An enforced mitophagy system to reduce mitochondrial abundance from cells and organisms
The described methods generate mitochondria-depleted pluripotent stem cells and embryos, addressing the need to study mitochondrial depletion effects and interspecies composite PSCs, revealing evolutionary impacts on cellular processes.
Patent Information
- Application Number
- PCT/US2025/040563
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-06-09
- Filing Date
- 2025-08-04
- Publication Date
- 2026-02-05
AI Technical Summary
There is a need for methods to generate mitochondria-depleted pluripotent stem cells (mdPSCs) and composite PSCs to study the effects of mitochondrial depletion on pluripotency and differentiation, as well as to assess the impact of evolutionary changes in the mitochondrial genome on cellular processes.
Methods involving culturing pluripotent stem cells in a medium containing antimycin A and oligomycin A, overexpressing PRKN and optionally PINK1, and using a three-dimensional culture device with specific culture media and buffers to induce mitophagy, as well as electro cell fusion for generating embryos with reduced mitochondrial abundance.
The methods effectively generate mitochondria-depleted PSCs and embryos, allowing for the study of mitochondrial depletion effects and enabling the creation of interspecies composite PSCs, revealing transcriptomic and metabolomic consequences of mitochondrial divergence.
Smart Images

Figure US2025040563_05022026_PF_FP_ABST
Abstract
Description
AN ENFORCED MITOPHAGY SYSTEM TO REDUCE MITOCHONDRIAL ABUNDANCE FROM CELLS AND ORGANISMSCROSS REFERENCE TO RELATED APPLICATION
[0001] This application claims priority to U.S. Provisional Patent Application Serial No. 63 / 678,957, filed August 2, 2024, and U.S. Provisional Patent Application Serial No. 63 / 820,316, filed June 9, 2025, each of which are incorporated by reference in their entirety.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was made with government support under R01HD103627, R01GM138565, and F3 INS 125906 awarded by the National Institutes of Health. The government has certain rights in the invention.INCORPORATION OF SEQUENCE LISTING
[0003] The present application contains a Sequence Listing which has been submitted in .XML format via Patent Center and is hereby incorporated by reference in its entirety. Said WIPO Sequence Listing was created on August 4, 2025, named UTSD_4460_Sequence_Listing, and is 82,731 bytes in size.BACKGROUND
[0004] L Field
[0005] The present disclosure relates to methods and in vitro culture system for generation of mitochondria-depleted pluripotent stem cells (mdPSCs), composite PSCs, and mitochondria-depleted embryos and methods and systems of using the same for in vitro drug screening.
[0006] 2. Background
[0007] Tire symbiotic relationship between mitochondria and their eukary otic cellular hosts dates back approximately 1.7 billion years. This relationship has been critical in the evolution, diversification, and survival of the entire domain of Eukarya. Over decades of research, the mitochondrion has surpassed its stereotypical portrayal as the ATP -producing powerhouse of the cell; they are now recognized for their essential roles in various cellular processes, including the regulation of cell death, differentiation, signal transduction, aging, and developmental timing. However, the extent to which mammalian development is dependent on mitochondria remains an open and fundamental question.
[0008] Over the last ~6 to ~18 million years, the mitochondrial genomes of Hominidae (the great apes) have become increasingly divergent, resulting in thousands of naturally occurring nucleotide alterations within mitochondrial DNA (mtDNA). By generating interspecies composite PSCs with species-specificmitochondrial content, the impact evolutionary changes in the mitochondrial genome have on pluripotent cells and development can be assessed. Thus, there is an unmet need for developing methods to generate mdPSCs, composite PSCs, and mitochondria-depleted embryos to enable the study of effects of mitochondria depletion on pluripotency and differentiation.SUMMARY OF THE INVENTION
[0009] Disclosed herein are methods for generating mitochondria-depleted pluripotent stem cells (mdPSCs) including culturing pluripotent stem cells having a normal or non-reduced number of mitochondria (PSCs) in a culture medium that contains antimycin A and oligomycin A and maintaining the PSCs in the culture medium for a period of time.
[0010] Also disclosed are methods for generating mitochondria-depleted pluripotent stem cells (mdPSCs) including overexpressing PRKN, and optionally PINK1, in PSCs having a normal or nonreduced number mitochondria of culturing pluripotent stem cells having a normal or non-reduced number of mitochondria (PSCs) in a culture medium. In some aspects, the culture medium can contain antimycin A and oligomycin A.
[0011] Also disclosed herein are methods for generating a composite PSC including: a) culturing a first PSC and a second PSC in a first culture medium comprising a ROCK inhibitor for a period of time in a three-dimensional culture device; b) removing the first culture medium and adding a second culture medium that does not comprise the ROCK inhibitor; c) adding a fusion buffer and maintaining cells in the co-culture for a period of time; d) removing the fusion buffer and washing the cells with a wash buffer; and e) incubating the cells in a third culture medium that contains chroman, emricasan, trans-ISRIB, and a polyamine supplement for a period to time.
[0012] Also disclosed herein are polynucleotides that include a nucleotide sequence that encodes Parkin and PTEN-induced kinase 1, each of which are operably linked to a promoter.
[0013] Also disclosed herein are methods for generating a non-human, tetrapioid embryo with reduced abundance of mitochondria including generating the tetrapioid embryo by electro cell fusion of a 2-cell non-human embryo and providing a nucleotide that includes a nucleotide sequence that encodes Parkin and PTEN-induced kinase 1. each of which are operably linked to a promoter. Also disclosed herein are methods for generating a non-human embryo with reduced abundance of mitochondria including generating the embryo by providing a nucleotide that includes a nucleotide sequence that encodes Parkin and PTEN- induced kinase 1, each of which are operably linked to a promoter and culturing or otherwise growing the zygote to generate an embryo.BRIEF DESCRIPTION OF THE DRAWINGS
[0014] FIGs. 1A-1L characterize mitochondria-depleted PSCs. FIG. 1A depicts a representative schematic of vectors used for enforced mitophagy in PSCs. FIG. IB depicts representative fluorescent images of Mito-EGFP and mCherry-PRKN expression in PRKN-hESCs. Scale bar, 130 pm. FIG. 1C depicts the relative expression levels of core pluripotency genes (SOX2, POU5F1, and NANOG) and PRKN in PRKN-hESCs (n=3, biological replicates, mean ± SD, Tukey’s multiple comparisons test, p- values: PRKN, p = 0.0011: SOX2, p = 0.4089; POU5F1, p = 0.0690; NANOG, p = 0.0513). FIG. ID depicts growth curves ofWT and PRKN-hESCs over three days (n=3, biological replicates, mean ± SD). FIG. IE depicts representative H&E staining images of teratomas formed by PRKN-hESCs containing tissues from all three embryonic germ layers. Scale bar, 110 pm. FIG. IF depicts a representative timeline and process of generating mitochondria-depleted PRKN-hESCs. FIG. 1G depicts representative live-cell fluorescent images of A / O-induced Mito-EGFP loss over 72 hours. Scale bar, 130 pm. FIG. 1H depicts survival of mitochondria-depleted PRKN-hESCs. with (+CEPT) or without (+DMSO) CEPT supplementation (n=3, biological replicates, mean ± SD). FIG. 1 1 depicts representative fluorescent images of EdU incorporation in Day 0 mitochondria-depleted (+A / O) or control (-A / O) PRKN-hESCs. Scale bar, 130 pm. FIG. 1J depicts DAPI cell cycle analysis of control (-A / O) and Day 0 mitochondria-depleted PRKN-hESCs (+A / O) (n=l or 3, respectively, biological replicates, mean ± SD). FIG. IK depicts representative IF and fluorescent images of NANOG staining and Mito-EGFP signal in control (-A / O) and mitochondria-depleted (+A / O) PRKN-hESCs on Day 2. Scale bar, 130 pm. FIG. IL depicts representative IF images of COXIV staining in PSCs (PRKN-MELAS iPSCs, PRKN-mESCs, and PRKN-mEpiSCs) with (+A / O) or without (-A / O) enforced mitophagy. Scale bar, 130 pm.
[0015] FIGs. 2A-2G show that enforced mitophagy efficiently generates PSCs devoid of mitochondria. FIG. 2A depicts a schematic of enforced mitophagy system in PSCs. FIG. 2B depicts IF staining and fluorescent images of COXIV and Mito-EGFP in A / O-treated and control (-A / O) PRKN- hESCs. Scale bar. 130 pm. FIG. 2C depicts relative mtDNA abundances in PRKN-hESCs with (+A / O) or without (-A / O) mitochondria-depletion over 72 hours (n=3, biological replicates, mean ± SD, Dunnett’s multiple-comparisons test, ****p < 0.0001). FIG. 2D depicts representative electron micrographs of PRKN-hESCs with or without A / O treatment. Scale bar, 1 pm. Mitochondria outlined in hatched circles. FIG. 2E depicts oxygen consumption rates (OCR) of mitochondria-depleted (+A / O) or control (-A / O) PRKN-hESCs (n=l 1-12, technical replicates, mean ± SD: Oligo, oligomycin: CCCP, carbonyl cyanide 3- chlorophenylhydrazone: AA, antimycin A). FIG. 2F depicts representative IF and fluorescent images of OCT4 ( / ) and SOX2 (ii) staining with Mito-EGFP signal in control (-A / O) and Day 2 mitochondria-depleted (+A / O) PRKN-hESCs. Scale bar, 130 pm. FIG. 2G depicts relative mtDNA abundances in PRKN-MELASiPSCs, PRKN-mESCs, and PRKN-mEpiSCs with (+A / 0) or without (-A / O) mitochondria-depletion (n=3, biological replicates, mean ± SD, unpaired / -tests, **p < 0.01, ***p < 0.001).
[0016] FIGs. 3A-3F show that exposure time to A / O can be tuned to transiently reduce mitochondria. FIG. 3A depicts a representative timeline of A / O titration experiments. FIG. 3B depicts representative fluorescent and brightfield images of Mito-EGFP signal in PRKN-hESCs on (z) Day 4 and (zz) Day 8 after continuous treatment of 10 pM, 100 pM, or 1 nM A / O. FIG. 3C depicts relative mtDNA abundances in PRKN-hESCs with or without 50 pM A / O treatment for 8 days (n=3, biological replicates, mean ± SD, unpaired / -test, p = 0.4364). Scale bar, 130 pm. FIG. 3D depicts a representative timeline of A / O treatment duration experiments. FIG. 3E depicts relative mtDNA abundances in PRKN-hESCs on Days 3, 5 and 7 after treatment with 1 pM A / O for 1 minute, 5 minutes, or 48 hours (n=3, biological replicates, mean ± SD. unpaired / -tests. ***p < 0.001, **p < 0.01 FIG. 3F depicts representative fluorescent and brightfield images of Mito-EGFP signal in PRKN-hESCs on (z) Day 3 (72 h) and (zz) Day 7 after treatment with 1 pM A / O for 1 minute, 5 minutes, or 48 hours. Scale bar, 130 pm.
[0017] FIGs. 4A-4H show multi-omics analysis of the effect of mitochondria depletion on hPSCs. FIG. 4A depicts a representative schematic of multi-omics analysis of mitochondria depletion in PRKN- hESCs. FIG. 4B depicts a representative heatmap showing gene expression profiles of control (n=2) and Day 0 mitochondria-depleted (n=2) PRKN-hESCs. Red and blue indicate upregulation and downregulation, respectively. Data plotted from genes with a |log2 fold change) > 1.5 and FDR-corrected p < 0.05. FIG. 4C depicts a representative volcano plot of the RNA-seq data showing the log2 fold change in gene expression in mitochondria-depleted compared to control PRKN-hESCs. Light red points indicate nuclear-encoded mitochondrial genes, green points indicate mtDNA-encoded genes, and blue points indicate pluripotency genes. FIG. 4D depicts a representative heat map showing protein expression profiles of control (n=2) and Day 0 mitochondria-depleted (n=2) PRKN-hESCs. Red and blue indicate upregulation and downregulation, respectively. Data plotted from genes with a |log2 fold change) > 1.5 and uncorrected p < 0.05. FIG. 4E depicts bar charts displaying the proportion of nuclear-encoded mitochondrial, mtDNA-encoded, and pluripotency genes that are upregulated, downregulated, or unchanged in transcriptomic and proteomic expression levels. FIG. 4F depicts a representative heat map showing metabolite abundance profiles of control (n=3) and Day 0 mitochondria-depleted PRKN-hESCs (n=3). Red and blue indicate up and downregulation, respectively. Data plotted from all metabolites with FDR-corrected p < 0.05. FIG. 4G depicts relative metabolite levels in Day 0 mitochondria-depleted PRKN-hESCs (+A / O) normalized to control (-A / O) (mean ± SD, FDR-corrected **p < 0.01, *p < 0.05). a-KG, a-ketoglutarate; SAM, S- adenosyl-L-methionine; ATP, adenosine triphosphate. FIG. 4H depicts relative levels of metabolites upregulated in Day 0 mitochondria-depleted PRKN-hESCs (+A / O) compared to control (-A / O) (mean ±SD, FDR-corrected *p < 0.05, |log2 fold change| > 1.0). 2-HG, 2-hydroxyglutarate; GPI, glycerophosphoinositol .
[0018] FIGs. 5A-5N show multi-omic analysis of mitochondria-depleted PRKN-hESCs. FIG. 5A depicts a representative timeline for transcriptomic, proteomic, and metabolomic analyses of mitochondria- depleted PRKN-hESCs. FIG. 5B depicts a PCA plot comparing control and Day 0 mitochondria-depleted PRKN-hESCs based on transcriptomic data. FIG. 5C depicts correlation scores of control and mitochondria-depleted PRKN-hESCs from transcriptomic data. FIG. 5D depicts KEGG pathway analysis of up- and downregulated genes in mitochondria-depleted (+A / O) PRKN-hESCs compared to control (-A / O), based on transcriptomic data. FIGs. 5E and 5F depict GO analyses of up- and downregulated genes in mitochondria-depleted (+A / O) PRKN-hESCs compared to control (-A / O), based on transcriptomic data. FIG. 5G depicts the relative abundance of mtDNA and expression of SOX2, OCT4, and NANOG overtime in control and A / O-treated PRKN-hESCs. FIG. 5H depicts PCA plot of control and Day 0 mitochondria- depleted PRKN-hESCs based on proteomic data. FIGs. 51 and 5J depict GO and KEGG pathway analyses of upregulated and downregulated proteins in mitochondria-depleted (+A / O) PRKN-hESCs, compared to control (-A / O), based on proteomic data. FIG. 5K depicts a representative pathway analysis of downregulated metabolites in mitochondria-depleted PRKN-hESCs compared to control. FIGs. 5L, 5M, and 5N depict metabolite ratios based on metabolomic analysis of Day 0 mitochondria-depleted PRKN- hESCs compared to control (mean ± SD, unpaired / -test. nonsignificant p = 0.0545, ***p < 0.001, ****p < 0.0001).
[0019] FIGs. 6A-6G show that human mtDNA is selected for in human-NHH PSC fusions. FIG. 6A depicts a representative strategy used to generate human-NHH composite PSCs. FIG. 6B depicts representative brightfield images of composite PSC colonies (HsPt. HsPp, HsGg. HsPa). Scale bars. 180 pm. FIG. 6C depicts IF images of OCT4 and SOX2 staining in composite PSC lines. Scale bar, 130 pm. FIG. 6D depicts an RFLP analysis of mtDNA genotypes of contributor lines (hESCs and ciPSCs) and a pooled population of HsPt PSCs. FIG. 6E depict percent of linear amplicon reads from contributor and HsPt PSC populations that align to the human or chimp mtDNA genome (n=3 loci with species-specific SNPs in mtDNA, mean ± SD). FIG. 6F depicts a representative schematic of clonal analysis (upper) and RFLP analysis of mtDNA genotypes of two contributor lines (hESCs and ciPSCs) and twelve individual clonal HsPt PSC lines (lower). FIG. 6G depicts percent of linear amplicon reads from contributor and composite PSC populations that align to the human or NHH (chimp, bonobo, gorilla, or orangutan) mtDNA genome (n=3 loci with species-specific SNPs in mtDNA, mean ± SD). For contributor hESCs, comparison to ciPSCs is shown as a representative example.
[0020] FIGs. 7A-7J show generation of a comprehensive panel of human-NHH composites PSCs.FIG. 7A depicts representative histograms of propidium iodide staining intensity in contributor andcomposite PSCs. FIG. 7B depicts representative brightfield images of contributor and composite lines. Scale bars, 100 pm. FIG. 7C depicts representative IF images of OCT4 and SOX2 staining in contributor PSC lines. Scale bar, 130 pm. FIG. 7D depicts representative karyotypes of contributor PSCs and one clonal HsPt PSC line. FIG. 7E depicts quantification of metaphase spreads that were normal (i.e., perfectly diploid or tetrapioid [94 chromosomes]) or aneuploid (< or > 94 chromosomes for composite lines) in HsPt composite PSC lines (n=15-16 spreads). FIG. 7F depicts an overview of unique restriction sites present in the human and NHH mitochondrial genomes. FIGs. 7G, 7H, and 71 depict RFLP analyses of mtDNA contribution in contributor and composite cell lines. (G), human-bonobo; (H), human-gorilla; (I), humanorangutan. FIG. 7J depicts RFLP analysis of mtDNA contribution in contributor and composite cell lines generated from fusion of hiPSCs (SCVI274) and oiPSCs.
[0021] FIGs. 8A-8J show that transient enforced mitophagy generates hESCs with reduced mitochondrial content and allows contribution from NHH mtDNA. FIG. 8A depicts RFLP analysis of contributor and HsPp PSCs generated in mTeSR™, E8™, or AFX condition. FIG. 8B depicts representative brightfield images of HsPp PSCs in mTeSR™, E8™, or AFX condition. Scale bar, 130 pm. FIG. 8C depicts a proportion of linear amplicon sequencing reads that align to either the chimp or orangutan mtDNA genomes in contributor and PtPa PSCs. FIG 8D depicts a representative schematic of episomal enforced mitophagy vector used for reducing mitochondrial abundance in hESCs. FIG. 8E depicts representative fluorescent images of hESCs harboring the enforced mitophagy episome after 24 h of A / O treatment. Scale bars, 130 pm. FIG. 8F depicts quantification of relative mtDNA abundance in hESCs harboring the enforced mitophagy episome, with or without 24 h of A / O treatment (n=3, biological replicates, mean ± SD, / -test, ***p < 0.001). FIG. 8G depicts percent of linear amplicon reads from contributor and pooled populations of composite PSCs that align to the human or NHH (chimp, bonobo, gorilla, orangutan) mtDNA genome after fusion with mitochondria-depleted hESCs (n=3 different loci with species-specific SNPs in mtDNA sequence, mean ± SD). For hESCs, comparison to the chimp mtDNA is shown as a representative example. FIG. 8H depicts quantification of metaphase spreads that were perfectly tetrapioid(94 chromosomes) or aneuploid (< or > 94 chromosomes) in PlsPt composite PSC lines. 15 to 16 spreads were counted per cell line. FIG. 81 depicts representative karyotypes of two clonal HsPt composite PSC lines harboring chimp mtDNA. FIG. 8J depicts representative IF images of OCT4 and SOX2 staining in human-NHH mitochondrial-composite PSCs harboring NHH mtDNA. Scale bar, 130 pm.
[0022] FIGs. 9A-9F show that depletion of human mitochondria allows the NHH mitochondrial genome to contribute to PSC fusions. FIG. 9A depicts a representative schematic of strategy used to generate human-NHH composite PSCs harboring NHH mtDNA using enforced mitophagy, dual antibiotic resistance, and PEG-mediated fusion. FIG. 9B depicts percent of linear amplicon reads from contributor and HsPt PSC populations that align to the human or chimp mtDNA genome after enforced mitophagy(n=3 loci with species-specific SNPs in mtDNA, mean ± SD). FIG. 9C depicts RFLP analysis showing mtDNA genotypes of contributor lines (hESCs and ciPSCs) and twelve clonal HsPt PSC lines that arose from fusion with mitochondria-depleted hESCs. FIG. 9D depicts representative brightfield images of HsPtHs PtPSCs lines harboring either human or chimp mtDNA (HsPt and HsPt ). Scale bar, 220 pm. FIG. 9E depicts percent of linear amplicon reads from contributor and clonal composite PSCs that align to the human or NHH (chimp, bonobo, gorilla, orangutan) mtDNA genome after fusion with mitochondria-depleted hESCs (n=3 loci with species-specific SNPs in mtDNA, mean ± SD). FIG. 9F depicts a representative overview of mtDNA contribution in human-NHH mitochondrial -composite PSCs.
[0023] FIGs. 10A-10K show human-orangutan composite PSCs reveal functional overlap andHs divergence in mitochondrial genomes. FIG. 10A depicts representative comparisons between HsPa and PaHsPa PSCs. Mya, million years ago. FIG. 10B depicts the percent of linear amplicon reads from contributor and clonal HsPa PSC lines that align to the human or orangutan mtDNA genome (n=3 loci with species-specific SNPs in mtDNA, mean ± SD). FIG. 10C depicts the proportion of mtDNA-encoded transcripts of either human or orangutan origin in HsPa mitochondrial-composite PSCs. FIG. 10D depicts relative mtDNA abundance in HsPa mitochondrial-composite PSCs (n=3, biological replicates, mean ± SD, unpaired / -test, p = 0.2169). FIG. 10E depicts a representative principal component plot of RNA-SeqHs Pa analysis for hESCs, oiPSCs, HsPa , and HsPa PSCs. FIG. 10F depicts a representative heat map depicting HsPa mitochondrial -composite PSC gene expression profiles (n=3 individual clonal lines of each genotype). FIG. 10G depicts a representative volcano plot of the RNA-Seq data showing the log2 fold change in gene expression in HsPa mitochondrial-composite PSCs. Data plotted from genes with a |log2 fold change) > 1 .5 and FDR-corrected p < 0.05. FIG. 10H depicts relative expression levels (RT-qPCR) of SURF1, TIMM17B, and PCDHA6 in HsPa mitochondrial-composite PSCs (n=3, biological replicates, mean ± SD, unpaired / -tests, ***p < 0.001, **p < 0.01). FIG. 101 depicts oxygen consumption rates (OCR) of HsPa mitochondrial-composite PSCs (n=12, technical replicates, mean ± SD, unpaired / -test, *p < 0.0001). FIG. 10J depicts extracellular acidification rates (ECAR) of HsPa mitochondrial-composite PSCs (n=12. technical replicates, mean ± SD, unpaired / -test. *p < 0.05). FIG. 10K depicts a representative heatmap depicting HsPa mitochondrial -composite PSC metabolite profiles (metabolites with unadjusted p < 0.05). Red and blue indicate upregulated and
[0024] FIGs. 11A-11J shows transcriptomic verification and metabolic analysis of HsPa composite PSCs. FIG. 11 A depicts RFLP analysis showing mtDNA genotypes of contributor lines (hESCs and oiPSCs) and twelve individual clonal HsPa PSC lines that arose from fusion of oiPSCs and mitochondria-depleted hESCs. FIG. 1 IB depicts RFLP analysis of mtDNA contribution in contributor and mitochondrial-composite HsPa PSCs used for RNA-Seq and metabolomics. FIG. 11C depictsrepresentative karyotypes of contributor cells (hESCs and oiPSCs) and six individual HsPa mitochondrial- composite PSC lines. Five spreads were assessed for the diploid contributor lines, and 5-13 spreads were assessed for each composite line. FIG. 11D depicts a representative Venn diagram depicting the total number of reads that mapped to the human reference, orangutan reference, or both from HsPa mitochondrial -composites. FIG. 1 IE depicts a mapping rate (rf HsPa mitochondrial -composite PSCs to the human or orangutan references (n=3 individual clones of each mtDNA genotype). FIG. 1 IF depicts total expression (TPM) of nuclear-encoded genes in HsPa mitochondrial-composite PSCs. FIG. 11G depicts total expression (TPM) of mtDNA-coded genes in HsPa mitochondrial -composite PSCs (***p < 0.001). FIG. 11H depicts basal oxygen consumption rates (OCR) of hESCs and oiPSCs (n=l l, technical replicates, mean ± SD, unpaired / -test, / ? = 0.0898). FIG. 1 II depicts extracellular acidification rates (ECAR) of hESCs and oiPSCs (n=l 1, technical replicates, mean ± SD, unpaired / -test, / ? = 0.4734). FIG. 11J depicts a representative principal component plot of metabolomic analysis o HsPa and HsPa composite PSCs (n=3 individual HsPa composite clones of each mtDNA genotype).
[0025] FIGs. 12A-12J show that transgenic expression of OMM-PINK1 and PRKN is sufficient to reduce mitochondrial content in vivo. FIG. 12A depicts a representative schematic of a transgenic enforced mitophagy system. FIG. 12B depicts a representative IF staining and fluorescent images of COXIV and Mito-EGFP in H9 hESCs with or without dox-inducible expression of 0MM-PINK1 and PRKN for 72 hours. Scale bar, 130 pm. FIG. 12C depicts a representative schematic of a strategy for mitochondria-depletion in ex vivo pre -implantation mouse embryos. FIG. 12D depicts representative fluorescent images of OMM-PINKl-mScarlet and EGFP-PRKN expression in 2-cell mouse embryos, 24 hours (Day 1) after mRNA injection. FIG. 12E depicts quantification of relative mtDNA abundance in mouse embryos 72 h (Day 3) after 0MM-PINK1 / PRKN (200 ng / pL mRNA) or water-only injection (n=22- 31 embryos, biological replicates, mean ± SD, / -test, **** / ? < 0.0001). FIG. 12F depicts quantification of relative mtDNA abundances in mouse embry os 72 h (Day 3) after OMM-PINK1 / PRKN (ranging from 20 - 400 ng / pL) or water-only injection (n=19-29 embryos, biological replicates, mean± SD, Dunnett’s multiple comparisons test, **p < 0.01, **** / ? < 0.0001). FIG. 12G depicts distribution of developmental stages reached by embryos on Days 1-5 (El.5-5.5) after OMM-P1NK1 PRK injection (n=15-31 embryos). FIG. 12H depicts representative E8.5 decidua formed by mouse embry os after 0MM-PINK1 / PRKN 400 ng / pL (z), 200 ng / pL (zz), or water-only injection. Embryos were transferred at a 2-cell stage (24 h post-injection). FIG. 121 depicts quantification of relative mtDNA abundances in post-implantation mouse embry os after 200 ng / pL OMM-PINKl / PRKN or water-only injection (biological replicates, mean ± SD, / -test), (z) E8.5, n=12-17 embryos. **p < 0.01; (zz) El l. n=l l-12 embryos, ? = 0.7153. FIG. 12J depicts a representative schematic of pre-implantation developmental perturbations observed in mitochondria-depleted embryos.
[0026] FIGs. 13A-13O show that co-expression of OMM-PINK1 and PRKN in hPSCs and mouse embryos reduces mitochondrial abundance. FIG. 13A depicts relative mtDNA abundances in hESCs inducibly expressing 0MM-PINK1 and PRKN transgenes following 72 hours of doxycycline induction (n=3, biological replicates, mean ± SD, Dunnett's multiple comparisons, ****p < 0.0001. FIG. 13B depicts a representative schematic of a doxycycline -inducible vector containing an additional puromycin resistance gene, integrated into H9 hESCs for uniform depletion of mitochondria. FIG. 13C depicts a representative schematic of a construct and strategy for in vivo mitochondria-depletion in whole mouse embryos. FIG. 13D depicts representative brightfield and fluorescent images of mouse embryos after 48 h of doxycycline or PBS-only treatment. FIG. 13E depicts relative mtDNA abundances in mouse embryos after 48 h of doxycycline or PBS-only treatment (n=4 embryos, biological replicates, mean ± SD, / -test, *p < 0.05). FIG. 13F depicts representative fluorescent images of PRKN-EGFP localization in mouse embryos with or without OMM-PINKl-mScarlet co-expression at 24 h (Day 1, El .5) after mRNA injection to zygotes. FIG. 13G depicts a proportion of embryos that reached the blastocyst stage by Day 3 (E3.5) post-injection with OMM-PINKLPRKN. FIG. 13H depicts the percentage of embryos that survived initial microinjection of mRNAs (left), and, of surviving zygotes, the percentage of embryos that survived until Day 3 (72 h postmicroinjection) (right). FIG. 131 depicts implantation efficiency of mouse embryos injected with 200 and 400 ng / pL of OMM-PINKI PRKN. compared to water-only injected control, assessed at E8.5 (n=15-40 transferred embryos). FIG. 13 J depicts the proportion of transferred embryos injected with 200 or 400 ng / pE of OMM-PINKI, PRKN. compared to water-only injected control, which formed more advanced embryos after implantation (n=15-40 transferred embryos). FIG. 13K depicts representative images of isolated E8.5 embryos with or without 200 ng / pL OMM-PINKL PRKN injection. FIG. 13E depicts a length of E8.5 embryos with or without 200 ng / pE 0MM-PINK1 / PRKN injection (n=12-17 embryos). FIG. 13M depicts a length of E12.5 embryos with or without 200 ng / pL 0MM-PINK1 / PRKN injection (n=l 1-13 embryos). FIG. 13N depicts representative images of isolated E12.5 embryos with or without 200 ng / pL OMM- PINKI / PRKN injection. FIG. 130 depicts the birth rate of embryos after injection with 200 ng / pE OMM- P1NK1 PRKN (n=3 rounds of injection and transfer, 31 live pups from 58 transferred embry os).
[0027] FIGs. 14A-14C show that primordial germ cells (PGCs) decreased migration in embryos with reduced mitochondrial abundance. FIG. 14A depicts immunostaining of 9.5 days post coitum (dpc) embryos derived from zygotes injected with water (control) or OMM-PINK1 / PRKN mRNAs. followed by embryo transfer. OCT4 marks PGCs; nuclei are counterstained with DAPI. FIG. 14B depicts linear regression analysis of OCT4+cell numbers, showing a reduction in PGCs in embry os with decreased mitochondrial abundance following enforced mitophagy (squares) as compared to control embryos (circles).
[0028] FIGs. 15A-15E show that transient reduction of mitochondrial abundance during development does not affect mouse fecundity. FIG. 15A depicts embryonic gonads dissected from 12.5 dpc embryos derived from zygotes injected with water (control) or OMM-PINK1 / PRKN mRNAs, followed by embryo transfer. Fig. 15B depicts the female gonad length between mice derived from zygotes injected with water or OMM-PINK1 / PRKN mRNA. Fig. 15C depicts immunostaining of embryonic gonad sections visualizing germ cells. M indicates mesonephros. FIG. 15D depicts representative mice derived from zygotes injected with OMM-PINK1 / PRKN mRNA and histological analyses of adult testes (H&E and PAS staining) and ovaries (H&E staining). FIG. 15E depicts the number of pups based from mating between two wild type BDF1 mice or between a BDF1 mouse and a mouse derived from a zygote injected with OMM-PINK1 / PRKN mRNA.
[0029] FIGs. 16A-16B show the production of CRE expressing animals. FIG. 16A depicts representative transgenic constructs and expression timing of the various constructs. FIG. 16B depicts immunostaining of gonadal tissues to confirm CRE expression. Nuclei are counterstained with DAPI.
[0030] FIGs. 17A-17C show the production of lox-stop-lox (LSL)-enforced mitophagy in mice. FIG. 17A depicts a schematic representation of knockin (KI) mouse generation, where an RNP complex targeting the Rosa26 locus and donor DNA are microinjected into the pronucleus of zygotes. FIG. 17B depicts a representative diagram of donor construct used for integration. FIG. 17C depicts representative genotyping of founder (FO) mice using primers (Fwl, Fw2, Fw3, Rvl, Rv2, Rv3) as shown in FIGs. 17A and 17B.
[0031] FIGs. 18A-18C show the production of inducible-enforced mitophagy in animals. FIG. 18A depicts a schematic representation of the KI mouse generation strategy and diagram of the donor construct used for Rosa26-targeted integration. FIG. 18B depicts genotyping of founder (F0) mice using primers indicated in the construct schematic shown in FIG. 18A. In these representative embodiments, a CAG promoter was used to drive enforced mitophagy throughout the whole body. FIG 18A depicts genotyping of founder (F0) mice using primers indicated in the construct schematic shown in FIG. 18A. In these representative embodiments, a Cypl7 promoter was used to drive enforced mitophagy in ovarian stromal tissue.
[0032] FIGs. 19A-19B show enforced mitophagy in male germ cells. FIG. 19A depicts LSL- enforced mitophagy mice were crossed with Prml-Cre transgenic mice. FIG. 19B depicts the length of Mitotracker™ regions (mitochondrial sheath) in mice with LSL-enforced mitophagy or LSL-enforced mitophagy and Prml-Cre.
[0033] FIGs. 20A-20C show immunoblotting for acetylated tubulin and COXIV in KI and KI- Prml-Cre mice. FIG. 20A depicts immunoblotting for acetylated tubulin as a loading control. FIG. 20Bdepicts immunoblotting for COXIV to quantify mitochondrial abundance. FIG. 20C depicts a normalized COXIV signal intensity.
[0034] FIGs. 21A-21C show sperm motility. FIG. 21A depicts a representative experimental scheme to incubate spermatozoa in IVF pre-incubation medium. FIG. 2 IB depicts a representative still photo of sperm from LSL-enforced mitophagy KI mice and LSL-enforced mitophagy KI Prml-Cre mice.
[0035] FIGs. 22A-22B show in vitro fertilization with sperm having reduced mitochondrial abundance. FIG. 22A depicts a representative experimental scheme for IVF. FIG. 22B depicts the fertilization rate of eggs eight hours after insemination with spermatozoa isolated from LSL-enforced mitophagy KI mice or LSL-cnforccd mitophagy KI Prml-Cre mice.
[0036] The drawing figures do not limit the present disclosure to the specific aspects disclosed and described herein. The drawings are not necessarily to scale, emphasis instead being placed on clearly illustrating principles of certain aspects of the present disclosure.DETAILED DESCRIPTION
[0037] The following detailed description references the accompanying drawings that illustrate various aspects of the present disclosure. The drawings and description are intended to describe aspects of the present disclosure in sufficient detail to enable those skilled in the art to practice the present disclosure. Other components can be utilized, and changes can be made without departing from the scope of the present disclosure. The following description is, therefore, not to be taken in a limiting sense.
[0038] Tire inventors have discovered a method to enforce mitophagy in PSCs and embry os to reduce mitochondrial abundance in cells and organisms. The methods provide mitochondria-depleted PSCs (mdPSCs), composite PSCs, and tetrapioid, mitochondria-depleted embryos. Hie disclosed methods enable study of the effects of mitochondria depletion on pluripotency. In addition, the pre-emptive removal of mitochondria facilitates the generation of a comprehensive set of interspecies composite PSCs. By generating isogenic composite PSCs that differ only by their mitochondrial genomes, the inventors observed the transcriptomic and metabolomic consequences of interspecific mtDNA divergence that has accumulated over millions of years of evolution. A transgenic enforced mitophagy method was developed based on the hyperactivation of PINK1 and PRKN that can be used to significantly reduce mitochondrial abundance in mouse embryos. A direct relationship between mitochondrial abundance and the developmental pace of embryos is identified, where reduced mitochondrial content leads to a developmental delay and compromised implantation.I. Terminology
[0039] For the purposes of promoting an understanding of the principles of the present disclosure, reference will now be made to preferred aspects and specific language will be used to describe the same. Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this disclosure belongs.
[0040] As used in the specification, articles '‘a” and “an” are used herein to refer to one or to more than one (i.e., at least one) of the grammatical object of the article. By way of example, “an element” means at least one element and can include more than one element.
[0041] “About” is used to provide flexibility to a numerical range endpoint by providing that a given value can be “slightly above” or “slightly below” the endpoint without affecting the desired result. The term “about” in association with a numerical value means that the numerical value can van’ plus or minus by about 10% or less of the numerical value, including plus or minus about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, or about 1% of the numerical value.
[0042] Throughout this specification, unless the context requires otherwise, the word “comprise” and “include” and variations (e.g., “comprises,” “comprising,” “includes,” “including”) will be understood to imply the inclusion of a stated component, feature, element, or step or group of components, features, elements or steps but not the exclusion of any other integer or step or group of integers or steps.
[0043] As used herein, “and / or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations where interpreted in the alternative (“or”).
[0044] As used herein, the transitional phrase “consisting essentially of’ (and grammatical variants) is to be interpreted as encompassing the recited materials or steps and additional materials or steps “that do not materially affect the basic and novel characteristic(s)” of the claimed disclosure. Thus, the term “consisting essentially of’ as used herein should not be interpreted as equivalent to “comprising.”
[0045] Moreover, the present disclosure also contemplates that in various aspects, any feature or combination of features set forth herein can be excluded or omitted. To illustrate, if the specification states that a complex comprises components A, B, and C, it is specifically intended that any of A, B, or C, or a combination thereof, can be omitted and disclaimed singularly or in any combination.
[0046] Any recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise-indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. Forexample, if a concentration range is stated as 1 % to 50%, it is intended that values such as 2% to 40%, 10% to 30%, or l%to 3%, etc., are expressly enumerated in this specification. These are only examples of what is specifically intended, and all possible combinations of numerical values between and including the low est value and the highest value enumerated are to be considered to be expressly stated in this disclosure.
[0047] As used herein, “treatment,” “therapy” and / or “therapy regimen” refer to the clinical intervention made in response to a disease, disorder, or physiological condition manifested by a patient or to which a patient can be susceptible. The aim of treatment includes the alleviation or prevention of symptoms, slowing or stopping the progression or worsening of a disease, disorder, or condition and / or the remission of the disease, disorder, or condition.
[0048] As used herein, “prevent” or “prevention” refers to eliminating or delaying the onset of a particular disease, disorder, or physiological condition, or to the reduction of the degree of severity of a particular disease, disorder, or physiological condition, relative to the time and / or degree of onset or severity in the absence of intervention.
[0049] Tire term “effective amount” or “therapeutically effective amount” refers to an amount sufficient to effect and / or achieve beneficial or desirable biological and / or clinical results.
[0050] As used herein, “individual”, “subject”, “host”, and “patient” can be used interchangeably herein and refer to any subject for whom diagnosis, treatment, prophylaxis or therapy is desired, for example, humans, non-human primates, pets, livestock, horses or other animals. Mammals are of the class mammalia and include human and non-human primates, rodents, caniforms, feliforms, artiodactyls (eventoed ungulates), or perissodactyls (odd-toed ungulates). Primates can include, but are not limited to, prosimians, monkeys (both old-world and new world), apes, and humans. Rodents can include, but are not limited to, rats, mice, guinea pigs, and hamsters, as well as lagomorphs (e.g., rabbits, hares, and pikas). Caniforms include, but are not limited to, dogs, wolves, foxes, bears, raccoons, mustelids, and pinnipeds. Feliforms include, but are not limited to. small cats, large cats (e.g., lions, tigers, jaguars, cougars), hyenas, mongoose, and civets. Artiodactyls include, but are not limited to, pigs and peccaries, hippopotamuses, antelopes, deer, giraffes, camels, llamas, alpacas, sheep, goats, and cattle, as well as cetaceans (e.g. , whales, dolphins, and porpoises). Perissodactyls include, but are not limited to, horses, donkeys, mules, zebras, rhinoceroses, and tapirs. Bird can refer to animals within the class aves, and include, but arc not limited to, companion birds (e.g., parrots and pigeons), wild birds (e.g, eagles, falcons, owls, gulls, flamingoes), and / or farm birds (e.g., chickens, ducks). Reptile encompasses animals within the class reptilia, and include, but are not limited to, lizards, snakes, turtles, tortoises, crocodiles, and alligators. Alternatively, animals can include companion animals (e.g., dogs, cats, pets), farm animals (e.g., horses, cattle, oxen, pigs, hogs.sheep, goats), beasts of burden, captive animals (e.g., animals living permanently or temporarily in zoos or under other captive environments), or wild animals (e.g., animals that live outside of captivity).
[0051] As used herein, the term ’‘subject” and “patient” are used interchangeably herein and refer to both human and nonhuman animals. The term “nonhuman animals” of the disclosure includes all vertebrates, e.g., mammals and non-mammals, such as a nonhuman primate, a mouse, a rat, a rabbit, a cat, a dog, a guinea pig, a hamster, a horse, a cow, a sheep, a pig, a goat, an elephant, a rhinoceros, an orangutan, a gorilla, a bonobo, a chimpanzee, a monkey, a panda, a tiger, a whale, a dolphin, a sea lion, a narwhal, a beluga, a fox, a wolf, a pronghorn, a kangaroo, a sloth, a koala, a hippopotamus, a bear, or a leopard. In some aspects, the subject can be a rodent, e.g. , a mouse, a rat, a guinea pig, etc. In another aspect, the subject can be a livestock animal. Non -limiting examples of suitable livestock animals can include pigs, cows, horses, goats, sheep, llamas, and alpacas. In still another aspect, the subject can be a companion animal. Non-limiting examples of companion animals can include pets such as dogs, cats, rabbits, and birds. In yet another aspect, the subject can be a zoological animal. As used herein, a “zoological animal” refers to an animal that can be found in a zoo. Such animals can include non-human primates, large cats, wolves, and bears. In some aspects, the subject can be a human. In other aspects, the subject can be a human in need of repairing or regenerating a tissue or organ.
[0052] As used herein, “effective amount,” “effective dose,” or an “amount effective to”, refers to an amount that is effective in providing at least one desirable biological result.
[0053] As used herein “expression” or “expression level” or “level of expression” refers to amount of a particular analyte (e.g., a biomarker, gene, nucleic acid, protein) present in the sample. The amount can be a concentration, number, ratio, proportion, or a percentage of the analyte compared to the control sample or determined using a standard curve. The amount can be an absolute amount or a relative amount.
[0054] As used herein, “pluripotent stem cell” or “PSC” refers to cells that have or retain the capacity to self-renew and can differentiate into all cells within a body. Unless otherwise described, PSCs include, but are not limited to. embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), and epiblast- derived stem cells (EpiSCs). ESCs can include cells obtained from or derived from the inner cell mass (ICM) of an embryo or blastocyst (e.g., preimplantation embryo or preimplantation blastocyst). ESCs include cells that have never undergone differentiation into somatic cells. iPSCs include cells reprogrammed or dedifferentiated from somatic cells into a pluripotent state. EpiSCs include cells isolated from post-implantation epiblasts and can be naive EpiSCs (e.g., EpiSCs that are generally hypomethylated) or primed EpiSCs (e.g., EpiSCs that are hypermethylated). PSCs can express one or more that allow the PSCs to be maintained and expanded indefinitely. Such genes include Oct 3, Oct4, Nanog, Sox2, Pou5fl,Lin28, Glisl, Rexl K / / 2. Klf4, Tert, C-myc, L-myc T)ppa4, Smad2, Smad3, Igf, Fgf, and combinations thereof.
[0055] As used herein, “PSC” and “PSCs” refers to the pluripotent stem cells described above, and contain a normal, wildtype, or non-reduced number of mitochondria within the cell. Although PSCs can be genetically manipulated (e.g., transfected cells, transformed cells, knockout cells, conditional knockout cells, knockin cells, conditional knockin cells, chimeric cells), polyploid (e.g., tetrapioid) pharmacologically modified, fresh, cryopreserved (e.g.. frozen) thawed, stored, or a combination thereof, the number of mitochondria in the PSCs remains unaffected or not substantially decreased. PSCs can be naive PSC, naive-like PSCs, primed PSCs, formative PSCs, or extended PSCs.
[0056] As used herein PSCs can be distinguished from mitochondria-depleted PSCs (e.g., mdPSCs generated by methods described herein), in which mdPSCs have a reduced number of mitochondria as compared to PSCs. In some aspects, mdPSCs can contain about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% fewer in mitochondria as compared to nondepleted PSCs.
[0057] In some aspects, the ESCs and EpiSCs can be obtained from embryos at the 2-cell stage, 4-cell stage, 6-cell stage, 8-cell stage, 10-cell stage, 12-cell stage, the 14-cell stage, the 16-cell stage, the 20-cell stage, the 22-cell stage, the 24-cell stage, the 26-cell stage, the 28-cell stage, the 30-cell stage, the 32-cell stage, the 34-cell stage, the 36-cell stage, the 38-cell stage, the 40-cell stage, the 42-cell stage the 44-cell stage, the 46-cell stage, the 48-cell stage, the 50-cell stage, the 52-cell stage, the 54-cell stage, the 56-cell stage, the 58-cell stage, the 60-cell stage, the 62-cell stage, or the 64-cell stage. In some aspects, ESCs, iPSCs. and / or EpiSCs can be used immediately following harvesting of the cells or the ESCs. iPSCs, and / or EpiSCs can be maintained, expanded, and / or cultured under conventional conditions for one or more passages prior to use in any method described herein.IT. MethodsMitochondria-depleted PSCs
[0058] Disclosed herein is a method for generating mitochondria-dependent pluripotent stem cells, also known as mdPSCs. In some aspects, the method comprises culturing pluripotent stem cells (e.g., PSCs having a normal, wildtype, or unreduced number of mitochondria). In some aspects, depletion of mitochondria can be achieved by various means.
[0059] In some aspects, the method for generating mdPSCs can include culturing PSCs in a culture medium comprising antimycin A and oligomycin A. In some aspects, the culture medium can be any medium suitable for the maintenance and expansion of PSCs. In some aspects, the culture medium can be StemFlex™ medium, Essential 8™ (E8) medium, Essential 8™ Flex medium. StemPro™ medium, StemPro™ MSC serum-free (SF) medium, StemPro™-34 SF medium, StemScale™ PSC suspension medium, CTS™ Knockout™ SR XenoFree medium, MesenPRO RS™ medium, StemPro™ MSC SF XenoFree medium, CTS™ StemFlex™ medium, CTS™ StemScale™ PSC suspension medium, CTS™ Essential 8™ medium, CTS™ Essential 6 medium, TeSR™ PSC culture medium, or StemSpan™ hematopoietic cell medium. In some aspects, the culture medium can include antimycin A and oligomycin A at the same or different concentrations. In some aspects, the antimycin A can be at a concentration between about 0.01 pM and about 5 pM and the oligomycin A can be at a concentration between about 0.01 pM and about 5 pM. In some aspects, the culture medium can include between about 0.01 pM and about 0.1 pM, between about 0.1 pM and about 1 pM, between about 1 pM and about 2.5 pM, or between about 2.5 pM and about 5 pM antimycin A. In some aspects, the culture medium can include about 0.01 pM, about 0.02 pM, about 0.03 pM, about 0.04 pM, about 0.05 pM, about 0.06 pM, about 0.07 pM, about 0.08 pM, about 0.09 pM, about 0.1 pM. about 0.2 pM, about 0.3 pM. about 0.4 pM, about 0.5 pM, about 0.6 pM, about 0.7 pM. about 0.8 pM, about 0.9 pM, about 1 pM, about 1.5 pM, about 2 pM. about 2.5 pM, about 3 pM, about 3.5 pM, about 4 pM, about 4.5 pM, or about 5 pM antimycin A. In some aspects, the culture medium can include between about 0.01 pM and about 0.1 pM, between about 0.1 pM and about 1 pM, between about 1 pM and about 2.5 pM, or between about 2.5 pM and about 5 pM oligomycin A. In some aspects, the culture medium can include about 0.01 pM, about 0.02 pM, about 0.03 pM, about 0.04 pM, about 0.05 pM, about 0.06 pM, about 0.07 pM, about 0.08 pM, about 0.09 pM, about 0.1 pM, about 0.2 pM, about 0.3 pM, about 0.4 pM, about 0.5 pM. about 0.6 pM, about 0.7 pM, about 0.8 pM, about 0.9 pM, about 1 pM, about 1.5 pM, about 2 pM, about 2.5 pM, about 3 pM, about 3.5 pM, about 4 pM, about 4.5 pM, or about 5 pM oligomycin A. In some aspects, the culture medium includes about 1 pM antimycin A and about 1 pM oligomycin A.
[0060] In some aspects, the PSCs cultured in culture medium containing antimycin A and oligomycin A can be obtained from any source, including a mammal, marsupial, monotreme, bird, or reptile. In some aspects, PSCs can be obtained from human PSCs, non-human primate PSCs. rodent PSCs, canine PSCs, feline PSCs, porcine PSCs, bovine PSCs, ovine PSCs. equine PSCs, or combinations thereof. In some aspects, mdPSCs can be generated from iPSCs, ESCs. and / or EpiSCs. In some aspects, PSCs can be naive PSCs, naive-like PSCs, primed PSCs, formative PSCs, or extended PSCs. In some aspects, the PSCs are naive PSCs. In some aspects, the PSCs are naive-like PSC. In some aspects, PSCs can be conventional human ESCs (hESCs) or induced human PSCs (hiPSCs).
[0061] In some aspects, PSCs can be cultured with antimycin A and oligomycin A in a three- dimensional culture device. In some aspects, the three-dimensional culture device of the in vitro system is any suitable three-dimensional culture vessel for generation of peri-gastruloids or other embryo-like structures. In some aspects, three-dimensional culturing methods can include methods using scaffold, and scaffold-free methods. In methods using scaffolds, hydrogels can be used as a scaffold. Scaffold-free methods can include a low adhesion plate, hanging drop plate, micropattemed surface, spheroid, bioreactor, magnetic levitation, chip, and / or microfluidic device. In some aspects, the disclosed three-dimensional culture device can be a microwell plate. In some aspects, the disclosed three-dimensional culture device can be an AggrcWcll™ plate.
[0062] In some aspects, the three-dimensional device of the disclosed in vitro system can be pretreated with an anti-adherence solution. Anti -adherence solution as disclosed herein can be any commercially available anti-adherence solution which can prevent attachment of the cells to the device, for e.g., anti -adherence rinsing solution from stem cell technologies (Catalog No. 07010).
[0063] In some aspects, the three-dimensional culture device can be a plate (e.g., a microwell plate), including, but not limited to, a 2-well plate, a 4-well plate, a 6-well plate, a 12-well plate, a 24-well plate, a 48-well plate, a 96-well plate, a 384-well plate, or a 1536-well plate. The plate can be a flat-bottomed plate, a round-bottom plate, or a V-bottomed plate. In some aspects, the three-dimensional culture device can be coated with a composition that provides a structure, template, or scaffold upon which cells (e.g., PSCs or mdPSCs) can grow, maintain, and / or expand. In some aspects, the three-dimensional culture device can be coated with a reconstituted basement membrane derived from extracts of Engelbreth-Holm-Swarm (EHS) mouse tumor (e.g., Matrigel®). a basement membrane extract (e.g.. Geltrex®). a hydrogel that mimics natural extracellular matrix (e.g., Vitrogel®), collagen, laminin, fibronectin, gelatin, or vitronectin.
[0064] In another aspect is a method for generating mdPSCs comprising modulating one or more proteins in PSCs that reduce, attenuate, block, or otherwise inhibit the number, expression, and / or function of mitochondria in PSCs. In some aspects, the method can include overexpressing one or more proteins or peptides. In some aspects, the method can include overexpressing Parkin (PRKN) in PSCs to generate mdPSCs. In some aspects, PSCs can be treated to induce expression of one or more proteins, such as PRKN. In some aspects. PSCs can be contacted with a nucleic acid sequence encoding PRKN operably linked to a promoter. In some aspects, the method can include overexpressing one or more additional proteins or peptides, including PTEN-induced kinase 1 (PINK1) along with PRKN. In some aspects, PSCs can be contacted with a nucleic acid encoding PINK1 operably linked to a promoter. In some aspects, the nucleic acid sequence encoding PINK1 can further include a nucleic acid sequence encoding a peptide sequence that targets PINK1 to mitochondria, including an outer mitochondrial membrane (e.g. , an N-terminal OMMtransmembrane signal peptide). Tn some aspects, the N-terminal OMM transmembrane signal can be a CDGSH iron-sulfur domain-containing protein 1 (CISDI).
[0065] In some aspects, the promoter driving expression of one or more proteins that reduce, attenuate, block, or otherwise inhibit the number, expression, and / or function of mitochondria in PSCs can be an inducible promoter or a tissuc-spccific promoter. In some aspects, the promoter can drive expression of PRKN and / or PINK1. In some aspects, the promoter can be induced by a pharmacological agent or chemical, temperature, and / or light. In some aspects, the inducible promoter can be induced by any pharmacological agent or chemical including, but not limited to, doxorubicin, tetracycline, sugars (e.g., glucose, galactose), hormones (e.g., estradiol, testosterone, or derivatives thereof), steroids (e.g., dexamethasone), copper ion (e.g. , Cu2+), phosphate, or combinations thereof. In some aspects, temperatureinducible promoters can include promoters derived from heat shock proteins, such as Hsp70 and HSp90. In some aspects, light-inducible promoters can utilize direct light or a fluorescent system to activate gene expression.
[0066] In some aspects, one or more of the proteins overexpressed in the PSCs can be conjugated to a label that can be used to identify the presence of the overexpressed protein. In some aspects, the label can be a fluorescent protein, enzyme, radioactive label, and / or mass tag. In some aspects, the nucleic acid sequence encoding the one or more proteins can further include a nucleic acid sequence encoding the label. In some aspects PRKN can be conjugated to a fluorescent protein, including, but not limited to, green fluorescent protein (GFP), enhanced GFP (EGFP), blue fluorescent protein (BFP), enhanced BFP (EBFP), cyan fluorescent protein (CFP), enhanced CFP (ECFP). red fluorescent protein (RFP), enhanced RFP (ERFP). yellow fluorescent protein (YFP). enhanced YFP (EYFP), an mFruit fluorescent protein (e.g., mCherry, mStrawberry, mTangerine, mOrange, mBanana, mPlum, m Raspberry, or mHoneydew), DsRed, DsRed2, Sapphire, Emerald, Azurite SBFP2, EBFP2, Cerulean, Citrine, Venus, Azami Green, rnKate, and mKate2. In an aspect, PRKN can be labelled with EGFP.
[0067] Tire nucleic acid sequence encoding the one or more proteins can be DNA (e.g., cDNA, genomic DNA, double stranded DNA or single stranded DNA) or RNA (e.g., mRNA, siRNA, rniRNA). In some aspects, the nucleic acid sequence encoding PRKN can be provided in a vector. Hie vector can be a plasmid introduced into the PSC by electroporation, gene gun, impalefection, hydrostatic pressure, lipofection, magnetofection. and the like. In some aspects, nucleic acid sequences encoding two or more proteins to reduce, attenuate, block, or otherwise inhibit the number, expression, and / or function mitochondria can be separately provided to PSCs in two or more vectors. In some aspects, nucleic acid sequences encoding two or more proteins (e.g., PRKN and PINK1) can be provided to PSCs in the same vector (e.g., a single vector). In some aspects, each of the two or more proteins can be operably linked tothe same or different promoters. Tn some aspects, the nucleic acid sequence encoding PRKN can be provided in a viral vector, including a viral vector that targets PSCs. In some aspects, the viral vector can be an adeno-associated virus (AAV), adenovirus, lentivirus, herpes simplex virus (HSV), retrovirus, sendai virus (e.g., murine respirovirus) , and / or poxvirus. In some aspects, the nucleic acid can be provided in an episomal vector. In some aspects, the method can further include providing the nucleic acid sequence directly to cells within an oocyte, fertilized egg. zygote, or embryo. In some aspects, the nucleic acid sequence, or a vector including the nucleic acid sequence, can be provided by microinjecting the nucleic acid sequence of vector thereof directly into the oocyte, fertilized egg, zygote, or embryo.
[0068] In some aspects, transfected PSCs induced to overexpress one or more proteins that reduce, attenuate, block, or otherwise inhibit the number, expression, and / or function of mitochondria can be further treated with antimycin A and / or oligomycin A. In some aspects, PSCs induced to overexpress the one or more proteins (e.g., PRKN) can be treated with both antimycin A and oligomycin A. In some aspects, the culture medium can be Stc FIcx1'1medium, Essential 8™ (E8) medium, Essential 8™ Flex medium, StemPro™ medium, StemPro™ MSC serum-free (SF) medium, StemPro™-34 SF medium, StemScale™ PSC suspension medium, CTS™ Knockout™ SR XenoFree medium, MesenPRO RS™ medium, StemPro™ MSC SF XenoFree medium, CTS™ StemFlex™ medium, CTS™ StemScale™ PSC suspension medium, CTS™ Essential 8™ medium, CTS™ Essential 6 medium, TeSR™ PSC culture medium, mTeSR™ Plus culture medium, or Stem Span1'1hematopoietic cell medium. In some aspects, the culture medium can include antimycin A and oligomycin A at the same or different concentrations. In some aspects, the antimycin A can be at a concentration between about 0.01 pM and about 5 pM and the oligomycin A can be at a concentration between about 0.01 pM and about 5 pM. In some aspects, the culture medium can include between about 0.01 pM and about 0. 1 pM, between about 0. 1 pM and about 1 pM, between about 1 pM and about 2.5 pM, or between about 2.5 pM and about 5 pM antimycin A. In some aspects, the culture medium can include about 0.01 pM. about 0.02 pM. about 0.03 pM. about 0.04 pM. about 0.05 pM, about 0.06 pM, about 0.07 pM, about 0.08 pM, about 0.09 pM, about 0.1 pM, about 0.2 pM. about 0.3 pM, about 0.4 pM, about 0.5 pM, about 0.6 pM, about 0.7 pM, about 0.8 pM, about 0.9 pM, about 1 pM, about 1.5 pM, about 2 pM, about 2.5 pM, about 3 pM, about 3.5 pM, about 4 pM, about 4.5 pM, or about 5 pM antimycin A. In some aspects, the culture medium can include between about 0.01 pM and about 0.1 pM, between about 0.1 pM and about 1 pM, between about 1 pM and about 2.5 pM, or between about 2.5 pM and about 5 pM oligomycin A. In some aspects, the culture medium can include about 0.01 pM, about 0.02 pM. about 0.03 pM. about 0.04 pM. about 0.05 pM. about 0.06 pM. about 0.07 pM. about 0.08 pM, about 0.09 pM, about 0. 1 pM, about 0.2 pM, about 0.3 pM, about 0.4 pM, about 0.5 pM, about 0.6 pM, about 0.7 pM, about 0.8 pM, about 0.9 pM, about 1 pM, about 1.5 pM, about 2 pM, about 2.5 pM, about 3 pM, about3.5 pM, about 4 pM, about 4.5 pM, or about 5 pM oligomycin A. In some aspects, the culture medium includes about 1 pM antimycin A and about 1 pM oligomycin A.
[0069] In some aspects, the PSCs treated to overexpress one or more proteins that reduce, attenuate, block, or otherwise inhibit the number, expression, and / or function mitochondria can be obtained from any source, including a mammal, marsupial, monotreme, bird, or reptile. In some aspects, PSCs can be obtained from human PSCs, non-human primate PSCs, rodent PSCs, canine PSCs, feline PSCs, porcine PSCs, bovine PSCs, ovine PSCs, equine PSCs, or combinations thereof. In some aspects, mdPSCs can be generated from iPSCs, ESCs, and / or EpiSCs. In some aspects, PSCs can be naive PSC, naive-like PSCs, primed PSCs, formative PSCs, or extended PSCs. In some aspects, PSCs can be conventional human ESCs (hESCs) or induced human PSCs (hiPSCs).
[0070] In some aspects, PSCs that overexpress one or more proteins that reduce, attenuate, block, or otherwise inhibit the number, expression, and / or function of mitochondria can be cultured in a three- dimensional culture device. In some aspects, the three-dimensional culture device of the in vitro system is any suitable three-dimensional culture vessel for generation of peri-gastruloids or other embryo-like structures. In some aspects, three-dimensional culturing methods can include methods using scaffold, and scaffold-free methods. In methods using scaffolds, hydrogels can be used as a scaffold. Scaffold-free methods can include low adhesion plate, hanging drop plate, micropattemed surface, spheroid, bioreactor, magnetic levitation, chip, and microfluidic device. In some aspects, the disclosed three-dimensional culture device can be a microwell plate. In some aspects, the disclosed three-dimensional culture device can be an AggreWell™ plate.
[0071] In some aspects, the three-dimensional device of the disclosed in vitro system can be pretreated with an anti-adherence solution. Anti -adherence solution as disclosed herein can be any commercially available anti-adherence solution which can prevent attachment of the cells to the device, for e.g., anti -adherence rinsing solution from stem cell technologies (Catalog No. 07010).
[0072] In some aspects, the three-dimensional culture device can be a plate (e.g., a microwell plate), including, but not limited to, a 2-well plate, a 4-well plate, a 6-well plate, a 12-well plate, a 24-well plate, a 48-well plate, a 96-well plate, a 384-well plate, or a 1536-well plate. The plate can be a flat-bottomed plate, a round-bottom plate, or a V-bottomed plate. In some aspects, the three-dimensional culture device can be coated with a composition that provides a structure, template, or scaffold upon which cells (e.g., PSCs or mdPSCs) can grow, maintain, and / or expand. In some aspects, the three-dimensional culture device can be coated with a reconstituted basement membrane derived from extracts of EHS mouse tumor (e.g., Matrigel®), a basement membrane extract (e.g., Geltrex®), a hydrogel that mimics natural extracellular matrix (e.g., Vitrogel®), collagen, laminin, fibronectin, gelatin, or vitronectin.Composite PSCs
[0073] Further provided herein is a method of generating a composite PSC comprising: culturing a first PSC and a second PSC in a three-dimensional culture device that comprises a first culture medium comprising a ROCK inhibitor; removing the first culture medium and adding a second culture medium that does not comprise the ROCK inhibitor; adding a fusion buffer and maintaining cells in the co-culture; removing the fusion buffer and washing the cells with a wash buffer; and incubating the cells in a third culture medium to obtain composite PSCs.In some aspects, the composite PSCs generated by tire methods described herein can be mitochondria- depleted or have a reduced abundance of mitochondria (e.g., mdPSCs).
[0074] In some aspects, the first, second, and third culture media can be the same or different. In some aspects the first, second, and third culture medium can be the culture medium can be independently selected from StemFlex™ medium, Essential 8™ (E8) medium, Essential 8™ Flex medium, StemPro™ medium, StemPro™ MSC serum-free (SF) medium, StemPro ™-34 SF free medium, StemScale™ PSC suspension medium, CTS™ Knockout™ SR XenoFree medium, MesenPRO RS™ medium, StemPro™ MSC SF XenoFree medium, CTS™ StcmFlcxImedium, CTS™ StemScale™ PSC suspension medium, CTS™ Essential 8™ medium, CTS™1Essential 6 medium. TeSR™1PSC culture medium, mTeSR™1Plus culture medium, or StemSpan™ hematopoietic cell medium.
[0075] In some aspects, the first PSCs and second PSCs can be maintained and / or cultured in the first culture medium for at least about 1 day or at least 1 day. In various aspects, the first and second PSCs can be maintained and / or cultured for about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, or longer than about 10 days. In various aspects, the first PSCs and second PSCs can be maintained and / or cultured in the first culture medium for 1 day, 2 days, 3 days, 4 days, 5 days. 6 days, 7 days, 8 days, 9 days, 10 days, or more than 10 days. In some aspects, the first culture medium can be replaced daily.
[0076] In one aspect, the first culture medium can comprise rho-associated protein kinase (ROCK) inhibitor. In some aspects, the ROCK inhibitor can be selected from AT- 13148, BA-210, P-elemene, belumosudil, chroman 1, DJ4, fasudil, hydroxyfasudil, GSK-579371 , GSK429286A, H-1152, ibuprofen, netarsudil, RKI-1447, ripasudil, TCS-7001, thiazovivin, verosudil, Y-27632, Y-30141, Y-33075, and / or Y-39983. In some aspects, the ROCK inhibitor can be present in the first culture medium at a concentration of between about 0.1 pM and about 100 pM, between about 0.5 pM and about 50 pM, or between about 1 pM and about 15 pM. In some aspects, the first culture medium can include about 0.1 pM, about 0.5 pM, about 1 pM. about 2 pM, about 3 pM, about 4 pM, about 5 pM, about 6 pM, about 7 pM, about 8 pM, about 9 pM, about 10 pM. about 11 pM, about 12 pM, about 13 pM, about 14 pM, about 15 pM, about 16 pM. about 17 pM. about 18 pM. about 19 pM, or about 20 pM of the ROCK inhibitor, such as Y -27632.
[0077] In some aspects, the first culture medium can be removed and a second culture medium that does not contain a ROCK inhibitor can be provided. In some aspects, the first and second PSCs can be maintained and / or cultured in the second culture medium for about 0.5 days, about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, or longer than about 10 days. In some aspects, the first and second PSCs can be maintained and / or cultured in the second culture medium for 0.5 days, 1 day. 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, or longer than 10 days. In some aspects, the second culture medium can be replaced daily. In some aspects, a fusion buffer can be added to the second culture medium. In some aspects, the fusion buffer can comprise polyethylene glycol 1500 (PEG 1500), dimethyl sulfoxide (DMSO), and media (e.g., DMEM / Hams F-12 in a 1:1 ratio). In some aspects, the fusion buffer can contain phosphate buffered solution, optionally modified as necessary depending upon the cells to be fused, and can further include cytochalasin D, calcium (Ca2+), or the like. The pH of the fusion buffer can be adjusted by titrating in an acid (e g., HC1, H2SO4, HNOs, H3PO4, H2CO3) to lower pH or a base (e g.. NaOH. KOH, or Na2COs). In some aspects, the first and second PSCs can be maintained in the second culture medium with a fusion buffer addition for about 10 seconds to about 10 minutes, about 30 seconds to about 5 minutes, or about 1 minute to about 2 minutes. In some aspects, the first and second PSCs can be washed with a wash buffer prior to being maintained in culture medium with fusion buffer. In some aspects, the first PSCs and second PSCs can be maintained in the second culture medium with a fusion buffer addition for about 10 seconds, about 20 seconds, about 30 seconds, about 40 seconds, about 50 seconds, about 60 seconds, about 1 minute, about 1.25 minutes, about 1.5 minutes, about 1.75 minutes, about 2 minutes, about 2.5 minutes, about 3 minutes, about 3.5 minutes, about 4 minutes, about 4.5 minutes, about 5 minutes, about 6 minutes, about 7 minutes, about 8 minutes about 9 minutes, or about 10 minutes. In some aspects, incubation of the first PSCs and second PSCs in the fusion buffer can fuse the two PSCs to generate a composite PSC that contains the genetic material from both the first PSCs and second PSCs.
[0078] In some aspects, the second culture medium with the fusion buffer addition can be removed and the cells (e.g.. composite PSCs) can be washed with a wash buffer. In some aspects, the wash buffercan be a phosphate buffered saline solution (PBS), that can further include a surfactant (e g., polysorbate 20 or Tween®20).
[0079] In some aspects, fused PSCs can be incubated, cultured, or maintained in a third culture Y- 27632 medium. In some aspects, the third culture medium can include chroman, emricasan, trans-ISRIB, and / or a polyaminc supplement (CEPT). In some aspects, the third culture medium can contain about 1 nM to about 10 pM chroman, about 0.1 pM to about 10 pM emricasan, about 0.01 pM to about 10 pM trans- ISRIB, and / or about a 1 : 10,000 to about 1 : 100 dilution of polyamine supplement. In some aspects, the third culture medium can contain about 1 nM to about 10 pM of a ROCK inhibitor (e.g., Y- 27632) instead of CEPT. The cells can be incubated in the third culture medium comprising CEPT for about 1 minute to about 2 hours. In some aspects, the cells can be incubated and / or maintained in the third culture medium comprising CEPT for about 1 minute, about 5 minutes, about 10 minutes, about 15 minutes, about 30 minutes, about 45 minutes, about 1 hour, about 1.25 hours, about 1.5 hours, about 1.75 hours, about 2 hours, about 2.5 hours, or about 3 hours. In some aspects, the cells can be incubated or maintained in the third culture medium (optionally with CEPT) in an incubator at a temperature of about 30 °C to about 40 °C. In some aspects, the cells can be incubated or maintained in the third culture medium (optionally with CEPT) at a temperature of about 30 °C, about 31 °C, about 32 °C, about 33 °C, about 34 °C, about 35 °C, about 36 °C, about 37 °C, about 38 °C, about 39 °C, or about 40 °C.
[0080] In a specific aspect, the method of generating composite PSCs comprises; (a) culturing a first PSC and a second PSC in a three-dimensional culture device that comprises a first culture medium comprising a ROCK inhibitor for about 1 to about 7 days; (b) removing the first culture medium and adding a second culture medium that does not comprise the ROCK inhibitor; (c) adding a fusion buffer and maintaining cells in the co-culture for about 30 seconds to about 5 minutes; (d) removing the fusion buffer and washing the cells with a wash buffer; and (e) incubating the cells in a third culture medium comprising chroman, emricasan, trans-ISRIB, and polyamine supplement (CEPT) for about 1 minute to about 2 hours to obtain composite PSCs.
[0081] In some aspects the first PSCs and second PSCs can be independently selected from any source, including a mammal, marsupial, monotreme, bird, or reptile. In some aspects, the first PSC can be obtained from human PSCs, non-human primate PSCs, rodent PSCs, porcine PSCs. canine PSCs, feline PSCs, bovine PSCs, ovine PSCs. equine PSCs. or combinations thereof and the second PSC can be obtained from human PSCs, non-human primate PSCs, rodent PSCs, canine PSCs, feline PSCs, porcine PSCs, bovine PSCs, ovine PSCs, equine PSCs, or combinations thereof. In some aspects, the first PSCs and second PSCs can be from different genus and / or species. In some aspects, one or both of the first PSCs and second PSCs can be treated with a pharmacological agent and / or genetically manipulated prior fusion. In one aspect, thefirst PSC can be a human PSC and the second PSC can be a non-human primate PSC (also known as a nonhuman hominoid (NHH) PSC). In some aspects, the first PSC can be a human PSC and the second PSC can be a bonobo PSC, chimpanzee PSC, gorilla PSC, and / or orangutan PSC. In some aspects, composite PSCs can be generated from iPSCs, ESCs, and / or EpiSCs. In some aspects, PSCs can be naive PSCs, naive-like PSCs, primed PSCs. formative PSCs, or extended PSCs. In some aspects, PSCs can be conventional human ESCs (hESCs) or induced human PSCs (hiPSCs). In some aspects, the first and second PSCs can be cultured at equal numbers of cells (e.g. , the same number of cells), about equal numbers of cells, or different numbers of cells. In some aspects, the first PSCs and second PSCs can be independently present in the first culture medium at a number of about IxlO2cells to about IxlO10cells, about IxlO3cells to about 5xl07cells, about IxlO4cells to about 5xl06cells, or about IxlO5cells to about 5xl06cells. In some aspects, the first PSCs and second PSCs can be independently present within the first culture medium at a number of about IxlO2cells, about 5xl02cells, about IxlO3cells, about 5xl03cells, about IxlO4cells, about 5xl04cells, about IxlO5cells, about 5xl05cells, about IxlO6cells, about 5xl06cells, about IxlO7cells, about 5xl07cells, about IxlO8cells, about 5xl08cells, about IxlO9cells, about 5xl09cells, or about IxlO10cells.
[0082] In some aspects, the first PSC, second PSC, or both PSCs can be a mitochondria-depleted PSC (mdPSC). In such aspects, the described method can further comprise a step of depleting mitochondria from the first PSC, second PSC or both PSCs prior to cell fusion. In some aspects, mitochondria depletion can occur prior to or after the first PSC and second PSC are co-cultured.
[0083] In some aspects, the first PSCs or second PSCs, or both, can be contacted with antimycin A and oligomycin A to deplete mitochondria. In some aspects, mitochondria can be depleted from the first PSC, second PSC. or both by culture the cells in a culture medium that includes antimycin A and oligomycin A at the same or different concentrations. In some aspects, the antimycin A can be at a concentration between about 0.01 pM and about 5 pM and the oligomycin A can be at a concentration between about 0.01 pM and about 5 pM. In some aspects, the culture medium can include between about 0.01 pM and about 0.1 pM, between about 0.1 pM and about 1 pM. between about 1 pM and about 2.5 pM, or between about 2.5 pM and about 5 pM antimycin A. In some aspects, the culture medium can include about 0.01 pM. about 0.02 pM. about 0.03 pM. about 0.04 pM. about 0.05 pM. about 0.06 pM. about 0.07 pM, about 0.08 pM, about 0.09 pM, about 0.1 pM, about 0.2 pM, about 0.3 pM, about 0.4 pM, about 0.5 pM, about 0.6 pM, about 0.7 pM, about 0.8 pM, about 0.9 pM, about 1 pM, about 1.5 pM, about 2 pM, about 2.5 pM, about 3 pM, about 3.5 pM, about 4 pM, about 4.5 pM, or about 5 pM antimycin A. In some aspects, the culture medium can include between about 0.01 pM and about 0.1 pM, between about 0.1 pM and about 1 pM, between about 1 pM and about 2.5 pM, or between about 2.5 pM and about 5 pM oligomycin A. In some aspects, the culture medium can include about 0.01 pM, about 0.02 pM, about 0.03 pM, about 0.04pM, about 0.05 pM, about 0.06 pM, about 0.07 pM, about 0.08 pM, about 0.09 pM, about 0.1 pM, about 0.2 pM, about 0.3 pM, about 0.4 pM, about 0.5 pM, about 0.6 pM, about 0.7 pM, about 0.8 pM, about 0.9 pM, about 1 pM, about 1.5 pM, about 2 pM, about 2.5 pM, about 3 pM. about 3.5 pM, about 4 pM, about 4.5 pM. or about 5 pM oligomycin A. In some aspects, the culture medium includes about 1 pM antimycin A and about 1 pM oligomycin A.
[0084] In some aspects, a vector can be provided to the first PSC, second PSC, or both, wherein the vector includes a nucleotide sequence encoding PRKN operably linked to a promoter such that PRKN is overexpressed in the PSC that receives the vector. The vector can be a plasmid that can be introduced into the first PSCs and / or the second PSCs by electroporation, gene gun, impalefection, hydrostatic pressure, lipofection, magnetofection, and the like. In some aspects, the vector can be a viral vector, including a viral vector that targets PSCs in general or PSCs of a particular genus and / or species. In some aspects, the viral vector can be adeno-associated virus (AAV), adenovirus, lentivirus, herpes simplex virus (HSV), retrovirus, sendai virus (e.g., murine re spiro virus), and / or poxvirus. In some aspects, the nucleic acid can be provided in an episomal vector.
[0085] In some aspects, the first PSC, second PSC, or both PSCs receiving a vector encoding PRKN can also receive a vector including a nucleotide sequence encoding PINK1 operably linked to a promoter. In some aspects, PRKN and PINK1 can be operably linked to the same promoter operably linked to different promoters. In some aspects, PINK1 can also include an N-terminal OMM signal peptide. In some aspects, the N-terminal OMM signal peptide can include CISD 1. In some aspects, the nucleotide sequence encoding PINK1 can be provided to the PSCs in the same vector that encodes PRKN protein or PINK1 can be provided in a different vector. When PINK1 is encoded within the same vector as PRKN, PINK1 can be operably linked to the same promoter as PRKN or a different promoter. In some aspects, PSCs exposed to a vector encoding PRKN, and optionally PINK1, can be further treated with antimycin A and / or oligomycin A.
[0086] In some aspects, mdPSCs and composite PSCs described herein can be used for studying imprinting, reprogramming, rejuvenation, and / or other biochemical, metabolic, and physiological phenomena associated with embryogenesis and development. In some aspects, the mdPSCs, composite PSCs, and methods for preparing mdPSCs and composite PSCs described herein can be used to generate and isolate cells, for example, for therapeutic transplant. In some aspects, the disclosed mdPSCs and / or composite PSCs can be used for cell replacement therapy. In some aspects, the mdPSCs and composite PSCs can be administered to a subject for a therapeutic application. In some aspects, the therapeutic applications can include, but are not limited to, transplantation, cancer, autoimmune diseases of all kinds, proliferative disorders, inflammatory disorders, neurological disorders, age-related disorders, allergicdisorders, immune disorders, viral infections, bum, trauma, other conditions involving tissue injury, and other conditions wherein replacement cells are desirable. Non-limiting examples of conditions include lupus, diabetes, myasthenia gravis, rheumatoid arthritis, ALS, Parkinson's disease, Alzheimer's disease, Huntington's disease, paralysis, multiple sclerosis, thyroiditis, AIDS, psoriasis, psoriatic arthritis, pancreatitis, hematologic malignancies, non-specific cell damage associated with radiotherapy or chemotherapy, cardiac injuries, e.g.. associated with heart attack, Sjogren's syndrome, and many others.
[0087] In some aspects, mdPSCs and composite PSCs described herein can be administered by any known methods. In some aspects, the cells can be administered parietally, e.g., via intravenous injection. The cells can be in solution, for example a buffered saline solution. The number of cells administered will be an amount effective to treat the particular condition. In some aspects, the mdPSCs or composite PSCs can express a label (e.g., green fluorescent protein (GFP)) to allow for the detection of the location of engrafted cells and / or the number of cells which have become stably engrafted in the subject. In some aspects, the method can further include repeatedly administering the mdPSCs or composite PSCs for diseases, disorders, and / or conditions requiring multiple treatments or for chronic diseases, disorders, and / or conditions.
[0088] In some aspects, the mdPSCs or the composite PSC described herein can be used for determining a drug toxicity. In some aspects is an in vitro drug or chemical screening system comprising the mdPSCs or the composite PSCs, for example to assess how mitochondrial genetic variants affect the response to drugs. In some aspects, methods and / or in vitro culture systems comprising mdPSCs or composite PSCs as described herein can be used as a control and comparator to determine whether a candidate molecule (e.g., a compound, or a drug) is capable of altering the abundance of mitochondria in the tested PSCs. For example, the candidate molecule can be added into the in vitro culture system as described herein. After being cultured under suitable conditions for a suitable period, the abundance of mitochondria in the culture system can be compared with a control culture system that does not contain the candidate molecule. If the mdPSCs, the composite PSCs, or model thereof is altered in the presence of the candidate molecule as compared to that in tire absence of the candidate molecule, it indicates that the candidate molecule can affect abundance of mitochondria.
[0089] Further disclosed herein is a high throughput platform comprising the mdPSCs or composite PSCs described above. In some aspects, disclosed is a method of high-throughput genetic or chemical screening, comprising testing genetic mutations within the mdPSCs or composite PSCs or exposing the mdPSCs or composite PSCs to chemicals that can cause pregnancy loss or congenital defects using the in vitro drug or chemical screening system. Tire mdPSCs and composite PSCs (including PSCs used to generate the mdPSCs or composite PSCs) generated by the methods described herein can be geneticallyaltered by any known means. Genetically modified cells and tissues can be obtained by performing nuclear transfer with a genetically modified nuclear PSCs to produce nuclear transfer embryo made up of genetically modified cells.
[0090] In further aspects, methods and / or in vitro culture systems described herein can be used to study the behavior of stem cells (e.g., the discovery of novel biological pathways or processes involved in pluripotency of stem cells).Polynucleotides to deplete mitochondria
[0091] Further disclosed herein is a polynucleotide that contains a nucleotide sequence encoding PRKN operably linked to a promoter. In some aspects, the polynucleotide can further contain a nucleotide sequence that encodes PINK1, also operably linked to a promoter. In some aspects, the nucleotide sequence encoding PRKN and nucleotide sequence encoding PINK1 can be operably linked to the same promoter or to different promoters. In some aspects, the PINK1 can further include an N-terminal OMM signal peptide. In some aspects, the OMM signal peptide can be a CISDI protein. In some aspects, the promoter can be an inducible promoter or a tissue-specific promoter. In some aspects, the promoter can be induced by a pharmacological agent or chemical, temperature, and / or light. In some aspects, the inducible promoter can be induced by any pharmacological agent or chemical including, but not limited to, doxorubicin, tetracycline, sugars (e.g. , glucose, galactose), hormones (e.g. , estradiol, testosterone, or derivatives thereof), steroids (e.g., dexamethasone), copper ion (e.g., Cu2+), phosphate, or combinations thereof. In some aspects, temperature-inducible promoters can include promoters derived from heat shock proteins, such as Hsp70 and HSp90. In some aspects, light-inducible promoters can utilize direct light of a fluorescent system to activate gene expression. In some aspects, the inducible promoter can be a tissue-specific promoter and can be induced by one or more markers of PSCs. In some aspects, the markers include Oct3. Oct4, Nanog, Pou5fl, Sox2. Lin28, Glisl. Rexl, Klf2, Klf4, Tert, C-myc, L-myc Dppa4. Smad2, Smad3, Igf, Fgf. and combinations thereof
[0092] In some aspects, the polynucleotide sequence can further encode a label, including a fluorescent protein, enzyme, radioactive label, and / or mass tag. In some aspects, the polynucleotide sequence can encode a label that can be directly conjugated to the one or more proteins that reduce, attenuate, block, or otherwise inhibit the number, expression, and / or function of mitochondria.
[0093] In some aspects, the polynucleotide can be in the form of a plasmid or viral vector. The plasmid or viral vector can include the gene of interest (e.g., one or more proteins that reduce, attenuate, block, or otherw ise inhibit the number, expression, and / or function of mitochondria) operably linked to the promoter. In some aspects, the polynucleotide can further include one or more selection sequences (e.g.. antibioticresistance genes) and / or transcription regulatory? elements (e.g., transcription factors, enhancers, and silencers).Embrvo generation
[0094] Further provided herein is a method for generating an embryo having a reduced abundance of mitochondria. In some aspects, the method can include generating a fused tetrapioid embryo by providing a polynucleotide described above to the fused tetrapioid cmbiyo to deplete mitochondria within the tetrapioid embryo. In some aspects, the tetrapioid embryo can be generated by electro cell fusion of a 2-cell embryo. In some aspects, the polynucleotide can be provided directly to the tetrapioid embryo via microinjection to the embryo, or providing the polynucleotide on or within a targeting agent that directs the polynucleotide to the embry o. In some aspects, the polynucleotide can be provided directly to a zygote, including a diploid zygote, optionally via microinjection to the zygote or providing the polynucleotide within a targeting agent that directs the polynucleotide to the embryo. In some aspects, the zygote can be cultured or maintained in conditions and for a time sufficient to develop into an embryo.
[0095] In some aspects, the zygote or embryo can be a non-human primate zygote or embryo, rodent zygote or embryo, canine zygote or embryo, feline zygote or embryo, porcine zygote or embryo, bovine zygote or embry o, ovine zygote or embryo, or equine zygote or embryo. In some aspects, the embryo (including an embryo derived from the zygote described above) can be implanted into a uterus or oviduct of a surrogate animal or an artificial surrogate structure (e.g., ex vivo tissue such as an isolated uterus or oviduct or uterus or oviduct removed from an animal) or human-constructed structure that is suitable to maintain and grow the modified embry o to term or for a designated period of time and does not naturally occur or is otherwise manipulated from its natural form. The implanted embry o can be gestated within the surrogate animal or artificial structure for a period of time until birth or until the modified embryo is capable of surviving on its own (e.g., outside or away from the surrogate animal). In some aspects, the embryo can gestate and be bom naturally? (e.g., by vaginal birth or hatching from one or more eggs) or surgically removed (e.g., by Caesarian section or C-section).
[0096] In some aspects, embryos described herein can be used for studying imprinting, reprogramming, rejuvenation, and other biochemical, metabolic, and physiological phenomena associated yvith embryogenesis and development. In some aspects, the embry os and methods for preparing embryos described herein can be used to generate and isolate cells, for example, for therapeutic transplant. In some aspects, the disclosed embryos can be used for cell replacement therapy. In some aspects, the embryos can be administered to a subject for a therapeutic application. In some aspects, the therapeutic applications include, but are not limited to, transplantation, cancer, autoimmune diseases of all kinds, proliferative disorders, inflammatory disorders, neurological disorders, age-related disorders, allergic disorders, immunedisorders, viral infections, bum, trauma, other conditions involving tissue injury, and other conditions wherein replacement cells are desirable. Non-limiting examples of conditions include lupus, diabetes, myasthenia gravis, rheumatoid arthritis, ALS, Parkinson's disease, Alzheimer's disease, Huntington's disease, paralysis, multiple sclerosis, thyroiditis, AIDS, psoriasis, psoriatic arthritis, pancreatitis, hematologic malignancies, non-specific cell damage associated with radiotherapy or chemotherapy, cardiac injuries, e.g., associated with heart attack. Sjogren's syndrome, and many others.
[0097] In some aspects, the embryos described herein can be used for determining a drug toxicity. In some aspects is an in vitro drug or chemical screening system comprising the embryos, for example to assess how mitochondrial genetic variants affect the embryo’s response to drugs. In some aspects, methods and / or in vitro culture systems comprising embryos as described herein can be used as a control and comparator to determine whether a candidate molecule (e.g. , a compound, or a drug) is capable of altering the abundance of mitochondria in the tested embryos. For example, the candidate molecule can be added into the in vitro culture system as described herein. After being cultured under suitable conditions for a suitable period, the abundance of mitochondria in the culture system can be compared with a control culture system that does not contain the candidate molecule. If the embryos in the presence of the candidate molecule are altered as compared to embry os not treated yvith the candidate molecule, it indicates that the candidate molecule can affect abundance of mitochondria within the embryo.
[0098] Further disclosed herein is a high throughput platform comprising the embryos described above. In some aspects, disclosed is a method of high-throughput genetic or chemical screening, comprising testing genetic mutations yvithin the embryos or exposing the mitochondria-depleted embryos to chemicals that can cause pregnancy loss or congenital defects using the in vitro drug or chemical screening system. The embryos (including embryonic cells used to generate the embryos) generated by the methods described herein can be genetically altered by any knoyvn means. Genetically modified cells and tissues can be obtained by performing nuclear transfer with a genetically modified mitochondria-depleted embryos to produce nuclear transfer embryo made up of genetically modified cells.
[0099] Animals prepared by the method described above are also contemplated. Animals can be derived from tire tetrapioid embryo with depleted mitochondria and can be in vivo models of one or more diseases. In some aspects, the animal can be a mouse, rat, rabbit, dog. cat. monkey, or any animal suitable for a disease model. Animals generated by the method described herein can further include at least one gene that has been modified (e.g., transfected cells, transformed cells, knockout cells, conditional knockout cells, knockin cells, conditional knockin cells, chimeric cells) and / or are modifiable by a particular treatment or intervention. Animals generated by the method described herein can include genes with expression profiles that can be enhanced or reduced. The animals can be viable and fertile.
[0100] In some aspects, an implanted non-human embryo or tissue therefrom can be harvested at a time prior to birth or viability, such as, for example, for additional experimentation. Irrespective of how the implanted embryo gestates and is bom, the resulting animal can be fully derived from fused, mitochondria- depleted, tetrapioid embryo. In further aspects, embryo models can be used for studying effects of mutations in embryogenesis and development.III. In vitro system
[0101] In some aspects, an in vitro system can contain the mdPSCs, the composite PSCs, or the mitochondria-depleted embryos and a three-dimensional culture device. In some aspects, the in vitro drug or chemical screening system containing disclosed mdPSCs. composite PSCs. and / or the mitochondria- depleted embryos are further provided. Such in vitro drug or chemical screening system can be used in a method of high-throughput genetic or chemical screening, comprising testing genetic mutations or chemicals that can cause pregnancy loss or congenital defects.
[0102] In some aspects of the in vitro system, mdPSCs, composite PSCs, and / or mitochondria- depleted embryos can be mammalian in origin. In some aspects, the mdPSCs, composite PSCs, and / or mitochondria-depleted embryos can be from a human, a mouse, a rat, a rabbit, a cat, a dog, a guinea pig, a hamster, a horse, a cow, a sheep, a pig, a goat, an elephant, a rhinoceros, an orangutan, a gorilla, a bonobo, a chimpanzee, a monkey, a panda, a tiger, a whale, a dolphin, a sea lion, a narwhal, a beluga, a fox, a wolf, a pronghorn, a kangaroo, a sloth, a koala, a hippopotamus, a bear, or a leopard. In some aspects, mdPSCs or composite PSC in the in vitro system can be naive PSCs, naive-like PSCs, primed PSCs, formative PSCs, or extended PSCs. In some aspects, PSCs can be conventional human ESCs or induced human PSCs.
[0103] In some aspects, the three-dimensional culture device of the in vitro system can be any suitable three-dimensional culture vessel for generation of peri-gastruloids or the embryo-like structures. In some aspects, three-dimensional culturing methods can include methods using a scaffold, and scaffold-free methods. In methods using scaffolds, hydrogels can be used as a scaffold. Scaffold-free methods can include low adhesion plate, hanging drop plate, micropattemed surface, spheroid, bioreactor, magnetic levitation, chip, and microfluidic device. In some aspects, the disclosed three-dimensional culture device can be a microwell plate. In some aspects, the disclosed three-dimensional culture device can be an AggreWell™ plate.
[0104] In some aspects, the three-dimensional device of the disclosed in vitro system can be pretreated with an anti-adherence solution. Anti -adherence solution as disclosed herein can be any commercially available anti-adherence solution which can prevent attachment of the cells to the device, for e.g., anti-adherence rinsing solution from stem cell technologies (Catalog No. 07010).
[0105] In some aspects, the three-dimensional culture device can be a plate (e.g., a microwell plate), including, but not limited to, a 2-well plate, a 4-well plate, a 6-well plate, a 12-well plate, a 24-well plate, a 48-well plate, a 96-well plate, a 384-well plate, or a 1536-well plate. The plate can be a flat-bottomed plate, a round-bottom plate, or a V-bottomed plate. In some aspects, the three-dimensional culture device can be coated with a composition that provides a structure, template, or scaffold upon which cells (e.g., PSCs or mdPSCs) can grow, maintain, and / or expand. In some aspects, the three-dimensional culture device can be coated with a reconstituted basement membrane derived from extracts of EHS mouse tumor (e.g., Matrigel®), a basement membrane extract (e.g., Geltrex®), a hydrogel that mimics natural extracellular matrix (e.g., Vitrogcl®), collagen, laminin, fibronectin, gelatin, or vitronectin.V. Kits
[0106] The present disclosure provides kits containing mdPSCs, the composite PSCs, and / or mitochondria-depleted embryos described herein. Such kits can include one or more containers comprising one or more of culture medium and optionally, a population of PSCs. The disclosed kits can comprise instructions for use in accordance with any of the methods described herein.
[0107] In some aspects, components of the kit can be provided in one or more liquid solutions. In some aspects, the liquid solution can be an aqueous solution or a sterile aqueous solution being particularly preferred. In some aspects, the components of the kit can be provided as dried powder(s). When reagents or components are provided as a dry powder, the powder can be reconstituted by the addition of a suitable solvent. In some aspects, reconstitution solvents can be provided in another container.
[0108] In some aspects, containers can provide components in unit doses, bulk packages (e , singledose or multi-dose packages), or subunit doses. Instructions supplied in the kits of the disclosure can be written instructions on a label or package insert (e.g., a paper sheet included in the kit), and / or provided as machine-readable instructions (e.g., instructions carried on a magnetic or optical storage disk).
[0109] In some aspects, kits can be in suitable packaging. Suitable packaging includes, but is not limited to. vials, bottles, jars, flexible packaging (e.g.. sealed Mylar or plastic bags), and the like. A kit can have a sterile access port (e.g., the container can be a vial having a stopper pierceable by a hypodermic injection needle).
[0110] Kits can optionally provide additional components such as buffers and interpretive infonnation. In some aspects, the kit can include a container and a label and / or package insert(s) on or associated with the container. In some aspects, the disclosure also provides articles of manufacture comprising contents of the kits described above.
[0111] Having described several aspects, it will be recognized by those skilled in the art that various modifications, alternative constructions, and equivalents can be used without departing from the spirit of the present disclosure. Additionally, a number of well-known processes and elements have not been described in order to avoid unnecessarily obscuring the present disclosure. Accordingly, this description should not be taken as limiting tire scope of the present disclosure.
[0112] Those skilled in the art will appreciate that the presently disclosed aspects taught by way of example and not by limitation. Therefore, the matter contained in this description or shown in the accompanying drawings should be interpreted as illustrative and not in a limiting sense. The following claims are intended to cover all generic and specific features described herein, as well as all statements of the scope of the method and assemblies, which, as a matter of language, might be said to fall there between.EXAMPLES
[0113] The following examples are included to demonstrate aspects of the disclosure. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventor to function well in the practice of the present disclosure, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific aspects which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the present disclosure.Materials and MethodsTable 1: Reagent and resources used in the examplesREAGENT or RESOURCE SOURCE IDENTIFIERAntibodiesMouse anti-Oct3 / 4 Santa Cruz Biotechnology sc-5279Mouse anti-SOX2 Santa Cruz Biotechnology sc-365823Mouse anti-COXIV Cell Signaling Technology 11967SGoat anti-NANOG R&D Systems AF1997Goat anti-Mouse 647 Thermo Scientific A-21240Donkey anti-Rabbit 647 Thermo Scientific A-31573Goat anti-Mouse 555 Thermo Scientific A-21127Donkev anti-Goat 555 Thermo Scientific A-21432Chemicals, peptides, and recombinant proteinDMEM / F12 Gibco 11320-0332-Mercaptoethanol Gibco 21985023Neurobasal Thermo Scientific 21103049N2 supplement (100X) Gibco 17502-048DMEM / F12 Coming 10-092-CMRecombinant Human LIF Peprotech 300-05CHIR-99021 Selleckchem S1263Recombinant Human FGF-basic Peprotech 100-18BRecombinant Activin A Peprotech 120-14ECEPT Cocktail Kit Tocns 7991(S)- (+)-Dimethindene maleate Tocris 1425Minocvciine. Hydrochloride Santa Cruz Biotechnology sc -203339XAV939 MedChem Express ' HY-15147Y -27632 Selleckchem SI 049Mirdametinib (PD0325901) Selleckchem S1036GlutaMAX (100X) Gibco 35050-061MEM Non-Essential Amino Gibco 11 140-050Acids (100X) Sodium pyruvate Sigma-Aldrich S8636-100MLProgesterone Sigma- Aldrich P0130-25GN-acetvl-L-cysteine Sigma-Aldrich A7250-10G mTeSR™ Plus STEMCELL Technologies 100-1130Fetal Bovine Serum (Heat Fisher Scientific SH3007001HIInactivated) Knockout Serum Replacement Thermo Scientific 10828-028Matrigel Coming 354277D-glucose Gibco A2494001Dulbecco’s phosphate buffered Coming 20-030-CV saline Tryple™ Express Thermo Scientific 12605036PEG-1500 Sigma-Aldrich P5402-500GAntimycin A Sigma-Aldrich A8674-25MGOligomycin A Sigma-Aldrich 75351-5MGL-ascorbic acid 2-phosphate Sigma Aldrich A8960-5GInsulin ProSpec CYT-270Holo-Transferrin Sigma-Aldrich T0665-50MGSodium Selenite Sigma- Aldrich S5261-25GFGF2-G3 Defined Bioscience LSR-101TGF-B-3 Irvine Scientific 800-07- 100UGDoxycycline hyclate Sigma-Aldrich P7255Blasticidin S HC1 Goldbio B-800-100Hygromycin B Fisher Scientific 10-687-010Puromycin InvivoGen Ant-pr-1B27 supplement (50X) Gibco 17504-044Critical commercial assaysClick-iT™ EdU Cell Thermo Scientific C10340Proliferation Kit for Imaging,Alexa Fluor™ 647 dveDeposited dataAll deposited data is listed in the N / A N / AResource Availability sectionExperimental models: Cell linesHuman: H9 ES cells WiCell WA09Human: MELAS induced Laboratory of Shoukhrat N / A pluripotent stem cells (iPSCs) MitalipovChimpanzee: iPSCs Laboratory of Fred Gage Cellosaurus: PR00818-iPSBonobo: iPSCs Laboratory of Fred Gage PR01086-iPSGorilla: iPSCs Laboratory of Fred Gage PR00075Orangutan: iPSCs Laboratory of David Haussler 11045-4593, Josephine and Sofie SalamaMouse: ES cells This study N / AMouse: Epiblast stem cells This study N / AHuman: SCVI274 iPSCs Laboratory of Michael Buszczak N / AOligonucleotidesAll primers used in this study N / A N / A are listed in Table S3Recombinant DNAPlasmid: Mito-EGFP, PuroR- This study N / A mCherry-PRKNEpisome: Mito-EGFP, PuroR- This study N / A mCherry-PRKNPlasmid: rtTA-PuroR, Mito- This study N / AEGFP-OMM-PINK 1 -PRKNPlasmid: rtTA-HvgR-Mito- This study N / AEGFP, OMM-PINKl-PuroR-PRKNOtherCell culture multiwell plate, 96 Greiner Bio-One 655101 wellCell culture multiwell plate, 12 Greiner Bio-One 665165 wellCell culture multiwell plate, 24 Greiner Bio-One 662102 wellCell culture multiwell plate, 6 Greiner Bio-One 657160 wellGeneration and culture of mitochondria-depleted PSCs
[0114] Mitochondria-depletion in PRKN-hESCs and PRKN-MELAS iPSCs was carried out by culturing cells on Matrigel (Coming) coated plates in mTeSR™ Plus (StemCell Technologies) medium supplemented with 1 pM antimycin A and 1 pM oligomycin A (Sigma-Aldrich). A / O stock solutions were prepared at 1 mM in ethanol, aliquoted, and stored at -20 °C. Mitochondria-depleted mESCs and mEpiSCs were generated using the same method, except cultured in 2iL and AFX medium, respectively. Medium containing A / O was refreshed every 24 hours, for a total treatment duration of 48 hours (72 hours for mESCs), at which point cells were washed three times with complete medium and then left in fresh medium without A / O. Medium was continually refreshed every day thereafter. Ethanol-only (-A / O) treated cells were used as control for all experiments involving A / O.
[0115] In some experiments (where noted), medium was supplemented with CEPT (Tocris) (Chroman 1 [50 nM], Emricasan [5 pM], trans-ISRIB [0.7 pM], and Polyamine Supplement [diluted 1: 1000] following manufacturer’s instructions).Teratoma formation assay.
[0116] 2x10° cells were resuspended in 50 pL of DMEM / Matrigel solution (1: 1 mixture) and subcutaneously injected into 10-week-old immunodeficient NOD-SCID mice. After 6-8 weeks, teratomas were dissected and fixed with Bouin’s solution. Paraffin-embedded teratomas were sectioned (10 pm thick) and stained with hematoxylin and cosin (H&E stain).Immunofluorescence stainins
[0117] Samples were fixed in 4% paraformaldehyde (PF A) in PBS for 20 minutes at room temperature, and then permeabilized in 0.5% Triton X-100 (Fischer Scientific), diluted in PBS, for 1 hour at room temperature. Samples were then washed three times with PBS before being incubated with blocking buffer (6% donkey serum, 0.2% Triton X-100, diluted in PBS) for 1 hour at room temperature. Primary antibodies were diluted in blocking buffer and then applied to the samples and incubated overnight at 4 °C. Next, primary antibody solution was removed, and the samples washed three times with 0.1% Tween-20 (Fischer Scientific) diluted in PBS (PBS-T), followed by incubation with the fluorescently conjugated antibodies diluted in blocking buffer. Finally, samples were washed three times with PBS-T, counterstained with 300 nM 4',6-diamidino-2-phenylindole (DAPI) solution for 20 minutes at room temperature, and then washed a final time in PBS-T before analysis. Samples were imaged using a fluorescence microscope (Echo Laboratories, CA).RT-qPCR
[0118] Total RNA was extracted using RNeasy Mini Kit (Qiagen) following manufacturer’s instructions. cDNA was synthesized using iScript Reverse Transcription Supermix (BIORAD) and amplified using Hotstart 2X SYBR Green qPCR PCR Master Mix (APExBIO) on a Touch Thermal Cycler Real-Time PCR system (Cl 000, BIO-RAD). GAPDH and - Actin were used an internal normalization controls. All primer sequences are listed in Table 2.Table 2: Primer sequences used for RT-qPCR, mtDNA quantification, and RFLP analysisMitochondria DNA quantification
[0119] Relative mtDNA abundance was assessed as previously described. Briefly, IxlO6cells were resuspended in 100 pE of QuickExtract DNA Extraction Solution (LGC Biosearch Technologies). Samples were then incubated at 68 °C for 15 minutes, followed by 95 °C for 10 minutes, and then centrifuged at 17,000 g for 15 minutes. The supernatant containing DNA was then collected and diluted at 1:30 in nuclease-free water. 1 pL of DNA extract was used for each qPCR reaction using Hotstart 2X SYBR Green qPCR PCR Master Mix (APExBIO) on a Touch Thermal Cycler Real-Time PCR system (Cl 000, BIORAD). For human samples, primers for the MT-TL1 and MT-RNR2 genes were used to amplify mtDNA sequences and normalized to nuclear-encoded B2Mand HBB genes. For mouse samples, primers for the MT-ND2 and MT-ND1 genes were used to amplify mtDNA sequences and normalized to nuclear-encoded RNA18S and PECAM1. Quantification of mtDNA in whole post-implantation mouse embryos was carried out the same way. except embryos were macerated and pipetted vigorously until embryo was adequately dissociated before the first incubation at 68 °C. For quantification of mtDNA abundance in pre -implantation mouse embryos, individual embryos were isolated and lysed in 5 pL of QuickExtract. The lysate was then incubated at 68 °C for 5 minutes, 98 °C for 2 minutes, then diluted in nuclease-free water to a total volume of 20 pL. 1 pL of lysate was used for each qPCR reaction using primers specific to MT-ND2, analyzed using the Delta-Delta Ct ( CT) method, and then compared to control embryos.DNA plasmids and molecular cloning
[0120] All vectors used in this study were generated in-house using Gibson Assembly Master Mix (NEB). All DNA fragments were PCR-amplified from existing plasmids (including m Cherry -PRKN-IRES- zeo, Addgene #61727), or genomic DNA sequences. The CISD1-PINK1 sequence was synthesized by Twist Bioscience, before being molecularly cloned into expression vectors. All vector sequences were verified using whole plasmid sequencing (Eurofms Genomics).Transmission electron microscopy
[0121] Control (untreated) and mitochondria-depleted PRKN-hESCS (48 h A / O treatment, then 24 h additional culture) were fixed in 4% PF A, 2.5% glutaraldehyde, and 0.1 M sodium cacodylate buffer for 10 minutes, then submitted for processing and analysis. Micrographs were taken at 4,000x magnification on a JEOL 1400 Plus. Mitochondria-depleted samples were analyzed for roughly 1 h, but no clear mitochondrial structures were present. In control (untreated) samples, mitochondrial structures were easily identified.EdU Cell Proliferation Assay
[0122] EdU incorporation was assessed using a Click-iT™ EdU Cell Proliferation Kit, Alexa Fluor™ 647 dye (Invitrogen), according to manufacturer’s instructions, and counterstained using 300 nM DAPI.Cell cycle analysis
[0123] 1x10° cells (mitochondria-depleted and control PRKN-hESCs) were collected and fixed in 70% ethanol, then washed with PBS and stained with DAPI ( 10 pg / mL) for 30 minutes. Stained cells were then washed, resuspended in PBS, and analyzed by flow cytometry. Flow cytometry was performed alongside unstained controls using a BDBioscicnccs LSR II flow cytometer and analyzed using FlowJo.Propidium iodide assessment of ploidy
[0124] IxlO6cells (hESCs, ciPSCs, biPSCs, giPSCs, oiPSCs, and composite PSCs) were collected and fixed in 70% ethanol, then washed with PBS and stained with FxCycle PI / RNase Staining Solution (Invitrogen) following manufacturer instructions. Flow cytometry was performed alongside unstained controls using a BD Biosciences FACSCalibur flow cytometer and analyzed using FlowJo. Tetrapioid cells had PI staining intensity roughly twice that of diploid contributor cells.Cell Culture
[0125] All contributor and composite lines were cultured on Matrigel (BD Biosciences) coated plates in E8 medium (made in-house), with the exception of contributor gorilla iPSCs. which were cultured in mTeSR™ Plus medium (StemCell Technologies) supplemented with 10 pM Y-27632 (Selleckchem). All PSCs were passaged routinely at 80% confluence using Versene or TrypLE™ (Gibco) and cultured in mTeSR™ Plus supplemented with 10 pM Y-27632 (Selleckchem) for the first day after passaging. BALB mESCs were cultured feeder-free on Matrigel-coated plates in 2iL medium (DMEM / F12 and Neurobasal medium mixed at 1 : 1 ratio, 0.5x N2 supplement, 0.5x B27 supplement, 2 mM GlutaMAX, lx NEAA, 0.1 mM 2-Mercaptoethanol. 10 ng / mL rhLIF. 3 pM CHIR 99021, and 1 pM PD0325901). B6 mEpiSCs were cultured feeder-free on Matrigel-coated plates in AFX medium (DMEM / F12 and Neurobasal medium mixed at 1 : 1 ratio, 0.5x N2 supplement, 0.5x B27 supplement, 2 mM GlutaMAX, lx NEAA, 0.1 mM 2- Mercaptoethanol, 20 ng / mL Activin A, 12.5 ng / mL FGF2, and 2 pM XAV939). Both mESCs and mEpiSCs were routinely passaged using TrypLE™ as a dissociation reagent.Generation and culture of composite cell lines
[0126] An equal number of human and NHH PSCs (typically 2.5xl05hESCs and 2.5xlO5NHH iPSCs) were plated onto Matrigel-coated 6-well plates in E8 medium (made in-house) supplemented with 10 pM Y-27632 (Selleckchem). After 24 hours, the media was refreshed and Y-27632 was removed. Cells were co-cultured with daily media changes until they had formed a monolayer (roughly -90% confluence) to ensure maximum cell -cell contact between the two cell lines. Cells were washed once with PBS, and then fused by adding 1 mL of fusion buffer to the culture and incubating for 60 seconds. Fusion buffer was then aspirated, and the cells were washed 3-4 times with 1 mL of PBS (e.g., a wash buffer), with gentle agitationto wash away the fusion buffer. After the final PBS wash, cells were allowed to recover in E8 medium supplemented with CEPT for 30 minutes in a 37 °C incubator. After recovery, the fused cells were then dissociated using TrypLE™, centrifuged at 300 g, resuspended in 6 mL of E8 media supplemented with CEPT, and then distributed into 3 wells of a Matrigel-coated 6-well plate. After 48 hours, the media was refreshed and CEPT removed. Dual hygromycin B (100 pg / L) and blasticidin S (20 pg / mL) selection started 48 hours post-fusion, or when the cells became roughly -50% confluent. After 1 to 2 weeks of selection, double resistant colonies were either collected and pooled for analysis or isolated individually for clonal expansion.
[0127] All composite lines were generated and cultured in E8 medium, except for HsGg composites, which were generated initially in mTeSR™ + 10 pM Y-27632 then adapted to E8 medium after antibiotic selection.Linear amplicon sequencing for determinins mtDNA contribution
[0128] Primers were designed to amplify human and NHH mtDNA sequences, with completely nucleotide identity, between the MT-RNR2 and MT-ND1 coding regions . PCR products were purified using a QIAquick PCR Purification (Qiagen) kit following manufacturer instructions. Purified PCR products were sequenced by nanopore linear amplicon sequences (Eurofins Genomics).
[0129] Three species-specific SNPs were identified between each pair of human-chimp, humanbonobo, human-gorilla, and human-orangutan (i.e., SNPs between human and the NHH mitochondrial genomes). The number of base pair calls that corresponded to the human or the NEIH sequence at each SNP-containing nucleotide position was totaled to detennine the proportion of human to NHH mtDNA aligned reads. A minimum read depth of 100 was used for each analysis.Preparation of Fusion Buffer
[0130] Fusion buffer consisted of a 50% w / v polyethylene glycol 1500 (PEG 1500) solution with 10% DMSO in basal medium. Briefly, 4.7 g of PEG 1500 (Sigma-Aldrich) was added to a 50 mL conical tube, followed by the addition of 4 mL of DMEM / Hams F-12 50 / 50 Mix (Coming) and 1 mL of DMSO (Sigma- Aldrich). The tube was placed into a 65 °C water bath for 20 minutes until the contents were completely dissolved, and then allowed to cool to room temperature before being used for fusion.Generation of modified cell lines
[0131] To generate PRKN-hESCs. H9 hESCs were electroporated using a NEPA21 Type II Super Electroporator (Bulldog -Bio) using the manufacturer’s recommended parameters. Briefly, 2xl06H9 hESCs were mixed with 10 pg of DNA vector in 100 pL of Opti-MEM (Gibco). After electroporation, cells were collected in 2 mL of mTeSR™ Plus media supplemented with ROCK inhibitor (Y -27632). After 48 h, cellswere treated puromycin (1 pg / mL) for two weeks to select for stable transformants, at which point individual colonies were manually isolated. PRKN-MELAS iPSCs, PRKN-mESCs, and PRKN-mEpiSCs were all generated using the same method. HygR-hESCs and BlastR-NEIH iPSCs were generated the same way except selected for using Hygromycin B (50 pg / mL) and Blasticidin S (10 pg / mL), respectively.Respiration Analysis
[0132] An Agilent Seahorse Xfe96 Analyzer was used to measure respiration rates. PRKN-hESCs were first depleted of mitochondria using 1 pM A / O treatment for 48 h, refreshed each day in mTeSR™ Plus medium. At 48 h. cells were washed three times with media before being washed with PBS once, and then dissociated using TrypLE™ Cells were counted and plated at 5xl04cells / well in a total volume of 80 pLAvell and cultured overnight. The following day, cells were rinsed twice using 200 pL of Seahorse assay medium (DMEM [Sigma D5030] supplemented with 2 mmol / L L-glutamine, 1 mmol / L sodium pyruvate, 10 mmol / L glucose, and 1% penicillin / streptomycin), then left in 150 pL of Seahorse assay medium. Cells were then equilibrated for 45 minutes in a 37 °C, CCE-free incubator before assaying. Standard calibration was performed, and oxygen consumption measurements were performed using “‘Mix” and “Measure” cycles every three minutes. Three measurements were collected at baseline and three after the injection of each compound (2 pM oligomycin A, 3 pM CCCP, 3 pM antimycin A). Ethanol -treated PRKN-hESCs were used as control.
[0133] For respiration analysis of HsPa mitochondrial-composite PSCs, cells were counted and plated at 5xl04cells / well in a total volume of 80 pL / well and cultured overnight. Tire following day, cells were rinsed twice using 200 pL of Seahorse assay medium (DMEM [Sigma D5030] supplemented with 2 mM L-glutamine, 1 mM sodium pyruvate, 10 mM glucose, and 1% penicillin / streptomycin), then left in 150 pL of Seahorse assay medium. Cells were then equilibrated for 45 minutes in a 37 °C, CCL-free incubator before assaying basal OCR and ECAR. After the assay, cell number was quantified and used for normalization.Cell Viability, Survival, and Growth Curves
[0134] Growth curves were generated by plating 2.5x10scells / well. At each of the indicated timepoints, cell concentration was manually counted and calculated using a hemocytometer and Trypan Blue exclusion. Survival of mitochondria-depleted cells was determined the same way following 48 hours of A / O treatment. Cell viability was assessed using a LIVE / DEAD™ Viability / Cytotoxicity Kit for mammalian cells (Invitrogen). following manufacturer’s instructions.Mitochondrial Genomic Sequences
[0135] The human mtDNA sequence was obtained from NCBI reference sequence NC_012920.1. The chimpanzee mtDNA sequence was obtained from NCBI reference sequence NC 001643.1. The bonobo mtDNA sequence was obtained from NCBI reference sequence NC 001644.1. The gorilla mtDNA sequence was obtained from NCBI reference sequence NC_011120.1. The orangutan mtDNA sequence was obtained from NCBI reference sequence NC 002083.1.Genomic DNA extraction and mtDNA genotyping by RFLP
[0136] Genomic DNA was extracted using QuickExtract DNA Extraction solution (LGC Biosearch Technologies). Briefly, lx 10" cells were resuspended in 100 pL of QuickExtract DNA Extraction Solution (LGC Biosearch Technologies). The samples were then incubated at 68 °C for 15 minutes, followed by 95 °C for 10 minutes, and then centrifuged at 17,000 g for 15 minutes. The supernatant containing DNA was then collected and diluted at 1:30 in nuclease-free water. Typically, 1 pL of diluted DNA extract was used for polymerase chain reactions (PCR) using CloneAmp HiFi PCR Premix (Takara).
[0137] Unique restrictions sites between human and NHH mtDNA sequences were identified based on the aforementioned reference sequence files. Human and orangutan mtDNA contain an EcoRV restriction site in the MT-RNR2 gene (position 03.176 - 03,181 of the human mitochondrial genome). Uris site can be used to differentiate human mtDNA from chimp, bonobo, and gorilla mtDNA. Orangutan mtDNA contains a Hindlll site in the MT-TL1 gene that is not present in the human mitochondrial genome (position 03,165 - 0,3171 of the orangutan mitochondrial genome). To differentiate between primate mtDNA sequences, primers were designed to bind both human and NHH mtDNA sequences with 100% identity and used to amplify the portions of mtDNA containing the unique restriction sites. Amplicons were purified using a QIAquick PCR Purification Kit (Qiagen) according to the manufacturer’s instructions. Typically, 300 ng of DNA amplicon was digested using the specified restriction enzymes, EcoRV or Hindlll (NEB), and then separated by agarose gel electrophoresis.Metaphase DNA fluorescent in situ hybridization (FISH)
[0138] To prepare metaphase spreads, cells were arrested for 4-5 hr with 100 ng / mL colcemid (KaryoMAX, Thermo Fisher) and harvested by trypsinization. Cell pellets were resuspended in prewarmed 75 mM KC1 hypotonic solution while gently vortexing and incubated for 6 min at 37°C. Resuspended cells were fixed by adding icc-cold Camoy’s fixative (3: 1 methanol: acetic acid), centrifuged, and gently resuspended in fixative. Fixed cells were dropped onto slides and air dried. For multi-color DNA FISH, 4 pL of 24XCyte Human Multicolor FISH Probe (MetaSystems) were applied to the metaphase spreads. Slides were sealed with a coverslip and denatured at 75°C for 2 min, followed by overnight hybridizationat 37°C in a humidified chamber using a ThermoBrite system (Leica). Slides were subsequently washed with 0.4x SSC at 72°C for 2 min and rinsed in 2x SSC, 0.05% Tween-20 at room temperature for 30 sec. Slides were then rinsed in water, counterstained with DAPI, and mounted with an antifade solution. FISH images were acquired using a Metafer Slide Scanning Platform (MetaSystems). MSearch software was used to search for metaphase spreads and then images were automatically captured using Autocapt at 63X magnification. Multicolor karyotypes were generated using Isis (v5.8.12. MetaSystems) and adjusted for imaging threshold.Mice
[0139] C57BL / 6J, DBA / 2J, and B6D2F1 / J mice were purchased from the Jackson Laboratory. Mice were housed in 12-hr light / 12-hr dark cycle. All procedures related to animals were performed in accordance with the ethical guidelines of the University of Texas Southwestern Medical Center.Generation of mRNA
[0140] RNA synthesis and polyA tail elongation were performed with a mMESSAGE mMACHINE T7 kit (AM1344, Ambion), and a Poly(A) Tailing kit (AM1350, Ambion) was used, according to the manufacturer’s instruction. Briefly, 0.1 pg cDNA was subjected to in vitro Transcription reaction at 37°C for 2 hours, followed by 15 min incubation with TURBO DNase. The solution was further subjected to poly(A) tailing reaction at 37°C for 1 hour. Tire mRNA was purified with Monarch® RNA Cleanup Kits (T2040L, New England Biolabs) according to the manufacturer’s instructions.Ess collection
[0141] B6D2F1 female mice were subjected to supcrovulation using an injection of CARD HypcrOva (0.1 mL, Kyudo, Japan) into the abdominal cavity, followed by an injection of human chorionic gonadotropin (hCG) (7.5 units, HOR-250. Prospec, Israel). Natural mating was done with B6D2F1 males 46-48 h after CARD HyperOva injection. After 19-21 h, cumulus -intact eggs were collected and treated with 0.33 mg / mL hyaluronidase (H4272, SIGMA -Aldrich) for 5 min to remove cumulus cells for genome editing. Obtained eggs were cultured in KSOMaa medium at 37°C under 5% CO2 / 5% O2until subsequent treatments.Injection of mRNA
[0142] mRNA solution was injected into the cytoplasm of zygotes with FemtoJet™ 4i Microinjector system (Eppendorf) in an FHM medium. After injection, the embry os were transferred to KSOMaa for further culture at 37°C under 5% CO2 / 5% O2. Tire embryos were observed with a Nikon Eclipse Ti2 microscope (Nikon, Japan) equipped with an ORCA-Fusion BT Digital CMOS camera (Cl 5440,HAMAMATSU, Japan) and objective xl 0 / 0.30 NA air and x20 / 0.50 NA. For quantification of mtDNA abundance, each embryo was transferred to 5 pL QuickExtract™ DNA Extract solution (QE09050, Biosearch Technologies, UK) and incubated for 5 min at 65°C, followed by 2 min incubation at 98°C. For post-implantation development analysis, 2-cell stage embryos, cultured for one day in KSOM after mRNA injection, were transferred to the oviduct of recipient ICR mice (0.5 dpc). The embryos were dissected at E8.5 and E12.5 for further analysis.Mitochondria-depletion in tetraploid-complemented mouse embryos
[0143] B6D2F 1 female mice were subjected to superovulation using an injection of CARD HyperOva (0.1 mL, Kyudo. Japan) into the abdominal cavity, followed by an injection of human chorionic gonadotropin (hCG) (7.5 units, HOR-250, Prospec, Israel). 2-cell stage embryos were recovered from the oviducts of mice 1.5 days postcoitum (dpc). Electrofusion was carried out using a DC pulse (100 V / mm, 30 psec, 1 time) followed by application of AC pulses (5 V / mm, 10 sec, 1 MHz) using an LF201 Electro Cell Fusion Generator (Nepa, Japan). Fused tetrapioid embryos were cultured in KSOMaa until blastocyst stage for ESCs injection.
[0144] Mouse ESCs bearing an inducible Mito-EGFP, 0MM-PINK1, and PRKN expression cassette were trypsinized with TrypLE™ and suspended in M2 medium for injection. A piezoelectric driven micromanipulator (Prime Tech, Tokyo, Japan) was used to penetrate the zona pellucida and trophectoderm under the 20x objective lens. Around 12 mouse ESCs were injected into the blastocyst cavity. These blastocysts were transferred to tire uteri of pseudopregnant recipient ICR female mice (2.5 dpc).
[0145] To induce expression of the transgenes, doxycycline (dissolved in PBS) was administered at 100 pg per gram of body weight each day via IP injection for two days starting at day 5 after embryo transfer. Control embryos were generated the same way, except PBS without doxycycline was used for IP injection. The embryos were dissected at E9.5 for further analysis.Metabolomics
[0146] Mitochondria-depleted PRKN-hESCs were generated using 48 h of A / O treatment, followed by 3 washes with complete media and then a 24 h recovery period. At the 72 h timepoint (Day 0), mitochondria-depleted PRKN-hESCs and control PRKN-hESCs (IxlO6cells, in triplicate) were collected. For HsPa metabolomics, composite PSC lines ( 1x106cells, in triplicate) were collected. For collection, cells were treated with 1 mL of ice-cold 80% MeOH solution in high-performance liquid chromatography (HPLC)-grade water and incubated at -20 °C or 5 minutes. The plates were placed on ice and cells were collected by scraping and placed into tubes, then subjected to three freeze-thaw cycles between liquid nitrogen and a 37 °C water bath. Samples were then centrifuged at 20,000 g for f5 minutes at 4 °C toremove debris, and the supernatants collected. The supernatants were evaporated overnight in a SpeedVac concentrator (Thermo Savant). Samples were then processed and analyzed for mass spectrometry targeted (screening) metabolomic analysis. Metabolite values are represented as total ion count (TIC) -normalized peak areas. Data was analyzed using Metaboanalyst 6.0 (www.metaboanalyst.ca). Statistical Analysis (one factor) comparisons were carried out using TIC-normalized data, left unfiltered, log 10 transformed, and auto-scaled. For HsPa mitochondrial-composite samples, metabolites with an uncorrected p < 0.05 (Student’s / -test) were used to generate the heat map. All analyses on mitochondria-depleted samples were performed using only metabolites with an FDR-corrected p < 0.05.Proteomics
[0147] Mitochondria-depleted PRKN-hESCs were generated using 1 pM A / O treatment for 48 h in E8 medium on Matrigel-coated plates, washed, and then cultured for an additional 48 h. Then, mitochondria- depleted and control cells were collected and lysed in RIPA buffer with lx protease and lx phosphatase inhibitor cocktails. Samples were agitated on ice for 20 minutes, and then centrifuged at 5,000 g for 20 minutes at 4 °C. The supernatant was then collected, snap frozen in liquid nitrogen, and stored at -80 °C until use. Samples were submitted for tandem mass tag (TMT) labeling followed by liquid chromatography with tandem mass spectrometry (LC-MS / MS) and phosphopeptide enrichment.RNA-seq data analysis
[0148] Tire same analysis pipeline was performed on human and mouse transcriptomic data. Trim Galore (Version 0.6.10) was utilized for quality control with quality score higherthan Q30 and length lager than 20pb. Hisat2 (Version 2.1.0) and StringTie (Version 2.1.7) were used for sequence blast, assembly, and quantification. The GRCh38 and Susie_PABv2 were downloaded from Ensembl database as the reference genomes for human and orangutan, respectively. To eliminate the impact of nuclear- mitochondrial insertions (NUMTs) on mitochondrial gene expression in hybrid cells, numty-dumpty (github.com / nkschaefer / numty-dumpty) was used to identify NUMTs and remove autosomal gene annotations that are homologous to mitochondrial genes in the human and orangutan reference genomes. This process generates new reference genome files, where all potential NUMT sequences are replaced with "N". preventing reads that should map to the mitochondrion from being misaligned. Then the NUMT-free genome was used for sequence BLAST, assembly, and quantification for composite samples.
[0149] DESeq2 (Version 1.38.3) was used for calculating significant gene expression differences in all samples. Genes with adjusted P-values less than 0.05 were filtered and absolute log2 fold change higher than 1 .5 as significantly different expression genes.Proteomic data analysis
[0150] Human proteomics data was analyzed based on a published standard pipeline. Terms that were missing in more than half of the samples were deleted. Then, the proteomic data was transformed to a normal distribution, standardized, and centralized. T-tests were used to calculate significant differentially expressed proteins with a P-value less than 0.05 and an absolute log2 fold change greater than 1.5.Gene Function and pathway annotation for DEGs
[0151] Functional annotation of differentially expressed genes or proteins in each data set was performed by using clusterProfiler (version 4.6.2) based on Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases. Enrichment function and pathways terns were calculated by using enrichGO and enrichKEGG function with p-values less than 0.05.Statistical Analysis
[0152] All quantitative data is presented as the mean ± SD. Experiments were repeated at least three times (repeat number was indicated as “n” in figure legends). Differences between groups were evaluated by statistical test denoted in the figure caption. P values are shown in the figures. Graphic analyses were done using GraphPad Prism version 10.0 (GraphPad Software, La Jolla, Ca) and Microsoft Excel (Microsoft 365).Data availability
[0153] All transcriptome sequencing data of mitochondria-depleted cell lines have been deposited in the NCBI Gene Expression Omnibus (GEO; www.ncbi.nlm.nih.gov / geo) under accession number GSE268632 (Token: wfqbeiymzlsfjwj). All human-NHH PSC fusions cells sequencing data have been deposited in GEO database under accession number GSE270085 (Tokemcxevkgwqtxyjhyl)).Example 1. Enforced mitophagy enables the generation of pluripotent cells devoid of mitochondria
[0154] To deplete mitochondria from PSCs. a vector that allows for expression of mCherry-tagged Parkin (PRKN) and mitochondria-localized EGFP (Mito-EGFP) was generated. PRKN is an E3 ubiquitin ligase that is recruited to dysfunctional mitochondria to promote mitophagy, (FIGs. 1A and IB). The inclusion of Mito-EGFP enables monitoring of mitochondria-dcplction in live cells. Constitutive expression of these transgenes did not affect the growth rate or pluripotent characteristics of the H9 human embryonic stem cells (hESCs) (hereafter referred to as PRKN-hESCs) (FIGs. 1C-1E).
[0155] To test whether enforced mitophagy is applicable to PRKN-hESCs, the cells were treated with oligomycin A and antimycin A (A / O), two mitochondria uncouplers that depolarize the mitochondrial membrane and stimulate widespread mitophagy in PRKN-expressing cells, for 48 hours (h) (FIGs. 2A and IF). Following A / O treatment, a loss of EGFP -labelled mitochondria over 72 h and an absence of COXIVstaining was observed (FIGs. 2B and 1G). Relative mtDNA abundance was quantified and a -97% reduction in mtDNA levels in PRKN-hESCs after A / 0 treatment was observed (FIG. 2C). Furthermore, transmission electron microscopy failed to identify mitochondria in PRKN-hESCs treated with A / O, and these cells exhibited significantly reduced oxygen consumption rates compared to control cells (FIGs. 2D and 2E). PRKN-hESCs are devoid of mitochondria 72 h after the initial addition of A / O (i.e.. 48 h A / O treatment, then an additional 24 h of recovery [FIGs. 2A and 1FJ). This timepoint is referred to as Day 0.
[0156] Following mitochondria depletion, PRKN-hESCs survived for 3 to 5 days in culture, depending on initial cell density and the presence of the pro-survival CEPT cocktail (FIG. 1H). Mitochondria-depleted PRKN-hESCs did not divide or replicate DNA and experienced a G2 / M phase cell cycle arrest (FIGs. II and 1J). Immunocytochemistry analysis revealed core pluripotency transcription factors OCT4, SOX2, and NANOG were still present after depletion of mitochondria (FIGs. 2F and IK).
[0157] Next, this strategy was applied to three other PSC lines: a mouse ESC (mESC) line, a mouse epiblast stem cell (mEpiSC) line, and a human induced pluripotent stem cell (hiPSC) line harboring a pathogenic mtDNA mutation known to cause mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS). PRKN overexpression and treatment with A / O for 48-72 h was sufficient to generate mitochondria-depleted counterparts to these PSCs, as determined by mtDNA quantification and COXIV staining (FIGs. 2G and IL).
[0158] Whether a lower concentration or shorter treatment duration of A / O could induce partial mitochondria-depletion was investigated. To this end, PRKN-hESCs were treated with A / O concentrations ranging from 10 pM to 1 pM. Concentrations >1 nM A / O consistently led to the complete depletion of mitochondria, while concentrations <100 pM induced no detectable mitophagy (FIGs. 3A-3C), suggesting a minimum threshold of A / O is required to trigger mitophagy in PRKN-hESCs. Next, using 1 pM A / O, treatment times ranging from 1 minute to 48 hours were tested. Even a brief 5-minute treatment resulted in delayed, but complete, mitochondria depletion within 7 days. Conversely, an extremely short 1 -minute treatment induced a transient -30% reduction in mtDNA, which recovered to baseline levels within 7 days (FIGs. 3D-3F).
[0159] Taken together, PRKN- and A / O-mediated enforced mitophagy can efficiently generate various PSCs devoid of mitochondria (e.g., mitochondria-depleted PSCs or mdPSCs).Example 2: Multi-omic analysis of the effects of mitochondria depletion on PSCs
[0160] To better understand the global effects the loss of mitochondria has on PSCs, we performed RNA sequencing (RNA-Seq), proteomic profiling, and metabolomics on control and Day 0 mitochondria- depleted PRKN-hESCs (FIGs. 4A and 5A). Transcriptomic analysis identified 788 downrcgulatcd and 1,696 upregulated genes in Day 0 mitochondria-depleted PRKN-hESCs when compared to control(adjusted P < 0.05 and |log2 fold change) > 1.5) (FIGs. 4B, 5B, and 5C). All detected mtDNA-encoded genes were significantly downregulated in mitochondria-depleted PRKN-hESCs except for MT-TD, which was barely detected even in control cells (average TPM < 3) (FIGs. 4C and 4E). GO and KEGG pathway analyses on differentially expressed genes (DEGs) revealed that GO terms associated with membrane transporter activity and KEGG terms related to ligand-receptor interactions were consistently enriched among upregulated genes (FIGs. 5D-5F). Consistent with impaired cell division in mitochondria-depleted PRKN-hESCs, terms related to chromatin remodeling, nucleosome assembly, and DNA replication were enriched among downregulated genes.
[0161] To evaluate the impact of mitochondrial depletion on pluripotency gene expression, the expression profiles of 297 pluripotency-associated genes were analyzed. ~92% (274 / 297) of these genes exhibited no significant change in expression level in Day 0 mitochondria-depleted PRKN-hESCs compared to control (FIGs. 4C and 4E). RT-qPCR analysis over four days revealed that PRKN-hESCs maintained strong expression of OCT4, SOX2, and NANOG (OSN) during enforced mitophagy, despite significant depletion of mitochondria. OSN expression persisted for two days in a fully mitochondria- depleted state but progressively declined, with near-complete loss by Day 4 (FIG. 5G). These findings suggest that while pluripotency gene expression initially resists loss of mitochondria, mitochondria are ultimately essential for maintaining the pluripotent state
[0162] Almost all (>98%) mitochondrial genes are encoded within the nuclear genome, including all transcription factors and transcriptional co-activators necessary for mitochondrial gene expression. Additionally, mitochondrial proteins are translated on cytosolic ribosomes before being transported to the mitochondria. How the absence of the entire mitochondrial organelle affects the expression of nuclear- encoded mitochondrial genes was investigated. Despite the complete absence of mitochondria, -95% (1,441 / 1,515) of nuclear-encoded mitochondrial genes were present at normal levels in Day 0 mitochondria- depleted PRKN-hESCs (FIGs. 4C and 4E). Among nuclear-encoded mitochondrial DEGs, only 42 were upregulated and 32 downregulated.
[0163] Proteomic analysis of Day 0 mitochondria-depleted PRKN-hESCs was consistent with transcriptomic findings. We found that most pluripotency-related genes (-91%, 160 / 176) and nuclear- encoded mitochondrial genes (-72%, 291 / 403) were unchanged in abundance despite the complete absence of mitochondria (FIGs. 4D, 4E, and 5H). In addition. GO analysis confirmed an enrichment of terms related to transport activity among upregulated proteins, and an enrichment of terms related to respiration and electron transport chain (ETC) among downregulated proteins, consistent with the depletion of mtDNA and its encoded oxidative phosphorylation proteins. KEGG pathway analysis of upregulated proteins showed an enrichment for terms related to endocytosis, phagosome, and metabolism, suggesting possible cellular adaptations to the loss of mitochondria and the utilization of alternative energy- and substrate-producingpathways. For downregulated proteins, we observed an enrichment of terms related to various neurodegenerative diseases, suggesting that a reduction of mitochondria might, in some ways, be protective in a neurodegenerative context (FIGs. 51 and 5J).
[0164] Together, transcriptomic and proteomic analyses of Day 0 mitochondria-depleted PRKN- hESCs revealed that more genes were upregulated than downregulated following mitochondria depletion in hESCs, and most pluripotency genes and nuclear-encoded mitochondrial genes remained at normal levels.Example 3: Impacts of mitochondria-depletion on PSC metabolites
[0165] The metabolism of PSCs is intricately linked to their pluripotent state. Metabolic changes influence epigenetic landscape and modulate gene expression and cell fate decisions. As mitochondria- depleted PSCs lack all mitochondria-dependent functions, they provide a unique model to dissect the contribution of mitochondrial versus cytoplasmic and nuclear metabolism in maintaining key pluripotency- associated metabolites. S-adenosylmethionine (SAM), a-Ketoglutarate (a-KG), and acetyl-CoA are central to pluripotency due to their roles in epigenetic regulation, including DNA and histone methylation and acetylation. Additionally, tricarboxylic acid (TCA) cycle enzymes have been shown to translocate to the nucleus in pluripotent cells and during somatic cell reprogramming. To explore the metabolic impact of mitochondria depletion, metabolomic profding of Day 0 mitochondria-depleted and control PRKN-hESCs was conducted. This analysis identified a significant downregulation of 58 metabolites, with only 9 metabolites upregulated (P < 0.05) (FIG. 4F). Pathway analysis revealed significant enrichment of downregulated metabolites in alanine, aspartate, glutamate, and pyrimidine metabolism, as well as the TCA cycle, reflecting the central role of mitochondria in these metabolic pathways (FIG. 5K). Mitochondria depletion led to a dramatic reduction in the epigenetic substrate SAM and a complete loss of detectable acetyl-CoA, highlighting the essential function of mitochondria in sustaining normal levels of these metabolites in PSCs (FIG. 4G). The intracellular a-KG / succinate ratio plays an important role in regulating pluripotency gene expression by influencing histone and DNA methylation dynamics. Despite the absence of mitochondrial TCA cycle activity, mitochondria-depleted cells maintained largely normal levels of both a-KG and succinate (FIGs. 4G and 5L). This finding suggests non-mitochondrial production of these metabolites or the persistence of pre-existing metabolite pools at the Day 0 timepoint. In contrast, other TCA intermediates, including citrate / isocitrate, fumarate, and malate, were markedly reduced, suggesting a complete reliance on mitochondria fortheir production and maintenance (FIGs. 4G and 5M). ATP levels remained normal despite the absence of mitochondria and oxidative phosphor lation (FIG. 4G). Together, these observations underscore the selective metabolic dependencies of PSCs on mitochondrial function.
[0166] In mitochondria-depleted PRKN-hESCs, dozens of metabolites were downregulated, while only nine were upregulated. Among them, two mitochondria-associated metabolites, 2-hydroxyglutarate (2-HG) and ureidosuccinate, showed the most significant increase (FIGs. 4H and 5N). Ureidosuccinate, an intermediate in pyrimidine synthesis, depends on mitochondrial respiratory chain-dependent dihydroorotate dehydrogenase. Its accumulation aligns with the loss of mitochondrial function in mitochondria-depleted cells, consistent with known metabolic traits of mtDNA-deficient (pO) cells. 2-HG, a competitive inhibitor of a-KG-dependent dioxygenases, accumulates under hypoxia or metabolic dysfunction, disrupting epigenetic programs and impairing stem cell differentiation. Its accumulation suggests dysfunction in 2- hydroxyglutaratc dehydrogenases (L2HGDH, D2HGDH) or aberrant activity of lactate dehydrogenase A or malate dehydrogenase 1 / 2 in the absence of mitochondria.
[0167] Together, these findings highlight the essential role of mitochondria in maintaining core pluripotency metabolites, including SAM and acetyl-CoA, while indicating that a-KG levels can be sustained through non-mitochondrial pathways or metabolite pools. In addition, the observed changes in metabolite levels precede alterations in pluripotency gene expression, suggesting the progressive loss of pluripotency gene expression in mitochondria-depleted PRKN-hESCs (FIG. 5G) can be driven by disruptions in mitochondrial retrograde signaling, particularly due to the depletion of acetyl-CoA and SAM, and accumulation of 2-HG.Example 4: Enforced mitophagy enables the generation of interspecies composite PSCs with speciesspecific mtDNA contribution
[0168] Recent studies on human-chimpanzee composite PSCs have revealed the functional consequences of nuclear genome divergence between species. However, tire impact of mitochondrial genome divergence on composite PSCs remains unknown. To investigate this, hESCs were fused with iPSCs from all non-human hominid (NHH) species: chimpanzee (ciPSCs), bonobo (biPSCs), gorilla (giPSCs), and orangutan (oiPSCs). Uris process (FIG. 6A) generated tetrapioid composite PSCs between human and all NHHs (FIGs. 6B and 7A). All composite PSCs exhibited a larger size and a morphology intennediate between the two diploid contributor lines (FIG. 7B) and maintained expression of pluripotency-related transcription factors OCT4 and SOX2 (FIGs. 6C and 7C). Human-chimpanzee, human-bonobo, human-gorilla, and human-orangutan composite PSCs are referred to as HsPt, HsPp, HsG . and HsPa composite PSCs, respectively.
[0169] To confirm that the composite PSCs contained the nuclear genomes of both contributor species, multiplex DNA FISH was performed on metaphase chromosome spreads. Using hESCs, ciPSCs, and three individual ElsPt clonal cell lines as representative examples, we observed that both contributorlines were karyotypically diploid and that all three HsPt composite lines were tetrapioid, sometimes with the gain or loss of one or more chromosomes (FIGs. 7D and 7E).
[0170] mtDNA contribution in composite PSC lines was assessed by restriction fragment length polymorphism (RFLP) analysis (FIG. 7F). In agreement, we identified only human mtDNA in HsPt composite populations and further confirmed this result by linear amplicon sequencing (FIGs. 6D and 6E). 12 clonal HsPt lines were isolated and only human mtDNA were identified in all clones (FIG. 6F). Finally, mtDNA contribution in HsPp. HsGg. and HsPa composite PSCs was assessed, and contribution only from human mtDNA with no contribution from NHH mtDNA (FIGs. 6G and 7G-7I). Selection for human mtDNA was also observed in HsPa composite PSCs that were generated by the fusion of a human iPSC line (SCVI274) with oiPSCs (FIG. 7J). These results suggest that in human-NHH composite PSCs, the human mitochondrial genome was preferentially selected for over mitochondria of other great apes.
[0171] To investigate whether this mtDNA selection process is influenced by culture conditions, we fused hESCs with biPSCs in three culture conditions: mTeSR™, Essential 8™, and AFX. RFLP analysis consistently revealed the selection for human mtDNA across all three conditions in HsPp cells (FIGs. 8 A and 8B). Next, to explore whether this mtDNA selection process occurs among non-human fusions, ciPSCs with oiPSCs were fused, which revealed that the resulting PtPa cells exclusively retained orangutan mtDNA (FIG. 8C). These results indicate that this mtDNA selection process is independent of culture condition and is conserved across multiple interspecies PSC fusions.
[0172] The potential of enforced mitophagy to promote the contribution of NHH mtDNA to human- NHH composites was investigated. To this end, human mitochondria was depleted from hESCs using a non-integrating episome encoding PRKN, Mito-EGFP, and a selectable antibiotic resistance gene (FIG. 8D). After 24 h of A / O treatment (FIGs. 8E and 8F), mitochondria-depleted hESCs were fused with NHH iPSCs (FIG. 9A). Linear amplicon sequencing and RFLP analysis revealed that this strategy robustly supported the contribution of NHH mtDNA, with NHH mtDNA contribution ranging from -25-85% in pooled populations of composites (FIGs. 9B and 8G). Further analysis of HsPt composite PSCs revealed that mtDNA contribution was binary , with each composite clone containing either human or NHH mtDNA, but not a mix of both (FIG. 9C). A complete panel of human-NHH composite PSCs with species-specific mtDNA contribution was generated (FIGs. 9D and 9E). These PSCs harbored the nuclear genomes of both contributor species and maintained expression of OCT4 and SOX2 (FIGs. 8H-8J), like those generated without using enforced mitophagy (FIGs. 6 and 7A). The successful generation of stable interspecies composite PSCs between human and all other hominid species suggests that Hominidae mitochondrial genomes are functionally interchangeable for maintaining pluripotency in composite PSCs.
[0173] Composite PSCs with selective mtDNA contribution disclosed herein are referred to as "‘mitochondrial -composites"’ and annotate mitochondrial genotype using a superscript (e.g.. HsPt compositePSCs harboring the human or chimpanzee mitochondrial genome are referred to as HsPP' or HsPf respectively) (FIG. 9F).Example 5: Conserved and distinct transcriptional and metabolic features shaped by mitochondrial genome divergence
[0174] Assessing phenotypic impacts of intcrspccics mitochondrial genome divergence is hindered by significant challenges. Traditional cross-species comparisons are confounded by a range of species-specific factors, including differences in nuclear genome composition, developmental timing, and culture condition. By creating mitochondrial-composite PSCs, generated interspecies cell lines that are genetically identical except for their mtDNA genotype can be prepared by the method disclosed herein. This approach enables the isolation and direct study of the effects of mtDNA variation while minimizing the confounding influences of nuclear or environmental factors.
[0175] To more precisely assess how divergence in mitochondrial genomes might affect composite PSCs, a study was conducted comparing the human mitochondrial genome to that of its most distant great ape cousin, the orangutan (i.e., HsPaHsversus HsPcfa) (FIG. 10A). Humans and orangutans are separated by -14-18 million years of evolution and share -85% nucleotide identity between their mitochondrial genomes. Consistent with HsPt mitochondrial -composites, a binary contribution from human or orangutan mtDNA was observed in PlsPa composites, but not a mix of both (FIG. 11A). RNA-Seq was performed on contributor lines (hESCs and oiPSCs) and three clones each of HsPcr" and HsPcfacomposite PSCs, whose mtDNA genotypes were confimicd by RFLP and linear amplicon sequencing (FIGs. 10B and 11B). Multiplex DNA FISH revealed that all HsPa mitochondrial-composites lines assessed were largely tetrapioid, and contributor hESCs and oiPSCs were diploid (FIG. 11C).
[0176] Through RNA-Seq analysis, overall mapping rates were observed for both HsPa"' and HsPcfncomposite PSCs to be comparable when aligned to the human and orangutan reference genomes. This indicates that both nuclear genomes were present and transcriptionally active in the composite cells, in addition to the mitochondrial genome being transcriptionally active (FIGs. 11D-11G). HsPa'" composite PSCs were confirmed to exclusively express mtDNA-encoded mRNAs of human origin, with no detectable expression from those of orangutan. Conversely, HsPaPacomposite PSCs exclusively expressed mtDNA- encoded mRNAs of orangutan origin, with no expression from those of human (FIG. IOC). HsPa composite PSCs harbored similar levels of mtDNA regardless of mitochondrial origin, suggesting mtDNA copy number returns to a steady-state level despite transient modulation of mitochondrial content via enforced mitophagy (FIG. 10D).
[0177] To comprehensively examine how human versus orangutan mtDNA affects the global transcriptome of composite PSCs, total gene expression was calculated by integrating reads from bothhuman and orangutan origins. This analysis revealed that, regardless of mtDNA genotype, HsPa composite PSCs clustered together, forming a distinct group separate from the diploid contributor lines (FIG. 10E). This suggests the mitochondrial genome has an overall minimal impact on the global transcriptional profde of composite PSCs. 21 differentially expressed protein-coding homologs between HsPaHsand HsPaPacomposite PSCs were identified, suggesting that while hominid mitochondrial genomes are largely interchangeable, they exert a modest but consistent influence on composite PSC transcriptomes (FIG. 10F).
[0178] Among the most upregulated genes in HsPaHscomposite PSCs compared to HsPa “ were three disease-associated genes: TIMM17B, SURF1, and PCDHA6 (FIG. 10G). RT-qPCR analysis confirmed the elevated expression of these genes in HsPcP composite PSCs (FIG. 10H). SURF1 mutations are known causes of Leigh syndrome, a neurological disorder associated with cytochrome c oxidase deficiency. TIMM17B encodes an integral subunit of the TIM23 complex, which imports ~60% of all mitochondrial proteins into the mitochondria and is implicated in mitochondrial and Parkinson's disease. PCDHA6 is a protocadherin that is predominantly expressed in the nervous system and linked to intellectual disabilities and perturbed telencephalic development. The upregulation of these genes in HsPatIScomposites suggests that composites harboring the human mitochondrial genome can exhibit enhanced mitochondrial activity, potentially providing greater support for developmental processes. To investigate this, oxygen consumption rates (OCR) and extracellular acidification rates (ECAR) were measured in the contributor lines and lsPa mitochondrial -composites. While parental hESCs and oiPSCs exhibited similar oxygen consumption and glycolytic rates, Hs a,!>' composites displayed a more oxidative metabolism, while HsPcfacomposites were more glycolytic (FIGs. 101, 10J, 11H, and 111). Metabolomic profiling oiHsPa mitochondrial-composite PSCs was performed and identified 15 metabolites with moderately differential abundances (unadjusted p < 0.05) between those harboring human or orangutan mtDNA (FIGs. 10K and 11J). 13 of 15 were upregulated in HsPaFacomposites, while alanine and 3 -hydroxybutyrate (3-OHB), key components of mitochondrial metabolic pathways, were specifically upregulated in HsPa' composites. These findings indicate a modest functional divergence in metabolic programming influenced by the mitochondrial genome.
[0179] Taken together, these findings indicate that despite being separated by millions of years of evolution, hominid mitochondrial genomes are remarkably interchangeable, as the global transcriptional and metabolic profiles of HsPa mitochondrial-composites were highly similar. Still, mtDNA divergence can be sufficient to drive subtle but distinct transcriptional and metabolic differences, underscoring the influence mitochondrial genome divergence has on cellular phenotypes.Example 6: In vivo mitochondria depletion through transgenic expression of OMM-PINK1 and PRKN
[0180] Current methods for inducing enforced mitophagy rely on mitochondrial uncouplers such as A / O or CCCP. While effective in vitro, these compounds are unsuitable for in vivo studies due to their toxicity. PINK1 was targeted to the outer mitochondrial membrane (OMM) and PRKN was overexpressed to activate mitophagy in vivo (FIG. 12A). A modified version of PINK1 with an N-tcrminal OMM transmembrane signal peptide from the CDGSH iron-sulfur domain-containing protein 1 (CISDI) was generated to direct an autophagy receptor to the OMM. In hESCs under doxycycline (DOX) control, co- overexpression of 0MM-PINK1 with PRKN reduced mtDNA abundance by -80% within 72 h (FIG. 13A). A puromycin resistance gene was included alongside OMM-PINK1 and PRKN to allow for the selection of cells specifically expressing the transgenes (FIG. 13B). COXIV staining and loss of Mito-EGFP signal revealed that this method induced the complete and uniform depletion of mitochondria from hESCs, like A / O treatment (FIG. 12B).
[0181] To evaluate the in vivo potential of this method, a doxycycline -inducible vector encoding Mito- EGFP, 0MM-PINK1, and PRKN into ICR mESCs was prepared. Using these engineered mESCs, whole mouse embryos were generated via tetrapioid complementation. To activate transgene expression, DOX was administrated starting at E7.5 through daily intraperitoneal injection for two consecutive days (FIG. 13C). Dissection at E9.5 revealed EGFP signal exclusively in DOX-treated embryos, confirming transgene activation. EGFP -expressing embryos expressing exhibited an average -40% reduction in mtDNA levels compared to untreated controls (FIGs. 13D and 13E). These results demonstrate the efficacy of our transgenic enforced mitophagy system in reducing mitochondrial abundance in vivo.
[0182] Combined 0MM-PINK1 and PRKN expression can be used to study how the depletion of mitochondria at the organellar level influences mammalian pre-implantation embryonic development. To this end. mRNAs (200 ng / pL each) encoding m Scarlet-tagged 0MM-PINK1 (0MM-PINK1 and EGFP- tagged PRKN (PRKN) were microinjected into mouse zygotes (FIG. 12C). After 24 h, fluorescent signals of 0MM-PINK1 and PRKN were clearly visible (FIG. 12D). 0MM-PINK1 signal displayed a punctate pattern, indicating its localization and accumulation on mitochondria. Similarly, PRKN signal exhibited a punctate distribution, but only when co-expressed with 0MM-PINK1 (FIG. 13F). This suggests that PRKN is specifically recruited to mitochondria in the presence of 0MM-PINK1. After 3 days of culture, mitochondrial content was quantified by measuring mtDNA abundance in morula- and blastocyst-stage embryos, revealing a -32% reduction in mtDNA levels (FIG. 12E).
[0183] To determine whether a threshold of mitochondrial reduction exists that interferes with preimplantation development, mouse zygotes were microinjected with varying concentrations of OMM- PINK1 / PRKN mRNA (20 - 400 ng / pL each) (Table 3). This approach revealed a dose-dependent reduction in average mtDNA levels across embryos three days after injection (20 ng / pL: no reduction; 100 ng / pL:22.2% reduction; 200 ng / pL: 35.8% reduction; 400 ng / pL: 36.2% reduction) (FIG. 12F). While injection of 0MM-P1NK1 or PRKN alone (400 ng / pL) had no detectable impact on embry o development, coinjection of OMM-PPNKPR N revealed a clear dose-dependent effect on the speed of developmental progression (20 and 100 ng / pL: no developmental delay; 200 ng / pL: moderate developmental delay; 400 ng / pL: severe developmental delay) (FIGs. 12G and 13G; Table 4). Increasing concentrations of OMM- PINKl / PRKNhad minimal impact on overall embryo viability (FIG. 13H). These findings demonstrate that PINKl / PRKN-based enforced mitophagy can significantly delay pre-implantation development. This aligns with recent studies suggesting that reduced mitochondrial metabolism is associated with slower embryonic development rates.
[0184] To assess whether PINKl / PRKN-based enforced mitophagy impacts post-implantation development, 2-cell embryos were transplanted into the oviducts of surrogate mothers (0.5dpc) after injecting medium (200 ng / pL each) and high (400 ng / pL each) concentrations of OMM-PINKHPRKN. Dissection at E8.5 revealed that none of the high-dose embryos implanted (0 decidua out of 15 transferred embry os), whereas most medium -dose (34 / 40 transferred embry os) and control embry os (30 / 38 transferred embry os) successfully implanted (FIGs 12H and 131). The number of post-implantation embry os fonned was comparable between the medium-dosed group (25 / 40 transferred embryos) and the control group (26 / 38 transferred embryos) (FIG. 13J). Quantification of mtDNA abundance revealed that the mitochondrial reduction persisted at E8.5 but fully recovered by E12.5 (FIG. 121). Embryo length was measured at E8.5 and E12.5 and found no difference between 0MM-P1NK1 / PRKN -injected and control embry os (FIGs. 13K-13N). Remarkably, embry os injected with medium-dose (200 ng / pL each) of OMM- PINK1 / PRKN eventually developed into live-bom pups that grew to adulthood without any overt abnormality, indicating that transient moderate reduction in mitochondrial content during early embryonic development is recoverable and does not disrupt embryonic or postnatal development (FIG. 130).
[0185] Together, these results demonstrate that PINKl / PRKN-based transgenic enforced mitophagy method effectively reduces mitochondrial abundance in vivo. While a substantial reduction significantly delays pre-implantation development and disrupts implantation, embry os subjected to a moderate reduction can recover, ultimately resulting in successful live births.Table 3: Summary of embryo survival and development with microinjection of varying concentrations of OMM-PINK1 and PRKN mRNAsTable 4: Summary of embryo survival and development with microinjection of high concentration of OMM-PINK1 / PRKN m RNAExample 7: Reduced mitochondrial abundance decreases migrating primordial germ cells (PGCs in embryos
[0186] The effect of mitochondrial depletion on migration of PGCs was determined. Zygotes were microinjected with water (control) or 0MM-PINK1 / PRKN mRNA and implanted in surrogate mothers. The embryos were then harvested 9.5 days post coitum (dpc) and dissected. The samples were stained for OCT4 expression and counterstained with DAPI to identify nuclei. Embryos with mitochondrial depletion due to OMM-PINK1 / PRKN mRNA showed reduced PGC migration as compared to embryos derived from control zygotes (FIG. 14A). Linear regression analysis of OCT4+cells show a reduction of PGCs in embryos with reduced mitochondrial abundance following enforced mitophagy (FIG. 14B).
[0187] Despite the reduction in PGC migration following enforced mitophagy, the transient reduction of mitochondrial abundance during development did not affect mouse fecundity later in life. Zygotes were injected with water or OMM-PINK1 / PRKN as described above and implanted into surrogatemothers. Gonads were harvested from 12.5 dpc male and female embryos and analyzed for outward appearance and dissected and stained for OCT4 expression and counterstained with DAPI to identify nuclei. Some embry os were allowed to gestate to birth. Mice resulting from the control and mitochondrial depleted embryos were compared and reproductive ability was tested by comparing the number of pups bom following mating between: i) a female mouse derived from a mitochondrially depleted embryo and a normal male; ii) a normal female mouse and a male mouse derived from a mitochondrially depleted embryo: and iii) a normal female mouse and normal male mouse.
[0188] Male and female embry onic gonads from 12.5 dpc embry os derived from zygotes injected with water (control) or OMM-PINK1 / PRKN were similar in appearance (FIG. 15A), female gonad length (FIG. 15B) and OCT4 expression (FIG. 15C). Mice resulting from an embryo with transiently reduced mitochondrial abundance appear normal in adulthood (FIG. 15D). Testes and ovaries from these mice appeared normal in H&E and PAS staining (for testes) and H&E staining (for ovaries) (FIG. 15D). Mice resulting from embryos with transient reduction of mitochondria abundance via enforced mitophagy were fecund.Example 8: Creation of mice for enforced mitophagy
[0189] A murine model of enforced mitophagy was created utilizing CRE -expressing animals to control the timing of the enforced mitophagy during gonadogenesis. Transgenic constructs with expression start timings are shown in FIG. 16A. Table 5 shows the success rate for generating CRE-expressing transgenic mice based on the location of the CRE element. CRE expression in the relevant tissue can be seen in immunostaining for CRE in testicular and ovarian sections from the transgenic mice. Counterstaining with DAPI was used to show the nuclei (FIG. 16B).Table 5: Overview of transgenic mouse generation and outcomes.Injection pups2-cellTg fragment # eggs Survived Total Tg+Stra8-Cre 144 105 93 17 4Clgn-Cre 84 65 57 20 3Prml-Cre 144 116 113 12 3Gdf9-Cre 130 94 88 9 4Zp3-Cre 78 64 61 20 4
[0190] Knockin (KI) mice were generated to control enforced mitophagy. In an exemplary embodiment, donor DNA that includes an enforced mitophagy element was inserted between exon 1 and exon 2 of the Rosa26 locus (FIG. 17A). Tire enforced mitophagy element was under control of a lox-stop-lox (LSL) sequence such that when CRE is expressed, the enforced mitophagy element is expressed. A representative enforced mitophagy can be a sequence encoding 0MM-PINK1 / PRKN, potentially linked to a fluorescent tag (e.g., mito-GFP) (FIG. 17B). Insertion of the enforced mitophagy element was confirmed via PCR with a first set of primers (e.g., Fwl: GCCCCACACTTATTGGCCGG (SEQ ID NO: 37) and Rvl: GTCATTGACGTCAATAGGGG (SEQ ID NO: 38)) a second set of primers (e.g., Fw2: TGTGGCTGCGAGTGGAACCG (SEQ ID NO: 39) and Rv2:GCAGACTTACAGCGGATCGGGCGGGGAGGCGGCCCAAAGG (SEQ ID NO: 40)), and a third set of primers (e g., Fw3: TCTCTCAGTTGGGGGGGCGC (SEQ ID NO: 41) and Rv3: AGTGGCTCATTAGGGAATGC (SEQ ID NO: 42)) (FIG. 17C). The full length vector is represented by SEQ ID NO: 43
[0191] KI mice can also be prepared with a Tet-On inducible expression system to utilize tetracycline to induce expression of an enforced mitophagy element. In a representative embodiment, an OMM- PINK1 / PRKN enforced mitophagy element was inserted into a donor DNA vector under a Cyp 17 promoter and an rtTA element under a CAG promoter (FIG. 18A). Insertion of the enforced mitophagy element was confirmed via PCR with the first set of primers described above (FIG. 18B).
[0192] KI mice with and without timed expression of Cre were generated. KI mice that do not express Cre (e.g., LSL-enforced mitophagy KI) show an abundance of green spermatids indicating normal mitochondrial abundance, as indicated by Mitotracker™. However, KI mice crossed with Prml-Cre transgenic mice (LSL-enforced mitophagy KI & Prm 1 -Cre) showed a significant reduction in mitochondrial abundance due to the in vivo activation of enforced mitophagy due to timed CRE expression (FIG. 19A). The length of Mitotracker™ regions (mitochondrial sheath) was comparable between the two genotypes (FIG. 19B). Mitochondrial abundance was quantified by immunoblotting. Samples from KI mice with and without Prml-Cre expression were harvested separated via gel electrophoresis. Sample loading was confirmed by detection of acetylated tubulin (FIG. 20A). Mitochondrial abundance was measured by COXIV expression (FIG. 20B). Relative COXIV expression was determined by normalizing the COXIV staining against the loading control. Normalized signal intensity of COXIV immunoblotting indicated an approximately 60% reduction in mitochondrial abundance in KI Prml-Cre mice (spermatogenic enforced mitophagy) as compared to control KI mice (FIG. 20C).
[0193] Example 9: Animals derived from embryos having reduced mitochondrial abundance are fecund
[0194] Animals derived from embryos having reduced mitochondrial abundance were evaluated for their fecundity. KI and KI Prml-Cre mice were generated as above and maintained until adulthood. Spermatozoa were harvested and incubated in in vitro fertilization (IVF) pre -incubation medium (FIG.21 A). Spermatozoa isolated from KI mice displayed normal motility. Spermatozoa from KI Prm l-Cre mice displayed reduced motility due to abnormal rotational motility. (FIG. 2 IB). Spermatozoa from KI or KI Prml-Cre mice (2xl05spcrmatozoa / mL) were harvested and incubated with the cumulus-intact eggs from unmodified female mice (FIG. 22A). Incubation with spermatozoa from mice derived from KI zygotes (e.g., without enforced mitophagy) displayed a fertilization rate of 97%. Fertilization with spennatozoa from mice derived from KI Pnnl-Cre zygotes was also successful, albeit at a reduced rate of 42%.Summary of examples
[0195] In summary, by leveraging the PINK1 / PRKN pathway, the method disclosed herein represents a robust enforced mitophagy strategy that enables the reduction or complete removal of mitochondria in vitro and in vivo. This approach allowed for the generation of pure populations of PSCs devoid of mitochondria. Multi-omics analyses found that despite significant transcriptomic differences between control and mitochondria-depleted ESCs, the expression of pluripotency genes remained largely unaffected immediately after mitochondrial removal. However, over several days, a gradual loss of core pluripotency transcription factors was observed. Metabolomic analyses revealed that this decline was preceded by metabolic alterations in mitochondria-depleted PSCs, characterized by reduced levels of key epigenetic substrates such as SAM and acetyl-CoA, and the accumulation of 2-HG.
[0196] Protcomic analysis revealed that many nuclcar-cncodcd mitochondrial proteins remain unchanged in PSCs without mitochondria. Mitochondria-depleted PSCs described herein present a unique and valuable system to explore non-canonical roles of nuclear-encoded mitochondrial proteins.
[0197] A complete panel of human-NHH interspecies composite PSCs was also generated, finding that fusion products between human and bonobo, gorilla, and orangutan generate stable composite PSCs. Generation of these cells involved a species-biased mtDNA selection process, with all composite PSCs preferentially retaining the human mitochondrial genome. Tire use of enforced mitophagy to deplete human mitochondria prior to cell fusion enabled creation of a comprehensive panel of human-NHH interspecies composite PSCs with NHH mtDNA contribution. No composite PSCs maintained a stable mixed mtDNA contribution from both species. By generating composite PSCs that retain nuclear genomes from both species but inherit only one mitochondrial genome, the methods described herein provide a unique platform to investigate mitochondrial function across species. Mitochondrial composite PSCs (e.g. HsPf1and IIsl,t' HsPpHsand IIsPp'1") share identical nuclear genetic backgrounds but differ in mitochondrial genotype, enabling direct comparisons within the same cellular contexts. Additionally, the presence of nuclear-encoded mitochondrial factors from both species mitigates incompatibilities observed in human- NHH xenomitochondrial cybrids, such as the incompatibility of human nuclear genome with orangutan mtDNA or oxidative phosphorylation defects in human-chimpanzee pairings. By incorporating both humanand NHH nuclear genomes, the disclosed model supports functional mitochondrial cooperation across species.
[0198] Tire disclosed system offers an unprecedented opportunity to study mitochondrial-nuclear interactions across evolutionary boundaries. Future studies using composite PSCs (e.g., human-NHH composite PSCs) can uncover mechanisms of mitochondrial-nuclear incompatibility and expand interspecies cell fusion studies to more evolutionarily distant species. Additionally, this approach serves as a powerful tool for modeling disease (e.g., human disease), enabling the generation of genetically identical tetrapioid cells with distinct mitochondrial genomes to assess the impact of pathogenic mtDNA mutations. As these composite PSCs maintain pluripotency, they also provide a valuable system for studying mitochondrial function in differentiated cells and developmental contexts.
[0199] Metabolomic and transcriptomic analyses of HsPaHsand HsPcfacomposites highlight the remarkable cross compatibility of hominid mitochondrial genomes in supporting pluripotency in composite PSCs. Despite millions of years of independent evolution, only a narrow set of transcriptional and metabolic effects induced by replacing human mitochondria with those of orangutan were detected. These included the differential expression of SURF1, TIMM17B, and PCDH6, all of which are linked to human development and disease, as well as metabolites whose levels varied based on mitochondrial origin. Hie mitochondrial genome encodes only 13 ETC polypeptides, and HsPa composites with human mtDNA exhibited higher respiration rates than those with orangutan mtDNA, suggesting that gene expression differences can arise from variations in mitochondrial activity. These differences likely stem from mito- nuclear interactions between the composite nuclear genome and either the human or orangutan mitochondrial genome. Given that HsPa composite PSCs likely contain chimeric mitochondria with both human and orangutan nuclear-encoded mitochondrial proteins, variations in mitochondrial properties such as signal transduction could also contribute to these effects. The disclosed method can aid in additional studies comparing mitochondrial composition in HsPa mitochondrial-composite PSCs and can provide further insights into these mechanisms.
[0200] A PINKl / PRKN-based transgenic enforced mitophagy system is capable of significantly reducing mitochondrial abundance in both in vitro and in vivo settings. By overexpressing an OMM- localized PINK1 in combination with PRKN, complete mitochondria-depletion in PSCs was achieved. Furthermore, co-injection of 0MM-PINK1 and PRKN mRNAs into zygotes demonstrated that reduced mitochondrial abundance, quantified by mtDNA levels, correlates with developmental delay and implantation defects. Through PINKl / PRKN-based transgenic enforced mitophagy, studies with the disclosed systema and methods revealed a threshold of mitochondrial abundance required for normal pre- and peri -implantation development. Embryos with at least -65% of normal mtDNA levels developed normally, while those below this threshold began to exhibit developmental delays and / or implantationfailure (FIG. 12J). Embryos with moderate mitochondrial reduction recovered, leading to live births and normal adulthood, underscoring the resilience of embryonic development.
[0201] Given the evolutionary conservation of the PINK1 / PRKN mitophagy pathway across many eukaryotic species, the methods disclosed herein offer broad potential for application in diverse model organisms. The disclosed methods can enable precise, spatiotemporal modulation of mitochondrial abundance in vivo, including the generation of cells with minimal or no mitochondria. Such capabilities would unlock new opportunities to investigate additional roles of mitochondria in development, tissue homeostasis, disease progression, and aging across species.Table 6: Sequences
Claims
CLAIMSWhat is claimed is:
1. A method of generating mitochondria-depleted pluripotent stem cells (mdPSCs) comprising culturing pluripotent stem cells (PSCs) in a culture medium and maintaining the PSCs in the culture medium for about 1 day to about 7 days, wherein the culture medium comprises antimycin A and oligomycin A; and wherein mdPSCs arc generated.
2. The method of claim 1, wherein the PSCs are selected from the group consisting of human PSCs, non-human primate PSCs, rodent PSCs, canine PSCs, feline PSCs, porcine PSCs, bovine PSCs, ovine PSCs, and equine PSCs.
3. Tire method of claim 1 or claim 2, wherein the PSCs are selected from the group consisting of induced PSCs (iPSCs), embryonic stem cells (ESCs), and epiblast-derived stem cells (EpiSCs).
4. The method of any one of claims 1 to 3, wherein the PSCs are cultured in a three-dimensional culture device.
5. Tire method of claim 4, wherein the three-dimensional culture device is coated with a composition selected from the group consisting of reconstituted basement membrane derived from extracts of Engelbreth-Holm-Swarm mouse tumor, a basement membrane extract, and a hydrogel that mimics natural extracellular matrix.
6. Tire method of any one of claims 1 to 5, wherein the culture medium comprises between about 0.01 pM and about 5 pM antimycin A and between about 0.01 pM and about 5 pM oligomycin A.
7. The method of claim 6, wherein the culture medium comprises about 1 pM antimycin A and about 1 pM oligomycin A.
8. A method of generating mitochondria-depleted pluripotent stem cells (mdPSCs) comprising overexpressing Parkin (PRKN) in pluripotent stem cells (PSCs). wherein mdPSCs are generated.
9. The method of claim 8, comprising transfecting the PSCs with a vector comprising a nucleic acid sequence encoding PRKN operably linked to a promoter.
10. The method of claim 9, wherein the vector is a plasmid.
11. The method of any one of claims 8 to 10, further comprising overexpressing PTEN-induced kinase 1 (PINKl) in the PSCs.
12. Tire method of claim 11, comprising transfecting the PSC with a vector comprising a nucleic acid sequence encoding PINK1 operably linked to a promoter.
13. The method of claim 12, wherein PINK1 is targeted to an outer mitochondrial membrane (OMM).
14. Tire method of claim 13, wherein the vector further comprises a vector encoding an N-terminal OMM transmembrane signal peptide.
15. The method of claim 14, wherein the N-terminal OMM transmembrane signal peptide comprises a CDGSH iron-sulfur domain -containing protein 1 (CISDI).
16. Tire method of any one of claims 12 to 15, wherein PRKN and PINK1 are provided in a single vector.
17. The method of any one of claims 9 to 16, comprising microinjecting the vector into a zygote.
18. The method of any one of claims 9 to 17, wherein the PRKN is conjugated to a label.
19. Tire method of claim 18, wherein the label is EGFP.
20. The method of any one of claims 8 to 19. further comprising treating the PSCs with antimycin A and oligomycin A.
21. Tire method of claim 20, wherein tire PSCs are treated with between about 0.01 pM and about 5 pM antimycin A and between about 0.01 pM and about 5 pM oligomycin A.
22. The method of claim 20 or claim 21, wherein the PSCs are treated with about 1 pM antimycin A and about 1 pM oligomycin A.
23. The method of any one of claims 8 to 22, wherein the PSCs are selected from the group consisting of human PSCs. non-human primate PSCs, rodent PSCs, canine PSCs, feline PSCs. porcine PSCs, bovine PSCs. ovine PSCs, and equine PSCs.
24. The method of any one of claims 8 to claim 23, wherein the PSCs are selected from tire group consisting of induced PSCs (iPSCs), embry onic stem cells (ESCs), and cpiblast-dcrivcd stem cells (EpiSCs).
25. The method of any one of claims 8 to 24, wherein the PSCs are cultured in a three-dimensional culture device.
26. Tire method of claim 25, wherein the three-dimensional culture device is coated with a composition selected from the group consisting of reconstituted basement membrane derived from extracts of Engelbreth-Holm-Swarm mouse tumor, a basement membrane extract, and a hydrogel that mimics natural extracellular matrix.
27. A method of generating a composite PSC comprising:(a) culturing a first PSC and a second PSC in a three-dimensional culture device that comprises a first culture medium comprising a ROCK inhibitor for about 1 to about 7 days;(b) removing the first culture medium and adding a second culture medium that does not comprise the ROCK inhibitor;(c) adding a fusion buffer and maintaining cells in the culture for about 30 seconds to about 5 minutes;(d) removing the fusion buffer and washing the cells with a wash buffer; and(e) incubating the cells in a third culture medium comprising chroman, emricasan, trans-ISRIB, and polyamine supplement (CEPT) for about 1 minute to about 2 hours to obtain composite PSCs.
28. Tire method of claim 27,wherein the first PSC is selected from the group consisting of human PSCs, non-human primate PSCs, rodent PSCs, canine PSCs, feline PSCs, porcine PSCs, bovine PSCs, ovine PSCs, and equine PSCs; wherein the second PSC is selected from the group consisting of human PSCs, non-human primate PSCs, rodent PSCs, canine PSCs. feline PSCs, porcine PSCs, bovine PSCs, ovine PSCs, and equine PSCs; and wherein the first PSC and second PSC are from different species.
29. Tire method of claim 27 or claim 28, wherein the first PSC is a human PSC and the second PSC is a non-human primate PSC.
30. The method of any one of claims 27 to 29, wherein the first PSC is a human PSC and the second PSC is selected from the group consisting of a bonobo PSC, chimpanzee PSC, gorilla PSC, and orangutan PSC.
31. The method of any one of claims 27 to 30, wherein the PSCs are selected from the group consisting of induced PSCs (iPSCs), embryonic stem cells (ESCs). and epiblast-derived stem cells (EpiSCs).
32. The method of any one of claims 27 to 31, wherein the first culture medium, second culture medium, and third culture medium are each E8.
33. The method of any one of claims 27 to 32, wherein the first PSCs and second PSCs are present in the culture medium at equal number.
34. The method of any one of claims 27 to 33, wherein the first PSCs and second PSCs are present in the culture medium at about lxl03to about 5xl07cells.
35. The method of any one of claims 27 to 34, wherein the first culture medium comprises between about 1 pM and about 15 pM of the ROCK inhibitor.
36. The method of any one of claims 27 to 35, wherein the ROCK inhibitor is Y -27632.
37. Tire method of any one of claims 27 to 36, wherein step (a) and / or step (b) further comprises replacing the culture medium daily.
38. The method of any one of claims 27 to 37, wherein the cells are washed with a wash buffer before step (c).
39. The method of any one of claims 27 to 38, wherein incubating the cells in step (e) comprises incubating in an incubator at about 30 °C to about 40 °C.
40. The method of any one of claims 27 to 39, further comprising depleting mitochondria from the first PSC, the second PSC, or both.
41. The method of claim 40, further comprising contacting the first PSC or second PSC with antimycin A and oligomycin A.
42. Tire method of claim 40, further comprising providing a vector to the first PSC or the second PSC, wherein the vector comprises a nucleotide sequence encoding Parkin (PRKN) operably linked to a promoter and wherein PRKN is overexpressed in the PSC receiving the vector.
43. The method of claim 42, wherein the vector further comprises a nucleotide sequence encoding PTEN-induced kinase 1 (PINK1) operably linked to a promoter, wherein PINK1 is overexpressed in the receiving the vector.
44. The method of claim 42, wherein the nucleotide sequence encoding PINK1 further encodes an N- terminal outer mitochondrial membrane (OMM) signal peptide.
45. The method of claim 44, wherein the OMM signal peptide comprises a CDGSH iron-sulfur domaincontaining protein 1 (CISDI).
46. The method of any one of claims 27 to 45, wherein the composite PSC has reduced abundance of mitochondria.
47. A polynucleotide comprising a nucleotide sequence encoding Parkin (PRKN) and PTEN-induced kinase 1 (PINK1), each of which operably linked to a promoter.
48. The polynucleotide of claim 47, wherein PINK1 comprises an N-terminal outer mitochondrial membrane (OMM) signal peptide.
49. The polynucleotide of claim 48, wherein the N-terminal OMM signal peptide is a CDGSH ironsulfur domain-containing protein 1 (CISDI).
50. The polynucleotide of any one of claims 47 to 49, wherein the promoter is an inducible promoter.
51. Tire polynucleotide of claim 50, wherein the promoter is a doxorubicin-inducible promoter.
52. A method of generating a non-human, tetrapioid, mitochondria-depleted embryo comprising subjecting a 2-cell stage, non-human embryo to electro cell fusion and providing the polynucleotide of any one of claims 47 to 51 to the embryo to generate the non-human, tetrapioid, mitochondria-depleted embryo.
53. A method for generating a non-human, mitochondria-depleted embryo, the method comprising delivering the polynucleotide of any one of claims 47-51 to a zygote, and maintaining the zygote for a time and under conditions for the zygote to develop to an embryo.