Ctnnb1-targeting rnai agent, and medical use thereof
By using RNAi agents targeting CTNNB1, and utilizing the double-stranded region formed by the sense and antisense strands to mediate RNA interference, the problem of increased β-catenin stability caused by CTNNB1 gene mutation was solved, achieving effective tumor suppression.
Patent Information
- Application Number
- PCT/CN2025/112673
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-07-03
- Filing Date
- 2025-08-05
- Publication Date
- 2026-02-12
AI Technical Summary
In many cancers, mutations in the CTNNB1 gene lead to increased stability of the β-catenin protein, promoting tumor development and progression, and current technologies lack effective means of inhibition.
RNAi agents targeting CTNNB1 are provided, which mediate RNA interference by forming a double-stranded region through the sense and antisense strands to inhibit CTNNB1 expression. The RNAi agents may contain modified nucleotides and targeting ligands to improve delivery efficiency.
It effectively inhibits the expression of CTNNB1, reduces the accumulation of β-catenin, suppresses tumor growth, and provides a new approach to cancer treatment.
Smart Images

Figure PCTCN2025112673-FTAPPB-I100001 
Figure PCTCN2025112673-FTAPPB-I100002 
Figure PCTCN2025112673-FTAPPB-I100003
Abstract
Description
RNAi agents targeting CTNNB1 and medical uses thereof
[0001] The present disclosure claims priority to Chinese Patent Application No. 202411065074.3, filed on August 5, 2024, Chinese Patent Application No. 202411558309.2, filed on November 4, 2024, Chinese Patent Application No. 202510074816.7, filed on January 17, 2025, Chinese Patent Application No. 202510373531.3, filed on March 27, 2025, and Chinese Patent Application No. 202510912792.8, filed on July 3, 2025, the entire contents of which are incorporated herein by reference. TECHNICAL FIELD
[0002] The present disclosure belongs to the field of biological medicine, in particular relates to RNAi agents targeting CTNNB1, compositions and medical uses thereof. BACKGROUND
[0003] Beta-catenin (β-catenin) is a core component of the Wnt signaling pathway. Under normal circumstances, the level of β-catenin is strictly regulated. When the Wnt signal is activated, β-catenin accumulates in the nucleus, activates the expression of specific genes, and promotes cell proliferation and survival. In many cancers, abnormal activation of the Wnt signaling pathway leads to excessive accumulation of β-catenin, thereby promoting tumor occurrence and development. Beta-catenin is also involved in cell-cell adhesion, particularly through interaction with E-cadherin. This interaction plays an important role in maintaining the structural integrity of epithelial cells. In many cancers, the interaction between β-catenin and E-cadherin is disrupted, leading to increased cell detachment, migration, and invasion, thereby promoting cancer metastasis. In some cancers (such as colorectal cancer and liver cancer), mutations in the CTNNB1 gene, which encodes the β-catenin protein, can lead to increased stability of the β-catenin protein, making it more likely to accumulate in the nucleus, thereby further driving tumor occurrence.
[0004] The present disclosure provides RNAi agents that inhibit CTNNB1, which can be effectively delivered to tumor cells to inhibit the expression of CTNNB1, providing a new optional way for the treatment of the above-mentioned diseases. SUMMARY
[0005] The present disclosure provides an RNAi agent targeting CTNNB1.
[0006] In some embodiments, the present disclosure provides an RNAi agent comprising a sense strand and an antisense strand forming a double-stranded region; the sense strand or the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from a nucleotide sequence set forth in any of Tables 2-4.
[0007] In some embodiments, the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from a nucleotide sequence set forth in any of SEQ ID NOs: 1-62; and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from a nucleotide sequence set forth in any of SEQ ID NOs: 63-124.
[0008] In some embodiments, the "differing by no more than 3 nucleotides" means differing by 0, 1, 2, or 3 nucleotides; and in some embodiments, the "at least 15 contiguous nucleotides" means at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides. In some embodiments, at least 17, 18, 19, 20, or 21 contiguous nucleotides.
[0009] In some embodiments, the antisense strand is at least partially complementary to a target sequence to mediate RNA interference. In some embodiments, there are no more than 5, 4, 3, 2, or 1 mismatches between the antisense strand and the target sequence. In some embodiments, the antisense strand is perfectly reverse complementary to the target sequence.
[0010] In some embodiments, the sense strand is at least partially reverse complementary to the antisense strand to form a double-stranded region. In some embodiments, there are no more than 5, 4, 3, 2, or 1 mismatches between the sense strand and the antisense strand. In some embodiments, the sense strand is perfectly reverse complementary to the antisense strand.
[0011] In some embodiments, the RNAi agent of the present disclosure comprises one or two blunt ends.
[0012] In some embodiments, the sense strand and / or the antisense strand of the RNAi agent of the present disclosure each independently comprises 1 or 2 unpaired nucleotides. In some embodiments, the 3' end of the antisense strand comprises an overhang formed by unpaired nucleotides.
[0013] In some embodiments, the sense strand and the antisense strand each independently consists of 16 to 35, 16 to 34, 17 to 34, 17 to 33, 18 to 33, 18 to 32, 18 to 31, 18 to 30, 18 to 29, 18 to 28, 18 to 27, 18 to 26, 18 to 25, 18 to 24, 18 to 23, 19 to 25, 19 to 24, or 19 to 23 nucleotides. In some embodiments, the sense strand and the antisense strand each independently consists of 18, 19, 20, 21, 22, or 23 nucleotides.
[0014] In some embodiments, the sense strand and the antisense strand are the same or different in length, the sense strand is 19-23 nucleotides in length, and the antisense strand is 19-26 nucleotides in length. Thus, the ratio of the length of the sense strand to the antisense strand of the RNAi agent provided in the disclosure can be 19 / 19, 19 / 20, 19 / 21, 19 / 22, 19 / 23, 19 / 24, 19 / 25, 19 / 26, 20 / 19, 20 / 20, 20 / 21, 20 / 22, 20 / 23, 20 / 24, 20 / 25, 20 / 26, 21 / 20, 21 / 21, 21 / 22, 21 / 23, 21 / 24, 21 / 25, 21 / 26, 22 / 20, 22 / 21, 22 / 22, 22 / 23, 22 / 24, 22 / 25, 22 / 26, 23 / 20, 23 / 21, 23 / 22, 23 / 23, 23 / 24, 23 / 25, or 23 / 26. In some embodiments, the ratio of the length of the sense strand to the antisense strand of the RNAi agent is 19 / 19, 19 / 21, 21 / 21, 21 / 23, 23 / 23, or 23 / 25. In some embodiments, the ratio of the length of the sense strand to the antisense strand is 19 / 19, 19 / 21, or 21 / 23.
[0015] In some embodiments, the sense strand comprises the nucleotide sequence set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 62; and / or the antisense strand comprises the nucleotide sequence set forth in any one of SEQ ID NO: 63 to SEQ ID NO: 124.
[0016] In some embodiments, the sense strand has the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 62; and / or the antisense strand has the nucleotide sequence as set forth in any one of SEQ ID NO: 63 to SEQ ID NO: 124.
[0017] In some embodiments, the sense strand comprises at least 19 contiguous nucleotides as set forth in SEQ ID NO: 55, and / or the antisense strand comprises at least 19 contiguous nucleotides as set forth in SEQ ID NO: 117.
[0018] In some embodiments, the sense strand comprises or has the nucleotide sequence as set forth in SEQ ID NO: 55, and / or the antisense strand comprises or has the nucleotide sequence as set forth in SEQ ID NO: 117.
[0019] In some embodiments, the sense strand has the nucleotide sequence as set forth in GUGGAUCUAUUUCAUGUUA (SEQ ID NO: 55); and the antisense strand has the nucleotide sequence as set forth in UAACAUGAAAUAGAUCCACCU (SEQ ID NO: 117).
[0020] In some embodiments, at least one nucleotide in the sense strand and / or the antisense strand is a modified nucleotide. In some embodiments, all of the nucleotides in the sense strand and / or the antisense strand are modified nucleotides.
[0021] In some embodiments, the sense strand contains three consecutive 2'-fluoro modified nucleosides. In some embodiments, the 7th, 8th, 9th, or 8th, 9th, 10thnucleoside in the sense strand, in the direction from the 5' end to the 3' end, is a 2'-fluoro modified nucleoside, and the nucleotides at the remaining positions are non-2'-fluoro modified nucleosides.
[0022] In some embodiments, the nucleoside at positions 2, 6, 12, 14, and 16 of the antisense strand, in the direction from the 5' end to the 3' end, is independently a 2'-fluoro modified nucleoside.
[0023] In some embodiments, the nucleoside at positions 2, 4, 6, 10, 12, 14, 16, 18 of the antisense strand, in the direction from the 5' end to the 3' end, is independently a 2'-fluoro modified nucleoside, and the nucleoside at the remaining position is a non-2'-fluoro modified nucleoside.
[0024] In some embodiments, the nucleoside at positions 2, 6, 12, 14, and 16 of the antisense strand, in the direction from the 5' end to the 3' end, is independently a 2'-fluoro modified nucleoside, and the nucleoside at the remaining position is a non-2'-fluoro modified nucleoside.
[0025] In some embodiments, the non-2'-fluoro modified nucleoside is a 2'-methoxy modified nucleoside, or is an inverted abasic modified nucleoside.
[0026] In some embodiments, at least one of the phosphodiester groups in the sense strand and / or the antisense strand is a phosphodiester group having a modification group. The modification group provides for increased stability of the RNAi agent in a biological sample or environment. In some embodiments, a plurality of the phosphodiester groups having a modification group are included in the sense strand and / or the antisense strand. In some embodiments, a plurality of the phosphodiester groups having a modification group are included in both the sense strand and the antisense strand. In some embodiments, four phosphodiester groups having a modification group are included in the sense strand and four phosphodiester groups having a modification group are included in the antisense strand.
[0027] In some embodiments, the phosphodiester group having a modification group is present at one or more of the positions selected from: any two adjacent nucleotides between the 1st and 4th nucleotides of the 5' terminal end and / or the 3' terminal end of the sense strand, and / or any two adjacent nucleotides between the 1st and 4th nucleotides of the 5' terminal end and / or the 3' terminal end of the antisense strand. For example, the phosphodiester group having a modification group can be located between the 1st and 2nd nucleotides of the 5' terminal end of the sense strand;
[0028] the 2nd and 3rd nucleotides of the 5' terminal end of the sense strand;
[0029] the 1st and 2nd nucleotides of the 3' terminal end of the sense strand;
[0030] the 2nd and 3rd nucleotides of the 3' terminal end of the sense strand;
[0031] the 1st and 2nd nucleotides of the 5' terminal end of the antisense strand;
[0032] the 2nd and 3rd nucleotides of the 5' terminal end of the antisense strand;
[0033] the 1st and 2nd nucleotides of the 3' terminal end of the antisense strand; and
[0034] the 2nd and 3rd nucleotides of the 3' terminal end of the antisense strand.
[0035] In some embodiments, the phosphodiester group having a modification group is a phosphorothioate group.
[0036] In some embodiments, the 5' position of the first nucleotide of the 5' terminus of the antisense strand comprises a phosphodiester group with a modifying group. In some embodiments, the phosphodiester group with a modifying group is a 5'-vinyl phosphodiester group (5'-VP), which can be a 5'-E-VP isomer (i.e., a trans-vinyl phosphodiester group), a 5'-Z-VP isomer (i.e., a cis-vinyl phosphodiester group), or a mixture thereof.
[0037] In some embodiments, the vinyl phosphodiester group is a 5'-E-VP isomer (i.e., a trans-vinyl phosphodiester group).
[0038] In some embodiments, at least one modified nucleoside in the sense strand and / or the antisense strand is an inverted abasic modified nucleoside.
[0039] In the context of the present disclosure, the inverted abasic modified nucleoside has a structure as shown in Formula (III), as shown in Formula (III'), or as shown in Formula (III"), unless specified otherwise, wherein when the inverted abasic modified nucleoside is the first nucleoside at the 5' terminus of the sequence, it has a structure as shown in Formula (III), when it is the first nucleoside at the 3' terminus, it has a structure as shown in Formula (III'), and when it is in the middle of the sequence, it has a structure as shown in Formula (III"):
[0040] In some embodiments, the RNAi agent contains one or two inverted abasic modified nucleosides. In some embodiments, the inverted abasic modified nucleoside is in the sense strand. In some embodiments, the inverted abasic modified nucleoside is at the first position from the 5' terminus of the sense strand and / or at the first position from the 3' terminus of the sense strand.
[0041] In some embodiments, the RNAi agent contains two inverted abasic modified nucleosides at the first position from the 5' terminus of the sense strand and at the first position from the 3' terminus of the sense strand.
[0042] In some embodiments, the RNAi agent comprises at least one structure as shown in Formula (I'): wherein,
[0043] X1, X2are each independently a covalent bond, O, or C1-C3 alkylene;
[0044] X3is N or CH;
[0045] R1, R2are each independently selected from C1-C6alkylene or a covalent bond, said C1-C6alkylene is optionally substituted with one or more Ra, each Ra is independently selected from oxo, C1-C6alkyl, C1-C6alkoxy, hydroxyl, or halogen;
[0046] R3is selected from 3- to 12-membered cycloalkyl, 3- to 12-membered heterocyclyl, 5- to 12-membered aryl, or 5- to 12-membered heteroaryl, said 3- to 12-membered cycloalkyl, 3- to 12-membered heterocyclyl, 5- to 12-membered aryl, or 5- to 12-membered heteroaryl is optionally substituted with one or more Rb, each Rb is independently selected from oxo, C1-C6alkyl, halogen, hydroxyl, cyano, carbonyl, hydroxyl;
[0047] Optionally, one or more hydrogen atoms in the structure of Formula (I’) can be replaced with deuterium atoms.
[0048] In some embodiments, the structure of Formula (I’) and any one of the nucleotide sequences in the RNAi agent is linked to the 5’-terminal first nucleoside.
[0049] In some embodiments, the structure of Formula (I’) and the nucleotide sequence is linked to the 5’-terminal first nucleoside, wherein R2in the structure of Formula (I’) is linked to the 5’-terminal of the 5’-terminal first nucleoside via a linking group, R1is directly linked to the hydroxyl, or R1is linked to the delivery group via a linking group. Each of the linking groups is independently selected from -O-, a phosphodiester group, or a phosphodiester group with a modification group. In some embodiments, the phosphodiester group with a modification group is a phosphorothioate group.
[0050] In some embodiments, the structure of Formula (I’) and the nucleotide sequence is linked to the 3’-terminal first nucleoside, wherein R1in the structure of Formula (I’) is linked to the 3’-terminal first nucleoside via a linking group, R2is directly linked to the hydroxyl, or R2is linked to the delivery group via a linking group. Each of the linking groups is independently selected from -O-, a phosphodiester group, or a phosphodiester group with a modification group. In some embodiments, the phosphodiester group with a modification group is a phosphorothioate group.
[0051] In some embodiments, the RNAi agent comprises at least one structure of Formula (I’-1): wherein a represents a direction toward the 3’-terminal of the oligonucleotide sequence, and b represents a direction toward the 5’-terminal of the oligonucleotide sequence.
[0052] In some embodiments, the structure of Formula (I’-1) is selected from:
[0053] In some embodiments, the structure of Formula (I’) is selected from: wherein a represents a direction toward the 3' end of the oligonucleotide sequence, and b represents a direction toward the 5' end of the oligonucleotide sequence.
[0054] In some embodiments, the 5' terminal and / or 3' terminal first nucleoside of any one of the nucleotide sequences in the structure represented by Formula (I'-1), (I'-2), (I'-3) and the RNAi agent is linked.
[0055] In some embodiments, the structure represented by Formula (I'-1), (I'-2), (I'-3) is linked to the 5' terminal and / or 3' terminal first nucleoside of any one of the nucleotide sequences in the RNAi agent via a phosphodiester group or a phosphodiester group having a modification group.
[0056] In some embodiments, the 5' terminal and / or 3' terminal first nucleoside of the sense strand of the structure represented by Formula (I'-1), (I'-2), (I'-3) and the RNAi agent is linked.
[0057] In some embodiments, the structure represented by Formula (I'-1), (I'-2), (I'-3) is linked to the 5' terminal and / or 3' terminal first nucleoside of the sense strand of the RNAi agent via a phosphodiester group or a phosphodiester group having a modification group.
[0058] In some embodiments, the phosphodiester group having a modification group is a phosphorothioate group.
[0059] In some embodiments, the RNAi agent comprises at least one structure represented by Formula (I''): wherein,
[0060] X is selected from O or C(R X )2;
[0061] each R X is independently selected from hydrogen, halogen, C 1-6 alkyl, said C 1-6 alkyl is optionally substituted with one or more substituents selected from R A , said R A is selected from halogen, hydroxyl, cyano, oxo;
[0062] R 1A , R 1B are each independently selected from hydrogen, hydroxyl, C 1-6 alkyl, C 1-6 alkoxy, amino or halogen, said C 1-6 alkyl, C 1-6 alkoxy, amino is optionally substituted with one or more substituents selected from R A , said RA Selected from halogens, hydroxyl groups, cyano groups, and oxo groups;
[0063] Or R 1A R 1B With and R 1A R 1B The bonded carbon atoms form a 3- to 6-membered heterocyclic group, which is optionally surrounded by one or more atoms selected from R A The substituents replaced by R A Selected from halogens, hydroxyl groups, cyano groups, and oxo groups;
[0064] In formula (Ⅰ”), R2 and R3 are each independently selected from hydrogen or C. 1-6 Alkyl, the C 1-6 Alkyl groups are optionally surrounded by one or more components selected from R A The substituents replaced by R A Selected from halogens, hydroxyl groups, cyano groups, and oxo groups;
[0065] m is selected from 0, 1, 2, or 3;
[0066] The ring A is selected from 5- to 12-membered heteroaryl groups or 3- to 12-membered heterocyclic groups;
[0067] R4 is independently selected from hydrogen, cyano, halogen, hydroxyl, amino, C 1-6 Alkyl, C 2-6 alkynyl group, C 2-6 alkenyl, -SC 1-6 Alkyl, C 1-6 Alkoxy, -N(C) 1-6 Alkyl, 2-oxo, 3- to 6-membered cycloalkyl, 6- to 10-membered aryl, 5- to 12-membered heteroaryl, 3- to 12-membered heterocyclic, -NH-(C=O)-C 1-6 Alkyl, -NH-(C=O)-C 3-6 cycloalkyl, -NH(C=O)-OC 1-6 Alkyl, -NH(C=O)-OC 3-6 Cycloalkyl, -O(C=O)NHC 1-6 Alkyl group, -O(C=O)NH-C 3-6 cycloalkyl, -(C=O)NH-C 1-6 Alkyl group, -(C=O)-NH-C 3-6 cycloalkyl, -(C=O)-C 1-6 Alkyl, -(C=O)-C 3-6 cycloalkyl, -SO2-C 1-6 Alkyl group, -SO2-C 3-6 Cycloalkyl, -SO2-NH2, -SO2-NH-C 1-6 Alkyl group, -SO2-NH-C 3-6cycloalkyl, -SO2-N(C 1-6 alkyl)2, -SO2-NH(C 3-6 cycloalkyl)2, -S(O)(NH)-C 1-6 alkyl, -S(O)(NH)-C 3-6 cycloalkyl;
[0068] n is selected from 0, 1, 2, 3, 4, or 5;
[0069] Base represents a base;
[0070] In some embodiments, n is selected from 0 or 1.
[0071] In some embodiments, the RNAi agent comprises at least one structure as shown in formula (I-5), (I-6): wherein Base represents a base, the structure shown in formula (I-5), (I-6) is linked to a nucleoside adjacent thereto via a phosphodiester group or a phosphodiester group with a modification group.
[0072] In some embodiments, the phosphodiester group with a modification group is a phosphorothioate group.
[0073] In some embodiments, the RNAi agent of the present disclosure is selected from or comprises an RNAi agent sequence as shown in any one of Table 2, Table 3, or Table 4.
[0074] In some embodiments, the sense strand is selected from or comprises a nucleotide sequence as shown in any one of SEQ ID NO: 182, SEQ ID NO: 183, SEQ ID NO: 185, SEQ ID NO: 191, SEQ ID NO: 314 to SEQ ID NO: 322.
[0075] In some embodiments, the antisense strand is selected from or comprises a nucleotide sequence as shown in any one of SEQ ID NO: 251, SEQ ID NO: 252, SEQ ID NO: 254, SEQ ID NO: 260, SEQ ID NO: 323 to SEQ ID NO: 331.
[0076] In some embodiments, the sense strand is a nucleotide sequence as shown in SEQ ID NO: 183; and the antisense strand is a nucleotide sequence as shown in SEQ ID NO: 252.
[0077] In some embodiments, the RNAi agent is a structure as follows:
[0078] In some embodiments, the RNAi agent is the following structure or a pharmaceutically acceptable salt thereof:
[0079] In some embodiments, the RNAi agent is the following structure or a pharmaceutically acceptable salt thereof:
[0080] In the above formula, the direction from left to right is the direction from 5’ end to 3’ end in the sense strand, and the direction from left to right is the direction from 3’ end to 5’ end in the antisense strand, m represents that the adjacent nucleoside to the left of the letter m is a 2’-methoxy modified nucleoside, f represents that the adjacent nucleoside to the left of the letter f is a 2’-fluoro modified nucleoside; VP represents that the 5’ end of the adjacent nucleoside to the right thereof is a trans-vinyl phosphodiester group (5’-E-VP); NA0255” represents that the position has the structure shown in the following table NA0255”, respectively.
[0081] The structures of 2’-methoxy modified nucleoside, 2’-fluoro modified nucleoside, VP and NA0255” are shown in Table 1B below. represents the ionic form of phosphorothioate diester group, represents the ionic form of phosphodiester group, represents phosphorothioate diester group, represents phosphodiester group. The structures of the ionic form of phosphorothioate diester group, the ionic form of phosphodiester group, phosphorothioate diester group and phosphodiester group are shown in Table 1A below.
[0082] In some embodiments, the RNAi agent further comprises one or more delivery groups linked to the sense strand and / or the antisense strand. In the context of the present disclosure, “linked” includes covalent and non-covalent linkage. The delivery group is capable of delivering the RNAi agent of the present disclosure to a location where CTNNB1 gene expression exists.
[0083] In some embodiments, the delivery group comprises a targeting ligand targeting the liver; in some embodiments, the targeting ligand binds to asialoglycoprotein receptor (ASGPR); in some embodiments, the targeting ligand comprises a galactose cluster or a galactose derivative cluster, the galactose derivative being selected from N-acetyl-galactosamine (GalNAc), N-trifluoroacetyl galactosamine, N-propionyl galactosamine, N-n-butyryl galactosamine or N-isobutyryl galactosamine.
[0084] In some embodiments, the delivery group can be a delivery group as disclosed in PCT application WO2023274395A, the entire contents of which are incorporated herein by reference.
[0085] In some embodiments, the delivery group has a structure as shown in Formula (I) or Formula (IV):
[0086] In some embodiments, the delivery group is linked to the 3' end of the sense strand of the RNAi agent.
[0087] In some embodiments, the delivery group is linked to the end of the RNAi agent via a phosphodiester group, a phosphorothioate group, or a phosphonate group; in some embodiments, via a phosphodiester group.
[0088] In some embodiments, the delivery group is indirectly linked to the end of the RNAi agent via a phosphodiester group, a phosphorothioate group, or a phosphonate group; in some embodiments, via a phosphodiester group.
[0089] In some embodiments, the delivery group is directly linked to the end of the RNAi agent via a phosphodiester group, a phosphorothioate group, or a phosphonate group; in some embodiments, via a phosphodiester group.
[0090] In some embodiments, the delivery group is directly linked to the 3' end of the sense strand of the RNAi agent via a phosphodiester group or a phosphorothioate group; in some embodiments, via a phosphodiester group.
[0091] In some embodiments, the sense strand is selected from or comprises a nucleotide sequence as set forth in any one of SEQ ID NO: 267 to SEQ ID NO: 270, SEQ ID NO: 272, SEQ ID NO: 277.
[0092] In some embodiments, the antisense strand is selected from or comprises a nucleotide sequence as set forth in any one of SEQ ID NO: 282 to SEQ ID NO: 285, SEQ ID NO: 287, SEQ ID NO: 292.
[0093] In another aspect, the present disclosure provides a pharmaceutical composition comprising an RNAi agent described herein, and one or more pharmaceutically acceptable excipients thereof, such as vehicles, carriers, diluents, and / or delivery polymers. Various drug delivery systems are known and can be used with the RNAi agents of the present disclosure, such as encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing RNAi agents, receptor-mediated endocytosis, construction of the nucleic acid as part of a retroviral or other vector.
[0094] In some embodiments, the pharmaceutical composition comprises a RNAi agent of the present disclosure and a liposome for encapsulating the RNAi agent, the liposome comprising a lipid compound.
[0095] In some embodiments, the lipid compound is a cationic lipid compound.
[0096] In some embodiments, the liposome can comprise a lipid compound as described in PCT application WO2013086354A, or WO2023125738A, WO2016033326A, the disclosure of which is incorporated in its entirety.
[0097] In some embodiments, the aforementioned lipid compound is selected from a compound represented by formula (A) or a salt thereof
[0098] wherein L 1 and L 2 are each independently selected from -C(O)O-, -OC(O)-, -C(O)-, -OC(O)O-, -O-, -S(O) x -, -S-S-, -C(O)S-, -SC(O)-, -NR a C(O)-, -C(O)NR a -, -NR a C(O)NR a -, -NR a C(O)O-, -OC(O)NR a -, or a bond, R a is selected from hydrogen or C 1-6 alkyl or C 2-6 alkenyl;
[0099] H 1 and H 2 are each independently selected from C 1-12 heteroalkylene, C 1-12 alkylene, C 2-12 alkenylene, and at least one of H 1 and H 2 is C 1-12 heteroalkylene;
[0100] H 3 is selected from C 1-24 alkylene, C 2-24 alkenylene, C 3-8 cycloalkylene, or C 3-8 cycloalkenylene;
[0101] R 1 and R 2 are each independently selected from C 1-24Alkyl or C 2-24 alkenyl;
[0102] R in equation (A) 3 Selected from hydrogen, -CN, -C(O)OR 4 -OC(O)R 4 -OR 5 or -NR 5 C(O)R 4 R 4 Selected from C 1-6 Alkyl or C 2-6 alkenyl, R 5 Selected from hydrogen, C 1-6 Alkyl or C 2-6 alkenyl;
[0103] In equation (A), x is selected from 0, 1, or 2.
[0104] In some embodiments, H in the compound of formula (A) or its salt 1 and H 2 At least one of them is a heteroalkyl group, and the heteroalkyl group contains at least one heteroatom selected from O, N and S.
[0105] In some embodiments, H in the compound of formula (A) or its salt 1 Selected from C 1-12 Heteroalkyl, preferably C 2-9 Heteroalkyl groups. In some embodiments, the heteroalkyl group is a heteroalkyl group containing at least one oxygen atom. In some embodiments, the heteroalkyl group is a heteroalkyl group containing two oxygen atoms. In some embodiments, the heteroalkyl group is a heteroalkyl group containing at least one nitrogen atom. In some embodiments, the heteroalkyl group is a heteroalkyl group containing at least one oxygen atom.
[0106] In some embodiments, L in the compound of formula (A) or its salt 1 and L 2 Each is independently selected from -C(O)O-, -OC(O)-, or the bond.
[0107] In some embodiments, L in the compound of formula (A) or its salt 1 and L 2 Each is independently selected from -C(O)-, -OC(O)O-, -O- or the bond.
[0108] In some embodiments, L in the compound of formula (A) or its salt 1 and L 2 Each is independently selected from -S(O) x -、-SS-、-C(O)S-、-SC(O)- or key.
[0109] In some embodiments, in the compound of formula (A) or salt thereof, L 1 and L 2 are each independently selected from -NR a C(O)-, -C(O)NR a -, -NR a C(O)NR a -, -NR a C(O)O-, or a bond.
[0110] In some embodiments, in the compound of formula (A) or salt thereof, L 1 and L 2 are each independently selected from -NR a C(O)NR a -, -NR a C(O)O-, -OC(O)NR a -, or a bond.
[0111] In another aspect, in some embodiments, in the compound of formula (A) or salt thereof, R 1 and R 2 are each independently selected from C 2-24 alkyl (including, but not limited to, C2alkyl, C3alkyl, C4alkyl, C5alkyl, C6alkyl, C7alkyl, C8alkyl, C9alkyl, C 10 alkyl, C 11 alkyl, C 12 alkyl, C 13 alkyl, C 14 alkyl, C 15 alkyl, C 16 alkyl, C 17 alkyl, C 18 alkyl, C 19 alkyl, C 20 alkyl, C 21 alkyl). In other embodiments, in the compound of formula (A) or salt thereof, R 1 and R 2 are each independently selected from C 4-18 alkyl.
[0112] In some embodiments, in the compound of formula (A) or salt thereof, R 1 and R 2 are each independently selected from branched C 4-18 alkyl.
[0113] In some embodiments, in the compound of formula (A) or salt thereof, R 1 and R 2 are each independently selected from linear C 4-18 alkyl.
[0114] In some embodiments, the compound of Formula (A) or salt thereof is one wherein R 1 is selected from linear C 4-18 alkyl, R 2 is selected from branched C 4-18 alkyl.
[0115] In some embodiments, the compound of Formula (A) or salt thereof is one wherein R 1 is selected from branched C 4-18 alkyl, R 2 is selected from branched C 4-18 alkyl.
[0116] Some embodiments provide the compound of Formula (A) or salt thereof is one wherein R 1 and R 2 are each independently selected from C 2-24 alkenyl (including, but not limited to, C2 alkenyl, C3 alkenyl, C4 alkenyl, C5 alkenyl, C6 alkenyl, C7 alkenyl, C8 alkenyl, C9 alkenyl, C 10 alkenyl, C 11 alkenyl, C 12 alkenyl, C 13 alkenyl, C 14 alkenyl, C 15 alkenyl, C 16 alkenyl, C 17 alkenyl, C 18 alkenyl, C 19 alkenyl, C 20 alkenyl, C 21 alkenyl). Other embodiments provide the compound of Formula (A) or salt thereof is one wherein R 1 and R 2 are each independently selected from C 4-18 alkenyl.
[0117] In some embodiments, the compound of Formula (A) or salt thereof is one wherein R 1 and R 2 are each independently selected from branched C 4-18 alkenyl.
[0118] In some embodiments, the compound of Formula (A) or salt thereof is one wherein R 1 and R 2 are each independently selected from linear C 4-18 alkenyl.
[0119] In some embodiments, the compound of Formula (A) or salt thereof is one wherein R 1 is selected from linear C 4-18 alkenyl, R 2 is selected from branched C 4-18 alkenyl.
[0120] In some embodiments, R 1 is selected from branched C 4-18 alkenyl, R 2 is selected from branched C 4-18 alkenyl.
[0121] Further, some embodiments provide a compound of Formula (A) wherein H
[0122] is selected from H 1 , H 2 , H 3 , R 1 , R 2 and R 3 as defined in Formula (A).
[0123] In some embodiments, H 3 is selected from C 2-24 alkylene, C 3-8 cycloalkylene, or C 3-8 cycloalkenylene; or H 3 is selected from C 1-24 alkylene. In other embodiments, H 3 is selected from C 3-8 cycloalkylene.
[0124] In some embodiments, C 2-24 alkylene includes, but is not limited to, C2alkylene, C3alkylene, C4alkylene, C5alkylene, C6alkylene, C7alkylene, C8alkylene, C9alkylene, C 10 alkylene, C 11 alkylene, C 12 alkylene, C 13 alkylene, C 14 alkylene, C 15 alkylene, C 16 alkylene, C 17 alkylene, C 18 alkylene, C 19 alkylene, C 20 alkylene, C 21 alkylene, C 22 alkylene, or C 23 alkylene.
[0125] In some embodiments, C 2-24Alkylenes include, but are not limited to, C4 alkylenes, C5 alkylenes, C6 alkylenes, C7 alkylenes, C8 alkylenes, C9 alkylenes, and C6 alkylenes. 10 Alkylene, C 11 Alkylene, C 12 Alkylene, C 13 Alkylene, C 14 Alkylene, C 15 Alkylene, C 16 Alkylene, C 17 Alkylene, C 18 Alkylene, C 19 Alkylene, C 20 Alkylene, C 21 Alkylene, C 22 Alkylene or C 23 Alkylene.
[0126] Other embodiments provide compounds of formula (A), (A-1), or (A-2) as follows:
[0127] Among them, R 6 Each is independently selected from hydrogen, hydroxyl, and C. 1-6 Alkyl or C 2-6 Alkenyl group, n is selected from an integer between 1 and 12 (including but not limited to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12), H 1 H 2 R 1 R 2 and R 3 Defined in the compound shown in formula (A).
[0128] In some embodiments, n is 2, 3, 4, 5 or 6 in the compound or salt thereof shown in formula (A-3) or (A-4).
[0129] In some embodiments, R in the compound of formula (A) or formula (A-3) or (A-4) or a salt thereof 3 Selected from -CN or hydroxyl. In some embodiments, R in the compound of formula (A) or formula (A-3) or (A-4) or a salt thereof 3 Selected from -C(O)OR 4 -OC(O)R 4 or -NHC(O)R 4 R 4 As defined in equation (A) or equation (A-1) or equation (A-2) or equation (A-3) or equation (A-4).
[0130] In some embodiments, R in the compound of formula (A) or its salt 4 Selected from C 1-6alkyl, including but not limited to methyl, ethyl, or propyl.
[0131] In some embodiments, the compound of Formula (A) is wherein X is -N(R 7 )- or -O-, o is selected from an integer between 1 and 11, p is selected from an integer between 1 and 5, and o + p is not greater than 12, R 7 is selected from hydrogen, C 1-6 alkyl, or C 2-6 alkenyl, R 8 , R 9 , R 10 , R 11 are each independently selected from hydrogen, hydroxyl, C 1-6 alkyl, or C 2-6 alkenyl, L 1 , L 2 , H 2 , H 3 , R 1 , R 2 , and R 3 are as defined in the compound of Formula (A).
[0132] In some embodiments, p is selected from 1 or 2 in the compound of Formula (A-5) or (A-6), or a salt thereof.
[0133] In some embodiments, o is selected from 4, 5, 6, 7, or 8 in the compound of Formula (A-5) or (A-6), or a salt thereof.
[0134] In some embodiments, X is -O- in the compound of Formula (A-5) or (A-6), or a salt thereof.
[0135] In some embodiments, R 8 , R 9 , R 10 , R 11 are each independently selected from hydrogen.
[0136] In some embodiments, R 10 , R 11 are each independently selected from C 1-6 alkyl.
[0137] In some embodiments, R 3 is selected from hydroxyl.
[0138] In other embodiments, the compound of Formula (A) is
[0139] In other embodiments, the compound of Formula (A) is H 2 R 1 R 2 and R 3 As defined in the compound shown in formula (A), R 8 R 9 R 10 R 11 X, o, and p are defined in the compounds shown in formula (A-5).
[0140] In some embodiments, the H in the compound of formula (A) or (A-7) or (A-8) or its salt is... 2 Selected from C 3-7 Alkylene or C 3-7 Alkenyl group.
[0141] Some implementation schemes provide the compound shown in formula (A) as follows:
[0142] Among them, H 2 R 1 R 2 and R 3 As defined in the compound shown in formula (A), R 8 R 9 R 10 R 11 X, o, and p are defined as in the compounds shown in formula (A-5), and R 6 And n is defined as in equation (A).
[0143] On the other hand, in some embodiments, R in the compound of formula (A) or its salt 1 R 2 Each has the following structure:
[0144] Where R 12a R 12b R 12c Each is independently selected from hydrogen and C. 1-12 Alkyl or C 2-12 Alkenyl, where k is an integer between 2 and 12.
[0145] In some embodiments, R in the compound of formula (A) or its salt 12c Selected from hydrogen.
[0146] In some embodiments, R in the compound of formula (A) or its salt 1 Selected from:
[0147] In some embodiments, the liposomes comprise a lipid compound as shown in formula (II) or a lipid compound as shown in formula (III):
[0148] In some embodiments, the liposome further comprises cholesterol, DSPC, and DMG-PEG 2000.
[0149] In some embodiments, the liposome comprises: (a) (b) DSPC; (c) cholesterol; and (d) DMG-PEG 2000.
[0150] In some embodiments, the liposome comprises: (a) (b) DSPC; (c) cholesterol; and (d) DMG-PEG 2000.
[0151] In some embodiments, the liposome, wherein the molar ratio of each component a, b, c, d is 50:12:36:2.
[0152] In some embodiments, the liposome, wherein the molar ratio of each component a, b, c, d is 50:10:38.5:1.5.
[0153] In some embodiments, the pharmaceutical composition can further comprise a pharmaceutically acceptable excipient and / or adjuvant, which excipient can be one or more of various preparations or compounds conventionally employed in the art. For example, the pharmaceutically acceptable excipient can include at least one of a pH buffer, a protective agent, and an osmotic pressure adjusting agent.
[0154] In some specific embodiments, the excipient is selected from sodium chloride and / or tris(hydroxymethyl)aminomethane hydrochloride (Tris-HCl).
[0155] In some embodiments, the formulation of the composition is the same as that in Table 1 of WO2016033326A, except that the DLin-MC3-DMA in the formulation of Table 1 of WO2016033326A is replaced by the lipid compound as shown in Formula (II):
[0156] In some embodiments, the formulation of the composition is selected from the following formulations:
[0157] Formulation 1:
[0158] Formulation 2:
[0159] Formulation 3:
[0160] In some embodiments, the unit dose of the pharmaceutical composition is 0.001 mg to 1000 mg.
[0161] In certain embodiments, the pharmaceutical composition contains 0.01-99.99% of the foregoing compound, or a pharmaceutically acceptable salt thereof, or an isotopically- substituted variant thereof, based on the total weight of the composition. In certain embodiments, the pharmaceutical composition contains 0.1-99.9% of the foregoing compound, or a pharmaceutically acceptable salt thereof, or an isotopically-substituted variant thereof. In certain embodiments, the pharmaceutical composition contains 0.5-99.5% of the foregoing compound, or a pharmaceutically acceptable salt thereof, or an isotopically-substituted variant thereof. In certain embodiments, the pharmaceutical composition contains 1-99% of the foregoing compound, or a pharmaceutically acceptable salt thereof, or an isotopically-substituted variant thereof. In certain embodiments, the pharmaceutical composition contains 2-98% of the foregoing compound, or a pharmaceutically acceptable salt thereof, or an isotopically-substituted variant thereof.
[0162] In certain embodiments, the pharmaceutical composition contains 0.01-99.99% of a pharmaceutically acceptable excipient, based on the total weight of the composition. In certain embodiments, the pharmaceutical composition contains 0.1-99.9% of a pharmaceutically acceptable excipient. In certain embodiments, the pharmaceutical composition contains 0.5-99.5% of a pharmaceutically acceptable excipient. In certain embodiments, the pharmaceutical composition contains 1-99% of a pharmaceutically acceptable excipient. In certain embodiments, the pharmaceutical composition contains 2-98% of a pharmaceutically acceptable excipient.
[0163] In some embodiments, the RNAi agent or pharmaceutical composition of the present disclosure inhibits the expression of a target gene by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, as determined by, for example: psiCHECK activity screening and luciferase reporter assays, other methods such as PCR or branched DNA (bDNA)-based methods, or protein-based methods such as immunofluorescence assays, e.g., Western Blot or flow cytometry, when the RNAi agent or pharmaceutical composition contacts a cell expressing the target gene.
[0164] In some embodiments, the RNAi agent or pharmaceutical composition of the present disclosure, when contacted to a cell expressing the target gene, causes a percent of remaining expression of the mRNA of the target gene of no more than 99%, no more than 95%, no more than 90%, no more than 85%, no more than 80%, no more than 75%, no more than 70%, no more than 65%, no more than 60%, no more than 55%, no more than 50%, no more than 45%, no more than 40%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 15%, or no more than 10%, as determined by, for example: psiCHECK activity screening and luciferase reporter assay, other methods such as PCR or branched DNA (bDNA)-based methods, or protein-based methods such as immunofluorescence assays, for example Western Blot, or flow cytometry.
[0165] In some embodiments, the RNAi agent or pharmaceutical composition of the present disclosure, when contacted to a cell expressing the target gene, causes a reduction in off-target activity of at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75%, while maintaining the target activity, as determined by, for example: psiCHECK activity screening and luciferase reporter assay, other methods such as PCR or branched DNA (bDNA)-based methods, or protein-based methods such as immunofluorescence assays, for example Western Blot, or flow cytometry.
[0166] In some embodiments, the RNAi agent or pharmaceutical composition of the present disclosure, when contacted to a cell expressing the target gene, causes a reduction in off-target activity of at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75%, while reducing the target activity by at most 20%, at most 19%, at most 15%, at most 10%, at most 5%, or more than 1%, as determined by, for example: psiCHECK activity screening and luciferase reporter assay, other methods such as PCR or branched DNA (bDNA)-based methods, or protein-based methods such as immunofluorescence assays, for example Western Blot, or flow cytometry.
[0167] In some embodiments, the RNAi agent or pharmaceutical composition of the present disclosure, when contacted to a cell expressing a target gene, causes at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80% increase in target activity while causing at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% decrease in off-target activity, as determined by, for example: psiCHECK activity screening and luciferase reporter assay, other methods such as PCR or branched DNA (bDNA)-based methods, or protein-based methods such as immunofluorescence assays, for example Western Blot, or flow cytometry.
[0168] In another aspect, the present disclosure provides a method of reducing CTNNB1 gene expression, comprising administering to a subject an effective amount or effective dose of the RNAi agent and / or pharmaceutical composition of the present disclosure.
[0169] In another aspect, the present disclosure provides a method of treating and / or preventing a disease associated with CTNNB1 gene expression in a subject, comprising administering to the subject an effective amount or effective dose of the RNAi agent and / or pharmaceutical composition of the present disclosure.
[0170] In another aspect, the present disclosure provides use of the RNAi agent and / or pharmaceutical composition of the present disclosure in the manufacture of a medicament for treating and / or preventing a disease associated with CTNNB1 gene expression.
[0171] In another aspect, the present disclosure provides use of the RNAi agent and / or pharmaceutical composition of the present disclosure in the manufacture of a medicament for inhibiting expression of CTNNB1.
[0172] In some embodiments, the disease is a disease associated with CTNNB1. In some embodiments, the disease is cancer, for example, colorectal cancer, gastric cancer, melanoma, ovarian cancer, endometrial cancer, prostate cancer, hepatoblastoma, hepatocellular carcinoma, lung cancer, breast cancer, medulloblastoma, chronic lymphocytic leukemia, etc.
[0173] In another aspect, the present disclosure provides a method of delivering an RNAi agent that inhibits expression and / or replication of CTNNB1 in vivo, the method comprising administering to a subject the RNAi agent and / or pharmaceutical composition of the present disclosure.
[0174] The RNAi agents or pharmaceutical compositions and methods disclosed herein can reduce the level of a target mRNA in a cell, population of cells, cell population, tissue, or subject, comprising: administering to the subject a therapeutically effective amount of an RNAi agent or pharmaceutical composition of the present disclosure, the RNAi agent linked to the delivery moiety, thereby inhibiting expression of the target mRNA in the subject.
[0175] In some embodiments, the subject has been identified as having a pathological upregulation of the target gene in the targeted cell or tissue prior to administration of the RNAi agent and / or pharmaceutical composition of the present disclosure.
[0176] The subject described in the present disclosure refers to a subject diagnosed with (or suspected of having, or susceptible to) a disease or disorder that would benefit from a reduction or inhibition of the expression of a target mRNA.
[0177] The RNAi agent and / or pharmaceutical composition of the present disclosure can be administered by local administration (e.g., direct injection, implantation, or topical administration) or systemic administration. This can include subcutaneous, intravenous, intraperitoneal, or parenteral routes of administration, such as intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, buccal, and sublingual administration, among any suitable modes of administration known in the art.
[0178] In alternative embodiments, the pharmaceutical composition provided by the present disclosure can be administered by injection, such as intravenous, intramuscular, intradermal, subcutaneous, intraduodenal, or intraperitoneal injection.
[0179] In another aspect, the present disclosure provides a cell comprising an RNAi agent of the present disclosure. The cell is incapable of developing into a whole plant or animal.
[0180] In another aspect, the present disclosure provides a kit comprising an RNAi agent and / or pharmaceutical composition of the present disclosure.
[0181] The present disclosure also provides a method for silencing a mRNA of a target gene in a cell, comprising the step of introducing into the cell an RNAi agent and / or pharmaceutical composition of the present disclosure.
[0182] The present disclosure also provides a method for silencing a target gene or a mRNA of a target gene in a cell, in vivo or in vitro, comprising the step of introducing into the cell an RNAi agent and / or pharmaceutical composition according to the present disclosure.
[0183] The present disclosure also provides a method for inhibiting the expression of a target gene or a mRNA of a target gene, comprising administering to a subject in need thereof an effective amount or effective dose of an RNAi agent and / or pharmaceutical composition according to the present disclosure.
[0184] In some embodiments, an effective amount or effective dose of the RNAi agent and / or pharmaceutical composition is about 0.001 mg / kg body weight to about 200 mg / kg body weight, about 0.01 mg / kg body weight to about 100 mg / kg body weight, or about 0.5 mg / kg body weight to about 50 mg / kg body weight.
[0185] In some embodiments, the target gene is the CTNNB1 gene and the target mRNA is the mRNA expressed by the target gene.
[0186] The present disclosure also provides a method of preparing an RNAi agent and / or pharmaceutical composition, comprising: synthesizing an RNAi agent and / or pharmaceutical composition described in the present disclosure.
[0187] The pharmaceutically acceptable salts of the compounds described in the present disclosure are selected from inorganic or organic salts, and the compounds described in the present disclosure can react with acidic or basic substances to form corresponding salts. The compounds described in the context of the present disclosure include the RNAi agents of the present disclosure.
[0188] In another aspect, the compounds of the present disclosure can exist in particular geometric or stereoisomeric forms. The present disclosure contemplates all such compounds, including cis- and trans-isomers, (-)- and (+)-enantiomers, (R)- and (S)-enantiomers, diastereomers, (D)- isomers, (L)-isomers, as well as the racemic mixtures and other mixtures thereof, such as those examples of enantiomeric or diastereomeric mixtures, all of which are intended to be within the scope of the present disclosure. Additional asymmetric carbon atoms can be present in a substituent group. All such isomers, as well as mixtures thereof, are included within the scope of the present disclosure.
[0189] In addition, the compounds and intermediates of the present disclosure can exist in different tautomeric forms, and all such forms are included within the scope of the present disclosure. The term "tautomers" or "tautomeric forms" refers to different energy structures that can interconvert via a low energy barrier.
[0190] The compounds of the present disclosure can be asymmetric, e.g., having one or more stereocenters. Unless otherwise indicated, all stereoisomers are included, such as enantiomers and diastereomers. Compounds of the present disclosure having asymmetric carbon atoms can be isolated in optically active form or as racemic mixtures. Optically active forms can be obtained, for example, by resolution of a racemic mixture or by stereospecific synthesis from an optically pure starting material. The optically active forms can be converted to the other by conventional methods.
[0191] Optically active (R)- and (S)- isomers, as well as D- and L- isomers, can be prepared by chiral synthesis, chiral reagents, or other conventional techniques. To obtain an enantiomer of a compound disclosed herein, it can be prepared by asymmetric synthesis or derivatization with a chiral auxiliary, wherein the resulting diastereomeric mixture is separated and the auxiliary group is cleaved to provide the desired enantiomer in pure form. Alternatively, when the molecule contains a basic functional group (such as an amino group) or an acidic functional group (such as a carboxyl group), a salt of the diastereomeric isomer is formed with a suitable optically active acid or base, followed by diastereomeric resolution using conventional methods known in the art, and then the pure enantiomer is recovered. Furthermore, the separation of enantiomers and diastereomeric isomers is typically accomplished by using chromatography employing a chiral stationary phase and optionally combined with chemical derivatization (e.g., from amines to carbamates).
[0192] This disclosure also includes compounds identical to those described herein, but in which one or more atoms are labeled with isotopes whose atomic weights or mass numbers differ from those commonly found in nature. Examples of isotopes that can be incorporated into compounds of this disclosure include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, iodine, and chlorine, such as... 2 H, 3 H, 11 C 13 C 14 C 13 N、 15 N、 15 O、 17 O、 18 O、 31 P, 32 P, 35 S, 18 F, 123 I, 125 I and 36 Cl, etc.
[0193] Unless otherwise specified, in the chemical structure of the compounds described in this disclosure, the bonds are... This indicates that the configuration is not specified; that is, if chiral isomers exist in the chemical structure, the bond... It can be Or simultaneously include Two configurations. Although all structural formulas described herein are represented in certain isomer forms for simplicity, this disclosure can include all isomers, such as tautomers, rotatimers, geometric isomers, diastereomers, racemates, and enantiomers. In the chemical structure of the compounds described herein, bonds... No configuration was specified, i.e., key The configuration can be E or Z, or both E and Z.
[0194] Terminology
[0195] For easier understanding of the present disclosure, some technical and scientific terms are defined below. Unless otherwise defined herein, all other technical and scientific terms used herein have the meaning commonly understood by one of ordinary skill in the art to which this disclosure belongs.
[0196] The term "alkyl" refers to saturated aliphatic hydrocarbon groups, including straight-chain and branched-chain groups. Alkyl groups containing 1 to 6 carbon atoms, non-limiting examples include methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, t-butyl, sec-butyl, n-pentyl, 1,1-dimethylpropyl, 1,2-dimethylpropyl, 2,2-dimethylpropyl, and various branched isomers thereof, and the like. Alkyl groups can be substituted or unsubstituted, and when substituted, the substituents can be substituted at any available point of attachment, preferably one or more of the following groups, independently selected from halogen, hydroxyl, oxo, cyano, amino, C 1-6 alkyl, C 1-6 alkoxy, 3- to 6-membered cycloalkyl, or 3- to 6-membered heterocycloalkyl, the alkyl, alkoxy, cycloalkyl, or heterocycloalkyl being optionally substituted with halogen, hydroxyl, nitro, cyano, or amino. In some embodiments, the alkyl group has 10-22 carbons, also referred to as a C10-22 alkylene group. In some embodiments, the alkyl group has 4-22 carbons, also referred to as a C4-22 alkylene group.
[0197] The term "alkenyl" refers to unsaturated aliphatic straight-chain or branched hydrocarbon groups, and contains one or more carbon-carbon double bonds. Exemplary alkenyl groups include C 2-8 , C 2-7 , C 2-6 , C 2-4 , C 3-12 , and C 3-6 alkenyl. Non-limiting examples include ethenyl (i.e., vinyl), 1-propenyl, 2-propenyl (i.e., allyl), 2-methyl-l-propenyl, 1-butenyl, 2-butenyl (i.e., crotyl), and the like. In some embodiments, the alkenyl group has 10-22 carbons, also referred to as a C10-22 alkenyl group. In some embodiments, the alkenyl group has 4-22 carbons, also referred to as a C4-22 alkenyl group. Alkenyl groups used in any context herein are optionally substituted in the same manner as alkyl groups.
[0198] The term "cycloalkenyl" refers to an unsaturated monocyclic or polycyclic cyclic hydrocarbon substituent and contains one or more carbon-carbon double bonds. Cycloalkenyl groups contain 3 to 20 carbon atoms, including C2-C8, C4-C6, C8-C12, C14-C18, C16-C20 cycloalkenyl groups. Additionally, the cycloalkenyl group can be fused to an aryl or heteroaryl group. Exemplary cycloalkenyl groups include, but are not limited to:
[0199] Additionally, the cycloalkenyl group can be substituted or unsubstituted, and when substituted, the substituents can be substituted at any available point of attachment, preferably one or more groups, independently selected from halogen, C 1-3 alkyl or C 1-3 alkoxy.
[0200] The term "alkynyl" refers to an unsaturated aliphatic straight chain or branched hydrocarbon group and contains one or more carbon-carbon triple bonds. Exemplary alkynyl groups include C 2-8 , C 2-7 , C 2-6 , C 2-4 , C 3-12 and C 3-6 alkynyl groups. These include, but are not limited to, ethynyl, prop-1-ynyl, but-1-ynyl, pent-1-ynyl, pent-4-ynyl and pent-1,4-diynyl. Alkynyl groups used in any context herein are optionally substituted in the same manner as alkyl groups.
[0201] "Heteroalkyl" refers to straight chain or branched alkyl groups preferably having from 1 to 14 carbons, more preferably 2 to 10 carbons, in the chain, wherein one or more carbons are replaced by a heteroatom selected from S, O and N. Exemplary heteroalkyl groups include alkyl ethers, secondary and tertiary alkyl amines, amides, alkyl sulfides and the like.
[0202] The heteroalkyl group can be unsubstituted or substituted with one or more groups selected from halogen, hydroxyl, alkyl, amino, oxo, alkenyl, alkoxycarbonyl, amido, alkylamido, dialkylamido, nitro, amino, alkylamino, dialkylamino, carboxyl, thio, and thioalkyl.
[0203] The term "alkylene" denotes the moiety remaining after removal of two hydrogen atoms from an alkane molecule, including straight chain and branched alkylene groups of 1 to 24 carbon atoms. Alkylene groups containing 1 to 6 carbon atoms, non-limiting examples include methylene (-CH2-), ethylene (e.g., -CH2CH2- or -CH(CH3)-). Unless otherwise specified, the alkylene group can be substituted or unsubstituted, and when substituted, the substituents can be substituted at any available point of attachment, preferably one or more groups, independently selected from halogen, hydroxyl, cyano, amino, C 1-6 alkyl or C 1-6Alkoxy. In some embodiments, the alkyl group has 10-22 carbons, also referred to as C10-22alkylene. In some embodiments, the alkyl group has 4-22 carbons, also referred to as C4-22alkylene.
[0204] Likewise, the definitions of "alkylene", "cycloalkylene", "heteroalkylene", "cycloalkenylene" are as for "alkyl".
[0205] The term "alkoxy" refers to -O-(alkyl), wherein alkyl is as defined above. Non-limiting examples of alkoxy groups include methoxy, ethoxy, propyloxy, isopropoxy. The alkoxy group can be optionally substituted or unsubstituted, and when substituted, the substituents are preferably one or more groups independently selected from deuterium, halogen, hydroxyl, oxo, cyano, amino, C 1-6 alkyl, C 1-6 alkoxy, 3-7 membered cycloalkyl, or 3-7 membered heterocycloalkyl, said alkyl, alkoxy, cycloalkyl, or heterocycloalkyl optionally substituted with halogen, hydroxyl, nitro, cyano, or amino.
[0206] The term "cycloalkyl" refers to saturated or partially unsaturated monocyclic or polycyclic cyclic hydrocarbon substituents, comprising 3 to 20 carbon atoms, preferably comprising 3 to 12 carbon atoms. Non-limiting examples of monocyclic cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cyclohexadienyl, and the like; polycyclic cycloalkyl groups include spiro, fused, and bridged cycloalkyl groups. The cycloalkyl group can be substituted or unsubstituted, and when substituted, the substituents can be substituted at any available point of attachment, preferably one or more groups independently selected from halogen, hydroxyl, oxo, cyano, amino, C 1-6 alkyl, C 1-6 alkoxy, 3-6 membered cycloalkyl, or 3-6 membered heterocycloalkyl, said alkyl, alkoxy, cycloalkyl, or heterocycloalkyl optionally substituted with halogen, hydroxyl, nitro, cyano, or amino.
[0207] The term "heterocycloalkyl" refers to saturated or partially unsaturated monocyclic or polycyclic cyclic hydrocarbon substituents, comprising 3 to 20 ring atoms, wherein one or more ring atoms are heteroatoms selected from nitrogen, oxygen, or S(O) m (wherein m is an integer from 0 to 2) heteroatoms, but excluding -O-O-, -O-S-, or -S-S- ring moieties, with the remaining ring atoms being carbon. Preferably, comprising 3 to 12 ring atoms, of which 1 to 4 are heteroatoms; more preferably, comprising 5 to 8 ring atoms. Non-limiting examples of "heterocycloalkyl" groups include: and the like.
[0208] The heterocycloalkyl ring can be fused to an aryl or heteroaryl ring, wherein the ring that is attached to the parent structure is the heterocycloalkyl group, non-limiting examples of which include:
[0209] etc.
[0210] Heterocycloalkyl groups can be optionally substituted or unsubstituted, and when substituted, the substituents are preferably one or more groups independently selected from halogen, hydroxy, oxo, cyano, amino, C 1-4 alkyl, C 1-4 alkoxy, 3-6 membered cycloalkyl or 3-6 membered heterocycloalkyl, said alkyl, alkoxy, cycloalkyl or heterocycloalkyl being optionally substituted with halogen, hydroxy, nitro, cyano or amino.
[0211] The term "aryl" refers to a 6- to 14-membered all-carbon monocyclic or fused polycyclic (that is, rings which share adjacent pairs of carbon atoms) rings having a conjugated pi-electron system, preferably 6- to 12-membered, such as phenyl and naphthyl. The aryl ring can be fused to a heteroaryl, heterocycloalkyl or cycloalkyl ring, wherein the ring which is attached to the parent structure is the aryl ring, non-limiting examples of which include:
[0212] Aryl groups can be substituted or unsubstituted, and when substituted, the substituents are preferably one or more groups independently selected from halogen, hydroxy, oxo, nitro, cyano, C 1-6 alkyl, C 1-6 alkoxy.
[0213] The term "heteroaryl" refers to a heteroaromatic system comprising 1 to 4 heteroatoms, 5 to 14 ring atoms, wherein the heteroatoms are selected from oxygen, sulfur and nitrogen. Heteroaryl groups are preferably 6- to 12-membered, more preferably 5- or 6-membered. For example. Non-limiting examples include: imidazolyl, furanyl, thienyl, thiazolyl, pyrazolyl, oxazolyl, isoxazolyl, pyrrolyl, tetrazolyl, pyridyl, pyrimidinyl, thiadiazole, pyrazinyl, triazolyl, indazolyl, benzimidazolyl, etc.
[0214] The heteroaryl ring can be fused to an aryl, heterocycloalkyl or cycloalkyl ring, wherein the ring which is attached to the parent structure is the heteroaryl ring, non-limiting examples of which include:
[0215] Heteroaryl groups can be optionally substituted or unsubstituted, and when substituted, the substituents are preferably one or more groups independently selected from halogen, hydroxy, cyano, amino, C 1-6 alkyl or C 1-6 alkoxy.
[0216] The above cycloalkyl, heterocycloalkyl, aryl and heteroaryl groups include residues derived from removal of one hydrogen atom from a parent ring atom, or residues derived from removal of two hydrogen atoms from the same ring atom or from two different ring atoms of the parent, i.e., "cycloalkylene", "heterocycloalkylene", "arylene", "heteroarylene". Non-limiting examples include: The skilled artisan will recognize from the context of use that the number of valences can be utilized.
[0217] The term "heterocycle" refers to a ring composed of atoms other than carbon, including heterocycloalkyl and heteroaryl groups.
[0218] The term "halogen" or "halo" means fluorine, chlorine, bromine, or iodine.
[0219] The term "oxo" means an =0 substituent.
[0220] The term "hydroxy" means an -OH group.
[0221] The term "cyano" means -CN.
[0222] The term "amino" means -NH2.
[0223] The term "nitro" means -NO2.
[0224] As used herein, "RNAi agent" means an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that is capable of degrading, inactivating, or inhibiting (e.g., under appropriate conditions) translation of a messenger RNA (mRNA) transcript of a target mRNA in a sequence-specific manner. As used herein, an RNAi agent can act through an RNA interference mechanism (i.e., by interacting with the machinery of the RNA interference pathway of a mammalian cell (the RNA-induced silencing complex or RISC) to induce RNA interference) or through any alternative mechanism or pathway. While the term RNAi agent as used herein is believed to act primarily through an RNA interference mechanism, the disclosed RNAi agents are not bound or limited to any particular mechanism or pathway of action. The RNAi agents of the disclosure comprise or consist of a sense strand and an antisense strand, e.g., the RNAi agents disclosed herein can be presented in the form of a short (or small) interfering RNA (siRNA). The antisense strand of the RNAi agent described herein is at least partially complementary to the mRNA targeted. The RNAi agent can comprise one or more modified nucleotides and / or one or more phosphodiester groups having a modification group.
[0225] As used herein, the term "CTNNB1" refers to the CTNNB1 gene, including but not limited to human CTNNB1, cynomolgus monkey CTNNB1, mouse CTNNB1, rat CTNNB1, and the like, unless otherwise indicated. The amino acid and complete coding sequences, mRNA sequences of CTNNB1 are readily available using publicly available databases, such as GenBank, UniProt, OMIM, and the Macaca Genome Project website.
[0226] The term "CTNNB1" also refers to naturally occurring DNA sequence variations of the CTNNB1 gene, such as single nucleotide polymorphisms (SNPs) in the CTNNB1 gene. Exemplary SNPs can be found in the dbSNP database.
[0227] The term "target sequence" refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during transcription of CTNNB1, including mRNA that is a product of RNA processing of the primary transcript. The portion of the target sequence that is targeted should be long enough to serve as a substrate for iRNA-directed cleavage. In one embodiment, the target sequence is within the protein coding region of CTNNB1. As used herein, in the context of RNA-mediated gene silencing, the sense strand (also referred to as SS, SS strand, or sense strand) refers to the strand comprising a sequence identical or essentially identical to the sequence of the target mRNA; the antisense strand (also referred to as AS or AS strand) refers to the strand having a sequence complementary to the sequence of the target mRNA.
[0228] In the context of describing the sense strand of the RNAi agents described herein, the term "at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 62" is intended to mean that the sense strand of the RNAi agent described herein comprises at least 15 contiguous nucleotides of the nucleotide sequence set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 62, or differs by no more than 3 nucleotides (optionally, no more than 2 nucleotides; optionally, 1 nucleotide) from at least 15 contiguous nucleotides of the nucleotide sequence set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 62. Similar interpretation should be made for other similar descriptions in the context of the disclosure. The disclosure does not include the case where the "differing" nucleotides comprise different modifications, i.e., nucleotides having the same base but different modifications are not considered as "differing" nucleotides. Similar interpretation should be made for other similar descriptions of the sense strand and / or antisense strand in the context of the disclosure.
[0229] In the present disclosure, the "5' region" or "5' end" or "5' terminal" of the sense strand or the antisense strand can be used interchangeably. For example, the 2nd to 8th nucleotides of the 5' region of the antisense strand can also be referred to as the 2nd to 8th nucleotides of the 5' end of the antisense strand. Similarly, the "3' region", "3' end" and "3' terminal" of the sense strand or the antisense strand can be used interchangeably.
[0230] In the context of the present disclosure, "G", "C", "A", "T", "U" and "I" represent nucleosides, respectively, comprising the base of guanine, cytosine, adenine, thymidine, uracil and inosine, respectively, unless otherwise specified. It is well known to those skilled in the art that the replacement of base T with U does not significantly affect the properties of the RNAi agent sequence, and U in the sequences of the present disclosure can be replaced by T at will, and the sequence obtained after the replacement is also within the scope of protection of the present disclosure. In the sequences of the present disclosure, for the same nucleic acid strand, in the direction from 5' end to 3' end, the direction from left to right, the lower case letter m indicates that the nucleoside adjacent to the left of the letter m is a 2'-methoxy-modified nucleoside; the lower case letter f indicates that the nucleoside adjacent to the left of the letter f is a 2'-fluoro-modified nucleoside; VP indicates that the 5' end of the nucleoside adjacent to the left / right of the letter is a trans-ethenyl phosphodiester group (5'-E-VP); the lower case letter s indicates that the two nucleosides adjacent to the letter s are connected by a phosphorothioate group, and unless otherwise specified, the two nucleosides are connected by a phosphodiester group. Unless otherwise specified, "RNAi agent", "nucleotide", "compound", "chemical modification", "oligonucleotide", "double-stranded RNAi inhibitor molecule", "siRNA", "dsRNA", "nucleic acid" and "RNAi" in the present disclosure can independently exist in the form of a salt, a mixed salt or a non-salt (e.g. free acid or free base). When it exists in the form of a salt or a mixed salt, it can be a pharmaceutically acceptable salt. The term "pharmaceutically acceptable salt" includes a pharmaceutically acceptable acid addition salt and a pharmaceutically acceptable base addition salt. When it exists in the form of a salt, some groups can be ionized to form anions / cations, for example, a phosphodiester group and a thiophosphodiester group can exist in the form of anion, and unless otherwise specified, the structure of the salt form of the following structures is also within the scope of protection of the present disclosure. Unless otherwise specified, the 3' position of the first nucleotide at the 3' end of each strand is a hydroxyl group; and the 5' position of the first nucleotide at the 5' end of each strand is a hydroxyl group.
[0231] The above-mentioned modifications and linking groups have the structures shown in Table 1A, respectively, wherein Base represents the base at the corresponding position:
[0232] Table 1A
[0233] The term "lipophilic group" or "lipophilic moiety" broadly refers to any chemical compound or chemical moiety that has an affinity for lipids. One way to characterize the lipophilicity of a lipophilic moiety is by the octanol-water partition coefficient logK ow , where K ow is the ratio of the concentration of a chemical in the octanol phase to its concentration in the water phase of a two-phase system at equilibrium. In principle, logK ow is positive, the chemical is lipophilic. Typically, the logK ow of a lipophilic moiety is greater than 1, greater than 1.5, greater than 2, greater than 3, greater than 4, greater than 5, or greater than 10, for example, the logK ow of 6-aminohexanol is about 0.7, the logK ow of cholesteryl N-(hexan-6-ol)carbamate is 10.7.
[0234] The lipophilicity of a molecule can vary with respect to the functional groups it carries. For example, the addition of a hydroxyl or amine group at the end of a lipophilic moiety can increase or decrease the partition coefficient (e.g., logK ow ) value of the lipophilic moiety. For example, a lipophilic moiety can be an aliphatic, cyclic such as alicyclic, or polycyclic such as a polyalicyclic compound, such as a steroid (e.g., a sterol) or a straight-chain or branched aliphatic hydrocarbon. A lipophilic moiety can generally comprise a hydrocarbon chain, which can be cyclic or acyclic. The hydrocarbon chain can comprise various substituents and / or one or more heteroatoms, such as oxygen or sulfur atoms. Such lipophilic aliphatic moieties include, but are not limited to, saturated or unsaturated C4-C 30 hydrocarbons (e.g., C 10 -C 30 hydrocarbons), saturated or unsaturated fatty acids, waxes (e.g., monoalcohol esters of fatty acids and fatty diamides), terpenes (e.g., C 10 terpenes, C 15 sesquiterpenes, C 20 diterpenes, C 30 triterpenes, and C 40 tetra terpenes), and other polyalicyclic hydrocarbons; for example, a lipophilic moiety can be an optionally substituted straight-chain alkyl of C 10-30 ; for example, a lipophilic moiety can be an optionally substituted straight-chain alkyl of C 14-24 .
[0235] As used herein, the terms "complementary" or "reverse complementary" are used interchangeably and have the meaning well known to those skilled in the art, i.e., in a double-stranded nucleic acid molecule, the bases of one strand pair with the bases on the other strand in a complementary manner. In DNA, the purine base adenine always pairs with the pyrimidine base thymine (or, in RNA, uracil); the purine base guanine always pairs with the pyrimidine base cytosine. Each base pair includes one purine and one pyrimidine. When the adenine on one strand always pairs with the thymine (or uracil) on the other strand, and the guanine always pairs with the cytosine, the two strands are considered to be complementary to each other, and the sequence of one strand can be inferred from the sequence of its complementary strand. Correspondingly, "mismatch" in the art means that the bases at the corresponding positions in a double-stranded nucleic acid do not pair in a complementary manner.
[0236] As used herein, the term "inhibit" can be used interchangeably with "reduce", "silence", "down-regulate", "repress" and other similar terms, and includes inhibition at any level. Inhibition can be assessed by a decrease in absolute or relative level of one or more of these variables compared to a control level. The control level can be any type of control level used in the art, such as a pre-dose baseline level or a level determined from a subject, cell, or sample that has not been treated or treated with a control (e.g., a buffer control or inert agent control). For example, the degree of inhibition of target gene expression by an RNAi agent can be characterized by the amount of residual mRNA expression, such as no more than 99%, no more than 95%, no more than 90%, no more than 85%, no more than 80%, no more than 75%, no more than 70%, no more than 65%, no more than 60%, no more than 55%, no more than 50%, no more than 45%, no more than 40%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 15%, or no more than 10%. The rate of inhibition of target gene expression can be characterized by the fold-inhibition, such as no more than 10-fold, no more than 5-fold, no more than 4-fold, no more than 3-fold, no more than 2-fold, or no more than 1-fold. The degree of inhibition of target gene expression can also be characterized by the amount of mRNA remaining, such as no more than 50%, no more than 40%, no more than 30%, no more than 20%, no more than 10%, no more than 5%, no more than 1%, or no more than 0.1%. The rate of inhibition of target gene expression can also be characterized by the fold-reduction, such as no more than 10-fold, no more than 5-fold, no more than 4-fold, no more than 3-fold, no more than 2-fold, or no more than 1-fold. The degree of inhibition of target gene expression can also be characterized by the amount of mRNA remaining, such as no more than 50%, no more than 40%, no more than 30%, no more than 20%, no more than 10%, no more than 5%, no more than 1%, or no more than 0.1%. Luciferase Assay System, reading the firefly chemiluminescence value (Fir) and the Renilla chemiluminescence value (Ren), respectively, and calculating the relative value Ratio = Ren / Fir; in the present disclosure, the residual mRNA expression ratio (or the residual activity %) = Ratio (RNAi agent treatment group) / Ratio (no RNAi agent control group), and the inhibition rate (%) = 100% - residual mRNA expression (%).
[0237] The term "pharmaceutically acceptable salt" includes both pharmaceutically acceptable acid addition salts and pharmaceutically acceptable base addition salts.
[0238] "Pharmaceutically acceptable acid addition salt" refers to salts of the free base which retain the biological effectiveness and non-toxicity of the free amine and which are formed with inorganic acids or organic acids. Inorganic acid salts include, but are not limited to, hydrochloride, hydrobromide, sulfate, nitrate, phosphate, and the like. Organic acid salts include, but are not limited to, formate, acetate, 2,2-dichloroacetate, trifluoroacetate, propionate, hexanoate, octanoate, decanoate, undecylenate, glycolate, gluconate, lactate, sebacate, adipate, pimelate, malonate, oxalate, maleate, succinate, fumarate, tartrate, citrate, palmitoate, stearate, oleate, cinnamate, laurate, malate, glutamate, pyroglutamate, aspartate, benzoate, methanesulfonate (mesylate), benzenesulfonate (besylate), p-toluenesulfonate (tosylate), alginate, ascorbate, salicylate, 4-aminosalicylate, naphthalene-2-disulfonate, and the like. These salts can be prepared by methods known in the art.
[0239] "Pharmaceutically acceptable base addition salt" refers to salts of the free acid which retain the biological effectiveness and non-toxicity of the free acid and which are formed with inorganic or organic bases. Salts derived from inorganic bases include, but are not limited to, sodium salts, potassium salts, lithium salts, ammonium salts, calcium salts, magnesium salts, iron salts, zinc salts, copper salts, manganese salts, aluminum salts, and the like. In some embodiments, the inorganic salts are ammonium, sodium, potassium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines, including naturally occurring substituted amines, cyclic amines, and basic ion-exchange resins, such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, diethanolamine, triethanolamine, dimethyl ethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, choline, betaine, ethylenediamine, glucosamine, methylglucosamine, theobromine, purines, piperazine, piperidine, N-ethylpiperidine, polyamine resins, and the like. In some embodiments, the organic bases include isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine. These salts can be prepared by methods known in the art.
[0240] "Effective amount" or "effective dose" means the amount of a drug, compound, or pharmaceutical composition necessary to achieve any one or more beneficial or desired therapeutic outcome. For preventative use, beneficial or desired outcomes include eliminating or reducing risk, mitigating severity, or delaying the onset of a condition, including the condition itself, its complications, and the biochemical, histological, and / or behavioral symptoms of intermediate pathological phenotypes present during the development of the condition. For therapeutic use, beneficial or desired outcomes include clinical outcomes such as reducing the incidence of various disease-related conditions associated with the target genes, target mRNAs, or target proteins of this disclosure, or improving one or more symptoms of said conditions, reducing the dosage of other agents required to treat the condition, enhancing the efficacy of another agent, and / or delaying the progression of a patient's disease-related condition associated with the target genes, target mRNAs, or target proteins of this disclosure.
[0241] As used herein, the terms “patient,” “subject,” or “individual” are used interchangeably and include human or non-human animals, such as mammals, such as humans or monkeys.
[0242] The RNAi agents provided in this disclosure can be obtained using conventional preparation methods in the art (e.g., solid-phase synthesis and liquid-phase synthesis). Solid-phase synthesis is already available as a commercially available custom service. Modified nucleotide groups can be introduced into the RNAi agents described in this disclosure using appropriately modified nucleoside monomers. Methods for preparing appropriately modified nucleoside monomers and for introducing modified nucleotide groups into RNAi agents are also well known to those skilled in the art.
[0243] The term “chemical modification” or “modification” includes all alterations to nucleotides by chemical means, such as the addition or removal of a chemical moiety, or the substitution of one chemical moiety for another.
[0244] The term "base" includes any known DNA and RNA base, base analogues such as purines or pyrimidines, and also includes natural compounds such as adenine, thymine, guanine, cytosine, uracil, hypoxanthoside, and natural analogues.
[0245] The terms "blunt-ended" or "knuckle-ended" are used interchangeably and refer to the absence of unpaired nucleotides or nucleotide analogues at a given end of an RNAi agent; that is, no nucleotide protrusions. In most cases, RNAi agents with blunt ends will be double-stranded throughout their entire length.
[0246] The terms "about," "approximately," mean values within an acceptable error range for the specific value being measured or determined, such as within 1% or more of the specific value. For example, "about" can mean within 1 standard deviation, or up to 10%, or up to 15%, or up to 20%, or up to 25% of the specified range. Each instance in which a number or a value is preceded by the term "about" in the present disclosure also includes an embodiment in which the number or the value is exactly the same as the specified number or value. Unless otherwise indicated, the use of "about" or "approximately" with respect to a particular value or range of values should be construed to mean that the value or range of values need not be applied to the exact number or range of numbers.
[0247] Unless otherwise indicated, the terms "optionally," "optional," "optional" or "may" mean that the subsequently described event or circumstance can or can not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not. For example, "optionally, R1and R2are directly connected to form a ring" means that R1and R2may be directly connected to form a ring, but does not necessarily exist, and the description includes instances where R1and R2are directly connected to form a ring and instances where R1and R2do not form a ring.
[0248] In the chemical structural formulas of the present disclosure, which can be attached to one or more of any of the groups according to the scope of the application described herein.
[0249] The term "attached," when referring to the linkage between two molecules, means that the two molecules are connected by a covalent bond or that the two molecules are associated via a non-covalent bond (e.g., a hydrogen bond or an ionic bond), including direct attachment, indirect attachment.
[0250] The term "directly attached" means that a first compound or group is connected to a second compound or group without any intervening atoms or atom groups.
[0251] The term "indirectly attached" means that a first compound or group is connected to a second compound or group by an intervening group, compound or molecule (e.g., a linker).
[0252] The term "substituted" means that any one or more hydrogen atoms on the designated atom (typically carbon, oxygen, and nitrogen atoms) is replaced with any group defined herein, provided that the designated atom's normal valence is not exceeded, and that the substitution results in a stable compound. Non-limiting examples of substituents include C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, cyano, hydroxyl, oxo, carboxyl, cycloalkyl, cycloalkenyl, heterocyclyl, heteroaryl, aryl, ketone, alkoxycarbonyl, aryloxycarbonyl, heteroaryloxycarbonyl, or halogen (e.g., F, Cl, Br, I). When the substituent is a ketone or oxo (i.e., =0), then two (2) hydrogens on the atom are replaced.
[0253] "Substituted with one or more" means that the group can be substituted with a single or multiple substituents. When substituted with multiple substituents, it can be multiple identical substituents or a combination of one or multiple different substituents. BRIEF DESCRIPTION OF DRAWINGS
[0254] Figure 1: Percent of CTNNB1 mRNA expression remaining in liver tissue of C57BL / 6J mice at day 28. DETAILED DESCRIPTION
[0255] The present disclosure is further described below in connection with the following examples, but these examples are not meant to limit the scope of the present disclosure. Unless otherwise noted, experimental methods in the present disclosure examples were performed according to conventional conditions, such as Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory; or Molecular Cloning: A Laboratory Manual. Unless otherwise noted, reagents used in the following examples were commercially available and used according to the manufacturer's instructions.
[0256] Example 1. Design of CTNNB1 RNAi agents
[0257] The sequences of the sense strand, antisense strand of the RNAi agents of the present disclosure are shown in Table 2 below, which are unmodified sense / antisense strands designed according to the general rules of double-stranded oligonucleotides satisfying the activity, with the human CTNNB1 gene (NM_001904.4) as the target gene. The sequences of the modified RNAi agents are shown in Table 3, Table 4.
[0258] Table 2. Unmodified RNAi agent sequences of the present disclosure
[0259] Table 3. Modified RNAi agent sequences of the present disclosure
[0260] Table 4, Sequences of modified RNAi agents of the disclosure
[0261] In Tables 2, 3, and 4, G, C, A, U, I represent nucleosides having a base of guanine, cytosine, adenine, uracil, and inosine, respectively, in the same nucleic acid sequence, from left to right, in the direction of 5' end to 3' end, the sequence from left to right represents the direction of 5' end to 3' end, the lower case letter m represents that the nucleoside adjacent to the left of the letter m is a 2'-methoxy modified nucleoside; the lower case letter f represents that the nucleoside adjacent to the left of the letter f is a 2'-fluoro modified nucleoside; the capital letter IB represents an inverted abasic modified nucleoside; VP represents that the 5' end of the nucleoside adjacent to the right thereof is a trans- vinyl phosphodiester group (5'-E-VP); NA0218 represents that the nucleoside adjacent to the right thereof is a nucleoside containing the structure shown in Formula (I-5); NA0255' and NA0255" represent that the position has the structure shown in Table NA0255' and NA0255", respectively; the lower case letter s represents that the two nucleosides adjacent to the letter s, or the nucleoside and NA0255" or NA0255' or NA0218, or NA0255' and the delivery group are connected by a phosphorothioate group, unless otherwise specified, the two adjacent nucleosides, or the nucleoside and NA0255" or NA0255' or NA0218, or NA0255' and the delivery group are connected by a phosphodiester group. NAG0052' represents that the position is a delivery group having the structure shown in NAG0052'. L96 represents that the position is a delivery group having the structure shown in L96. Unless otherwise specified, the 3' position of the first nucleotide at the 3' end of each strand is a hydroxyl group; the 5' position of the first nucleotide at the 5' end of each strand is a hydroxyl group.
[0262] The structures of the 2'-methoxy modified nucleoside, 2'-fluoro modified nucleoside, phosphorothioate group, phosphodiester group, 5'-E-VP, NA0255', NA0255", NA0218, NAG0052', L96, inverted abasic modified nucleoside are shown in the following table, when the RNAi agent of the disclosure exists in the form of a salt, for example, in the form of a sodium salt, the structure of the salt form corresponding to the structure in Table 1B is also within the protection scope of the disclosure:
[0263] Table 1B
[0264] Example 2. Synthesis of compounds 1, 2, 3
[0265] Example 2.1. Synthesis of compound 1
[0266] Compound 1 was synthesized from starting material compound 1-1 following the route below:
[0267] Synthesis of compound 1-2
[0268] To a solution of commercially available compound 1-1 (10.00 g, 46.7 mmol) (CAS: 1489-97-0) in tetrahydrofuran (100 mL) was added LDA (33 mL, 65.3 mmol) slowly dropwise at -70 °C under nitrogen protection. After stirring for 45 min, benzyl chloromethyl ether (18.30 g, 116.7 mmol) was added. Stirring at room temperature overnight. Quench slowly into saturated aqueous ammonium chloride solution (200 mL) in an ice bath, extracted with ethyl acetate twice, 100 mL each time, combined organic phases were washed with 50 mL saturated brine, dried over anhydrous sodium sulfate, concentrated, and the crude product was purified by normal phase column chromatography to give the title compound 1-2 (10.00 g, yield 64%).
[0269] LCMS: m / z (ESI) = 335.3 [M+H] + .
[0270] Synthesis of compound 1-3
[0271] To a solution of compound 1-2 (10.0 g, 29.9 mmol) in tetrahydrofuran (50 mL) was added 1 N aqueous HC1 (200 mL) at room temperature. Stirring at room temperature overnight. The reaction was extracted with ethyl acetate twice, 100 mL each time, combined organic phases were washed with 100 mL saturated aqueous sodium bicarbonate solution, dried over anhydrous sodium sulfate, concentrated, and the crude product was purified by normal phase column chromatography to give the title compound 1-3 (7.00 g, yield 80%).
[0272] LCMS: m / z (ESI) = 291.4 [M+H] + .
[0273] Synthesis of compound 1-4
[0274] To a solution of compound 1-3 (7.00 g, 24.1 mmol) in dichloromethane (70 mL) was added piperidine (3.08 g, 36.2 mmol) and sodium borohydride (10.27 g, 48.2 mmol) sequentially at room temperature. The reaction was stirred at room temperature overnight. The reaction was quenched by the addition of 100 mL of water. The organic phase was dried over anhydrous sodium sulfate and concentrated. The crude product was purified by normal phase column chromatography to give the title compound 1-4 (4.10 g, 47% yield).
[0275] LCMS: m / z (ESI) = 360.4 [M+H] + .
[0276] Synthesis of compound 1-5
[0277] To a solution of compound 1-4 (2.80 g, 7.8 mmol) in dichloromethane (30 mL) was added boron trichloride (27 mL, 27.2 mmol) dropwise at -70 °C under nitrogen atmosphere. The reaction was stirred at 0 °C for 2 h. The reaction was quenched by the slow addition of saturated aqueous sodium bicarbonate solution. The reaction was extracted with a mixture of dichloromethane and methanol (v:v = 10:1) (4 x 100 mL). The organic phase was combined, washed with a small amount of saturated brine, dried over anhydrous sodium sulfate and concentrated to give the title compound 1-5 (1.00 g, 47% yield).
[0278] LCMS: m / z (ESI) = 270.3 [M+H] + .
[0279] Synthesis of compound 1-6
[0280] To a solution of compound 1-5 (1.00 g, 3.7 mmol) in pyridine (10 mL) was added 4,4'-dimethoxybenzhydryl chloride (2.52 g, 7.4 mmol) at room temperature under nitrogen atmosphere. The reaction was stirred at room temperature overnight. The reaction was concentrated to give the crude product which was purified by normal phase column chromatography to give the title compound 1-6 (1.10 g, 52% yield).
[0281] LCMS: m / z (ESI) = 572.7 [M+H] + .
[0282] Synthesis of compound 1-7
[0283] To a solution of compound 1-6 (1.20 g, 2.1 mmol) in tetrahydrofuran (12 mL) was added 2.5 M lithium aluminum hydride in tetrahydrofuran (1.85 mL, 4.6 mmol) dropwise at 0 °C under nitrogen. The reaction was stirred at room temperature for 2 h. The reaction was quenched with water and extracted with dichloromethane (30 mL x 2). The organic phase was combined, washed with a small amount of saturated brine, dried over sodium sulfate, and concentrated to give a crude product. The compound 1-7 and its isomer 1-7-BP were separated by normal phase column chromatography. The compound 1-7 was obtained by concentrating the fractions of compound 1-7 (0.52 g, 47% yield).
[0284] LCMS: m / z (ESI) = 530.7 [M+H] + .
[0285] 1 H NMR (400 MHz, CDC13) δ 7.45 (d, J = 7.2 Hz, 2H), 7.38 - 7.30 (m, 6H), 7.25 - 7.21 (m, 1H), 6.88 - 6.84 (m, 4H), 3.81 (s, 6H), 3.51 (d, J = 5.6 Hz, 2H), 3.18 (s, 2H), 2.66 (s, 1H), 2.45 (br, 4H), 2.25 (s, 1H), 1.84 - 1.63 (m, 8H), 1.47 (br, 2H), 1.17 - 1.11 (m, 2H), 1.03 - 0.97 (m, 2H).
[0286] The compound 1-7-BP was obtained by concentrating the fractions of compound 1-7-BP
[0287] Isomer 1-7-BP: 1 H NMR (400 MHz, CDC13) δ 7.43 - 7.37 (m, 2H), 7.28 (dd, J = 12.5, 6.4 Hz, 6H), 7.21 (t, J = 7.0 Hz, 1H), 6.83 (d, J = 8.6 Hz, 4H), 3.79 (s, 6H), 3.60 (s, 2H), 2.93 (s, 2H), 2.70 - 2.28 (m, 6H), 1.89 (d, J = 13.6 Hz, 2H), 1.78 (s, 2H), 1.68 (s, 4H), 1.55 - 1.37 (m, 4H), 1.15 - 1.03 (m, 2H).
[0288] Synthesis of compound 1
[0289] To a solution of compound 7 (0.43 g, 0.8 mmol) in dichloromethane (5 mL) was added bis(diisopropylamino)(2-cyanoethoxy)phosphine (0.44 g, 1.5 mmol) under nitrogen at room temperature, followed by the pre-prepared mixture of tetrazole (0.45 M) and 1-methylimidazole (0.18 M) in acetonitrile (1.71 mL). After stirring at room temperature for 2 h, the reaction was quenched with 5 mL of saturated sodium bicarbonate solution and extracted with dichloromethane (10 mL x 2). The combined organic phase was washed with 10 mL of saturated brine, dried over anhydrous sodium sulfate, and concentrated to give compound 1 (0.58 g, 95% yield).
[0290] LCMS: m / z (ESI) = 730.9 [M+H] + ;
[0291] 1 H NMR (400 MHz, CD3CN) δ 7.48 (d, J = 7.2 Hz, 2H), 7.36 - 7.27 (m, 6H), 7.20 (t, J = 7.2 Hz, 1H), 6.87 - 6.83 (m, 4H), 3.81 - 3.77 (m, 2H), 3.75 (s, 6H), 3.67 - 3.60 (m, 2H), 3.51 - 3.45 (m, 2H), 3.05 (m, 2H), 2.75 (t, J = 6.0 Hz, 1H), 2.62 (t, J = 6.0 Hz, 2H), 2.20 (t, J = 4.4 Hz, 4H), 1.95 - 1.92 (m, 4H), 1.70 - 1.61 (m, 2H), 1.43 - 1.41 (m, 4H), 1.37 - 1.31 (m, 4H), 1.24 - 1.19 (m, 12H);
[0292] 31 P NMR (162 MHz, CD3CN) δ 146.828.
[0293] Example 2.2. Synthesis of compound 2
[0294] Compound 2 was synthesized from starting material compound 2-1 according to the following route:
[0295] Synthesis of compound 2-2
[0296] To a solution of compound 2-1 (50.00 g, 193.62 mmol) in dimethylformamide (300 mL) was added 1H-imidazole (39 mL, 580.88 mmol) and tert-butyldimethylsilyl chloride (83 mL, 484.06 mmol) under ice bath. The reaction was stirred for 18 h. The reaction was diluted with water (1 L) and extracted with ethyl acetate (3 x 500 mL). The organic phase was combined, washed with saturated brine (3 x 200 mL), dried over anhydrous sodium sulfate, and concentrated to give the title compound 2-2 (109.0 g).
[0297] LCMS: m / z (ESI) 487.2 [M+H] + .
[0298] Synthesis of compound 2-3
[0299] To a solution of compound 2-2 (100.00 g, 205.44 mmol) in tetrahydrofuran (500 mL) was added a mixture of deionized water (250 mL) and trifluoroacetic acid (250 mL) under ice bath. The reaction was stirred for 2 h at 0 °C. The reaction was neutralized with ammonia water and extracted with ethyl acetate (1000 mL) twice. The organic phase was combined, washed with saturated brine (3 x 200 mL), dried over anhydrous sodium sulfate, and concentrated. The residue was purified by column chromatography to give the title compound 2-3 (25.00 g, yield 33%).
[0300] LCMS: m / z (ESI) 373.0 [M+H] + .
[0301] Synthesis of compound 2-4
[0302] To a solution of compound 2-3 (18.50 g, 49.67 mmol) in dimethyl sulfoxide (220 mL) was added EDCI (28.50 g, 148.99 mmol), pyridine (4 mL, 49.66 mmol) and trifluoroacetic acid (1.8 mL, 24.83 mmol) under ice bath. The reaction was stirred for 1.5 h at room temperature. The reaction was diluted with water (500 mL) and extracted with ethyl acetate (300 mL) twice. The organic phase was combined, washed with saturated brine (3 x 200 mL), dried over anhydrous sodium sulfate, and concentrated to give the title compound 2-4 (22.00 g).
[0303] LCMS: m / z (ESI) 371.2 [M+H] + .
[0304] Synthesis of compound 2-5
[0305] To a solution of compound 2-4 (14.30 g, 38.60 mmol) in dimethyl sulfoxide (130 mL) and tetrahydrofuran (70 mL) was added sodium hydride (3.09 g, 60%, 77.20 mmol) under ice bath. After the reaction was stirred at room temperature for 1 h, a solution of trimethylsulfoxonium iodide (25.4 g, 115.60 mmol) in tetrahydrofuran (70 mL) was added dropwise at 0 °C. The reaction was stirred under ice bath for 1.5 h. The reaction was added to ammonium chloride (20 mL), extracted with ethyl acetate (300 mL) twice, the organic phase was combined, washed with saturated brine (3 x 50 mL), dried over anhydrous sodium sulfate, concentrated, and the residue was purified by column chromatography to give the title compound 2-5 (9.00 g, yield 61%).
[0306] LCMS: m / z (ESI) 385.2 [M+H] + .
[0307] 1 H NMR (400 MHz, CDC13) δ 8.70 (s, 1H), 7.61 (d, J = 8.2 Hz, 1H), 7.43 (d, J = 8.2 Hz, 1H), 5.82 (d, J = 3.2 Hz, 1H), 5.76 (d, J = 2.8 Hz, 1H), 5.63 (dd, J = 8.2, 2.1 Hz, 1H), 4.13 - 4.05 (m, 2H), 3.51 (t, J = 3.5 Hz, 1H), 3.38 (d, J = 2.8 Hz, 3H), 3.09 (t, J = 3.1 Hz, 1H), 2.84 - 2.73 (m, 2H), 0.83 - 0.75 (m, 9H), -0.01 (dd, J = 9.9, 7.0 Hz, 6H).
[0308] Synthesis of compound 2-6
[0309] To a solution of compound 2-5 (1.10 g, 2.86 mmol) and lithium bromide (0.45 g, 5.15 mmol) in tetrahydrofuran (10.0 mL) was added boron trifluoride etherate (0.92 g, 3.15 mmol, 48% content) dropwise at -70 °C. The reaction was stirred at room temperature for 1 h. The reaction was added to saturated aqueous sodium bicarbonate solution (20 mL), extracted with dichloromethane (20 mL) three times, the organic phase was combined, washed with saturated brine (3 x 50 mL), dried over anhydrous sodium sulfate, concentrated, and the residue was purified by column chromatography to give the title compound 2-6 (1.50 g).
[0310] LCMS: m / z (ESI) 465.07 / 467.02 [M+H] + .
[0311] 1 H NMR (400 MHz, CDC13) δ 9.33 (s, 1H), 7.59 (d, J = 8.0 Hz, 1H), 5.64 (d, J = 8.0 Hz, 1H), 5.52 (d, J = 4.1 Hz, 1H), 4.26 (t, J = 4.3 Hz, 1H), 4.12 (d, J = 4.3 Hz, 1H), 3.91 (t, J = 4.2 Hz, 1H), 3.82 (t, J = 6.8 Hz, 1H), 3.49 - 3.28 (m, 5H), 0.80 (s, 9H), 0.00 (s, 6H).
[0312] Synthesis of compound 2-7
[0313] To a solution of compound 2-6 (1.10 g, 2.36 mmol) and triazole (0.24 g, 3.55 mmol) in anisole (10.0 mL) was added cesium carbonate (1.54 g, 4.73 mmol) at room temperature. The reaction was stirred at 80 °C for 16 h. The reaction was added to water solution (20 mL), extracted with ethyl acetate (20 mL) for three times, the organic phase was combined, washed with saturated brine (3 x 50 mL), dried over anhydrous sodium sulfate, concentrated and the residue was purified by column chromatography to give the title compound 2-7 (0.86 g, yield 80%).
[0314] LCMS: m / z (ESI) 454.22 [M+H] + .
[0315] 1 H NMR (400 MHz, CDC13) δ 9.72 (s, 1H), 8.17 (s, 1H), 7.98 (d, J = 8.4 Hz, 1H), 7.80 (s, 1H), 5.79 (d, J = 3.2 Hz, 1H), 5.77 (s, 1H), 4.39 (t, J = 5.6 Hz, 1H), 4.35 - 4.29 (m, 2H), 4.20 - 4.17 (m, 1H), 4.03 (d, J = 5.6 Hz, 1H), 3.87 (t, J = 4.4 Hz, 1H), 3.51 (s, 3H), 2.07 (br, 1H), 0.89 (s, 9H), 0.08 (d, J = 10.8 Hz, 6H).
[0316] Synthesis of compound 2-8
[0317] To a solution of compound 2-7 (0.40 g, 0.88 mmol) in pyridine (4.0 mL) was added 4,4'-dimethoxytrityl chloride (1.50 g, 4.41 mmol) at room temperature. The reaction was stirred at 55 °C for 18 h. The reaction was added to water solution (20 mL) and extracted with dichloromethane (50 mL) for three times. The organic phase was combined, washed with saturated brine, dried over anhydrous sodium sulfate, concentrated and the residue was purified by column chromatography to give the title compound 2-8 (0.21 g, yield 32%).
[0318] LCMS: m / z (ESI) 778.49 [M+Na] + .
[0319] Synthesis of compound 2-9
[0320] To a solution of compound 2-8 (0.48 g, 0.64 mmol) in tetrahydrofuran (5.0 mL) was added TBAF (0.34 g, 1.28 mmol) at room temperature. The reaction was stirred at room temperature for 2 h. The reaction was added to water solution (20 mL) and extracted with dichloromethane (50 mL) for three times. The organic phase was combined, washed with saturated brine, dried over anhydrous sodium sulfate, concentrated and the residue was purified by column chromatography to give the title compound 2-9 (0.40 g, yield 98%).
[0321] LCMS: m / z (ESI) 664.29 [M+Na] + .
[0322] Synthesis of compound 2
[0323] To a solution of compound 2-9 (0.26 g, 0.41 mmol) in dry dichloromethane (4 mL) was added 3A molecular sieves under nitrogen atmosphere at room temperature. After stirring for 5 min at room temperature, bis(diisopropylamino)(2-cyanoethoxy)phosphine (0.36 g, 1.20 mmol) was added, followed by the pre-prepared solution of 1H-tetrazole (0.45 M) and N-methylimidazole (0.18 M) in dry acetonitrile (2.7 mL). The reaction was stirred at room temperature for 2 h. After filtration, 5% aqueous sodium bicarbonate solution (30 mL) was added to the reaction. Dichloromethane (30 mL) was used to extract, dried over sodium sulfate, filtered and concentrated. The product was purified by C18 reverse phase column and lyophilized to give compound 2 (0.23 g, yield 67%).
[0324] LCMS: MS (ESI) m / z = 840.52 [M-H] - .
[0325] 1H NMR (400 MHz, DMSO-d6) δ 11.51 (d, J = 10.4 Hz, 1H), 8.12 (d, J = 18.8 Hz, 1H), 7.94 (d, J = 8.0 Hz, 1H), 7.84 (d, J = 14.2 Hz, 1H), 7.48 - 7.24 (m, 9H), 6.94 (dd, J = 8.4, 4.0 Hz, 4H), 5.79 (dd, J = 22.4, 12.0 Hz, 1H), 5.71 (dd, J = 27.2, 8.0 Hz, 1H), 4.41 - 4.30 (m, 1H), 4.20 - 4.07 (m, 2H), 4.03 - 3.91 (m, 1H), 3.88 - 3.79 (m, 1H), 3.76 (s, 6H), 3.71 - 3.65 (m, 1H), 3.62 - 3.60 (m, 1H), 3.45 - 3.37 (m, 3H), 3.29 (s, 1H), 2.74 (t, J = 6.0 Hz, 1H), 2.50 - 2.48 (m, 2H), 2.45 - 2.39 (m, 1H), 1.08 - 1.00 (m, 9H), 0.74 (d, J = 6.8 Hz, 3H).
[0326] 31 P NMR (162 MHz, DMSO-d6) δ 150.41, 149.84.
[0327] Example 2.3. Synthesis of compound 3
[0328] Compound 3 was synthesized from starting compound 3-1 according to the following route:
[0329] Synthesis of compound 3-2
[0330] Compound 3-1 (1.05 g, 1.98 mmol) was added to a mixture of DMF (10 ml) and pyridine (5 ml) at room temperature, then succinic anhydride (1.98 g, 19.82 mmol) and DMAP (1.21 g, 9.91 mmol) were added, and the reaction was heated to 50 °C for 4 h. The reaction was quenched by pouring into water (100 ml), extracted with dichloromethane (2 x 40 mL), the organic phases were combined, concentrated, and the residue was purified by normal phase column chromatography to give the title compound 3-2 (1.18 g, yield 94.52%).
[0331] LCMS: m / z (ESI) 630.8 [M+H] + .
[0332] Synthesis of compound 3
[0333] Take 50 mL centrifuge tube, dissolve 3-1 compound (135 mg, 0.214 mmol) in anhydrous DMF (23 mL), after the substrate is completely dissolved, add anhydrous acetonitrile (12 mL), DIEA (0.742 mL, 0.609 mmol) and HBTU (121.9 mg, 0.321 mmol) to the centrifuge tube in turn. After the reaction solution is mixed uniformly, add macroporous aminomethyl resin (2.0 g, blank load 0.45 mmol / g, target load 0.1 mmol / g) again. Put the reaction solution into a constant temperature shaker (temperature: 25°C, rotation speed: 210 rpm / min) and shake overnight. Filter the reaction solution, wash the filter cake with DCM 3-4 times in turn, wash with anhydrous acetonitrile, collect the solid, and dry overnight in vacuum.
[0334] Disperse the solid in the pre-configured CapB (40 mL). Put the reaction solution into a shaker (temperature: 25°C, rotation speed: 200 rpm / min) and shake for 3-4 h. Filter the reaction solution, wash the filter cake with anhydrous acetonitrile, collect the solid, and dry overnight in vacuum to obtain the resin with carrier. Weigh to obtain the target resin 1.9 g.
[0335] Product information:
[0336] Macroporous aminomethyl resin: SUNRESIN seplife Aminomethyl Resin 50-100um
[0337] CapB: mixed by mixing CapB1 and CapB2 in a volume ratio of 1:1
[0338] CapB1: BIOLINE CHEM Cap Blocker B1 Acetic anhydride / Acetonitrile SH3101-4
[0339] CapB2: BIOLINE CHEM Cap Blocker B2 Pyridine / Acetonitrile SH3201-4.
[0340] Example 3. Synthesis of the RNAi agents and pharmaceutical compositions of the disclosure
[0341] Example 3.1. Synthesis of the RNAi agents of the disclosure
[0342] The synthesis of the RNAi agents is no different from the general phosphoramidite solid-phase synthesis method. The synthesis process is briefly described as follows: on the Dr. Oligo 48 synthesizer (Biolytic), use the universal CPG carrier as the starting point, and connect the nucleoside phosphoramidite monomers one by one according to the synthesis program. For the sequence of the 3’ end of the sense strand being NA0255”, the difference is that the compound 3 in Example 2 is used instead of the universal CPG carrier described above.
[0343] Nucleoside monomer raw materials 2'-F RNA, 2'-O-methyl RNA, IB, etc. nucleoside phosphoramidite monomers were purchased from Shanghai Zhiwei or Suzhou Jimai, nucleoside phosphoramidite monomers of VPUm, VPAm, VPGm were purchased from Jiangsu Shenji, phosphoramidite monomers of NA0255', NA0255", NA0218(U) were synthesized according to the method of Example 2 above, the phosphoramidite monomers of NA0255' and NA0255" are compound 1, and the phosphoramidite monomers of NA0218(U) are compound 2. 5-ethylthio-1H-tetrazole (ETT) was used as an activator (0.6M acetonitrile solution), 0.22M PADS dissolved in 1:1 volume ratio of acetonitrile and trimethylpyridine (Suzhou Kelaima) solution was used as a sulfuration reagent, and iodopyridine / water solution (Kelaima) was used as an oxidizing agent.
[0344] After the completion of solid-phase synthesis, the oligoribonucleotide was cleaved from the solid support, and was soaked in a 3:1 solution of 28% ammonia and ethanol at 50°C for 16 hours. Then it was centrifuged, and the supernatant was transferred to another centrifuge tube, concentrated and evaporated to dryness, and then purified using C18 reverse phase chromatography with 0.1M TEAA and acetonitrile as the mobile phase, and 3% trifluoroacetic acid solution was used to remove DMTr. The target oligonucleotide was collected, freeze-dried, and identified as the target product by LC-MS, and then quantified by UV (260nm).
[0345] The obtained single-stranded oligonucleotide was annealed according to the complementary pairing of the equimolar ratio, and finally the obtained RNAi agent was dissolved in 1xPBS and adjusted to the required concentration for the experiment.
[0346] The synthesis of the RNAi agent containing NAG0052' is disclosed in WO2023274395A.
[0347] The synthesis of the RNAi agent containing L96 is disclosed in WO2014025805A.
[0348] Example 3.2. Synthesis of the pharmaceutical composition of the present disclosure
[0349] 810Z00-T used in this example was derived from Suzhou Shengdiya, L369 was derived from Tianjin Quanhecheng Technology Co., Ltd., cholesterol, DSPC were purchased from Shanghai Aiviton, DMG-PEG 2000 was purchased from Xiamen Senobangge. Anhydrous ethanol, sodium acetate, glacial acetic acid, Tris-HCl were purchased from the National Pharmaceutical Group. Sodium chloride was purchased from Jiangsu Diligent Pharmaceutical Co., Ltd.
[0350] The liposome nanoparticle composition of the RNAi agent in Table 9 of Example 6 of the present disclosure was prepared according to the same formula and method as the formula in Table 1 of WO2016033326A, the only difference being that DLin-MC3-DMA instead of DLin-MC2-ODA in the formulation in Table 1 of WO2016033326A.
[0351] The liposome nanoparticle compositions 1, 2, 3 of the RNAi agents in Table 10 of Example 6 of the disclosure are prepared according to Formulation 1, 2, and 3, respectively, in the specification.
[0352] For Composition 1 of TJR104398, it is prepared by dissolving 810Z00-T, DSPC, cholesterol, DMG-PEG 2000 in ethanol to prepare a lipid solution at a molar ratio of 50:12:36:2. The RNAi agent is dissolved in 50mM pH 5 acetic acid buffer to prepare an aqueous RNAi agent solution. The ethanol lipid solution and the aqueous RNAi agent solution are mixed by microfluidic device at a volume ratio of 1:3, and the mass ratio of 810Z00-T to RNAi agent in the mixing process is controlled to be 6.2:1, to form a lipid nanoparticle precursor mixture. The precursor mixture is dialyzed against 20mM pH 7.5 Tris HCl solution to remove ethanol. The prescribed amount of sodium chloride is added and dissolved to obtain an RNAi encapsulated lipid nanoparticle preparation. The preparation is filtered to remove bacteria, and stored at 2-8°C until use.
[0353] For Composition 2 of TJR104398, Composition 2 is prepared according to the same method as described above for preparing Composition 1, except that L369 is used instead of 810Z00-T.
[0354] For Composition 3 of TJR104398, Composition 3 is prepared according to the same method as described above for preparing Composition 2, except that L369, DSPC, cholesterol, DMG-PEG 2000 are dissolved in ethanol to prepare a lipid solution at a molar ratio of 50:10:38.5:1.5.
[0355] Example 4. Inhibition activity of the RNAi agents of the disclosure on two concentration points of human CTNNB1 gene in Hep3B cells
[0356] The RNAi agents of the disclosure are screened for in vitro molecular level activity in Hep3B cells using two concentration gradients (1nM, 0.1nM).
[0357] Hep3b cells are cultured in DMEM medium containing 10% fetal bovine serum at 37°C, 5% CO2. 16h before transfection, Hep3b cells are seeded in a 96-well plate at a seeding density of 2x10 4 cells per well, and 100μL of culture medium per well.
[0358] According to the product manual, the RNAi agent was transfected using Lipofectamine RNAi MAX (ThermoFisher, 13778150), and the final concentration of the RNAi agent transfection gradient was 1 nM and 0.1 nM, with double-cone holes for each concentration. After 48 h of treatment, total RNA extraction was performed using the high-throughput cell RNA extraction kit FG0417-L / FG0418-XL (Zhiwan Medical, magnetic bead method), RNA reverse transcription experiment (Takara, RR037A), and quantitative real-time PCR (Thermo, 4444557) detection to measure the mRNA level of human CTNNB1, and the mRNA level of human CTNNB1 was corrected according to the level of the GAPDH internal control gene.
[0359] The instruments involved in this experiment are shown in Table 5.
[0360] Table 5. Experimental instruments
[0361] In real-time quantitative PCR detection, probe Q-PCR detection experiments were used, and the primer information is shown in Table 6.
[0362] Table 6. Taqman primer sequence information table
[0363] Result analysis method
[0364] After the Q-PCR detection experiment was completed, the corresponding Ct value was obtained according to the threshold value set by the system, and the expression of a certain gene was compared by the Ct value: comparing Ct refers to calculating the difference in gene expression by the difference between the Ct values of the internal control gene, also known as 2 -△△Ct , △△Ct = [(Ct experimental group target gene - Ct experimental group internal control) - (Ct control group target gene - Ct control group internal control)]. Inhibition rate (%) = (1 - residual amount of target gene expression) * 100%.
[0365] The results of the inhibitory activity of the RNAi agent of the present disclosure in Hep3B cells are shown in Table 7.
[0366] Table 7. Inhibitory activity of the RNAi agent of the present disclosure in Hep3B cells
[0367] Example 5. Multiple concentration point inhibitory activity of the RNAi agent of the present disclosure on human CTNNB1 gene in Hep3B cells
[0368] The RNAi agent disclosed herein was screened for in vitro molecular-level activity in Hep3B cells using multiple concentration gradients (1 nM, 0.2 nM, 0.04 nM, 0.008 nM, 0.0016 nM, 0.00032 nM, 0.000064 nM).
[0369] Heb3b cells were cultured in DMEM medium containing 10% fetal bovine serum at 37°C and 5% CO2. Sixteen hours before transfection, Heb3b cells were seeded into 96-well plates at a density of 2 × 10⁶ cells per well. 4 100 μL of culture medium per well for each cell.
[0370] Following the product manual, Lipofectamine RNAi MAX (ThermoFisher, 13778150) was used to transfect RNAi agents. The final concentrations of the RNAi agents used for transfection were 1 nM, 0.2 nM, 0.04 nM, 0.008 nM, 0.0016 nM, 0.00032 nM, and 0.000064 nM, with each concentration in duplicate. After 48 h of treatment, total RNA was extracted from cells using a high-throughput cell RNA extraction kit FG0417-L / FG0418-XL (ZhiFan Medical, magnetic bead method). RNA reverse transcription experiments (Takara, RR037A) and quantitative real-time PCR (Thermo, 4444557) were performed to detect the mRNA level of human CTNNB1. The mRNA level of human CTNNB1 was corrected based on the level of the GAPDH internal reference gene. The instruments and probes and primers used in this experiment are shown in Tables 5 and 6. After the Q-PCR assay is completed, the corresponding Ct value is obtained according to the threshold automatically set by the system. The expression of a specific gene can be relatively quantified by comparing Ct values: comparing Ct refers to calculating the difference in gene expression by comparing the Ct value with that of the internal reference gene, also known as 2-1. -△△Ct △△Ct=[(Ct experimental group target gene - Ct experimental group internal reference) - (Ct control group target gene - Ct control group internal reference)]. 2 -△△Ct This represents the residual expression rate relative to the control group. The half-maximal inhibitory concentration (IC50) is calculated using this value. 50 The fitting and calculation were performed. The results are shown in the table below.
[0371] Table 8. Inhibitory activity of the RNAi agent of this disclosure in Hep3B cells.
[0372] Example 6. Inhibitory activity of the liposome nanoparticle composition of the RNAi agent disclosed herein against multiple concentration points of the human CTNNB1 gene in Hep3B cells.
[0373] In vitro molecular-level activity screening of the liposome nanoparticle composition of the RNAi agent disclosed herein was performed in Hep3B cells using multiple concentration gradients.
[0374] Heb3b cells were cultured in DMEM medium containing 10% fetal bovine serum at 37°C and 5% CO2. Sixteen hours before drug treatment, Heb3b cells were seeded into 96-well plates at a density of 2 × 10⁶ cells per well. 4 100 μL of culture medium was used per well for each cell. The concentrations used were 20 nM, 4 nM, 0.8 nM, 0.16 nM, 0.032 nM, 0.0064 nM, and 0.00128 nM, with double replicates for each concentration. After 24 h of treatment, total RNA was extracted from the cells using a high-throughput cell RNA extraction kit FG0417-L / FG0418-XL (ZhiFan Medical, magnetic bead method). RNA reverse transcription assays (Takara, RR037A) and quantitative real-time PCR (Thermo, 4444557) were performed to detect the mRNA level of human CTNNB1. The mRNA level of human CTNNB1 was corrected based on the level of the GAPDH internal reference gene. The instruments used in this experiment and the probes and primers for qPCR are shown in Tables 5 and 6. After the Q-PCR assay is completed, the corresponding Ct value is obtained according to the threshold automatically set by the system. The expression of a specific gene can be relatively quantified by comparing Ct values: comparing Ct refers to calculating the difference in gene expression by comparing the Ct value with that of the internal reference gene, also known as 2-1. -△△Ct △△Ct=[(Ct experimental group target gene - Ct experimental group internal reference) - (Ct control group target gene - Ct control group internal reference)]. 2 -△△Ct This represents the residual expression rate relative to the control group. The half-maximal inhibitory concentration (IC50) is calculated using this value. 50 The fitting and calculation were performed. The results are shown in the table below.
[0375] Table 9. Inhibitory activity of the liposome nanoparticle composition of the RNAi agent disclosed herein in Hep3B cells.
[0376] Table 10. Inhibitory activity of the liposome nanoparticle composition of the RNAi agent disclosed herein in Hep3B cells.
[0377] Example 7. The RNAi agent disclosed herein exhibits inhibitory activity at multiple concentration points against the human CTNNB1 gene in Huh7 cells.
[0378] The RNAi agent disclosed herein was screened for in vitro molecular-level activity in Huh7 cells using multiple concentration gradients (1 nM, 0.2 nM, 0.04 nM, 0.008 nM, 0.0016 nM, 0.00032 nM, 0.000064 nM).
[0379] Huh7 cells were cultured in DMEM medium containing 10% fetal bovine serum at 37°C and 5% CO2. Following the product instructions, Lipofectamine RNAi MAX (ThermoFisher, 13778150) was used for RNAi transfection. The final concentrations of the RNAi transfection gradient were 1 nM, 0.2 nM, 0.04 nM, 0.008 nM, 0.0016 nM, 0.00032 nM, and 0.000064 nM, with double replicates for each concentration. 10 μL of the transfection reagent-siRNA mixture was added to a 96-well plate, followed by 90 μL of cell suspension, for a total of 1.5 × 10⁻⁶ cells. 4 Cells were processed for 48 hours. Total RNA was extracted using a high-throughput cell RNA extraction kit (Zhiang Biotechnology, magnetic bead method), and RNA reverse transcription assay (Takara, RR037A) and quantitative real-time PCR (Thermo, 4444557) were performed to determine the mRNA level of human CTNNB1. The mRNA level of human CTNNB1 was corrected based on the level of the GAPDH internal reference gene. The instruments, materials, and QPCR probes and primers used in this experiment are shown in Tables 5 and 6. After the QPCR detection experiment, the corresponding Ct value was obtained according to the automatically set threshold. The expression of a gene can be relatively quantified by comparing Ct values: comparing Ct refers to calculating the gene expression difference by the difference between the Ct value and the internal reference gene Ct value, also known as 2-1. -△△Ct △△Ct=[(Ct experimental group target gene - Ct experimental group internal reference) - (Ct control group target gene - Ct control group internal reference)]. 2 -△△Ct This represents the residual expression rate relative to the control group. The half-maximal inhibitory concentration (IC50) is calculated using this value. 50 The fitting and calculation were performed. The results are shown in the table below.
[0380] Table 11. Inhibitory activity of the RNAi agent disclosed herein in Huh7 cells.
[0381] Example 8. Detection of human CTNNB1 knockdown activity of the RNAi agent disclosed herein in hepatocellular carcinoma cells.
[0382] Hep3B cells were incubated at 37°C, 5% CO2 in a cell incubator. In 96-well plates, 5 μL of Opti-MEM containing 0.3 μL of Lipofectamine RNAiMax and 5 μL of Opti-MEM containing CTNNB1 siRNA were added to each well and incubated at room temperature for 15 minutes. CTNNB1 siRNA was tested at 1, 0.2, 0.04, 0.008, 0.0016, 0.00032, 0.000064 nM final concentration. 20000 Hep3B cells were added to the siRNA mixture for reverse transfection. After 24 hours, total RNA was extracted from Hep3B cells using the cell RNA magnetic bead method extraction kit and cDNA was synthesized using PrimeScript TM RT reagent Kit. In 96-well plates, cDNA, GAPDH primers and TaqMan probe, CTNNB1 primers and TaqMan probe, and TaqMan Fast Advanced Master Mix were added for fluorescent real-time PCR. Data was analyzed using the ΔΔCt method to quantitatively determine the expression level of CTNNB1. GraphPad was used to process data and calculate IC TM . Experimental materials, instruments, and primer information are shown in Tables 12 and 13. Results are shown in Table 14. 50 . Experimental materials, instruments, and primer information are shown in Tables 12 and 13. Results are shown in Table 14.
[0383] Table 12. Experimental materials and instruments
[0384] Table 13. Primer sequences
[0385] Table 14-1. Activity of CTNNB1 RNAi agents of the present disclosure in Hep3B cells
[0386] Table 14-2. Activity of CTNNB1 RNAi agents of the present disclosure in Hep3B cells
[0387] Example 9. Detection of CTNNB1 knockdown activity of RNAi agents of the present disclosure in monkey primary hepatocytes
[0388] 30,000 primary monkey hepatocytes (PCH) were added to each well of a 96-well plate and cultured in a cell culture incubator at 37°C and 5% CO2. 5 μL of Opti-MEM containing 0.3 μL of Lipofectamine RNAiMax and 5 μL of Opti-MEM containing CTNNB1 siRNA were mixed and incubated at room temperature for 15 minutes. After 6 hours of static adhesion of PCH cells, the siRNA mixture was added to the PCH cells for positive transfection. CTNNB1 siRNA was used in experiments at final concentrations of 5, 1, 0.2, 0.04, 0.008, 0.0016, 0.00032, and 0.000064 nM. 24 hours later, total RNA was extracted from PCH cells using a cell RNA magnetic bead extraction kit and analyzed using PrimeScript. TM cDNA was synthesized using the RT reagent kit. cDNA, GAPDH primers and TaqMan probes, CTNNB1 primers and TaqMan probes, and TaqMan were added to a 96-well plate. TM Real-time fluorescence PCR was performed using Fast Advanced Master Mix. Data were analyzed using the ΔΔCt method to quantify the relative expression level of CTNNB1. GraphPad was used to process the data and calculate the IC50. 50 The experimental materials, instruments, and primer information are shown in Tables 15 and 16. The results are shown in Table 17.
[0389] Table 15. Experimental Materials and Instruments
[0390] Table 16. Primer Information
[0391] Table 17. Activity of the CTNNB1 RNAi agent of this disclosure in PCH cells.
[0392] Example 10. Validation of the RNAi agent disclosed herein in mice for knockdown.
[0393] Male C57BL / 6J mice aged 6-8 weeks (purchased from Zhejiang Vital River Laboratory Animal Technology Co., Ltd.) were randomly divided into experimental and control groups after acclimatization, with 3 mice in each group at each time point. Mice in the experimental group received a single subcutaneous injection of the test compound at 1 mg / kg, while the control group received an equal volume of physiological saline. On day 14 (D14) and day 28 (D28) after administration, the mice were euthanized, and liver tissue was collected and placed in a solution containing 10 times the volume of... The solution was stored in EP tubes at 4°C and then transferred to -80°C. The mCTNNB1 mRNA level in mouse liver tissue was detected by RT-PCR. Primer information is shown in Table 18. The results of this example are shown in Table 19 and Figure 1.
[0394] The results show that the RNAi agent TJR104760 of the present disclosure has more excellent and longer-acting CTNNB1 inhibitory activity in vivo in mice than TJR105089 and TJR104359, and the inhibition rate of the RNAi agent TJR104760 of the present disclosure on mCTNNB1 mRNA is still as high as more than 70% on day 28.
[0395] Table 18. Primer sequences
[0396] Table 19. mCTNNB1 mRNA levels in liver tissues of C57BL / 6J mice
Claims
1. An RNAi agent, comprising a sense strand and an antisense strand forming a double-stranded region, the sense strand comprising at least 19 contiguous nucleotides of GUGGAUCUAUUUCAUGUUA (SEQ ID NO: 55); the antisense strand comprising at least 19 contiguous nucleotides of UAACAUGAAAUAGAUCCACCU (SEQ ID NO: 117).
2. The RNAi agent of claim 1, the sense strand comprising a nucleotide sequence as set forth in GUGGAUCUAUUUCAUGUUA (SEQ ID NO: 55); the antisense strand comprising a nucleotide sequence as set forth in UAACAUGAAAUAGAUCCACCU (SEQ ID NO: 117). Preferably, the sense strand is as set forth in GUGGAUCUAUUUCAUGUUA (SEQ ID NO: 55); the antisense strand is as set forth in UAACAUGAAAUAGAUCCACCU (SEQ ID NO: 117).
3. The RNAi agent of claim 1 or 2, wherein at least one nucleotide in the sense strand and / or the antisense strand is a modified nucleotide.
4. The RNAi agent of claim 3, wherein three consecutive nucleotides in the sense strand are 2'-fluoro-modified nucleotides; preferably, the 7th, 8th, 9th or 8th, 9th, 10th nucleotides in the sense strand from the 5' end to the 3' end are 2'-fluoro nucleotides, and the nucleotides at other positions are non-2'-fluoro-modified nucleotides; more preferably, the non-2'-fluoro-modified nucleotides are each independently selected from 2'-methoxy-modified nucleotides or inverted abasic-modified nucleotides.
5. The RNAi agent of any one of claims 3 or 4, the nucleotides at positions 2, 6, 12, 14 and 16 in the antisense strand from the 5' end to the 3' end are each independently 2'-fluoro-modified nucleotides; Preferably, the nucleotides at positions 2, 4, 6, 10, 12, 14, 16 and 18 in the antisense strand from the 5' end to the 3' end are each independently 2'-fluoro-modified nucleotides, and the nucleotides at other positions are non-2'-fluoro-modified nucleotides; or, the nucleotides at positions 2, 6, 12, 14 and 16 in the antisense strand from the 5' end to the 3' end are each independently 2'-fluoro-modified nucleotides, and the nucleotides at other positions are non-2'-fluoro-modified nucleotides; more preferably, the non-2'-fluoro-modified nucleotides are 2'-methoxy-modified nucleotides.
6. The RNAi agent of any one of claims 1-5, wherein at least one phosphodiester group in the sense strand and / or the antisense strand is a phosphodiester group with a modification group. Preferably, the phosphodiester group with a modification group is a phosphorothioate group.
7. The RNAi agent of claim 6, wherein the phosphodiester group with a modifying group is present at at least one of the following positions: between any two adjacent nucleosides from the 1st to the 4th nucleoside at the 5' terminal end and / or the 3' terminal end of the sense strand, and / or between any two adjacent nucleosides from the 1st to the 4th nucleoside at the 5' terminal end and / or the 3' terminal end of the antisense strand; Preferably, the phosphodiester group with a modifying group is present at at least one of the following positions: between the 1st and 2nd nucleosides, and between the 2nd and 3rd nucleosides at the 5' terminal end of the sense strand; between the 1st and 2nd nucleosides, and between the 2nd and 3rd nucleosides at the 3' terminal end of the sense strand; between the 1st and 2nd nucleosides, and between the 2nd and 3rd nucleosides at the 5' terminal end of the antisense strand; between the 1st and 2nd nucleosides, and between the 2nd and 3rd nucleosides at the 3' terminal end of the antisense strand; More preferably, the sense strand contains 4 phosphodiester groups with a modifying group; the antisense strand contains 4 phosphodiester groups with a modifying group.
8. The RNAi agent of any one of claims 1-7, wherein the 5' position of the 1st nucleoside at the 5' terminal end of the antisense strand is a 5'-vinyl phosphodiester group; Preferably, the 5'-vinyl phosphodiester group is a 5'-trans vinyl phosphodiester group.
9. The RNAi agent of any one of claims 1-8, wherein the RNAi agent comprises at least one structure according to Formula (I'-1): wherein a represents a direction toward the 3' terminal end of the oligonucleotide sequence, and b represents a direction toward the 5' terminal end of the oligonucleotide sequence; Preferably, the structure as shown in formula (I'-1) is selected from: a represents a direction toward the 3' terminal end of the oligonucleotide sequence, and b represents a direction toward the 5' terminal end of the oligonucleotide sequence.
10. The RNAi agent of claim 9, wherein, the 5' terminal end and / or the 3' terminal end of the sense strand of the RNAi agent of formula (I'-1); Preferably, the 5' terminal end and the 3' terminal end of the sense strand of the RNAi agent of formula (I'-1) are connected by a phosphodiester group. More preferably, the 5' terminal end and the 3' terminal end of the sense strand of the RNAi agent of formula (I'-1) are connected by a phosphorothioate group.
11. The RNAi agent of any one of claims 1-8, which contains 1 or 2 inverted abasic modified nucleosides; Preferably, the inverted abasic modified nucleoside is located in the sense strand; More preferably, the inverted abasic modified nucleoside is located at the 1st position from the 5' terminal end and / or the 1st position from the 3' terminal end of the sense strand.
12. The RNAi agent of claim 11, which contains 2 inverted abasic modified nucleosides located at the 1st position from the 5' terminal end and the 1st position from the 3' terminal end of the sense strand.
13. The RNAi agent according to any one of claims 1-12, wherein the RNAi agent comprises at least one structure as shown in formulas (I-5) and (I-6): wherein, Base represents a base, and the structure of formula (I-5) or formula (I-6) is connected to the adjacent nucleoside by a phosphodiester group or a phosphodiester group with a modifying group.
14. The RNAi agent of any one of claims 1-13, wherein, the antisense strand comprises a nucleotide sequence as set forth in any one of SEQ ID NO: 251, SEQ ID NO: 252, SEQ ID NO: 254, SEQ ID NO: 260, SEQ ID NO: 323 to SEQ ID NO:
331.
15. The RNAi agent of any one of claims 1-14, further comprising one or more delivery groups attached to the sense strand and / or antisense strand. Preferably, the delivery group comprises a targeting ligand targeting the liver. More preferably, the targeting ligand is selected from one or more of N-acetyl-galactosamine (GalNAc), N-trifluoroacetyl galactosamine, N-propionyl galactosamine, N-n-butyryl galactosamine, or N-isobutyryl galactosamine. Further, more preferably, the delivery group is selected from 16. The RNAi agent of claim 15, wherein the delivery group is attached to the 3’- or 5’-end of the sense strand or antisense strand via a phosphorothioate or phosphodiester group. Preferably, the delivery group is attached to the 3’-end of the sense strand of the RNAi agent.
17. The RNAi agent of any one of claims 1-16, wherein, the antisense strand comprises a nucleotide sequence as set forth in any one of SEQ ID NO: 282 to SEQ ID NO: 285, SEQ ID NO: 287, SEQ ID NO:
292.
18. A pharmaceutical composition comprising the RNAi agent of any one of claims 1-17, and a pharmaceutically acceptable excipient thereof.
19. The pharmaceutical composition of claim 18, comprising a lipid compound as shown in Formula (II) or a lipid compound as shown in Formula (III):
20. The pharmaceutical composition of claim 19, further comprising: cholesterol, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), and (R)-methoxy-PEG2000-carbamoyl- dioctadecyl-sn-glycero-phosphate (DMG-PEG 2000).
21. The pharmaceutical composition according to any one of claims 18-20, wherein, The molar ratio of each component of the lipid compound, DSPC, cholesterol, and DMG-PEG 2000 is 50:12:36:2 or 50: 10:38.5:1.5。 22. A cell comprising the RNAi agent of any one of claims 1-17.
23. A kit comprising the RNAi agent of any one of claims 1-17 and / or the pharmaceutical composition of any one of claims 18-21.
24. A method of reducing CTNNB 1 gene expression comprising administering to a subject an effective amount or dose of the RNAi agent of any one of claims 1-17 and / or the pharmaceutical composition of any one of claims 18-21.
25. A method of treating and / or preventing a disease in a subject comprising administering to the subject an effective amount or dose of the RNAi agent of any one of claims 1-17 and / or the pharmaceutical composition of any one of claims 18-21; preferably, the disease is cancer.
26. A method of delivering an RNAi agent that inhibits CTNNB 1 expression and / or replication in vivo, the method comprising administering to a subject the RNAi agent of any one of claims 1-17 and / or the pharmaceutical composition of any one of claims 18-21.
27. A method of making an RNAi agent and / or a pharmaceutical composition, comprising: synthesizing the RNAi agent of any one of claims 1-17 or the pharmaceutical composition of any one of claims 18-21.
Citation Information
Patent Citations
Rna interference mediated inhibition of catenin (cadherin-associated protein), beta 1 (ctnnb1) gene expression using short interfering nucleic acid (sina)
CN103068980A
Oligonucleotide molecule for inhibiting expression of CTNNB1 target gene mRNA and complete kit thereof
CN107365771A
Beta catenin (CTNNB1) iRNA compositions and methods of use thereof
CN117651769A
Methods and compositions for the specific inhibition of beta-catenin by double-stranded RNA
US20130109740A1
Beta-catenin nucleic acids and uses thereof
US20170314030A1