Squid-derived conductive protein and manufacturing method thereof

Abstract

The present invention relates to a squid-derived conductive protein and a method for manufacturing same. Having a sequence partially similar to genetic information of a reflectin protein possessing a proton transport mechanism, the squid-derived conductive recombinant protein exhibits electrochemical properties corresponding to an in vivo electrical signal transmission mechanism, can be mass-produced from a transformant, can be used as a new material based on electrochemical properties, and can be formulated into various chemical formulations, thereby finding applications in a flexible electrode, an electrolyte, an active material, and the like.

Description

Squid-derived conductive protein and method for producing the same

[0001] The present invention relates to a squid-derived conductive protein and a method for producing the same.

[0002] With the advent of an aging society and growing public interest in the Internet of Things and personalized diagnosis and treatment, the market for various wearable devices is rapidly growing. Research on flexible and stretchable electrodes for use in these wearable devices is also on the rise. Implantable medical devices that provide treatment through biosignal stimulation or wearable or attachable medical devices that measure biosignals require prolonged contact with tissue or skin, requiring manufacturing of materials or fixtures that are harmless and non-irritating to the human body.

[0003] To date, various metallic materials with high electrical conductivity have been used as electrode materials. However, they lack flexibility and stretchability, and corrosion occurs even when implanted in the body. Therefore, the development of non-metallic conductive synthetic polymers has become increasingly important. While these polymers have lower electrical conductivity than previously studied metallic materials, their excellent processability, heat resistance, and chemical resistance allow them to form flexible and stretchable electrodes while maintaining the inherent electrical properties of the material. While methods to improve the electrical conductivity of synthetic polymers are being developed, most of them use organic solvents or acidic substances, which necessitate additional processes and costs to remove hazardous substances, limiting their application in the biomedical field.

[0004] Wearable devices are evolving from wearable to skin-attached and even implantable. For implantable technology, certain properties are required of the material itself. First, it must not corrode in vivo. This is because corrosion of electrode elements and electrolyte leakage can cause inflammation and toxicity in the body. Furthermore, it must maintain sensitivity for measuring neural signals over a long period of time, have a flexible formulation that can efficiently electrically stimulate cells, and have properties that match the properties of the substrate material and tissue, enabling high adhesion and attachment efficiency to each tissue. Furthermore, in the case of disposable devices, it must be able to be degraded in vivo without any side effects. Finally, current man-made electrical stimulation devices, such as retinal implants and neural stimulators, rely on negatively charged electrons, while the electrical activity of living organisms is driven by positively charged protons, Ca, and Ca. 2+ , Na + They fundamentally mismatch because they transmit electrical signals by moving positively charged ions, such as ions. Furthermore, they must be biocompatible and structurally stable under physiological conditions while maintaining effective transmission of electronic and biological signals. However, the mechanical stiffness modulus mismatch between the synthetic device and the tissues for interfacing with organs and tissues poses a problem in the compatibility of wearable and implantable bioelectronic devices. Resolving this mismatch would enable implantable electronic devices to interface more smoothly with biological tissues, and increase the sensitivity and accuracy of electrical signals exchanged with the nervous system.

[0005] In this regard, conductive synthetic polymers are soluble in toxic organic solvents and require processing under high-temperature and high-pressure conditions, limiting their application to implantable and wearable technologies. Therefore, there is a pressing need to develop natural polymer-based materials that are biodegradable, highly biocompatible, and possess protein- or polysaccharide-based conductivity that complements in vivo signaling mechanisms.

[0006] To address this issue, recent studies have shown the potential of using various proteins and sugars, such as bovine serum albumin, silk fibroin, and cellulose nanofibers, as flexible electrode materials through formulation. However, the conductivity of protein-based polymers under mild conditions at room temperature is 5 mS cm. -1 Accordingly, strategies exist to maximize the conductivity of natural polymers, including altering the folding and structure of existing proteins or designing new conductive protein sequences by mimicking naturally conductive proteins, such as pili from Geobacter. In particular, if we can create similar materials that maximize the properties of natural materials, they can be utilized as flexible electrode materials, electrolytes, and active materials, and thus contribute greatly to the development of new fields of electrochemical and bioelectronic technologies, such as fuel cells, batteries, and biological sensors.

[0007] The purpose of the present invention is to provide a squid-derived conductive protein and a method for producing the same, and more specifically, to provide a method for producing a recombinant protein comprising a squid skin tissue-derived protein sequence and utilizing a protein expression system using Escherichia coli.

[0008] The present invention provides a conductive protein comprising a conserved sequence of squid-derived reflectin proteins.

[0009] In addition, the present invention provides a composition for a flexible electrode comprising the conductive protein.

[0010] In addition, the present invention provides an electrolyte composition comprising the conductive protein.

[0011] In addition, the present invention provides a conductive protein expression vector into which a gene encoding the conductive protein is inserted.

[0012] The present invention also provides a transformant for producing a conductive protein, which is a strain transformed with the above vector.

[0013] In addition, the present invention provides a method for producing a conductive protein, comprising the steps of: producing an expression vector by inserting a gene encoding the conductive protein into a vector; producing a transformant that produces the conductive protein by transforming the expression vector into a host; and obtaining the conductive protein from the transformant.

[0014] According to the present invention, the squid-derived conductive recombinant protein has electrochemical properties corresponding to an in vivo electrical signal transmission mechanism because it contains genetic information and a partially similar sequence of a reflectin protein having a proton transport mechanism, and can be mass-produced from a transformant, and can be utilized as a new material based on its electrochemical properties, and can be chemically formulated in various ways to provide a new conductive protein that can be utilized as a flexible electrode, electrolyte, active material, etc.

[0015] Figure 1 is a schematic diagram of a conserved sequence search of a group of squid-derived reflectin proteins according to one embodiment of the present invention.

[0016] Figure 2 is a schematic diagram of an expression vector containing a gene for a squid-derived conductive recombinant protein according to one embodiment of the present invention.

[0017] Figure 3 is a diagram showing the expression level of a squid-derived conductive recombinant protein according to one embodiment of the present invention confirmed by SDS-PAGE.

[0018] FIG. 4 is a diagram showing the separation and purification of a squid-derived conductive recombinant protein using a His-tag resin according to one embodiment of the present invention, confirmed by SDS-PAGE.

[0019] Figure 5 is a diagram showing the expression level of a squid-derived conductive recombinant protein according to a comparative example of the present invention confirmed by SDS-PAGE.

[0020] Figure 6 is a diagram showing the expression level of a squid-derived conductive recombinant protein according to a comparative example of the present invention confirmed by SDS-PAGE.

[0021] FIG. 7 is a diagram showing the electrochemical conductivity of a squid-derived conductive recombinant protein solution according to one embodiment of the present invention, confirmed using a potentiostat.

[0022] FIG. 8 is a diagram showing the electrochemical conductivity of a squid-derived conductive recombinant protein according to one embodiment of the present invention dissolved in an acetic acid solution using a potentiostat.

[0023] FIG. 9 is a diagram comparing the electrochemical conductivity of a squid-derived conductive recombinant protein according to one embodiment of the present invention dissolved in a TFA (Trifluoroacetic acid) solution with a positive control group of a squid-derived conserved sequence using a potentiostat.

[0024] FIG. 10 is a diagram comparing the electrochemical conductivity of a squid-derived conductive recombinant protein according to one embodiment of the present invention dissolved in an acetic acid solution with a positive control group of squid-derived conserved sequences using a potentiostat.

[0025] The terms used in this specification have been selected from widely used, current terms, taking into account the functions of the present invention. However, these terms may vary depending on the intentions of those skilled in the art, precedents, the emergence of new technologies, etc. Furthermore, in certain cases, terms may be arbitrarily selected by the applicant, and in such cases, their meanings will be described in detail in the relevant description of the invention. Therefore, the terms used in this invention should not be defined simply as names, but rather based on their inherent meanings and the overall content of the present invention.

[0026] Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Terms defined in commonly used dictionaries should be interpreted as having a meaning consistent with their meaning in the context of the relevant technology, and shall not be interpreted in an idealized or overly formal sense unless explicitly defined herein.

[0027] Hereinafter, the present invention will be described in more detail.

[0028] The present invention provides a method for producing a squid-derived conductive recombinant protein comprising a reflectin protein sequence having a proton transport mechanism, using a protein expression system using Escherichia coli.

[0029] The conductive protein or conductive recombinant protein of the present invention has some sequence characteristics similar to the genetic information of the reflectin protein involved in the proton transport mechanism in squid skin tissue, and the sequence has been modified to improve electrical conductive properties. Since the conductive recombinant protein can be expressed and purified from a transformant, it is possible to mass-produce a squid-derived conductive recombinant protein. The conductive recombinant protein produced according to the present invention can create a new industrial field based on its electrochemical properties, can be utilized as a new material, can be applied to various technologies through various chemical formulations, and can be utilized as a flexible electrode material, electrolyte, active material, etc. In addition, the conductive recombinant protein produced according to the present invention can be utilized in fuel cells, batteries, biological sensors, etc., and can greatly contribute to the development of new fields of electrochemical and bioelectronic technology.

[0030] Specifically, the present invention provides a conductive protein comprising an amino acid sequence represented by SEQ ID NO: 2, which is a modification of the conserved sequence of a reflectin protein derived from squid skin tissue.

[0031] In the present invention, the term "protein" may be used interchangeably with "polypeptide" to mean the same thing. The protein or polypeptide refers to a peptide chain formed by forming continuous, unbranched peptide bonds between amino acids.

[0032] In one embodiment of the present invention, the conductive protein comprises an amino acid sequence represented by SEQ ID NO: 2. The amino acid sequence represented by SEQ ID NO: 1 (SGYQMDMQGRW) is a common conserved sequence of four reflectin proteins derived from squid skin tissue, and the four reflectin proteins are reflectin-like protein A1 (Genbank: ACZ57764.1), reflectin-like protein A2 (Genbank: ACZ57765.1), reflectin 1a (Genbank: AAQ21389.1), and reflectin 1b (Genbank: AAQ21390.1).

[0033] In one embodiment of the present invention, the conductive protein is represented by SEQ ID NO: 2 (SGXQMDFQGRY) in which the third Y from the N-terminus of the amino acid sequence represented by SEQ ID NO: 1 is modified to X, the seventh M to F, and the eleventh W to Y.

[0034] In the above sequence number 2, the third amino acid (X) from the N-terminus can be substituted with any type of amino acid as long as it is an aromatic amino acid. Specifically, the conserved reflectin of the present invention can be sequence number 3, where the third amino acid (X) from the N-terminus in sequence number 2 is tyrosine (Tyr; Y), sequence number 4, where it is phenylalanine (Phe; F), or sequence number 5, where it is tryptophan (Trp; W).

[0035] In one embodiment of the present invention, the conductive protein further comprises a sequence composed of Aspartic acid-Arginine-Tyrosine-Tyrosine (Asp-Arg-Tyr-Tyr; DRYY) at the N-terminus of the amino acid sequence represented by SEQ ID NO: 2, and further comprises a tyrosine (Tyr; Y) sequence at the C-terminus. As the additional sequence is included, the electrochemical properties are improved. In addition, the tyrosine (Tyr; Y) sequence may be added to the C-terminus of the amino acid sequence represented by SEQ ID NO: 2, and further comprises a linker sequence composed of Threonine-Serine (Thr-Ser; TS) at the C-terminus thereafter.

[0036] Preferably, in one embodiment of the present invention, the conductive protein is composed of an amino acid sequence (DRYYSGYQMDFQGRYYTS) represented by SEQ ID NO: 6.

[0037] In addition, the present invention provides an electrode composition comprising the conductive protein.

[0038] The conductive protein of the present invention can be utilized as a bioink that is dissolved in a solution and then molded into a desired size and shape, and because it exhibits conductive properties that allow current to flow, it can be utilized as a material for nano-sized electrodes. Furthermore, because it can be homogeneously mixed with high molecular polymers, it can also be utilized as a material for flexible electrodes. Furthermore, it can be utilized as a conductive / insulating material that coats the surface of existing electrodes to increase or decrease current. The material of the electrode may vary depending on the application field, and specifically, the electrode may be composed of silver, mercury, platinum, gold, carbon, graphite, copper, lead, zinc, or tin oxide.

[0039] In addition, the present invention provides an electrolyte composition comprising the conductive protein.

[0040] Since the conductive protein of the present invention is uniformly dissolved in a solution and exhibits conductivity that allows current to flow, a composition including the conductive protein can be used as an electrolyte. The electrolyte composition may include an additional electrolyte as needed, and the electrolyte may be at least one selected from sodium chloride, sulfuric acid, hydrochloric acid, sodium hydroxide, potassium hydroxide, sodium nitrate, sodium, potassium, calcium, and magnesium. The electrolyte may be dissolved in any one solvent selected from water, ethanol, acetone, cyclohexane, carbon tetrachloride, benzene, ethylene carbonate, diethyl carbonate, dimethyl carbonate, and ethyl methyl carbonate.

[0041] In addition, the present invention provides a conductive protein expression vector into which a gene encoding the conductive protein is inserted.

[0042] The above gene is used synonymously with polynucleotide. “Polynucleotide” refers to a DNA or RNA strand of a certain length or longer, which is a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain.

[0043] The above "vector" may comprise a DNA construct comprising a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the target protein or polypeptide in a suitable host. The expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences regulating the termination of transcription and translation. The vector may be capable of replicating or functioning independently of the host genome after being transformed into a suitable host cell, or may be integrated into the genome itself.

[0044] The above vector is not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ series, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors. Specifically, it can be a pET22b(+) vector, but is not limited thereto.

[0045] Specifically, a polynucleotide encoding a target polypeptide can be inserted into a chromosome via a vector for intracellular chromosomal insertion. The insertion of the polynucleotide into the chromosome can be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker for confirming the chromosomal insertion can be additionally included. The selection marker is used to select cells transformed with the vector, i.e., to confirm the insertion of the target nucleic acid molecule, and markers that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of a surface polypeptide, can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, so that transformed cells can be selected.

[0046] The above "transformation" means introducing a vector containing a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoded by the polynucleotide can be expressed in the host cell. The transformed polynucleotide can include both an integrated location within the chromosome of the host cell or an extrachromosomal location, as long as it can be expressed in the host cell. In addition, the polynucleotide includes DNA and / or RNA encoding the target polypeptide. The polynucleotide can be introduced in any form as long as it can be introduced into the host cell and expressed. For example, the polynucleotide can be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all elements necessary for autonomous expression. The expression cassette can typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal that are operably linked to the polynucleotide. The above expression cassette may be in the form of a self-replicating expression vector. Furthermore, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell, but is not limited thereto. The term "operably linked" refers to a polynucleotide sequence being functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the variant of the present application.

[0047] In addition, the present invention provides a transformant for producing a conductive protein, which is a strain transformed with the above vector.

[0048] The above "strain" or microorganism includes both wild-type microorganisms and microorganisms that have undergone genetic modification naturally or artificially, and may be a microorganism that has had a specific mechanism weakened or strengthened due to causes such as the insertion of an external gene or the enhancement or inactivation of the activity of an endogenous gene, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein or product.

[0049] The above microorganism may be any type of microorganism capable of producing a recombinant vector, and specifically, may be a bacterium such as Escherichia coli, Bacillus sp., Streptomyces sp., Pseudomonas sp., Proteus sp., or Staphylococcus sp., or a fungus such as Aspergillus sp. and Saccharomyces sp., but is not limited thereto.

[0050] In one embodiment of the present invention, the strain is Escherichia coli, and preferably, it may be any one strain selected from among Arctic (DE3), BL21 (DE3), CD41 (DE3), Lemo (DE3), Rosetta (DE3), and Tuner (DE3) among E. coli, but is not limited thereto.

[0051] In addition, the present invention provides a method for producing a conductive protein, comprising the steps of: producing an expression vector by inserting a gene encoding the conductive protein into a vector; producing a transformant that produces the conductive protein by transforming the expression vector into a host; and obtaining the conductive protein from the transformant.

[0052] The gene encoding the above conductive protein may be composed of a base sequence represented by sequence number 4.

[0053] In addition, to facilitate separation and purification of the conductive protein from the transformant, a gene encoding the conductive protein can be inserted into a vector position in which a histidine tag (6 x His; HHHHHH) is linked to the promoter and the C-terminus of the conductive protein, and can be easily separated and purified using a histidine tag column.

[0054] Hereinafter, to aid understanding of the present invention, experimental examples and examples will be described in detail. However, the following experimental examples and examples are merely illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental examples and examples of the present invention are provided to more fully explain the present invention to those of average skill in the art.

[0055] Example 1. Search for conserved sequences of squid-derived reflectin proteins.

[0056] Based on the information of NCBI Reference Sequence, four proteins, reflectin-like protein A1 (Genbank: ACZ57764.1), reflectin-like protein A2 (Genbank: ACZ57765.1), reflectin 1a (Genbank: AAQ21389.1), and reflectin 1b (Genbank: AAQ21390.1), were searched for and squid-derived reflectin proteins were designed. The sequences of the four protein families were aligned to search for conserved sequences with commonly repeated structures, and as a result, as shown in Fig. 1, the conserved sequence was confirmed to consist of 11 amino acids.

[0057] Example 2. Preparation of a squid-derived conductive recombinant protein expression vector

[0058] Example 2-1 DNA sequence optimization of recombinant proteins

[0059] A modified sequence (SEQ ID NO: 2) was designed by changing two amino acids from the conserved sequence (SEQ ID NO: 1) of the squid-derived reflectin protein derived from Example 1 above, and the electrochemical properties were improved by extending additional sequences at both ends centered on this (SEQ ID NO: 2).

[0060] In addition, the third amino acid (X) from the N-terminus in the above sequence number 2 can be substituted with any type of amino acid as long as it is an aromatic amino acid. Specifically, the conserved reflectin of the present invention can be sequence number 3, where the third amino acid (X) from the N-terminus in the sequence number 2 is tyrosine (Tyr; Y), sequence number 4, where it is phenylalanine (Phe; F), or sequence number 5, where it is tryptophan (Trp; W).

[0061] In the above sequence number 2, the third amino acid (X) from the N-terminus shows the positional importance of the sequence in terms of the conductive properties due to the high sequence conservation of aromatic amino acids. Since nonpolar amino acids and uncharged polar amino acids are located alternately on both sides of the third amino acid (X), the geographical localization of aromatic amino acids can occur when the third amino acid (X) is composed of aromatic amino acids. The conductive properties of a protein sequence can be mediated through hopping by the geographical localization of aromatic amino acids. Accordingly, the third amino acid (X) from the N-terminus can be Tyrosine (Tyr; Y) in sequence number 3, Phenylalanine (Phe; F) in sequence number 4, or Tryptophan (Trp; W) in sequence number 5.

[0062] In this example, the process was performed based on the amino acid sequence represented by sequence number 3, in which the third amino acid (X) from the N-terminus of sequence number 2 is tyrosine (Tyr; Y).

[0063] A sequence (Additional 1) composed of Aspartic acid-Arginine-Tyr-Tyr; DRYY) was added to the N-terminus of the amino acid sequence represented by SEQ ID NO: 2, and a sequence composed of Tyrosine (Tyr; Y) was added to the C-terminus of the amino acid sequence represented by SEQ ID NO: 2 (Additional 2). In addition, a linker sequence composed of Threonine-Serine (Thr-Ser; TS) was added after the C-terminus of the Additional 2 sequence so that it can be utilized as a repeating sequence. Therefore, the squid-derived conductive recombinant protein designed to be optimized according to the present invention is composed of 16 amino acids as in the amino acid sequence of SEQ ID NO: 6 (Table 1).

[0064] Composition amino acid sequence (N-terminal → C-terminal) Sequence number Conserved reflectin SGYQMDMQGR-W1 Modified reflectin SGXQMDFQGR-Y2 Reflectin 1S-GYQMDFQGR-Y3 Reflectin 2S-GFQMDFQGR-Y4 Reflectin 3S-GWQMDFQGR-Y5 Added 1D-RYY-Added 2Y(Tyr, Tyrosine)-LinkerTS-OptimizedDRYYSGYQMDFQGRYYT-S6 Gene Base SequenceCATATGGCTAGCGACAGGTACTATTCAGGGTATCAAATGGATTTCCAGGGTCGTTACTACACCAGCGACCGTTACTACAGCGGCTATCAAATGGATTTTCAAGGCAGATACTACACCTCCGACCGCTACTACAGCGGTTATCAGATGGACTTCC AGGGCCGTTATTACACCTCTGATCGTTATTATTCCGGGCTATCAGATGGATTTTCAGGGTCGCTACTACACTTCGGATCGCTATTATTCTGGCTACCAAATGGACTTTCAAGGTCGTTATTACACCAGCGATCGTTATTACAGCGGTTATCAGATGGACTTCCAAGGTCGTTATTACACGAGCTCTAGACTCGAG7

[0065] Example 2-2. Preparation of expression vector for recombinant protein

[0066] In the above practical example, the DNA sequence of the optimized squid-derived conductive recombinant protein was inserted into the expression vector pET22b(+) containing the T7 promoter and the histidine tag (6 x His purification tag sequence; HHHHHH) at the C-terminus using the restriction enzymes Nde1 and Xho1. A schematic diagram of the expression vector containing the gene (SEQ ID NO: 7) of the manufactured recombinant protein is as shown in Fig. 2. The gene of the squid-derived conductive recombinant protein is composed of the base sequence of SEQ ID NO: 7 so as to encode the amino acid sequence of the optimized SEQ ID NO: 6.

[0067] Example 3. Production of transformed E. coli producing recombinant proteins

[0068] In order to express the above squid-derived conductive recombinant protein, the recombinant protein was expressed by transforming it into Escherichia coli, which is commonly used for protein expression in cloning. The Escherichia coli strains used were Arctic (DE3), BL21 (DE3), CD41 (DE3), Lemo (DE3), Rosetta (DE3), and Tuner (DE3). After making the E. coli reactive cells using CaCl2 buffer, the expression vector prepared in Example 2 was transformed into the E. coli using a heat-shock method. The E. coli was inoculated into an LB medium supplemented with ampicillin and cultured at 37°C for 12 hours to select the transformed E. coli.

[0069] Example 4. Expression and purification of recombinant proteins

[0070] Example 4-1. Expression of recombinant proteins

[0071] To induce the expression of squid-derived conductive recombinant proteins, the absorbance (OD) of the culture medium 600 ) was 0.6 to 1.0, preferably 0.8 to 1.0 at 600 nm, the inducer IPTG (isopropyl-β-D-thiogalactopyranoside) was added. The cells cultured with shaking at 30°C for more than 15 hours were centrifuged, the supernatant was removed, and the cells were harvested. The harvested cells were suspended in a lysis buffer and then disrupted using a sonicator.

[0072] To confirm the expression of the squid-derived conductive recombinant protein on SDS-PAGE, a portion of the disrupted cells was divided into a whole cell lysate, a soluble fraction, and an insoluble fraction. Expression in the soluble or insoluble fraction of each expression strain was confirmed by SDS-PAGE. As shown in Fig. 3, since the protein was expressed in the insoluble fraction, 8 M urea or 6 M GuHCl was added to the remaining whole cell lysate to denature all proteins in the whole cell lysate. Thereafter, the insoluble fraction was recovered by centrifugation.

[0073] Example 4-2. Purification of recombinant proteins using a His-tag column

[0074] The supernatant recovered in Example 4-1 was used to separate and purify the squid-derived conductive recombinant protein expressed in the insoluble fraction using a His-tag column. The protein in the insoluble fraction was injected onto a nickel NTA (nitrilotriacetic acid) column, and sufficient time was allowed for the protein to bind to the column. Next, the protein not bound to the column was washed with a washing solution (pH 6.3), and the protein was separated from the column and purified using elution buffer 1 (pH 5.9) and elution buffer 2 (pH 4.5). As a result of SDS-PAGE analysis of the purified squid-derived conductive recombinant protein, as shown in Figure 4, it was confirmed that more squid-derived conductive recombinant protein was purified from elution buffer 1 than from elution buffer 2.

[0075] Comparative Example 1. Preparation of a protein expression vector containing a conserved sequence derived from squid.

[0076] Comparative Example 1-1. DNA Sequence Optimization of Recombinant Proteins

[0077] A conserved sequence (SGYQMDMQGRW; SEQ ID NO: 1) derived from an existing squid reflectin protein (histidine-tagged wild type RfA2 from Doryteuthis (Loligo) pealeii (Genbank: ACZ57765.1)) was designed and repeated, and named AR. The sequence (SGYQMDFQGRY; SEQ ID NO: 2) in which the 7th F was changed to Y and the 11th W was changed to Y in the AR sequence was named MAR.

[0078] Comparative Example 1-2. Preparation of an expression vector for a recombinant protein

[0079] The DNA sequence of the squid-derived conductive recombinant protein consisting of the amino acid sequence of sequence number 1 or sequence number 2 designed in Comparative Example 1 above was inserted into the expression vector pET22b(+) containing the T7 promoter and the histidine tag (6 x His purification tag sequence; HHHHHH) at the C-terminus using the restriction enzymes Nde1 and Xho1 at both ends.

[0080] Comparative Example 2. Production of transformed E. coli producing a protein with a conserved sequence.

[0081] In order to express the squid-derived conductive recombinant protein, the recombinant protein was expressed by transforming Escherichia coli, which is commonly used for protein expression in cloning. The E. coli strains used in the same manner as in Example 3 are Arctic (DE3), BL21 (DE3), CD41 (DE3), Lemo (DE3), Rosetta (DE3), and Tuner (DE3). A vector containing a gene encoding the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 was prepared in the same manner as in Example 2, and then transformed into E. coli using a heat-shock method. The E. coli was inoculated into an LB medium supplemented with ampicillin and cultured with shaking at 37°C for 12 hours to select the transformed E. coli.

[0082] Comparative Example 3. Expression and Purification of Proteins with Conserved Sequences

[0083] Comparative Example 3-1. Expression of proteins with conserved sequences

[0084] To induce the expression of a conductive protein of a conserved sequence derived from squid, the absorbance (OD) of the culture medium 600 ) was 0.6 to 1.0, preferably 0.8 to 1.0 at 600 nm, the inducer IPTG (isopropyl-β-D-thiogalactopyranoside) was added. The cells cultured with shaking at 30°C for more than 15 hours were centrifuged, the supernatant was removed, and the cells were harvested. The harvested cells were suspended in a lysis buffer and then disrupted using a sonicator.

[0085] To confirm the expression of the conductive protein of the conserved sequence derived from squid using SDS-PAGE, a portion of the disrupted cells was divided into a whole cell lysate, a soluble fraction, and an insoluble fraction. Expression in the soluble or insoluble fraction was confirmed by SDS-PAGE.

[0086] As shown in Fig. 5, it was confirmed that AR protein was expressed in the selected strain BL21 (DE3), but MAR protein was not expressed. Accordingly, AR protein was used as a comparative example for comparing electrochemical properties with the purified protein from Example 4. Since AR protein was expressed in the insoluble fraction, 6 M GuHCl was added to the remaining whole cell homogenate to denature all proteins in the whole cell homogenate. Thereafter, the insoluble fraction was recovered by centrifugation.

[0087] Comparative Example 3-2. Purification of recombinant proteins using a His-tag column

[0088] The supernatant recovered in Comparative Example 3-1 was used to separate and purify the conductive protein of the squid-derived conserved sequence expressed in the insoluble fraction using a His-tag column. The protein of the insoluble fraction was injected onto a nickel NTA (nitrilotriacetic acid) column, and sufficient time was allowed for the protein to bind to the column. Next, the protein not bound to the column was washed with a washing solution (pH 6.3), and the protein was separated from the column and purified using elution buffer 1 (pH 5.9) and elution buffer 2 (pH 4.5). As a result of analyzing the purified squid-derived conductive recombinant protein by SDS-PAGE, as shown in Figure 6, it was confirmed that more conductive protein of the squid-derived conserved sequence was purified from elution buffer 1 than from elution buffer 2.

[0089] Experimental Example 1. Analysis of the electrochemical properties of a squid-derived conductive recombinant protein and comparison with the electrochemical properties of bovine serum albumin protein.

[0090] In Example 4, the purified squid-derived conductive recombinant protein was drop-casted onto a screen-printed electrode (SPE), dried, and then coated to prepare an experimental sample to be used for the analysis of electrochemical properties. At this time, an uncoated screen-printed electrode was used as a negative control group, and a positive control was used to prepare a sample by coating the same concentration of bovine serum albumin protein under the same conditions as above. The experimental sample was immersed in an electrolyte solution, and the electrochemical properties of the squid-derived conductive recombinant protein were analyzed based on cyclic voltammetry using a potentiostat.

[0091] As shown in Fig. 7, the results of the electrochemical characteristic analysis of the uncoated electrode as a negative control and the electrode coated with the squid-derived conductive recombinant protein showed that the range of measured current versus the applied voltage in the negative control was 0.25 mA to 0.33 mA (preferably 0.26-0.32 mA), whereas the range of measured current versus the applied voltage in the purified squid-derived conductive recombinant protein solution was 2.39 mA to 3.51 mA (preferably 2.53-3.10 mA), confirming that the squid-derived conductive recombinant protein solution has excellent conductivity. In addition, the range of measured current versus the applied voltage in the electrode coated with the same concentration of bovine serum protein as a positive control was measured to be 1.66 mA to 2.24 mA (preferably 1.76-2.15 mA). Comparing the above results, it can be confirmed that the squid-derived conductive recombinant protein solution has better electrical conductivity than bovine serum protein, as the maximum current value measured from the electrode coated with the squid-derived conductive recombinant protein is higher.

[0092] Additionally, the purified squid-derived conductive recombinant protein was dialyzed, then freeze-dried, and the powder was dissolved in an acetic acid solution, drop-casted onto a screen-printed electrode (SPE), dried in a fume hood, and coated to prepare experimental samples to be used for electrochemical characterization. At this time, an uncoated screen-printed electrode was used as a negative control group, and a positive control was used to prepare samples by coating the same concentration of bovine serum albumin protein under the same conditions as above. The experimental samples were immersed in physiological saline as an electrolyte solution, and the electrochemical properties of the squid-derived conductive recombinant protein were analyzed based on cyclic voltammetry using a potentiostat.

[0093] As shown in Fig. 8, in the electrode coated with the same concentration of bovine serum protein as a positive control, the measured current range versus the applied voltage was measured as 0.67 mA to 1.11 mA (preferably 0.76-1.02 mA), and in the electrode coated with the squid-derived conductive recombinant protein, the measured current range versus the applied voltage was measured as 1.16 to 1.93 mA (preferably 1.31-1.77 mA). The above results demonstrate that the squid-derived conductive recombinant protein solution exhibits electrical conductivity superior to that of bovine serum protein.

[0094] Experimental Example 2. Analysis of the electrochemical properties of a squid-derived conductive recombinant protein and comparison with the electrochemical properties of a squid-derived conductive protein with a conserved sequence.

[0095] The purified squid-derived conductive recombinant protein was dialyzed and then freeze-dried, and the powder was drop-casted onto a screen-printed electrode (SPE) in a TFA (Trifluoroacetic acid) solution, dried in a fume hood, and coated to prepare an experimental sample to be used for the analysis of electrochemical properties. At this time, an uncoated screen-printed electrode was used as a negative control group, and the powder obtained by dialyzing and freeze-drying the purified squid-derived conductive protein of the conserved sequence from Comparative Example 3 was used as a positive control group. The same concentration of the squid-derived conductive protein of the conserved sequence was coated under the same conditions as above to prepare a sample. The experimental sample was immersed in an electrolyte solution, and the electrochemical properties of the squid-derived conductive recombinant protein were analyzed based on cyclic voltammetry using a potentiostat.

[0096] As shown in Fig. 9, in the electrode coated with the same concentration of the squid-derived conserved sequence conductive protein as the positive control, the measured current range versus the applied voltage was measured as 0.03 mA to 0.14 mA (preferably 0.06-0.11 mA), and in the electrode coated with the squid-derived conductive recombinant protein, the measured current range versus the applied voltage was measured as 0.25 mA to 1.39 mA (preferably 0.57-1.06 mA). The above results demonstrate that the squid-derived conductive recombinant protein solution has superior electrical conductivity to the squid-derived conserved sequence conductive protein.

[0097] Additionally, the purified squid-derived conductive recombinant protein was dialyzed, then freeze-dried, and the powder was dissolved in an acetic acid solution, and then drop-casted onto a screen-printed electrode (SPE), dried in a fume hood, and coated to prepare an experimental sample to be used for the electrochemical characteristic analysis. At this time, an uncoated screen-printed electrode was used as a negative control group, and the powder obtained by dialyzing and freeze-drying the purified squid-derived conductive protein of the conserved sequence from Comparative Example 3 was used as a positive control group. The same concentration of the squid-derived conductive protein of the conserved sequence was coated on the same conditions as above to prepare a sample. The experimental sample was immersed in an electrolyte solution, and the electrochemical characteristics of the squid-derived conductive recombinant protein were analyzed based on cyclic voltammetry using a potentiostat.

[0098] As shown in Fig. 10, in the electrode coated with the same concentration of the squid-derived conserved sequence conductive protein as the positive control, the measured current range versus the applied voltage was measured as 0.01 mA to 0.05 mA (preferably 0.02-0.04 mA), and in the electrode coated with the squid-derived conductive recombinant protein, the measured current range versus the applied voltage was measured as 0.59 mA to 3.37 mA (preferably 1.39-2.58 mA). The above results demonstrate that the squid-derived conductive recombinant protein solution has superior electrical conductivity to the squid-derived conserved sequence conductive protein.

[0099] While specific aspects of the present invention have been described in detail above, it should be apparent to those skilled in the art that these specific descriptions merely represent preferred embodiments and are not intended to limit the scope of the present invention. In other words, the substantial scope of the present invention is defined by the appended claims and their equivalents.

[0100] Numerical ranges are inclusive of the values ​​defined in the ranges above. Any maximum numerical limitation given throughout this specification includes any lower numerical limitation, as if that lower numerical limitation were explicitly stated. Any minimum numerical limitation given throughout this specification includes any higher numerical limitation, as if that higher numerical limitation were explicitly stated. Any numerical limitation given throughout this specification will include any better numerical range within the broader numerical range, as if that narrower numerical limitation were explicitly stated.

Claims

1. A conductive protein comprising an amino acid sequence represented by sequence number 2.

2. A conductive protein characterized in that, in the first paragraph, it further comprises a sequence composed of aspartic acid-arginine-tyrosine-tyrosine (Asp-Arg-Tyr-Tyr; DRYY) at the N-terminus of the amino acid sequence represented by the sequence number 2.

3. A conductive protein characterized in that it further comprises a tyrosine (Tyr; Y) sequence at the C-terminus of the amino acid sequence represented by sequence number 2 in the first paragraph.

4. A conductive protein characterized in that it further comprises a linker sequence composed of threonine-serine (Thr-Ser; TS) at the C-terminus of the amino acid sequence represented by the sequence number 2 in the first paragraph.

5. A conductive protein according to claim 1, characterized in that the conductive protein has an amino acid sequence represented by sequence number 3.

6. A conductive protein expression vector having inserted therein a gene encoding a conductive protein comprising an amino acid sequence represented by sequence number 2.

7. A transformant for producing conductive proteins, which is a strain transformed with the vector of Article 6.

8. A step of preparing an expression vector by inserting a gene encoding a conductive protein including an amino acid sequence represented by sequence number 2 into a vector; A step of transforming the above expression vector into a host to produce a transformant that produces the above conductive protein; and A method for producing a conductive protein, comprising the step of obtaining the conductive protein from the transformant.

Images