysates and supernatants are evaluated for the ability of the corrected A1AT protein to inhibit neutrophil elastase. Genomic DNA and RNA are further extracted from the same hepatocyte (or whole liver cell) pellet to quantify SERPINA1 editing efficiency by TIDE analyses, SEPINA1 expression by qPCR, and HDR levels by dPCR and / or TIDER.

[0478] When mice are treated with RNPs of a SERPINA1-targeting gRNA and Cas9, e.g., when a template is used, about 5-10% or higher % of correction of the Z-allele, an increase of secreted A1AT protein, improved A1AT functions, and / or prevention or inhibition of A1ATD disease progression, is observed. Example 2: SERPINA1 rs28929474(A) gene editing – dual-guide approach with Cas9 nickase

[0479] A set of two SERPINA1 gRNAs designed according to the present disclosure was evaluated in a dual-guide approach. The editing strategy for this Example is exemplified in FIG.3A with gRNAs SERPINA1_16 and SERPINA1_21. Example 2-1: Editing and correction efficiency with dual gRNAs (SERPINA1_16 and SERPINA1_21) and Cas9 D10A nickase in HEK293 cells.

[0480] HEK293 cells were seeded at a density of 50,000 cells / mL on day 0. Twenty-four hours after seeding (day 1), TCVs (DODMA / DOPE / DSPC / Cholesterol = 30 / 20 / 10 / 40 mole %) encapsulating RNPs of Cas9 D10A nickase and (i) “SERPINA1_16+21” (i.e., 1:1 ratio of gRNA SERPINA1_16 and gRNA SERPINA1_21 having the spacer regions of SEQ ID NOS: 16 and 21, respectively), (ii) “2x gRNA SERPINA1_16” (i.e., gRNA SERPINA1_16 at the same amount as the total gRNA amount of (i)), (iii) “2x gRNA SERPINA1_21” (i.e., gRNA SERPINA1_21 at the same amount as the total gRNA amount of (i)), or (iv) “2x sgGFP” (i.e., a gRNA targeting an off-target gene GFP having the spacer region of SEQ ID NO: 31 at the same amount as the total gRNA amount of (i)), with or without an A>G correction template (SERPINA1 A>G HDR 120bp_F (“Template-F”) or SERPINA1 A>G HDR 120bp_R (“Template-R”) of SEQ ID NO: 61 or 62, respectively) (Tables 1-2), were added to culture media at a final RNP concentration of 100 nM (2:1 RNP to template stoichiometry, when a template was used). Two hours after treatment (day 1), culture media was changed and cells were incubated for 46 hours prior to harvest.

[0481] Genomic DNA and RNA were extracted to quantify SERPINA1 editing efficiency and HDR efficiency by TIDE analyses and TIDER analyses, respectively.

[0482] FIG.3B shows exemplary results of SERPINA1 editing efficiency (One-way ANOVA: p<0.0001. Dunnett’s multiple comparison test: ****p<0.0001) (left) and SERPINA1 HDR efficiency (One-way ANOVA: p<0.0001. Dunnett’s multiple comparison test: ****p<0.0001) (right). Example 2-2: Editing and correction efficiency with dual gRNAs (SERPINA1_16 and SERPINA1_21) and Cas9 D10A nickase in GM11423 cells.

[0483] GM11423 cells were seeded at a density of 80,000 cells / mL and TCVs (DODMA / DOPE / DSPC / Cholesterol = 30 / 20 / 10 / 40 mole %) encapsulating RNPs of Cas9 D10A nickase and (i) “SERPINA1_16+21” (i.e., 1:1 ratio of gRNA SERPINA1_16 and gRNA SERPINA1_21 having the spacer regions of SEQ ID NOS: 16 and 21, respectively), (ii) “2x gRNASERPINA1_16” (i.e., gRNA SERPINA1_16 at the same amount as the total gRNA amount of (i)), (iii) “2x gRNA SERPINA1_21” (i.e., gRNA SERPINA1_21 at the same amount as the total gRNA amount of (i)), or (iv) “2x sgGFP” (i.e., a gRNA targeting an off-target gene GFP having the spacer region of SEQ ID NO: 31 at the same amount as the total gRNA amount of (i)), with or without an A>G correction template (SERPINA1 A>G HDR 120bp_F (“Template-F”) or SERPINA1 A>G HDR 120bp_R (“Template-R”) of SEQ ID NO: 61 or 62, respectively) (Tables 1-2), were added to culture media at a final RNP concentration of 100 nM (2:1 RNP to template stoichiometry, when a template was used). Treatments were left on cells for 24 hours, followed by a medium change. The cells were subsequently cultured for an additional 48 hours prior to harvest.

[0484] Genomic DNA and RNA were extracted from the same cell pellet to quantify SERPINA1 editing efficiency and HDR efficiency by TIDE analyses and TIDER analyses, respectively. Relative SERPINA1 expression was measured by qPCR, and percent HDR-corrected SERPINA1 compared to non-corrected SERPINA1 (i.e., Z-allele) transcripts was quantified by dPCR.

[0485] FIG.3C shows exemplary results of SERPINA1 editing efficiency (One-way ANOVA: p<0.0001. Tukey’s multiple comparison test: ***p<0.001, ****p<0.0001) (left) and SERPINA1 HDR efficiency (One-way ANOVA: p<0.0001. Tukey’s multiple comparison test: ****p<0.0001) (right).

[0486] FIG.3D shows exemplary relative SERPINA1 expression (One-way ANOVA: p<0.0001. Tukey’s multiple comparison test: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001) (left) and percentages of HDR-corrected SERPINA1 transcripts and non-corrected (i.e., Z-allele) SERPINA1 transcripts (right). Example 2-3: Impact on A1AT protein levels by editing with dual gRNAs (SERPINA1_16 and SERPINA1_21) and Cas9 D10A nickase in GM11423 cells.

[0487] GM11423 cells are seeded, e.g., at a density of 80,000 cells / mL. Alternatively, HLCs derived from human induced pluripotent stem cells (iPSCs) homozygous or heterozygous for the Z-allele are prepared and seeded are prepared and seeded. TCVs encapsulating RNPs of Cas9 D10A nickase and (i) “SERPINA1_16+21” (i.e., 1:1 ratio of gRNA SERPINA1_16 and gRNA SERPINA1_21 having the spacer regions of SEQ ID NOS: 16 and 21, respectively), (ii) “2x gRNA SERPINA1_16” (i.e., gRNA SERPINA1_16 at the same amount as the total gRNA amount of (i)), (iii) “2x gRNA SERPINA1_21” (i.e., gRNA SERPINA1_21 at the same amount as the total gRNA amount of (i)), or (iv) “2x sgGFP” (i.e., a gRNA targeting an off-target gene GFP having the spacer region of SEQ ID NO: 31 at the same amount as the total gRNA amount of (i)), with or without an A>G correction template (SERPINA1 A>G HDR 120bp_F (“Template-F”) or SERPINA1 A>G HDR 120bp_R (“Template-R”) of SEQ ID NO: 61 or 62, respectively) (Tables 1-2), are added to culture media at a final RNP concentration of 100 nM (2:1 RNP to template stoichiometry, when a template was used). Treatments were left on cells for 24 hours, followed by a medium change. The cells were subsequently cultured for an additional 48 hours prior to harvest.

[0488] The cells and culture media arecollected. The cells are washed and lysed . Lysates are subjected to western blot to quantify intracellular A1AT protein levels. The culture media are subjected to enzyme-linked immunosorbent assay (ELISA) to measure the secretion of A1AT protein.

[0489] When cells are treated with RNPs of SERPINA1-targeting, dual gRNAs and Cas9 nickase, e.g., when a template is used, an increase of secreted A1AT protein is observed. Example 2-4: Impact on A1AT protein functions by editing with dual gRNAs (SERPINA1_16 and SERPINA1_21) and Cas9 D10A nickase in GM11423 cells.

[0490] HLCs derived from hPSCs homozygous or heterozygous for the Z-allele are seeded, and TCVs encapsulating RNPs of Cas9 D10A nickase and (i) “SERPINA1_16+21” (i.e., 1:1 ratio of gRNA SERPINA1_16 and gRNA SERPINA1_21 having the spacer regions of SEQ ID NOS: 16 and 21, respectively), (ii) “2x gRNA SERPINA1_16” (i.e., gRNA SERPINA1_16 at the same amount as the total gRNA amount of (i)), (iii) “2x gRNA SERPINA1_21” (i.e., gRNA SERPINA1_21 at the same amount as the total gRNA amount of (i)), or (iv) “2x sgGFP” (i.e., a gRNA targeting an off- target gene GFP having the spacer region of SEQ ID NO: 31 at the same amount as the total gRNA amount of (i)), with or without an A>G correction template (SERPINA1 A>G HDR 120bp_F (“Template-F”) or SERPINA1 A>G HDR 120bp_R (“Template-R”) of SEQ ID NO: 61 or 62, respectively) (Tables 1-2), are added to culture media at a final RNP concentration of 100 nM (2:1 RNP to template stoichiometry, when a template is used). The cells are treated in the presence of the treatments.

[0491] The cells and culture media are collected. The cells are washed and lysed . Lysates are subjected to western blot to quantify intracellular A1AT protein levels. The culture media are subjected to enzyme-linked immunosorbent assay (ELISA) to measure the secretion of A1AT protein.

[0492] When cells are treated with RNPs of SERPINA1-targeting, dual gRNAs and Cas9 nickase, e.g., when a template is used, improved A1AT functions are observed. Example 2-5: Editing efficiency and HDR levels with dual gRNAs (SERPINA1_16 and SERPINA1_21) and Cas9 D10A nickase in HLCs from healthy hPSCs.

[0493] GM02149 healthy control hPSCs were seeded at a density of 400,000 cells / mL and differentiated to HLCs for 14 days. On day 14, TCVs (DODMA / DOPE / DSPC / Cholesterol = 30 / 20 / 10 / 40 mole %) encapsulating RNPs of Cas9 D10A nickase and (i) “SERPINA1_16+21” (i.e., 1:1 ratio of gRNA SERPINA1_16 and gRNA SERPINA1_21 having the spacer regions of SEQ ID NOS: 16 and 21, respectively), (ii) “2x gRNA SERPINA1_16” (i.e., gRNA SERPINA1_16 at the same amount as the total gRNA amount of (i)), (iii) “2x gRNA SERPINA1_21” (i.e., gRNA SERPINA1_21 at the same amount as the total gRNA amount of (i)), or (iv) “2x negative controlgRNA” (i.e., a gRNA targeting an off-target gene at the same amount as the total gRNA amount of (i)), with or without an A>G correction template (SERPINA1 A>G HDR 120bp_F (“Template-F”) or SERPINA1 A>G HDR 120bp_R (“Template-R”) of SEQ ID NO: 61 or 62, respectively) (Tables 1 and 3), were added to culture media at a final RNP concentration of 50 nM (0.5:1 Cas9 D10A to gRNA stoichiometry, and when a template was used 0.5:1:0.5 Cas9 D10A to gRNA to template stoichiometry). Treatments were left on cells for 24 hours, followed by a medium change. The cells were harvested on day 18 of differentiation.

[0494] Genomic DNA and RNA were extracted from the same cell pellet to quantify SERPINA1 editing efficiency by TIDE analyses, SEPINA1 expression by qPCR, and HDR levels by dPCR. Note that GM02149 hPSCs are derived from a healthy control individual not carrying the Z-allele, and therefore HDR was quantified utilizing the additional mutations incorporated in the template (see the additional point mutations (including those underlined) in the template in Table 3 and SERPINA1_HDR_FAM probe sequence in Table 5). Culture media were collected to measure secreted AAT levels.

[0495] FIG.3E shows exemplary results of SERPINA1 editing efficiency (left) and percent SERPINA1 transcripts from the allele HDR has occurred compared to M-allele transcripts (right). Example 2-6: Impact on A1AT protein secretion by editing with dual gRNAs (SERPINA1_16 and SERPINA1_21) and Cas9 D10A nickase in A1ATD HLCs.

[0496] A1ATD hPSCs homozygous for the SERPINA1 c.1096G>A mutation (Z-allele) were seeded at a density of 1x106cells / mL and differentiated to HLCs for 14 days. On day 14, TCVs (DODMA / DOPE / DSPC / Cholesterol = 30 / 20 / 10 / 40 mole %) encapsulating RNPs of Cas9 D10A nickase and (i) “SERPINA1_16+21” (i.e., 1:1 ratio of gRNA SERPINA1_16 and gRNA SERPINA1_21 having the spacer regions of SEQ ID NOS: 16 and 21, respectively), (ii) “2x gRNA SERPINA1_16” (i.e., gRNA SERPINA1_16 at the same amount as the total gRNA amount of (i)), (iii) “2x gRNA SERPINA1_21” (i.e., gRNA SERPINA1_21 at the same amount as the total gRNA amount of (i)), or (iv) “2x negative control gRNA” (i.e., Cas9 off-target negative control gRNA at the same amount as the total gRNA amount of (i)), with or without an A>G correction template (SERPINA1 A>G HDR 120bp_F (“Template-F”) or SERPINA1 A>G HDR 120bp_R (“Template-R”) of SEQ ID NO: 61 or 62, respectively) (Tables 1 and 3), were added to culture media at a final RNP concentration of 50 nM (0.5:1 Cas9 D10A to gRNA stoichiometry, and when a template was used 0.5:1:0.5 Cas9 D10A to gRNA to template stoichiometry). Treatments were left on cells for 24 hours, followed by a medium change. The cells and culture media were harvested on day 18 of differentiation.

[0497] Genomic DNA and RNA were extracted from the same cell pellet to quantify SERPINA1 editing efficiency, SEPINA1 expression, and HDR levels. Secreted A1AT levels in the culture media were measured by ELISA and normalized based on SERPINA1 transcript levels.

[0498] FIG.3E shows exemplary, normalized levels of secreted A1AT protein (One-way ANOVA: p<0.0001. Tukey’s multiple comparison test: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). Example 2-7 Editing and HDR efficiency, SERPINA1 relative expression, HDR levels, and A1AT protein levels and function with dual gRNAs (SERPINA1_16 and SERPINA1_21) and Cas9 D10A nickase in HLCs homozygous for the Z-allele.

[0499] hPSCs homozygous for the Z-allele are seeded at a density of 400,000 cells / mL and differentiated to HLCs for 14 days. On day 14, TCVs (DODMA / DOPE / DSPC / Cholesterol = 30 / 20 / 10 / 40 mole %) encapsulating RNPs of Cas9 D10A nickase and (i) “SERPINA1_16+21” (i.e., 1:1 ratio of gRNA SERPINA1_16 and gRNA SERPINA1_21 having the spacer regions of SEQ ID NOS: 16 and 21, respectively), (ii) “2x gRNA SERPINA1_16” (i.e., gRNA SERPINA1_16 at the same amount as the total gRNA amount of (i)), (iii...

Claims

CLAIMS What is claimed is:

1. An isolated guide RNA (gRNA) for programmable endonuclease, nickase, or a derivaƟve thereof- mediated gene ediƟng, opƟonally clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) protein-mediated gene ediƟng, of SERPINA1, opƟonally an rs28929474(A) allele thereof, wherein the gRNA comprises at least one CRISPR RNA (crRNA) comprising a spacer region of at least 17 nucleoƟdes in length, opƟonally 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 nucleoƟdes in length, further opƟonally 19 or 20 nucleoƟdes or 21 or 22 nucleoƟdes in length, wherein: (1) (I) the spacer region comprises or consists of: (a) the polynucleoƟde of SEQ ID NO: 3, 2, 4, 16, 21, 1, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, or 22; (b) a polynucleoƟde comprising one or more (opƟonally one, two, or three) mutaƟons (e.g., one or more subsƟtuƟons, deleƟons, or addiƟons at the 5’-end) relaƟve to the polynucleoƟde of SEQ ID NO: 3, 2, 4, 16, 21, 1, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 20, or 22, said mutaƟons opƟonally at any nucleoƟde posiƟon(s) other than the 4th to the 7th, opƟonally other than the 1st to the 12th, nucleoƟde posiƟons from the 3’-end of the polynucleoƟde of SEQ ID NO: 3, 2, 4, 16, 21, 1, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, or 22, respecƟvely; and / or (c) a polynucleoƟde comprising at least the 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleoƟdes from the 3’-end of SEQ ID NO: 3, 2, or 4, opƟonally the polynucleoƟde of: X1X2CTGACCATCGACAAGAAA (SEQ ID NO: 53) (X1is any of A, T, C, or G, opƟonally A, C, or G; and X2is any of A, T, C, or G, opƟonally A, T, or C); X1X2GCTGACCATCGACAAGAA (SEQ ID NO: 52) (X1is any of A, T, C, or G, opƟonally A, T, or C; and X2is any of A, T, C, or G, opƟonally A, C, or G); or X1X2CAGTCCCTTTCTTGTCGA (SEQ ID NO: 54) (X1is any of A, T, C, or G, opƟonally A, C, or G; and X2is any of A, T, C, or G, opƟonally A, C, or G); and / or (II) the isolated gRNA is capable of specifically or selecƟvely hybridizing with a target polynucleoƟde chain / molecule comprising SEQ ID NO: 103, 102, 104, 116, 121, 101, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 117, 118, 119, 120, or 122 and / or a target polynucleoƟde complementary to a 17-30 nucleoƟde adjacent to (e.g., immediately upstream of) any of the PAM nucleoƟdes underlined (solid) in FIG.1A; (2) (I) the spacer region comprises or consists of: (a) the polynucleoƟde of SEQ ID NO: 202, 201, or 203; (b) a polynucleoƟde comprising one or more (opƟonally one, two, or three) mutaƟons (e.g., one or more subsƟtuƟons, deleƟons, or addiƟons at the 5’-end) relaƟve to the polynucleoƟde of SEQ ID NO: 202, 201, or 203, said mutaƟons opƟonally at anynucleoƟde posiƟon(s) other than the 5th, opƟonally other than the 1st to 7th, nucleoƟde posiƟon from the 3’-end of the polynucleoƟde of SEQ ID NO: 202, 201, or 203, respecƟvely; and / or (c) a polynucleoƟde comprising at least the 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleoƟdes from the 5’-end of SEQ ID NO: 201, opƟonally the polynucleoƟde of: TTGTCGATGGTCAGCACAX1X2X3(SEQ ID NO: 251) (X1is any of A, T, C, or G, opƟonally A, T, or C; X2 is any of A, T, C, or G, opƟonally A, T, or G; and X3 is any of A, T, C, or G, opƟonally A, T, or G); and / or (II) the isolated gRNA is capable of specifically or selecƟvely hybridizing with a target polynucleoƟde chaind / molecule comprising SEQ ID NO: 302, 301, or 303 and / or a target polynucleoƟde complementary to a 17-30 nucleoƟde adjacent to (e.g., immediately downstream of) of any of the PAM nucleoƟdes underlined (doƩed) in FIG.1A.

2. The isolated gRNAs according to claim 1, wherein the spacer region comprises the polynucleoƟde of: (1) SEQ ID NO: 3, 2, 4, 16, 21, X1X2CTGACCATCGACAAGAAA (SEQ ID NO: 53) (X1is any of A, T, C, or G, opƟonally A, C, or G; and X2is any of A, T, C, or G, opƟonally A, T, or C); X1X2GCTGACCATCGACAAGAA (SEQ ID NO: 52) (X1is any of A, T, C, or G, opƟonally A, T, or C; and X2is any of A, T, C, or G, opƟonally A, C, or G); or X1X2CAGTCCCTTTCTTGTCGA (SEQ ID NO: 54) (X1is any of A, T, C, or G, opƟonally A, C, or G; and X2is any of A, T, C, or G, opƟonally A, C, or G); or (2) SEQ ID NO: 202 or TTGTCGATGGTCAGCACAX1X2X3(SEQ ID NO: 251) (X1is any of A, T, C, or G, opƟonally A, T, or C; X2is any of A, T, C, or G, opƟonally A, T, or G; and X3is any of A, T, C, or G, opƟonally A, T, or G).

3. The isolated gRNA according to claim 1 or 2, wherein: (I) (1) the isolated gRNA is: (a) a single guide RNA fragment (sgRNA) comprising (i) a crRNA comprising the spacer region and a crRNA backbone and (ii) a trans-acƟvaƟng CRISPR RNA (tracrRNA) in a single strand, opƟonally wherein the crRNA and the tracrRNA are linked via a linker opƟonally comprising 5’-GAA-3’, further opƟonally wherein the gRNA comprises the spacer region followed by a sgRNA backbone of any of SEQ ID NOS: 85-88, opƟonally wherein the sgRNA backbone is followed by one or more uracils, further opƟonally 1-10 uracils, or (b) a duplex guide RNA (dgRNA) formed by hybridizaƟon between (i) a crRNA comprising the spacer region and a crRNA backbone and (ii) a tracrRNA, opƟonally wherein the crRNA backbone and the tracrRNA comprise the nucleoƟde of SEQ ID NOS: 89 and 90, respecƟvely, or SEQ ID NOS: 91 and 92, respecƟvely; or (2) comprises a crRNA comprising (a) the spacer region and (b) a repeat region, opƟonally wherein the repeat region is at the 5’-end of the spacer region, the repeat region comprising (b-1) an opƟonal 5’-end nucleoƟde, opƟonally comprising UAAUU or AAUU, (b-2) afirst stem nucleoƟde, opƟonally comprising UCUAC, (b-3) a loop nucleoƟde, opƟonally comprising UCUU, UAAGU, UGUU, UUUU, UAUU, UGUUU, UUCG, or UUU, (b-4) a second stemnucleoƟde which is reverse complementary to thefirst stem nucleoƟde, opƟonally comprising GUAGA, and (b-5) an opƟonal 3’-end nucleoƟde, opƟonally comprising U, further opƟonally wherein the repeat nucleoƟde comprises any one of SEQ ID NOS: 191-196; (II) the isolated gRNA is syntheƟc or recombinant, opƟonally comprising a syntheƟc sgRNA comprising at least one chemical modificaƟon, opƟonally (ii-1) 2'-O-methylaƟon further opƟonally at thefirst three and last three bases and / or (ii-2) one or more 3’ phosphorothioate bonds, opƟonally between thefirst three and last two bases, (III) the programmable endonuclease, nickase, or derivaƟve thereof is or comprises: (a) a Cas endonuclease, opƟonally: (1) a Cas9 endonuclease, opƟonally comprising any one of SEQ ID NOS: 140-151, opƟonally SEQ ID NO: 140, or a variant thereof; (2) a Cas12a endonuclease, opƟonally comprising any one of SEQ ID NOS: 210-215, 220-221, and 222-225, further opƟonally SEQ ID NO: 210, or a variant thereof; or (b) a Cas nickase, opƟonally a Cas9 nickase, opƟonally wherein the Cas9 nickase comprises the subsƟtuƟon D10A or one or more of the subsƟtuƟons D839A, H840A, N854A, and N863A, relaƟve to a wildtype Cas9 (e.g., wildtype SpCas9 or SaCas9), opƟonally further comprising one or more of the subsƟtuƟons L1111R, D1135V or D1135E, G1218R, E1219F, A1322R, R1335Q or R1335E, T1337R, and / or is a circular permutaƟon variant thereof, opƟonally comprising any one of SEQ ID NO: 158-169, further opƟonally SEQ ID NO: 160, or a variant thereof, and / or is, comprises, or is derived from: (1) a Class 2 Cas protein and / or a type II Cas protein, such as Cas9, opƟonally Streptococcus pyogenes (SpCas9), Staphylococcus aureus Cas9 (SaCas9), Streptococcus thermophilus (StCas9), Neisseria meningi dis (NmCas9), Francisella novicida (FnCas9),Campylobacter jejuni (CjCas9), Streptococcus canis (ScCas9), Staphylococcus auricularis (SauriCas9), or any engineered variants thereof, opƟonally SaCas9-HF, SpCas9-HF1, KKHSaCas9, eSpCas9, HypaCas9, FokI-Fused dCas9, xCas9, SpRY (variant of SpCas9), or SpG (variant of SpCas9); or (2) a Class 2 Cas protein and / or a type V Cas protein, such as Cas12a, opƟonally Cas12a of Acidaminococcus sp. (AsCas12a), Lachnospiraceae bacterium (LbCas12a), Francisella novicida (FnCas12a), Moraxella bovoculi (MbCas12a), Coprococcus eutactus (CeCas12a), Butyrivibriofibrisolvens (BfCas12a), Eubacterium rectale (ErCas12a), or any engineered variants thereof, opƟonally AsCas12a Ultra, enAsCas12a, enAsCas12a-Hifi, enAsCas12a Ultra, enAsCas12a-Hifi Ultra, or LbCas12a Ultra, or MAD7.

4. A composiƟon comprising one or more isolated gRNAs according to any one of claims 1-3.

5. A polynucleoƟde or polynucleoƟdes encoding the one or more isolated gRNAs according to any one of claims 1-3, opƟonally a DNA or an RNA.

6. A vector comprising the polynucleoƟde or polynucleoƟdes according to claim 5, opƟonally operably linked to one or more regulatory sequences.

7. A ribonucleoprotein (RNP), which comprises: (a) an isolated gRNA according to any one of claims 1-3; complexed with (b) the programmable endonuclease, nickase, or derivaƟve thereof according to any one of claims 1-3.

8. An isolated oligodeoxynucleoƟde (ODN) or a polynucleoƟde encoding said ODN, wherein the ODN is: (I) a coding, single-stranded ODN (ODN) comprising or consisƟng of a 5’-homology arm, G (guanine), and a 3’ homology arm in the direcƟon from the 5’-end to the 3’-end, and wherein: (i) the 5’-homology arm is at least 10, about 10-100, about 15-90, about 20-80, about 30-70, about 40-60, or about 60 nucleoƟdes in length, and comprises a polynucleoƟde corresponding to thefirst to at least the 10th, at least about 20th, at least about 25th, at least about 30th, at least about 35th, at least about 40th, at least about 45th, at least about 50th, at least about 55th, or about 60th nucleoƟdes counƟng from the 3’-end of SEQ ID NO: 183, or comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) mutaƟons relaƟve to said polynucleoƟde; and (ii) the 3’-homology arm is at least 10, about 10-100, about 15-90, about 20-80, about 30-70, about 40-60, or about 60 nucleoƟdes in length, and comprises a polynucleoƟde corresponding to thefirst to at least the 10th, at least about 20th, at least about 25th, at least about 30th, at least about 35th, at least about 40th, at least about 45th, at least about 50th, at least about 55th, or about 60th nucleoƟdes counƟng from the 5’-end of SEQ ID NO: 184, or comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) mutaƟons relaƟve to said polynucleoƟde, wherein thefirst based of the 3’-homology arm is A (adenine) and the second base of the 3’-homology arm is A (adenine) or G (guanine); (II) a non-coding ssODN which is a reverse complement of the coding ODN; or (III) a double-stranded ODN (dsODN) comprising a coding strand comprising or consisƟng of a 5’- homology arm, G (guanine), and a 3’ homology arm according to (I) and a non-coding strand which is a reverse complement of the coding strand, opƟonally wherein: (a) the ODN is about 20-200, about 30-180, about 40-160, about 60-140, about 80-120, about 120 or 121 nucleoƟdes in length; (b) the coding ssODN of (I) or the coding strand of (III) has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence idenƟty to SEQ ID NO: 181; and / or (c) the non-coding ssODN of (II) or the non-coding strand of (III) has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence idenƟty to SEQ ID NO: 182.

9. The ODN or polynucleoƟde encoding said ODN according to claim 8, wherein: (a) at least one of the one or more mutaƟons in (I)(i) is a silent mutaƟon and / or a PAM-altering mutaƟon (e.g., 5’-NGG-3’ or 5’-TTTN-3’ PAM-altering mutaƟon), opƟonally wherein the 5’- homology arm comprises a polynucleoƟde corresponding to thefirst to at least the 10th, at least about 20th, at least about 25th, at least about 30th, at least about 35th, at least about 40th, at least about 45th, at least about 50th, at least about 55th, or about 60th nucleoƟdes counƟng from the 3’-end of: (1) SEQ ID NO: 173 (X1, X2, X3, X4, X5, X6, X7, and X8are individually any of A, T, C, or G; X9is A or G; and X10is any of A, T, C, or G), or comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) mutaƟons relaƟve to said polynucleoƟde; (2) SEQ ID NO: 273, or comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) mutaƟons relaƟve to said polynucleoƟde; or (3) SEQ ID NO: 283 (X1, X2, X3, X4, X5, X6, X7, and X8= individually any of A, T, C, or G; X9= A or G; X10= individually any of A, T, C, or G), or comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) mutaƟons relaƟve to said polynucleoƟde; and / or (b) at least one of the one or more mutaƟons in (I)(ii) is a silent mutaƟon and / or a PAM-altering mutaƟon (e.g., 5’-NGG-3’ or 5’-TTTN-3’ PAM-altering mutaƟon), opƟonally wherein the 3’- homology arm comprises a polynucleoƟde corresponding to thefirst to at least the 10th, at least about 20th, at least about 25th, at least about 30th, at least about 35th, at least about 40th, at least about 45th, at least about 50th, at least about 55th, or about 60th nucleoƟdes counƟng from the 5’-end of: (1) SEQ ID NO: 174 (X11, X12, and X13are individually any of A, T, C, or G; X14is A or G; X15and X16are individually any of A, T, C, or G; X17is any of A, T, or C; and X18is any of A, T, C, or G), or comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) mutaƟons relaƟve to said polynucleoƟde sequence; (2) SEQ ID NO: 274 (X1is G or A; and X2is C or T), or comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) mutaƟons relaƟve to said polynucleoƟde sequence; or (3) SEQ ID NO: 284 (X1is G or A; X2, X3, and X4are individually any of A, T, C, or G; X5is C or T; X6is A or G; X7and X8are individually any of A, T, C, or G ; X9is any of A, T, or C; X10is any of A, T, C, or G), or comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) mutaƟons relaƟve to said polynucleoƟde sequence, opƟonally wherein: (a) the coding ssODN of (I) or the coding strand of (III) has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence idenƟty to SEQ ID NO: 171, 181, 271, 281, or 61; and / or (b) the non-coding ssODN of (II) or the non-coding strand of (III) has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence idenƟty to SEQ ID NO: 172, 182, 272, 282, or 62.

10. A composiƟon comprising: (i) an RNP which comprises (a) an isolated gRNA according to any one of claims 1-3 complexed with (b) the programmable endonuclease, nickase, or derivaƟve thereof according to any one of claims 1-3; or (ii) (a) an isolated gRNA according to any one of claims 1-3 or a polynucleoƟde encoding said gRNA; and (b) the programmable endonuclease, nickase, or derivaƟve thereof according to any one of claims 1-3, or a polynucleoƟde encoding said programmable endonuclease, nickase, or derivaƟve thereof, opƟonally further comprising a pharmaceuƟcally acceptable carrier and / or excipient.

11. The composiƟon according to claim 10, wherein: (1) (a) the spacer region comprises the polynucleoƟde of SEQ ID NO: 3, 2, 4, X1X2CTGACCATCGACAAGAAA (SEQ ID NO: 53) (X1is any of A, T, C, or G, opƟonally A, C, or G; and X2is any of A, T, C, or G, opƟonally A, T, or C), X1X2GCTGACCATCGACAAGAA (SEQ ID NO: 52) (X1is any of A, T, C, or G, opƟonally A, T, or C; and X2is any of A, T, C, or G, opƟonally A, C, or G), or X1X2CAGTCCCTTTCTTGTCGA (SEQ ID NO: 54) (X1is any of A, T, C, or G, opƟonally A, C, or G; and X2is any of A, T, C, or G, opƟonally A, C, or G) and / or specifically or selecƟvely binds to a SERPINA1 rs28929474(A) allele, opƟonally over a SERPINA1 rs28929474(G) allele; and / or (b) the programmable endonuclease, nickase, or derivaƟve thereof is a nuclease which recognizes 5-NGG-3’, opƟonally a Cas9 nuclease or a derivaƟve thereof, further opƟonally a Cas9 nuclease comprising SEQ ID NO: 160; or (2) (a) the spacer region comprises the polynucleoƟde of SEQ ID NO: 202 or TTGTCGATGGTCAGCACAX1X2X3(SEQ ID NO: 251) (X1is any of A, T, C, or G, opƟonally A, T, or C; X2is any of A, T, C, or G, opƟonally A, T, or G; and X3is any of A, T, C, or G, opƟonally A, T, or G); and / or specifically or selecƟvely binds to a SERPINA1 rs28929474(A) allele, opƟonally over a SERPINA1 rs28929474(G) allele; and / or (b) the programmable endonuclease, nickase, or derivaƟve thereof is a nuclease which recognizes 5-TTTN-3’, opƟonally a Cas12a nuclease or a derivaƟve thereof, further opƟonally a Cas12a nuclease comprising any one of SEQ ID NOS: 210-215.

12. A composiƟon comprising: (I) (i) afirst RNP comprising (a) afirst gRNA according to any one of claims 1-3 complexed with (b) afirst programmable endonuclease, nickase, or derivaƟve thereof according to any one of claims 1-3; or (ii) (a) afirst gRNA according to any one of claims 1-3 or a polynucleoƟde encoding saidfirst gRNA; and (b) afirst programmable endonuclease, nickase, or derivaƟve thereof according to any one of claims 1-3 or a polynucleoƟde encoding saidfirst programmable endonuclease, nickase, or derivaƟve thereof, wherein thefirst gRNA and thefirst programmable endonuclease, nickase, or derivaƟve thereof are capable of forming afirst RNP; and(II) (i) a second RNP comprising (a) a second gRNA according to any one of claims 1-3 complexed with (b) a second programmable endonuclease, nickase, or derivaƟve thereof according to any one of claims 1-3; or (ii) (a) a second gRNA according to any one of claims 1-3 or a polynucleoƟde encoding said second gRNA; and (b) a second programmable endonuclease, nickase, or derivaƟve thereof according to any one of claims 1-3 or a polynucleoƟde encoding said second programmable endonuclease, nickase, or derivaƟve thereof, wherein the second gRNA and the second programmable endonuclease, nickase, or derivaƟve thereof are capable of forming a second RNP, opƟonally further comprising a pharmaceuƟcally acceptable carrier and / or excipient.

13. The composiƟon according to claim 12, wherein SERPINA1 is encoded in a double-stranded polynucleoƟde comprising a coding strand and a non-coding strand, and wherein thefirst programmable endonuclease, nickase, or derivaƟve thereof is afirst nickase, the second programmable endonuclease, nickase, or derivaƟve thereof is a second nickase, and thefirst RNP and the second RNP are capable of inducing a single-stranded break (SSB) in opposite strands of the SERPINA1-encoding, double-stranded polynucleoƟde, opƟonally wherein: (i) thefirst RNP is capable of inducing a SSB in the coding strand and the second RNP is capable of inducing a SSB in the non-coding strand; or (ii) thefirst RNP is capable of inducing a SSB in the non-coding strand and the second RNP is capable of inducing a SSB in the coding strand, opƟonally wherein: in (i), (i-1) thefirst gRNA binds to the coding strand and thefirst nickase when complexed with thefirst gRNA is capable of inducing a SSB in the coding strand, and the second gRNA binds to the non-coding strand and the second nickase when complexed with the second gRNA is capable of inducing a SSB in the non-coding strand; (i-2) thefirst gRNA binds to the non-coding strand and thefirst nickase when complexed with thefirst gRNA is capable of inducing a SSB in the coding strand, and the second gRNA binds to the coding strand and the second nickase when complexed with the second gRNA is capable of inducing a SSB in the non-coding strand; (i-3) thefirst gRNA binds to the non-coding strand and thefirst nickase when complexed with thefirst gRNA is capable of inducing a SSB in the coding strand, and the second gRNA binds to the non-coding strand and the second nickase when complexed with the second gRNA is capable of inducing a SSB in the non-coding strand; or (i-4) thefirst gRNA binds to the coding strand and thefirst nickase when complexed with thefirst gRNA is capable of inducing a SSB in the coding strand, and the second gRNA binds to the coding strand and the second nickase when complexed with the second gRNA is capable of inducing a SSB in the non-coding strand; or in (ii), (ii-1) thefirst gRNA binds to the non-coding strand and thefirst nickase when complexed with thefirst gRNA is capable of inducing a SSB in the non-coding strand, and the second gRNA binds to the coding strand and the second nickase when complexed with the second gRNA is capable of inducing a SSB in the coding strand;(ii-2) thefirst gRNA binds to the coding strand and thefirst nickase when complexed with thefirst gRNA is capable of inducing a SSB in the non-coding strand, and the second gRNA binds to the non-coding strand and the second nickase when complexed with the second gRNA is capable of inducing a SSB in the coding strand; (ii-3) thefirst gRNA binds to the coding strand and thefirst nickase when complexed with thefirst gRNA is capable of inducing a SSB in the non-coding strand, and the second gRNA binds to the coding strand and the second nickase when complexed with the second gRNA is capable of inducing a SSB in the coding strand; or (ii-4) thefirst gRNA binds to the non-coding strand and thefirst nickase when complexed with thefirst gRNA is capable of inducing a SSB in the non-coding strand, and the second gRNA binds to the non-coding strand and the second nickase when complexed with the second gRNA is capable of inducing a SSB in the coding strand.

14. The composiƟon according to claim 13, wherein: (I) thefirst gRNA comprises afirst spacer region comprising the polynucleoƟde of SEQ ID NO: 16, 3, 2, 13, 15, 19, 20, or 22, X1X2CTGACCATCGACAAGAAA (SEQ ID NO: 53) (X1is any of A, T, C, or G, opƟonally A, C, or G; and X2is any of A, T, C, or G, opƟonally A, T, or C), or X1X2GCTGACCATCGACAAGAA (SEQ ID NO: 52) (X1is any of A, T, C, or G, opƟonally A, T, or C; and X2is any of A, T, C, or G, opƟonally A, C, or G); and (II) the second gRNA comprises afirst spacer region comprising the polynucleoƟde of SEQ ID NO: 21, 4, 1, 5, 6, 7, 8, 9, 10, 11, 12, 14, 17, 18, or X1X2CAGTCCCTTTCTTGTCGA (SEQ ID NO: 54) (X1is any of A, T, C, or G, opƟonally A, C, or G; and X2 is any of A, T, C, or G, opƟonally A, C, or G), opƟonally wherein thefirst nickase and the second nickase are: (i) individually a Cas9 nickase which comprises the subsƟtuƟon D10A relaƟve to a wildtype Cas9 (e.g., wildtype SpCas9 or SaCas9), opƟonally further comprising one or more of the subsƟtuƟons L1111R, D1135V or D1135E, G1218R, E1219F, A1322R, R1335Q or R1335E, T1337R, and / or is a circular permutaƟon variant thereof, opƟonally comprising any one of SEQ ID NO: 158-166, further opƟonally SEQ ID NO: 160, or a variant thereof; or (ii) individually a Cas9 nickase which comprises one or more of the subsƟtuƟons D839A, H840A, N854A, and N863A, relaƟve to a wildtype Cas9 (e.g., wildtype SpCas9 or SaCas9), opƟonally further comprising one or more of the subsƟtuƟons L1111R, D1135V or D1135E, G1218R, E1219F, A1322R, R1335Q or R1335E, T1337R, and / or is a circular permutaƟon variant thereof, opƟonally comprising any one of SEQ ID NO: 167-169, or a variant thereof.

15. The composiƟon according to any one of claims 10-14, which further comprises an isolated ODN or a polynucleoƟde encoding said ODN, opƟonally wherein the ODN is a ssODN or a dsODN, opƟonally an ODN according to claim 8 or 9.

16. The composiƟon according to any one of claims 10-15, wherein the pharmaceuƟcally acceptable carrier is a lipid-based TCV which comprises at least one ionizable caƟonic lipid, opƟonally wherein: (i) the at least one ionizable caƟonic lipid comprises, essenƟally consists of, or consists of a lipid selected from the group consisƟng of N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1,2-dioleoyl-3-dimethylammonium propane (DODAP), 1,2-Dilinoleoyl-3- dimethylaminopropane (DLinDAP), N,N-dimethyl-2,2-di-(9Z,12Z)-9,12-octadecadien-1-yl-1,3- dioxolane-4-ethanamine (KC2), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (MC3), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(1-(2,3-dioleoyloxy)propyl)- N,N,N-trimethylammonium chloride (DOTAP), N-(1-(2,3-dioleyloxyl)propyl)-N,N,N- trimethylammonium chloride (DOTMA), 1,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2- Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-Dilinoleyoxy-3- (dimethylamino)acetoxypropane (DLin-DAC), 1,2-Dilinoleyoxy-3-morpholinopropane (DLin- MA), 1,2-Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-Linoleoyl-2-linoleyloxy-3- dimethylaminopropane (DLin-2-DMAP), 1,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAR.Cl), 1,2- Dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N,N-Dilinoleylamino)-1,2- propanediol (DLinAP), 3-(N,N-Dioleylamino)-1,2-propanedio (DOAP), 1,2-Dilinoleyloxo-3-(2- N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-Dilinolenyloxy-N,N- dimethylaminopropane (DLin-K-DMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or analogs thereof, (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12- dienyl)tetrahydro-3 aH-cyclopenta[d][1,3]dioxol-5-amine (ALNY-100), N-(2,3- dioleyloxyl)propyl-N,N-N-triethylammonium chloride (DOTMA); 1,2-Dioleyloxy-3- trimethylaminopropane chloride salt (DOTAP.Cl); 3.beta.-(N-(Nʹ,Nʹ-dimethylaminoethane)- carbamoyl)cholesterol (DC-Chol), N-(1-(2,3-dioleyloxyl)propyl)-N-2- (sperminecarboxamido)ethyl)-N,N-dimethyl-ammonium trifluoracetate (DOSPA), dioctadecylamidoglycyl carboxyspermine (DOGS), and N-(1,2-dimyristyloxyprop-3-yl)-N,N- dimethyl-N-hydroxyethyl ammonium bromide (DMRIE), and any combinaƟons thereof; (ii) the TCV further comprises at least one helper lipid, opƟonally wherein the at least one helper lipid comprises, essenƟally consists of, or consists of a lipid selected from the group consisƟng of dioleoylphosphaƟdylethanolamine (DOPE), distearoylphosphaƟdylcholine (DSPC), dioleoylphosphaƟdylcholine (DOPC), dipalmitoylphosphaƟdylcholine (DPPC), dioleoylphosphaƟdylglycerol (DOPG), dipalmitoylphosphaƟdylglycerol (DPPG), palmitoyloleoylphosphaƟdylcholine (POPC), palmitoyloleoyl-phosphaƟdylethanolamine (POPE), dioleoyl-phosphaƟdylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1- carboxylate (DOPE-mal), dipalmitoyl phosphaƟdyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphaƟdyl-ethanolamine (DSPE), 16- O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, l-stearoyl-2-oleoyl- phosphaƟdyethanolamine (SOPE), and any combinaƟons thereof; (iii) the TCV further comprises at least one phospholipid, opƟonally wherein the at least one phospholipid comprises, essenƟally consists of, or consists of a lipid selected from the group consisƟng of distearoylphosphaƟdylcholine (DSPC), dioleoyl phosphaƟdylethanolamine (DOPE), dipalmitoylphosphaƟdylcholine (DPPC), phosphocholine (DOPC), dimyristoylphosphaƟdylcholine (DMPC), phosphaƟdylcholine (PLPC), 1,2-distearoyl-sn- glycero-3-phosphocholine (DAPC), phosphaƟdylethanolamine (PE), egg phosphaƟdylcholine (EPC), dilauryloylphosphaƟdylcholine (DLPC), dimyristoylphosphaƟdylcholine (DMPC), 1- myristoyl-2-palmitoyl phosphaƟdylcholine (MPPC), 1-palmitoyl-2-myristoyl phosphaƟdylcholine (PMPC), 1-palmitoyl-2-stearoyl phosphaƟdylcholine (PSPC), 1,2- diarachidoyl-sn-glycero-3-phosphocholine (DBPC), 1-stearoyl-2-palmitoyl phosphaƟdylcholine (SPPC), 1,2-dieicosenoyl-sn-glycero-3-phosphocholine (DEPC), palmitoyloleoyl phosphaƟdylcholine (POPC), lysophosphaƟdyl choline, dilinoleoylphosphaƟdylcholine distearoylphophaƟdylethanolamine (DSPE), dimyristoyl phosphaƟdylethanolamine (DMPE), dipalmitoyl phosphaƟdylethanolamine (DPPE),palmitoyloleoyl phosphaƟdylethanolamine (POPE), lysophosphaƟdylethanolamine, and any combinaƟons thereof; (iv) the TCV further comprises at least one cholesterol or cholesterol derivaƟve, opƟonally wherein the at least one cholesterol or cholesterol derivaƟve comprises, essenƟally consists of, or consists of a cholesterol or cholesterol derivaƟve selected from the group consisƟng of cholesterol, N,N-dimethyl-N-ethylcarboxamidocholesterol (DC-Chol), 1,4-bis(3-N-oleylamino- propyl)piperazine, imidazole cholesterol ester (ICE), and any combinaƟons thereof; (v) the TCV further comprises at least one PEG or PEG-lipid, opƟonally wherein: (v-1) the PEG or the PEG contained in the PEG-lipid comprises, essenƟally consists of, or consists of PEG4000 or PEG2000 or a PEG having a molecular weight of about 1500 to about 5000; (v-2) the PEG-lipid comprises, essenƟally consists of, or consists of PEG-DOPE (such as PEG2000-DOPE) and / or PEG-cholesterol (or cholesterol derivaƟve) (such as PEG4000- cholesterol or PEG2000-cholesterol); (v-3) the at least one PEG-lipid comprises, essenƟally consists of, or consists of a PEG-lipid selected from the group consisƟng of PEG-myristoyl diglyceride (PEG-DMG) (e.g., 1,2- dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (AvanƟ® Polar Lipids (Birmingham, AL)), which is a mixture of 1,2-DMG PEG2000 and 1,3-DMG PEG2000 (e.g., in about 97:3 raƟo)), PEG-phosphaƟdylethanolamine and phosphaƟdic acid, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines, PEG-modified 1,2-diacyloxypropan-3-amines, and any combinaƟons thereof; and / or (vi) the TCV is substanƟally, essenƟally, or enƟrely free of destabilizing agents, or any combinaƟon of (i) to (vi).

17. The composiƟon according to claim 16, wherein: (a) the amount of the at least one ionizable caƟonic lipid relaƟve to the total components of the TCV is about 20 mol% to about 50 mol%, about 20 mol% to about 40 mol%, about 20 mol% to about 30 mol%, about 15 mol% to about 25 mol%, about 18 mol% to about 22 mol%, about 19 mol% to about 21 mol%, about 19.5 mol% to about 20.5 mol%, about 19.8 mol% to about 20.2 mol%, about 20 mol%, about 25 mol% to about 35 mol%, about 28 mol% to about 32 mol%, about 29 to about 31 mol%, about 29.5 mol% to about 30.5 mol%, about 29.8 mol% to about 30.2 mol%, about 30 mol%; (b) in (ii), the amount of the at least one helper lipid relaƟve to the total components of the TCV is about 10 mol% to about 60 mol%, about 10 mol% to about 50 mol%, about 10 mol% to about 40 mol%, about 20 mol% to about 40 mol%, about 20 mol% to about 30 mol%, about 25 mol% to about 35 mol%, about 28 mol% to about 32 mol%, about 29 mol% to about 31 mol%, about 29.5 mol% to about 30.5 mol%, about 29.8 mol% to about 30.2 mol%, about 30 mol%, about 15 mol% to about 25 mol%, about 18 mol% to about 22 mol%, about 19 mol% to about 21 mol%, about 19.5 mol% to about 20.5 mol%, about 19.8 mol% to about 20.2 mol%, about 20 mol%; (c) in (iii), the amount of the at least one phospholipid relaƟve to the total components of the TCV is about 5 mol% to about 65 mol%, about 5 mol% to about 55 mol%, about 5 mol% to about 45 mol%, about 5 mol% to about 35 mol%, about 5 mol% to about 25 mol%, about 5 mol% toabout 15 mol%, about 8 mol% to about 12 mol%, about 9 mol% to about 11 mol%, about 9.5 mol% to about 10.5 mol%, about 9.8 mol% to about 10.2 mol%, or about 10 mol%; (d) in (iv), the amount of the at least one cholesterol or cholesterol derivaƟve relaƟve to the total components of the TCV is about 20 mol% to about 60 mol%, about 25 mol% to about 55 mol%, about 30 mol% to about 50 mol%, about 35 mol% to about 45 mol%, about 38 mol% to about 42 mol%, about 39 mol% to about 41 mol%, about 39.5 mol% to about 40.5 mol%, about 39.8 mol% to about 40.2 mol%, or about 40 mol%, or about 39%; and / or (e) in (v), the amount of the at least one PEG or PEG-lipid relaƟve to the total components of the TCV is: about 0%, about 0.1 mol% to about 10 mol%, about 0.1 mol% to about 5 mol%, 0.1 mol% to about 4 mol%, 0.1 mol% to about 3 mol%, 0.1 mol% to about 2 mol%, 0.5 mol% to about 1.5 mol%, 0.8 mol% to about 1.2 mol%, 0.9 mol% to about 1.1 mol%, or about 1 mol%; or about 1 mol% to about 10 mol%, about 1 mol% to about 5 mol%, or about 2, 3, 4, or 5 mol%.

18. The composiƟon according to claim 16 or 17, wherein: (I) the TCV comprises, consists essenƟally of, or consists of: (i) at least one ionizable caƟonic lipid, which opƟonally comprises or is DODMA; (ii) at least one helper lipid, which opƟonally comprises or is DOPE; (iii) at least one phospholipid, which opƟonally comprises or is DSPC; and (iv) at least one cholesterol or cholesterol derivaƟve, opƟonally wherein the amounts of the at least one ionizable caƟonic lipid, the at least one helper lipid, the at least one phospholipid, and the at least one cholesterol or cholesterol derivaƟve, relaƟve to the total components of the TCV, is about 30 mol%, about 20 mol%, about 10 mol%, and about 40 mol%, respecƟvely, about 20 mol%, about 30 mol%, about 10 mol%, and about 40 mol%, respecƟvely, about 25 mol%, about 25 mol%, or about 10 mol%, and about 40 mol%, respecƟvely; or (II) the TCV comprises, consists essenƟally of, or consists of: (i) at least one ionizable caƟonic lipid, which opƟonally comprises or is DODMA; (ii) at least one helper lipid, which opƟonally comprises or is DOPE; (iii) at least one phospholipid, which opƟonally comprises or is DSPC; (iv) at least one cholesterol or cholesterol derivaƟve; and (v) at least one PEG or PEG-lipid, which opƟonally comprises or is PEG-DOPE (such as PEG2000-DOPE or PEG4000-DOPE) and / or PEG-cholesterol (or cholesterol derivaƟve) (such as PEG4000-cholesterol or PEG2000-cholesterol), and / or PEG-DMG, opƟonally wherein the amounts of the at least one ionizable caƟonic lipid, the at least one helper lipid, the at least one phospholipid, the at least one cholesterol or cholesterol derivaƟve, and the at least one PEG or PEG-lipid, relaƟve to the total components of the TCV, is: about 30 mol%, about 20 mol%, about 10 mol%, about 39 mol%, and about 1 mol%, respecƟvely; about 20 mol%, about 30 mol%, about 10 mol%, about 39 mol%, and about 1 mol%, respecƟvely; about 25 mol%, about 25 mol%, about 10 mol%, about 39 mol%, and about 1 mol%, respecƟvely;about 30 mol%, about 20 mol%, about 10 mol%, about 38 mol%, and about 2 mol%, respecƟvely; about 20 mol%, about 30 mol%, about 10 mol%, about 38 mol%, and about 2 mol%, respecƟvely; about 25 mol%, about 25 mol%, about 10 mol%, about 38 mol%, and about 2 mol%, respecƟvely; about 30 mol%, about 20 mol%, about 10 mol%, about 37 mol%, and about 3 mol%, respecƟvely; about 20 mol%, about 30 mol%, about 10 mol%, about 37 mol%, and about 3 mol%, respecƟvely; or about 25 mol%, about 25 mol%, about 10 mol%, about 37 mol%, and about 3 mol%, respecƟvely.

19. A method of manufacturing the composiƟon according to claim 10 or 11 comprising (A) (i) the RNP and opƟonally (ii) an isolated ODN or a polynucleoƟde encoding said ODN, opƟonally wherein the ODN is a ssODN or a dsODN, opƟonally an ODN according to claim 8 or 9; and (B) a pharmaceuƟcally acceptable carrier comprising a lipid-based TCV according to any one of claims 16-18, the method comprising: (a) providing an aqueous soluƟon comprising the lipid-based TCV, opƟonally wherein the pH of the aqueous soluƟon is about 2 to about 6.5, further opƟonally about 3 to about 6, about 4 to about 5, about 3.5 to about 5, about 3.5 to about 4.5, or about 4; and (b) mixing (i) the RNP and opƟonally (ii) the isolated ODN, with the aqueous soluƟon under condiƟons suitable for encapsulaƟon.

20. A method of manufacturing the composiƟon according to any one of claims 12-14 comprising (A) (i) thefirst RNP, (ii) the second RNP, and opƟonally (iii) an isolated ODN or a polynucleoƟde encoding said ODN, opƟonally wherein the ODN is a ssODN or a dsODN, opƟonally an ODN according to claim 8 or 9; and (B) a pharmaceuƟcally acceptable carrier comprising a lipid-based TCV according to any one of claims 16-18, the method comprising: (a) providing an aqueous soluƟon comprising the lipid-based TCV, opƟonally wherein the pH of the aqueous soluƟon is about 2 to about 6.5, further opƟonally about 3 to about 6, about 4 to about 5, about 3.5 to about 5, about 3.5 to about 4.5, or about 4; and (b) mixing (i) thefirst RNP, (ii) the second RNP, and opƟonally (ii) the isolated ODN, with the aqueous soluƟon under condiƟons suitable for encapsulaƟon.

21. A method of ediƟng SERPINA1, opƟonally an rs28929474(A) allele thereof, in one or more target cells, the method comprising contacƟng the target cell with a composiƟon according to any one of claims 10-18, opƟonally wherein: (a) the contacƟng is in vitro, ex vivo, or in vivo;(b) the one or more target cells comprise (i) mammalian, opƟonally human, non-human primate, monkey, horse, cow, sheep, goat, pig, rabbit, dog, cat, or rodent (mouse, rat, guinea pig, hamster) cells; or (ii) non-mammalian, opƟonally bacterial, yeast, fungal, protozoa, plant, insect, amphibian, repƟle,fish, or bird (such as chicken) cells; (c) the one or more target cells comprise a liver cell, a bone marrow cell, a lymphocyte, a monocyƟc cell, a cell in a lymphoid Ɵssue, a Paneth cell of the gut, a germ cell, an oocyte, an ovum, a spermatocyte, a sperm, a ferƟlized egg, an embryo, and / or a stem cell; and / or (d) the method is for correcƟng rs28929474(A), opƟonally to rs28929474(G), and / or reducing expression of SERPINA1 rs28929474(A) and / or of mutant alpha-1 anƟtrypsin (A1AT) protein comprising Glu366Lys (commonly referred to as E366K and also annotated as Glu342Lys or E342K).

22. A method of ediƟng SERPINA1, opƟonally an rs28929474(A) allele thereof, in one or more target cells in a subject, the method comprising administering a composiƟon according to any one of claims 10-18 to the subject, opƟonally wherein: (a) the one or more target cells comprise a liver cell, a bone marrow cell, a lymphocyte, a monocyƟc cell, a cell in a lymphoid Ɵssue, a Paneth cell of the gut, a germ cell, an oocyte, an ovum, a spermatocyte, a sperm, a ferƟlized egg, an embryo, and / or a stem cell; (b) the subject is: (i) a mammal, opƟonally a human, a non-human primate, a monkey, a horse, a cow, sheep, a goat, a pig, a dog, a cat, a rabbit, a rodent (mouse, rat, guinea pig, hamster), a rat, or a mouse; or (ii) a non-mammalian vertebrate, opƟonally a amphibian, repƟle,fish, or bird such as chicken; (c) the administering is: (c-i) locally administering, opƟonally by inhalaƟon or administering to the liver, bone marrow, lymphoid Ɵssue, gut, ovary, tesƟs, eye, ear, nose (opƟonally intranasally), skin (opƟonally transdermally or epicutaneously), mucosa, skin, or vagina; (c-ii) parenterally administering, opƟonally by injecƟon (opƟonally intravenous, intramuscular, subcutaneous, intradermal, intrathecal, intra-arterial, intraarƟcular, intraosseous, intraparenchymal, or intraperitoneal administraƟon) or by inhalaƟon; or (c-iii) enterally administering, opƟonally orally, sublingually, buccally, or rectally; (d) the administering is effected two or more Ɵmes, opƟonally about 3-5 Ɵmes, opƟonally about once a week, about every 2 weeks, or about every 3 weeks, about once a month, about every 3 months, about every 6 months, or about once per year; (e) the method is for correcƟng rs28929474(A), opƟonally to rs28929474(G), and / or reducing expression of SERPINA1 rs28929474(A) and / or of mutant alpha-1 anƟtrypsin (A1AT) protein comprising Glu366Lys; and / or(f) the method is for prevenƟng or treaƟng A1AT deficiency (A1ATD) and / or an A1ATD-associated lung and / or liver disease(s) and / or condiƟon(s), opƟonally wherein the A1ATD-associated lung and / or liver disease(s) and / or condiƟon(s) comprises emphysema, chronic obstrucƟve pulmonary disease (COPD), bronchiectasis, neonatal cholestasis, cirrhosis, hepatocellular carcinoma, liver failure, lung failure, and / or panniculiƟs.

23. A method of prevenƟng or treaƟng A1AT deficiency (A1ATD) and / or an A1ATD-associated lung and / or liver disease(s) and / or condiƟon(s) in a subject, the method comprising administering a composiƟon according to any one of claims 10-18 to the subject, opƟonally wherein: (a) the A1ATD-associated lung and / or liver disease(s) and / or condiƟon(s) comprises emphysema, chronic obstrucƟve pulmonary disease (COPD), bronchiectasis, neonatal cholestasis, cirrhosis, hepatocellular carcinoma, liver failure, lung failure, and / or panniculiƟs; (b) the subject is: (i) a mammal, opƟonally a human, a non-human primate, a monkey, a horse, a cow, sheep, a goat, a pig, a dog, a cat, a rabbit, a rodent (mouse, rat, guinea pig, hamster), a rat, or a mouse; or (ii) a non-mammalian vertebrate, opƟonally a amphibian, repƟle,fish, or bird such as chicken; (c) the administering is: (c-i) locally administering, opƟonally by inhalaƟon or administering to the liver, bone marrow, lymphoid Ɵssue, gut, ovary, tesƟs, eye, ear, nose (opƟonally intranasally), skin (opƟonally transdermally or epicutaneously), mucosa, skin, or vagina; (c-ii) parenterally administering, opƟonally by injecƟon (opƟonally intravenous, intramuscular, subcutaneous, intradermal, intrathecal, intra-arterial, intraarƟcular, intraosseous, intraparenchymal, or intraperitoneal administraƟon) or by inhalaƟon; or (c-iii) enterally administering, opƟonally orally, sublingually, buccally, or rectally; (d) the administering is effected two or more Ɵmes, opƟonally about 3-5 Ɵmes, opƟonally about once a week, about every 2 weeks, or about every 3 weeks, about once a month, about every 3 months, about every 6 months, or about once per year; and / or (e) the method is for correcƟng rs28929474(A), opƟonally to rs28929474(G), and / or reducing expression of SERPINA1 rs28929474(A) and / or of mutant A1AT protein comprising Glu366Lys.

24. A kit, which comprises: (A) (I) one or more RNPs according to claim 7; and (II) opƟonally an isolated ODN or a polynucleoƟde encoding said ODN, opƟonally wherein the ODN is a ssODN or a dsODN, opƟonally an ODN according to claim 8 or 9; and(III) a lipid-based TCV according to claim 16-18; and (B) a label, opƟonally comprising an instrucƟon for use in a method according to claim 19 or 20.

25. A kit, which comprises: (A) a composiƟon according to claim 10-18; and (B) a label, opƟonally comprising an instrucƟon for use in a method according to any one of claims 21-23.

26. An isolated gRNA according to any one of claims 1-3, a composiƟon according to claim 4, a polynucleoƟde or polynucleoƟdes according to claim 5, a vector according to claim 6, an RNP according to claim 7, an isolated ODN or a polynucleoƟde encoding said ODN according to claim 8 or 9, or a composiƟon according to any one of claims 10-18, for use in medicine, opƟonally for use in prevenƟng or treaƟng an A1ATD-associated lung and / or liver disease(s) and / or condiƟon(s), opƟonally emphysema, chronic obstrucƟve pulmonary disease (COPD), bronchiectasis, neonatal cholestasis, cirrhosis, hepatocellular carcinoma, liver failure, lung failure, and / or panniculiƟs, opƟonally according to a method according to any one of claims 21-23.

27. Use of an isolated gRNA according to any one of claims 1-3, a composiƟon according to claim 4, a polynucleoƟde or polynucleoƟdes according to claim 5, a vector according to claim 6, an RNP according to claim 7, an isolated ODN or a polynucleoƟde encoding said ODN according to claim 8 or 9, or a composiƟon according to any one of claims 10-18, in prevenƟng or treaƟng A1AT deficiency (A1ATD) and / or an A1ATD-associated lung and / or liver disease(s) and / or condiƟon(s), opƟonally according to a method according to any one of claims 21-23.

28. Use of an isolated gRNA according to any one of claims 1-3, a composiƟon according to claim 4, a polynucleoƟde or polynucleoƟdes according to claim 5, a vector according to claim 6, an RNP according to claim 7, an isolated ODN or a polynucleoƟde encoding said ODN according to claim 8 or 9, or a composiƟon according to any one of claims 10-18, in the manufacture of a medicament, opƟonally wherein the medicament is for prevenƟng or treaƟng an A1ATD-associated lung and / or liver disease(s) and / or condiƟon(s), opƟonally emphysema, chronic obstrucƟve pulmonary disease (COPD), bronchiectasis, neonatal cholestasis, cirrhosis, hepatocellular carcinoma, liver failure, lung failure, and / or panniculiƟs, opƟonally according to a method according to any one of claims 21-23.

Images