composition

By employing human platelet lysate and low molecular weight poly-L-lysine, MSC aggregates with enhanced characteristics are produced, addressing scalability and quality issues, achieving therapeutic benefits in treating various diseases.

WO2026032855A1PCT designated stage Publication Date: 2026-02-12CELLBIOMEDEU GROUP SL
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/072130
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-06
Filing Date
2025-07-31
Publication Date
2026-02-12

AI Technical Summary

Technical Problem

Existing methods for producing mesenchymal stem cells (MSCs) and their conditioned medium are limited by scalability, cost, and the artificial microenvironment created by cell adherence, which affects the quality and secretion of bioactive factors.

Method used

The use of human platelet lysate at specific concentrations and low molecular weight poly-L-lysine during priming results in the formation of MSC aggregates with improved morphology, cell output, and metabolic activity, which are stable and suitable for therapy, and their conditioned medium exhibits therapeutic effects on various diseases.

Benefits of technology

The MSC aggregates and their conditioned medium show high therapeutic potential, including significant effects on cartilage regeneration, frostbite recovery, colitis recovery, and wound healing, with low dose tolerance and no adverse effects, indicating improved quality and efficacy compared to traditional methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000052_0001
    Figure IMGF000052_0001
  • Figure IMGF000059_0001
    Figure IMGF000059_0001
  • Figure IMGF000059_0002
    Figure IMGF000059_0002
Patent Text Reader

Abstract

Provided herein is a composition comprising a population of mesenchymal stem cell (MSC) aggregates, wherein the aggregates have a mean diameter between 30 to 250 microns and number of cells per aggregate between 100 to 500 MSCs. Also provided is a method of producing said composition, and a method of obtaining conditioned medium from said aggregates. Both the composition comprising the aggregates, and the conditioned medium may be used to treat diseases, disorders, conditions or injuries such as age-related disorders, chronic and acute inflammatory conditions (including arthritis), degenerative joint diseases (including osteoarthritis), joint injury, chronic and acute respiratory diseases, musculoskeletal conditions, neurodegenerative diseases and / or brain injury.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] COMPOSITION

[0002] FIELD OF THE INVENTION

[0003] The present invention relates to compositions comprising a population of mesenchymal stem cell (MSC) aggregates, wherein the aggregates have homogenous characteristics, such as diameter and number of cells per aggregate and methods of producing said composition. The present method may also be used to produce a conditioned medium. Both the composition comprising the aggregates, and the conditioned medium may be used to treat diseases, disorders, conditions or injuries, such as age-related disorders, chronic and acute inflammatory conditions (including arthritis), degenerative joint diseases (including osteoarthritis), joint injury, chronic and acute respiratory diseases, musculoskeletal conditions, neurodegenerative diseases and / or brain injury.

[0004] BACKGROUND OF THE INVENTION

[0005] Cell therapy is a popular field of regenerative medicine. However, the use of cell therapy is limited by difficulties in providing methods that consistently result in cellular products of high quality. The use of cells cultured in monolayers, or immobilized to micro supports in bioreactors, have been the most studied culture methods for production of MSCs and conditioned medium from MSCs. However, both have important limitations at the level of manufacture. In the case of 2D culture, 2D culture is limited in terms of monitoring and the ability to control variables, along with issues of scaling the method for industrial use. 2D cultures therefore do not present a viable method of producing MSCs for therapy, nor condition medium from said cells. Similarly, culture in bioreactors is highly expensive. Both 2D cultures and bioreactor methods are further limited by the requirement of surfaces for the cells to adhere to, which results in an artificial microenvironment that limits the cellular interactions important for the secretion of bioactive factors, and therefore affect the quality of the MSCs and conditioned medium to be obtained. There is therefore a need for culture methods that are scalable for industrial use, cost effective, and result in high quality MSC cultures and conditioned medium.

[0006] SUMMARY OF THE INVENTION

[0007] The inventors found surprising effects at different stages of the aggregate preparation process. First, the inventors surprisingly found that human platelet lysate at specific concentrations (i.e. , 3- 5% of human platelet lysate in cell culture medium) resulted in a drastic improvement in the morphology of cultured MSCs and the cell output number during MSC expansion (i.e., serial passaging of MSCs to increase the number of cells). Expansion of MSC cultures with other growth supplements (e.g., mitogens) such as FBS surprisingly did not result in adequate cell numbers to produce aggregates.

[0008] The inventors also surprisingly found that the methods of producing aggregates as described herein resulted in aggregates that had surprising characteristics. In particular, the small number of cells per aggregate suggests that the cells in the aggregates are healthier than cells in larger aggregates, as nutrients are better able to reach the centre of a smaller aggregate. In addition, the MSCs in the aggregates were not proliferative which means that such aggregates may be more suitable for therapy as they are not expected to have tumour-like properties. Similarly, the MSCs in the aggregates retained their differentiation potential (Example 2), which means that they are expected to be beneficial for cell-replacement therapies. The aggregates were also surprisingly stable at room temperature for at least 48 hours, at 4-6 °C for 24 hours and at 40 °C for 8 hours which is practical for therapy (Example 2).

[0009] The aggregates were surprisingly able to survive in transplanted tissue until at least 3 weeks after treatment (Example 8). Surprisingly, a single dose resulted in protective effects against Parkinson’s disease pathology (Example 8) and had a significant therapeutic effect on cartilage regeneration (Example 7), frostbite recovery (Example 6) and colitis recovery (Example 16). The dose of aggregates in these experiments was low, indicating that these aggregates have a high therapeutic potential. A surprisingly high number of aggregates were tolerated at a systemic dose of 300 and 1500 aggregates in animals (Example 5). Similarly, local administration allowed the application of an even higher number of aggregates (up to 3000 aggregates) with no adverse effects (Example 4).

[0010] Similarly, conditioned medium from the aggregates resulted in a surprising therapeutic effect on wound healing compared to administration of conditioned medium from monolayer ad-hMSCs (Example 17). Similarly, conditioned medium from aggregates was found to be helpful in treating colitis (Example 16).

[0011] Finally, the inventors surprisingly found that the morphology, cell viability and metabolic activity of primed aggregates were improved by the addition of a low molecular weight poly-l-lysine during priming (Example 12). In addition, the inventors found that certain priming conditions resulted in improved metabolic activity of MSCs in aggregates (Example 14). Priming can therefore be used to improve the quality of aggregates for therapy, or to improve the quality of conditioned medium obtained from the aggregates. The aggregates described herein, or conditioned medium obtained from said aggregates, are expected to have an improved effect compared to aggregates obtained using other methods.

[0012] Therefore, one aspect of the present disclosure relates to a composition comprising aggregates of mesenchymal stem cells (MSCs), wherein the aggregates have a mean diameter between 30 to 250 microns, and wherein the aggregates comprise, consist or consist essentially of 50 to 500 MSCs.

[0013] In embodiments, the aggregates have a mean diameter between 30 to 250 microns, 30 to 240 microns, 35 to 230 microns, 40 to 230 microns, 45 to 230 microns, 50 to 225 microns, 50 to 220 microns, 50 to 210 microns, 50 to 200 microns, 50 to 190 microns, 60 to 210 microns, 60 to 200 microns, 60 to 190 microns, 60 to 180 microns, 65 to 175 microns, 70 to 170 microns, 75 to 165 microns, 80 to 160 microns. In embodiments, the aggregates have a mean minimum diameter of

[0014] 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, or 85 microns, preferably wherein the mean minimum diameter of the aggregates is 85 ± 31 pm. In embodiments, the aggregates have a mean maximum diameter of 110, 115, 120, 125, 130, 140, 150, 160, 170, 180, 190, 200, 210 or 220 microns, preferably wherein the mean maximum diameter of the aggregates is 156 ± 64 pm. In embodiments, the diameter is a Feret diameter.

[0015] In embodiments, the aggregates comprise, consist or consist essentially of a mean number of MSCs between 100 to 500 MSCs, 100 to 450 MSCs, 100 to 400 MSCs, 150 to 350 MSCs, 200 to 350 MSCs, 200 to 300 MSCs, or around 238 MSCs, preferably when counted using a method described herein.

[0016] In embodiments, the aggregates have a mean perimeter between 100 to 700, 150 to 650, 150- 625, 150-600, 175-575, 200-550, 225-525, 250-500, 275-500, 250-475, 250-450, 250-425, 275- 450, 250-425, 275-425, 300-425, 300-400 or around 383 ± 111 microns.

[0017] In embodiments, the aggregates have a mean circularity of at least 0.5, 0.55, 0.6, 0.61 , 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69 or 0.70 ± 0.1. In embodiments, the aggregates have a mean circularity between 0.5 to 1.0, 0.5 to 0.99, 0.5 to 0.98, 0.5 to 0.95, 0.55 to 0.9, 0.6 to 1.0, 0.6 to 0.99, 0.6 to 0.98, 0.6 to 0.95, 0.6 to 0.9, 0.6 to 0.85, 0.6 to 0.8, 0.65 to 1.0, 0.65 to 0.99, 0.65 to 0.98, 0.65 to 0.95, 0.65 to 0.90, 0.65 to 0.85, 0.65 to 0.80, 0.60 to 0.80, 0.65 to 0.75, or 0.68 to 0.71 , preferably between 0.60 to 0.80.

[0018] In embodiments, the aggregates have a mean roundness of at least 0.5, 0.6, 0.65, 0.7, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81 , 0.82, 0.83 or 0.84. In embodiments, the aggregates have a mean roundness between 0.5 to 1.0, 0.5 to 0.95, 0.6 to 1.0, 0.6 to 0.95, 0.7 to 1.0, 0.7 to 0.99, 0.7 to 0.95, 0.75 to 1.0, 0.75 to 0.99, 0.75 to 0.95, 0.75 to 0.9, 0.78 to 0.9, 0.8 to 0.9, 0.79 to 0.89, or 0.83 to 0.85.

[0019] In embodiments, the aggregates have a mean solidity of 0.8-1.0, 0.82-1.0, 0.84-0.99, 0.86-0.97, 0.88-0.95, or 0.9-0.93.

[0020] In embodiments, the percentage of aggregates having the mean diameter, mean perimeter, mean circularity, mean roundness, mean number of cells, or mean solidity is least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% of the total number of aggregates.

[0021] In embodiments, the MSCs are human MSCs (hMSCs). In embodiments, the MSCs are derived from adipose tissue (ad-hMSCs), bone marrow, umbilical cord, Wharton’s jelly, gingiva, amniotic fluid and membrane, dental tissue, limb bud, menstrual blood, peripheral blood, placenta, foetal membrane, endometrium, salivary gland, skin and foreskin, synovial fluid, or cartilage tissue, preferably from adipose tissue. In embodiments, the MSCs comprise two X chromosomes.

[0022] In embodiments, the aggregates secrete one or more of: anti-inflammatory cytokines, growth factors, or chondrogenic factors.

[0023] In embodiments, the aggregates secrete one or more of: Tumor necrosis factor- (TNF) stimulated gene-6 (TSG-6), interleukin 1 receptor associated kinase (IRAK), interleukin (IL) 10 (IL-10), IL- 12, IL-8, nitric oxide (NO), C-X-C motif chemokine ligand 10 (CXCL10), hepatocyte growth factor (HGF), Prostaglandin E2(PGE2), leukemia inhibitory factor (LIF), tissue inhibitor matrix metalloproteinase (TIMP) 1 (TIMP-1), TIMP-2, Cellular Inhibitor of Apoptosis Protein 1 (IAP-1), tumour necrosis factor alpha (TNFa), Stanniocalcin-1 (STC1), interleukin-1 receptor antagonist (IL-1 Ra), FGF2, cyclooxygenase-2 (COX-2), vascular endothelial growth factor (VEGF), bone morphogenetic protein-2 (BMP2), and / or interleukin 6 (IL-6). In embodiments, the secretion of TSG-6, GONE, IRAQ, EPI-2, IL-10, IL-12, IL-8, NO, CXCL10, HGF, PGE2, LIF, TIMP-1 , TIMP-2, IAP-1 , TNFa, STC1 , IL-1 Ra, FGF2, COX-2, VEGF, BMP2, and / or IL-6 from the aggregates is increased compared to a composition comprising control aggregates.

[0024] In embodiments, the metabolic activity of the aggregates is increased compared to a composition comprising control aggregates. Preferably, wherein the consumption of glucose by the aggregates is increased compared to a composition comprising control aggregates. Preferably, wherein the production of lactate by the aggregates is increased compared to a composition comprising control aggregates. Another aspect of the present disclosure provides a conditioned medium that has been exposed to the aggregates described herein.

[0025] Another aspect of the present disclosure provides a pharmaceutical composition comprising the composition described herein, in combination with a pharmaceutically acceptable carrier, excipient or diluent. In embodiments, the pharmaceutically acceptable carrier, excipient or diluent is a saline solution, or a pharmaceutically acceptable buffer. In embodiments the pharmaceutically acceptable buffer is a phosphate buffer or bicarbonate buffer. In embodiments, the pharmaceutically acceptable buffer is a Krebs-Ringer HEPES buffer, preferably at pH 7.4 (+ / - 0.2), more preferably a Krebs-Ringer HEPES buffer comprising: 120 mM NaCI, 2 mM CaCh, 5 mM KCI, 25 mM NaHCCh, 1 mM Glucose, 1 mM MgCh, and 5.5 mM HEPES. The Krebs-Ringer HEPES buffer was found by the inventors to improve the stability of the composition of aggregates.

[0026] In embodiments, the pharmaceutical composition comprises 100-500000, 1000-500000, 100- 200000, 100-180000, 100-160000, 100-150000, 100-125000, 100-100000, 100-75000, 100- 50000, 100-25000, 100-20000, 100-17500, 100-15000, 100-12500, 100-10000, 500-200000, 500-180000, 500-160000, 500-150000, 500-125000, 500-100000, 500-75000, 500-50000, 500- 25000, 500-20000, 500-17500, 500-15000, 500-12500, 500-10000, 500-8000, 1000-200000, 1000-180000, 1000-160000, 1000-150000, 1000-125000, 1000-100000, 1000-75000, 1000- 50000, 1000-25000, 1000-20000, 1000-17500, 1000-15000, 1000-12500, 1000-10000, 1000- 8000, 1000-6000, 1000-5000, 2000-8000, 2000-6000, 2000-5000, 2000-4000, 2000-3000 or 3000-4000 aggregates per dose, preferably per dose for an 80 kg human.

[0027] Another aspect of this disclosure relates to use of the conditioned medium, composition or pharmaceutical composition described herein, for treatment or prevention of age-related disorders, chronic and / or acute inflammatory conditions, degenerative joint diseases, joint injury, traumatic lesions, chronic and / or acute respiratory diseases, musculoskeletal conditions, neurodegenerative diseases and / or brain injury.

[0028] In embodiments, the inflammatory disease is a chronic or acute inflammatory condition. In embodiments, the inflammatory condition is selected from ulcerative colitis, Chron’s disease, Epidermolysis bullosa, degenerative disc disease, facet syndrome, chondromalacia patella, tendinopathy, arthritis, or osteoarthritis, preferably wherein the inflammatory disease is osteoarthritis. In embodiments, the injury is a wound, burn, corrosion, lesion, wear, cut, and / or traumatic lesion. For example, the injury may be or be the result of frostbite, osteoarthritis, degenerative disc disease, facet syndrome, chondromalacia patella, and / or Epidermolysis bullosa.

[0029] In embodiments, the neurodegenerative disease is selected from Parkinson’s disease, Alzheimer’s disease, Amyotrophic lateral sclerosis, Huntington’s disease, Motor Neuron Disease, stroke, traumatic brain injury and multiple sclerosis.

[0030] In embodiments, the composition, conditioned medium or pharmaceutical composition is administered to a site of pathology.

[0031] In embodiments, the chronic and / or acute respiratory disease is COVID-19.

[0032] In embodiments, the musculoskeletal condition is osteoarthritis, rheumatoid arthritis, juvenile arthritis, spondyloarthritis, fractured bone, tendinitis, bursitis, back problems, gout, osteoporosis, bruise, sprain, strain, sarcopenia, cartilage tear, tendon tear, torn ligament, dislocation, soft-tissue damage, or amputation.

[0033] In embodiments, the degenerative joint disease, joint injury, or age related disorder is osteoarthritis.

[0034] Another aspect of the present disclosure provides a method of treating or preventing age-related disorders, chronic and / or acute inflammatory conditions, degenerative joint diseases, joint injury, traumatic lesions, chronic and / or acute respiratory diseases, musculoskeletal condition, neurodegenerative diseases and / or brain injury in a subject in need thereof, said method comprising administering to the subject in need thereof the composition, conditioned medium, or the pharmaceutical composition disclosed herein.

[0035] In embodiments, the inflammatory disease is a chronic or acute inflammatory condition. In embodiments, the inflammatory condition is selected from ulcerative colitis, Crohn's disease, Epidermolysis bullosa, degenerative disc disease, facet syndrome, chondromalacia patella, tendinopathies, arthritis or osteoarthritis, preferably wherein the inflammatory disease is arthritis.

[0036] In embodiments, the injury is a wound, burn, corrosion, lesion, wear, cut, and / or traumatic lesion. For example, the injury may be or be the result of frostbite, osteoarthritis, degenerative disc disease, facet syndrome, chondromalacia patella, and / or Epidermolysis bullosa. In embodiments, the neurodegenerative disease is selected from Parkinson’s disease, Alzheimer’s disease, Amyotrophic lateral sclerosis, Huntington’s disease, Motor Neuron Disease, stroke, traumatic brain injury and multiple sclerosis.

[0037] In embodiments, the musculoskeletal condition is osteoarthritis, rheumatoid arthritis, juvenile arthritis, spondyloarthritis, fractured bone, tendinitis, bursitis, back problems, gout, osteoporosis, bruise, sprain, strain, sarcopenia, cartilage tear, tendon tear, torn ligament, dislocation, soft-tissue damage, or amputation.

[0038] In embodiments, the composition, conditioned medium or pharmaceutical composition is administered to a site of pathology.

[0039] In embodiments, the chronic and / or acute respiratory disease is COVID-19.

[0040] In embodiments, the degenerative joint disease, joint injury, or age-related disorder is osteoarthritis.

[0041] In embodiments, the subject is administered a therapeutically effective dose of the composition, conditioned medium or pharmaceutical composition.

[0042] Another aspect of the present disclosure relates to a method of producing a composition comprising aggregates of mesenchymal stem cells (MSCs), said method comprising: (a) providing 100,000 to 1 ,000,000 MSCs to a cell culture container; and (b) culturing the MSCs in the container to obtain a composition comprising aggregates as defined herein.

[0043] In embodiments, between 100-500,000, 1000-500,000, 10000-500,000, 100,000-500,000, 100- 400,000, 1000-400,000, 10000-400,000, 100,000-400,000, 100-350,000, 1000-350,000, 10000- 350,000, 100,000-350,000, 200,000-400,000, 250,000-350,000, 300,000-350,000, 100-200000, 100-180000, 100-160000, 100-150000, 100-125000, 100-100000, 100-75000, 100-50000, 100- 25000, 100-20000, 100-17500, 100-15000, 100-12500, 100-10000, 500-200000, 500-180000, 500-160000, 500-150000, 500-125000, 500-100000, 500-75000, 500-50000, 500-25000, 500- 20000, 500-17500, 500-15000, 500-12500, 500-10000, 500-8000, 1000-200000, 1000-180000, 1000-160000, 1000-150000, 1000-125000, 1000-100000, 1000-75000, 1000-50000, 1000- 25000, 1000-20000, 1000-17500, 1000-15000, 1000-12500, 1000-10000, 1000-8000, 1000- 6000, 1000-5000, 2000-8000, 2000-6000, 2000-5000, 2000-4000, 2000-3000 or 3000-4000 aggregates are provided per dose. In embodiments, these doses are the total dose for an 80 kg human. It is estimated that the average human weighs around 80 kg. In embodiments, these doses are per kg body weight. In embodiments, these doses are per cm2of injured area to be treated.

[0044] In embodiments, between 10-5000, 100-5000, 1000-5000, 10-3500, 100-3500, 1000-3500, IQ- 3000, 100-3000, 1000-3000, 2000-3000, 10-2500, 100-2500, 1000-2500, 10-2000, 100-2000, 1000-2000, 10-10-1500, 10-1000, 100-1000, 10-500, 25-500, 50-500, 100-500, 10-450, 25-450, 50-450, 10-400, 25-400, 50-400, 10-350, 25-350, 50-350, 10-300, 25-300, 50-300, 10-250, 25- 250, 50-250, 10-200, 25-200, 50-200, 10-150, 25-150, 50-150, 10-125, 10-100, 20-100, 30-100, 40-100, 10-90, 20-90, 30-90, 40-90, 10-80, 20-80, 30-80, 40-80, 10-70, 20-70, 30-70, 40-70, IQ- 60, 20-60, 30-60, 40-60, or 30-50 aggregates per kg body weight are provided as a dose. In embodiments, between 10-3000, 100-3000, 1000-3000, 10-2500, 100-2500, 1000-2500, IQ- 2000, 100-2000, 1000-2000, 10-1500, 100-1500, 1000-1500, 10-1000, 100-1000, 10-500, 25- 500, 50-500, 10-450, 25-450, 50-450, 10-400, 25-400, 50-400, 10-350, 25-350, 50-350, 10-300, 25-300, 50-300, 10-250, 25-250, 50-250, 10-200, 25-200, 50-200, 10-150, 25-150, 50-150, IQ- 125, or 10-100 aggregates per cm2of injury surface area is provided as a dose.

[0045] In embodiments, the culture container comprises one or more wells comprising at least one cavity, wherein the cavity is a pyramid with a rounded tip, and wherein the pyramid has rounded edges between the pyramid side walls.

[0046] In embodiments, the MSCs are cultured in the cell culture container for between 24 to 120, 36 to 108, 48 to 96, 60 to 84, 66 to 78, 69 to 75 or around 72 hours.

[0047] In embodiments, the method further comprises a step before (a) of culturing MSCs in a medium comprising 1-5%, 1.5-4.5%, 2-4%, 2.5-3.5% or around 3% human platelet lysate.

[0048] In embodiments, the MSCs are plated at an initial seeding density of between 2000-6000, 2000- 5000, 2500-5000, 3000-5000, or around 3000 cells / cm2.

[0049] In embodiments, the MSCs are human MSCs (hMSCs). In embodiments, the MSCs are derived from adipose tissue (ad-hMSCs), bone marrow, umbilical cord, Wharton’s jelly, gingiva, amniotic fluid and membrane, dental tissue, limb bud, menstrual blood, peripheral blood, placenta, foetal membrane, endometrium, salivary gland, skin and foreskin, synovial fluid, or cartilage tissue, preferably from adipose tissue. In embodiments, the MSCs comprise two X chromosomes. In embodiments, the MSCs have been passaged between 1 to 12 times, preferably wherein the MSCs have been passaged up to 12 times, more preferably wherein the MSCs have been passaged up to 6 times. In embodiments, the passage number refers to the number of passages before MScs are used to form spheroids. In embodiments, the MSCs are obtained from a donor under the age of 40 years old, preferably wherein the MSCs are obtained from a donor between 18 to 35 years old, more preferably wherein the MSCs are obtained from a donor between 25 to 35 years old.

[0050] In embodiments, the MSCs are cultured for aggregation in a media for MSCs, preferably a media for undifferentiated MSCs. In embodiments, the medium comprises or consists or consists essentially of: alpha MEM In embodiments, the medium further comprises human platelet lysate. In embodiments, the human platelet lysate is present in the media at between 0.1 to 10%, 0.1 to 8%, 0.1 to 7%, 0.1 to 5%, 0.1 to 4%, 0.1 to 3%, 0.1 to 2%, 0.5 to 2%, 0.5 to 1.5%, or around 1% (v / v). In embodiment, the media further comprises one or more antibiotics, such as penicillin / streptomycin or gentamicin. In embodiments, the media further comprises heparin, preferably heparin at 2 Ul / rnl. In preferred embodiments, the media comprises or consists or consists essentially of: alpha MEM, platelet lysate, heparin and one or more antibiotics.

[0051] In embodiments, the MSCs are cultured at a temperature between 34 °C to 40 °C, 35 °C to 39 °C, 36 °C to 38 °C, 36.5 °C to 37.5 °C or around 37 °C.

[0052] In embodiments, one or more internal surfaces of the culture container is coated with a hydrophobic composition, preferably comprising or consisting of hydrophobic silanes, silica, polyethylene glycol, polydimethylsiloxane, organopolysiloxane in heptane, or agarose.

[0053] In embodiments, the method further comprises (c) priming the MSC aggregates. In embodiments, the aggregates are primed in a bioreactor. In embodiments, the bioreactor is a rotating vessel, vertical wheel or hollow fiber bioreactor.

[0054] In embodiments, the aggregates are primed under hypoxic conditions, preferably wherein the MSCs are primed with between 2-8%, 3-7%, 3.5-6.5%, 4-6%, 4.5-5.5% or around 5% O2. In embodiments, the aggregates are primed with between 2-8%, 3-7%, 3.5-6.5%, 4-6%, 4.5-5.5% or around 5% CO2.

[0055] In embodiments, the aggregates are agitated during priming, preferably wherein the aggregates are agitated at a speed of between 60-100, 65-95, 70-90, 75-85 or around 80 revolutions per minute (rpm). In embodiments, the aggregates are agitated during priming at a speed between 0.5-5, 0.5-4, 0.5-3, 1-3, 1.5-2.5 or around 2 relative centrifugal force (RCF, also referred to as g force).

[0056] In embodiments, the aggregates are primed in a culture container with one or more internal surfaces coated with a hydrophobic composition, preferably comprising or consisting of hydrophobic silanes, silica, poly-ethylene glycol, polydimethylsiloxane, organopolysiloxane in heptane, or agarose.

[0057] In embodiments, the aggregates are primed at a temperature between 34 °C to 40 °C, 35 °C to 39 °C, 36 °C to 38 °C, 36.5 °C to 37.5 °C or around 37 °C.

[0058] In embodiments, the aggregates are primed in the presence of a cationic polymer. In embodiments, the cationic polymer is added to a culture media. In embodiments, the final concentration of cationic polymer in the media is between 0.1-5, 0.5-5, 0.1-4, 0.1-3.5, 0.1-3, 0.5- 3.5, 0.5-3, 0.1-2.5, 0.5-2.5, 0.1-2, 0.5-2, 0.1-1.5, 0.5-1.5, or around 1 pg / mL. In embodiments, the cationic polymer is poly-L-lysine. In embodiments, the poly-L-lysine is low molecular weight poly- L-lysine. In embodiments, the poly-L-lysine has a molecular weight between 1 ,000 to 100,000, 1 ,000 to 90,000, 1 ,000 to 80,000, 1 ,000 to 75,000, 1 ,000 to 70,000, 5,000 to 100,000, 5,000 to 90,000, 5,000 to 80,000, 5,000 to 75,000, 5,000 to 70,000, 10,000 to 100,000, 10,000 to 90,000, 10,000 to 80,000, 10,000 to 75,000, 10,000 to 70,000, 15,000 to 100,000, 15,000 to 90,000, 15, 000 to 80,000, 15,000 to 75,000, 15,000 to 70,000, 20,000 to 100,000, 20,000 to 90,000, 20,000 to 80,000, 20,000 to 75,000, 20,000 to 70,000, 25,000 to 100,000, 25,000 to 90,000, 25,000 to 80,000, 25,000 to 75,000, 25,000 to 70,000, 30,000 to 100,000, 30,000 to 90,000, 30,000 to 80,000, 30,000 to 75,000 or 30,000 to 70,000 Da.

[0059] In embodiments, the aggregates are primed in a media, preferably a media for MSCs, more preferably a media for undifferentiated MSCs. Preferably, the medium is serum free and xeno- free. In embodiments, the media comprises or consists of StemPro™ MSC serum free (SFM) XenoFree medium (Gibco, Thermo Fisher Scientific, A1067501) .

[0060] Another aspect of the disclosure relates to aggregates obtained or obtainable by the method of producing aggregates described herein.

[0061] Another aspect of the disclosure relates to a method of producing a conditioned medium, wherein the method comprises the method of producing the aggregates as described herein, and wherein the method further comprises a step of harvesting culture medium exposed to the aggregates.

[0062] Another aspect of the disclosure relates to a composition comprising the conditioned medium obtained or obtainable by the method of producing conditioned medium as described herein.

[0063] Another aspect of the disclosure relates to a method of producing a pharmaceutical composition as described herein, wherein the method comprises the method of producing the aggregates as described herein, and wherein the method further comprises providing the aggregates with a pharmaceutically acceptable carrier, excipient or diluent.

[0064] Another aspect of the disclosure relates to a method for expanding mesenchymal stem cells, said method comprising culturing MSCs in a medium comprising 1-5%, 1.5-4.5%, 2-4%, 2.5-3.5% or around 3% human platelet lysate. In embodiments, the MSCs are plated with an initial seeding density of 2000-6000, 2000-5000, 2500-5000, 3000-5000, or around 3000 cells / cm2.

[0065] BRIEF DESCRIPTION OF THE DRAWINGS

[0066] The accompanying drawings are not intended to be drawn to scale. The Figures are illustrative only and are not required for enablement of the disclosure. For purposes of clarity, not every component may be labelled in every drawing.

[0067] Figure 1. Comparison of six mitogens on hMSC expansion. Effect of mitogens on hMSC (A) cell density (cells / cm2), (B) cell viability, or (C) DTP. MSCs are Histocell 2022 Master Cell Bank 02. Cells were evaluated in both normoxia (blue, left) and hypoxia (red, right). Tested mitogens = FBS Q, FBS P, NuSerum, and xeno-free mitogens SteMACS and human platelet lysates (numbers indicate batches).

[0068] Figure 2. Comparison of mitogens on expansion of hMSCs from different sources. FBS P, FBSQ, NuSerum, SteMACs and human platelet lysate on MSCs from three different donors; Histocell 2022 Master Cell Bank 02 (MCB02-HTC-22), Histocell 2022 Master Cell Bank 01 (MCBO1-HTC-22) and Internal Allogenic Master Cell Bank 004 (004-ALO-22).

[0069] Figure 3. Comparison of effect of mitogens in combination with alpha-minimum essential medium (aMEM) and Dulbecco’s modified eagle medium (DMEM) on the (A) and (D) cell density, (B) and (E) cell viability, or (C) and (F) DTP of (A)-(C) MSCs from HistoCell 2022 master cell bank 02 (MCB-HTC-22) or (D)-(F) Innoprot 2022 Master Cell Bank (MCB-I NO-22).

[0070] Figure 4. Effects of concentration of platelet lysate on the expansion of MSCs. Concentrations between 1-5% of platelet lysate in total media were tested on Histocell 2022 Master Cell Bank 02 MSCs that were plated at different seeding densities of 1000-5000 cells (input) on (A) cell viability and (B) cell output. Concentrations between 1-5% of platelet lysate in total media were also tested on Innoprot 2022 Master Cell Bank (MCB-I NO-22) for (C) cell output, (D) cell viability, and (E) DTP. Figure 5. Effect of platelet concentration on morphology of MSCs. (A) shows the morphology of MSCs plated without (0%) platelet lysate, and with 1 %, 2%, 3%, 4% and 5% platelet lysate. (B) shows a heat map where MSCs were expanded with 1-5% platelet lysate with seeding densities ranging between 1000-5000 cells. Morphology was assessed by five different experienced observers and classified as optimal, regular or deficient with respect to a pre-agreed standard of characteristics.

[0071] Figure 6. Characterisation of the cytokines and molecules in FBS, platelet lysate and pooled human sera. (A) heat map showing the levels of pro-inflammatory, and anti-inflammatory cytokines, along with regenerative and adhesion molecules in FBS, human platelet lysate and pooled human sera. (B) absolute levels of pro-inflammatory, and anti-inflammatory cytokines, along with regenerative and adhesion molecules in FBS, human platelet lysate and pooled human sera.

[0072] Figure 7. Masks generated with Imaged. Aggregates of the edges and single cells are excluded. From left to right: original photo, mask and mask with quantified aggregates. Aggregates are divided if they appear very close together, but their shape is clearly distinguished.

[0073] Figure 8. Parameters used to define aggregates. (A) Maximum and minimum feret diameter , (B) perimeter, and (C) circularity and roundness. (D) shows the adhesion of single aggregates to a cell culture plate and the migration of MSCs out of the aggregate to allow cell counts.

[0074] Figure 9. Effect of different concentrations of platelet lysate on aggregate morphology. Effect of platelet lysate and 1% and 3% on aggregate morphology (including (A) spheroids per plate, (B) perimeter, (C) Feret diameter, (D) Roundness and (E) percentage of live cells compared to aggregates formed without platelet lysate (0%).

[0075] Figure 10. Representative images of aggregates. Brightfield light microscopy of aggregates. (A) 4X magnification and (B) 10X magnification. Scale bar: 100 pm.

[0076] Figure 11. Characterization of the morphological parameters of aggregates. (A) maximum and minimum Feret parameters, (B) perimeter, (C) roundness, (D) circularity and (E) solidity of aggregates.

[0077] Figure 12. Counting hMSCs in aggregates. (A) shows a DAPI staining of a whole aggregate imaged using confocal microscopy Z-stack, and (B) shows a rendering using software of the individual nuclei in the aggregate. Figure 13. Effect of temperature on aggregate morphology. Aggregates were kept at 4-6 °C, 22-24 °C, 40 °C for up to 48 hours, and observed for effects on (A) cell viability, (B) feret diameter, (C) perimeter, and (D) roundness obtained through Imaged software. The dotted lines represent the mean ± 2 SD.

[0078] Figure 14. Immunofluorescence of aggregates. Representative confocal microscopy images of aggregates after immunofluorescence experiments for (A) CD73 (green, left image), (B) CD90 (green, left image), and (C) CD105 (green, left image). (D) and (E) show confocal microscopy images of (D) monolayer MSCs and (E) aggregates stained with anti-Ki67 (orange, left image). Cell nuclei were stained with DAPI (blue, middle column) and merged images shown in the last column. (F) - (J) show representative confocal microscopy images of aggregates after immunofluorescence experiments for (F) Oct-3 / 4, (G) Nanog, and (H) Sox-2. (I) shows DAPI staining, and (J) shows a merged image. All images were obtained with a Zeiss LSM 800 laser scanning confocal microscope. Scale bar: 50 pm. 40X magnification.

[0079] Figure 15. Differentiation potential of aggregates into (A), (B) chondrocytes, (C), (D) adipocytes and (E), (F) osteocytes. (A), (B) Chondrogenic differentiation: presence of acid mucopolysaccharides identified with specific Alcian blue stain. (C), (D) Adipogenic differentiation: presence of intracellular lipids stained with Oilred-O. (E), (F) Osteogenic differentiation: presence of calcium deposits stained with specific Alizarin red-S dye. The samples were analysed using Nikon E600 optical microscopy. 20X magnification (A, C, E) and 40X magnification (Bottom row).

[0080] Figure 16. Glucose consumption of aggregates in a co-cultivation model with lymphocytes in vitro. Glucose concentration (mg / dL) of culture media containing peripheral blood mononuclear cells (PBMC), ad-hMSCs and aggregates (Celluspheres) at 72h of culture.

[0081] Figure 17. Safety evaluation of aggregates in a pharmacological model of Parkinson's disease. A) Schematic of generation of a pharmacological model of Parkinson's in mice and administration of aggregates in the brain. B) Local administration of aggregates in the brains of animals previously treated with 6-OHDA did not affect the weight of animals compared to control. ‘Cellusphere7’MSC-3D’: aggregates, MSC-2D: ad-hMSC disaggregated. Initial weight % is with respect to day 0.

[0082] Figure 18. Safety evaluation of aggregates in a pharmacological model of joint damage. A) Schematic of generation of a pharmacological model of joint damage in rat and administration of aggregates locally in one knee. B) Local administration of aggregates in one knee of animals previously treated with MIA did not affect the weight of the animals compared to the control. MSC- 3D (Id): 750 aggregates; MSC-3D (md): 3000 aggregates. The error bars reflect standard error. Initial weight % is with respect to day 0.

[0083] Figure 19. Safety evaluation of aggregates by systemic administration. Schematic of evaluation of the toxicity and tolerability of aggregates after the administration of different doses of aggregates via a systemic route. B) Systemic administration of aggregates did not significantly affect body weight of the mice. The data shows the average weight per group on the day of measurement. The error bars reflect standard error. Initial weight % is with respect to day 0. C) Example of H&E staining of lung of a mouse treated with 300 aggregates when evaluated at 14 days after treatment. Magnification 5X. D) Example of H&E staining of lungs from groups 1-4 at 28 days after treatment.

[0084] Figure 20. Quantification of necrotic area in muscles treated with aggregates or saline, 7 and 14 days after injury. The data are expressed as an average ±SEM. *: p<0.05, Mann Whitney test. At least 3 cuts of each muscle were analyzed for each n, as indicated in the methodology. n=4. ‘MSC-3D’: aggregates.

[0085] Figure 21. Rescue of chondral tissue damage after treatment with aggregates. A) Types of chondral tissue damage. CD: Cartilage damage. (1) EML: Extracellular matrix loss. (2) SAL: Surface architecture loss. (3) AST: Abnormal subchondral tissue. B) Histological score results for treatment with aggregates show a reduction in MIA-mediated joint damage, p value was calculated using Mann Whitney U. Error bars indicate mean + / - SEM. ‘Cellusphere’: aggregates.

[0086] Figure 22. Neuroprotection after treatment with aggregates in a Parkinson’s model. A) Survival of the hMSCs in treated tissue. Histological sections corresponding to the striatum area marked with the anti-hSSEA3 antibody indicate that the cells that make up the aggregates are able to survive in the transplanted tissue until at least 3 weeks after treatment. B) Immunohistochemistry against TH in the striatum zone (CPu) in animals treated with 6-OHDA and provided with aggregates (MSC-3D), dissociated aggregates (MSC-2D), PBS or sham. C) Densitometry of the reactive zone to TH. D) Immunohistochemistry against TH of the substantia nigra pars compacta (SNpc) in animals treated with 6-OHDA and provided with aggregates (MSC- 3D), dissociated aggregates (MSC-2D), PBS or sham. E) Quantification of neuronal somas in the TH-positive sNpc.

[0087] Figure 23. Priming of aggregates: aggregates after 24 (TT) hours in shaken Techne™ bottles with aMEM. 4X magnification. Figure 24. Priming of aggregates: Effects of polymers E1 (high molecular weight poly-L- lysine) and E3 (alginate) on the structural stability of aggregates. A) Aggregates cultured in aMEM with platelet lysate (S1) 10%. B) Aggregates cultured with 4 pg / ml (‘C3’) high molecular weight poly-L-lysine (‘E ) in StemPro™ (M2) medium with and without StemPro™ (‘S3’) supplement. Aggregates were cultured in low-adhesion, 24-well plates in 1 mL medium and incubated at 37 °C, 90 % humidity, 21% oxygen and with 5 % CO2. 4X magnification.

[0088] Figure 25. Priming of aggregates: Effects of different concentrations (4 pg / ml (‘C3’), 8 pg / ml (‘C4’) and 12 pg / ml) of E1 (high molecular weight poly-L-lysine) on the stability and metabolic activity of aggregates in serum-free StemPro™ (M2) medium. A) without, and B) with StemPro™ (‘S3’) supplement at time 0, and then 24 (‘T1’), 48 (‘T2’), 72 (‘T3’) and 96 (‘T4’) hours. 4X magnification. C) Concentration of glucose (red line representative of the baseline glucose concentration present in the StemPro™ (M2) medium) at 96 (‘T4’) hours in static culture with different concentrations of high molecular weight poly-L-lysine ‘E1’ (4 pg / ml (‘C3’), 8 pg / ml (‘C4’) and 12 pg / ml). D) Concentration of lactate (the StemPro™ (M2) medium does not contain lactate, so the baseline concentration is zero), at 96 (‘T4’) hours in static culture with different concentrations of high molecular weight poly-L-lysine ‘E1’ (4 pg / ml (‘C3’), 8 pg / ml (‘C4’) and 12 pg / ml). Aggregates were cultured in low-adhesion, 24-well plates in 1 mL medium and incubated at 37 °C, 90 % humidity, 21% oxygen and with 5 % CO2.

[0089] Figure 26. Priming of aggregates: Effects of different concentrations of high molecular weight poly-L-lysine ‘E1’ (1 pg / ml (‘C1’) and 2 pg / ml (‘C2’)) on the stability, viability and metabolic activity of aggregates in dynamic culture. A) and B) show light microscopy images of aggregates cultured with different concentrations of high molecular weight poly-L-lysine ‘E1’ in 5 mL StemPro™ (M2) medium with 1% pen / strep, X% GlutaMAX™ (‘S4’) without StemPro™ (‘S3’) supplement, at 250,000 cells / ml cultured for 96 (‘T4’) hours at 37 °C, 90 % humidity, 21% oxygen and 5 % CC^ and 60 rpm (‘V3’) agitation. 4X magnification. A) and B) controls differ only in the starting MSCs. C) and D) show the re-adhesion analysis of samples obtained from the aggregate cultures of A) and B) at 24 (‘T1’) hours. 10X magnification. C) and D) differ only in the starting MSCs. E) Aggregates observed with the naked eye after 24 (‘T1’) hours of dynamic culture without in the control (‘M2 S3(-)E1(-)’ condition). F) Consumption of glucose, ammonium and lactate, and lactate dehydrogenase activity, over 0 (‘TO’) to 96 (‘T4’) hours at different concentrations of high molecular weight poly-L-lysine ‘E1’ (1 pg / ml (‘C1’), 2 pg / ml (‘C2’), 4 pg / ml (‘C3’) and 8 pg / ml (‘C4’)). The data are expressed as the mean ± error (SD).

[0090] Figure 27. Priming of aggregates: Effects of different concentrations of low-molecular weight poly-L-lysine ‘E2’ (1 pg / ml (‘C1’) and 2 pg / ml (‘C2’)) on the stability, viability and metabolic activity of aggregates in dynamic culture. A) light microscopy images of aggregates cultured with different concentrations of low-molecular weight poly-L-lysine ‘E2’ in 5 mL of StemPro™ (M2) medium with 1% pen / estrep, X% GlutaMAX™ (‘S4’), without StemPro™ (‘S3’) supplement. 250,000 cells / mL plated for 96 (‘T4’) hours, at 37 °C, 21 % oxygen and 5 % CO2. 4X magnification. B) re-adhesion assay of sample obtained from the aggregates of A) after 24 ( T) hours. 10X magnification. C) Glucose consumption, ammonium and lactate production, and LDH activity, over 0 (‘TO’) to 96 (‘T4’) hours at different concentrations of low-molecular weight poly-L- lysine ‘E2’ (1 pg / ml (‘C1’) and 2 pg / ml (‘C2’)). I). The data is expressed as the mean ± error (SD).

[0091] Figure 28. Priming of aggregates: stability, viability and metabolic activity of aggregates cultured in a bioreactor system. A) light microscopy images of aggregates cultured in a bioreactor system with low-molecular weight poly-L-lysine ‘E2’ at 2 pg / mL (‘C2’). All cultures were performed with 30 mL StemPro™ (M2) medium with 1 % pen / estrep, X% GlutaMAX™ (‘S4’), without StemPro™ (‘S3’) supplement. 250,000 cells / mL cultured for 96 (‘T4’) hours, at 37 °C, 21 % oxygen and 5% CO2 . 4X magnification. B) re-adhesion analysis of samples obtained from the aggregates of A) at 24 (‘T1’) hours. 10X magnification. C) Consumption of glucose, B) consumption of ammonium and C) LDH activity over 0 (‘TO’) to 96 (‘T4’) hours. It was not possible to obtain the LDH value for Sp3 due to problems with the sample volume.

[0092] Figure 29. Priming of aggregates: testing the effect of oxygen concentration on the stability of aggregates. A) light microscopy images showing morphology of aggregates cultured under normoxia, hypoxia 1 or hypoxia 2 conditions at 0 (‘TO’), 48 (‘T2’) and 72 (‘T3’) hours in a bioreactor. 4X magnification. B)-D) shows box-plots of perimeter, Feret diameter and roundness of the aggregates of A) at 0 (‘TO’), 48 (‘T2’) and 72 (‘T3’) hours in culture.

[0093] Figure 30. Priming of aggregates: testing the effect of concentration on the stability of aggregates using MSCs from a second donor. A) light microscopy images showing morphology of aggregates cultured under normoxia or hypoxia 2 conditions and replicates at 0 (‘TO’), 48 (‘T2’) and 72 (‘T3’) hours. 4X magnification. B)-D) shows box-plots of perimeter, Feret and roundness of the aggregates of A) at 0 (‘TO’), 48 (‘T2’ )and 72 (‘T3’) hours.

[0094] Figure 31. Priming of aggregates: Re-adhesion analysis of aggregates of Figure 16A and Figure 17A. A) Light microscopy of re-adhesion assay. 10X magnification.

[0095] Figure 32. Priming of aggregates: Metabolic activity analysis of aggregates of Figure 16A and 17A. Glucose consumption, lactate production, ammonium production and LDH activity over time. Figure 33. Priming of aggregates: RT-PCR analysis of the expression of the FGF2, BMP2, HGF, COX-2 and IL-6 genes for aggregates of Figure 16A and Figure 17A. Data shown as the levels of expression under Hypoxia 1 and Hypoxia 2 conditions with respect to the control condition (normoxia) and using the B2M gene for reference.

[0096] Figure 34. Priming of aggregates: Quantification of secreted factors of the aggregates of Figure 16A and Figure 17A. A) ELISA measurements of VEGF and B) ELISA measurements of TSG-6 by ELISA. ELISA measurements made in duplicate. C) Quantification of factors secreted by aggregates using a multiplex ELISA. All measurements were made in duplicate. Data is reported as the mean ± error (SD). Mann- Whitney, ns, p>0.05, *p<0.05.

[0097] Figure 35. Priming of aggregates: Immunoassay of aggregates produced using a bioreactor. A) Graphical representation of dilution and marking with CellTrace Violet (Invitrogen) through cell generations and analysed by Flow Cytometry. Peaks represent successive generations of cells stimulated with PHA and cultured for 7 days. Peak 1 represents the basal culture, corresponding to cells grown for 7 days without stimulus. B) Percentage proliferation of lymphocytes stimulated with 8 pg / ml of PHA grown with AIM medium without serum (Stimulated), 25% of AIM medium without serum, 75% of aMEM (‘Stimulated MT), 25% of AIM medium without serum and 75% of StemPro™ (M2) (‘Stimulated M2'). The data is expressed as mean ± error (SD). C) Dot-plots of viability (CD3 vs LIVE DEAD IR), activation (CD3 vs CD25) and proliferation (CD3 vs CTV) and proliferation percentage histogram (Number of events vs CTV) for lymphocytes unstimulated: baseline (AIMV without serum), baseline aMEM (AIMV without serum and 75% M1) and baseline M2 (AIMV without serum and 75% M2). 20,000 CD3+ events were recorded in each acquisition. D) Dot-plots of viability (CD3 vs LIVE DEAD IR), activation (CD3 vs CD25) and proliferation (CD3 vs CTV) and proliferation percentage histogram (Number of events vs CTV) for lymphocytes stimulated: basal (AIMV without serum), baseline aMEM (AIMV without serum and 75% aMEM) and baseline M2 (AIMV without serum and 75% M2). 20,000 CD3+ events were recorded in each acquisition. E) Histograms of the percentage of proliferation (Number of events vs CTV) of stimulated lymphocytes (Stimulated M2) and lymphocytes cultured with the MC obtained under Normoxia. F) Histograms of the percentage of proliferation (Number of events vs CTV) of stimulated lymphocytes(Stimulated M2) and lymphocytes cultured with the MC obtained under Hypoxia. G) Histograms of the percentage of proliferation (Number of events vs CTV) of stimulated lymphocytes (Stimulated M2) and lymphocytes cultured with MC obtained from 2D cultures in aMEM (M1) medium and StemPro™ (M2), free of serum, of MSCs incubated for 48 (‘T2’) hours at 37° C, 5 % CO2 and Hypoxia. Figure 36. Effects of CELLUSPHERES (aggregates) and Cellusome (conditioned medium) on DSS-induced colitis in mice. A) body weight distribution of study animals. Bars correspond to standard error. B) Histological score from distal colonic cross section calculated according to Table 6. Data shows the histological score of each mouse at day 7 and the mean by group. Bars correspond to standard error. Statistics: one-way ANOVA; * = p < 0.05. C) Representative H&E staining of distal colonic cross sections from control (vehicle) group and DSS-treated groups after 7 days of treatments. 25X magnification. D) representative Alcian blue staining of distal colonic cross sections from control (vehicle) group and DSS-treated groups after 7 days of treatments. 25X magnification. The DSS-induced loss of goblet cells in the mucosa can be easily observed by the loss of blue staining.

[0098] Figure 37. Effect of conditioned medium from aggregates versus conditioned medium from monolayer ad-hMSCs on chondrocyte migration, chondrocyte regeneration and fibrotic differentiation. (A) shows a wound assay at Time 0, and after 24 hours of treatment with medium (basal), conditioned medium from ad-hMSCs, or conditioned medium from aggregates. Images taken using Nikon E600 optical microscopy at 4X magnification. (B) shows the percentage of wound closure at 24 hours after treatment. (C) and (D) show the expression of COL2A1 (C) and ACAN (D) in joint tissue in a chondrocyte model treated with medium (basal), conditioned medium from ad-hMSCs (ad-hMSC) or conditioned medium from aggregates (CELLUSPHERES). Results are expressed as the mean ±SD for three replicates. (E) shows the expression of TGFpi in joint tissue of a chondrocyte model treated with medium (basal), conditioned medium from ad-hMSCs (ad-hMSC) or conditioned medium from aggregates (CELLUSPHERES). Results are expressed as the mean ±SD for three replicates. ***p<0.001 using an ANOVA.

[0099] Figure 38. Determination of the direct anti-inflammatory effect of aggregate-conditioned medium. Analysis of gene expression of the major TNF-induced proinflammatory cytokines (A) IL1A, (B) IL1 B, (C) IL6, (D) IL8, (E) IL17 in a model of joint damage in chondrocytes. The experimental groups show the difference of each condition inflamed with TNF (25 ng I ml), with respect to the condition without stimulation with TNF. The analysis of gene expression was determined by qPCR normalizing with respect to the endogenous gene ACT-p. The results are expressed as the mean ± SD of three replicates.*** p<0.001 , ** p<0.002, * p<0.033 using the ANOVA statistical test.

[0100] Figure 39. Determination of the indirect anti-inflammatory effect of conditioned medium from aggregates. Analysis of expression of the anti-inflammatory cytokine IDO1 in a chondrocyte model. The experimental groups show the difference of each condition inflamed with TNF (25 ng I ml), with respect to the condition without stimulation with TNF respectively. The analysis of gene expression was determined by qPCR normalizing with respect to the endogenous gene ACT-p. The results are expressed as the mean ± SD of three replicates.*** p<0.001 , ** p<0.002, * p<0.033 using ANOVA.

[0101] Figure 40. Representation of the platform for spherification by self-assembly (EpA). (A) The diagram shows the architecture of the technology on inverted pyramid shape, which allows cells to self-assemble into a homogeneous and reproducible three-dimensional structure. (B) Image showing the inverted pyramids seen from above with CELLUSPHERES® (aggregates) inside.

[0102] DETAILED DESCRIPTION OF THE INVENTION

[0103] Disclosed herein is a novel method of producing a composition of homogenous aggregates with improved protective properties compared to aggregates prepared using other methods, preferably where the aggregates are for the treatment or prevention of age-related disorders, chronic and / or acute inflammatory conditions, degenerative joint diseases, joint injury, traumatic lesions, chronic and / or acute respiratory diseases, musculoskeletal conditions, neurodegenerative diseases and / or brain injury. The present disclosure also provides a method of producing a conditioned medium from the composition of aggregates that may also be used for the treatment or prevention of age-related disorders, chronic and / or acute inflammatory conditions, degenerative joint diseases, joint injury, traumatic lesions, chronic and / or acute respiratory diseases, musculoskeletal conditions, neurodegenerative diseases and / or brain injury.

[0104] Unless otherwise defined below, all technical terms used herein have the same meaning as commonly understood by one of the ordinary skills in the art in the field to which this disclosure belongs.

[0105] Any reference to ‘or’ herein may encompass ‘and / or’.

[0106] The singular forms ‘a’, ‘an’, and ‘the’ may include both singular and plural reference unless the context clearly dictates otherwise.

[0107] The terms ‘comprising’, ‘comprises’ and ‘comprised of’ may be synonymous with ‘including’, ‘includes’ or ‘containing’, ‘contains’, and are inclusive or open-ended and do not exclude additional, non-recited members, elements or method steps. The term may also encompass ‘consisting of’ and ‘consisting essentially of’.

[0108] Whereas the term ‘one or more’, such as one or more members of a group of members, is clear per se, by means of further exemplification, the term encompasses inter alia a reference to any one of said members, or to any two or more of said members, such as, e.g., any >3, >4, >5, >6 or >7 etc. of said members, and up to all said members.

[0109] Mesenchymal Stem Cells (MSCs)

[0110] As used herein, the term ‘cell’ or ‘cells’ may refer to mesenchymal stem cells (MSCs). MSCs are multipotent stem cells capable of self-renewing or differentiating into a variety of cell types including osteoblasts, chondrocytes, adipocytes, hepatocytes and cardiomyocytes, among others. MSCs can be harvested from various adult and foetal tissues. According to the International Society for Cellular Therapy (ISCT), three key criteria are needed to identify MSCs: 1) MSCs must re-adhere to plastic when cultured under standard conditions, 2) the MSC population must express CD105, CD73 and CD90 (>95%) and not express CD45, CD34, HLA- DR, CD14 or CD11b, CD79a or CD19 (<2%), and 3) when cultured in vitro the MSCs must show osteogenic, adipogenic and chondrogenic differentiation. These characteristics are valid for all MSCs, although there can be some differences in MSCs isolated from different tissues.

[0111] In the present disclosure, the MSCs used with the present invention may be any MSCs, preferably any mammalian MSCs, and more preferably any human MSCs. Preferably, the MSCs used with the present invention meet the ISCT criteria for MSCs. Preferably, the MSCs will be derived from bone marrow, adipose tissue, umbilical cord, Wharton’s jelly, gingiva, amniotic fluid and membrane, dental tissue, limb bud, menstrual blood, peripheral blood, placenta and foetal membrane, endometrium, salivary gland, skin and foreskin, synovial fluid, and cartilage tissue, among others. Preferably, the MSCs are derived from adipose tissue. As used herein, MSCs derived from adipose tissue may also be denoted ‘ad-MSC’ or ‘at-MSC’. Therefore, MSCs from adipose tissue can provide a non-invasive source of cells, as adipose tissue can be considered medical waste which is discarded after surgery or liposuction.

[0112] Autologous or allogeneic MSCs may be used, depending on the intended clinical use. The term ‘autologous’ may refer to any material derived from the same individual to which it is later to be re-introduced, i.e., the donor and recipient are the same individual. ‘Allogeneic’ may refer to a graft derived from a different individual of the same species, i.e., the donor and recipient are different individuals. Preferably, the MSCs are allogenic. ‘Donor’ refers to the individual providing the source of MSCs, such as the adipose tissue. ‘Recipient’ refers to the individual receiving the final product disclosed herein, i.e., the aggregates. In embodiments, inclusion and exclusion criteria may be applied for donors of adipose tissue, preferably the inclusion and exclusion criteria listed in Table 1 , below. Table 1. Inclusion / exclusion criteria of preferred adipose tissue donors.

[0113] Preferably the MSCs are derived from a female. In other words, in preferred embodiments the MSCs are female MSCs, i.e., the MSCs have two X chromosomes. Methods for identifying the sex of cells are standard in the art and may include karyotyping, polymerase chain reaction or fluorescence in situ hybridisation. Example methods are disclosed in, Munne et al. (1994. Sex determination of human embryos using the polymerase chain reaction and confirmation by fluorescence in situ hybridization. Fertility and Sterility, 61(1): 111-117.) and Lund et al. (2012. High-throughput karyotyping of human pluripotent stem cell. Stem Cell Research, 9: 192-195), which are herein incorporated by reference.

[0114] Preferably, the MSCs are derived from a donor under the age of 40 years old, more preferably a donor between the ages of 25 to 35 years of age. Preferably, the MSCs are derived from a healthy donor.

[0115] Isolation and Expansion of MSCs

[0116] A skilled person appreciates that MSCs isolated and expanded (cultured in vitro) using any known method suitable for maintaining undifferentiated MSCs may be used in combination with the present invention.

[0117] Methods are disclosed in, for example, in Zeng et al. (2013. A rapid and efficient method for primary culture of human adipose-derived stem cells. Organogenesis, 9(4): 287-295) and Bunnell et al. (2008. Adipose-derived Stem Cells: Isolation, Expansion and Differentiation, Methods, 45(2): 115-120). Briefly, adipose tissue fragments can be obtained through surgery or lipoaspiration. In a preferred embodiment, the adipose is obtained through a mini periumbilical liposuction (100-200 cc), under local anesthesia. If the tissue is obtained via surgery, the adipose fragments are minced and washed. If the adipose tissue is obtained via liposuction, the tissue may not require further mechanical processing. The adipose tissue is then subjected to enzymatic digestion to liberate cells and the MSCs can then be separated from the resulting cell suspension through standard cell sorting methods (such as flow cytometry for known markers of MSCs), or plastic re-adherence assays.

[0118] However, the skilled person will appreciate that suitable MSCs may also be obtained and expanded from a supplier, research facility or laboratory using standard methods that are known in the art, and then expanded.

[0119] Any suitable culture media may be used for isolation and expansion of undifferentiated MSCs. Examples of suitable culture medium include DMEM, a-MEM, Ham's F12 medium, MCDB (such as 102, 107, 120, 131 , 143, 199 or 201) medium, DME, L15, SkBM, RITC80, RPMI11640, StemPro™ MSC SFM XenoFree medium, MesenCult™-XF Complete medium, Mesencult® medium, MSCGM™ medium, MSC NutriStem® XF medium, Human Mesenchymal-XF Expansion medium, or StemXVivo® Medium can be used. Preferably, the medium comprises, consists or consists essentially of a-MEM. Media added with serums (such as foetal bovine serum, human serum) or serum replacement (such as Knockout serum replacement (KSR)) may also be used. Preferably, the serum is a human serum, preferably a human platelet lysate. Preferably the amount of serum or serum replacement (including the human platelet lysate) is between 0.5 to 10%, 0.5 to 8%, 0.5 to 7%, 0.5 to 5%, 1 to 5%, 2 to 4%, 2.5% to 3.5%, or around 3% (v / v) with the culture media. In embodiments, the serum, or serum replacement is applied with heparin, preferably a heparin , more preferably 0.5-5, 1-5, 0.5-4, 1-4, 0.5-3.5, 1-3.5, 1-3, 1.5-3.5 or around 2 Ul / rnl heparin . In embodiment, the medium further comprises one or more antibiotics, such as penicillin / streptomycin or gentamicin. In preferred embodiments, the medium comprises or consists essentially of alpha MEM, platelet lysate, heparin and one or more antibiotics.

[0120] A person skilled in the art appreciates that MSCs, including hMSCs, ad-MSCs and ad-hMSCs may be expanded in any suitable cell culture vessel, including coated or un-coated cell culture vessels. Preferably, the cell culture vessel comprises one or more hydrophilic surfaces for cells to re-adhere to.

[0121] As used herein, the term ‘passaging’, ‘splitting’, ‘subculturing’, ‘seeding’ or ‘planting’ refers to ‘splitting’ populations of dissociated cells onto a new culture vessel. In embodiments, the MSCs have been passaged for a maximum of 12 passages, more preferably a maximum of 10 passages, even more preferably less than 8 passages, most preferably less than 6 passages.

[0122] MSC Aggregates

[0123] According to the present invention, MSCs may be cultured to form aggregates of MSCs. The terms ‘aggregate’, ‘spheroid’, ‘agglomerate’, ‘3D’ or Cellusphere® may be used interchangeably to refer to a self-assembly of MSCs, and preferably refer to an aggregate of human MSCs, more preferably an aggregate of human ad-MSCs (ad-hMSC).

[0124] A skilled person will appreciate that characteristics of the aggregates reported herein refer to the mean value of the total aggregates, preferably the mean value of the total aggregates in a composition or pharmaceutical composition. In embodiments, the number the percentage of aggregates having the specified characteristic is least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% of the total number of aggregates in the composition or pharmaceutical composition.

[0125] The aggregates may comprise, consist or consist essentially of between 100 to 500 MSCs, 100 to 450 MSCs, 100 to 400 MSCs, 150 to 350 MSCs, 200 to 350 MSCs, 200 to 300 MSCs, or around 238 MSCs, preferably when counted using a method disclosed herein. In embodiments, the number of MSCs per aggregate is a mean. In embodiments, the number of MSCs per aggregate is the total number of cells per aggregate. In embodiments, the number of MSCs per aggregate is the number of living cells per aggregate.

[0126] The number of MSCs in an aggregate may be counted using various methods that are standard in the art. The cell counting method may be selected depending on criteria such as speed, cost, ease of use, etc. Cell counting methods are expected to give similar estimates of cell numbers per aggregate.

[0127] For example, the number of MSCs in an aggregated may be counted by dissociating a known number of aggregates using a dissociation agent to produce a cell suspension and counting the number of cells in the suspension using standard cell counting methods disclosed herein. The number of cells per aggregate can then be estimated. Dissociation agents and methods are standard in the art. Dissociation agents may include enzymatic reagents (such as trypsin, accutase, TrypLE, collagenase, and papain, dispase, hyaluronidase, elastase, pronase or any commercial dissociation solution comprising one or more enzymes) or non-enzymatic reagents (such as a commercial cell dissociation kit such as Cell Dissociation Buffer [CDB], and ethylenediamine tetra-acetic acid (EDTA) solutions).

[0128] Alternatively, the number of MSCs in an aggregate may be estimated by taking the average size of the MSC (i.e., diameter or area) and dividing this by the average diameter or area of an MSC.

[0129] Another method of counting MSCs in an aggregate may be performed by plating a low density of aggregates on an adherent culture dish (Figure 8D) and leaving the aggregates for between 1 to 72, 1 to 60, 1 to 48, 1 to 36, 1 to 24, 1 to 12, 1 to 10, 1 to 6, 4 to 72, 4 to 60, 4 to 48, 4 to 36, 4 to 24, 4 to 12, 4 to 10, 4 to 6, 6 to 72, 6 to 60, 6 to 48, 6 to 36, 6 to 24, 6 to 12, 6 to 10, 12 to 72, 6 to 60, 12 to 48, 12 to 36, or 12 to 24 hours. After this, you can count the number of cells by either a) staining with a nuclear stain / dye / label and counting the number of cells per aggregate, or b) counting the number of aggregates on a dish, and then dissociating the cells using a dissociation agent and counting the cells. A low density of aggregates (i.e, a low number of aggregates per cm2of the surface area of the dish) is considered to be a number suitable for establishing distinctive adhered aggregates, such as 1-40, 1-35, 1-30, 1-25, 1-20, 1-15, 5-40, 5- 35, 5-30, 5-25 aggregates per cm2of the cell culture dish. A low density of aggregates may be achieved by performing serial dilutions of aggregates. In preferred embodiments, 1500 aggregates are produced, and then serial dilutions produced. Each dilution is brought to a final volume of medium, preferably 1 ml of aMEM supplemented with 1 % platelet lysate, and seeded in well, preferably a 24-well plate. The culture is maintained for around 24 hours in normoxic conditions (5% CO2, 37°C). The adhered cells are then trypsinized and cell counting is performed, preferably using a Neubauer chamber camera system.

[0130] Another method of counting the number of MSCs in an aggregate may be performed by staining whole aggregates with a nuclear stain / dye / label using methods that are known in the art and producing a ‘z-stack’ by confocal microscopy of a whole aggregate and counting the number of nuclei. In embodiments, a known number of aggregates are centrifuged. Preferably, the aggregates are centrifuged at between 100-500, 150-450, 200-400, 250-350 or around 300 x g. Preferably aggregates are centrifuged for around 0.5-5, 0.5-4.5, 0.5-4, 0.5-3.5, 1-3, 1.5-2.5 or around 2 minutes. Preferably, aggregates are centrifuged at room temperature. In embodiments, the number of aggregates is between 10-100, 10-1000, 10-500, 20-100, 20-500, 20-1000, 50- 100, 50-500, 50-1000, 100-5000, 100-4000, 100-3500, 100-3000, 500-5000, 500-4000, 500- 3500, 500-3000, 1000-5000, 1000-4000, 1000-3500, 1000-3000, 2000-3000 or around 2500 aggregates. In a preferred embodiment, around 2500 aggregates are centrifuged at around 300 x g for around 2 minutes at room temperature. The supernatant is then removed, and the cell pellet incubated in a fixative agent, preferably paraformaldehyde, more preferably 4% paraformaldehyde. In embodiments, the cell pellet is incubated with between 1-2mL paraformaldehyde, preferably around 1.5mL paraformaldehyde. In embodiments, the aggregates are incubated at room temperature, preferably for between 15 minutes to 8 hours, 30 minutes to 8 hours, 30 minutes to 6 hours, 30 minutes to 4 hours, 30 minutes to 2 hours, or around 1 hour. Subsequently, the aggregates are washed, preferably with DPBS®. The aggregates are then centrifuged as described above, and resuspended in a buffer solution, preferably DBPS®. Resuspended aggregates are then transferred to an adhesive microscope slide, preferably a Super Frost adhesion slide. The slides are left to dry, preferably for at least 10, 15, 20, 25 or 30 minutes. The slides are then incubated with a nucleic marker as described herein. To determine the number of cells per aggregate, analysis is performed using a confocal microscope. Representative z-stack captures of at least 1 , 5, or 10 aggregates are obtained. The images are analyzed using software, such as NoviSight (Evident Scientific Olympus) software, using that allows determination of the average number of nuclei per aggregate.

[0131] Suitable nuclear stains / dyes / labels are known in the art and may be selected from: cell permanent dyes / stains / labels (such as Hoechst or SYTO®) or cell-impermanent stains (such as 4',6-diamidino-2-phenylindole (DAPI), propidium iodide, TO-PRO®^3, BioTracker dyes, NucBlue™, and SYTO® stains).

[0132] A skilled person appreciates that any of the above methods may be combined with manual cell counting methods (i.e., by eye), or using automatic cell counting methods (i.e. , an automatic cell counting device or software). A skilled person appreciates that any of the above methods may be used to count the total number of cells per aggregate, or the total number of living cells per aggregate. Differentiation of living and dead cells can be through standard methods in the art, such as fluorescent dyes, colorimetric assays or chemiluminescence methods. Examples of fluorescence dyes include dyes for calcein AM, fluorescein diacetate, ethidium homodimer or propidium iodide. Examples of colorimetric assays include Trypan blue, neutral red and tetrazolium salts such as MTT, XTT and WST-1. Examples of chemiluminescence methods include luciferase assays.

[0133] The aggregates may have a diameter between 30 to 250 microns, 30 to 240 microns, 35 to 230 microns, 40 to 230 microns, 45 to 230 microns, 50 to 225 microns, 50 to 220 microns, 50 to 210 microns, 50 to 200 microns, 50 to 190 microns, 60 to 210 microns, 60 to 200 microns, 60 to 190 microns, 60 to 180 microns, 65 to 175 microns, 70 to 170 microns, 75 to 165 microns, 80 to 160 microns. Preferably, the diameter is a ‘Feret diameter’, ‘Feret's diameter’ or ‘Calliper diameter’ which may refer to a measure of an object size along a specified direction. In general, the Feret diameter may be defined as the distance between the two parallel lines restricting the object perpendicular to that direction. The maximum Feret diameter may therefore refer to the longest distance between two points of an aggregate perimeter. The minimum Feret diameter may therefore refer to the shortest distance between two points of an aggregate perimeter. The Feret diameters may be measured using standard techniques in the art, such as light microscopy images and software such as Image J. The Feret diameter units correspond to the units used in the scale factor (such as pm in the present disclosure). In embodiments, the maximum Feret diameter of the aggregates is at most 115, 120, 125, 130, 140, 150, 160, 170, 180, 190, 200, 210 or 220 microns, preferably wherein the maximum diameter of the aggregates is 156 + 64 pm. In embodiments, the minimum Feret diameter of the aggregates is at least 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, or 85, preferably wherein the minimum diameter of the aggregates is 85 + 31 pm. In embodiments, the diameter is a mean diameter.

[0134] Perimeter may be used herein to refer to the length of the outer boundary or contour of the aggregates. The perimeter may be measured using standard techniques in the art, such as light microscopy images and software such as Image J. The perimeter units correspond to the units used in the scale factor used (such as pm in the present disclosure). In embodiments, the aggregates have a perimeter between 100 to 700, 150 to 650, 150-625, 150-600, 175-575, 200- 550, 225-525, 250-500, 275-500, 250-475, 250-450, 250-425, 275-450, 250-425, 275-425, SOO- 425, 300-400 or around 383 ± 111 microns. In embodiments, the perimeter is the mean perimeter.

[0135] Roundness is a measure of how precise a circle is in any given cross section and identifies errors in the perfect circle. Circularity refers to a circle having the same value of all radii from its centre point. Both circularity and roundness are dimensionless values, and a value of 1.0 indicates that the shape is a perfect circle, and the closer the value is to 0.0, the more likely that the shape is elongated. The circularity and roundness may be measured using standard techniques in the art, such as light microscopy images and software such as Image J. Circularity may be measured using the following equation An x (area / perimeter2). Roundness may be calculated as circularity + (circularityperfect circle - circularityaspectratio). Examples of circularity numbers are shown in Figure 8C. For example, an equilateral triangle would be expected to give a circularity value of 0.777, and a square a circularity value of 0.886. In embodiments, the aggregates have a circularity of at least 0.5, 0.55, 0.6, 0.61 , 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69 or 0.70 ± 0.1. In embodiments, the aggregates have a circularity between 0.5 to 1.0, 0.5 to 0.99, 0.5 to 0.98, 0.5 to 0.95, 0.55 to 0.9, 0.6 to 1.0, 0.6 to 0.99, 0.6 to 0.98, 0.6 to 0.95, 0.6 to 0.9, 0.6 to 0.85, 0.6 to 0.8, 0.65 to 1.0, 0.65 to 0.99, 0.65 to 0.98, 0.65 to 0.95, 0.65 to 0.90, 0.65 to 0.85, 0.65 to 0.80, 0.60 to 0.80, 0.65 to 0.75, or 0.68 to 0.71 , preferably between 0.60 to 0.80. In embodiments the aggregates have a circularity of 0.70 ± 0.10. In embodiments, the circularity is the mean circularity. In embodiments, the aggregates have a roundness of at least 0.5, 0.6, 0.65, 0.7, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81 , 0.82, 0.83 or 0.84. In embodiments, the aggregates have a roundness between 0.5 to 1.0, 0.5 to 0.95, 0.6 to 1.0, 0.6 to 0.95, 0.7 to 1.0, 0.7 to 0.99, 0.7 to 0.95, 0.75 to 1.0, 0.75 to 0.99, 0.75 to 0.95, 0.75 to 0.9, 0.78 to 0.9, 0.8 to 0.9, 0.79 to 0.89, or 0.83 to 0.85. In embodiments the aggregates have a roundness of 0.84 ± 0.034. In embodiments, the roundness is the mean roundness.

[0136] Solidity may be measured using Imaged. In embodiments, the aggregates have a solidity of 0.8- 1.0, 0.82-1.0, 0.84-0.99, 0.86-0.97, 0.88-0.95, or 0.9-0.93. In embodiments, the aggregates have a solidity of 0.92 ± 0.04. In embodiments, the solidity is a mean solidity.

[0137] Compositions and Pharmaceutical Compositions

[0138] The term ‘composition’ may be used herein to refer to a composition comprising a population of aggregates and / or conditioned medium produced as disclosed herein.

[0139] By ‘pharmaceutical composition’ it is generally meant that the composition comprising aggregates and / or conditioned medium as described herein is suitable for pharmaceutical use, e.g., in mammals such as humans. Thus a pharmaceutical composition is typically in a form that is suitable for administration (e.g. to humans) via oral or parenteral administration (e.g. intravenous or subcutaneous administration). Thus, a pharmaceutical composition may exclude the presence of components not suitable for administration (e.g., to humans). Particularly in the case of pharmaceutical compositions for injection (e.g., intravenous or subcutaneous administration), it is preferred that the composition is sterile.

[0140] In embodiments, the composition is administered to the subject using a needle and / or syringe. In embodiments where the composition comprises aggregates, the needle and / or syringe has an outlet having a diameter that is larger than the aggregate diameter to avoid damaging the morphology of the aggregates being administered. In embodiments, the needle and / or syringe has an outlet with a diameter +10% of the average aggregate diameter. In embodiments, the needle and / or syringe has an outlet with a diameter +10% of the largest expected aggregate diameter. In embodiments, the needle and / or syringe has an outlet with a diameter of at least 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 220, 250, 500, 600, 700, 800, 850 or 900 microns. In embodiments, the needle and / or syringe n embodiments, the needle is a 21G needle.

[0141] The pharmaceutical composition may further comprise a pharmaceutically acceptable carrier, diluent or excipient. The carrier, diluent or excipient may be any suitable media, including sterile water, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol, bacteriostatic water, a buffer solution such as a phosphate buffer (e.g., phosphate-buffered saline (PBS)) or a bicarbonate buffer, Cermophor EL™ (BASF, Parsippany, N.J), other solvents or suitable mixtures thereof. In embodiments, the composition or pharmaceutical composition comprises a volume of the carrier, diluent or excipient suitable for the intended use.

[0142] The composition or pharmaceutical composition may further comprise additional agents that are used for treating or preventing disorders / disease / conditions, and or treating an injury, as disclosed herein. In embodiments, the composition may further comprise a humectant (such as hyaluronic acid), anti-inflammatory agents, steroidal and non-steroidal drugs (including salicylic acid), antibiotics (such as doxycycline, metronidazole, minocycline, erythromycin, clindamycin), antimicrobials, brimonidine, antipruritic (such as clemastine, cyproheptadine, loratadine, hydroxyzine, ketotifen, promethazine, chlorpheniramine, alimemazine, pheniramine, nalmefene, doxepin, crotamiton), corticosteroids (such as hydrocortisone, triamcinolone and clobetasol), local anaesthetics (such as lidocaine, pramoxine or benzocaine), antipsoriatic agents, green tea, vitamin D analogues (including calcipotriene, calcitriol), collagen, chitosan, niacinamide, feverfew, calcineurin inhibitors (such as tacrolimus and pimecrolimus), benzoyl peroxide, moisturising agents, glycolic acid, witch hazel, essential oils, cetearyl alcohol, azelaic acid, and / or ivermectin. Compositions or pharmaceutical compositions of the present invention can have a selected viscosity by the addition of further reagents, such as water, glycerin, alcohol, oil, a silicone- containing compound, wax and thickening agents. Compositions of the present invention may be produced as an emulsion (e.g., water-in-oil, water-in-oil-in-water, oil-in-water, silicone-in-water, water-in-silicone, oil-in-water-in-oil, oil-in-water-in-silicone emulsions), creams, lotions, solutions (both aqueous and hydroalcoholic), anhydrous bases, gels, masks, ointment or sponge.

[0143] The composition or pharmaceutical composition may comprise or consist of a therapeutically effective amount of aggregates and / or conditioned medium. As used herein, the term ‘therapeutically effective amount’ or ‘therapeutically effective dose’ refers to an amount of aggregates and / or conditioned medium as described herein that, when administered to a patient or subject, is sufficient to cause a qualitative or quantitative reduction in the severity or frequency of symptoms of a disease, disorder, condition or injury, and / or a reduction in the underlying pathological markers or mechanisms. Certain factors may influence the dosage required to effectively treat a subject, patient or individual, including but not limited to the severity of the disease, disorder, condition or injury, previous or concurrent treatments, the general health and / or age of the subject, and other diseases, disorders, conditions or injuries present. In embodiments, the composition or pharmaceutical composition may comprise between 100-500000, 1000- 500000, 100-200000, 100-180000, 100-160000, 100-150000, 100-125000, 100-100000, 100- 75000, 100-50000, 100-25000, 100-20000, 100-17500, 100-15000, 100-12500, 100-10000, 500- 200000, 500-180000, 500-160000, 500-150000, 500-125000, 500-100000, 500-75000, 500- 50000, 500-25000, 500-20000, 500-17500, 500-15000, 500-12500, 500-10000, 500-8000, 1000- 200000, 1000-180000, 1000-160000, 1000-150000, 1000-125000, 1000-100000, 1000-75000, 1000-50000, 1000-25000, 1000-20000, 1000-17500, 1000-15000, 1000-12500, 1000-10000, 1000-8000, 1000-6000, 1000-5000, 2000-8000, 2000-6000, 2000-5000, 2000-4000, 2000-3000 or 3000-4000 aggregates per dose, preferably per dose for an 80 kg human.

[0144] In embodiments, between 10-5000, 100-5000, 1000-5000, 10-3500, 100-3500, 1000-3500, IQ- 3000, 100-3000, 1000-3000, 2000-3000, 10-2500, 100-2500, 1000-2500, 10-2000, 100-2000, 1000-2000, 10-10-1500, 10-1000, 100-1000, 10-500, 25-500, 50-500, 100-500, 10-450, 25-450, 50-450, 10-400, 25-400, 50-400, 10-350, 25-350, 50-350, 10-300, 25-300, 50-300, 10-250, 25- 250, 50-250, 10-200, 25-200, 50-200, 10-150, 25-150, 50-150, 10-125, 10-100, 20-100, 30-100, 40-100, 10-90, 20-90, 30-90, 40-90, 10-80, 20-80, 30-80, 40-80, 10-70, 20-70, 30-70, 40-70, IQ- 60, 20-60, 30-60, 40-60, or 30-50 aggregates per kg body weight is provided as a dose.

[0145] In embodiments, between 10-3000, 100-3000, 1000-3000, 10-2500, 100-2500, 1000-2500, IQ- 2000, 100-2000, 1000-2000, 10-1500, 100-1500, 1000-1500, 10-1000, 100-1000, 10-500, 25- 500, 50-500, 10-450, 25-450, 50-450, 10-400, 25-400, 50-400, 10-350, 25-350, 50-350, 10-300, 25-300, 50-300, 10-250, 25-250, 50-250, 10-200, 25-200, 50-200, 10-150, 25-150, 50-150, ID- 125, or 10-100 aggregates per cm2of injury surface area is provided as a dose.

[0146] In embodiments, the calculation to determine the dose in humans from the dose used in animals is as described in Nair and Jacob (2016, J. Basic Clin. Pharm. 7(2): 27-31). In embodiments, the calculation to determine the dose in humans = (dose in mouse in mg / kg 1 12.3) I Safety factor. In embodiments, the dose is calculated as [the dose in animal in mg / kg I Kmfactor for human) * Kg of the patient ] I Safety factor. In embodiments, the Kmfactor for an adult human is 37, preferably for a 60kg human with a body surface area of 1 ,6m2. In embodiments, the Kmfactor for a human child in 25, preferably for a 20 kg child with a body surface area of 0.8 m2. In embodiments, the safety factor is 2.

[0147] As used herein, ‘control’ refers to a suitable scientific control. In embodiments, a control may be refer to the same individual, patient, subject or cell prior to receiving treatment, or a non-treated individual, patient, subject or cell, or an individual, patient, subject or cell receiving administration of a buffer solution (such as PBS) or a composition of MSC aggregates not produced by the method disclosed herein or a composition of MSCs not produced by the method disclosed herein (such as MSCs cultured using monolayer techniques) or MSCs derived from dissociated aggregates produced using the method disclosed herein or a conditioned medium not exposed to the MSCs or aggregates produced as disclosed herein. features of aggregates

[0148] Cytokines and growth factors released by aggregates acts as a paracrine organ releasing factors that exert a regulatory effect on the activity, phenotype and proliferation of macrophages and T lymphocytes. Preferably, aggregates secrete one or more of tumor necrosis factor- (TNF) stimulated gene-6 (TSG-6), interleukin 1 receptor associated kinase (IRAK), interleukin (IL) 10 (IL-10), IL-12, IL-8, nitric oxide (NO), C-X-C motif chemokine ligand 10 (CXCL10), hepatocyte growth factor (HGF), Prostaglandin E2(PGE2), leukemia inhibitory factor (LIF), tissue inhibitor matrix metalloproteinase (TIMP) 1 (TIMP-1), TIMP-2, Cellular Inhibitor of Apoptosis Protein 1 (IAP-1), tumour necrosis factor alpha (TNFa), Stanniocalcin-1 (STC1), interleukin-1 receptor antagonist (IL-1 Ra), FGF2, cyclooxygenase-2 (COX- 2), vascular endothelial growth factor (VEGF), bone morphogenetic protein-2 (BMP2), and / or interleukin 6 (IL-6). These may be quantified using standard methods in the art, such as RT-PCR, ELISA or western blot. Methods of producing a composition or pharmaceutical composition comprising aggregates

[0149] ‘Culture’ or ‘cultured’ may refer to the growth of cells in vitro, preferably under controlled conditions.

[0150] Compositions of the present disclosure may be produced by providing between 100,000 to 1 ,000,000, 100,000 to 900,000, 100,000 to 800,000, 200,000 to 1 ,000,000, 200,000 to 900,000, 200,000 to 800,000, 300,000 to 1 ,000,000, 300,000 to 900,000, 300,000 to 800,000, 300,000 to 700,000, 350,000 to 1,000,00, 350,000 to 900,000, 350,000 to 800,000, 350,000 to 700,000, 350,000 to 650,000, 400,000 to 1 ,000,000, 400,000 to 900,000, 400,000 to 800,000, 400,000 to 700,000, 400,000 to 650,000, 400,000 to 600,000, 450,000 to 550,000 or around 500,000 MSCs to a cell culture container, and culturing the cells. The MSCs may be obtained and expanded as disclosed herein. A skilled person will understand that the number of MSCs provided to a cell culture container is the starting number of MSCs before culturing.

[0151] The number of MSCs in a cell suspension can be obtained using standard methods in the art. For example, the numbers of MSCs in a cell suspension may be counted manually (such as using a hemacytometer and light microscope) or using an automated process (such as coulter counters, flow cytometers or image-based counters). In this way, if it is required that a certain number of cells be plated in a culture vessel, the amount of cell suspension needed to provide the required number of cells to the new culture vessel can be calculated. The number of viable cells can also be counted manually or in an automated process by the addition of cellular dyes, such as Trypan Blue.

[0152] In embodiments, the MSCs may be cultured for aggregation in a culture media suitable for MSCs, preferably a culture media suitable for maintaining undifferentiated MSCs. Examples of suitable culture media include DMEM, a-MEM, Ham's F12 medium, MCDB (such as 102, 107, 120, 131 , 143, 199 or 201) medium, DME, L15, SkBM, RITC80, RPMI11640, StemPro™ MSC SFM XenoFree medium, MesenCult™-XF Complete medium, Mesencult® medium, MSCGM™ medium, MSC NutriStem® XF medium, Human Mesenchymal-XF Expansion medium, or StemXVivo® Medium can be used. Preferably, the media comprises or consists or consists essentially of a-MEM. Media added with serums (such as foetal bovine serum, or human serum) or serum replacement (such as Knockout serum replacement (KSR)) may be used. Preferably, the serum is a human serum, preferably a human platelet lysate. Preferably the amount of serum or serum replacement is between 0.1 to 10%, 0.1 to 8%, 0.1 to 7%, 0.1 to 5%, 0.1 to 4%, 0.1 to 3%, 0.1 to 2%, 0.5 to 2%, 0.5 to 1.5%, or around 1% (v / v) with the culture media. In embodiment, the media further comprises one or more antibiotics, such as penicillin / streptomycin or gentamicin. In embodiments, the media further comprises heparin, preferably heparin at 2 lll / rnl . In preferred embodiments, the medium comprises or consists or consists essentially of: alpha MEM, platelet lysate, heparin and one or more antibiotics.

[0153] The MSCs may be cultured for aggregation for a suitable length of time to obtain aggregates. Preferably, the MSCs are cultured for between 24 to 120, 36 to 108, 48 to 96, 60 to 84, 66 to 78, 69 to 75 or around 72 hours.

[0154] The culture container may be a low adhesion or non-adhesive container. Such containers are standard in the art and would be understood by the skilled person to refer to containers with one or more internal surfaces being hydrophobic. In embodiments, one or more internal surfaces of the culture container may be coated with a hydrophobic composition, such as a composition comprising or consisting of hydrophobic silanes, silica, poly-ethylene glycol, polydimethylsiloxane, organopolysiloxane in heptane, or agarose.

[0155] In embodiments, one or more wells of the culture container may comprise a micropatterned surface. In embodiments, the culture container comprises one or more wells comprising at least one cavity, wherein the cavity is a pyramid with a rounded tip, and wherein the pyramid has rounded edges between the pyramid side walls. Preferably, the rounded tip has a diameter d2 between 1 to 350 pm. Preferably, the pyramid is a quadrangular or a trilateral pyramid. Preferably, the height h of the cavity is from 10 pm to 2000 pm. Preferably the wall angle a of the cavity is from 35° to 75°. Preferably, the top opening edge length c of the pyramidal cavity is from 50 pm to 2000 pm. Preferably, the device comprises from 1 to 1000000 cavities. Preferably, the device is separated into compartments of cavities, wherein each compartment contains at least one cavity being a pyramid with a rounded tip, wherein the pyramid has rounded edges between the pyramid sidewalls. Preferably, each compartment comprises at least one filling insert placed therein. Preferably, each compartment comprises at least one surface without cavities. Preferably, the at least one surface without cavities is located on at least one edge of each compartment. Preferably, the space between the cavities is less than 20 pm. Suitable micropatterned culture containers are described, for example, in US 8911690 B2, which is incorporated by reference in its entirety.

[0156] The MSCs may be cultured for aggregation at a temperature between 34 °C to 40 °C, 35 °C to 39 °C, 36 °C to 38 °C, 36.5 °C to 37.5 °C, or a temperature around 37 °C. This may be achieved, for example, using a standard cell culture incubator. The MSCs may be cultured for aggregation under hypoxic conditions. In embodiments, the MSCs are cultured with between 2-8%, 3-7%, 3.5-6.5%, 4-6%, 4.5-5.5% or around 5% O2. In embodiments, the MSCs are cultured with between 2-8%, 3-7%, 3.5-6.5%, 4-6%, 4.5-5.5% or around 5% CO2. The levels of O2 and CO2 may be controlled, for example, using a standard cell culture incubator.

[0157] In embodiments, the MSCs may be agitated during culturing for aggregation. ‘Agitated’ or ‘agitation’ may be used to refer to movement of the MSC culture (e.g., by comparison to culture where the container is on a static surface), preferably by mechanical means. The movement may be, for example, shaking, stirring, rolling or rocking. This may be achieved using standard equipment in the art, such as a bioreactor, orbital shaker, rocker, or rollers. In embodiments, the agitation is continuous. In embodiments, the agitation is intermittent, such as every 1 , 2, 3, 4, 5, 10, 15, 20, 30, 45, 60, or 100 minutes, agitated, preferably wherein the MSCs are agitated at a speed of between 60-100 rpm, 65-95 rpm, 70-90 rpm, 75-85 rpm or around 80 rpm, or around 0.5-5, 0.5-4, 0.5-3, 1-3, 1.5-2.5 or around 2 relative centrifugal force (RCF, also referred to as g force).

[0158] In embodiments, the MSCs may be cultured for aggregation in the presence of a cationic polymer, preferably poly-L-lysine more preferably a low-molecular weight poly-L-lysine. In embodiments, the poly-L-lysine has a molecular weight between 1 ,000 to 100,000, 1 ,000 to 90,000, 1 ,000 to 80,000, 1 ,000 to 75,000, 1 ,000 to 70,000, 5,000 to 100,000, 5,000 to 90,000, 5,000 to 80,000,

[0159] 5,000 to 75,000, 5,000 to 70,000, 10,000 to 100,000, 10,000 to 90,000, 10,000 to 80,000, 10,000 to 75,000, 10,000 to 70,000, 15,000 to 100,000, 15,000 to 90,000, 15, 000 to 80,000, 15,000 to

[0160] 75,000, 15,000 to 70,000, 20,000 to 100,000, 20,000 to 90,000, 20,000 to 80,000, 20,000 to

[0161] 75,000, 20,000 to 70,000, 25,000 to 100,000, 25,000 to 90,000, 25,000 to 80,000, 25,000 to

[0162] 75,000, 25,000 to 70,000, 30,000 to 100,000, 30,000 to 90,000, 30,000 to 80,000, 30,000 to

[0163] 75,000 or 30,000 to 70,000 Da. In embodiments, the cationic polymer is added to the culture media.

[0164] A pharmaceutical composition of the present disclosure may be produced using the methods disclosed herein for producing a composition of aggregates and / or the methods disclosed herein for producing a conditioned medium, and further adding a pharmaceutically acceptable carrier, diluent or excipient to the composition. In embodiments, the aggregates may first be washed, for example, with a buffer, and then a pharmaceutically acceptable carrier, diluent or excipient added.

[0165] Priming of aggregates In embodiments the aggregates produced using the method disclosed herein may be primed (i.e., the aggregates are subjected to priming). As used herein ‘priming’ may refer to exposing the aggregates to specific culture conditions in order to further improve the properties of the aggregates (i.e., the MSCs forming the aggregates). For example, priming may be performed in order to improve the metabolic activity, or cell viability of the aggregates, or improve the secretion of growth factors. Alternatively, priming may be performed to obtain a conditioned medium.

[0166] In embodiments, the aggregates may be primed in a bioreactor. A ‘bioreactor’ is defined as a closed culture vessel configured to provide a dynamic fluid environment for cell culture. Bioreactors suitable for culture of MSCs (and thus MSC aggregates) are known in the art, such as ambr15®, and UniVessel® bioreactor. In preferred embodiments, the bioreactor is a Spinner flask, preferably a Corning® ProCulture® spinner flask. In embodiments, the bioreactor has a volume of around 50-1000, 100-1000, 50-750, 100-750, 50-500, 100-500, 50-250 or around 125 mL.

[0167] In embodiments, the aggregates are primed in a media, preferably a media for MSCs, more preferably a media for undifferentiated MSCs. Examples of suitable medias for culturing undifferentiated MSCs are disclosed herein.

[0168] In embodiments, the aggregates are primed under hypoxic conditions, preferably wherein the MSCs are primed under between 2-8%, 3-7%, 3.5-6.5%, 4-6%, 4.5-5.5% or around 5% O2. In embodiments the aggregates may be primed with between 2-8%, 3-7%, 3.5-6.5%, 4-6%, 4.5- 5.5% or around 5% CO2.

[0169] In embodiments, the aggregates are agitated during priming, preferably wherein the aggregates are agitated at a speed between 1-100, 10-100, 25-100, 50-100, 60-100, 65-95, 70-90, 75-85, or around 80 rpm, or between 0.5-5, 0.5-4, 0.5-3, 1-3, 1.5-2.5 or around 2 relative centrifugal force (RCF). Agitation may be performed as disclosed herein. In embodiments, the aggregate may not be agitated during priming.

[0170] In embodiments, the aggregates are primed in a culture container defined herein, preferably a culture container with at least one internal surface that is hydrophobic. Preferably, one or more internal surfaces of the culture container are coated in a hydrophobic composition, more preferably a composition comprising or consisting of hydrophobic silanes, silica, poly-ethylene glycol, polydimethylsiloxane, organopolysiloxane in heptane, or agarose. In embodiments, the aggregates are primed at a temperature between 34 °C to 40 °C, 35 °C to 39 °C, 36 °C to 38 °C, 36.5 °C to 37.5 °C or around 37 °C. This may be achieved in a standard incubator.

[0171] In embodiments, the aggregates are primed in the presence of a cationic polymer, preferably where the cationic polymer is added to the culture media. In embodiments, the final concentration of cationic polymer in the media is between 0.1-5, 0.5-5, 0.1-4, 0.1-3.5, 0.1-3, 0.5-3.5, 0.5-3, 0.1- 2.5, 0.5-2.5, 0.1-2, 0.5-2, 0.1-1.5, 0.5-1.5, or around 1 pg / mL. Preferably, the cationic polymer is poly-L-lysine, more preferably a low molecular weight poly-L-lysine, even more preferably where the poly-L-lysine has a molecular weight between 1 ,000 to 100,000, 1 ,000 to 90,000, 1 ,000 to 80,000, 1 ,000 to 75,000, 1 ,000 to 70,000, 5,000 to 100,000, 5,000 to 90,000, 5,000 to 80,000,

[0172] 5,000 to 75,000, 5,000 to 70,000, 10,000 to 100,000, 10,000 to 90,000, 10,000 to 80,000, 10,000 to 75,000, 10,000 to 70,000, 15,000 to 100,000, 15,000 to 90,000, 15, 000 to 80,000, 15,000 to

[0173] 75,000, 15,000 to 70,000, 20,000 to 100,000, 20,000 to 90,000, 20,000 to 80,000, 20,000 to

[0174] 75,000, 20,000 to 70,000, 25,000 to 100,000, 25,000 to 90,000, 25,000 to 80,000, 25,000 to

[0175] 75,000, 25,000 to 70,000, 30,000 to 100,000, 30,000 to 90,000, 30,000 to 80,000, 30,000 to

[0176] 75,000 or 30,000 to 70,000 Da.

[0177] Conditioned medium

[0178] The present disclosure also provides a conditioned medium exposed to the aggregates disclosed herein. In embodiments, the conditioned medium is obtained or obtainable by the method of producing the aggregates disclosed herein, wherein the method further comprises a step of harvesting a medium exposed to the aggregates. Alternatively, the conditioned medium may be obtained or obtainable by the method of producing aggregates disclosed herein, the aggregates then primed as disclosed herein, and then the medium exposed to the primed aggregates may be harvested.

[0179] Harvesting of medium may be performed by allowing aggregates to settle in a container before transferring the supernatant (i.e. , conditioned medium) to a fresh container.

[0180] The medium may be harvested after at least 2, 4, 6, 8, 10, 12, 18, 24, 30, 36, 40, 46, 52, 58, 64, 70, or 72 hours of culture with the aggregates.

[0181] The conditioned medium may be processed after harvesting. For example, the conditioned medium may be filtered, sterilised or lyophilised.

[0182] Methods of use The composition or pharmaceutical composition disclosed herein may be for use in the treatment or prevention of a disease, disorder, condition or injury. The composition or pharmaceutical composition disclosed herein may be used in a method of treating or preventing a disease, disorder or condition, and / or treating an injury. The disease, disorder or condition may be selected from the list comprising or consisting of: age-related disorders, chronic and / or acute inflammatory conditions, degenerative joint diseases, joint injury, traumatic lesions, chronic and / or acute respiratory diseases, musculoskeletal conditions, neurodegenerative diseases and / or brain injury in a subject in need thereof.

[0183] The inflammatory disease, disorder or condition may be a chronic or acute inflammatory disease, disorder or condition. In embodiments, the inflammatory disease may be ulcerative colitis, Crohn's disease, Epidermolysis bullosa, degenerative disc disease, facet syndrome, chondromalacia patella, tendinopathies, arthritis, preferably rheumatoid arthritis or osteoarthritis. In preferred embodiments, the arthritis may be knee osteoarthritis. Treatment or prevention of a chronic inflammatory disorder, including arthritis, may be measured by one or more of: a reduction in reported pain / discomfort, improved mobility, reduced localised and / or systemic inflammation, reduced C-reactive protein (CRP) levels, and reduced chondral damage by comparison to levels prior to treatment. These may be assessed using standard techniques in the art. These measurements may also be compared to a control as defined herein.

[0184] The injury may be skin, joint, cartilage, bone and / or muscle damage or injury such as a wound, burn, corrosion, lesion, cut, wear, frostbite, arthritis, degenerative disc disease, facet syndrome, chondromalacia patella, or Epidermolysis bullosa. Prevention or treatment of injury may be measured by one or more of: a reduction in reported pain / discomfort and reduced damaged or necrotic tissue area. These may be assessed using standard techniques in the art. These measurements may also be compared to a control as defined herein.

[0185] The neurodegenerative disease, disorder or condition may be selected from the list comprising or consisting of: Parkinson’s disease, Alzheimer’s disease, Amyotrophic lateral sclerosis, Huntington’s disease, Motor Neuron Disease, stroke, traumatic brain injury and multiple sclerosis. Prevention or treatment of neurodegenerative disease may be measured by one or more of: reduced loss of neurons, improved cognitive function, or improved mobility and coordination. These may be assessed using standard techniques in the art. These measurements may also be compared to a control as defined herein.

[0186] In embodiments, the musculoskeletal condition is osteoarthritis, rheumatoid arthritis, juvenile arthritis, spondyloarthritis, fractured bone, tendinitis, bursitis, back problems, gout, osteoporosis, bruise, sprain, strain, sarcopenia, cartilage tear, tendon tear, torn ligament, dislocation, soft-tissue damage, or amputation.

[0187] The terms ‘disease’, ‘disorder’, ‘condition’, ‘illness’ or ‘pathology’ may be used interchangeably to refer to any condition that is or is predicted to be associated with symptoms or an underlying pathology. ‘Injury’ may be used to refer to damage induced by physical stress, such as an impact, lesion or wound that may not associated with an underlying pathology.

[0188] The terms ‘treating’, or ‘treatment’ as used herein refer to reducing the severity and / or frequency of symptoms, reducing the underlying pathological markers, eliminating symptoms and / or pathology, arresting the development or progression of symptoms and / or pathology, slowing the progression of symptoms and / or pathology, eliminating the symptoms and / or pathology, or improving or ameliorating pathology / damage already caused by the disease, condition, disorder or injury.

[0189] The terms ‘preventing’ or ‘prophylaxis’ as used herein refer to the prevention of the occurrence of symptoms and / or pathology, delaying the onset of symptoms and / or pathology. Therefore, ‘preventing’ or ‘prophylaxis’ in particular, applies when a patient or subject is susceptible to, or has, a disease, disorder or condition but does not yet display symptoms.

[0190] As used herein, the terms ‘administering’, ‘administer’ or ‘administration’ may refer to providing to a subject, patient or individual a composition or pharmaceutical composition as disclosed herein using any method of delivery known to those skilled in the art. In embodiments, routes of delivery of the composition or pharmaceutical composition include intravenous, intradermal, subcutaneous, intraperitoneal, intramuscular, intrathecal or direct application to the main site of the disease, disorder, condition or injury, e.g., direct injection into the cerebrospinal fluid or brain, inhalation, rectal (suppository or retention enema), vaginal, oral (capsules, tablets, solutions or troches), transmucosal, topical or transdermal (e.g., skin patches, ophthalmic, intranasal) application. In preferred embodiments, the composition or pharmaceutical composition is administered topically, directly to a local site of pathology.

[0191] The composition or pharmaceutical composition may be administered only once, or multiple times.

[0192] In one embodiment, the composition or pharmaceutical composition may be administered with other therapies or methods (a ‘secondary therapy’), preferably a secondary therapy intended to treat or prevent symptoms of the same disease, disorder, condition or injury to be treated or prevented by the presently disclosed composition or pharmaceutical composition. For example, where the composition or pharmaceutical composition is to treat degenerative disc disease, facet syndrome, chondromalacia patella, tendinopathies, arthritis, the composition or pharmaceutical composition may further comprise, or be administered alongside, an analgesic and / or chondroprotector. Examples of chrondroprotectors include chondroitin sulfate, glucosamine sulfate or hydrochloride, hyaluronic acid, and glycosaminoglycans. In another example, where the composition or pharmaceutical composition is to treat an inflammatory disease such as ulcerative colitis, Crohn's disease, Epidermolysis bullosa, degenerative disc disease, facet syndrome, chondromalacia patella, tendinopathies, arthritis or osteoarthritis, the composition or pharmaceutical composition may further comprise, or may be administered alongside an analgesic and / or anti-inflammatory agent. Examples of anti-inflammatory agents include chondroitin sulfate, ibuprofen, naproxen, diclofenac, celecoxib, mefenamic acid, etoricoxib, indomethacin, high-dose aspirin, betamethasone, cortisone, dexamethasone, hydrocortisone, methylprednisolone, prednisolone and triamcinolone acetonide.

[0193] As used herein, the terms ‘subject’, ‘patient’ or ‘individual’ may be used interchangeably and may refer to vertebrates, preferably mammals, more preferably humans. Accordingly, the term ‘subject’ or ‘patient’ may be used to refer to any individual diagnosed with, predisposed to, or suspected of having a disease, disorder or condition. Identification of diseases, disorders or conditions may be established through standard clinical tests or assessments. Examples of suitable analgesics may include paracetamol, non-steroidal anti-inflammatory drugs (NSAIDs), opioids, corticosteroids, which allow control of the inflammatory process in the short term. Examples of suitable chondroprotectors include glucosamine and chondroitin sulfate.

[0194] All publications mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described methods, uses and products of the present invention will be apparent to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art are intended to be within the scope of the following claims.

[0195] The invention will now be described by way of example only, with reference to the following nonlimiting embodiments.

[0196] EXAMPLES Example 1 : MSC Isolation and Expansion

[0197] Isolation and expansion of ad-hMSCs

[0198] Mesenchymal cells were obtained from adipose tissue from healthy donor women using the criteria listed in Table 1. Adipose tissue was obtained by a mini periumbilical liposuction (100-200 cc), under local anesthesia. The tissue was processed by the CELLLIS Biofactory production laboratory in order to purify and expand the population of ad-hMSCs. Different conditions were tested for the expansion of MSCs.

[0199] According to the standards established by the International Society for Cell Therapy (ISCT), the isolated ad-hMSCs meet the acceptance parameters described for mesenchymal cells, with expression of membrane markers such as CD73, CD90, CD105, and CD29 and do not express the markers CD45, CD34 , HLA-DR, CD44, CD19, and CD11 b (data not shown).

[0200] Comparison of mitogens in the expansion of MSCs

[0201] 5,000 cells / cm2of HistoCell Master Cell Bank 02 (MCB02-HTC-22) MSCs, HistoCell Master Cell Bank 01 (MCB01-HTC-22) MSCs and Internal Allogenic Master Cell Bank 004 (004-ALO-22) MSCs were seeded into 6-well plates in alpha minimum essential medium (alpha MEM) medium under both hypoxic (5% O2) and normoxic (18- 21% O2) conditions. Five mitogens were added to the medium, including: 10% qualified fetal bovine serum (FBS Q), 10% premium FBS P (FBS P), 10% NuSerum™, 10% ELAREM™ perform research grade human platelet lysate (LP) from lots 17.01 , 17.02 and 10% ELAREM™ prime research grade human LP from lot 16.02 were added to the medium for five days. 100% SteMACS™ XF RUO medium was also tested. The medium was replaced every 48 hours. The cells were then dissociated using TrypLE™ express following the manufacturer guidelines. In brief, the cells were washed twice with PBS without calcium and magnesium and incubated with 300 pL TrypLE™ at 37 °C for 10 minutes. Medium was then added to the wells to reach a final volume of 1.5 mL.

[0202] Various outcomes tested to determine the effect of the mitogens on MSC culture quality. The parameters included counts of cells / cm2, cell viability and doubling time (herein referred to as DT or DTP). Cells were centrifuged at 1000 x g for five minutes, the supernatant removed and the pellet resuspended in a final volume of 300 pl of PBS 1X.

[0203] Cell counts and cell viability were performed using an automatic cell counter such as the LUNA™ according to the manufacturer's instructions, or manually counted using a Neubauer chamber. The yield of cells per cm2was obtained by dividing the total number of cells calculated from the cell count per well per condition by 9.4 which corresponds to the area of a well in a 6 well plate.

[0204] The doubling time was obtained using the standard formula: DTP=(t*24)*ln(2) I ln(rf / ri), where t corresponds to the time of the culture in days, rf refers to the yield of cells when counted and ri refers to the seeding input / cm2.

[0205] As can be seen from Figures 1A-1C, xeno-free platelet lysates, particularly human platelet lysate, were the most efficient mitogens for the culture and expansion of the MSCs as they resulted in a drastic reduction in doubling time and the resulting number of cells, without affecting the viability of the cells. In contrast, expansion of MSC cultures with other growth supplements such as FBS did not result in adequate cell numbers to produce aggregates and had long doubling times which is not compatible with commercial use.

[0206] We then determined whether this effect was specific to the Histocell 2022 Master Cell Bank 02 MSCs, or if this could apply to MSCs derived from different donors. As can be seen from Figure 2, the platelet lysate and SteMACS outperformed Nuserum, FBS P and FBS Q as found in the previous experiment with minimal differences between MSC lines. In addition, the same pattern was observed regardless of the MSC donor.

[0207] Effect of base medium on the expansion of MSCs

[0208] We then tested the effect of base medium on the quality of expanded MSCs. To do this, we compared the effects of culturing MCB01-HTC-22 and MCB-I NO-22 LP01 for seven days in alpha-MEM and Dulbecco’s modified Eagle medium (DMEM) each supplemented with platelet lysate, FBS Q or FBS under normoxic conditions as described above. Cell output, viability and DTP were measured as described above. Cells were dissociated and measured at seven days after seeding.

[0209] As can be seen from Figures 3A-3F, although the base medium did not have a significant impact on cell viability (Figures 3B and 3E), and in most cases, the DTP levels were acceptable (Figures 3C and 3F), the base medium did have an impact on the number of cells obtained (Figures 3A and 3D). Therefore, whilst DMEM is compatible with the present methods, alpha MEM is preferred.

[0210] Effect of platelet lysate concentration on the expansion of MSCs We then determined whether there was an effect of the concentration of platelet lysate (exemplified by lot 17.02) on the yield, viability and morphology of MSC cultures, and whether this was impacted by the initial seeding density. To do this a seeding matrix was set up in 6-well plates with a seeding density of 1000, 2000, 3000, 4000 or 5000 of MCB02-HTC-22 (passage 5) cells / cm2. Cells were then cultured under normoxic conditions in alpha MEM at different concentrations of platelet lysate (ELAREM™ Perform lot 17.02) at 1 , 2, 3, 4, and 5%. Medium was replaced every 48 hours. After five days of culture, cells were dissociated as described above and the output of cells / cm2and cell viability were measured as described above. Morphology of MSC cultures was evaluated by five different experienced observers and classified as optimal, regular or different with respect to normal 2D MSC cultures.

[0211] A comparison of platelet lysate concentrations was also performed for MCB-I NO-22 LP01 (passage 4) cells seeded at 5000 cells / cm2in six well plates using the concentrations and methods described above with the exception that dissociation was performed after seven days in culture. Doubling time estimates were performed as described above.

[0212] As can be seen in Figure 4A, surprisingly the viability of cells was not massively impacted by the cell seeding density, nor the concentration of platelet lysate in the medium. In addition, it was surprising that the cell seeding density did not have a major impact on the cell output (cells / cm2) after 2000 cells / cm2. However, the concentration of platelet lysate had a major impact on the output cell number (Figure 4B), with a drastic improvement in the output cell number being seen for 2% and 3%, and a minor further improvement in the output cell number for 4% and 5%. The same pattern was observed when culturing MCB-INO-22 LP01 (Figures 4C-4E), with the largest improvement for the cell output when MSCs were cultured with 3% platelet lysate, with minor improvements for increasing platelet lysate to 4% and 5% (Figure 4C).

[0213] As can be seen in Figure 5A, the MSC morphology of MCB01-HTC-22 changed with the percentage of platelet lysate added. As can be seen in Figure 5B, the optimal MSC morphology was achieved with an initial seeding density of 3000 cells / cm2and between 2% to 4% platelet lysate. Optimal MSC morphology was also achieved with 3% platelet lysate at higher seeding densities of 4000 and 5000 cells / cm2.

[0214] FBS compared to platelet lysate

[0215] To determine why platelet lysate had such an improved effect over FBS, we compared levels of pro-inflammatory, anti-inflammatory, regenerative and adhesion proteins in platelet lysate (ELAREM™ perform research grade human platelet lysate lot 17.02) and FBS Q, compared to a pool of human serum (SRF pool) from 27 healthy donors using using a chemiluminescent quantitative enzyme-linked immunosorbent assay (ELISA) (Quansys Q-Plex™ Human Custom (14-Plex) kit), customized for the proteins of interest for our study, following the manufacturer's recommendations. The quantified protein expression is represented on an intensity scale, with 0 pg / mL being the lightest colour, and up to 6500 pg / mL being the darket colour. The results were obtained from a technical triplicate.

[0216] As can be seen from Figures 6A and 6B, platelet lysate had the profile of molecules closest to that of human serum, whereas FBS tended to have higher levels of molecules found in human serum.

[0217] Example 2: Manufacture and Characteristics of MSC Aggregates

[0218] Methods

[0219] Method for producing aggregates

[0220] To test the conditions for producing aggregates, we tested the effect of platelet lysate on the quality of aggregates formed from MSCs. To do this, we prepared aggregates by plating 500,000 MSCs in a Sphericalplate 5D® (Kugelmeier) with saline and 0%, 1 % or 3% platelet lysate for 72 hours. We then measured the parameters of aggregates cultured for 72 hours at 37 °C, 5 % CO2; 5 % O2 and 90-95 % humidity for 72 hours with 1% platelet lysate in alpha MEM.

[0221] Retrieval of aggregates

[0222] To retrieve aggregates from the culture plate, the medium in the well was pipetted several times with moderate intensity without introducing bubbles. The medium was then immediately transferred to a second tube. 1 mL PBS was then immediately added to the well, and the pipetting process repeated a second time to recover remaining aggregates from the well and transferred to the second tube. The tube was then centrifuged at 200 x g for 3 minutes, and the supernatant removed. The aggregates were then resuspended in a suitable medium for analysis, priming or application.

[0223] Analysis of aggregates

[0224] To evaluate the size and shape of the aggregates the aggregates were photographed using bright field microscopy using the 4x objective . Using the Imaged software, masks were created (Figure 7) and various parameters were measured using standard tools in Image J (Figures 8A-8D). The following parameters were evaluated: 1. Maximum Feret (i.e., maximum diameter of each aggregate) was measured as the greater distance between two points of the outline of each aggregate (Figure 8A);

[0225] 2. Minimum Feret (i.e., minimum diameter of each aggregate) was measured as the shorter distance between two points of the outline of each aggregate (Figure 8A);

[0226] 3. Perimeter was measured as the length of the outline of the aggregate (Figure 8B);

[0227] 4. Circularity (i.e., coefficient of similarity with a circle) was calculated as An x (area / peri meter2) (Figure 8C); and

[0228] 5. Roundness was calculated as circularity + (circularityperfect circle - circularityaspectratio) (Figure 8C).

[0229] The number of cells per aggregate was calculated by one of two methods. The first method involves staining whole aggregates with DAPI and producing a ‘z-stack’ by confocal microscopy of a whole aggregates and counting the number of nuclei stained by the DAPI. To do this, approximately 2500 aggregates are centrifuged at 300 x g for 2 minutes at room temperature. The supernatant is removed and the cell pellet incubated in 1.5 mL of 4% paraformaldehyde at room temperature for 1 hour to perform the fixing process. Subsequently, the aggregates are washed with DPBS®. After centrifugation at 300 x g for 2 minutes at room temperature, the aggregates are resuspended with 60 pL of DBPS®. 30 pl of resuspended aggregates are transferred to a Super Frost® adhesion slide. The slides are left to dry for 30 minutes and finally the marking with DAPI is carried out. To determine the number of cells per aggregate, analysis is performed using Zeiss LSM 800 laser scanning confocal microscope. Representative z-stack captures of ten aggregates are obtained of the entire aggregate. The images obtained are analyzed using the NoviSight (Evident Scientific Olympus) software that allows determination of the average number of nuclei per aggregate.

[0230] The second method involves counting by plating a known number of aggregates on an adherent dish for 12 hours (Figure 8D), trypsinizing the cells and counting the number of cells obtained in the dissociated cell suspension using automatic or manual counting techniques. To do this a decreasing series of serial dilutions 1 / 2 are made, starting from 1500 aggregates. Each dilution is brought to a final volume of 1 ml of aMEM supplemented with 1% platelet lysate and seeded in a 24-well plate. The culture is maintained for 24 hours in normoxic conditions (5% CO2, 37°C). The adhered cells are then trypsinized from the adhered aggregates and cell counting is performed using a Neubauer chamber camera system. Cell viability was measured by flow cytometry using the reagent 7-actinomycin-D (7AAD, Beckman Coulter, catalogue number A07704), according to the manufacturer's instructions. Viability was obtained with n=1.

[0231] Temperature Conditions

[0232] We then tested whether the characteristics of aggregates were influenced by the temperature at which the aggregates were stored. To do this, one thousand aggregates per condition were stored in a low adhesion Kahn tube for up to 48 hours at 4-6 (fridge), 22-24 (room temperature) or 40 °C (water bath) in Krebs-Ringer solution. The characteristics of the aggregates were assessed as described above.

[0233] Proliferation and pluripotency

[0234] Aggregates were stained with anti-CD73, anti-CD90, anti-Ki67, anti-Oct-3 / 4, anti-Nanog, anti- Sox2 or anti-CD105, and DAPI and imaged using a confocal microscope.

[0235] To determine that aggregates retain the ability to express membrane factors corresponding to mesenchymal cells, aggregates were fixed with 4% paraformaldehyde (PFA) for 1 hour and approximately mounted on a SuperFrost® adhesion slide. They were then incubated with anti- CD73, anti-CD90 and anti-CD105 primary antibodies overnight at 4°C under agitation. Subsequently, the aggregates were treated with biotinylated secondary antibodies (lgG1) for 3 hours at room temperature and stained with streptavidin-Alexa 488 antibody for 24 hours at 4 °C in the dark. Finally, a DAPI solution was added in combination with Fluoromount mounting medium in order to stain the cell nuclei. Analysis was performed using a Zeiss LSM 800 confocal microscope.

[0236] We also evaluated whether the aggregates were in the active phase of the cell cycle. For this purpose, Ki67 was analyzed as a nuclear marker of proliferating cells that is expressed in all active phases of the cell cycle (G1 , S, G2). To do this, aggregates were fixed with 4% PFA for 10 minutes and mounted on a SuperFrost® adhesion slide. They were then incubated with Alexa Fluor 555-conjugated anti-Ki67 primary antibody for 1 hour at room temperature. Subsequently, DAPI solution was added in combination with Fluoromount mounting medium. Analysis was performed using a Zeiss LSM 800 confocal microscope.

[0237] The ability of aggregates to maintain the expression of pluripotency factors was determined. For this purpose, aggregates were fixed with 4% PFA for 10 minutes and approximately mounted on a SuperFrost® adhesion slide. They were then incubated with three conjugated antibodies (NL637 conjugated Oct-3 / 4, NL493 conjugated Nanog and NL557 conjugated S0X2) for 3 hours at room temperature. Subsequently, a DAPI solution was added in combination with Fluoromount mounting medium to stain the cell nuclei. The analysis was performed using a Zeiss LSM 800 confocal microscope.

[0238] Differentiation potential

[0239] Different techniques were performed to determine the presence of mucopolysaccharides, calcium salts and lipids to determine the cell differentiation capacity of aggregates. To do this, aggregates were placed in a Chamber Slide™ (Lab-Tek®) with aMEM and 3% human platelet lysate (lot 17.02) and incubated at 37°C for 24 hours. Subsequently, the medium was removed, and chondrogenic differentiation medium (aMEM, 10ng / mL human transforming growth factor pi (TGFpi), 6.25 pg / ml ITS + liquid media supplement (100x), 50 nM 2 phospho-L-ascorbic acid trisodium salt and 1% antibiotic-antimycotic solution (100x)), adipogenic differentiation medium (aMEM, 3% platelet lysate, 1 % antibiotic-antimycotic solution (100x), 500 pM isobutyl-methyl- xanthine (IBMX), 1 pM dexamethasone, 10 pM insulin, and 150 pM indomethacin) or osteogenic differentiation medium (aMEM, 10 pM 2-phospho-L-ascorbic acid trisodium salt, 10 mM p glycerol phosphate disodium salt hydrate, 0.1 pM dexamethasone, and 1% antibiotic-antimycotic solution (100x)) was added to the aggregates. Aggregates were cultured in the differentiation medias for 15 days and the media exchanged every 2-3 days. Control medium was aMEM with 3% platelet lysate.

[0240] Chondrogenic differentiation was tested for using Alcian blue stain to detect the presence of acid mucopolysaccharides. Adipogenic differentiation was tested for using Oilred-O staining to detect the presence of intracellular lipids and triglycerides. Osteogenic differentiation was tested for using Alizarin red-S dye to detect calcium deposits.

[0241] Glucose consumption

[0242] Glucose consumption of aggregates was tested in a co-cultivation model with lymphocytes activated with phitohemagglutinin (PHA) in vitro. Briefly, lymphocytes from three healthy donors were separated by gradient and activated with PHA according to the manufacturer's instructions and co-cultured in a ratio of 1 :10 ad-hMSCs: Lymphocytes and 0.4:10 Celluspheres: Lymphocytes. The ratio was normalised by the number of ad-hMSCs per spheroid. Glucose was quantified in the culture medium at 0 h (baseline) and after 72 hours using a hemoglucotest according to the manufacturer's instructions.

[0243] Results Analysis of the aggregates cultured with 3% platelet lysate showed a trend towards having an increased number of spheroids per plate, but this difference was not significant (Figure 9A). In addition, culturing of aggregates with platelet lysate did not have a significant impact on the morphology of aggregates (Figures 9B-9D). However, platelet lysate resulted in a trend towards an increased average roundness in Figure 9D, and the reduced variability in roundness for aggregates cultured with 1% and 3% platelet lysate. Therefore, for culturing of aggregates, it is preferred that the medium comprises at least 1% platelet lysate.

[0244] Analysis of the aggregates revealed that the aggregate formation was surprisingly consistent and reproducible. The aggregates showed a surprising homogeneity (Figure 10A and 10B). In particular, analysis showed that the aggregates have a maximum Feret diameter of 156 ± 64 pm (Figure 11A), a minimum Feret diameter of 85 ± 31 pm (Figure 11A) and a perimeter of 383 ±111 pm (Figure 11B; figures reported as ± 1 SD). The circularity of the aggregates is 0.70 ± 0.1 (Figure 11D) and the roundness was 0.84 ± 0.034 (Figure 11C). The aggregates also had a solidity of 0.92 ± 0.04 (Figure 11E). The small standard deviation in Figures 11A-11 E indicates very little variation occurred between aggregates and that the culture method results in highly homogenous cultures of aggregates.

[0245] Counts of the number of cells per aggregate using the adherence method (6a) showed an average of 331 total cells per aggregate. Counts of living cells per aggregate using the adherence method gave an average of 288 cells per aggregate. Counts using confocal microscopy showed an estimate of 238 cells per aggregate (Figure 12A and 12B).

[0246] As shown in Figure 13A, the viability of aggregates was optimal around 22-24°C for up to 48 hours. However, as shown in Figure 13A, the viability of aggregates was stable at 4-6 °C up to 24 hours, and then declined up to 48 hours. For aggregates stored at 40 °C, the viability dropped substantially at 8 hours, remained stable up until 24 hours, and then saw a further drop in viability at 48 hours. Figures 13B-D show the characteristics of the aggregates over time at different temperatures. As can be seen from Figure 13B, the average feret diameter was stable up to 48 hours at 22-24 °C and was reasonably stable for up to 24 hours at 40 °C, although there was a decrease in the average feret diameter at 40°C at 48 hours. Surprisingly, the range (i.e., variability) of feret diameters increased between 0 and 48 hours at 4-6 °C, and the average feret diameter increased at 24 and 48 hours after storage at 4-6 °C.

[0247] As shown in Figure 13C, the average perimeter of the aggregates remained consistent over 48 hours at 22-24 °C, and surprisingly at 40 °C. However, at 4-6 °C the perimeter showed a high degree of variability (evidenced by the range) at 24 and 48 hours. As shown in Figure 13D, the average roundness of the aggregates was stable for up to 6 hours at 22-24 °C. There was a slight increase in the variability of the aggregate roundness at 24 and 48 hours at 22-24 °C, however, the average roundness of aggregates was still acceptable. Similarly, the aggregates stored at 4-6 °C showed a similar average level of roundness at 6 hours, but by 24 and 48 hours at 4-6 °C, the aggregates had a decreased average roundness and increased variability in the roundness. At 40 °C, there was a decrease in the average roundness of aggregates at 6 hours, which continued to decrease up to 48 hours. The aggregates stored at 40 °C also showed increased variability between 0 to 48 hours.

[0248] These results show that the preferred temperature for storing aggregates is surprisingly at 22-24 °C, but that the aggregates are suitable for experiments under hypothermic (e.g., 4-6 °C) or fever (e.g., 40 °C) conditions for up to 24 hours before loss of cell viability or substantial changes to the aggregate morphology. These results also show that aggregates should ideally be used within 6 hours of formation.

[0249] Immunofluorescence analysis of aggregates showed that the cells in the aggregates retain their mesenchymal stem cell like properties, as the cells were shown to express CD73, CD90 and CD105 (Figures 14A-C). Surprisingly, whilst monolayer cultures of MSCs show Ki67 staining (Figure 14D), MSCs in aggregates did not show Ki67 staining (Figure 14E), and therefore are not proliferating. This has the advantage that aggregates may be used therapeutically without concerns over tumour-like properties. Similarly, MSCs in aggregates were not positive for Oct- 3 / 4, Nanog or SOX2 (Figures 14F-J).

[0250] Figure 15 shows that the MSCs in the aggregates retain their differentiation potential and are able to differentiate into chondrocytes, adipocytes and osteocytes.

[0251] No significant differences were observed between baseline glucose consumption and aggregates, suggesting that proportionally, aggregates consume less glucose than their 2D counterpart (Figure 16).

[0252] Example 3: Subacute toxicology in mouse model by local administration in the brain.

[0253] Methods

[0254] This study was conducted in adult male mice of the C57BI / 6 strain. The animals were kept in 12- hour light / dark cycles with free access to their feed. The animals were anesthetized and inoculated by stereotactic injection, with 8 pg of 6 hydroxydopamine (6-OHDA) in the striatum of both hemispheres and 7 days later the striatum of one hemisphere was treated with 75 aggregates suspended in 2 pL of saline or an equivalent dose of ad-hMSC (dissociated cells) (Figure 17A). The animals were monitored daily following the protocol established by Morton & Griffiths (1985. Guidelines on the recognition of pain, distress and discomfort in experimental animals and an hypothesis for assessment. Vet Rec., 116(16): 431-436) in the post-operative period and every 48 hours their body weight was recorded (Figure 17A). At 28 days the animals were sacrificed and tissues of control organs (heart, lung, liver, kidney and spleen) were analyzed to evaluate possible side effects of cell treatment.

[0255] Results

[0256] The results reveal that the administration of the aggregates and the disaggregated ad-hMSC (ad- hMSC 2D) was safe for animals as treated animals did not show abnormal patterns of weight (Figure 17B), behaviour (data not shown) or at histology (data not shown), with respect to the control.

[0257] Example 4. Subacute toxicology in rat model by local administration in the knee.

[0258] Methods

[0259] Adult male Sprague Dawley rats were kept in 12-hour light / dark cycles with free access to feed. The animals were anesthetized and inoculated by local injection of 1 mg of monoiodoacetate (MIA) into each knee (Figure 18A). 14 days later one knee was treated with a dose of 750 or 3000 aggregates suspended in 50 pL of PBS, and the other knee treated with the same volume of saline (Figure 18A). The animals were monitored daily following the protocol established by Morton and Griffiths, 1985 in the post-operative period and their body weight recorded every 7 days (Figure 18A). At 35 days the animals were sacrificed and tissues of control organs (heart, lung, liver, kidney and spleen) were analyzed to evaluate possible side effects of cell treatment (Figure 18A).

[0260] Results

[0261] No adverse effects were observed following bilateral administration of MIA and subsequent injection of aggregates into one of the joints with respect to weight (Figure 18B) or blood glucose levels (data not shown).

[0262] Example 5. Acute and subacute toxicology in mouse model by systemic administration.

[0263] Methods This study was conducted in adult male mice of the C57BI / 6 strain. The animals were kept in 12- hour light / dark cycles with free access to their feed. The animals were divided into four groups of 6 individuals each (24 animals in total) and administered intravenously, in the caudal vein of the tail, 100 pL of one of the following treatments:

[0264] Group 1: Krebs-Ringer (n=6)

[0265] Group 2: 300 aggregates in Krebs-Ringer solution (n=6)

[0266] Group 3: 1500 aggregates in Krebs-Ringer solution (n=6)

[0267] Group 4: 3000 aggregates in Krebs-Ringer solution (n=6)

[0268] After injection, toxicity and tolerability was assessed acutely for 24 hours and sub-acutely for 14 and 28 days (Figure 19A).

[0269] For the assessment of acute toxicity, lethality and animal welfare were assessed during the first 24 hours. For this, all animals in each group were continuously monitored for the first 2 hours by trained personnel and then every 6 hours up to 24 hours.

[0270] For the evaluation of subacute toxicity, animal welfare was evaluated by monitoring individuals 2 times a day by trained personnel up to 14 and 28 days.

[0271] For the evaluation of animal welfare, the following parameters were considered:

[0272] Physical parameters: it was evaluated if there was nasal discharge, eye discharge, hunched posture, piloerection, hyperventilation, tremors, spasms, inconsistency of stool, rectal bleeding, lack of mobility;

[0273] Psychological parameters: it was evaluated if there was isolation and segregation of the rest of the animals in the box, passive behavior, loss of grooming, erratic or unstable displacement, changes in behavior such as violent reaction or vocalizations; and

[0274] Body weight: the weight of each animal was measured three times a week and it was expected that there was no reduction in body weight compared to the initial day. A reduction of more than 10% of the weight within 24 hours or 20% during the duration of the study was considered an ethical exclusion criterion and euthanasia was to be applied to any animals exhibiting this criterion. Depending on the severity of the parameters, veterinary interventions were to be applied, such as the application of analgesic, or in the case of being very severe, euthanasia.

[0275] 14 days after the start of the treatments, 3 animals per group were used to perform a histological analysis (hematoxylin and eosin) on paraffin-embedded, formalin-fixed samples of the liver, heart, kidney, spleen and lung (Figure 19A). At 28 days this procedure was repeated for the remaining animals (Figure 19A).

[0276] Results

[0277] Acute

[0278] All the animals in the Control groups, group 1 (300 aggregates) and group 2 (1500 aggregates) presented normal behaviours without any alteration in the physical or psychological parameters. It was concluded that there was no lethality or acute toxicological effects in these three groups.

[0279] On the contrary, 5 of the 6 animals of group 3 (3000 aggregates) presented loss of locomotor stability and hyperventilation after 5 minutes of the injection of the aggregates. Within 15 minutes, 4 of these 5 animals died whilst 1 of these 5 animals remained unstable with hyperventilation and poor mobility during the first hour and after this began to recover gradually. After 2 hours of the injection, this animal recovered, showing normal behaviour, similar to the animals of the other 3 study groups. Only 1 of the 6 animals of group 3 did not show any observable clinical alteration.

[0280] Subacute toxicology (days 1-24)

[0281] All animals evaluated at this stage presented normal behaviour without evidence of presenting any clinical sign mentioned in the previous point, both in physical and psychological parameters. This indicates that in the sub-acute stage, treatments for groups 1 and 2 were well tolerated. The animal welfare of the two remaining mice of group 3 were evaluated with special attention, since there were evident physical difficulties in the acute stage. However, in the sub-acute stage these animals showed no clinical signs and showed normal behaviour throughout this stage indicating that, in the sub-acute stage, treatment was well tolerated for group 3.

[0282] Up to 14 or 28 days after treatment, the body weight was measured of each mouse 3 times a week. None of the study groups experienced weight loss during the study, indicating that the systemic treatment of aggregates was well tolerated (Figure 19B).

[0283] Histological analysis revealed that all of the study groups presented normotypic livers and hepatic structures 14 and 28 days after treatment. In particular, it was noted that there was uniform morphology of hepatocytes and conserved size of the portal vein and blood vessels. No morphological signs of fibrosis, steatosis, lipid deposits or inflammation were observed. In addition, no neoplastic cells were observed (results not shown).

[0284] Histological analysis revealed that all of the study groups presented normotypic heart tissue 14 and 28 days after treatment. In particular, it was noted that there was normal ventricular space and heart muscle, and that there were no morphological signs of fibrosis, inflammation or atrophy. In addition, no neoplastic cells were observed (results not shown).

[0285] Histological analysis revealed that all of the study groups presented normal renal tissue 14 and 28 days after treatment. In particular, it was noted that there was normal renal parenchyma, cortex and medulla, and normal proximal and distal convoluted tubules and glomerular structure. No pathological signs of kidney damage were observed, and there were no morphological signs of fibrosis, inflammation or infiltration. In addition, no neoplastic cells were observed (results not shown).

[0286] Histological analysis revealed that all of the study groups presented normal spleen tissue 14 and 28 days after treatment. In particular, the stroma, capsule and lymphoid follicles were observed without alterations. In addition, no neoplastic cells were observed (results not shown).

[0287] Histological analysis revealed that all animals in the control group showed unchanged, normotypic lung tissue 14 and 28 days after treatment, as expected (Figure 19D). However, in groups 1 and 2, 14 and 28 days after treatment, and in the two remaining animals of group 3 at 28 days after treatment, there were focal lymphoid aggregates in the peribronchial and perivascular zone, indicating a focal inflammatory reaction (Figures 19C and 19D). These lymphoid aggregates corresponded to less than 5% of the total lung area in all cases. Outside of these focal aggregates, the pulmonary parenchyma was preserved, showing normal bronchial and vascular tissue (Figures 19C and 19D).

[0288] The lymphoid aggregates observed on day 14 were more prominent and in greater numbers than those found on day 28. At day 14, no multinucleated cells were observed in the lymphoid aggregates. At day 28 mononucleated cells of histiocytic lineage were observed in some lymphoid aggregates (results not shown).

[0289] Example 6: Muscle regeneration in a model of severe muscle damage with frostbite.

[0290] Methods Male Balb / C mice of 6 to 8 weeks of age were obtained from the Faculty of Medicine of the University of Chile, according to the protocols approved by the bioethics committee of the same institution. The animals were anesthetized by intraperitoneal injection of a mixture of ketamine (100 mg / kg) and xylacin (10 mg / kg). The right gastrocnemius muscle was exposed by a small incision in the skin which had been previously shaved. To generate the freeze lesion, a pallet of surgical material 1 cm long and 0.5 cm wide, previously cooled in liquid nitrogen for 10 seconds, was applied to the exposed muscle for 15 seconds without pressing. This procedure was repeated 3 times. An incision was then sutured with Safil ® 4 / 0 absorbable suture thread. 24 hours after injury, 4500 aggregates suspended in saline, or a saline control, were injected local to the lesion site. The magnitude of the injury was assessed at 7 and 14 days post-injury by H&E staining of the injured muscles (n = 4 per observation group). To do this, the right and left gastrocnemius muscles were dissected and immediately frozen in liquid nitrogen-cooled isopentane. Cross sections 12 pm thick were cut on a Leica CM1510 S Cryostat. Sections were stained with Harris Hematoxylin and Eosin (H&E) and with Van Gieson staining according to standard histology protocols. The sections were visualized with a bright field microscope with 4x magnification, scanning the complete area of at least 3 different sections per muscle and 20x magnification of at least 10 representative areas of the muscle. Images were captured and processed with Imaged software. The necrotic / fibrotic area of the entire muscle area was quantified using the H&E “colour deconvolution” extension, which allows the staining components to be separated. The total area of the tissue was determined with the original image, while the area of the healthy tissue was determined by means of the automatic signal threshold (threshold) measured on the eosin component after applying the Imaged “colour deconvolution” tool. In this way, the total necrotic / fibrotic area ((total area - healthy area) I in the total area) was obtained. The same calculation was used to determine fibrotic area (van Putten et al., 2010. A 3 months mild functional test regime does not affect disease parameters in young mdx mice. Neuromuscul Disord., 20(4): 273-280). The determination of the distribution of the sectional area of the fibers was carried out by measuring the diameter of 15,000 fibers per animal, coming from three cuts at different positions of the anterior-posterior axis of the muscle, stained with H&E as described above.

[0291] Results

[0292] Muscles from animals treated with aggregates or control saline were analyzed 7 and 14 days after injury. At 7 days post-injury, no significant differences were observed between the group injected with aggregates and the control group. Both groups had an area of necrosis close to 20%. At 14 days post-injury the muscles of the animals injected with aggregates showed a significant decrease in the necrotic area compared to the control injected with saline (Figure 20). At this time point, the muscles injected with saline had an average necrotic area of 10.28 % ± 0.86, whilst the muscles injected with aggregates had an average necrotic area of 7.42 % ± 0.94.

[0293] In addition, 14 days post-injury, the fibrotic area of the muscle in the control group was 15.16 % ± 1.63, whilst the muscles injected with aggregates had a fibrotic area of 18.23 % ± 2.57. This difference was not statistically significant.

[0294] In a further example, male Balb / C mice of 6 to 8 weeks of age are anesthetized by intraperitoneal injection of a mixture of ketamine (100 mg / kg) and xylacin (10 mg / kg). The right gastrocnemius muscle is exposed by a small incision in the skin which is shaved and a freeze lesion generated and sutured as described above. The animals are monitored and analyzed as described above. 24 hours after injury, 4500 control aggregates suspended in saline, or a saline control, are injected local to the lesion site. It is expected that there is an increased necrotic area for animals treated with control aggregates compared to the animals treated with aggregates of the present invention.

[0295] Example 7: Cartilage regeneration in a model of joint damage by MIA injection.

[0296] Methods

[0297] For assembly of the animal model, see Example 4. To evaluate the efficacy of treatment, a qualitative score for histological analysis was established as follows (see Figure 21A):

[0298] 0 (normal): normal tissue morphology;

[0299] 1 (mild chondral damage): loss of cartilage matrix staining (safranin-0 staining);

[0300] - 2 (medium chondral damage): loss of surface architecture; and

[0301] 3 (Severe chondral damage): loss of surface architecture and safranin-0 staining and subchondral damage also present.

[0302] Results

[0303] Analysis of the results reveals that treatment for 3 weeks with a dose of 3000 aggregates resulted in a regenerative effect from chondral damage, compared to a control with saline (Figure 21 B). These results show a significant therapeutic effect on the treated knees of the animals compared to the control. The post-treatment animals were sacrificed and a hematological study was carried out that evidenced tissue regeneration in the affected area (data not shown). In a further example, adult, male Sprague Dawley rats are anesthetized and inoculated by local injection of 1 mg of MIA into each knee as in Example 4. 14 days later one knee is treated with a dose of 750 or 3000 control aggregates suspended in 50 pL of PBS, and the other knee treated with the same volume of saline. The animals were monitored and analyzed as described in Example 4. It is expected that there is an increased loss of chondral damage for animals treated with control aggregates compared to the animals treated with aggregates of the present invention.

[0304] Example 8. Neuroprotection in a model of nerve tissue damage by injection of 6-OHDA.

[0305] Methods

[0306] For assembly of the animal model, see Example 3. 3, 7, 14 and 21 days after administration of the aggregates or monolayer MSCs (control), animals were euthanized by aortic perfusion and immunohistochemical analysis performed. For the immunohistochemical analysis, the brains were post-fixed in 4 % paraformaldehyde (PFA) for 12 hours at 4 °C and dehydrated in sucrose at 30% with 0.02% azide sodium for 48 hours at 4 °C. Histopathological analysis was then performed using antibodies against human stage-specific embryonic antigen-3 (SSEA3; a marker specific for stem cells) or tyrosine hydroxylase (TH).

[0307] Results

[0308] Histological slices show positive zones for hSSEA3 in the striatum and cerebral cortex 3, 7, 14 and 21 days after injection (Figure 22A). This indicates that the aggregates are able to survive in the transplanted tissue until at least 3 weeks after treatment.

[0309] 3 weeks after administration of aggregates or dissociated aggregates (MSC-2D) in animals previously treated with 6-OHDA, the brain tissue was processed for immunohistochemistry and regions corresponding to the striatum zone (CPu) were marked against Tyrosine Hydroxylase (TH), used as a marker of dopaminergic innervation of the circuit from Substance Nigra compacta pars (SNpc). The neurotoxin 6-OHDA induced a strong loss of dopaminergic innervation in the striatum zone in the control hemisphere. However, in the hemisphere treated with aggregates or dissociated aggregates (MSC-2D), significant prevention in the loss of immunoreactive neurons against TH was observed (Figures 22B and 22C).

[0310] In histological sections corresponding to the area of the SNpc marked against TH, it was observed that aggregates exert a protective effect against the loss of dopaminergic neurons (positive TH staining; see Figures 22D and 22E). The effect of disaggregated hMSCs was similar to the PBS control Figures 22D and 22E, indicating that there may be an enhanced protective benefit when administering the cells in aggregate form.

[0311] In another example, adult male mice of the C57BI / 6 strain are anaesthetized and inoculated by stereotactic injection with 8 pg of 6 hydroxydopamine (6-OHDA) in the striatum of both hemispheres and 7 days later one hemisphere is treated with 75 control aggregates suspended in 2 pL of saline in the same area of damage. The other hemisphere is untreated. The animals are monitored and analyzed as described in Example 3. It is expected that there is an increased loss of TH positive neurons for animals treated with the control aggregates compared to the animals treated with aggregates of the present invention.

[0312] Example 9. Obtaining conditioned medium: initial experiment.

[0313] Methods

[0314] Aggregates were prepared as in Example 2 using MSCs (passage 3). 125 mL Techne™ bottles were treated for 12 hours with Sigmacote (Sigma-Aldrich) to prevent adhesion of the aggregates to the walls of the container. In order to obtain conditioned medium, 150 aggregates / ml were then added to 40 mL aMEM culture medium (10% of fetal bovine serum (FBS, ‘S2’), 500 mg / mL bovine serum albumin (BSA) and 1 % penicillin / streptomycin) in the coated Techne™ bottles and incubated at 37 °C, 21 % O2, 5 % CO2 and 90 % humidity with agitation at 80 rpm. After 24 (T1), 48 (T2), and 72 (T3) hours, aliquots of 200 pl were taken from the bottles and added to aMEM with platelet lysate (‘ST) 10% and 1 % pen / strep in a 96 well plate (flat bottomed) for observation. For comparison aggregates were plated in static culture in Techne™ bottles with no-agitation .

[0315] Results

[0316] Direct observation of the sample derived from the Techne™ flask cultures showed that at 24 (T 1) hours, the aggregates began to disintegrate, independent of the agitation speed and the culture volume. Less compaction of the aggregates and irregular edges and the presence of isolated cells in suspension were observed (Figure 23). At 48 (T2) hours no aggregates were observed, and it was only possible to observe isolated cells in suspension (data not shown).

[0317] Based on these results, we increased the number of aggregates per mL for priming to add observation of the samples being taken. In addition, as aggregates began to dissociate already at 24 (T1) hours it is essential to increase their stability. We therefore tested several conditions that could improve the stability of aggregates before and during priming including: 1) Number of aggregates (as used herein ‘D1’ =150, ‘D2’ = 375 and ‘D3’ = 1130 aggregates / mL);

[0318] 2) Culture medium (as used herein ‘MT = a Minimum Essential Medium (aMEM, Gibco, Thermo Fisher) and ‘M2’ = StemPro™ Serum Free Xeno Free medium (Gibco, Thermo Fisher);

[0319] 3) Need for supplementation of nutrients and growth factors (as used herein ‘ST = human platelet lysate,), ‘S2’ = fetal bovine serum (FBS, Biological Industries), ‘S3’ = StemPro™ serum free, xeno free supplement kit (Gibco, Thermo Fisher)and ‘S4’ =GlutaMAX™ (Thermo Fisher) at 1%, 10% and 5%);

[0320] 4) Stabilizers (as used herein ‘E1’ = high molecular weight poly-L-lysine (mol wt 150,000- 300,000 Da, 0.01 %, sterile-filtered, Merck, P8920), ‘E2’ = low-molecular weight poly-L- lysine (mol wt 30,000- 70,000 Da, 0.01 %, sterile-filtered, Merck #P4707) and ‘E3’ = alginate);

[0321] 5) Stabilizer concentration (as used herein ‘CT = 1 pg / ml, ‘C2’ = 2 pg / ml, ‘C3’ = 4 pg / ml, ‘C4’ = 8 pg / ml, ‘C5’ = 12 pg / ml, ‘C6’ = 0.1% and ‘C7’ = 0.05%);

[0322] 6) Stirring speed (as used herein ‘VT = 30 rpm, ‘V2’ = 50 rpm, and ‘V37’V4’ = 80 rpm);

[0323] 7) Culture time (as used herein ‘TO’ = 0 hours, ‘T1’ = 24 hours, ‘T2’ = 48 hours, ‘T3’ = 72 hours, ‘T4’ = 96 hours);

[0324] 8) Oxygen level (as used herein Hypoxia 1 (3% O2), Hypoxia 2 (1% O2), Normoxia (21% O2).

[0325] Example 10. Effect of stabilising polymer on the structure of aggregates cultured under static conditions.

[0326] Methods

[0327] Aggregates were produced as described in Example 2. D2 cells / ml were added to low-adhesion 24-well plates (Costar® Ultra-low attachment surface, CLS3473, Corning) and incubated at 37 °C, 5 % CO2 and 90 % humidity without agitation for T4 hours with either: 1) M1 medium with S1 Z %, and 1 % of pen / strep 2) M2 serum free medium with 1 % pen strep and supplement S3 at 1%, 3) M2 serum free medium with 1 % pen strep without supplement S3. Control groups were treated with media only for conditions for 1) to 3). In addition, two polymers were also evaluated: E1 and E3. Three concentrations of E1 , C2, C3 and C4 pg / mL, and two concentrations of E3, C6 and C7% with condition 1). Additionally, the E1 stabilizer at C3 concentration was tested in conditions 2) and 3). The cultures were observed directly under phase contrast microscope every T1 hour for T4 hours.

[0328] Results

[0329] Aggregates grown in M1 medium (condition 1) from T1 hours onwards failed to preserve their structure in terms of size, number and morphology (e.g., aggregate density and regularity of the aggregate edges) by comparison to the zero time, regardless of whether E1 or E3 was added to the culture (Figure 24A). Moreover, over time the aggregates grown with M1 medium (condition 1) clumped together to generate irregular, large aggregates, and this was observed within 24 hours. In contrast, the M2 medium supplemented with C3 pg / ml of E1 showed better preservation both in the cultures supplemented with S3 (M2 +S3) and in those without supplementation M2 (M2 S3(-)), and better preservation compared to M2 medium without E1 (control). (24B). In particular, the aggregates maintained a more homogeneous diameter throughout the entire culture time, remained as individual aggregates and did not generate large, dense multiaggregates.

[0330] Example 11. Evaluation of different concentrations of E1 to preserve the structure of the aggregates under static culture conditions in serum-free medium.

[0331] Given the results of Example 10, we tested different concentrations of stabilizer E1 in M2 medium. In addition, as it is known that supplement S4 improved the growth rate of MSCs, we also tested the concentrations of E1 in M2 medium with or without S4 at X%.

[0332] Methods

[0333] Production of

[0334] Aggregates were produced as in Example 2. Then, D2 cells / ml were incubated in a low-adhesion 24 well plate at 37 °C, 5 % CO2, without agitation with M2 medium (1% pen / strep and X% of S4) with or without S3 supplement. Three concentrations of E1 were tested: 03, C4 and 05 pg / ml.

[0335] The cultures were observed directly under a phase contrast microscope every T 1 hour for a total of T4.

[0336] Analysis of aggregates After T4 hours, samples were taken from the culture and isolated cells from each culture were recovered, centrifuged at 1 ,500 rpm for 5 minutes. The supernatant stored at -20 °C for further analysis, and 100 pl of TrypLE Select (Gibco) was added to the cells for 3 minutes at 37 °C. Subsequently, the dissociated cells were seeded 03 ponto re-adherent 96-well plates with flat bottomed wells with 200 pl final volume of medium M1 with S1 Z% and cultures for 24 hours to evaluate the ability of the cells to re-adhere to plastic in 2D culture (a known method of evaluating cell viability).

[0337] The supernatant after T4 hours, obtained as described in the preceding paragraph, was then analysed for key metabolites (glucose, lactate and ammonium). The quantification was carried out by means of a Biochemical Analyzer Y15 (Biosystem, Spain) in the Laboratory of Animal Cell Culture, EIB-PUCV (LCCA). The measurement of each metabolite was carried out by means of a specific kit from Biosystem following the instructions of the manufacturer (D-glucose / D-fructose #12800, L-lactic acid #12802, ammonium #12809).

[0338] Results

[0339] In this activity, the effect of E1 on the stability of the spheroids in a static culture and serum-free M2 medium with and without S3 supplement was evaluated. When compared with the control condition, it was clear that E1 has a positive effect on the preservation of three-dimensional structures during the first T2 hours of culture, in all the concentrations evaluated and both in the supplemented media (M2 + S3, Figure 25B) and in those without supplementation (M2 S3 (-), Figure 25A). Particularly, a considerable improvement is observed with respect to M2 medium without S3 supplement (Figure 25A) compared to M2 medium with S3 supplement (Figure 25B).

[0340] However, from T3 hours two phenomena occur: a part of the spheroids began to disaggregate, thereby causing the aggregates to reduce their diameter and solidity; and, some of the aggregates that remained in the culture agglomerate into larger groups around an extracellular component (Figures 25A and 25B), both in the cultures with and without S3. However, the spheroids that were maintained with E1 at concentrations C4 and C5 still presented a homogeneous appearance with defined edges and were found individually (not agglomerated). Readherance analysis showed that cells derived from the control cultures, and aggregates treated with M2 with E1 (supplemented and not supplemented with S3), were found to be spherical in shape and found in suspension.

[0341] The addition of the S4 supplement had no effect on the morphology of the spheroids or on the re-adhesion of the cells (data not shown). Figure 25C shows the results of the metabolite analysis. The average glucose concentration in the supernatant of MSC aggregates cultured with M2 culture alone was 5.5 mM. The results in Figure 25C shows that there was no significant change in glucose consumption when aggregates were cultured with S3 supplementation or varying concentrations of stabiliser. This indicates that the cells are in an inactive metabolic state. Therefore, we tested the effect of E1 in culture under dynamic conditions (i.e. , agitation).

[0342] Example 12. Evaluation of E1 and E2 on the maintenance of aggregate structure under dynamic culture conditions.

[0343] Methods

[0344] Production of aggregates

[0345] Aggregates were cultured using the methods outlined in Example 2. To evaluate the effect of E1 and E2 on the stability of aggregates in dynamic culture, aggregates were cultured on an orbital shaker (LSE Low Speed Orbital Shaker, Corning). Our analysis of culturing aggregates on an orbital shaker showed that V3 rpm was the optimal stirring speed to allow the aggregates to remain in suspension and be homogenously mixed (data not shown). Therefore, D2 cells / mL were suspended in 5 mL M2 medium with 1 % pen / strep and X% of S4 and with stabilizer E1 at C1 , C2, C3 and C4 pg / mL, or stabilizer E2 at C1 and C2 pg / mL for T4 hours at 37 °C, 90 % humidity, and 5 % CO2 in 25 mL glass flasks previously coated with Sigmacote ( Sigma-Aldrich) on an orbital shaker at V3 rpm.

[0346] Analysis of aggregates

[0347] Aliquots of 500 pL were taken every T 1 hours for imaging and adherence analysis. 200 pL of each sample was deposited in a 96-well, flat bottomed plate for as described in Example 11. The supernatant was then recovered from the wells after imaging and centrifuged with the remaining 300 pL sample at 1 ,500 rpm for 5 minutes. The supernatant was stored at -20 °C for measurement of metabolites as described in Example 11. Lactate dehydrogenase was measured as described for metabolites in Example 11 , except kit #12580 was used.

[0348] Results

[0349] Effects of E1

[0350] Figures 26A and 26B show the effect of culturing aggregates in a dynamic culture system.

[0351] Figures 26A and 26B show aggregates that used different donor ad-hMSCs. As can be seen from Figures 26A and 26B, the donor ad-hMSCs did not have an effect on the culture. In addition, Figure 26A and 26B show that aggregates cultured in a dynamic system when agitated at V3 rpm maintained their three-dimensional structure compared to 0 (‘TO’).

[0352] Evaluation of E1 stabiliser showed that aggregates cultivated with M2 medium without S3 supplement and without E1 stabiliser (M2 S3(-) E1 (-)) clustered to form larger, irregular aggregates that were evident to the naked eye (Figures 26A and 26B). As shown in Figures 26A and 26B, stabilizer E1 appeared to have a positive effect on the stability of the aggregates at all tested concentrations (C1 , C2, C3 and C4 pg / mL), and allowed the aggregates to remain individual, with a homogeneous diameter and homogenous degree of sphericity similar to TO.

[0353] However, the re-adherence analysis showed that after 24 hours, the cells derived from E1 treated cultures were similar to controls and did not readhere to the surface of a culture dish (Figures 26C and 26D). The control culture of Figure 26D did show a large aggregate visible by the eye, but this became stuck in the pipette at the time of taking the sample at T1 hours (see Figure 26E). However, for all conditions tested, many cells remained suspended and spherical, which is a feature of non-viable cells, indicating that many of the cells treated with E1 , regardless of concentration, were not viable.

[0354] Analysis of metabolites showed increased metabolic activity in the aggregates under the control condition, which was reflected by a higher total glucose consumption and lactate production compared to aggregates grown in the presence of E1 (see Figure 26F). Ammonium, after T4 hours, reaches a similar concentration for E1 to C1 and C2 pg / ml, and tended to increase for C3 and C4 pg / ml (C3: 2.3 mM; C4: 2.3 mM). In addition, in cultures with E1 at C1 pg / ml and the corresponding control, LDH activity remained constant until T3 hours, but then doubled in the final time (T4). Supernatants generated by cells of the condition E1 C2 pg / ml had a higher LDH activity after T3 hours, increasing by 100% with respect to TO. In cultures with E1 C3 and C4 pg / ml, LDH activity remained constant throughout the culture, although the amount of LDH activity was higher than under the other conditions (see Figure 26F). Therefore, analysis of the metabolites indicated that E1 did not have a cytotoxic effect on the cells as the cells still appeared to secrete active LDH. However, the lack of relevant metabolic activity could affect the quality of MSCs in the aggregates.

[0355] We therefore assessed a stabiliser with a lower degree of polymerization than E1 ; herein referred to as E2.

[0356] Effect of E2 Aggregates grown under control conditions (M2 medium S3(-) E2(-)) maintained their three- dimensional structure, but they were not preserved as individual aggregates and instead generated large clusters of irregular aggregates (Figure 27A).

[0357] The stabilizer E2 at C1 pg / mL shows an effect on the stability of three-dimensional structures during the first T1 hours (Figure 27A). However, from T2, the aggregates began to lose their shape and group into larger aggregates (Figure 27A). The aggregates then presented morphology and size very similar to those of the control group (measurement data not shown), indicating that this concentration of E2 was not sufficient to preserve the structure of aggregates for more than T1 hours. The stabilizer E2 at C2 pg / mL had a positive effect on the stability of three-dimensional structures throughout the culture (TO to T4 hours) (Figure 27A). The aggregates maintained a very similar size to those of the initial conditions (TO) and maintained individual aggregates with high density (Figure 27A).

[0358] Cells were analysed using the adhesion assay outlined above. Cells dissociated from the aggregates at T1, T2, T3 and T4 hours for all treatment groups attached to the well (see Figure 27B), i.e., control, E2 C1 and C2 pg / ml. Additionally, the re-adhered cells remained attached for a number of days.

[0359] Metabolite analysis showed that cells were metabolically active under all conditions, which was reflected by glucose consumption and the production of waste metabolites, such as lactate and ammonium (Figure 27C).

[0360] In all conditions, the cells had a rate of production of lactate of 2 to 2.8 pmol of lactate / pmol of glucose (see Table 2) which is consistent with previously reported values in the literature for MSCs in 3D cultivation. From T2 hours, the concentration of ammonium doubled for all conditions, and then decreased up to T4 hours. There was an increase in LDH activity over time in all conditions, which stabilized between T2 and T3 hours, and then decreased at T4 hours. This decrease in LDH activity would be expected to lead to a decrease in the number of viable cells, which may reflect accumulation of waste metabolites. Table 2. Glucose consumption and lactate production of MSC aggregates under different culture conditions (n=3)

[0361] Discussion

[0362] The cells obtained from control cultures (i.e., M2 medium without stabiliser) satisfactorily recovered their ability to re-adhere to the a plastic surface and presented expected metabolic activity, reflected by the consumption of glucose and the production of waste metabolites, suggesting that the cells were not only viable but metabolically active. However, glucose consumption and lactate production showed that aggregates cultured with E1 at different concentrations (C1 , 02, 03 and 04 pg / ml) were surprisingly not viable and not metabolically active. Indeed, the glucose consumption of aggregates cultured with E1 remained virtually unchanged until T4 hours of culture, as did the lactate production. This phenomenon, however, did not appear to be associated with an increase in cell death according to LDH activity values. This suggests that cells of aggregates cultured in the presence of E1 could be in a quiescent state, which would not favor the secretion of factors. In contrast, aggregates of cultured with E2 showed improved stability of the 3D aggregate structure and exhibited similar viability and metabolic activity (assessed through the adhesion and metabolite analysis assays, respectively) as the control. In fact, for aggregates cultured with E2 01 pg / mL had preserved aggregate shape for T1 hours but showed increased glucose consumption and lactate production compared to control aggregates, suggesting that these cells have a surprisingly improved viability and metabolic activity. In contrast, aggregates cultured with E2 02 pg / mL provided favourable conditions for the preservation of structures in culture up to T4 hours, and cells surprisingly had a metabolic activity comparable to that of cells previously produced using conventional 2D culture.

[0363] Example 13. Priming of aggregates in a bioreactor. Methods

[0364] Production of aggregates

[0365] Aggregates were produced as described in Example 2 using ad-hMSCs from at least four different donors (referred to herein as Sp1-Sp3 and Sp5). The aggregates were then cultured at D2 cells / mL for T4 hours at 37 °C and 5 % CO2 in 30 mL of M2 medium (with 1% pen / strep and X% of S4) with and without stabilizer E2 at C2 pg / mL in 125 mL Techne™ bottles (bioreactor system) that had been previously coated with Sigmacote (Sigma-Aldrich) maintained on a rotating, magnetic stirring platform. Various speeds of agitation were tested, and a speed of V4 rpm found to be the minimum speed to ensure homogenous mixing.

[0366] Analysis of aggregates

[0367] Aliguots of 1 ,500 pL were taken every T1 hour for morphological analysis of the structures and subseguent metabolite analysis of the supernatant. To do this, 500 pL of each sample obtained was deposited in a well of an re-adherent flat-bottomed 24-well plate for imaging. Photographs were taken with a Canon Eos Rebel T5i digital camera (Canon, Japan) set on the microscope using a Canon SLR / DSLR adapter (CA-CAN-SLR, AmScope) and a 4X lens. Image analysis and processing was performed with Fiji (Imaged), using at least 3 photographs per sample. The samples used were then recovered from the plate and centrifuged together with the remaining 1000 pL of sample at 1 ,500 rpm for 5 minutes. The total supernatant was filtered through a 0.22 pm filter and stored at -20 °C for metabolite analysis as described in Examples 11 and 12. Cells from the cell pellet were plated onto re-adherent, flat- bottomed, 96-well plates with 200 pL M1 medium with Z% of S1 for 24 hours for re-adherence analysis.

[0368] Results

[0369] Figure 28A shows that under similar conditions as Example 12, with the exception of a larger volume of medium in a bioreactor, C2 pg / mL of stabilizer E2 had the same positive effect on the stability of the aggregates up to T4 hours. This was confirmed by morphological measurements as shown in Table 3.

[0370] Table 3. Morphological parameters of aggregates at the end of culture in the bioreactor (T4 hours). Data are presented as mean ± error (SD).

[0371] The adhesion analysis revealed that MSCs derived from the Sp1, Sp2, Sp3 and Sp5 aggregate bioreactor cultures showed re-adhesion capacity (Figure 28B). In particular, the Sp1, Sp3 and Sp5 cultures presented the highest proportion of re-adhered cells.

[0372] Metabolite analysis was then performed (see Figures 28C to 28E). Data is not shown for Figure Sp1 as not control was tested. As evidenced in the figures, the cultures showed similar glucose consumption, ammonium production and LDH activity over time as the control, indicating that there is no significant impact of use of the stabiliser on metabolic activity of the aggregates.

[0373] Example 14. Effect of hypoxia on aggregate priming.

[0374] Methods Production of aggregates

[0375] Aggregates were prepared as described in Example 2 using ad-hMSCs from at least three different donors. Aggregates were then cultured in 30 mL medium M1 (Mark M1) with Y% supplement S2 (Brand S2) at D2 cells / ml in 125 mL Techne™ bottles previously coated with Sigmacote (Sigma-Aldrich) on a magnetic stirring platform (Techne™) at V4 rpm. Aggregates were incubated for at least T3 hours at 37 °C, 5 % CO2 and with Hypoxia 1 , Hypoxia 2 or Normoxia levels of oxygen.

[0376] Sampling of aggregates Samples of 2,000 pL were taken every T1 hours, and the sample centrifuged at 1 ,500 rpm for 5 minutes. The supernatant (MC) was divided and stored in centrifuge tubes at -80 °C as follows: 1 ,000 pL for functional tests, 750 pL for ELISA and 250 pL for metabolite analysis as described in Examples 11 and 12. The cell pellet was resuspended in 500 pL of aMEM medium with 10% NuSerum.

[0377] Metabolite analysis

[0378] Metabolite analysis was performed as described in Examples 11 and 12.

[0379] Adhesion assay

[0380] As described in previous examples, to assess the re-adhesion capacity of the cells and observe the aggregates under a microscope, 50 pL of the cell pellet suspension was cultured for 24 hours on a flat-bottomed, 96-well re-adherent plate in 100 pl of medium (final volume) before analysis.

[0381] Morphological analysis

[0382] 50 pL of the cell pellet suspension was deposited on the lid of a 24-well plate to form a droplet for observation and photographic recording of the aggregates. Imaging was performed as described in Example 13.

[0383] RNA analysis

[0384] 400 pL of the cell suspension was centrifuged at 1 ,500 rpm for 5 minutes, the supernatant removed and the pellet resuspended in 350 pL of TRK lysis buffer (Omega Bio-tek) for extraction and purification of RNA using the commercial kit E.Z.N.A. ® Total RNA Kit I (Omega Biotek), following the manufacturer's instructions. The RNA was then quantified using a BioSpec-nano spectrophotometer (Shimadzu). Subsequently, 200 ng of the extracted RNA was used for synthesis of complementary DNA (cDNA) using the reverse transcriptase enzyme M-MuLV (New England BioLabs) following the manufacturer protocol.

[0385] For real-time polymerase chain reaction (PCR), the Master Mix Brilliant II SYBR Green QPCR (Agilent Technologies) was used with 2 pL cDNA in a final volume of 10 pL with 200 nM of each pair of primers listed in Table 4. The primers were designed using the PrimerQuest™ software (Integrated DNA Technologies, IDT). Real-time PCR was then performed in the Stratagene Mx3005P (Agilent Technologies), and expression normalized to obtain the relative expression with respect to the reference gene p2-microglobulin (B2M) using the method of2-AACt(Livak and Schmittgen, 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 25(4): 402-408).

[0386] Table 4. Primers for RT-PCR.

[0387] Analysis of secreted factors

[0388] The secretion of VEGF, TSG-6 and TGF-b1 in the stored MC samples was quantified using ELISA (RayBiotech) following the manufacturer protocol. All samples were measured in duplicate. In addition, the secretion of a panel of 14 analytes in the stored MC samples was quantified by means of multiplex ELISA Q-Plex™ (Quansys Biosciences) following the manufacturer protocol. In brief, each Q-Plex™ kit consists of a plate of 96 wells printed with different capture antibodies at specific points in each well, called nano spots. The process was completed by capturing the light produced by the addition of a chemiluminescent substrate through an imaging system . The pixel intensity values of the images were used to construct a standard curve and calculate the concentrations for each well. The panel of various analytes including IL-6, IL-8, TIMP-1 , TIMP-2 and VCAM. For the acquisition, reproduction and analysis of images, the Q-View system and program (Quansys Bioscience) were used.

[0389] Statistical analysis

[0390] The Anderson-Darling, D'Agosto & Pearson and Shapiro-Wilk normalization tests were applied. Subsequently, the Kruskal-Wallis non-parametric test was used for comparison of multiple medians and the Mann-Whitney test used for the comparison of medians between two groups. A value of p<0.05 was considered statistically significant. Box-plots (Tukey) were used to visualize the distribution of data between two or more groups. All statistical analysis was performed with Prism 9 (Version 9.3.1 , GraphPad Software).

[0391] Results Figures 29A to 29D show the aggregates cultured under Hypoxia 1 , Hypoxia 2 or Normoxia levels of oxygen. At TO the aggregates presented an average perimeter of 448.7 ± 116.3 pm and 139.4 ± 32.92 pm Feret diameter. Over T3 hours in normoxia culture, both the perimeter and Feret diameter of the aggregates decreased to 332.3 ± 109.8 pm and 110.7 ± 35.73 pm, respectively. Similarly, over T3 hours in hypoxia 1 culture, the perimeter and Feret diameter also decreased, although to a lesser extent than the aggregates cultured under normoxia. The perimeter at T3 hours for hypoxia 1 was 385.6 ± 142.6 pm and the Feret diameter was 129.3 ± 46.85 pm. However, under hypoxia 2 conditions, there was an increase in both the perimeter and Feret diameter of aggregates to 573 ± 298.8 pm and 186.3 ± 90.12 pm, respectively, due to the the aggregates clustering into larger, irregular aggregates. Despite this increase, in all times and conditions more than 90% of the spheroids had a Feret diameter less than 350 pm). After this diameter, aggregates began to show necrotic centres.

[0392] The culture was therefore repeated using the Hypoxia 2 conditions but for aggregates derived from ad-hMSCs from different donors. The results are shown in Figures 30A to 30D. At TO the aggregates presented an average perimeter of 471.1 ± 129.3 pm and 128.7 ± 33.04 pm Feret diameter. During normoxia culture, both the perimeter and Feret diameter decreased to 420.8 ± 200.8 pm and 110.4 ± 49.92 pm, respectively at T3 hours. During the culture in hypoxia 2, an increase in the perimeter was observed compared to TO, with the perimeter being 571.3 ± 356.0 pm at T3 hours. However, the Feret diameter decreased in the hypoxia 2 culture compared to TO, with the Feret diameter being 116.6 ± 55.25 pm at T3 hours. In all conditions over 90% of the aggregates had a Feret diameter that was less than 350 pm.

[0393] Figures 31 A and 31 B show the results of the re-adherence assay. The re-adherence assay shows that samples from all conditions were able to re-adhere to plastic after T2 and T3 hours of culture in the bioreactor.

[0394] Metabolic analysis (Figure 32) shows that aggregates cultured under Hypoxia 1 and Hypoxia 2 exhibited a larger decrease in the consumption of glucose (from 5.5 mM at TO to 1.165 mM for Hypoxia 1 and 0.334 mM for Hypoxia 2) compared to the culture to normoxia which reached 3.7 mM. This was consistent with an increase in lactate concentration compared to aggregates cultured under Normoxia conditions (average maximum lactate concentration of 3.74 mM) and an average maximum concentration of lactate of 8.77 mM in the culture under Hypoxia 2 and 7.06 mM under Hypoxia 1. Ammonium production did not show significant differences over time, regardless of condition (p>0.05). The maximum concentration of ammonium was 3.76 mM in culture under Normoxia, 3.345 mM under Hypoxia 1 and 3.79 mM under Hypoxia 2. LDH activity remained constant throughout the conditions (p>0.05). A minimum of 46, 37 and 57 [I U / L] was observed for culture under Normoxia, Hypoxia 1 and Hypoxia 2, respectively and a maximum of 72.5, 64.5 and 161.5 [I U / L] for culture under Normoxia, Hypoxia 1 , and Hypoxia 2, respectively.

[0395] To assess the secretion profile of aggregates from the bioreactor, the expression of different factors involved in pro-regenerative and immunomodulatory processes: COX-2, BMP2, FGF2, HGF, IL-6, TSG-6, was assessed using RT-PCR analysis and p2-microglobulin as a reference gene. The results of the RT-qPCR analysis are presented in Figure 33 and show increased expression of genes of interest under hypoxia conditions, compared to the condition control, also presenting differences according to the time of cultivation. The expression of FGF2 and COX-2 showed an increase to T2 in both cultures under hypoxia 1 and hypoxia 2 compared to the cultures under normoxia. The expression of BMP2, HGF and IL-6 increased considerably at T3, and in all cases, were greater under Hypoxia 2 than Hypoxia 1. FGF2 also increased 40-fold at T2 under Hypoxia 1 , compared to a 10-fold increase under Hypoxia 2. COX-2 increased 30-fold at T2 under Hypoxia 2, in contrast to a 4-fold increase under Hypoxia 1. For the case of BMP2, HGF and IL- 6 these increased 40, 15 and 8 times, respectively, at T3 under Hypoxia 2 compared to the control condition.

[0396] The quantification of factors secreted by the aggregates was carried out by ELISA assays (RayBiotech), for VEGF and TSG-6. As shown in Figure 34A, VEGF increased in both the Hypoxia 1 and Hypoxia 2 conditions compared to VEGF in the normoxia condition at both T2 and T3 hours. This increase was statistically significant at T3 hours, where the concentration of VEGF in the medium increased by more than 200% for both hypoxia conditions compared to normoxia. At both T2 and T3 hours, VEGF levels showed a trend towards being increased in the hypoxia 2 condition compared to the hypoxia 1 condition. Analysis of TSG-6 and analytes were performed later using different donor MSCs. As shown in Figure 34B, TSG-6 did not appear to be significantly changed by the levels of oxygen (hypoxia 2 at T2: 448.7 ± 128.1 / T3540±262 [pg / ml]) and normoxia at T2: 366 ± 306.5 / T3: 332.4±217.9 [pg / ml]).

[0397] Quantification of the secretion of other factors was performed using ELISA Multiplex (Q-Plex, Quansys Biosciences) as described above. As shown in Figure 34C, IL-6, IL-8, TIMP-1 , TIMP-2 and VCAM show no significant difference between aggregates grown under normoxia or hypoxia 2.

[0398] Discussion

[0399] These results show that aggregates cultured in the bioreactor system recovered their ability to adhere to the surface which supports that the cells are still viable, although metabolite analysis indicates that aggregates grown under hypoxia 2 conditions were more metabolically active than aggregates grown under normoxia conditions.

[0400] Example 15. Effect of conditioned medium in in vitro immunosuppressive assays.

[0401] Methods

[0402] To test whether aggregates modify the function of immune cells grown in the conditioned medium, we tested the effect of conditioned medium obtained as described in Example 14 on the proliferation of blood human peripheral blood mononuclear cells (PBMCs) from healthy donors. To do this, PBMCs were isolated by centrifugation with a histopath gradient (Sigma-Aldrich). Because they have a high density, erythrocytes, granulocytes and dead cells go through the Histopath phase and settle at the bottom of the gradient, while lymphocytes and monocytes, of lower density, accumulate at the histopath / plasma interface. PBMC were then dyed with CellTrace Violet (CTV, Invitrogen) and grown in serum-free AIM medium (ThermoFisher) at 37 °C and 5 % CO2 with 8 pg / mL phytohemagglutinin (PHA; previously optimised) which is a polyclonal activator of lymphocytes (referred to herein as ‘simulated cultures’). Cultures without PHA are referred to as basal cultures. We also tested the effect of conditioned medium on the proliferation of stimulated T lymphocytes was evaluated using 25, 50 and 75% conditioned medium + AIMV medium + 8 pg / mL PHA from hypoxia and normoxia conditions as described in Example 14. All conditions were performed in triplicate. After 5 days, stimulated and basal cultures were labelled with anti-CD3, anti-CD25 (BD Biosciences) and LiveDead Fixable Near-IR (ThermoFisher). Determination of the percentage of proliferation was evaluated by quantifying the decrease in CTV fluorescence. A schematic of the marking with CTV is shown in Figure 35A.

[0403] Statistical analysis

[0404] Anderson-Darling, D'Agosto & Pearson and Shapiro-Wilk normalization tests were applied. Subsequently, the Kruskal-Wallis non-parametric test was used for the comparison of multiple medians and the Mann-Whitney test for the comparison of medians between two groups. The value of p<0.05 was considered statistically significant. The data is expressed as the mean ± error (SD). All statistical analysis was performed with Prism 9 (Version 9.3.1 , GraphPad Software).

[0405] Results

[0406] The effect of conditioned medium on the proliferation, viability, and activity of lymphocytes was evaluated both stimulated and unstimulated (‘basal’). Based on the results presented in Table 5, it was decided to evaluate all the conditioned medias (MC) at 75% of the total culture volume as this is where a greater effect on proliferation was evidenced. As shown in Table 5, in the baseline condition, no difference was observed in the percentage of proliferation. However, significant differences in the percentage of proliferation were observed in the stimulated wells (as shown in Figure 35B). This suggests that adding 75% of M1 or M2 medium (without conditioning) already had an effect on the percentage of lymphocyte proliferation.

[0407] Table 5. Percentage of lymphocyte proliferation under different culture conditions: basal (with 100% AIMV medium and 75% M1 or M2), stimulated PHA pg / ml with 100% AIMV and 75% M1 or M2) and conditioned (MC at 25, 50 and 75%).

[0408] Figures 35C and 35D present dot-plots and histograms representative of the analysis performed by flow cytometry. The results indicate that the substitution of 75% of AIMV without serum by 75% of Medium (M1 or M2) did not have an effect on the activation of lymphocytes, nor a negative effect on viability. As noted above, a significant difference was observed between the proliferation of lymphocytes stimulated in AIMV without serum and those stimulated in 75% of M1 and M2 medium, being higher for the latter condition. On the other hand, the results show that the percentages of proliferation obtained were consistent with the percentages of activation, determined by marking of C25. From the marking with LiveDead Fixable Near-IR it is observed that there were no significant differences in viability, so the increase in the percentage of activation and proliferation of stimulated lymphocytes would not be related to an increase or decrease in this parameter. Based on the results presented in Figures 35E to 35G, the CM significantly decreased the percentage of proliferation of the lymphocyte population, from 92.32 ± 2.45% to 74.53 ± 4.52 and 71.15 ±5.57% for normoxia and hypoxia, respectively. It was surprising that the decrease in proliferation was higher for conditioned medium obtained under hypoxic conditions. The aggregates, and the conditioned medium thereof, clearly have immunosuppressive effects. Example 16. Effect of aggregates and conditioned medium on DSS-induced colitis in mice.

[0409] Methods

[0410] 7 week-old female C57BL / 6 mice (vivarium of Fundacion Ciencia & Vida, Chile) were allowed to acclimate to the study site vivarium for one week. Mice had access to water and food (Prolab RMH 3000 (Labdiet)) ad libitum. One day before the study started, 29 animals were weighed and randomized into 4 study groups as shown below:

[0411] 1. Control (water) (n=5);

[0412] 2. dextran sulfate sodium (DSS) 1.5% (n=8);

[0413] 3. DSS 1.5% + 1500 aggregates (n=8); and

[0414] 4. DSS 1.5% + conditioned medium (48 hour exposure) (n=8).

[0415] As shown in Figure 36A, the mice all had similar average weights upon starting between groups.

[0416] At day 0, mice were treated with water (control group - group 1) or DSS ad libitum (1.5 % w / v 36- 50 kDa, MP Biomedicals, LLC - Colitis Grade Cat No. 160110 - Lot: S3045) in drinking water (groups 2-4) for 7 days. Fresh DSS solution was replaced at days 3 and 6 for groups 2-4. From day 0, DSS groups 3 and 4 also received a single intraperitoneal injection of 200 pL aggregate solution (100 pL of 1500 aggregates in Krebs-ringer solution at pH 7.2 + 100 pL sterile saline previously mixed) or 200 pL of conditioned medium.

[0417] Ethical exclusion criteria was as follows: (i) Loss of > 20% body weight during the experiment and (ii) loss of > 10% body weight during 24h. At day 7, all animals were euthanized according to ethical procedures described in the AVMA Guidelines for the Euthanasia of Animals: 2020 Edition, established at Merken Biotech.

[0418] Colon tissue was removed from each animal, washed with saline and distal colon tissues were fixed in neutral buffered formalin for 24 hours before processing for histological analysis. The distal colon tissues were then stained with hematoxylin & eosin (H&E) and Alcian Blue (AB). Three independent parameters measured were the severity of inflammation, extent of injury and crypt damage. Histology parameters were evaluated and scored by a trained pathologist (blinded to the conditions of the experiment) according to the scoring system described in Table 6 below.

[0419] Table 6. Histological scoring. Feature Score Description

[0420] Inflammation 0 None

[0421] 1 Slight

[0422] 2 Moderate

[0423] 3 Severe

[0424] Extent of injury O None

[0425] 1 Mucosal

[0426] 2 Mucosal and sub-mucosal

[0427] 3 Transmural

[0428] Crypt damage 0 none

[0429] 1 Basal 1 / 2 damage

[0430] 2 Basal 2 / 3 damage

[0431] 3 Only surface epithelium intact

[0432] 4 Entire crypt and epithelium lost

[0433] The srae of C-KII priiameta mnlhphed by a Twiw idkcliiM the peiventace of tissue involvement _

[0434] Percent Involvement

[0435] (Multiply for 3 features above) 1 O-SSSf S 25-50V,'

[0436] / 3i 51-75%

[0437] 4 76-100%

[0438] Results

[0439] Table 7 shows the histological score for each parameter measured. The scores are represented graphically in Figure 36B. As can be seen from Table 7 and Figure 36B, mice treated with DSS tended to show increased damage to inflammation, injury and crypt damage compared to controls, reflecting ulcerative colitis, as expected. However, where mice were treated with a single dose of 1500 aggregates, there was a trend of a reduced histological score, indicating that there was a slight reduction in the inflammation, injury and crypt damage caused by DSS after only one dose. Surprisingly, where mice were treated with a single dose of conditioned medium, there was a significantly reduced histological score, reflecting a reduction in inflammation, injury and crypt damage caused by the DSS. This suggests that conditioned media and aggregates have a protective effect against colitis.

[0440] Table 7. Scores for inflammation, damage extent, crypt damage and the resultant histological score.

[0441] H&E staining of colonic cross sections 7 days after treatment showed that 1.5% DSS treatment in mice resulted in the presence of mixed cell infiltrates, hyperplasia, abnormal crypt architecture, edema and erosions compared to controls (Figure 36C). However, as can be seen in Figure 36C, treatment with a single dose of 1500 aggregates, or conditioned medium seemed to substantially rescue the colon architecture.

[0442] Goblet cells are one the main components of the crypts in colonic tissue and are responsible for the secretion and maintenance of mucosubstances such as mucins. Alcian blue stains mucosubstances within crypts of the colon. Therefore, Alcian blue staining allows for evaluation of crypt architecture and integrity. As can be seen from Figure 36D, nearly all mucosubstances were lost in mice treated with 1.5% DSS compared to the control, indicating a substantial loss of goblet cells. However, in mice treated with a single dose of 1500 aggregates, or conditioned medium, there was a substantial increase in the amount of mucosubstances in the colon, indicating that there was conservation of goblet cells within crypts. It therefore appears that the aggregates of the present invention have a protective effect against colitis.

[0443] In a further example, another treatment group is tested with repeated doses of aggregates or conditioned medium, along with an increased dose of aggregates or conditioned medium. It is expected that an increased dose, and repeated number of applications will result in a larger improvement in the histological scores, reduced inflammation, reduced damage and reduced loss of mucosubstances as found in the above experiment.

[0444] Example 17. Effect of conditioned medium on chondrocytes.

[0445] Method

[0446] Chondrocyte migration

[0447] A wound assay was prepared by culturing chondrocytes in vitro in a six well plate. When the chondrocytes reached 100% confluence, a 12 hour starving was performed and then a wound was made with a micropipette (Figure 37A). The wound was then treated for 24 hours with normal medium, conditioned medium from monolayer ad-hMSCs or conditioned medium from aggregates. The chondrocytes were then fixed and observed by Nikon E600 optical microscopy, photographing four representative fields. The number of migrant cells was quantified using Imaged software.

[0448] Gene expression analysis in a chondrocyte model

[0449] A chondrocyte model was prepared as described above and treated with normal medium or conditioned medium from monolayer ad-hMSCs, or conditioned medium from aggregates. Gene expression of COL2A1 (a marker of joint tissue), ACAN (a marker of joint tissue) and TGFpi (a marker of hypertrophic degeneration), was determined by qPCR normalizing to the endogenous ACT-p gene. The average expression was taken from three replicates. To do this, extraction of total RNA from cell culture was performed using the GeneMATRIX Universal RNA purification kit (EURx). 1000 ng of total RNA was used to synthesize cDNA using a high-throughput cDNA reverse transcription kit. Gene expression of COL2A1 was determined by qPCR using ACT-p as a control for endogenous RNA expression. The qPCR reactions were performed using Power SYBR Green PCR Master Mix 2X (Applied Biosystems) in a total volume of 10 pl and on the StepOne real-time PCR system (Applied Biosystems). Gene expression analysis of pro-inflammatory cytokines in TNF-inflamed chondrocytes treated with conditioned medium

[0450] A chondrocyte model was prepared as described above, and treated with TNF at 25 ng / mL and compared to a non-treated model (‘basal condition’). When the chondrocytes reached 80% confluency, the cells were treated with standard medium, conditioned medium from ad-hMSCs or conditioned medium from aggregates for 24 hours. Total RNA was then extracted from the cells using the GeneMATRIX Universal RNA purification kit (EURx). 1000 ng of total RNA was used to synthesize cDNA using a high-throughput cDNA reverse transcription kit. Gene expression of IL- 1a, IL-1 p, IL-6, IL-8, IL-17, IDO1 and TNF was determined by qPCR using ACT-p as a control for endogenous RNA expression. The qPCR reactions were performed using Power SYBR Green PCR Master Mix 2X (Applied Biosystems) in a total volume of 10 pl and on the StepOne real-time PCR system (Applied Biosystems).

[0451] Analysis of anti-inflammatory factors in TNF-inflamed chondrocytes treated with conditioned medium

[0452] A chondrocyte model was prepared and treated with TNF as described above. Cells were then treated with conditioned medium or standard medium as described above. The relative expression of IDO1 in chondrocytes was determined by qPCR.

[0453] Results

[0454] Figures 37A and 37B show that conditioned medium from aggregates resulted in improved chondrocyte migration in a wound assay over conditioned medium from monolayer MSCs. This resulted in improved wound healing.

[0455] Figure 37C shows a gene expression analysis of COL2A1 in a chondrocyte model treated with conditioned medium from monolayer ad-hMSCs or aggregates. As shown in Figures 37C, the levels of COL2A1 were surprisingly increased in joint tissue treated with conditioned medium from aggregates, but not from conditioned medium from monolayer ad-hMSCs. Therefore, conditioned medium from aggregates had an improved ability over conditioned medium from monolayer ad- hMSCs to induce chondrogenic regeneration. Similarly, Figure 37D shows that the levels of ACAN, a marker of joint tissue, were not significantly different between conditioned medium from ad-hMSCs and aggregates.

[0456] Figure 37E shows that the levels of TGF i were significantly decreased in a chondrocyte model treated with conditioned medium from aggregates compared to the basal condition. In addition, there was a trend towards decreased TGFpi levels in the condition where the chondrocyte model was treated with conditioned medium from aggregates compared to where the model was treated with conditioned medium from ad-hMSCs. TGFpi is associated with hypertrophic degeneration. Therefore, conditioned medium from aggregates had an improved ability over conditioned medium from monolayer ad-hMSCs to reduce hypertrophic degeneration in joint tissues.

[0457] Figure 38A-E shows that conditioned medium from aggregates resulted in improved reduction of the pro-inflammatory cytokines I L1 A, IL1 B, IL6, IL8 and I L17 as compared to conditioned medium from ad-hMSCs. These results suggest that aggregates directly inhibit the secretion of proinflammatory cytokines in the degeneration of cartilage.

[0458] Figure 39 shows that treatment with conditioned medium from aggregates induces the expression of ID01 , a known anti-inflammatory factor. Surprisingly, the induction of ID01 expression was significantly higher for chondrocytes treated with conditioned medium from aggregates than chondrocytes treated with conditioned medium from monolayer ad-hMSCs.

[0459] Example 18. Clinical trials of aggregates in humans.

[0460] A phase I, randomized, controlled, double-blind clinical trial is performed to evaluate the safety and efficacy of allogeneic ad-hMSC aggregates described above (CELLUSPHERES®) in the treatment of knee osteoarthritis. The main objective is to determine the optimal dose of treatment with CELLUSPHERES®, as a maximum tolerated dose (MTD), in terms of adverse occurrences after one day, three days and 2 weeks from administration. The secondary objective is to evaluate the efficacy of CELLUSPHERES® in terms of pain and changes in femorotibial cartilage and patellofemor volume after 1 , 3, 6 and 12 months from administration in patients with knee osteoarthritis.

[0461] Safety

[0462] For safety variables, the occurrence of adverse events is assessed after 24 hours ± 6 hours after infiltration in a telephone visit and 3 days ± 24 hours after infiltration in a face-to-face visit. For the first three patients we will also assess adverse events 2 weeks ± 24 hours after infiltration in a face-to-face visit. In addition, any adverse events are recorded at follow-up visits, after 1 month ± 1 week, 3 months ± 1 week, 6 months ± 2 weeks and 12 months ± 4 weeks after filtration.

[0463] Efficiency Changes in pain intensity, stiffness, and functional limitation are assessed on Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC) and Visual analog scale (VAS) prior to infiltration and after 1 month ± 1 week, 3 months ± 1 week, 6 months, ± 2 weeks, and 12 months ± 4 weeks after infiltration and changes in femorotibial and patellofemoral cartilage volume measured by MRI after 12 months.

[0464] Inclusion criteria

[0465] • Male or female patient > 18 years and < 75 years.

[0466] • Patients with bilateral knee osteoarthritis with at least one grade Il-Ill knee, identified by two different observers, according to the Radiological Classification Scale of osteoarthritis (Scale by Kellgren-Lawrence).

[0467] • Patients with chronic knee pain (duration greater than or equal to three months) with characteristics of knee osteoarthritis.

[0468] • Patient with the ability to understand the nature of the study.

[0469] • Informed consent signed by the patient.

[0470] Exclusion criteria

[0471] • Patients with signs of infection or HIV-positive serology, hepatitis or syphilis.

[0472] • Patients with congenital or acquired diseases that cause significant deformities of the knee that may interfere with the performance of treatment and I or interpretation thereof . For example, patients with rheumatoid arthritis, systemic lupus erythema cough, psoriatic arthritis, and any other systemic disease that makes them dependent on corticosteroids.

[0473] • Patients with misalignment of the mechanical axis of the leg. Women and men with genu varum > 8 degrees and genu valgum > 12 degrees.

[0474] • Patients with obesity, defined as a body mass index > 30 (calculated as mass in kg / height in m2).

[0475] • Pregnant or breastfeeding women.

[0476] • Patients with any type of neoplasm.

[0477] • Patients who, due to a rheumatological disease or autoimmune, are taking corticosteroids. Patients who have been given an intra-articular injection of any drug in the last 3 months.

[0478] Patients participating in another clinical trial or treatment with another investigational product within 30 days prior to study enrollment.

[0479] • Patients with other conditions that, according to medical criteria, may advise against participation in the study.

[0480] • Patients with contraindication to magnetic resonance imaging.

[0481] Treatment

[0482] Single injection with CELLUSPHERES® or control at visit 1 along with standard medical care with follow-up up to 12 months after infiltration. The doses of active treatment selected are derived from preclinical toxicity data in mice, in which it was established that the level without adverse effects (NOAEL) was 300 CELLUSPHERES®. Following the conversion factors in the FDA's guideline for deriving the maximum recommended starting dose (MRSD) (CDER, 2005), and using body surface area as a factor to convert animal dose at the human equivalent dose (HED) (Reagan-Shaw, 2007), the resulting HED for an average weight of 80 kg is approximately 19,450 CELLUSPHERES®. Finally, applying a safety factor of dividing this number by 2, the resulting MRSD is approximately 9,730 CELLUSPHERES®. Therefore, the doses used are 1000 CELLUSPHERES® (625000 ad-MSC) in the first step, 2000 CELLUSPHERES® (1.25 million ad- MSC ) in the second step, 4000 CELLUSPHERES® (2.5 million ad-MSC) in the third step and 8000 CELLUSPHERES® (5 million ad-MSC) in the fourth step. CELLUSPHERES® are delivered in an insulin syringe with 2 U / ml of heparin in Krebs-Ringer sterile saline.

[0483] It is expected that 8000 CELLUSPHERES® is tolerated without adverse events. It is therefore expected that a dose of 8000 CELLUSPHERES® is used for phase II studies.

[0484] The control treatment is 2 ml of hyaluronic acid.

[0485] Procedure

[0486] Before treatment, the subjects undergo a baseline assessment. This may include gathering the following information:

[0487] • Approximate time from the onset of symptoms;

[0488] • Previous treatments for osteoarthritis (weight loss, physiotherapy, orthopedic insoles, collagen or hyaluronic acid supplements, non-steroidal anti-inflammatory drugs , corticosteroids or previ infiltrations;

[0489] • Age;

[0490] • Sex;

[0491] • Body mass index;

[0492] • Current pain (average intensity over 24 hours);

[0493] • Level of stiffness and functional limitation (high / medium / low);

[0494] • Radiological classification of osteoarthritis (Kellgren-Lawrence scale) separately for each knee;

[0495] • MRI of the knee;

[0496] • Previous pathology of the knee (any of the following: bone and cartilage - such as previous fractures, dislocation, chondromalacia patellae, osteochondritis or traumatic erosions, injury to ligaments, tendons, menisci or bursosinovials, misalignment, or alterations of fat pads , popliteal fossa or fascia);

[0497] • Hemogram;

[0498] • Biochemical analysis: creatinine, GOT, GPT, glycemia, Na, K;

[0499] • Complete urinalysis;

[0500] • Hemostasis;

[0501] • VAS to determine pain intensity; and / or

[0502] • WOMAC questionnaire which checks pain, stiffness and functional capacity.

[0503] The following procedure may be used for the treatment:

[0504] 1. The patient arrives at the clinic 30 minutes before the scheduled treatment time after having fasted for 6 hours;

[0505] 2. The patient is arranged into a dorsal decubitus position and vital signs monitored;

[0506] 3. Site of administration in the knee is cleaned with chlorhexidine; 4. The doctor anesthetizes the puncture site in the knee with 2% lidocaine outside the joint capsule with a 25 G needle;

[0507] 5. The doctor infiltrates the CELLUSPHERES® treatment or control treatment with a 21 G needle through the joint capsule.

[0508] The study is carried out in two phases, an initial dose escalation and a subsequent dose modulation by the continuous re-evaluation (CRM ) method. The first patient assigned to the active group will receive the first dose step of CELLUSPHERES® and is observed during their minimum observation period for 2 weeks . The next patient will not be included until the end of this period. If no dose-limiting toxicities (DLTs) are observed, the next patient in the active group receives the second dose and is observed until the end of a minimum observation period of 2 weeks. If the patient does not exhibit dose-limiting toxicities, the third patient receives the third dose and is observed for a minimum observation period. The fourth patient will not be treated until the end of the minimum observation period of the third patient, and if the third patient dose not exhibit DLTs. The fourth patient then receives the fourth dose.

[0509] After treatment of the fourth patient, the CRM is activated and the first intermediate analysis is performed. The CRM is only activated earlier if any of the first three patients presented with DLTs. The activity of the CRM involves the transition to the dose modulation phase. Thereafter, patients receive the dose recommended by the CRM, defined as closest to the target toxicity level (TTL) or the fourth level, as long as there is no DLT in the study. After the activation of the CRM, new intermediate analyses is carried out on every three patients without having to wait for all of them to finish the minimum observation period, and the dose of the next patient is recommended by the model according to the above definition. This process will continue until the completion of the sample size.

[0510] Safety and efficacy are analysed as described above. Adverse events are categorised as serious or non-serious, and intensity are evaluated as mild, moderate or severe.

[0511] It is expected that the subjects treated with CELLUSPHERES® will show an improvement in pain, stiffness and functional capacity compared to the control group. It is also expected that subjects treated with CELLUSPHERES® will show improved morphology of the knee when comparing the baseline MRI with the MRI performed after treatment. The improvement is expected to be larger than that for controls. It is expected that the treatment doses are well tolerated and have minimal if no adverse events. SEQUENCE LISTING

[0512] SEQ ID NO: 1

[0513] BMP2 F primer

[0514] TCCACCATGAAGAATCTTTGGA

[0515] SEQ ID NO: 2

[0516] BMP2 R primer

[0517] GAAGCTCTGCTGAGGTGATAAA

[0518] SEQ ID NO: 3

[0519] HGF F primer

[0520] GTGCAAGGACCTACGAGAAA

[0521] SEQ ID NO: 4

[0522] HGF R primer

[0523] GTTTGGAATTTGGGAGCAGTAG

[0524] SEQ ID NO: 5

[0525] TSG-6 F primer

[0526] CAGAAGCTAAGGCGGTGTGTGAAT

[0527] SEQ ID NO: 6

[0528] TSG-6 R primer

[0529] CCATCCAGCAGCACAGACATGAAA

[0530] SEQ ID NO: 7

[0531] COX-2 F primer

[0532] CGCTCAGCCATACAGCAAATCCTT

[0533] SEQ ID NO: 8

[0534] COX-2 R primer

[0535] GTGCACTGTGTTTGGAGTGGGTTT

[0536] SEQ ID NO: 9 FGF2 F primer

[0537] GCTTCTAAATGTGTTACGGATGAG

[0538] SEQ ID NO: 10

[0539] FGF2 R primer

[0540] TACTGCCCAGTTCGTTTCAG

[0541] SEQ ID NO: 11

[0542] IL-6 F primer

[0543] AAATTCGGTACATCCTCGACGGCA

[0544] SEQ ID NO: 12

[0545] IL-6 R primer

[0546] AGTGCCTCTTTGCTGCTTTCACAC

Claims

CLAIMS1. A composition comprising aggregates of mesenchymal stem cells (MSCs), wherein the aggregates have a mean diameter between 30 to 250 microns, and wherein the aggregates comprise, consist or consist essentially of 50 to 500 MSCs.

2. The composition according to claim 1 , wherein the aggregates have a mean diameter between 30 to 240 microns, 35 to 230 microns, 40 to 230 microns, 45 to 230 microns, 50 to 225 microns, 50 to 220 microns, 50 to 210 microns, 50 to 200 microns, 50 to 190 microns, 60 to 210 microns, 60 to 200 microns, 60 to 190 microns, 60 to 180 microns, 65 to 175 microns, 70 to 170 microns, 75 to 165 microns, 80 to 160 microns, preferably wherein the diameter is a Feret diameter.

3. The composition according to claim 1 or claim 2, wherein the aggregates comprise, consist or consist essentially of a mean number of MSCs between 100 to 500 MSCs, 100 to 450 MSCs, 50 to 400, 100 to 400 MSCs, 150 to 350 MSCs, 200 to 350 MSCs, 200 to 300 MSCs, or around 238 MSCs.

4. The composition according to any preceding claim, wherein the aggregates have a mean perimeter between 100 to 700, 150 to 650, 150-625, 150-600, 175-575, 200- 550, 225-525, 250-500, 275-500, 250-475, 250-450, 250-425, 275-450, 250-425, 275- 425, 300-425, 300-400 or around 383 ± 111 microns.

5. The composition according to any preceding claim, wherein the aggregates have a mean roundness of at least 0.5, 0.6, 0.65, 0.7, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81 , 0.82, 0.83 or 0.84.

6. The composition according to any preceding claim, wherein the MSCs are human MSCs (hMSCs), preferably wherein the hMSCs comprise two X chromosomes.

7. The composition according to any preceding claim, wherein the MSCs are derived from adipose tissue, bone marrow, umbilical cord, Wharton’s jelly, gingiva, amniotic fluid and membrane, dental tissue, limb bud, menstrual blood, peripheral blood, placenta, foetal membrane, endometrium, salivary gland, skin and foreskin, synovial fluid, or cartilage tissue, preferably wherein the MSCs are derived from adipose tissue.

8. The composition according to any preceding claim, wherein the aggregates in the composition secrete one or more of: Tumor necrosis factor- (TNF) stimulated gene- 6 (TSG-6), interleukin 1 receptor associated kinase (IRAK), interleukin (IL) 10 (IL-10), IL-12, IL-8, nitric oxide (NO), C-X-C motif chemokine ligand 10 (CXCL10), hepatocyte growth factor (HGF), Prostaglandin E2(PGE2), leukemia inhibitory factor (LIF), tissue inhibitor matrix metalloproteinase (TIMP) 1 (TIMP-1), TIMP-2, Cellular Inhibitor of Apoptosis Protein 1 (IAP-1), tumour necrosis factor alpha (TNFa), Stanniocalcin-1 (STC1), interleukin-1 receptor antagonist (IL-1Ra), FGF2, cyclooxygenase-2 (COX-2), vascular endothelial growth factor (VEGF), bone morphogenetic protein-2 (BMP2), and / or interleukin 6 (IL-6).

9. The composition according to any preceding claim, wherein the metabolic activity of the aggregates is increased compared to a composition comprising control aggregates.

10. A conditioned medium exposed to the composition according to any of claims 1 to 9.

11. A pharmaceutical composition comprising the composition according to any of claims 1 to 9, or the conditioned medium of claim 10, in combination with a pharmaceutically acceptable buffer, carrier, excipient or diluent.

12. The pharmaceutical composition according to claim 11, wherein the pharmaceutically acceptable buffer is a Krebs-Ringer HEPES buffer.

13. The pharmaceutical composition according to claim 11 or claim 12, wherein the pharmaceutical composition comprises between 100-500,000, 1000-500,000, 10000- 500,000, 100,000-500,000, 100-400,000, 1000-400,000, 10000-400,000, 100,000- 400,000, 100-350,000, 1000-350,000, 10000-350,000, 100,000-350,000, 200,000- 400,000, 250,000-350,000, 300,000-350,000, 100-200000, 100-180000, 100-160000, 100-150000, 100-125000, 100-100000, 100-75000, 100-50000, 100-25000, 100-20000, 100-17500, 100-15000, 100-12500, 100-10000, 500-200000, 500-180000, 500-160000, 500-150000, 500-125000, 500-100000, 500-75000, 500-50000, 500-25000, 500-20000, 500-17500, 500-15000, 500-12500, 500-10000, 500-8000, 1000-200000, 1000-180000, 1000-160000, 1000-150000, 1000-125000, 1000-100000, 1000-75000, 1000-50000, 1000-25000, 1000-20000, 1000-17500, 1000-15000, 1000-12500, 1000-10000, 1000-8000, 1000-6000, 1000-5000, 2000-8000, 2000-6000, 2000-5000, 2000-4000, 2000-3000 or 3000-4000 aggregates per dose, preferably per dose for an 80 kg human.

14. The composition according to any of claims 1 to 9, the conditioned medium according to claim 10, or the pharmaceutical composition according to any of claims 11 to 13, for use in treatment or prevention of age-related disorders, chronic and / or acute inflammatory conditions, degenerative joint diseases, joint injury, traumatic lesions, chronic and / or acute respiratory diseases, musculoskeletal conditions, neurodegenerative diseases and / or brain injury.

15. The composition, conditioned medium or pharmaceutical composition for use according to claim 14, wherein the chronic and / or acute inflammatory condition is selected from ulcerative colitis, Crohn's disease, Epidermolysis bullosa, degenerative disc disease, facet syndrome, chondromalacia patella, tendinopathies, osteoarthritis, or arthritis.

16. The composition, conditioned medium or pharmaceutical composition for use according to claim 14, wherein the injury is a wound, burn, corrosion, lesion, wear, cut, traumatic lesion, frostbite, osteoarthritis, degenerative disc disease, facet syndrome, chondromalacia patella, and / or Epidermolysis bullosa.

17. The composition, conditioned medium or pharmaceutical composition for use according to claim 14, wherein the neurodegenerative disease is selected from Parkinson’s disease, Alzheimer’s disease, Amyotrophic lateral sclerosis, Huntington’s disease, Motor Neuron Disease, stroke, traumatic brain injury and multiple sclerosis.

18. The composition, conditioned medium or pharmaceutical composition for use according to claim 14, wherein the chronic and / or acute respiratory disease is COVID.

19. The composition, conditioned medium or pharmaceutical composition for use according to claim 14, wherein the degenerative joint disease, joint injury or age-related disorder is osteoarthritis.

20. The composition, conditioned medium or pharmaceutical composition for use according to claim 14, wherein the musculoskeletal condition is osteoarthritis, rheumatoid arthritis, juvenile arthritis, spondyloarthritis, fractured bone, tendinitis,bursitis, back problems, gout, osteoporosis, bruise, sprain, strain, sarcopenia, cartilage tear, tendon tear, torn ligament, dislocation, soft-tissue damage, or amputation.

21. The composition, conditioned medium or pharmaceutical composition for use according to any of claims 14 to 20, wherein the composition, conditioned medium or pharmaceutical composition is administered locally to a site of pathology.

22. A method of treating or preventing age-related disorders, chronic and / or acute inflammatory conditions, degenerative joint diseases, joint injury, traumatic lesions, chronic and / or acute respiratory diseases, musculoskeletal conditions, neurodegenerative diseases and / or brain in a subject in need thereof, said method comprising administering to the subject in need thereof the composition according to any of claims 1 to 9, the conditioned medium of claim 10, or the pharmaceutical composition according to any of claims 11 to 13.

23. A method of producing a composition comprising aggregates of mesenchymal stem cells (MSCs), said method comprising:(a) providing 100,000 to 1 ,000,000 MSCs to a cell culture container; and(b) culturing the MSCs in the container to obtain a composition comprising aggregates as defined in claims 1 to 9.

24. The method according to claim 23, wherein the culture container comprises one or more wells comprising at least one cavity, wherein the cavity is a pyramid with a rounded tip, and wherein the pyramid has rounded edges between the pyramid side walls.

25. The method according to claim 23 or claim 24, wherein the MSCs are cultured in the cell culture container for between 24 to 120, 36 to 108, 48 to 96, 60 to 84, 66 to 78, 69 to 75 or around 72 hours.

26. The method according to any of claims 23 to 25, wherein the MSCs are human MSCs (hMSCs), preferably wherein the hMSCs comprise two X chromosomes.

27. The method according to any of claims 23 to 26, wherein the MSCs are derived from adipose tissue, bone marrow, umbilical cord, Wharton’s jelly, gingiva, amniotic fluid and membrane, dental tissue, limb bud, menstrual blood, peripheral blood, placenta, foetal membrane, endometrium, salivary gland, skin and foreskin, synovial fluid, or cartilage tissue, preferably wherein the MSCs are derived from adipose tissue, more preferably wherein the MSCs comprise two X chromosomes.

28. The method according to any of claims 23 to 27, wherein the MSCs are cultured in step (b) for aggregation in a medium for MSCs, preferably a medium for comprising alpha minimum essential medium (MEM).

29. The method according to claim 28, wherein the medium further comprises human platelet lysate, preferably at between 0.1 to 10%, 0.1 to 8%, 0.1 to 7%, 0.1 to 5%, 0.1 to 4%, 0.1 to 3%, 0.1 to 2%, 0.5 to 2%, 0.5 to 1.5%, or around 1% (v / v).

30. The method according to any of claims 23 to 29, wherein the method further comprises a step before (a) of culturing MSCs in a medium comprising 1-5%, 1.5-4.5%, 2-4%, 2.5-3.5% or around 3% human platelet lysate.

31. The method according to claim 30, wherein the MSCs are plated at an initial seeding density of between 2000-6000, 2000-5000, 2500-5000, 3000-5000, or around 3000 cells / cm2.

32. The method according to any of claims 23 to 31 , wherein one or more internal surfaces of the culture container is coated with a hydrophobic composition, preferably comprising or consisting of hydrophobic silanes, silica, poly-ethylene glycol, polydimethylsiloxane, organopolysiloxane in heptane, or agarose.

33. The method according to any of claims 23 to 32, further comprising step (c) of priming the MSC aggregates, preferably wherein the aggregates are primed in a bioreactor.

34. The method according to claim 33, wherein the aggregates are primed under hypoxic conditions, preferably wherein the MSCs are primed with between 2-8%, 3-7%, 3.5-6.5%, 4-6%, 4.5-5.5% or around 5% O2.

35. The method according to claim 33 or claim 34, wherein the aggregates are agitated, preferably wherein the aggregates are agitated at a speed of 0.5-5, 0.5-4, 0.5-3, 1-3, 1.5-2.5 or around 2 relative centrifugal force (RCF).

36. The method according to any of claims 33 to 35, wherein the aggregates are primed in the presence of a cationic polymer, preferably wherein the cationic polymer is poly-L-lysine, more preferably a low molecular weight poly-L-lysine.

37. The method according to claim 36, wherein the final concentration of cationic polymer in the media is between 0.1-5, 0.5-5, 0.1-4, 0.1-3.5, 0.1-3, 0.5-3.5, 0.5-3, 0.1- 2.5, 0.5-2.5, 0.1-2, 0.5-2, 0.1-1.5, 0.5-1.5, or around 1 pg / mL.

38. The method according to any of claims 33 to 37, wherein the aggregates are primed in a media for undifferentiated MSCs, preferably wherein the medium is Xenofree and serum free.

39. A composition comprising the aggregates obtained or obtainable by the method of any of claims 23 to 38.

40. A method of producing a conditioned medium, wherein the method comprises the method of any of claims 23 to 38, and wherein the method further comprises a step of harvesting culture medium exposed to the aggregates to obtain conditioned medium.

41. A composition comprising the conditioned medium obtained or obtainable by the method of claim 40.

42. A method of producing a pharmaceutical composition of claims 11 to 20, wherein the method comprises the method of any of claims 23 to 38, and wherein the method further comprises providing the aggregates with a pharmaceutically acceptable carrier, excipient or diluent.

43. A method for expanding mesenchymal stem cells, said method comprising culturing MSCs in a medium comprising 1-5%, 1.5-4.5%, 2-4%, 2.5-3.5% or around 3% human platelet lysate.

44. The method of claim 43, wherein the MSCs are plated with an initial seeding density of between 2000-6000, 2000-5000, 2500-5000, 3000-5000, or around 3000 cells / cm2.

Citation Information

Patent Citations

  • Devices for the production of cell clusters of defined cell numbers and cluster sizes

    US8911690B2

  • Automatic continuous driving type reinforced workpieces cart system

    KR102347609B1

  • Culture method for enhancing the activity of stem cells, method of preparing formulation for treating central nervous diseases, and method of treating central nervous diseases

    US20190112574A1