System and process for in vivo manufacturing nanostructure-ended double-stranded covalently-closed linear DNA, the resulting molecules and their uses

The in vivo manufacturing system efficiently produces nanostructure-ended double-stranded covalently-closed linear DNA molecules using a recombinant cell with a Parental Plasmid DNA Platform, addressing inefficiencies and costs in existing methods, enabling diverse applications.

WO2026036023A1PCT designated stage Publication Date: 2026-02-12WILLIAMS MARTIN +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/041255
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-09
Filing Date
2025-08-08
Publication Date
2026-02-12

AI Technical Summary

Technical Problem

Current methods for producing nanostructure-ended double-stranded covalently-closed linear DNA molecules are inefficient and costly, limiting their application in medical and industrial fields.

Method used

A novel in vivo manufacturing system using a recombinant cell with a Parental Plasmid DNA Platform, comprising Retron, Linear, and Bacterial Backbone modules, to produce nanostructure-ended double-stranded covalently-closed linear DNA molecules through cloning, transcription, recombination, and homing endonuclease cleavage.

Benefits of technology

The system enables scalable and cost-effective production of customizable DNA molecules with protein-like functions, suitable for various medical and industrial applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025041255_12022026_PF_FP_ABST
    Figure US2025041255_12022026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a novel biological in vivo manufacturing system and a process for generating nanostructure-ended double-stranded covalently-closed linear DNA molecules. These DNA molecules possess the ability to merge the information-storage and function-encoding attributes of nucleic acids with the structural properties and functional capabilities typically found in proteins, such as specific binding and catalysis, in a single nucleic acid-only molecular entity, making them useful for a wide variety of medical applications and industrial implementations.
Need to check novelty before this filing date? Find Prior Art

Description

SYSTEM AND PROCESS FOR flV I7UO MANUFACTURING NANOSTRUCTURE- ENDED DOUBLE-STRANDED COVALENTLY-CLOSED LINEAR DNA, THE RESULTING MOLECULES AND THEIR USESFIELD OF INVENTION

[0001] The present invention generally relates to an engineered DNA technology for the manufacturing of linear DNA molecules, and, in particular, to a system and process for the manufacturing of nanostructure-ended double-stranded covalently-closed linear DNA molecules which can function in a myriad of different medical applications, from gene therapy to immunotherapy, as well as in industrial processes.INCORPORATION BY REFERENCE

[0002] The instant application includes a sequence listing encoded in extensible Markup Language (a "xml" file) that is submitted herewith named Sequence Listing.xml created on June 25 2025, and is 69,042 bytes in size. This sequence listing is incorporated by reference herein.BACKGROUND OF THE INVENTION

[0003] Nucleic acids are essential biological macromolecules that store genetic information in sequences of four nucleotides, guiding RNA and protein synthesis in cells. While traditionally, nucleic acids are carriers of genetic data and proteins serve structural, signaling, and enzymatic roles, nucleic acids can also perform protein-like functions such as specific binding and catalytic activity. Proteins, despite their functional diversity, face significant stability challenges due to their complex three-dimensional structures, which are highly sensitive to environmental factors. In contrast, nucleic acids can form stable, complex three-dimensional structures, like ribozymes and aptamers, that exhibit protein-like functionalities without the same stability concerns. Combining these nanostructures within a single DNA molecule through a double-stranded linear DNA linker, which may also serve as an expression cassette, offers extensive functional versatility. An innovative in vivo manufacturing system for producing these nanostructure-ended double-stranded covalently closed linear DNA molecules would overcome current production challenges, providing a scalable, cost-effective solution for creating DNA molecules with protein-like functions, beneficial for various industrial and medical applications.SUMMARY

[0004] In one aspect of the present invention, there is provided a nanostructure-ended double-stranded covalently-closed linear DNA molecule in vivo manufacturing system comprising: a recombinant cell comprising: a Repressor Protein Module comprising: a First Bacterial Constitutive Promoter, a First Ribosome Binding Site, a First Repressor Protein Coding sequence, a Second Ribosome Binding Site, a Second Repressor Protein Coding sequence, and a First Bacterial Terminator; a Recombinase-Reverse Transcriptase Module comprising: a First Bacterial Inducible Promoter, a Third Ribosome Binding Site, a Recombinase Coding Sequence, a Fourth Ribosome Binding Site, a Reverse Transcriptase Coding Sequence, and a Second Bacterial Terminator; and a Homing Endonuclease Module comprising: a Second Bacterial Inducible Promoter, a Fifth Ribosome Binding Site, a Homing Endonuclease Coding Sequence, and a Third Bacterial Terminator; and a Parental Plasmid DNA Platform, housed in the same recombinant cell, comprising: a Retron Module comprising: a Left Retron Unit comprising: a First Parental Bacterial Constitutive Promoter, a msr sequence, a 5’ -mW sequence, a Left Sense Stem Recombination Sequence (L-SSR), a Left DNA Nanostructure Sequence (L-DNS) inserted in a First Multiple Cloning Site (MCS 1 ), a Left Antisense Stem Recombination Sequence (L-ASR), complementary to the L-SSR sequence, a 3 ’-m sequence, and a First Parental Bacterial Terminator; and a Right Retron Unit comprising: a Second Parental Bacterial Constitutive Promoter, a msr sequence, a 5 ’-mW sequence, a Right Sense Stem Recombination Sequence (R-SSR), a Right DNA Nanostructure Sequence (R- DNS) inserted in a Second Multiple Cloning Site (MCS 2), a Right Antisense Stem Recombination Sequence (R-ASR), complementary to the R-SSR sequence, a -msd sequence, and a Second Parental Bacterial Terminator; a Linear Module comprising: a First Acceptor Recombinase Recognition Sequence (Al), a sequence selected from a DNA Spacer and an Expression Cassette inserted in a Third Multiple Cloning Site (MCS 3), and a Second Acceptor Recombinase Recognition Sequence (A2); anda Bacterial Backbone comprising: a Parental Bacterial Origin of Replication, a Parental Selection Marker, and a Parental Homing Endonuclease Recognition Sequence (HRE), wherein the retron units, linear module, and bacterial backbone are contained in at least one Cloned Parental Plasmid DNA.

[0005] In another aspect of the invention, there is provided an engineered parental circular covalently closed synthetic plasmid DNA platform usable for manufacturing nanostructure-ended double-stranded covalently-closed linear DNA molecules, comprising: a Retron Module comprising: a Left Retron Unit comprising: a First Parental Bacterial Constitutive Promoter, a msr sequence, a '-msd sequence, a Left Sense Stem Recombination Sequence (L- SSR), a First Multiple Cloning Site (MCS 1), a Left Antisense Stem Recombination Sequence (L-ASR), complementary to the L-SSR sequence, a -msd sequence, and a First Parental Bacterial Terminator; and a Right Retron Unit comprising: a Second Parental Bacterial Constitutive Promoter, a msr sequence, a '-msd sequence, a Right Sense Stem Recombination Sequence (R-SSR), a Second Multiple Cloning Site (MCS 2), a Right Antisense Stem Recombination Sequence (R-ASR), complementary to the R-SSR sequence, a 3’- msd sequence, and a Second Parental Bacterial Terminator; a Linear Module comprising: a First Acceptor Recombinase Recognition Sequence (Al), a Third Multiple Cloning Site (MCS 3), and a Second Acceptor Recombinase Recognition Sequence (A2); and a Bacterial Backbone comprising: a Parental Bacterial Origin of Replication, a Parental Selection Marker, and a Parental Homing Endonuclease Recognition Sequence (HRE), wherein the retron units, linear module, and bacterial backbone are contained in at least one Parental Plasmid DNA.

[0006] In a further aspect of the invention, there is provided a nanostructure-ended double-stranded covalently-closed linear DNA molecule in vivo manufacturing process comprising the steps of:1. cloning DNA Nanostructured Sequences (DNS) in multiple cloning sites 1 (MCS1) and 2 (MCS2), and a sequence selected from a DNA spacer and an expressioncassete in multiple cloning site 3 (MCS3) of a Parental Plasmid Platform comprising: a Retron Module comprising: a Left Retron Unit comprising: a First Parental Bacterial Constitutive Promoter, a msr sequence, a 5’ -mW sequence, a Left Sense Stem Recombination Sequence (L-SSR), a First Multiple Cloning Site (MCS 1), a Left Antisense Stem Recombination Sequence (L-ASR), complementary to the L-SSR sequence, a -msd sequence, and a First Parental Bacterial Terminator; and a Right Retron Unit comprising: a Second Parental Bacterial Constitutive Promoter, a msr sequence, a 5 ’-mW sequence, a Right Sense Stem Recombination Sequence (R-SSR), a Second Multiple Cloning Site (MCS 2), a Right Antisense Stem Recombination Sequence (R-ASR), complementary to the R-SSR sequence, a -msd sequence, and a Second Parental Bacterial Terminator; a Linear Module comprising: a First Acceptor Recombinase Recognition Sequence (Al), a Third Multiple Cloning Site (MCS 3), and a Second Acceptor Recombinase Recognition Sequence (A2); and a Bacterial Backbone comprising: a Parental Bacterial Origin of Replication, a Parental Selection Marker, and a Parental Homing Endonuclease Recognition Sequence (HRE); transforming a recombinant cell with the parental plasmid of step 1, in order to allow the constitutive promoters to transcribe Retron RNA Molecules from the retron units, the recombinant cell comprising: a Repressor Protein Module comprising: a First Helper Bacterial Constitutive Promoter, a First Helper Ribosome Binding Site, a First Repressor Protein Coding sequence, a Second Helper Ribosome Binding Site, a Second Repressor Protein Coding sequence, and a First Helper Bacterial Terminator; a Recombinase-Reverse Transcriptase Module comprising: a First Helper Bacterial Inducible Promoter, a Third Helper Ribosome Binding Site, a Recombinase Coding Sequence, a Fourth Helper Ribosome Binding Site, a Reverse Transcriptase Coding Sequence, and a Second Helper Bacterial Terminator; and a Homing Endonuclease Module comprising: a Second Helper Bacterial Inducible Promoter, a Fifth Helper Ribosome Binding Site, a Homing Endonuclease Coding Sequence, and a Third Helper Bacterial Terminator;3. promoting the expression of the Reverse Transcriptase encoded in the recombinant cell by the addition of a suitable inducer, in order for the Reverse Transcriptase to recognize the Retron RNA Molecule templates and generate Left and Right Retron Donor DNA Molecules, comprising a Nanostructured DNA End and a Donor Sequence (D), wherein the Nanostructured DNA is formed by the DNS sequence and the Donor Sequence is formed by the annealing of ASR and SSR;4. promoting the expression of the Recombinase protein encoded in the recombinant cell by the addition of a suitable inducer, in order for the Recombinase to produce a recombination of the Left and Right Retron Donor DNA Molecules with the First and Second Acceptor Recombination Sequences contained in the Linear Module of the parental plasmid platform so as to generate Nanostructure-Ended Double- Stranded Covalently-Closed Linear DNA molecules;5. promoting the expression of the Homing Endonuclease encoded in the recombinant cell by addition of a suitable inducer in order to produce double-strand cuts in the Homing Endonuclease Recognition Sequences on residual DNA molecules; and6. isolating the resulting nanostructure-ended double-stranded linear covalently closed DNA molecules from the recombinant cell.

[0007] An additional aspect of the invention provides a nanostructure-ended doublestranded covalently-closed linear DNA molecule obtainable by the aforementioned process.BRIEF DESCRIPTION OF DRAWINGS

[0008] Figure 1 is a schematic representation of a parental plasmid DNA before cloning the sequences of interest in the multiple cloning sites MCS 1-3, being this parental plasmid a component of the system for in vivo manufacturing nanostructure-ended double-stranded covalently-closed linear DNA, according to one aspect of the present invention.

[0009] Figure 2 is a schematic representation of a helper plasmid DNA, another component of the system for in vivo manufacturing nanostructure-ended double-stranded covalently-closed linear DNA, according to one aspect of the present invention.

[0010] Figure 3 schematically depicts the complete in vivo process for manufacturing nanostructure-ended double-stranded covalently-closed linear DNA molecules in accordancewith an embodiment of the present invention. The nucleotide elements shown in this figure are identified by sequence identifiers as follows:Step 1 : Cloning of the parental plasmid- DNA nanostructured sequences (DNS) cloned into multiple cloning sites MCS1 and MCS2; spacer or expression cassette cloned into MCS3 of the parental plasmid (no SEQ IDs).Step 2: Manufacturing system formation via parental plasmid transformation- Transformation of the recombinant cell with the cloned parental plasmid platform establishes the complete in vivo manufacturing system.- Constitutive promoters on the parental plasmid initiate transcription of retron units to generate retron RNA molecules.Step 3 : Retron donor DNA synthesis by induced reverse transcriptase- Upon addition of inducer, reverse transcriptase expressed in the recombinant cell recognizes retron RNA templates and synthesizes left and right retron donor DNA molecules, each comprising a nanostructured DNA end (DNS-derived) and a donor sequence (formed by annealing ASR and SSR).The schematic diagram identifies the following donor sequences:- DI : left donor sequence (SEQ ID NO: 5)- D2: right donor sequence (SEQ ID NO: 4).Step 4: Recombinase-mediated recombination- Upon induction, recombinase catalyzes site-specific recombination of retron donor DNA molecules (DI : SEQ ID NO: 5; D2: SEQ ID NO: 4) with acceptor recombinase recognition sequences Al (SEQ ID NO: 30) and A2 (SEQ ID NO: 31) within the linear module of the parental plasmid, generating the nanostructure-ended double-stranded covalently-closed linear DNA molecule. This resulting molecule displays terminal recombination junctions:- Left-end DI -Al recombination product: SEQ ID NO: 32- Right-end D2-A2 recombination product: SEQ ID NO: 33.Step 5: Homing endonuclease cleavage- Cleavage of homing endonuclease recognition sites for nuclease-directed digestion of the residual DNA resulting molecules of the process. In this step:- Residual parental DNA, left-end: SEQ ID NO: 34- Residual ssDNA loop, left-end: SEQ ID NO: 35- Residual parental DNA, right-end: SEQ ID NO: 36- Residual ssDNA loop, right-end: SEQ ID NO: 37.

[0011] Figure 4 shows in greater detail the First Step of the in vivo process for manufacturing nanostructure-ended double-stranded covalently-closed linear DNA molecules illustrated in Figure 3.

[0012] Figure 5 shows in greater detail the Second Step of the in vivo process for manufacturing nanostructure-ended double-stranded covalently-closed linear DNA molecules illustrated in Figure 3.

[0013] Figure 6 shows in greater detail the Third Step of the in vivo process for manufacturing nanostructure-ended double-stranded covalently-closed linear DNA molecules illustrated in Figure 3, highlighting the donor sequences:- DI (SEQ ID NO: 5)- D2 (SEQ ID NO: 4).

[0014] Figure 7 shows in greater detail the Fourth Step of the in vivo process for manufacturing nanostructure-ended double-stranded covalently-closed linear DNA molecules illustrated in Figure 3, depicting:- DI : left donor sequence (SEQ ID NO: 5) and D2: right donor sequence (SEQ ID NO: 4)- Al : first acceptor recombinase recognition sequence (SEQ ID NO: 30)- A2: second acceptor recombinase recognition sequence (SEQ ID NO: 31)- Left-end DI -Al recombination product: SEQ ID NO: 32- Right-end D2-A2 recombination product: SEQ ID NO: 33- Residual parental DNA, left-end: SEQ ID NO: 34- Residual ssDNA loop, left-end: SEQ ID NO: 35- Residual parental DNA, right-end: SEQ ID NO: 36- Residual ssDNA loop, right-end: SEQ ID NO: 37.

[0015] Figure 8 shows in greater detail the Fifth Step of the in vivo process for manufacturing nanostructure-ended double-stranded covalently-closed linear DNA molecules illustrated in Figure 3, highlighting residual parental fragments:- Residual parental DNA, left-end: SEQ ID NO: 34- Residual ssDNA loop, left-end: SEQ ID NO: 35- Residual parental DNA, right-end: SEQ ID NO: 36- Residual ssDNA loop, right-end: SEQ ID NO: 37.

[0016] Figure 9 depicts examples of different possible configurations that the Nanostructure-Ended Double-Stranded Covalently-Closed Linear DNA molecule can adopt, according to some embodiments of the present invention, to suit several functional needs.

[0017] Figure 10 represents the results of an agarose gel electrophoresis analysis of the DNA Parental and Helper plasmids, and of the resulting Nanostructure-Ended Double- Stranded Covalently-Closed Linear DNA molecules obtained after carrying out the manufacturing process described in the present application.

[0018] Figure 11 represents the results of an agarose gel electrophoresis analysis of the PCR products obtained using a specific set of primers designed to demonstrate the topology of the Nanostructure-Ended Double- Stranded Covalently-Closed Linear DNA molecules. In this figure, arrows indicate PCR primers:- Black arrows: forward primer (SEQ ID NO: 38) and reverse primer (SEQ ID NO: 39)- White arrows: forward primer (SEQ ID NO: 40) and reverse primer (SEQ ID NO: 41)- Grey arrows: forward primer (SEQ ID NO: 42) and reverse primer (SEQ ID NO: 43).

[0019] Figure 12 shows a representation of three different nanostructure-ended doublestranded covalently-closed linear DNA molecules assayed for the fluorescent staining of cells expressing a specific protein on their surface.

[0020] Figure 13 shows the results of the application of nanostructure-ended doublestranded covalently-closed linear DNA molecules of Figure 10 on HEK-293 cells expressing the RVGP from rabies virus.

[0021] Figure 14 is a schematic depiction of the bi-specific nanostructure-ended double-stranded covalently-closed linear DNA molecule designed for a cell-to-cell binding proof-of-concept assay.

[0022] Figure 15 shows the cell-to-cell linkage results using the bi-specific nanostructure-ended double-stranded covalently-closed linear DNA molecule of Figure 12.

[0023] Figure 16 depicts the four different nanostructure-ended double-stranded covalently-closed linear DNA molecules used in a transfection-expression assay.

[0024] Figure 17 shows the results of a nanostructure-ended double-stranded covalently-closed linear DNA molecule-mediated gene therapy proof-of-concept assay.DETAILED DESCRIPTION OF THE INVENTION

[0025] The general operating characteristics and advantages of the present invention will now be described in greater detail in this section in connection with the preferred embodiments, which should be considered as exemplary only and not limiting of the present invention.I. MANUFACTURING SYSTEM

[0026] The present invention provides, in a first aspect, a novel in vivo system for manufacturing nanostructure-ended double-stranded covalently-closed linear DNA molecules. These resulting DNA molecules bear three distinct regions: Left End, Linear Module, and RightEnd, each of them being customizable to meet different needs according to all the possible applications.

[0027] In particular, a nanostructure-ended double-stranded covalently-closed linear DNA molecule in vivo manufacturing system is provided, wherein such system comprises: a recombinant cell; and a Parental Plasmid DNA platform housed in the same recombinant cell.1. PARENTAL PLASMID PLATFORM

[0028] The Parental Plasmid Platform provides the physical sequences that will serve as raw material for the assembly of the nanostructure-ended double-stranded covalently-closed linear DNA molecules, namely the two (i.e., “Left“ and “Right”) nanostructured ends, and the linear DNA module (double-stranded linear DNA linker), which links both nanostructured ends together, and that can additionally function as a genetic expression unit.

[0029] Specifically, the Parental Plasmid Platform comprises a Retron Module, a Linear Module, and a Bacterial Backbone. Said modules are contained in at least one Parental Plasmid.

[0030] Preferably, as shown in Figure 1, the Parental Plasmid Platform comprises a single Parental Plasmid comprising a Retron Module, a Linear Module, and a Bacterial Backbone.

[0031] In other embodiments, the Retron Module may be contained in a Parental Plasmid different from the Parental Plasmid containing the Linear Module, the Parental Plasmid Platform thus comprising a plurality of Parental Plasmids.

[0032] Both nanostructured ends are generated by the retron module, which will be described in greater detail below. a. Retron Module

[0033] Retrons, which are genetic elements found in various bacterial species, can synthesize single-stranded DNA molecules from an RNA template.

[0034] Retrons integrate two essential components: a reverse transcriptase enzyme (RT) and a non-coding RNA molecule known as the "retron RNA." These are transcribed from a specific retron locus within the bacterial genome. The resulting RNA molecule possesses a unique sequence, composed of two main regions, called msr and msd (for multi-copy singlestranded RNA and DNA, respectively). Msr sequence adopts a typical three-dimensional structure conformation which makes the retron RNA a proper substrate for the reverse transcriptase. The reverse transcriptase encoded by the retron gene then uses the retron RNA msd region as a template for the production of a complementary DNA strand. The resulting single-stranded DNA molecule containing the template sequence is referred to as "retron DNA".

[0035] The retron module of the present invention comprises a Left Retron Unit and a Right Retron Unit.

[0036] In turn, the Left Retron Unit comprises the following elements operably linked in the following order: a First parental Bacterial Constitutive Promoter, an msr sequence, a 5' msd, a Left Sense Stem Recombination Sequence (L-SSR), a First Multiple Cloning Site (MCS 1), a Left Antisense Stem Recombination Sequence (L-ASR) complementary to the L-SSR sequence, a 3' msd, and a First Parental Bacterial Terminator.

[0037] On the other hand, the Right Retron Unit comprises the following elements operably linked in the following order: a Second Parental Bacterial Constitutive Promoter, an msr sequence, a 5' msd, a Right Sense Stem Recombination Sequence (R-SSR), a Second Multiple Cloning Site (MCS 2), a Right Antisense Stem Recombination Sequence (R-ASR) complementary to the R-SSR sequence, a 3' msd, and a Second Parental Bacterial Terminator.

[0038] In some embodiments, the msr sequences present in the Retron Module of the Parental Plasmid Platform are selected from the group consisting of bacterial retron sequences such as, but not limited to, Ecl (E. coli) bacterial retron sequence, Ecl 43 bacterial retron sequence, Ec42 bacterial retron sequence, Ec6 bacterial retron sequence, Ec86 bacterial retron sequence, and Ec93 (E. coli) bacterial retron sequence, Ent4 (Enterobacter cloacae) bacterial retron sequence, Lpo2 (Listeria monocytogenes) bacterial retron sequence, Sal (Staphylococcus aureus) bacterial retron sequence, Ssl (Shigella sonnei) bacterial retron sequence, Rcl bacterial retron sequence, Rc2 and Rc3 (Ralstonia solanacearum) bacterial retron sequences, Ryl, Ry 2 and Ry3 (Rhizobium etli) bacterial retron sequences, Tyl (Yersiniapeslis) bacterial retron sequence, Ty2 (Yersinia pseudotuberculosis) bacterial retron sequence, Ty3 (Yersinia enterocolitica) bacterial retron sequence, and Ty4 (Yersinia ruckeri) bacterial retron sequence.

[0039] In a preferred embodiment, the msr sequence is that of the Ec86 bacterial retron.

[0040] The naturally occurring msd sequence, which may be, but is not limited to, some of the examples mentioned for the msr sequence, is subjected to specific modifications to fulfill the intended purposes. These modifications comprise precise alterations in the nucleotide sequence, which confer improved functionality, stability, and specific interaction capabilities tailored to the target use.

[0041] The ability to generate single-stranded DNA molecules in vivo through the use of retrons is valuable for many applications in biotechnology. By engineering the msd sequence, retrons can be programmed to generate single-stranded DNA of a desired sequence and architecture.

[0042] The composition of the modified msd sequence is variable among different retrons, giving each retron a specific function, according to its adaptive value. This region can thus be adjusted to carry sequences of interest, such as aptamers, DNA-zymes, etc. i. Multiple Cloning Sites

[0043] The First and Second Multiple Cloning Sites (MCS 1 and MCS 2) are each cloned with a DNA Nanostructure Sequence (DNS) before generating the manufacturing system of the present invention.

[0044] In some embodiments, the DNA Nanostructure Sequences (DNS) can be selected from the group of sequences consisting of, but not limited to, aptamers, DNAzymes, DNA cages, DNA Nanomachines. DNA Logic Gates, DNA Walkers, DNA Immune Modulators, DNA Origami Structures, G-Quadruplexes-containing sequences, i-Motifs, DNA Nanostructures for Imaging, DNA Tweezers, DNA Nanocontainers, DNA Antennas, DNA Hydrogels, and DNA Brushes.

[0045] DNAzymes (Deoxyribozymes)

[0046] DNAzymes are DNA molecules that have enzymatic activity. They can catalyze a variety of chemical reactions, including RNA cleavage, RNA ligation, covalent modifications of amino acid side chains, tyrosine-azido adenylation, phosphorylation and dephosphorylation, covalent modification of phosphorylated amino acid chains, amide and ester hydrolysis, copper-mediated azide-alkyne cycloaddition, Diels-Alder addition, glycosylation, porphyrin metalation, thymine-dimer repair, DNA depurination, DNA phosphorylation, DNA capping, DNA cleavage and ligation, all of which can be harnessed for different applications. For instance, some DNAzymes are designed to target and cleave the mRNA of disease-associated genes, effectively inhibiting their expression.

[0047] DNA Aptamers

[0048] DNA-based aptamers are single stranded deoxyribonucleic acid molecules having intrinsically complex secondary structure that confers them with the capability of binding to tspecific targets, including proteins, small molecules, or even cells, with high specificity and high affinity, through molecular interactions not involving the classic Watson- Crick base pairing. Through these interactions, aptameric DNA molecules are also capable of modulating their physiological activity and / or physicochemical properties. These aptamers can be de novo designed by an in vitro selection process from pools of random sequence oligonucleotides, called Systematic Evolution of Ligands by Exponential enrichment (SELEX). Several aptamers have been generated with specific binding capabilities against over 100 proteins, including growth factors, transcription factors, enzymes, immunoglobulins, and receptors. Typically, an aptamer is approximately 10-15 kDa (30-45 nucleotides) in size, binds to its target with subnanomolar affinity, and can distinguish between closely related targets, such as two proteins from the same family. Several studies show that aptamer-protein interactions are of the same nature, specificity and affinity as antibody-antigen or enzymeligand interactions (v.g., hydrogen bonding, electrostatic complementarity, hydrophobic contacts, steric exclusion, etc.).

[0049] Aptamers and aptamer-functionalized molecules have been used extensively for targeted therapeutics and molecular diagnostics, and have a high number of desirable characteristics such as high specificity and affinity, biological efficacy, and excellent pharmacokinetic properties. In addition, they also offer specific competitive advantages over antibodies and other protein-based biologies because its manufacture process is substantially fast and cost-effective, they are smaller, non-toxic, non-immunogenic, easily scalable, rapidlymodificable, and chemically robust. These DNA aptamers can be engineered to regain activity following exposure to factors such as heat, extreme pH values and denaturants, and can be stored for extended periods (more than 1 year) at room temperature as freeze-dried powders. Moreover, the nature of nucleic acid molecules provides additional regulatory functions; they can be modulated for desired therapy and drug delivery applications using the complementary oligo-antidote strategy. The spontaneous heteroduplex formation by hybridization of an aptamer to a cognate complementary DNA strand can abolish the interaction of the aptamer with its target, therefore, reversing its biological activity. Recently, there have been certain therapeutic advances through the development of DNA and RNA aptamers that can be functionalized with drugs or delivery vehicles to specifically target cell surface receptors, improving the specificity of the recognition and efficacy of internalization of therapeutic agents by the target cell.

[0050] The three-dimensional structure of DNA-based aptamers, can be stabilized by canonical and noncanonical intracatenary base pairing, G-quadruplexes, pseudo knots and i- motifs. The spatial structure of a DNA-Based Aptamer is simpler than those of antibodies, so it can be easily assembled and renatured. Target binding proceeds through the formation of nonco valent interactions: electrostatic, H-bonding, and hydrophobic between an aptamer and its ligand.

[0051] As chemical compounds, DNA aptamers have demonstrated little or no toxicity or immunogenicity. In chronic dosing in rats or woodchucks with high levels of aptamer (10 mg / kg daily for 90 days), no toxicity was observed by any clinical, cellular, or biochemical measure. While the efficacy of monoclonal antibody administration can be severely limited by the immune response elicited against the antibodies themselves (anti-antibodies), it is extremely difficult to raise antibodies against aptamers. This is most likely because aptamers - or their fragments- cannot be presented by T-cells via MHC molecules, and the immune response is generally trained not to recognize nucleic acid fragments.

[0052] Although antibodies can be made to recognize small molecules, the process for their manufacturing is cumbersome, and implies crosslinking of the small molecule to a wider molecular carrier allowing the establishment of additional interactions between the antibody and the small molecule-carrier complex.

[0053] Aptamers, on the other hand, can be easily designed to target small organic and inorganic substances, including metabolites, and can be consistently produced at low costs using automated oligomer synthesis methods.

[0054] DNA-Based Aptamers can thus be chemically synthesized and consequently be readily scaled as needed to meet large scale production demands. Whereas difficulties in scaling production are currently limiting the availability of some biologies and the capital cost of a large-scale protein production plant is quite considerable, a single large-scale oligonucleotide synthesizer can produce up to 100 kg of nucleic acids per year and requires a relatively modest initial investment. The current cost of goods for aptamer synthesis at the kilogram scale is estimated at $500 / g, comparable to that for milligrams of highly optimized antibodies. Continuing improvements in process development are expected to lower the cost of oligomer manufacturing goods to <$100 / g in five years.

[0055] According to state-of-the-art processes, original aptamers are generated by an entirely in vitro process, called SELEX. This process allows for the rapid generation of initial leads, including therapeutic leads. In vitro selection allows the specificity and affinity of the aptamer to be tightly controlled and continuously adjusted, enabling the generation of leads, including leads against both toxic and non-immunogenic targets.

[0056] DNA Nanomachines

[0057] DNA Nanomachines are DNA structures that can undergo controlled molecular movements in response to specific stimuli. These nanomachines can be used for various applications, such as targeted drug delivery, where the nanomachine delivers the drug payload only when it encounters a specific physicochemical trigger.

[0058] DNA Logic Gates

[0059] DNA can be used to create logic gates, similar to those used in computers, which carry out a specific action (such as releasing a drug) based on a set of input signals. For example, a DNA logic gate could be designed to release a drug only when it encounters two specific biomarkers, reducing off-target effects.

[0060] DNA Walkers

[0061] DNA Walkers are DNA structures that can move along a surface or another DNA molecule. They have potential applications in nanotechnology and material science, including molecular assembly and the transport of molecules.

[0062] Immune Modulators

[0063] DNA molecules, especially those with unmethylated CpG motifs, can modulate the immune response in mammals. Regarding this, synthetic DNA sequences with CpG motifs are used as adjuvants in vaccines to enhance the immune response.

[0064] DNA Origami Structures

[0065] DNA can be manipulated into a variety of complex three-dimensional shapes using a technique called DNA origami. These structures have potential applications in many fields, from nanotechnology to medicine. Some of these DNA molecules fold into shapes that favor cell internalization, and thus may act as a delivery adjuvant for other molecules, or the DNA itself.

[0066] Triplex DNA

[0067] Triplex DNA is a structure where a third strand of DNA binds to a DNA duplex. It can be used for gene regulation and has potential therapeutic applications, such as targeted gene modification or inhibition.

[0068] G-Quadruplexes

[0069] G-Quadruplexes are four-stranded DNA structures that can be formed by guanine-rich sequences. These structural motifs are found naturally in the genome and have been associated with gene regulation and genomic stability. They are also being explored as potential targets for therapeutic intervention, particularly in cancer.

[0070] i-Motifs

[0071] i-Motifs are four-stranded DNA structures that can be formed by cytosine-rich sequences. Like G-quadruplexes, they have been associated with gene regulation and are being investigated as potential therapeutic targets.

[0072] DNA Nanostructures for Imaging

[0073] DNA structures can be used to improve imaging techniques. For example, gold nanoparticles can be attached to certain DNA structures and used to enhance contrast in electron microscopy. Other applications may include imaging with Magnetic resonance imaging (MRI) or Positron emission tomography (PET) scans.

[0074] DNA Tweezers

[0075] DNA Tweezers are DNA structures that can undergo controlled conformational changes in response to specific stimuli, similar to the opening and closing of tweezers. They could be used as biosensors or to control the activity of other molecules.

[0076] DNA Nanocontainers

[0077] DNA Nanocontainers are DNA structures that can encapsulate other molecules. They can be used for targeted drug delivery or to protect sensitive molecules from degradation.

[0078] DNA Antennas

[0079] DNA Antennas are DNA structures that can capture and transfer light energy. They could be used in solar cells or other light-harvesting applications.

[0080] DNA Hydrogels

[0081] DNA Hydrogels are networks of DNA strands that form a gel-like material.They can be used for controlled drug release, tissue engineering, or as scaffolds for cell culture.

[0082] DNA Brushes

[0083] DNA Brushes are DNA structures that extend out from a surface, like bristles on a brush. They can be used for bio-detection or to control the properties of surfaces.

[0084] DNA as a Scaffold for Protein Structure Determination

[0085] DNA can be used to spatially arrange proteins in a precise manner, aiding in the determination of protein structures using methods such as X-ray crystallography.

[0086] In some possible embodiments, the DNA Nanostructure Sequence (DNS) of one or both retron units is a simple unstructured single-stranded DNA loop with no a priori physical or physiological function.

[0087] According to some embodiments, the L-DNS and R-DNS are aptamers selected from, but not limited to, the group of known aptamers binding to specific protein and nonprotein targets, such as Mucinl aptamer, VEGF aptamer, Thrombin aptamer, Prostate-specific antigen (PSA) aptamer, Tumor necrosis factor alpha (TNF-a) aptamer, ATP aptamer, Dopamine aptamer, Lipopolysaccharide (LPS) aptamer, Ochratoxin A aptamer, and Mercury ion (Hg2+) aptamer, Fluorophore-binding aptamers, Drug-binding aptamers, and combinations thereof.

[0088] According to other embodiments of the present invention, the DNA Nanostructure Sequence (DNS) of both retron units is the Apta-SYTE Glucagon Receptor (GR) aptamer sequence (SEQ ID NO 29).

[0089] In yet other embodiments, the L-DNS and R-DNS are DNAzymes selected from the group of known DNAzymes such as, but not limited to, 10-23 DNAzyme (cleaves HIV RNA), 8-17 DNAzyme (cleaves Hepatitis C virus (HCV) RNA), E7 DNAzyme (cleaves Human papillomavirus (HPV) 16 E7 mRNA), Thrombin DNAzyme (Cleaves thrombin RNA, and VEGF DNAzyme (cleaves the Vascular Endothelial Growth Factor (VEGF) mRNA).

[0090] In some embodiments, the DNA Nanostructure Sequence (DNS) of both retron units can be different sequences.

[0091] In preferred embodiments, the DNA Nanostructure Sequence (DNS) of both retron units are flanked by specific restriction enzyme recognition sequences so any sequence of interest can be interchanged. ii. Parental plasmid promoters

[0092] In some embodiments, the Parental Plasmid Bacterial Constitutive Promoters are E. coli o70 promoters selected from the group consisting of, but not limited to, P(Bla) constitutive promoter, P(Cat) constitutive promoter, P(Kat) constitutive promoter, reverse lambda cl-regulated promoter, pBAD reverse constitutive promoter, lacQ constitutive promoter, GlnRS constitutive promoter, Trp operon constitutive promoter, tac constitutive promoter, PRNA1 promoter, Lambda Phage constitutive promoter, rrnB Pl constitutive promoter, Pspc constitutive promoter, J23119 constitutive promoter, and Laclq constitutive promoter, and combinations thereof.

[0093] In a preferred embodiment, the Parental Plasmid Bacterial Constitutive Promoters are the J23119 constitutive promoters. b. Linear Module

[0094] The Linear Module comprises a Multiple Cloning Site (MCS) flanked by a First Acceptor Recombinase Recognition Sequence (Al) and a Second Acceptor Recombinase Recognition Sequence (A2). i. Acceptor Recombinase Recognition Sequences

[0095] In preferred embodiments, the First Acceptor Recombinase Recognition Sequence (Al) is AttP2. In even more preferred embodiments, the Recombinase Recognition Sequence is SEQ ID NO. 7.

[0096] In preferred embodiments, the Second Acceptor Recombinase Recognition Sequence (A2) is AttPl . In even more preferred embodiments, the Recombinase Recognition Sequence is SEQ ID NO. 6. ii. Third Multiple Cloning Site (MCS 3)

[0097] The linear DNA module of the Parental Plasmid Platform bears a Third Multiple Cloning Site (MCS 3), which is cloned with a sequence selected from a DNA spacer and an expression cassette before constituting the manufacturing system of the present invention.

[0098] When cloned with at least one expression cassette, it makes the generated nanostructure-ended double-stranded covalently-closed linear DNA molecules capable of gene expression. Alternatively, when cloned with a DNA spacer, said non expressing DNA sequence would serve merely as a physical linker between both retron-derived DNA ends.

[0099] According to some embodiments of the present invention, the Linear Module has an expression cassette, inserted in the multiple cloning site, comprising the following elements operably linked in the following order:• an Eukaryotic Enhancer;• an Eukaryotic Promoter;an Eukaryotic Coding Sequence (CDS); and• an Eukaryotic Terminator / Polyadenylation Signal.

[0100] Eukaryotic Enhancer

[0101] In some embodiments, the Eukaryotic Enhancer is selected from the group consisting of, but not limited to, Cytomegalovirus Enhancer, SV40 Virus Enhancer, Chicken 13-Globin Enhancer, and Interferon 13 Enhancer.

[0102] In preferred embodiments, the Eukaryotic Enhancer is the Cytomegalovirus enhancer.

[0103] In other preferred embodiments, the Eukaryotic Enhancer is the SV40 Enhancer.

[0104] Eukaryotic Promoter

[0105] The Eukaryotic Promoter Sequence of the linear Module is selected, in some embodiments, from the group consisting of, but not limited to, RNA polymerase II constitutive mammalian promoters, such as the human cytomegalovirus (CMV) immediate-early enhancer and promoter (pCMV), the early promoter of the simian virus 40 (pSV40), the polyubiquitin gene promoter (pUBC), the hybrid construct of the cytomegalovirus (CMV) enhancer fused to the chicken beta-actin promoter (pCAGG), the human elongation factor-1 alpha promoter (pEFlA), the human phosphoglycerate kinase 1 promoter (pGK), inducible promoters constituted by the minimal CMV promoter and different response elements such as bacterial operators (e.g., lac repressor, tetracycline repressor) and other DNA binding sequences where artificial transcription factors can be associated, and RNA polymerase III promoters such as the Hl RNA promoter (pHl), the U6 promoter, and the 7SK promoter.

[0106] In some embodiments, the sequence of the Eukaryotic Enhancer and / or Promoter is SEQ ID NO 12.

[0107] Eukaryotic Transcription Terminator Sequences

[0108] In some embodiments of the present invention, the transcription terminator sequence is selected from the group consisting of, but not limited to, human a-globin polyadenylation signal sequence, human [3-globin polyadenylation signal sequence, rabbit a-globin polyadenylation signal sequence, rabbit 0-globin polyadenylation signal sequence, mouse k-light chain polyadenylation signal sequence, chicken ovalbumin polyadenylation signal sequence, SV40 polyadenylation signal sequence (SV40 pA) such as SEQ ID NO 14, Bovine Growth Hormone polyadenylation signal sequence (BGH pA), Herpes Simplex Virus thymidine kinase polyadenylation signal sequence (HSV TK pA), Cytomegalovirus early enhancer / promoter polyadenylation signal sequence (CMV pA), woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), and a small polyT stretch (5-6) for RNA pol III promoters.

[0109] Eukaryotic Origins of Replication

[0110] In some embodiments, the Linear Module may further comprise one or more Eukaryotic Origins of Replication.

[0111] Said eukaryotic origins of replication may be selected from the group consisting of, but not limited to, Homo sapiens LOC107198088 Origin of Replication, Homo sapiens LOC107133510 Origin of Replication, SV40 Origin of replication, Epstein Barr Origin of replication, Bovine Papilloma Virus Origin of replication, and combinations thereof.

[0112] In some embodiments, the expression cassette of the present invention further comprises at least one of:• a 5’ Untranslated Region;• a 3 ’ Untranslated Region;• an IRES (Internal Ribosome Entry Site); and• a MIRES (m6A induced ribosome engagement sites).

[0113] Eukaryotic Untranslated Regions

[0114] In some embodiments, the sequence of the 5'and 3' Eukaryotic Untranslated Regions (UTRs) are selected from the group consisting of, but not limited to, 5' and 3' UTRs from any known-in-the-art eukaryotic mRNA, riboswitches, riboregulators, zip-code structures, localization structures, RNA-binding protein recognition sequences, IRES, MIRES, temperature-sensitive regulators, regulatory structures, RNA-stabilizing elements, RNA- destabilizing elements, translational modulators, etc.

[0115] IRES (Internal Ribosome Entry Sites)

[0116] Internal Ribosome Entry Sites (IRES) are natural or artificial RNA sequences typically present in the 5 ' untranslated region of mRNAs that undergo intracatenary folding to render a three-dimensional structure that resembles that of eukaryotic factors involved in the initiation of translation. Hence, IRES make certain posttranscriptional modifications of the mRNA (such as capping) and said initiation factors superfluous, allowing the mRNA to enter directly into a translationally active state. When placed between different open reading frames in an mRNA, IRES can be used to achieve polycistronic translation in eukaryotes to render several proteins from a single mRNA molecule. Some IRES can even enhance translation of a downstream coding sequence.

[0117] In some embodiments, the IRES element is derived from a DNA sequence from an organism including, but not limited to, an animal, a plant, a fungus, a bacterium, a virus, an alga, and a protozoan.

[0118] In some embodiments, viral IRES are sequences at least partially derived from a virus including, but not limited to, encephalomyocarditis virus (ECMV) IRES, Coxsackievirus B3 (CVB3) IRES, Taura Syndrome Virus (TSV) IRES, Triatoma Virus (TV) IRES, Human mastadenovirus C (HAdV-C) IRES, Human adenovirus 5 (HAdV5) IRES, Human adenovirus 7 (HAdV7) IRES, Human mastadenovirus B (HAdV-B) IRES, Hepatitis GB virus B (HGBV-B) IRES, HPV31 IRES, Human Poliovirus 3 (HPV-3) IRES, Human papillomavirus type 11 (HPV11) IRES, Human immunodeficiency virus 1 (HIV 1) IRES, Human immunodeficiency virus 2 (HIV-2) IRES, Simian T-lymphotropic virus 1 (STLVs-1) IRES, Human Parvovirus B19 (HPB19) IRES, Human betaherpesvirus 6B (HHV-6B) IRES, Human alphaherpesvirus 3 (HHV-3) IRES, Human papillomavirus type 41 (HPV41) IRES, Human papillomavirus type 6b (HPV6b) IRES, Alphapapillomavirus 7 IRES, Friend murine leukemia virus IRES, Heilovirus (ThV) IRES, Rous sarcoma virus (RSV) IRES, Human mastadenovirus F (HAdv-F) IRES, Human papillomavirus type 4 (HPV4) IRES, Human papillomavirus type 63 (PHV63) IRES, Human mastadenovirus A IRES, Feline immunodeficiency virus (FIV) IRES, Human T-lymphotropic virus 2 (HTLV-2) IRES, Jaagsiekte sheep retrovirus (JSRV) IRES, Spleen focus-forming virus (SFFV) IRES, Mouse mammary tumor virus (MMTV) IRES, Murine osteosarcoma virus (MOV) IRES, Ovine lentivirus (OLV / OvLV) IRES, Squirrel monkey retrovirus (SMRV) IRES, Human papillomavirus type 16 (HPV16) IRES, Human papillomavirus type 5 (HPV5) IRES, Human polyomavirus 1 IRES, Rabies lyssavirus IRES, Simian immunodeficiency virus (SIV) IRES, 1Human papillomavirus type 10 (HPV 10) IRES, Human papillomavirus type 26 (HPV26) IRES, Human papillomavirus type 32 (HPV32) IRES, Human papillomavirus type 34 (HPV34) IRES, Marburg margurgvirus IRES, Enterovirus A IRES, Rhinovirus A IRES, Human betaherpesvirus 6A (HHV-6A) IRES, Macaca mulatta polyomavirus 1 IRES, Snakehead retrovirus (SnRV) IRES, Bovine foamy virus (BFV) IRES, Drosophila C virus (DCV) IRES, Hendra henipavirus (HeV) IRES, Aichi virus 1 (AiV-1) IRES, Influenza B virus (IBV) IRES, Zaire ebolavirus (ZEBOV) IRES IRES, Human coronavirus 229E (HCoV-229E) IRES, Nipah henipavirus (NiV) IRES, Human respirovirus 1 (HPIV-1) IRES, Modoc virus (MODV) IRES, Sudan ebolavirus IRES, Human parvovirus 4 G1 IRES, Rotavirus C IRES, Human gammaherpesvirus 4 (Epstein-Barr virus) IRES, or eukaryotic IRES derived from Homo sapiens, Aplysia californica, Canis lupus familiaris, Drosophila melanogaster, Gallus gallus, Mus pahari, Mus musculus, Saccharomyces cerevisiae, Zea mays, Rattus norvegicus, Ovis aries, and combinations thereof.

[0119] In some embodiments, eukaryotic IRES are sequences at least partially derived from mRNAs from different species including, but not limited to, Homo sapiens IRES, Aplysia californica IRES, Canis lupus familiaris IRES, Drosophila melanogaster IRES, Gallus gallus IRES, Mus pahari IRES, Mus musculus IRES, Saccharomyces cerevisiae IRES, Zea mays IRES, Rattus norvegicus IRES, and Ovis aries IRES.

[0120] m6A induced ribosome engagement sites (MIRES)

[0121] trM6-methyladenosine (m6A) is a reversible epitranscriptomic modification found in several eukaryotic mRNAs, and when present in the 5’ untranslated region (5’UTR), even a single m6A, it promotes cap-independent translation. These sites are called m6A induced ribosome engagement sites (MIRES).

[0122] MIRES stimulate selective mRNA translation in stress conditions by a mechanism that involves the direct binding of the initiation factor eIF3. Cellular methylation of selected adenine bases on mRNAs is promoted by one or multiple DRACH (D = Guanine or Adenine or Uracil, R = Guanine or Adenine, H = Adenine or Cytosine or Thymine) consensus motifs.

[0123] Additionally, the cellular m6A writing / reading machinery allows nucleic acids to be marked as self or endogenous. When m6A DRACH motifs are incorporated into coding DNA sequences, RIG-1 mediated immunogenicity is decreased by 10,000-fold, compared tomutated m6A DRACH motifs. Thus, when designing the Nanostructure-Ended Double- Stranded Covalently-Closed Linear DNA molecules, it is beneficial to make use of an m6A- dependent translation process to avoid unwanted immune responses against foreign nucleic acid sequences.

[0124] When placed between different open reading frames in an mRNA, MIRES can be used to achieve polycistronic translation in eukaryotes to render several proteins from a single mRNA molecule. Some MIRES can even enhance translation of a downstream coding sequence.

[0125] In an embodiment of the present invention, the sequence of the expression cassette is SEQ ID NO 11.

[0126] In some embodiments, the Linear Module may further comprises at least one of:• a Scaffold Matrix Attachment Region (S / MAR); and• a DNA Nuclear Targeting Sequence (DNTS).

[0127] Scaffold Matrix Attachment Region

[0128] In a preferred embodiment, the nuclear scaffold matrix-association sequence (S / MAR) is selected from the group consisting of human b-interferon gene-derived S / MAR, human immunoglobulin heavy chain-derived S / MAR, human apolipoprotein B-derived S / MAR, chicken lysozyme-derived S / MAR, other vertebrate- derived S / MAR, SV40T mutated sequence, B-Globin Replicator sequence, Epstein-Barr virus (EBV) elements oriP, and EBNA1.

[0129] According to some embodiments, the nuclear scaffold matrix-association sequence (S / MAR) is SEQ ID NO 15.

[0130] DNA Nuclear Targeting Sequences

[0131] In some embodiment, the DNA nuclear targeting sequence is selected from the group consisting of SV40 enhancer DNA nuclear targeting sequence, NF-kB DNA nuclear targeting sequence, GRE DNA nuclear targeting sequence, smooth muscle-specific DNA nuclear targeting sequence, smooth muscle y-actin (SMGA) promoter DNA nuclear targeting sequence, Sox2 regulatory region 2 (SRR2) DNA nuclear targeting sequence, Karyopherin(importin) 01, isoform 1 (Kpnpi) DNA nuclear targeting sequence, RanBP7 / importin 7 (Ipo7) DNA nuclear targeting sequence, RAN DNA nuclear targeting sequence, Ran binding protein 1 (RanBPl) DNA nuclear targeting sequence, Ran binding protein 3 (RanBP3) DNA nuclear targeting sequence, SYTE-DNTS1 DNA nuclear targeting sequence, and combinations thereof.

[0132] In a preferred embodiment, the DNA nuclear targeting sequence is the SV40 enhancer DNA nuclear targeting sequence. Preferably, the sequence of the SV40 enhancer is SEQ ID NO 16.

[0133] According to other embodiments of the present invention, the Linear Module has a Spacer Sequence (non expressing DNA sequence) inserted in the multiple cloning site.

[0134] In some embodiments, the multiple cloning site (MCS) sequences comprise one or more contiguous restriction endonuclease recognition sequences which facilitate the insertion of exogenous DNA fragments into the parental plasmid. Sites for known-in-the-art restriction endonucleases within the MCS may include, but are not limited to, EcoRI, Xbal, BamHI, Xhol, HmdIII, EcoRV, PstI, Kpnl, Stul, Sall, Ncol, Ndel, Notl, Spel and Bstel.

[0135] In one specific embodiment of the present invention, the sequence of the Parental Plasmid Platform is SEQ ID NO 1.2. RECOMBINANT CELL

[0136] The recombinant cell provides all the regulatory functions needed for the generation of the final product, namely the nanostructure-ended double-stranded covalently- closed linear DNA molecules. These functions are: constitutive expression of two suitable protein repressors (e.g.: LacI and AraC) needed for: 1) Inducible expression of the reverse transcriptase (RT) along with the recombinase that catalyzes the fusion between the retrons and the linear DNA module, and 2) inducible expression of an endonuclease which promotes degradation of residual parental DNA after the generation of the nanostructure-ended doublestranded covalently-closed linear DNA molecules. Inducible expression of the Retrotranscriptase and Recombinase is catalyzed by addition of a suitable inducer (such as isopropyl-thiogalactoside -IPTG- in the case of LacI repressor) to the culture medium, while induction of the endonuclease is catalyzed by addition of another suitable inducer (such as L- Arabinose in the case of AraC repressor) to the culture medium. The endonuclease activity will degrade the residual DNA sequences of the nanostructure-ended double-stranded covalently-closed linear DNA molecules manufacturing process, derived from both the recombinant cell and the Parental Plasmid Platform, thus rendering the cells ready for nanostructure-ended double-stranded covalently-closed linear DNA molecules isolation and purification, as the sole small DNA molecules present in the bacteria.

[0137] Specifically, the recombinant cell of the present invention comprises a Repression Protein Module, a Recombinase-Reverse Transcriptase Module, and a Homing Endonuclease Module.

[0138] Preferably, as shown in Figure 2, the Repressor Protein Module, Recombinase- Reverse Transcriptase Module, and Homing Endonuclease Module are contained in a helper plasmid along with a Bacterial Backbone.

[0139] That is, the Repression Protein Module, the Recombinase-Reverse Transcriptase Module and the Homing Endonuclease Module may be part of a Helper Plasmid that is maintained episomally, or may be stably integrated into the bacterial chromosome of the recombinant cell by means of an homologous recombination process. In the latter case, the Homing Endonuclease Recognition Sequence of the Helper Plasmid should be kept outside the recombining fragment, in order to protect the bacterial genome from nuclease-dependent degradation. a. Repression Protein Module

[0140] The Repression Protein Module comprises the following genetic elements operably linked in the following order:• a First Bacterial Constitutive Promoter,• a First Ribosome Binding Site,• a First Repressor Protein Coding sequence,• a Second Ribosome Binding Site,• a Second Repressor Protein Coding sequence, and• a First Bacterial Terminator.Recombinant cell promoters and repressors

[0141] In some embodiments, the expression of the Recombinase, Reverse Transcriptase and Homing Endonuclease in the recombinant cell is under the control of inducible promoters selected from, but not limited to, the group consisting of Escherichia coliG70 promoters such as: L-Arabinose inducible promoter, IPTG-inducible promoter, Lactose- inducible promoter, Glucose-inducible promoter, Tetracycline-inducible promoter, Temperature-inducible promoter, pH-inducible promoter, HSL-inducible promoter, Maltose- inducible promoter, Xylose-inducible promoter, Phosphate-inducible promoter, or where the inducible promoter comprises E. coli o32 promoters such as: Cold-Shock-inducible promoter, or where the inducible promoter comprises E. coli o54 promoters such as glnG transcription enhancer-inducible promoter, and combinations thereof.

[0142] In a preferred embodiment, the First Bacterial Inducible Promoter is the Lac operon inducible promoter, and the Second Helper Bacterial Inducible Promoter is the pBAD inducible promoter. Even more preferably, the sequence of the pBAD inducer promoter is SEQ ID NO 26.

[0143] In some embodiments, the Bacterial Constitutive Promoter is selected from the group consisting of E. coli o70 promoters such as -but not limited to P(Bla) constitutive promoter, P(Cat) constitutive promoter, P(Kat) constitutive promoter, reverse lambda cl- regulated promoter, pBAD reverse constitutive promoter, lacQ constitutive promoter, GlnRS constitutive promoter, Trp operon constitutive promoter, tac constitutive promoter, PRNA1 promoter, Lambda Phage constitutive promoter, rrnB Pl constitutive promoter, Pspc constitutive promoter, J23119 constitutive promoter, Laclq constitutive promoter, and combinations thereof.

[0144] In a preferred embodiment, the Bacterial Constitutive Promoter is the Laclq constitutive promoter. Preferably the sequence of the Laclq constitutive promoter is SEQ ID NO 18.

[0145] In some embodiments, Repression Proteins are used to control the expression of other genes. The coding sequences can be selected from the group consisting of, but not limited to, LacI Repressor, AraC Repressor, Trp repressor, LexA Repressor, Mar repressor, RsaL Repressor, Tet repressor, PhoP Repressor, and Omp Repressor.

[0146] In other embodiments of this invention, the first repressor protein controlling the expression of the BP recombinase and the Ec86 reverse transcriptase is LacI (SEQ ID NO 19).

[0147] In further embodiments, the second repressor protein controlling the expression of I-Scel Endonuclease is AraC (SEQ ID NO 20). b. Homing Endonuclease Module

[0148] The Homing Endonuclease Module comprises the following genetic elements operably linked in the following order:• a Second Bacterial Inducible Promoter,• a Fifth Ribosome Binding Site,• a Homing Endonuclease Coding Sequence, and• a Third Bacterial TerminatorHoming Endonuclease Coding Sequence

[0149] In some embodiments, the Homing Endonuclease coding sequence encoded in the recombinant cell comprises at least one of the “LAGLIDADG” homing endonuclease family such as I- Seel endonuclease, for example, having a sequence SEQ ID NO 27, F-Scel endonuclease, F-Scell endonuclease, I-Anil endonuclease, I-Ceul endonuclease, I-Chul endonuclease, I-Cpal endonuclease, I-Cpall endonuclease, I-Crel endonuclease, I-CsmI endonuclease, I-Dmol endonuclease, I-Porl endonuclease, I-Scal endonuclease, I-Scell endonuclease, 1-SceIII endonuclease, 1-SceIV endonuclease, Pl-Scel endonuclease, PI-PspI endonuclease, PI-Tlil endonuclease, F-Suvl, or the endonuclease comprises at least one the GIY-YIG endonuclease family such as F-TevI endonuclease, F-TevII endonuclease, or the endonuclease comprises at least one of the His Cys-His Box endonuclease family such as I- Dirl, I-Hmul endonuclease, I-HmuII endonuclease, I-Ppol endonuclease, I- TevIII, or combinations thereof.

[0150] In one specific embodiment of the present invention, the system comprises a Helper Plasmid, within the recombinant cell, having a sequence SEQ ID NO 17.

[0151] The nanostructure-ended double-stranded covalently-closed linear DNA molecule in vivo manufacturing system of the present invention thus comprises: a recombinant cell comprising:a Repression Protein Module comprising: a First Helper Bacterial Constitutive Promoter, a First Helper Ribosome Binding Site, a First Repressor Protein Coding sequence, a Second Helper Ribosome Binding Site, a Second Repressor Protein Coding sequence, and a First Helper Bacterial Terminator; a Recombinase-Reverse Transcriptase Module comprising: a First Helper Bacterial Inducible Promoter, a Third Helper Ribosome Binding Site, a Recombinase Coding Sequence, a Fourth Helper Ribosome Binding Site, a Reverse Transcriptase Coding Sequence, and a Second Helper Bacterial Terminator; and a Homing Endonuclease Module comprising: a Second Helper Bacterial Inducible Promoter, a Fifth Helper Ribosome Binding Site, a Homing Endonuclease Coding Sequence, and a Third Helper Bacterial Terminator; a Parental Plasmid DNA Platform, housed in the same recombinant cell, comprising: a Retron Module comprising: a Left Retron Unit comprising: a First Parental Bacterial Constitutive Promoter, a msr sequence, a '-msd sequence, a Left Sense Stem Recombination Sequence (L-SSR), a Left DNA Nanostructure Sequence (L-DNS) inserted in a FirstMultiple Cloning Site (MCS 1), a Left Antisense Stem Recombination Sequence (L-ASR), complementary to the L-SSR sequence, a -msd sequence, and a First Parental Bacterial Terminator; a Right Retron Unit comprising: a Second Parental Bacterial Constitutive Promoter,a msr sequence, a '-msd sequence, a Right Sense Stem Recombination Sequence (R-SSR), a Right DNA Nanostructure Sequence (R-DNS) inserted in a SecondMultiple Cloning Site (MCS 2), a Right Antisense Stem Recombination Sequence (R-ASR), complementary to the R-SSR sequence, a -msd sequence, and a Second Parental Bacterial Terminator; a Linear Module comprising: a First Acceptor Recombinase Recognition Sequence (Al), a sequence selected from a DNA Spacer and an Expression Cassette inserted in a Third Multiple Cloning Site (MCS 3), and a Second Acceptor Recombinase Recognition Sequence (A2); and a Bacterial Backbone comprising: a Parental Bacterial Origin of Replication, a Parental Selection Marker, and a Parental Homing Endonuclease Recognition Sequence (HRE), wherein the retron units, linear module, and bacterial backbone are contained in at least one Cloned Parental Plasmid DNA.

[0152] According to some embodiments, the Repressor Protein Module, Recombinase- Reverse Transcriptase Module, and Homing Endonuclease Module are contained in a Helper Plasmid DNA along with a Bacterial Backbone comprising: a Helper Bacterial Origin of Replication, a Helper Selection Marker, and a Helper Homing Endonuclease Recognition Sequence (HRE).

[0153] The genetic elements of the Parental and Helper Plasmids and the recombinant cell are operably linked preferably in the aforementioned order. However, It is contemplated within the scope of the invention that the modules and genetic elements can be arranged in a different order as long as the integral functionality of the system is not affected.

[0154] Bacterial Terminators

[0155] In some embodiments, the Bacterial Transcriptional Terminator sequences are selected from the group consisting of, but not limited to, bacterial terminators such as Rho- dependent terminators like Tryptophan operon terminator, rRNA operon terminators, NhaA gene terminator and Cold shock (cspA) gene terminator, and / or Rho-independent terminators such as (but not limited to) Phage T7 terminators, such as a T7 terminator with a sequence SEQ ID NO 3 or SEQ ID NO 28, Lambda phage terminator, Riboflavin (rib) operon terminator, Glutamine (gin) operon terminator, RrnB T1 terminator, for example, having a sequence SEQ ID NO 25, and Sulfate (sue) operon terminator.

[0156] In preferred embodiments, the terminators are the RrnB T1 Rho-independent terminator sequence, and the T7Te Rho-independent terminator sequence in the Parental plasmid, and RrnB T1 Rho-independent terminator sequence, the T7 Rho-independent terminator sequence, and the Laclq Rho-independent terminator sequence in the Helper plasmid. Even more preferably, the Laclq Rho-independent terminator sequence is the SEQ ID NO 21.

[0157] Plasmid Backbone

[0158] In some embodiments, the Plasmid Backbone comprises an Origin of Replication, a Selection Marker Cassette and a Homing Endonuclease Recognition Sequence.

[0159] In some embodiments, the Origin of Replication can be selected from the group consisting of, but not limited to, pUC19-derived Origin of Replication, pBR322-derived Origin of Replication (having a sequence such as SEQ ID NO 9), pl5A-derived Origin of Replication, pSCl 01 -derived Origin of Replication, Pir-R6K Origin of Replication, trfA-oriV Origin of Replication, Ml 3 Phage Origin of Replication, fl Phage Origin of Replication, PhiX174 / ProteinA Ori Origin of Replication, and pT181 (RepC) Origin of Replication.

[0160] In preferred embodiments, the Parental Bacterial Origin of Replication is pUC19-derived Origin of Replication.

[0161] In preferred embodiments, the Helper Bacterial Origin of Replication is pBR322-derived Origin of Replication.

[0162] In some embodiments, the Selection Marker can be a Selection Marker Cassette composed of a Bacterial Promoter, an RBS Sequence, an antibiotic resistance coding sequence(or -alternatively- a non-antibiotic resistance coding sequence, and a Bacterial Terminator. The antibiotic resistance coding sequence can be selected from the group consisting of, but not limited to, ampicillin resistance gene, kanamycin resistance gene, gentamicin resistance gene and chloramphenicol resistance gene, while coding sequences for non-antibiotic selection systems are selected from, but not limited to, the group consisting of the following selection systems: dapD complementation, infA complementation, Amino Acid auxotrophy complementation, RNA-OUT or combinations thereof.

[0163] In preferred embodiments, the Parental Selection Marker is the Kanamycin Resistance Cassette. Preferably, the sequence of the Kanamycin Resistance Cassette is SEQ ID NO 8.

[0164] In preferred embodiments, the Helper Selection Marker is the Chloramphenicol Resistance Cassette.

[0165] In a preferred embodiment, the Parental and Helper Homing Endonuclease Recognition Sequence is the I-Scel endonuclease recognition sequence. (SEQ ID NO 10).

[0166] Ribosome Binding Sites

[0167] In some embodiments, The Ribosome Binding Site can be selected from the group consisting of, but not limited to, Eshcerichia coli Shine-Dalgarno DNA Sequences. In preferred embodiments, the RBS sequence is AGGAGGU, located between the -14 and -8 position of the translation start site.II. MANUFACTURING PROCESS

[0168] In another aspect of this invention, a nanostructure-ended double-stranded linear covalently closed DNA molecule in vivo manufacturing process is provided. This process allows the combination of several possible different right and left DNA nanostructures with a central double-stranded linear DNA linker (which can further function as a gene expression cassette). Said manufacturing process is based on the aforementioned manufacturing system, comprised by the recombinant cell and parental plasmid platform, where the parental plasmid platform is engineered according to the intended application.

[0169] In particular, the nanostructure-ended double-stranded linear covalently closed DNA manufacturing process comprises the steps of:1. cloning DNA Nanostructured Sequences (DNS) in multiple cloning sites MCS1 and MCS2 and a sequence selected from a DNA spacer and an expression cassette in multiple cloning site MCS3 of the Parental Plasmid Platform of the present invention,2. transforming the recombinant cell with the cloned parental plasmid platform, forming the system of the present invention, in order to allow the constitutive promoters to transcribe Retron RNA Molecules from the retron units,3. promoting the expression of the Reverse Transcriptase encoded in the recombinant cell by the addition of a suitable inducer, in order for the Reverse Transcriptase to recognize the Retron RNA Molecule templates and generate Left and Right Retron Donor DNA Molecules, comprising a Nanostructured DNA End and a Donor Sequence (D), wherein the Nanostructured DNA is formed by the DNS sequence and the Donor Sequence is formed by the annealing of ASR and SSR,4. promoting the expression of the Recombinase protein encoded in the recombinant cell by the addition of a suitable inducer, in order for the Recombinase to produce recombination of the Left and Right Retron Donor DNA Molecules with the First and Second Acceptor Recombination Sequences contained in the Linear Module of the engineered parental plasmid platform so as to generate Nanostructure-Ended Double-Stranded Covalently-Closed Linear DNA molecules,5. promoting the expression of the Homing Endonuclease encoded in the recombinant cell by addition of a suitable inducer in order to produce double-strand cuts in the Homing Endonuclease Recognition Sequences on all extragenomic DNA molecules that carry the Homing Endonuclease Recognition Sequences; and6. isolating the resulting nanostructure-ended double-stranded linear covalently closed DNA molecules from the recombinant cell.

[0170] Figures 3 to 8 represent a possible embodiment of said process. The specific sequences illustrated for DI, Al, D2 and A2 are provided by way of example.

[0171] As can be appreciated from Figure 3, briefly, after forming the system of the present invention with the desired sequences cloned in the Parental Plasmid, the Left and Right Retron Donor DNA Molecules are generated in the Third Step, and subsequently recombined with the linear double-stranded DNA Module during the Fourth Step. The Fifth Step involves the nuclease-directed digestion of the residual DNA molecules of the process, leaving the nanostructure-ended double-stranded covalently-closed linear DNA molecules ready to be isolated and purified by processes well-known in the art.

[0172] Figures 4 to 8 show first to fifth steps of this manufacturing process in detail.

[0173] Figure 4 illustrates the cloning that is carried out on multiple cloning sites of theParental Plasmid of the present invention prior to forming the manufacturing system.

[0174] Figure 5 shows the generation of the recombinant cell of the present invention, according to some embodiments, by co-transformation with the helper and engineered parental plasmids, forming the manufacturing system.

[0175] As depicted in Figure 6, expression of the retrotranscriptase from the Helper Plasmid by proper induction with, for example, IPTG, allows the Retron Module of the Parental plasmid to produce Left and Right single-stranded nanostructure-DNA Ends which fold independently to form cohesive double-stranded termini compatible with the recombination reaction of Step 4.

[0176] Specifically, after incorporating a parental plasmid into a recombinant cell in accordance with the manufacturing system of the present invention, its parental bacterial constitutive promoters transform the retron units producing Retron RNA molecules (Right and Left). When these Retron RNA molecules are subjected to the activity of the retrotranscriptase enzyme, single stranded DNA molecules comprising a Retron Donor DNA Molecule are generated. Each Retron Donor DNA Molecule (Right and Left) in turn comprises a Nanostructured DNA End and a Donor Sequence, these being a consequence of the structural rearrangement of the sequences DNS, and ASR and SSR, respectively.

[0177] In some embodiments, the Donor Sequences (DI and D2) are selected from the group consisting of, but not limited to, PhiC31 attP recombinase recognition sequence such as but not limited to AttPl and attP2, phiC31 attB recombinase recognition sequence such as but not limited to attBl and attB2, CRE recombinase recognition sequence (LoxP), Flprecombinase recognition sequence, Lambda recombinase recognition sequence, ResT recombinase recognition sequence, cppK02 telRL sequence, the FRT sequence, TelN recombinase recognition sequence, PY54 Tel recombinase recognition sequence, VP882 TelK recombinase recognition sequence, QHAP-1 Tel recombinase recognition sequence, B. burgdorferi Tel recombinase recognition sequence, B. hermsii Tel recombinase recognition sequence, B. parkeri Tel recombinase recognition sequence, B. recurrentis Tel recombinase recognition sequence, B. turicatae Tel recombinase recognition sequence, B. anserine Tel recombinase recognition sequence, A. tumefaciens C58 ResT recombinase recognition sequence, and combinations thereof.

[0178] In preferred embodiments, the Donor Sequence DI is the attB2 Recombinase Recognition Sequence. In even more preferred embodiments, the Recombinase Recognition Sequence is SEQ ID NO. 5.

[0179] In preferred embodiments, the Donor Sequence D2 is the attBl Recombinase Recognition Sequence. In even more preferred embodiments, the Recombinase Recognition Sequence is SEQ ID NO. 4.

[0180] Figure 7 shows the co-expression of the recombinase, for example, PhiC31 recombinase having a sequence such as SEQ ID NO 23, along with retrotranscriptase from the Third Step, which allows the recombination of Left and Right single-stranded DNA molecules produced during the Third Step with the First and Second Acceptor Recombination Sequences of the Linear Module of the Parental Plasmid, rendering nanostructure-ended double-stranded covalently-closed linear DNA molecules.

[0181] The Donor Sequences are recognized by the Hepler Plasmid expressed Recombinase in order to recombine each Retron Donor DNA Molecule to the Acceptor Recombination Sequences present in the Linear Module of the Parental Plasmid.

[0182] Other Suitable inducers can be selected from, but not limited to, Isopropyl 0-D- 1 -thiogalactopyranoside (IPTG) for the induction of Lac Promoter (pLac) having a sequence such as SEQ ID NO 22, L-Arabinose for the induction of AraBAD promoter (pBAD), Tetracycline for the induction of Tetracycline promoter (pTet), Tryptophan for the induction of Trp promoter (pTrp), L-Rhamnose for the induction of Rhamnose promoter (pRha), D- Xylose for the induction of Xylose promoter (pXyl, Temperature Shift (heat induction) for the induction of Page X promoter (pX), Nitric Oxide for the induction of Nitric oxide (NO) promoter(pNOrV), Cold shock for the induction of CspA promoter (pCspA), Maltose for the induction of MalT-dependent malP promoter (pMalP).

[0183] Figure 8 represents the induction of the expression of homing endonuclease, for example I-Scel, from the Helper Plasmid by addition of an inducer, such as an arabinose inducer, which catalyzes the digestion of residual Helper and Parental Plasmid sequences, allowing direct purification of the manufacturing process of the Nanostructure-Ended Double-

[0184] Stranded Covalently-Closed Linear DNA molecules, for example, by standard low molecular weight DNA isolation protocols from bacteria. This promotes the degradation of the residual DNA molecules by exonucleases present in the host cell.

[0185] The isolation of the resulting nanostructure-ended double-stranded linear covalently closed DNA molecules from the recombinant cell can be performed by isolation procedures well known in the art, such as by low-molecular weight DNA isolation procedures.III. NANOSTRUCTURE-ENDED DOUBLE- STRAND ED COVALENTLY-CLOSED LINEAR DNA MOLECULES

[0186] In yet another aspect of this invention, a Nanostructure-Ended Double-StrandedCovalently-Closed Linear DNA molecule is provided, wherein such DNA molecule is produced by the aforementioned process and system.

[0187] In general, several different nanostructure-ended double-stranded covalently- closed linear DNA molecules can be produced by the manufacturing process and system formerly described. A list of possible configurations and combinations of double-stranded linear DNA linkers (linear modules) and ends (nanostructures), comprising the nanostructure- ended double-stranded covalently-closed linear DNA “family” of functionalized molecules is incorporated below (some of them being schematically illustrated in Figure 9). This list by no means pretends to be exhaustive.1. TrEx nanostructure-ended double-stranded covalently-closed linear DNA molecules

[0188] Gene therapy is becoming a promising therapeutic modality for the treatment of genetic and acquired disorders. Gene therapy is defined as the introduction of a foreign genetic material into a host cell (in-vivo or ex-vivo) to prevent, treat and, ultimately, cure diseases by changing the expression of a gene. It provides a unique approach to treat both inherited and acquired genetic and non-genetic disorders by delivering a therapeutic gene and its associatedregulatory elements into the nucleus. Also, other pathological conditions, such as cancer or heart disease, among others, can be treated by supplying genetic sequences that can express a protein or even non translatable RNA to correct the disease.

[0189] Other medical uses for the introduction of foreign DNA into a patient's cells is to achieve the expression of antigens which could confer immunological advantages for the treatment of cancer, autoimmune diseases, or for the prevention or elimination of infections.

[0190] Clinical trials implementing these DNA vaccines are steadily growing, especially after the world has witnessed the safety and effectiveness of nucleic acid-based vaccines against SARS-CoV-2 during the COVID-19 pandemics.

[0191] The utility of any gene therapy strategy is defined by its balance between safety and effectiveness. While virus-derived vectors offer the exceptional potential to target and deliver DNA cargo with high efficiency into the target cell, viral strategies often have several safety concerns, and recent viral gene therapy-related patient mortalities in clinical trials highlight some of the safety issues attributed to the use of viral gene transfer systems that include, but are not limited to unwanted immune responses to viral capsid proteins, regeneration of virulent particles, insertional mutagenesis, difficulty in manufacturing and limited opportunity for repeated administrations due to acute inflammatory response. In contrast, non-viral strategies based on naked DNA vectors, generally offer safer approaches. DNA vectors are relatively easy to manufacture and store and offer tremendous design capacity, cell or tissue specificity can be achieved by harnessing cell-specific functionality in the design of chemical or biological vectors, while physical procedures can provide spatial precision. Other practical advantages of nonviral approaches include the potential for repeated administration, lack of immunogenicity, low toxicity, and potential for tissue specificity. Several major barriers need to be considered in order to develop non-viral gene delivery systems as a therapeutic product to be safely administered in vivo.

[0192] For the gene therapy to be successful the transgene delivery system has to be effective in inserting DNA molecules into the mammalian cell cytoplasm and, ultimately, into the nucleus for achieving proper expression of the encoded transgene(s). Naked natural DNA molecules do not enter cells efficiently because of their large size and hydrophilic nature due to their negatively charged phosphate groups. Therefore, the primary challenge for gene therapy is to develop biological or chemical vectors or physical methods that facilitate gene transfer to targeted cells without degradation of the delivered gene. Current FDA approved31nucleic acid based gene therapies using chemically modified oligonucleotide based gene therapies include: Spinraza, Exondys 51 and Vyondys 53.

[0193] Although several cell transfection methods have been developed for oligonucleotide delivery to patients' cells, virtually all of them present one or more drawbacks such as unwanted immune responses, cytotoxicity, or low transfection efficiencies.

[0194] Thus, in a preferred embodiment of the present invention, the nanostructure- ended double-stranded covalently-closed linear DNA molecules produced by the manufacturing system and process bears a central double-stranded linear expression unit flanked by two nanostructured aptameric ends. Said resulting DNA molecule is denoted hereinafter as TrEx (transfection & Expression unit) nanostructure-ended double-stranded covalently-closed linear DNA molecule. The aptamers at the ends of the molecule serve for recognition of a target cell's receptor, triggering endocytosis, followed by endosomal escape.

[0195] In order for the transforming DNA molecules to gain access to the cytoplasm to start expressing their information cargo, endosomal escape must be guaranteed after the endocytic process takes place, before lysosome-derived hydrolases completely degrade the endolysosomal vesicle's content. Right after lysosomal fusion to the endosome, ATP-driven proton pumps rapidly acidify the luminal compartment of the endolysosome, paving the way for acid hydrolases to activate their catalytic properties. In nature, the selective pressure exerted by this process onto enveloped and non-enveloped viruses lead to the development of different adaptations aimed at achieving a timely endosomal escape of the virions before hydrolytic degradation ensues. For enveloped viruses, these strategies are based on the action of fusogenic proteins which orchestrate an efficient fusion process of the viral envelope and the endosomal membrane, allowing the capsids containing the viral genome to rapidly exit the vesicle and access the cytoplasm, where it starts its replication process.

[0196] Non-enveloped viruses on the other hand, make use of direct protein disruptors of the endosomal membrane structural integrity, leading to the lysis of the vesicle, ensuing viral escape.

[0197] But apart from these natural mechanisms, engineered molecules have also been demonstrated to be able to escape the endosomal compartment. Although the details are still a matter of debate, the most widely accepted explanation for these observations is known as the “proton sponge” model. In this mechanistic view, the process is supposed to start with theendosomal compartment acidification triggered by lysosomal fusion. Provided that any of the luminal components has the capacity to bind to and retain some of the incoming protons, the necessity of extra protons to achieve the optimal pH for hydrolytic degradation will drive an excessive accumulation of net charge in the lumen. This in turn leads to chloride ions to passively permeate the endosomal membrane from cytoplasm to lumen. The progressive buildup of HC1 in the luminal space triggers an osmotic imbalance between the endosome and the cytosol, which will cause the rapid lytic rupture of the endosomal membrane, freeing its contents to the cytoplasmic compartment. Some of the most frequently used agents for achieving the delivery of DNA into cells and successful gene expression are hypothesized to show some proton sponging capacity. This is mostly due to the presence of amino groups which should be able to titrate protons entering the endosomal lumen. Thus amino groups in delivery molecules would serve two different purposes: on one hand, they promote nucleic acid binding, due to the electric complementarity with negatively charged phosphate groups on the backbone and, secondly, facilitating endosomal escape by proton sponging. This is thought to be the case for bupivacaine, and polyamines such as poly-L-lysine, chitosan or polyethylenimine (PEI).

[0198] The transfection strategy implemented by the TrEx nanostructure-ended double-stranded covalently-closed linear DNA molecules of the present invention could exploit the specific binding capacity of one of its two aptamers to capture an abundant protein naturally present in serum (human serum albumin) whose constituent basic amino acids may act as proton sponges, contributing to the process of endosomal escape of the TrEx nanostructure- ended double-stranded covalently-closed linear DNA molecule to the cytoplasm. Alternatively, DNA aptamers can be designed to mimic virus-derived membrane destabilizing proteins which may contribute to the enhancement of the endosomal escape of the therapeutic DNA molecules. Finally, the whole TrEx nanostructure-ended double-stranded covalently-closed linear DNA molecule can be complexed with accessory agents and molecules (like lipids such as DOPE, DOTAP, etc.; or poly cationic compounds such as chitosan, polyamines, etc.) which might enhance cell entry and / or endosomal escape.

[0199] Besides strategies aimed at achieving entry of the DNA molecules into the cell cytoplasm, several nuclear import techniques are currently being developed. Although the nuclear import of DNA molecules from the cytoplasmic compartment is not a normal event in the cell, several mechanisms exist for their transportation. These nuclear translocation mechanisms have evolved over billions of years, as viruses and other pathogens have perfectedtheir way to invade the host. In one example, the SV40 virus genome ensues a “molecular hijacking” process where binding to host proteins while they are in their regular transit to the nucleus occurs.

[0200] Some of the strategies aimed to achieve proper nuclear localization of nucleic acids artificially delivered to the cell include the modification of DNA molecules with a covalent linkage to a protein bearing a Nuclear Localization Signal (NLS), and / or attachment to nuclear import receptors such as Karyopherins. On the other hand, the direct engineering of DNA by the incorporation of Nuclear Targeting Sequences (NTS) also results in highly efficient translocation of linear DNA molecules without the need of further modification of the molecule. The mechanism consists in conferring a DNA molecule with one or more NTS, which are short consensus motifs recognized and bound by specific transcription factors (TFs) which in turn can carry the DNA molecule to the nucleus by interacting with the nuclear pore complex.

[0201] Some of the current approaches to gene therapy involve some form of recombination of foreign genetic elements into the host's genome. However, the integration of foreign DNA sequences into the genome of in vitro cultured cells or even live organisms may have detrimental consequences, especially when used for gene therapy. DNA insertions into the genome may have far-reaching effects such as insertional mutagenesis, activation of proto- oncogenic zones or silencing by de novo methylation of the introduced gene or the nearby cellular DNA. To circumvent problems inherent to genomic integration, the development of episomal or extrachromosomal eukaryotic DNA platforms or vectors offers an attractive and safe alternative. Episomal platforms harboring one or more transcriptional units are DNA sequences capable of being maintained in a non-integrated way in the host nucleus, while providing sustained or regulated gene expression in order to correct genetic defects or even prevent, treat or cure a disease.

[0202] In order to obtain a long-term expression of a protein of interest, DNA molecules can also be engineered to maintain a certain stability in the cell nucleus. For that purpose, several virus-derived and self-derived DNA sequences can be added to the linear DNA molecules. Natural chromosomes of eukaryotic cells have Matrix Attachment Regions (MARs) that are operationally defined as A / T-rich DNA elements that bind specifically to the protein nuclear matrix. These elements are frequently located in gene-rich areas associated with actively transcribed units and there is evidence that they can reduce or totally abrogate someforms of gene silencing. Genes flanked by MAR sequences have been shown to exhibit less variation in expression among independent transgenic plants or cell culture lines. In particular, MARs appear to prevent silencing caused by multiple transgene copies in cis. There is some conjecture as to the precise role of MAR sequences in transgene cassettes, but current hypotheses suggest that they may act as boundary elements facilitating the formation of decondensed chromatin loops that in turn enhance transgene transcription and reduce some forms of gene silencing.

[0203] Another virus-derived element used for introducing extra chromosomal material into cells is based on genetic elements of the polyomavirus, Simian virus 40 (SV40). This virus exhibits a replication pattern that is uncoupled from the regulatory mechanisms of the host cells so that each viral genome replicates many times with each cell cycle. As a consequence transfection of cells with recombinant SV40 vectors ultimately results in cell death, limiting this vector to transient expression set-ups. For stable long term expression, several episomal vectors based on viral sequences have been designed and each of these vectors contains an SV40 origin of replication and one or more viral early genes, activating the viral origin and thus allowing the episome to reside in the cell in a stable and replicative manner. According to the state of the art, the placement of an SV40 origin of replication in the vicinity of an S / MAR sequence in a genetic construct has the capability of driving replication of said genetic construct at very low copy numbers, in a cell cycle-synchronized fashion, and is stably maintained without selection for more than 100 generations. This becomes especially relevant when considering a therapeutic approach that requires transfection of replicative cells with the TrEx nanostructure-ended double-stranded covalently-closed linear DNA molecule of this invention.

[0204] Episomal vectors present several advantages such as the non-disruption of the gene of interest which often occurs from integration into genomic DNA. Also, the presence of the transgene does not lead to the rearrangement or disruption of important transcriptionally active regions. Besides, episomal vectors can be designed to persist in multiple copies in the nucleus, resulting in greater transcriptional activity of the gene of interest, as long as the necessary virus-derived trans-acting factors are supplied.

[0205] The linear DNA module of TrEx nanostructure-ended double-stranded covalently-closed linear DNA molecules thus comprises at least one DNA Nuclear Targeting Sequence (DNTS), at least one Scaffold Matrix Attachment Region (S / MAR) and at least one expression cassette, and -optionally- one origin of replication.

[0206] In summary, this molecule allows cell-specific transformation and selective episomal expression of a gene of interest in the target cell. These functions make TrEx nanostructure-ended double-stranded covalently-closed linear DNA molecules an ideal tool for gene therapy and DNA-based vaccination approaches.2. Bi-specific nanostructure-ended double-stranded covalently-closed linear DNA molecules

[0207] Antibodies, also known as immunoglobulins, are proteins produced by the immune system to combat various diseases and infections. Their unique structural and functional attributes make them indispensable components of the body's immune response. In recent years, antibodies have garnered significant attention in fields such as disease diagnostics, vaccine development, and targeted therapy.

[0208] Antibodies are typically Y-shaped molecules composed of two heavy and two light chains linked via disulfide bonds. Each antibody has two regions: the constant or “Fc” region, which defines the class of the antibody, and the variable region, which determines the antigen specificity. Antibodies exhibit high specificity towards the antigens that stimulated their production. They recognize and bind to specific epitopes on antigens, forming an antigenantibody complex. This binding leads to a series of events that facilitate the neutralization, opsonization, or lysis of the pathogen, ultimately aiding in the clearance of the infectious agent from the body.

[0209] Antibody production is a sophisticated process involving several steps, including B-cell maturation, activation, differentiation, and proliferation. During a primary immune response, naive B-cells that recognize the invading pathogen through their B-cell receptors (BCRs) undergo activation. They differentiate into plasma cells, which produce and secrete large amounts of antibodies specific to the recognized antigen. Memory B-cells are also generated during this process, providing quicker and more potent responses during subsequent exposures to the same antigen.

[0210] Over the years, antibodies have found broad applications in the field of medical diagnostics. Techniques like ELISA (Enzyme-Linked Immunosorbent Assay), immunofluorescence or immunohistochemistry rely on the antigen-antibody interaction to detect the presence of specific pathogens or analytes in patient samples, tissues, cells or fluids. In recent years, the potential of antibodies as therapeutic agents has also been explored.Monoclonal antibodies -antibodies produced by a single clone of B cells, all identical and specific to the same epitope- have become crucial in treating several diseases, including cancers, autoimmune disorders, and infectious diseases. The COVID-19 pandemic further highlighted the role of monoclonal antibodies and convalescent plasma (rich in antiviral polyclonal antibodies taken from patients) in therapeutic interventions.

[0211] In Vitro Antibody Uses

[0212] The uses of antibodies extend far beyond the confines of the human immune system. Today, in vitro applications of antibodies have become a cornerstone in scientific research, clinical diagnostics, and therapeutics. This essay will delve into the versatile uses of antibodies in m vitro settings, spotlighting their roles in immunological assays, therapeutic drug monitoring, and research involving protein identification and characterization.

[0213] Enzyme-Linked Immunosorbent Assay (ELISA) is one of the most commonly used immunological assays that capitalizes on the antigen-antibody interactions. Through direct, indirect, sandwich, or competitive ELISA, scientists can detect the presence and quantify the concentration of an antigen or antibody in a sample. This technique is invaluable for diagnosing infections, measuring protein concentration, and determining the immune response to a particular antigen.

[0214] In a similar vein, western blotting employs antibodies to detect specific proteins in a sample. After separating proteins by electrophoresis and transferring them onto a membrane, the desired protein can be identified and quantified using specific primary antibodies, then visualized by means of secondary antibodies coupled to chromogenic or fluorogenic enzymatic activities. Western blotting is widely used in research for protein identification and understanding post-translational modifications.

[0215] Flow cytometry is another application where antibodies are used to analyze cell populations. Fluorescently-labeled antibodies bind to specific antigens on the cells' surface, enabling their detection and sorting based on emitted fluorescence. This technique is particularly beneficial in assessing immune cell populations, analyzing cell surface markers, and in cancer diagnostics.

[0216] Therapeutic drug monitoring (TDM) is a clinical practice that measures specific drug levels at designated intervals to maintain a constant concentration in a patient'sbloodstream. Antibodies play an integral role in TDM, as they are used in immunoassays designed to quantify drug concentrations. For example, digoxin, an important drug used to treat heart failure, can be measured using a radioimmunoassay. The principle is based on competition between radiolabeled digoxin and the patient's serum digoxin for a limited amount of digoxin-specific antibody.

[0217] Monoclonal antibodies, due to their specificity towards a single epitope, are utilized in protein characterization studies. They help in understanding protein expression patterns, post-translational modifications, and the investigation of protein-protein interactions.

[0218] Immunoprecipitation and co-immunoprecipitation assays use antibodies to precipitate proteins and protein complexes from cell lysates. The -at least- dual antigen-binding domains of antibodies enable simultaneous binding of two antigenic molecules, allowing molecular bridging among several antigenic molecules at the same time, thus increasing the effective molecular weight of the immune complex, promoting its desolvation and precipitation out of solution. These techniques provide insights into protein-protein interactions and the dynamics of protein complexes.

[0219] In a similar approach, antibodies are used in chromatin immunoprecipitation (ChIP) assays, which study protein-DNA interactions in vivo. In these assays, DNA-binding proteins (such as transcription factors or modified histones) are cross-linked to DNA. Antibodies specific to these proteins are used to pull-down the protein-DNA complexes, followed by sequencing or PCR to identify the DNA sequences of interest.

[0220] Antibodies also play a significant role in the visualization of specific molecules in imaging studies on tissues or cells. Immunohistochemistry (IHC) and immunofluorescence (IF) are two such techniques. IHC uses antibodies to visualize the distribution and localization of specific antigens in cells or tissue sections, with a chromogenic substrate providing the visual signal. On the other hand, IF employs fluorescence-tagged antibodies, which, under appropriate excitation light, enable the visualization of the target antigen.

[0221] Solid-phase agarose beads can be chemically linked to antibodies, to manufacture affinity chromatographic columns, where a mixture or whole protein extract is applied to the column, and only the analyte of interest is retained in the column's matrix due to specific binding to the antibodies in the column.

[0222] In Vivo Antibody Uses

[0223] Monoclonal and polyclonal antibodies are powerful tools in the field of immunotherapy, offering new and effective treatment options for a wide range of diseases. These antibodies are produced by the immune system or through laboratory techniques and can be harnessed for a wide range of therapeutic applications. Monoclonal antibodies provide precise targeting and tailored therapy, while polyclonal antibodies offer broad-spectrum coverage and immunomodulatory effects.

[0224] Monoclonal antibodies are engineered to be highly specific to a single target antigen. This uniformity allows for precise targeting of disease-related molecules or cells.

[0225] Cancer Therapy: Monoclonal antibodies have revolutionized cancer treatment. They can be designed to target cancer-specific antigens, such as overexpressed cell surface receptors. Examples include trastuzumab, which targets HER2 / neu in breast cancer, and rituximab, which targets CD20 in B-cell lymphomas. Monoclonal antibodies can induce cell death, inhibit growth signaling pathways, or recruit immune cells to attack cancer cells.

[0226] Autoimmune Disorders: Monoclonal antibodies are used to modulate the immune system in autoimmune diseases. For example, infliximab and adalimumab target tumor necrosis factor-alpha (TNF-a) in rheumatoid arthritis and inflammatory bowel disease, reducing inflammation and improving symptoms.

[0227] Infectious Diseases: Monoclonal antibodies can be developed to neutralize pathogens or their toxins. They have been successful in the treatment of viral infections like HIV and hepatitis C, where they can bind to viral envelope proteins and prevent viral entry into host cells. Monoclonal antibodies also hold promise in the fight against emerging infectious diseases, such as COVID-19, with the development of antibodies targeting the SARS-CoV-2 spike protein.

[0228] Polyclonal antibodies, on the other hand, are derived from a diverse population of B cells, resulting in a mixture of antibodies targeting multiple epitopes on an antigen. They are produced by immunizing an animal with an antigen and harvesting the antibodies from its serum. Polyclonal antibodies offer several advantages in therapeutic applications.

[0229] Infectious Diseases: Polyclonal antibodies can provide immediate immune protection against pathogens. They are commonly used for post-exposure prophylaxis in conditions like rabies or botulism. Polyclonal antibodies contain a variety of antibodies, each with unique specificities, allowing for broad-spectrum neutralization of different strains or variants of a pathogen. For example, antibodies can bind to specific protein molecules on the surface of a virus, hampering its capacity to bind its natural targets, such as cell receptors that mediate pathogen entry to host cells. Other approaches exploit the opsonizing activity of antibodies, by enhancing pathogen clearance by the process of phagocytosis.

[0230] Antibodies as antitoxins: polyclonal and monoclonal antibodies can be administered to patients to neutralize certain toxins such as diphtheria toxin, tetanus toxin, snake or scorpion venoms, for example. These antibodies are a form of passive immunity, where a patient that has recovered from infections or intoxications, naturally develops specific antitoxin antibodies that can be harnessed to confer protection to the same toxins in other patients.

[0231] Immunomodulation: Polyclonal antibodies can modulate the immune system by affecting multiple targets. For instance, intravenous immunoglobulins (IVIG) derived from pooled human plasma are used to treat immune deficiencies or autoimmune disorders. IVIG contains a mixture of antibodies that can regulate immune responses, suppress autoantibody production, and modulate inflammatory processes.

[0232] Transplantation: Polyclonal antibodies are utilized in transplant medicine to prevent organ rejection. Antibodies such as antithymocyte globulin (ATG) or antilymphocyte globulin (ALG) are administered to deplete T cells and suppress the immune response against the transplanted organ.

[0233] As research continues, the therapeutic potential of these antibodies will likely expand, providing hope for improved patient outcomes and novel treatment approaches.

[0234] Immunotherapy

[0235] Unlike traditional therapeutic approaches such as drug-based therapy, surgery or lifestyle prescriptions, immunotherapy harnesses the power of the body's own immune system to cope with disease. By leveraging the body's immune system, immunotherapy holds promise in combating infectious diseases or autoimmune disorders, enabling the regenerationof damaged tissues, or even treating cancer. This expansion of immunotherapy's scope exemplifies its profound potential to reshape the landscape of medical treatment and improve patient outcomes.

[0236] Infectious Disease Treatment: As mentioned above, monoclonal and polyclonal antibodies can be engineered to specifically target and neutralize pathogens. In the case of viral infections such as COVID-19, monoclonal antibody therapies like bamlanivimab and casirivimab / imdevimab have been authorized for emergency use, helping to reduce disease severity and hospitalizations.

[0237] Vaccines: Vaccines are a form of immunotherapy that primes the immune system to recognize and mount a robust response against specific pathogens. Vaccines have played a crucial role in eradicating or significantly reducing the impact of diseases like polio, measles, and hepatitis. Recent advancements in mRNA vaccine technology, as demonstrated by the COVID-19 mRNA vaccines from Pfizer-BioNTech and Moderna, have further highlighted the potential of immunotherapy in rapidly developing effective vaccines.

[0238] Autoimmune Disease Management: Immunotherapy has shown promise in managing autoimmune diseases, where the immune system mistakenly attacks healthy tissues. Examples include i) Immune Modulators: Biologic drugs, such as TNF inhibitors and interleukin inhibitors, modulate the immune system's activity to reduce inflammation and suppress autoimmune responses. These therapies have revolutionized the management of conditions like rheumatoid arthritis, psoriasis, and inflammatory bowel disease, providing relief and improving quality of life for many patients; ii) Tolerance-Inducing Therapies: Research is actively assaying tolerance-inducing therapies that retrain the immune system to tolerate self-antigens. This approach holds promise for conditions like multiple sclerosis and type 1 diabetes, where the immune system mistakenly targets specific cells or tissues.

[0239] Tissue Regeneration and Transplantation: Immunotherapy has also shown potential in tissue regeneration and transplantation, aiming to overcome rejection and promote healing. Examples include: i) Stem Cell Therapies: Stem cells possess unique regenerative properties and can differentiate into various cell types. Immunotherapy approaches, such as the use of immune-modulating drugs or engineering cells to evade immune recognition, can enhance the success of stem cell therapies in conditions like spinal cord injuries, heart disease, and degenerative disorders; ii) Organ Transplantation: Transplant rejection occurs when theimmune system recognizes the transplanted organ as foreign. Immunotherapy drugs, such as calcineurin inhibitors and immune checkpoint inhibitors, are used to suppress the immune response and improve the success of organ transplantation.

[0240] Cancer: The immune system comprises various cells, including T-cells and natural killer (NK) cells, which possess the ability to detect and eliminate abnormal cells. However, cancer cells often develop mechanisms to evade immune surveillance. Thus Immunotherapy seeks to overcome these mechanisms and bolster the immune response against cancer.

[0241] Examples of successfully applied immunotherapy approaches to the treatment of cancer include: i) Checkpoint Inhibitors: a class of immunotherapy drugs that target proteins on immune cells or cancer cells, such as PD-1 and CTLA-4. By blocking these proteins, checkpoint inhibitors unleash the immune system to attack cancer cells. Pembrolizumab (Keytruda) and nivolumab (Opdivo) are examples of checkpoint inhibitors that have demonstrated remarkable efficacy in treating various cancers, including melanoma, lung cancer, and bladder cancer, ii)CAR-T Cell Therapy: Chimeric Antigen Receptor (CAR) T-cell therapy involves modifying a patient's own immune cells to recognize and attack cancer cells. The patient's T-cells are extracted, genetically engineered to express specific receptors targeting cancer cells, and then reintroduced into the patient's body. CAR-T cell therapy has shown remarkable success in treating certain blood cancers, such as acute lymphoblastic leukemia and diffuse large B-cell lymphoma.

[0242] Novel approaches and ongoing clinical trials based on immunotherapy approaches to the treatment of cancer include: i) Personalized Cancer Vaccines: Several clinical trials are investigating the potential of personalized cancer vaccines. These vaccines are tailored to each patient's unique tumor characteristics, stimulating the immune system to specifically recognize and attack cancer cells. Such approaches hold promise in improving treatment outcomes and reducing the risk of cancer recurrence; ii) Tumor-Infiltrating Lymphocytes (TILs) Therapy: this involves isolating immune cells present within a patient's tumor, expanding them in the laboratory, and then reinfusing them back into the patient. These activated TILs can target and destroy cancer cells. Ongoing trials are exploring the effectiveness of TILs therapy in various cancer types, including melanoma and cervical cancer; iii) Combination Therapies: Combining different immunotherapy approaches or combining immunotherapy with other treatment modalities, such as chemotherapy or targeted therapy, isan active area of research. For instance, combining a checkpoint inhibitor with a targeted therapy has shown improved outcomes in certain cancers, including melanoma and lung cancer.

[0243] Bi-specific antibodies:

[0244] Bi-specific antibodies are designed to recognize and bind to two different antigens simultaneously. This unique feature enables them to bridge different cellular components, directing immune cells to specific targets or enhancing the binding between targets. The applications of bi-specific antibodies include: a) Cancer Therapy: Bi-specific antibodies can engage immune cells, such as T-cells or natural killer (NK) cells, and redirect them to recognize and eliminate cancer cells. By binding to cancer cells and immune cells, bi-specific antibodies enhance immune cell- mediated cytotoxicity, facilitating tumor eradication. For instance, blinatumomab (Blincyto) is a bi-specific antibody approved for the treatment of acute lymphoblastic leukemia, bringing T-cells in proximity to cancer cells and stimulating immune responses against the cancer. b) Autoimmune Diseases: Bi-specific antibodies can be engineered to simultaneously bind to disease-causing antibodies and target cells involved in autoimmune disorders. By linking the disease-causing antibodies to immune cells, these bi-specific antibodies facilitate their elimination, reducing inflammation and suppressing the autoimmune response. Such approaches offer potential treatment options for conditions like rheumatoid arthritis and lupus.

[0245] Tri-Specific Antibodies:

[0246] Tri-specific antibodies take the concept of bi-specific antibodies a step further by incorporating three different binding specificities. This added complexity allows for even greater precision and versatility in targeting diseases. The applications of tri-specific antibodies include: a) Cancer Immunotherapy: Tri-specific antibodies can engage multiple immune cell populations, such as T-cells, NK cells, and macrophages, simultaneously targeting different molecules on cancer cells. By coordinating the immune response and optimizing theinteraction between immune cells and cancer cells, tri-specific antibodies have the potential to enhance tumor cell killing and overcome immune evasion mechanisms. Ongoing research is investigating the therapeutic potential of tri-specific antibodies in various cancers, including solid tumors. b) Infectious Diseases: Tri-specific antibodies can be engineered to simultaneously bind to different epitopes of a pathogen, enhancing neutralization and preventing escape mutations. By combining multiple mechanisms of action, such as blocking viral entry and enhancing antibody-dependent cellular cytotoxicity, tri-specific antibodies hold promise in the treatment of infectious diseases like HIV, influenza, and COVID-19.

[0247] Thus, in another embodiment of the present invention, the nanostructure-ended double-stranded covalently-closed linear DNA molecule is a bi-specific molecular entity, having a central double-stranded linear DNA linker, comprising a Spacer Sequence (non expressing DNA sequence) inserted in the multiple cloning site, flanked by two aptamers. The aptamers at the ends of the molecule are capable of specific recognition and binding to a molecular / cellular target like proteins, carbohydrates, lipids, etc., wherein both molecular / cellular targets are different. The resulting construct would be useful for direct physical linking of two specific molecules (or cells bearing them), like what is achieved using bi-specific antibodies, without the drawbacks associated with proteins (folding issues, thermal instability, proteolytic degradation, etc.).3. Fluorophore- and gold-binding nanostructure-ended double-stranded covalently- closed linear DNA molecules

[0248] As mentioned above, antibodies are essential for diagnostic and detection assays such as immunofluorescence, immunohistochemistry, ELISA, western blotting, lateral flow dipsticks, etc. In many of these applications, antibodies require to be conjugated to fluorescent molecules to allow detection in readout steps of the assays.

[0249] DNA aptamers can emulate antibodies in these kinds of assays, allowing the user to specifically recognize certain molecular targets, while also emitting fluorescence in order for quantitative detection to take place.

[0250] In another embodiment of the present invention, the nanostructure-ended double-stranded covalently-closed linear DNA molecule is a fluorophore-bindingnanostructure-ended double-stranded covalently-closed linear DNA molecule, having a central double-stranded linear DNA linker, comprising a Spacer Sequence (non expressing DNA sequence) inserted in the multiple cloning site, flanked by two aptamers. One of the aptamers being capable of specific recognition and binding to a fluorophore (like for example 3,5- difluoro-4-hydroxybenzylidene imidazolinone, HBI, or hydroxyethyl methyl-amino benzylidene-cyanophenyl acetonitrile, HBC), which -when bound- is strongly fluorescent. The other aptamer being capable of specific recognition and binding to a molecular target, like a protein, carbohydrate, lipid, or any other molecule of interest. Fluorophore-binding nanostructure-ended double-stranded covalently-closed linear DNA molecules avoid the need of adding a step of organic synthesis crosslinking the construct to a fluorophore (such as fluorescein or rhodamine): the sole addition of the fluorophore is sufficient for strong association of both reactants. The resulting construct would be useful for direct fluorescent staining of specific molecules, like what is achieved during direct immunofluorescence protocols.

[0251] In yet another embodiment of the present invention, the nanostructure-ended double-stranded covalently-closed linear DNA molecule is a gold-binding nanostructure-ended double-stranded covalently-closed linear DNA molecule, having a central double-stranded linear DNA linker, comprising a Spacer Sequence (non expressing DNA sequence) inserted in the multiple cloning site, flanked by two nanostructured ends. One of the ends folds into a molecular array capable of specifically binding and trapping a gold atom or gold-compound. The other end is an aptamer capable of specific recognition and binding to a molecular target, like a protein, carbohydrate, lipid, or any other molecule of interest. The resulting nanostructure-ended double-stranded covalently-closed linear DNA molecules would be useful for generating electron-dense staining of specific molecules in electron microscopy imaging protocols.4. Molecular cages and molecular traps using nanostructure-ended double-stranded covalently-closed linear DNA molecules

[0252] Molecular cages are submicroscopic devices that can encapsulate and release drugs, toxins, or other compounds in a controlled manner at specific locations. They are made up of a variety of materials, including polymers, metals, and nucleic acids. Molecular cagescan be designed to target specific cells or tissues, which makes them ideal for drug delivery applications.

[0253] One of the main advantages of molecular cages is that they can protect the encapsulated drug from degradation in the body. This is important because many drugs are unstable and can break down before they reach their target. Molecular cages can also help to avoid nonspecific toxicity by means of selective delivery of toxins to their intended targets, sparing normal or non -target cells.

[0254] Drug release by molecular cages can be achieved by using triggers that can be activated by changes in pH, temperature, or the presence of specific additional molecules.

[0255] Overall, molecular cages can help to reduce the side effects of drugs and improve their efficacy. Molecular cages can be made up of polymers, metal-organic frameworks, dendrimers, and nucleic acids. Applications for molecular cages include cancer therapy, gene therapy, and pain management.

[0256] Thus, in yet another embodiment of the present invention, the nanostructure- ended double-stranded covalently-closed linear DNA molecule is a molecular cage, having a central double-stranded linear DNA linker, comprising a Spacer Sequence (non expressing DNA sequence) inserted in the multiple cloning site, flanked by two nanostructured ends. One of the ends folds into a sort of molecular cage capable of specific recognition and trapping a specific small molecule or drug. The other end is an aptamer capable of specific recognition and binding to a molecular target, like a protein, carbohydrate, lipid, or any other molecule of interest. This nanostructure-ended double-stranded covalently-closed linear DNA molecule is pre-loaded with the drug molecule before its administration to a patient / system. When the recognition aptamer binds its target, a conformational change is induced on the cage aptamer, resulting in timely- and / or location-dependent release of the drug. This function could be applied to the directed treatment of tumors, where a toxic molecule could be delivered specifically to tumor cells upon binding of tumor-associated antigens, thus sparing normal cells.

[0257] In another embodiment of the present invention, the nanostructure-ended double-stranded covalently-closed linear DNA molecule is a molecular cage, having a central double-stranded linear DNA linker, comprising a Spacer Sequence (non expressing sequence) inserted in the multiple cloning site, flanked by two nanostructured ends. One of the ends foldsinto a sort of molecular cage capable of specific recognition and trapping a specific small molecule or drug. The other end is an aptamer capable of specific recognition and binding to a molecular target, like a protein, carbohydrate, lipid, or any other molecule of interest. In this case (as opposed to molecular cage molecules), the nanostructure-ended double-stranded covalently-closed linear DNA molecule is administered as unbound to the target molecule.

[0258] When the molecule is administered to a patient / system, if the trapping aptamer recognizes its target a conformational change is induced, resulting in the entrapment of the target molecule. Then, the other recognition aptamer eventually binds to its target in another location (secretory pathway in the patient, or outside the system into consideration) resulting in the clearance of the small target molecule off the system. This function could be applied to the selective detoxification of a patient or system under the effects of a toxic molecule.5. Nanostructure-ended double-stranded covalently-closed linear DNA molecules for lateral flow dipstick assays

[0259] In another embodiment of the present invention, the nanostructure-ended double-stranded covalently-closed linear DNA molecule is adapted for lateral flow dipstick assays, having a central double-stranded linear DNA linker, comprising a Spacer Sequence (non expressing DNA sequence) inserted in the multiple cloning site, flanked by two nanostructured aptameric ends. One of these aptamers is capable of specifically binding to streptavidin, while the other aptamer is designed to bind a specific immunoglobulin from a certain species. Thus, this molecule is the ideal linker in lateral flow dipstick assays, where the reactive bands are coated with streptavidin. This setup allows for the detection of specific antibodies present in a serum sample against a desired target, working in a similar manner as a “sandwich” ELISA works. For example, if one wants to detect immunoreactivity against SARS-CoV2 to prove viral exposure in a patient, one could use a lateral flow dipstick pretreated with nanostructure-ended double-stranded covalently-closed linear DNA molecules for lateral flow dipstick assays (equipped with a streptavidin-binding aptamer and a human IgG- binding aptamer), to enrich for general human IgG antibodies into the reactive bands. Then the dipsticks are dipped in a solution comprising a mixture of purified spike protein and specific FITC-conjugated mouse antibodies against the spike protein. While the liquid migrates onto the reactive bands, should the patient's serum contain specific antibodies against the spike protein, they will be bound by the mixture of spike protein-FITC-mouse Ig. Subsequent detection of FITC by colloidal gold-conjugated anti FITC antibodies present in the reactivebands, will stain the reactive band, indicating a positive result for presence of reactive antispike antibodies in the patient's serum.6. Catalytically active nanostructure-ended double-stranded covalently-closed linear DNA molecules

[0260] The spontaneous capacity of single-stranded nucleic acids of folding three- dimensionally into complex architectures can cause these molecules to gain specific binding, or even catalytic properties. Many so-called ribozymes or DNAzymes, have been studied and characterized to date. Among some examples of their catalytic functions are RNA / DNA cleavage, ligation, polymerization, RNA splicing, peptide bond formation and hydrolysis, small molecule cleavage, co-factor modification, oxidation, reduction, and rearrangement reactions.

[0261] Thus, the DNA nanostructured ends of the nanostructure-ended double-stranded covalently-closed linear DNA molecules can host DNAzymes, which can provide additional complementary functions to either gene therapy strategies or to binding platforms. For example, while one of the DNA ends is an aptamer providing specific recognition and transfection to a particular cell type, the other end could be an RNA-cleaving DNAzyme, programmed to degrade a specific pathogenic mRNA in the cell's cytoplasm.

[0262] Thus, in a further embodiment of the present invention, the nanostructure-ended double-stranded covalently-closed linear DNA molecule is catalytically active, having a central double-stranded linear DNA linker, comprising a Spacer Sequence (non expressing DNA sequence) inserted in the multiple cloning site, flanked by two nanostructured ends. One of the ends is composed of an aptamer capable of specific recognition of a molecular target, like a protein, carbohydrate, lipid, or any other molecule of interest. The other end carries a DNAzyme capable of catalyzing a specific chemical reaction while binding a specific ligand by means of the other aptamer. This could be used, for example as a diagnostic device, which gives off a color upon a reaction on a specific soluble chromophore, while the whole catalytically active nanostructure-ended double-stranded covalently-closed linear DNA molecule is fixed to a solid substrate coated with a specific ligand, or a process similar to an immunohistochemistry, where the colorimetric reaction catalyzed by the DNAzyme end isphysically restricted to a location where a specific ligand is present, bound by the opposite nanostructured end.IV. ASSAYS AND EXPERIMENTS1. Analysis of the Parental plasmid, Helper plasmid and DNA derivatives by agarose gel electrophoresis.

[0263] The molecular weight of the DNA molecules described in this invention were subjected to analysis by electrophoresis in 1% agarose gel. The results shown in Figure 10 confirm the production of the expected nanostructure-ended double-stranded covalently-closed linear DNA molecules upon induction. Lane 1 shows the Molecular Weight Ladder, Lane 2 shows the bands corresponding to supercoiled and relaxed Parental Plasmid forms. Lane 3 shows supercoiled and relaxed forms of the Helper Plasmid. Lane 4 shows the coexistence of both previously shown plasmid molecules in a single bacterial recipient strain, after transformation with both plasmids, followed by miniprep plasmid purification, without induction. IScel Endonuclease-mediated degradation of Parental Plasmid and Helper Plasmid ensures that the only DNA purified products are nanostructure-ended double-stranded covalently-closed linear DNA molecules, which are shown as a single band in lane 5. These nanostructure-ended double-stranded covalently-closed linear DNA molecules are demonstrated to be made exclusively of DNA, since DNAse-I treatment degrades the band completely (Lane 6). Exonuclease V is not able to degrade nanostructure-ended doublestranded covalently-closed linear DNA molecules, due to the closed nature of the molecules ends (Lane 7). Lane 8 shows that nanostructure-ended double-stranded covalently-closed linear DNA molecules are indeed made of dsDNA, since Type-2 restriction endonuclease-mediated digestion of the band produces the expected digestion products. Finally, lane 9 shows restriction endonuclease digestion exposes free DNA ends onto which exonuclease V can act, promoting complete degradation of the previously cut nanostructure-ended double-stranded covalently-closed linear DNA molecules.2. Topology analysis of nanostructure-ended double-stranded covalently-closed linear DNA molecules by polymerase chain reaction (PCR)

[0264] With the aim of demonstrating that the topological structure of nanostructure- ended double-stranded covalently-closed linear DNA molecules is as expected, three pairs of specific PCR primers were designed, which hybridize at the positions shown in Figure 11 (lower panel). Briefly, “Black” primers: FW (SEQ ID NO: 38): 5'-TTTCCACACCAACCGGTAGGC-3' ; REV (SEQ ID NO: 39): 5'-GCCGGCGTACAGGTCACTAAT-3', “White” primers: FW (SEQ ID NO: 40): 5'- AAAGGTGTGGTTGGCCATCCG-3'; REV (SEQ ID NO: 41): 5'- GTCAGCAACCAACCGGT-3 ', and “Grey” primers: FW (SEQ ID NO: 42): 5'- TGGAGTTCCGCGTTACATAACTT-3 '; REV (SEQ ID NO: 43): 5 -AGACTGCAGGCTCT AGATTCG-3 ' .These primer sequences are provided solely for use in experimental validation of the claimed nanostructure-ended linear DNA molecules and are not themselves claimed or considered part of the invention.

[0265] Below is a description of what each lane shows.

[0266] Lane 1 : Molecular Weight Ladder; Lane 2: amplification product using “black” PCR primers on nanostructure-ended double-stranded covalently-closed linear DNA molecules DNA A template (300 bp product); Lane 3: results obtained by a PCR amplification attempt using “black” primers on DNA B template; Lane 4: “white” PCR primers on DNA A template (248 bp product); Lane 5: amplification product using the “white” PCR primers on DNA B template; Lane 6: amplification product using “gray” PCR primers on DNA A template (1327 bp product); Lane 7: amplification product using “gray” PCR primers on DNA B template (1327 bp product); Lane 8: negative controls with water instead of template.

[0267] The results effectively demonstrate the covalently closed nature of the ends of the nanostructure-ended double-stranded covalently-closed linear DNA molecules.3. Fluorophore-binding nanostructure-ended double-stranded covalently-closed linear DNA molecule-mediated aptafluorescence proof-of-concept assay

[0268] As it was described as a possible embodiment of the present inventions, fluorophore-binding nanostructure-ended double-stranded covalently-closed linear DNA molecules bear a central double-stranded linear DNA linker, comprising a Spacer Sequence (non expressing DNA sequence) inserted in the multiple cloning site flanked by twonanostructured ends. One of the ends is a fluorescent aptamer thanks to its capability of specifically binding a bright fluorophore. The other end is an aptamer capable of specific recognition and binding to a molecular target, like a protein, carbohydrate, lipid, or any other molecule of interest. The resulting nanostructure-ended double-stranded covalently-closed linear DNA molecules would be useful for fluorescent staining of specific molecules, like what is achieved during direct immunofluorescence protocols.

[0269] As a proof-of-concept of the hereinafter called single-step aptafluorescence method and of the fluorophore-binding nanostructure-ended double-stranded covalently-closed linear DNA molecular tool itself, a nanostructure-ended double-stranded covalently-closed linear DNA molecule was generated, where one of the aptameric ends is a DNA aptamer well known in the art which spontaneously binds to auramine O (AO; a diarylmethane dye), enhancing its fluorescence by 100 fold. The other end was engineered to be an aptamer showing rabies virus glycoprotein (RVGP) specific recognition and binding. A schematic representation of three different nanostructure-ended double-stranded covalently-closed linear DNA molecules assayed for the fluorescent staining of cells expressing a specific protein on their surface are shown in Figure 12.

[0270] After transfection of cultured BHK-21 cells with an expression plasmid encoding RVGP, cells were stained with the anti-RVGP, AO-binding, nanostructure-ended double-stranded covalently-closed linear DNA molecule (molecule A, on Figure 12), a control nanostructure-ended double-stranded covalently-closed linear DNA molecule bearing only the RVGP aptamer on one of its ends and a closed loop on the other end (molecule B on Figure 12), or a nanostructure-ended double-stranded covalently-closed linear DNA molecule bearing a fluorescent aptamer on one of its ends and a closed loop on the other end (molecule C on Figure 12).

[0271] Figure 13 shows the aptafluorescence results on RVGP -transfected HEK-293 cells, demonstrating that binding and fluorescence is specific and that it is due to the described features of the corresponding nanostructure-ended double-stranded covalently-closed linear DNA molecules.

[0272] The images show that only Type A fluorophore-binding nanostructure-ended double-stranded covalently-closed linear DNA molecules are capable of rendering RVGP- expressing BHK-21 cells fluorescent.4. Bi-specific nanostructure-ended double-stranded covalently-closed linear DNA molecule-mediated cell-cell binding proof-of-concept assay

[0273] Bi-specific nanostructure-ended double-stranded covalently-closed linear DNA molecules can be designed to provide bi-functional specific recognition and binding between two molecular or cellular targets. As a proof-of-concept of this functionality of the nanostructure-ended double-stranded covalently-closed linear DNA molecules of the present invention, a Bi-specific nanostructure-ended double-stranded covalently-closed linear DNA molecule bearing an anti-CD3 specific aptamer on one end and an anti-fibronectin receptor specific aptamer on the other end (Figure 14) is provided, to bring together T-Cell lymphocytes and NIH3T3 fibroblasts. Figure 15 shows the cell-to-cell linkage results using the bi-specific nanostructure-ended double-stranded covalently-closed linear DNA molecule of Figure 14, demonstrating that the bi-specific nanostructure-ended double-stranded covalently-closed linear DNA molecule is capable of bringing CTLs and Fibroblasts together, emulating the capabilities of bi-specific antibodies. T-cell lymphocytes were transfected with a construct expressing RFP and NIH3T3 fibroblasts were transfected with a plasmid expressing GFP. Cells were detached from their respective plates, and subsequently resuspended together. The bi- specific nanostructure-ended double-stranded covalently-closed linear DNA molecule was added immediately to provoke association of the two cell types, which can be visualized in the colocalization events.5. Transfection and gene expression assay by using TrEx nanostructure-ended doublestranded covalently-closed linear DNA molecules

[0274] The TrEx nanostructure-ended double-stranded covalently-closed linear DNA molecule has a central double-stranded linear DNA linker, comprising an expression cassette inserted in the multiple cloning site flanked by functional aptamers which confer cell-specific transfection capabilities and endosomal escape activities. Thus TrEx nanostructure-ended double-stranded covalently-closed linear DNA molecules do not require extra delivery agents for achieving cell transformation and efficient expression of an encoded transgene.

[0275] However, according to some embodiments, the DNA construct of the present invention may be combined with substances that can facilitate the uptake of exogenous nucleic acids by cells, such as -but not limited to- polyethylenimine, bupivacaine, chitosan or poly-L-lysine, e.g. by inducing endocytosis and / or any other plasma membrane-borne mechanism involving structural rearrangements of the lipid bilayer which allow external molecules to gain access to the cell’s interior.

[0276] In further embodiments, formulations of the present invention can also include substances that promote endosomal structural instability allowing for the nucleic acid construct to escape this compartment towards the cytosol.

[0277] Additionally, the expression cassette bears sequences that maximize nuclear localization and stable episomal maintenance of the DNA for long periods of time. This makes TrEx molecules ideal for gene therapy approaches that require sustainable and efficient expression of a therapeutic gene.

[0278] In this experiment, the four TrEx nanostructure-ended double-stranded covalently-closed linear DNA molecules shown in Figure 16 were assayed. Briefly, Jurkat cells (T-cell lymphocytes or TCLs) were treated with a full TrEx molecule (Molecule A), bearing an anti-CD3 aptamer for specific transfection of TCLs on one end, and an anti-HSA aptamer for association to this abundant serum protein on the other end, which serves later as a proton sponge for endosomal escape once the complex is taken up by cells after endocytosis ensued. Molecule B represents a control molecule only displaying CD3 -specific binding but no binding to HSA. Molecule C is a control molecule only having HSA-specific binding but no CD3- specific binding, and molecule D is a control molecule having no specific binding neither to CD3 nor to HSA. All molecules bear a green fluorescent protein expression cassette inserted into their linear DNA module. Preferably, the sequence of the green fluorescent protein expression cassette is SEQ ID NO 13.

[0279] When cells are exposed to the full TrEx nanostructure-ended double-stranded covalently-closed linear DNA molecules, the target cell type (TCL) is transfected, demonstrating the functionality of the delivery system produced by the present invention (Figure 17). Jurkat cells were treated with the molecules described in Figure 14. GFP expression is observed only in molecule A treated cells, demonstrating the transfection and expression capabilities of the TrEx nanostructure-ended double-stranded covalently-closed linear DNA molecules. TrEx nanostructure-ended double-stranded covalently-closed linear DNA molecules, lacking an endosomal escape-enhancing HSA-binding aptamer, are only able to reach a minimum expression efficiency compared to full TrEx molecules. TrExnanostructure-ended double-stranded covalently-closed linear DNA C molecules, bearing only an endosomal escape-enhancing aptamer, but lacking a specific cell binding aptamer, or even TrEx nanostructure-ended double-stranded covalently-closed linear DNA D molecules, devoid of both aptamers, fail to transform the cells.STATEMENT OF NO NEW MATTER

[0280] Applicant hereby states that the Substitute Specification, including all the amendments shown in the marked-up and clean versions, contains no new matter under 35 U.S.C. § 132 and 37 C.F.R. §§ 1.121 and 1.125.SEQUENCESSEQ ID NO 1LENGTH: 6866TYPE: DNAORGANISM: ArtificialFEATURE: Parental PlasmidOTHER INFORMATION: Parental Plasmid - Main embodimentSEQUENCE:ACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGC AGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTA ATACCTGGAATGCTGTTTTCCCAGGGATCGCAGTGGTGAGTAACCATGCATCATC AGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCA GTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTT TCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACC TGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATG TTGGAATTTAATCGCGGCCTAGAGCAAGACGTTTCCCGTTGAATATGGCTCATAC TCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGA TACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTC CCCGAAAAGTGCCACCTGACGTCGATGAGCTCTTGACAGCTAGCTCAGTCCTAGG TATAATGCTAGCTACTAGATGCGCACCCTTAGCGAGAGGTTTATCATTAAGGTCA ACCTCTGGATGTTGTTTCGGCATCCTGCATTGAATCTGAGTTACTGTCTGTTTTCC TACCACTTTGTACAAGAAAGCTGGGTGATATCACCCAGCTTTCTTGTACAAAGTG GTCAGGAAACCCGTTTTTTCTGTCTACTAGAGCCAGGCATCAAATAAAACGAAAG GCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTGGTACCATATTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGCATGCGCACCCTTAGCGAGAGGTTTATCATTAAGGTCAACCTCTGGATGTTGTTTCGGCATCCTGCATTGAATCTGAGTTACTGTCTGTTTTCCTACAAGTTTGTACAAAAAAGCAGGCTCAGCTGAGCCTGCTTTTTTGTACAAACTTGTCAGGAAACCCGTTTTTTCTGTCTACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGCTGTTATCCCAGATAAACTCAATGATGATGATGATGATGGTCGAGACTCACCCGGGGCGGCCGCTATCAGCACACAATAGTCCATTATACGCGCGTATAATGGCAATTGTGTGCTGAAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGCTGAACGAGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATAAAAAACAGACTACATAATACTGTAAAACACAACATATCCAGTCACTATGAATCAACTACTTAGATGGTATTAGTGACCTGTACGCCGGCGAGGCCTACCGGTTGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGCATGCATGCATTGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGCATGCATGCATCTATCCATAGCTGATTGGTCTAAAATGAGATACATCAACGCTCCTCCATGTTTTTTGTTTTCTTTTTAAATGAAAAACTTTATTTTTTAAGAGGAGTTTCAGGTTCATAGCAAAATTGAGAGGAAGGTACATTCAAGCTGAGGAAGTTTTCCTCTATTCCTAGTTTACTGAGAGATTGCATCATGAATGGGTGTTAAATTTTGTCAAATGCTTTTTCTGTGTCTATCAATATGACCATGTGATTTTCTTCTTTAACCTGTTGATGGGACAAATTACGTTAATTGATTTTCAAACGTTGAACCACCCTTACATATCTGGAATAAATTCTACTTGGTTGTGGTGTATATTTTTTGATACATTCTTGGATTCTTTTTGCTAATATTTTGTTGAAAATGTTTGTATCTTTGTTCATGAGAGATATTGGTCTGTTGTTTTCTTTTCTTGTAATGTCATTTTCTAGTTCCGGTATTAAGGTAATGCTGGCCTAGTTGAATGATTTAGGAAGTATTCCCTCTGCTTCTGTCTTCTGAAAGAGATTGTAGAAAGTTGATACAATTTTTTTTTCTTTAAATATCTTGATAGGTGGCTATGGCAGGGCTTGCCGCCCCGACGTTGGCTGCGAGCCCTGGGCCTTCACCCGAACTTGGGGGTTGGGGTGGGGAAAAGGAAGAAACGCGGGCGTATTGGTCCCAATGGGGTCTCGGTGGGGTATCGACAGAGTGCCAGCCCTGGGACCGAACCCCGCGTTTATGAACAAACGACCCAACACCCGTGCGTTTTATTCTGTCTTTTTATTGCCGTCATAGCGCGGGTTCCTTCCGGTATTGTCTCCTTCCGTGTTTCAGTTAGCCTCCCCCATCTCCCGCTCGAGCTGCAGGAATTCCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCAGATCTACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAGCGGCCGCTTTCGAATCTAGAGCCTGCAGTCTCGACAAGCTTGTCGAGAAGTACTAGAGGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCGCTAGCTCTAGAGTCGACGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCCTATCCATAGCTGATTGGTCTAAAATGAGATACATCAACGCTCCTCCATGTTTTTTGTTTTCTTTTTAAATGAAAAACTTTATTTTTTAAGAGGAGTTTCAGGTTCATAGCAAAATTGAGAGGAAGGTACATTCAAGCTGAGGAAGTTTTCCTCTATTCCTAGTTTACTGAGAGATTGCATCATGAATGGGTGTTAAATTTTGTCAAATGCTTTTTCTGTGTCTATCAATATGACCATGTGATTTTCTTCTTTAACCTGTTGATGGGACAAATTACGTTAATTGATTTTCAAACGTTGAACCACCCTTACATATCTGGAATAAATTCTACTTGGTTGTGGTGTATATTTTTTGATACATTCTTGGATTCTTTTTGCTAATATTTTGTTGAAAATGTTTGTATCTTTGTTCATGAGAGATATTGGTCTGTTGTTTTCTTTTCTTGTAATGTCATTTTCTAGTTCCGGTATTAAGGTAATGCTGGCCTAGTTGAATGATTTAGGAAGTATTCCCTCTGCTTCTGTCTTCTGAAAGAGATTGTAGAAAGTTGATACAATTTTTTTTTCTTTAAATATCTTGATAGGCACGCATGCATTGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGCATGCATGCATTGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAACCGGTAGGCCTCGCCGGCGAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCTGAACGAGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATAAAAAACAGACTACATAATACTGTAAAACACAACATATCCAGTCACTATGAATCAACTACTTAGATGGTATTAGTGACCTGTATATCAGCACACAATAGTCCATTATACGCGCGTATAATGGCAATTGTGTGCTGAGGGGATAACGCAGGAAAGAACATGTACTAGTATCACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGTTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAAACGAAATSEQ ID NO 2LENGTH: 35TYPE: DNAORGANISM: ArtificialFEATURE: Strong Constitutive Bacterial PromoterOTHER INFORMATION: J23119 PromoterSEQUENCE:TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGCSEQ ID NO 3LENGTH: 28TYPE: DNAORGANISM: ArtificialFEATURE: Rho Independent Bacterial Terminator Sequence from Phage T7OTHER INFORMATION: TerminatorSEQUENCE:GGCTCACCTTCGGGTGGGCCTTTCTGCGSEQ ID NO 4LENGTH: 25TYPE: DNAORGANISM: ArtificialFEATURE: Recombinase Recognition SequenceOTHER INFORMATION: AttBl Recombination SequenceSEQUENCE:ACAAGTTTGTACAAAAAAGCAGGCTSEQ ID NO 5LENGTH: 25TYPE: DNAORGANISM: ArtificialFEATURE: Recombinase Recognition SequenceOTHER INFORMATION: AttB2 Recombination SequenceSEQUENCE:ACCCAGCTTTCTTGTACAAAGTGGTSEQ ID NO 6LENGTH: 232TYPE: DNAORGANISM: ArtificialFEATURE: Recombinase Recognition SequenceOTHER INFORMATION: AttPl Recombination SequenceSEQUENCE:AAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCTGAACGAGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATAAAAAACAGACTACATAATACTGTAAAACACAACATATCCAGTCACTATGAATCAACTACTTAGATGGTATTAGTGACCTGTASEQ ID NO 7LENGTH: 232TYPE: DNAORGANISM: ArtificialFEATURE: Recombinase Recognition SequenceOTHER INFORMATION: AttP2 Recombination SequenceSEQUENCE:AAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGCTGAACGAGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATAAAAAACAGACTACATAATACTGTAAAACACAACATATCCAGTCACTATGAATCAACTACTTAGATGGTATTAGTGACCTGTASEQ ID NO 8LENGTH: 816TYPE: DNAORGANISM: ArtificialFEATURE: Bacterial Selection Marker GeneOTHER INFORMATION: Kanamycin Resistance geneSEQUENCE:TTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGTTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAAACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCAGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTAGAGCAAGACGTTTCCCGTTGAATATGGCTCATSEQ ID NO 9LENGTH: 589TYPE: DNAORGANISM: ArtificialFEATURE: Bacterial Origin of ReplicationOTHER INFORMATION: pMBl Origin of ReplicationSEQUENCE:TTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAASEQ ID NO 10LENGTH: 18TYPE: DNAORGANISM: ArtificialFEATURE: Endonuclease Recognition SequenceOTHER INFORMATION: I- Seel Recognition SequenceSEQUENCE:TAGGGATAACAGGGTAATSEQ ID NO 11LENGTH: 3683TYPE: DNAORGANISM: ArtificialFEATURE: Expression cassetteOTHER INFORMATION: Possible expression cassette in Parental PlasmidSEQUENCE:TGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGCATGCATGCATTGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGCATGCATGCATCTATCCATAGCTGATTGGTCTAAAATGAGATACATCAACGCTCCTCCATGTTTTTTGTTTTCTTTTTAAATGAAAAACTTTATTTTTTAAGAGGAGTTTCAGGTTCATAGCAAAATTGAGAGGAAGGTACATTCAAGCTGAGGAAGTTTTCCTCTATTCCTAGTTTACTGAGAGATTGCATCATGAATGGGTGTTAAATTTTGTCAAATGCTTTTTCTGTGTCTATCAATATGACCATGTGATTTTCTTCTTTAACCTGTTGATGGGACAAATTACGTTAATTGATTTTCAAACGTTGAACCACCCTTACATATCTGGAATAAATTCTACTTGGTTGTGGTGTATATTTTTTGATACATTCTTGGATTCTTTTTGCTAATATTTTGTTGAAAATGTTTGTATCTTTGTTCATGAGAGATATTGGTCTGTTGTTTTCTTTTCTTGTAATGTCATTTTCTAGTTCCGGTATTAAGGTAATGCTGGCCTAGTTGAATGATTTAGGAAGTATTCCCTCTGCTTCTGTCTTCTGAAAGAGATTGTAGAAAGTTGATACAATTTTTTTTTCTTTAAATATCTTGATAGGTGGCTATGGCAGGGCTTGCCGCCCCGACGTTGGCTGCGAGCCCTGGGCCTTCACCCGAACTTGGGGGTTGGGGTGGGGAAAAGGAAGAAACGCGGGCGTATTGGTCCCAATGGGGTCTCGGTGGGGTATCGACAGAGTGCCAGCCCTGGGACCGAACCCCGCGTTTATGAACAAACGACCCAACACCCGTGCGTTTTATTCTGTCTTTTTATTGCCGTCATAGCGCGGGTTCCTTCCGGTATTGTCTCCTTCCGTGTTTCAGTTAGCCTCCCCCATCTCCCGCTCGAGCTGCAGGAATTCCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCAGATCTACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAGCGGCCGCTTTCGAATCTAGAGCCTGCAGTCTCGACAAGCTTGTCGAGAAGTACTAGAGGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCGCTAGCTCTAGAGTCGACGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCCTATCCATAGCTGATTGGTCTAAAATGAGATACATCAACGCTCCTCCATGTTTTTTGTTTTCTTTTTAAATGAAAAACTTTATTTTTTAAGAGGAGTTTCAGGTTCATAGCAAAATTGAGAGGAAGGTACATTCAAGCTGAGGAAGTTTTCCTCTATTCCTAGTTTACTGAGAGATTGCATCATGAATGGGTGTTAAATTTTGTCAAATGCTTTTTCTGTGTCTATCAATATGACCATGTGATTTTCTTCTTTAACCTGTTGATGGGACAAATTACGTTAATTGATTTTCAAACGTTGAACCACCCTTACATATCTGGAATAAATTCTACTTGGTTGTGGTGTATATTTTTTGATACATTCTTGGATTCTTTTTGCTAATATTTTGTTGAAAATGTTTGTATCTTTGTTCATGAGAGATATTGGTCTGTTGTTTTCTTTTCTTGTAATGTCATTTTCTAGTTCCGGTATTAAGGTAATGCTGGCCTAGTTGAATGATTTAGGAAGTATTCCCTCTGCTTCTGTCTTCTGAAAGAGATTGTAGAAAGTTGATACAATTTTTTTTTCTTTAAATATCTTGATAGGCACGCATGCATTGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGCATGCATGCATTGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCASEQ ID NO 12LENGTH: 589TYPE: DNAORGANISM: ArtificialFEATURE: Eukaryotic Promoter / enhancerOTHER INFORMATION: human cytomegalovirus (CMV) immediate-early enhancer and promoter (pCMV)SEQUENCE:CTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAA TGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTA CATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAAT GTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATSEQ ID NO 13LENGTH: 720TYPE: DNAORGANISM: ArtificialFEATURE: Fluorescent Reporter SequenceOTHER INFORMATION: Enhanced Green Fluorescence Protein (EGFP)SEQUENCE:ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGC CCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAA GGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACC CGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAG GGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAAC TACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAG GTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGAC CACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAASEQ ID NO 14LENGTH: 241TYPE: DNAORGANISM: ArtificialFEATURE: Polyadenylation signalOTHER INFORMATION: SV40 Polyadenylation signalSEQUENCE:GATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCSEQ ID NO 15LENGTH: 582TYPE: DNAORGANISM: ArtificialFEATURE: S / MAR SequenceOTHER INFORMATION: Scaffold Nuclear Matrix Attachment RegionSEQUENCE:CTATCCATAGCTGATTGGTCTAAAATGAGATACATCAACGCTCCTCCATGTTTTTTGTTTTCTTTTTAAATGAAAAACTTTATTTTTTAAGAGGAGTTTCAGGTTCATAGCAAAATTGAGAGGAAGGTACATTCAAGCTGAGGAAGTTTTCCTCTATTCCTAGTTTACTGAGAGATTGCATCATGAATGGGTGTTAAATTTTGTCAAATGCTTTTTCTGTGTCTATCAATATGACCATGTGATTTTCTTCTTTAACCTGTTGATGGGACAAATTACGTTAATTGATTTTCAAACGTTGAACCACCCTTACATATCTGGAATAAATTCTACTTGGTTGTGGTGTATATTTTTTGATACATTCTTGGATTCTTTTTGCTAATATTTTGTTGAAAATGTTTGTATCTTTGTTCATGAGAGATATTGGTCTGTTGTTTTCTTTTCTTGTAATGTCATTTTCTAGTTCCGGTATTAAGGTAATGCTGGCCTAGTTGAATGATTTAGGAAGTATTCCCTCTGCTTCTGTCTTCTGAAAGAGATTGTAGAAAGTTGATACAATTTTTTTTTCTTTAAATATCTTGATAGSEQ ID NO 16LENGTH: 73TYPE: DNAORGANISM: ArtificialFEATURE: DNA Nuclear Localization SequenceOTHER INFORMATION: SV40 EnhancerSEQUENCE:TGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCASEQ ID NO 17LENGTH: 10836TYPE: DNAORGANISM: ArtificialFEATURE: Helper PlasmidOTHER INFORMATION: Helper PlasmidSEQUENCE:TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGGAGATCGGTACTTCGCGAATGCGTCGAGATGTAGTGGCCAGGACCCAACGCTGCCCGAAATTGGCCAGGACCCAACGACTAGTCTGCCCGAAATTCCGACACCATCGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATTTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGAATTCAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGGCTGAAGCGCAAAATGATCCCCTGCTGCCGGGATACTCGTTTAATGCCCATCTGGTGGCGGGTTTAACGCCGATTGAGGCCAACGGTTATCTCGATTTTTTTATCGACCGACCGCTGGGAATGAAAGGTTATATTCTCAATCTCACCATTCGCGGTCAGGGGGTGGTGAAAAATCAGGGACGAGAATTTGTTTGCCGACCGGGTGATATTTTGCTGTTCCCGCCAGGAGAGATTCATCACTACGGTCGTCATCCGGAGGCTCGCGAATGGTATCACCAGTGGGTTTACTTTCGTCCGCGCGCCTACTGGCATGAATGGCTTAACTGGCCGTCAATATTTGCCAATACGGGGTTCTTTCGCCCGGATGAAGCGCACCAGCCGCATTTCAGCGACCTGTTTGGGCAAATCATTAACGCCGGGCAAGGGGAAGGGCGCTATTCGGAGCTGCTGGCGATAAATCTGCTTGAGCAATTGTTACTGCGGCGCATGGAAGCGATTAACGAGTCGCTCCATCCACCGATGGATAATCGGGTACGCGAGGCTTGTCAGTACATCAGCGATCACCTGGCAGACAGCAATTTTGATATCGCCAGCGTCGCACAGCATGTTTGCTTGTCGCCGTCGCGTCTGTCACATCTTTTCCGCCAGCAGTTAGGGATTAGCGTCTTAAGCTGGCGCGAGGACCAACGTATCAGCCAGGCGAAGCTGCTTTTGAGCACCACCCGGATGCCTATCGCCACCGTCGGTCGCAATGTTGGTTTTGACGATCAACTCTATTTCTCGCGGGTATTTAAAAAATGCACCGGGGCCAGCCCGAGCGAGTTCCGTGCCGGTTGTGAAGAAAAAGTGAATGATGTAGCCGTCAAGTTGTCATAAGCGCAACGCAATTAATGTAAGTTAGCTCACTCATTAGGCACAATTCTCATGTTTGACAGCTTATCATCGACTGCACGGTGCACCAATGCTTCTGG1CGTCAGGCAGCCATCGGAAGCTGTGGTATGGCTGTGCAGGTCGTAAATCACTGCATAATTCGTGTCGCTCAAGGCGCACTCCCGTTCTGGATAATGTTTTTTGCGCCGACATCATAACGGTTCTGGCAAATATTCTGAAATGAGCTACGGCCTCAACCTACTACTTCTAGAGGGCTGCTTCCTAATGCAGGATTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACATACTAGAGTCACACAGGAAAGTACTAGGTGGACACGTACGCGGGTGCTTACGACCGTCAGTCGCGCGAGCGCGAGAATTCGAGCGCAGCAAGCCCAGCGACACAGCGTAGCGCCAACGAAGACAAGGCGGCCGACCTTCAGCGCGAAGTCGAGCGCGACGGGGGCCGGTTCAGGTTCGTCGGGCATTTCAGCGAAGCGCCGGGCACGTCGGCGTTCGGGACGGCGGAGCGCCCGGAGTTCGAACGCATCCTGAACGAATGCCGCGCCGGGCGGCTCAACATGATCATTGTCTATGACGTGTCGCGCTTCTCGCGCCTGAAGGTCATGGACGCGATTCCGATTGTCTCGGAATTGCTCGCCCTGGGCGTGACGATTGTTTCCACTCAGGAAGGCGTCTTCCGGCAGGGAAACGTCATGGACCTGATTCACCTGATTATGCGGCTCGACGCGTCGCACAAAGAATCTTCGCTGAAGTCGGCGAAGATTCTCGACACGAAGAACCTTCAGCGCGAATTGGGCGGGTACGTCGGCGGGAAGGCGCCTTACGGCTTCGAGCTTGTTTCGGAGACGAAGGAGATCACGCGCAACGGCCGAATGGTCAATGTCGTCATCAACAAGCTTGCGCACTCGACCACTCCCCTTACCGGACCCTTCGAGTTCGAGCCCGACGTAATCCGGTGGTGGTGGCGTGAGATCAAGACGCACAAACACCTTCCCTTCAAGCCGGGCAGTCAAGCCGCCATTCACCCGGGCAGCATCACGGGGCTTTGTAAGCGCATGGACGCTGACGCCGTGCCGACCCGGGGCGAGACGATTGGGAAGAAGACCGCTTCAAGCGCCTGGGACCCGGCAACCGTTATGCGAATCCTTCGGGACCCGCGTATTGCGGGCTTCGCCGCTGAGGTGATCTACAAGAAGAAGCCGGACGGCACGCCGACCACGAAGATTGAGGGTTACCGCATTCAGCGCGACCCGATCACGCTCCGGCCGGTCGAGCTTGATTGCGGACCGATCATCGAGCCCGCTGAGTGGTATGAGCTTCAGGCGTGGTTGGACGGCAGGGGGCGCGGCAAGGGGCTTTCCCGGGGGCAAGCCATTCTGTCCGCCATGGACAAGCTGTACTGCGAGTGTGGCGCCGTCATGACTTCGAAGCGCGGGGAAGAATCGATCAAGGACTCTTACCGCTGCCGTCGCCGGAAGGTGGTCGACCCGTCCGCACCTGGGCAGCACGAAGGCACGTGCAACGTCAGCATGGCGGCACTCGACAAGTTCGTTGCGGAACGCATCTTCAACAAGATCAGGCACGCCGAAGGCGACGAAGAGACGTTGGCGCTTCTGTGGGAAGCCGCCCGACGCTTCGGCAAGCTCACTGAGGCGCCTGAGAAGAGCGGCGAACGGGCGAACCTTGTTGCGGAGCGCGCCGACGCCCTGAACGCCCTTGAAGAGCTGTACGAAGACCGCGCGGCAGGCGCGTACGACGGACCCGTTGGCAGGAAGCACTTCCGGAAGCAACAGGCAGCGCTGACGCTCCGGCAGCAAGGGGCGGAAGAGCGGCTTGCCGAACTTGAAGCCGCCGAAGCCCCGAAGCTTCCCCTTGACCAATGGTTCCCCGAAGACGCCGACGCTGACCCGACCGGCCCTAAGTCGTGGTGGGGGCGCGCGTCAGTAGACGACAAGCGCGTGTTCGTCGGGCTCTTCGTAGACAAGATCGTTGTCACGAAGTCGACTACGGGCAGGGGGCAGGGAACGCCCATCGAGAAGCGCGCTTCGATCACGTGGGCGAAGCCGCCGACCGACGACGACGAAGACGACGCCCAGGACGGCACGGAAGACGTAGCGGCGTAGGAATTCAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGAACAATTTGCATGACATGTCTAAGGCGACTCGCATATCTGTTGAAACACTTCGGTTGTTAATCTATACAGCTGATTTTCGCTATAGGATCTACACTGTAGAAAAGAAAGGCCCAGAGAAGAGAATGAGAACCATTTACCAACCTTCTCGAGAACTTAAAGCCTTACAAGGATGGGTTCTACGTAACATTTTAGATAAACTGTCGTCATCTCCTTTTTCTATTGGATTTGAAAAGCACCAATCTATTTTGAATAATGCTACCCCGCATATTGGGGCAAACTTTATACTGAATATTGATTTGGAGGATTTTTTCCCAAGTTTAACTGCTAACAAAGTTTTTGGAGTGTTCCATTCTCTTGGTTATAATCGACTAATATCTTCAGTTTTGACAAAAATATGTTGTTATAAAAATCTGCTACCACAAGGTGCTCCATCATCACCTAAATTAGCTAATCTAATATGTTCTAAACTTGATTATCGTATTCAGGGTTATGCAGGTAGTCGGGGCTTGATATATACGAGATATGCCGATGATCTCACCTTATCTGCACAGTCTATGAAAAAGGTTGTTAAAGCACGTGATTTTTTATTTTCTATAATCCCAAGTGAAGGATTGGTTATTAACTCAAAAAAAACTTGTATTAGTGGGCCTCGTAGTCAGAGGAAAGTTACAGGTTTAGTTATTTCACAAGAGAAAGTTGGGATAGGTAGAGAAAAATATAAAGAAATTAGAGCAAAGATACATCATATATTTTGCGGTAAGTCTTCTGAGATAGAACACGTTAGGGGATGGTTGTCATTTATTTTAAGTGTGGATTCAAAAAGCCATAGGAGATTAATAACTTATATTAGCAAATTAGAAAAAAAATATGGAAAGAACCCTTTAAATAAAGCGAAGACCTAATGGTCTTCGTTTTAAAACTAAAGCTCATAGGTTGAAAAATTGAGCACTTCTTCGTCCAACTGATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCATTGTGCTAGCATGCATAAGAAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACTGGCTCTTCTCGCTAACCAAACCGGTAACCCCGCTTATTAAAAGCATTCTGTAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTTTGGGCTAGCGAATTCGAGCTCAAGAGGATACCATATGAAAAACATTAAAAAAAACCAGGTGATGAACCTGGGCCCGAACAGCAAACTGCTGAAAGAATATAAAAGCCAGCTGATTGAACTGAACATTGAACAGTTTGAAGCGGGCATTGGCCTGATTCTGGGCGATGCGTATATTCGCAGCCGCGATGAAGGCAAAACCTATTGCATGCAGTTTGAATGGAAAAACAAAGCGTATATGGATCATGTGTGCCTGCTGTATGATCAGTGGGTGCTGAGCCCGCCGCATAAAAAAGAACGCGTGAACCATCTGGGCAACCTGGTGATTACCTGGGGCGCGCAGACCTTTAAACATCAGGCGTTTAACAAACTGGCGAACCTGTTTATTGTGAACAACAAAAAAACCATTCCGAACAACCTGGTGGAAAACTATCTGACCCCGATGAGCCTGGCGTATTGGTTTATGGATGATGGCGGCAAATGGGATTATAACAAAAACAGCACCAACAAAAGCATTGTGCTGAACACCCAGAGCTTTACCTTTGAAGAAGTGGAATATCTGGTGAAAGGCCTGCGCAACAAATTTCAGCTGAACTGCTATGTGAAAATTAACAAAAACAAACCGATTATTTATATTGATAGCATGAGCTATCTGATTTTTTATAACCTGATTAAACCGTATCTGATTCCGCAGATGATGTATAAACTGCCGAACACCATTAGCAGCGAAACCTTTCTGAAATGATTAACCTAGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTCTGCAGGGGCGCCATCTCCTCACTCAAAGGCGGTAATACGGTTATTACATCGGATGCCGGGACCGACGAGTGCAGAGGCGTGCAAGCGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCGGCCGCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTAGGGATAACAGGGTAATGTCATCTGGGATAACAGGGTAATGTCATCTAGGGATAACAGGGTATGTCATCTGGGATAACAGGGTAATGTATCTAGGGATAACAGGGTAATGTCATCTGGGATAACAGGGTAATGTCATCTAGGGATAACAGGGTATGTCATCTGGGATAACAGGGTAATGTATCTAGGGATAACAGGGTAATGTCATCTGGGATAACAGGGTAATGTCATCTAGGGATAACAGGGTATGTCATCTGGGATAACAGGGTAATGTATCTAGGGATAACAGGGTAATGTCATCTGGGATAACAGGGTAATGTCATCTAGGGATAACAGGGTATGTCATCTGGGATAACAGGGTAATGTATCTAGGGATAACAGGGTAATGTCATCTGGGATAACAGGGTAATGTCATCTAGGGATAACAGGGTATGTCATCTGGGATAACAGGGTAATGTATCTTGTATCTAGGGATAACAGGGTAATTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTATGGAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCTTAATAAGATGATCTTCTTGAGATCGTTTTGGTCTGCGCGTAATCTCTTGCTCTGAAAACGAAAAAACCGCCTTGCAGGGCGGTTTTTCGAAGGTTCTCTGAGCTACCAACTCTTTGAACCGAGGTAACTGGCTTGGAGGAGCGCAGTCACCAAAACTTGTCCTTTCAGTTTAGCCTTAACCGGCGCATGACTTCAAGACTAACTCCTCTAAATCAATTACCAGTGGCTGCTGCCAGTGGTGCTTTTGCATGTCTTTCCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGACTGAACGGGGGGTTCGTGCATACAGTCCAGCTTGGAGCGAACTGCCTACCCGGAACTGAGTGTCAGGCGTGGAATGAGACAAACGCGGCCATAACAGCGGAATGACACCGGTAAACCGAAAGGCAGGAACAGGAGAGCGCACGAGGGAGCCGCCAGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCACTGATTTGAGCGTCAGATTTCGTGATGCTTGTCAGGGGGGCGGAGCCTATGGAAAAACGGCTTTGCCGCGGCCCTCTCACTTCCCTGTTAAGTATCTTCCTGGCATCTTCCAGGAAATCTCCGCCCCGTTCGTAAGCCATTTCCGCTCGCCGCAGTCGAACGACCGAGCGTAGCGAGTCAGTGAGCGAGGAAGCGGAATATATCCTGTATCACATATTCTGCTGACGCACCGGTGCAGCCTTTTTTCTCCTGCCACATGAAGCACTTCACTGACACCCTCATCAGTGCCAACATAGTAAGCCAGTATACACTCCGCTAGCGCTGAGGTCTGCCTCGTGAAGAAGGTGTTGCTGACTCATACCAGGCCTGAATCGCCCCATCATCCAGCCAGAAAGTGAGGGAGCCACGGTTGATGAGAGCTTTGTTGTAGGTGGACCAGTTGGTGATTTTGAACTTTTGCTTTGCCACGGAACGGTCTGCGTTGTCGGGAAGATGCGTGATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCCACGTTGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTGAAGATCCTTTGAGCGGCCGCTCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCSEQ ID NO 18LENGTH: 78TYPE: DNAORGANISM: ArtificialFEATURE: Prokaryotic PromoterOTHER INFORMATION: Laclq PromoterSEQUENCE:GACACCATCGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATSEQ ID NO 19LENGTH: 960TYPE: DNAORGANISM: ArtificialFEATURE: Repressor ProteinOTHER INFORMATION: Lac I Repressor Protein coding sequenceSEQUENCE:ATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATTTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGASEQ ID NO 20LENGTH: 879TYPE: DNAORGANISM: ArtificialFEATURE: Repressor ProteinOTHER INFORMATION: AraC Repressor Protein coding sequenceSEQUENCE:ATGGCTGAAGCGCAAAATGATCCCCTGCTGCCGGGATACTCGTTTAATGCCCATCTGGTGGCGGGTTTAACGCCGATTGAGGCCAACGGTTATCTCGATTTTTTTATCGACCGACCGCTGGGAATGAAAGGTTATATTCTCAATCTCACCATTCGCGGTCAGGGGGTGGTGAAAAATCAGGGACGAGAATTTGTTTGCCGACCGGGTGATATTTTGCTGTTCCCGCCAGGAGAGATTCATCACTACGGTCGTCATCCGGAGGCTCGCGAATGGTATCACCAGTGGGTTTACTTTCGTCCGCGCGCCTACTGGCATGAATGGCTTAACTGGCCGTCAATATTTGCCAATACGGGGTTCTTTCGCCCGGATGAAGCGCACCAGCCGCATTTCAGCGACCTGTTTGGGCAAATCATTAACGCCGGGCAAGGGGAAGGGCGCTATTCGGAGCTGCTGGCGATAAATCTGCTTGAGCAATTGTTACTGCGGCGCATGGAAGCGATTAACGAGTCGCTCCATCCACCGATGGATAATCGGGTACGCGAGGCTTGTCAGTACATCAGCGATCACCTGGCAGACAGCAATTTTGATATCGCCAGCGTCGCACAGCATGTTTGCTTGTCGCCGTCGCGTCTGTCACATCTTTTCCGCCAGCAGTTAGGGATTAGCGTCTTAAGCTGGCGCGAGGACCAACGTATCAGCCAGGCGAAGCTGCTTTTGAGCACCACCCGGATGCCTATCGCCACCGTCGGTCGCAATGTTGGTTTTGACGATCAACTCTATTTCTCGCGGGTATTTAAAAAATGCACCGGGGCCAGCCCGAGCGAGTTCCGTGCCGGTTGTGAAGAAAAAGTGAATGATGTAGCCGTCAAGTTGTCATAASEQ ID NO 21LENGTH: 241TYPE: DNAORGANISM: ArtificialFEATURE: Prokaryotic Transcription TerminatorOTHER INFORMATION: Laclq TerminatorSEQUENCE:GCGCAACGCAATTAATGTAAGTTAGCTCACTCATTAGGCACAATTCTCATGTTTGACAGCTTATCATCGACTGCACGGTGCACCAATGCTTCTGGCGTCAGGCAGCCATCGGAAGCTGTGGTATGGCTGTGCAGGTCGTAAATCACTGCATAATTCGTGTCGCTCAAGGCGCACTCCCGTTCTGGATAATGTTTTTTGCGCCGACATCATAACGGTTCTGGCAAATATTCTGAAATGAGCTSEQ ID NO 22LENGTH: 31TYPE: DNAORGANISM: ArtificialFEATURE: Prokaryotic Inducible PromoterOTHER INFORMATION: Lac PromoterSEQUENCE:TTTACACTTTATGCTTCCGGCTCGTATGTTGSEQ ID NO 23LENGTH: 1818TYPE: DNAORGANISM: ArtificialFEATURE: RecombinaseOTHER INFORMATION: Phi C31 recombinase Protein Coding SequenceSEQUENCE:GTGGACACGTACGCGGGTGCTTACGACCGTCAGTCGCGCGAGCGCGAGAATTCGAGCGCAGCAAGCCCAGCGACACAGCGTAGCGCCAACGAAGACAAGGCGGCCGACCTTCAGCGCGAAGTCGAGCGCGACGGGGGCCGGTTCAGGTTCGTCGGGCATTTCAGCGAAGCGCCGGGCACGTCGGCGTTCGGGACGGCGGAGCGCCCGGAGTTCGAACGCATCCTGAACGAATGCCGCGCCGGGCGGCTCAACATGATCATTGTCTATGACGTGTCGCGCTTCTCGCGCCTGAAGGTCATGGACGCGATTCCGATTGTCTCGGAATTGCTCGCCCTGGGCGTGACGATTGTTTCCACTCAGGAAGGCGTCTTCCGGCAGGGAAACGTCATGGACCTGATTCACCTGATTATGCGGCTCGACGCGTCGCACAAAGAATCTTCGCTGAAGTCGGCGAAGATTCTCGACACGAAGAACCTTCAGCGCGAATTGGGCGGGTACGTCGGCGGGAAGGCGCCTTACGGCTTCGAGCTTGTTTCGGAGACGAAGGAGATCACGCGCAACGGCCGAATGGTCAATGTCGTCATCAACAAGCTTGCGCACTCGACCACTCCCCTTACCGGACCCTTCGAGTTCGAGCCCGACGTAATCCGGTGGTGGTGGCGTGAGATCAAGACGCACAAACACCTTCCCTTCAAGCCGGGCAGTCAAGCCGCCATTCACCCGGGCAGCATCACGGGGCTTTGTAAGCGCATGGACGCTGACGCCGTGCCGACCCGGGGCGAGACGATTGGGAAGAAGACCGCTTCAAGCGCCTGGGACCCGGCAACCGTTATGCGAATCCTTCGGGACCCGCGTATTGCGGGCTTCGCCGCTGAGGTGATCTACAAGAAGAAGCCGGACGGCACGCCGACCACGAAGATTGAGGGTTACCGCATTCAGCGCGACCCGATCACGCTCCGGCCGGTCGAGCTTGATTGCGGACCGATCATCGAGCCCGCTGAGTGGTATGAGCTTCAGGCGTGGTTGGACGGCAGGGGGCGCGGCAAGGGGCTTTCCCGGGGGCAAGCCATTCTGTCCGCCATGGACAAGCTGTACTGCGAGTGTGGCGCCGTCATGACTTCGAAGCGCGGGGAAGAATCGATCAAGGACTCTTACCGCTGCCGTCGCCGGAAGGTGGTCGACCCGTCCGCACCTGGGCAGCACGAAGGCACGTGCAACGTCAGCATGGCGGCACTCGACAAGTTCGTTGCGGAACGCATCTTCAACAAGATCAGGCACGCCGAAGGCGACGAAGAGACGTTGGCGCTTCTGTGGGAAGCCGCCCGACGCTTCGGCAAGCTCACTGAGGCGCCTGAGAAGAGCGGCGAACGGGCGAACCTTGTTGCGGAGCGCGCCGACGCCCTGAACGCCCTTGAAGAGCTGTACGAAGACCGCGCGGCAGGCGCGTACGACGGACCCGTTGGCAGGAAGCACTTCCGGAAGCAACAGGCAGCGCTGACGCTCCGGCAGCAAGGGGCGGAAGAGCGGCTTGCCGAACTTGAAGCCGCCGAAGCCCCGAAGCTTCCCCTTGACCAATGGTTCCCCGAAGACGCCGACGCTGACCCGACCGGCCCTAAGTCGTGGTGGGGGCGCGCGTCAGTAGACGACAAGCGCGTGTTCGTCGGGCTCTTCGTAGACAAGATCGTTGTCACGAAGTCGACTACGGGCAGGGGGCAGGGAACGCCCATCGAGAAGCGCGCTTCGATCACGTGGGCGAAGCCGCCGACCGACGACGACGAAGACGACGCCCAGGACGGCACGGAAGACGTAGCGGCGTAGSEQ ID NO 24LENGTH: 966TYPE: DNAORGANISM: ArtificialFEATURE: Reverse TranscriptaseOTHER INFORMATION: Ec86 Reverse Transcriptase Coding SequenceSEQUENCE:ATGAACAATTTGCATGACATGTCTAAGGCGACTCGCATATCTGTTGAAACACTTCGGTTGTTAATCTATACAGCTGATTTTCGCTATAGGATCTACACTGTAGAAAAGAAAGGCCCAGAGAAGAGAATGAGAACCATTTACCAACCTTCTCGAGAACTTAAAGCCTTACAAGGATGGGTTCTACGTAACATTTTAGATAAACTGTCGTCATCTCCTTTTTCTATTGGATTTGAAAAGCACCAATCTATTTTGAATAATGCTACCCCGCATATTGGGGCAAACTTTATACTGAATATTGATTTGGAGGATTTTTTCCCAAGTTTAACTGCTAACAAAGTTTTTGGAGTGTTCCATTCTCTTGGTTATAATCGACTAATATCTTCAGTTTTGACAAAAATATGTTGTTATAAAAATCTGCTACCACAAGGTGCTCCATCATCACCTAAATTAGCTAATCTAATATGTTCTAAACTTGATTATCGTATTCAGGGTTATGCAGGTAGTCGGGGCTTGATATATACGAGATATGCCGATGATCTCACCTTATCTGCACAGTCTATGAAAAAGGTTGTTAAAGCACGTGATTTTTTATTTTCTATAATCCCAAGTGAAGGATTGGTTATTAACTCAAAAAAAACTTGTATTAGTGGGCCTCGTAGTCAGAGGAAAGTTACAGGTTTAGTTATTTCACAAGAGAAAGTTGGGATAGGTAGAGAAAAATATAAAGAAATTAGAGCAAAGATACATCATATATTTTGCGGTAAGTCTTCTGAGATAGAACACGTTAGGGGATGGTTGTCATTTATTTTAAGTGTGGATTCAAAAAGCCATAGGAGATTAATAACTTATATTAGCAAATTAGAAAAAAAATATGGAAAGAACCCTTTAAATAAAGCGAAGACCTAATGGTCTTCGTTTTAAAACTAAAGCTCATAGGTTGAAAAATTGAGCACTTCTTCGTCCAACTGASEQ ID NO 25LENGTH: 72TYPE: DNAORGANISM: ArtificialFEATURE: Prokaryotic Transcription TerminatorOTHER INFORMATION: rrnB T1 terminatorSEQUENCE:CAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTT TGTCGGTGAACGCTCTCSEQ ID NO 26LENGTH: 285TYPE: DNAORGANISM: ArtificialFEATURE: Prokaryotic inducible promoterOTHER INFORMATION: pBAD Inducible PromoterSEQUENCE:AAGAAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACTG GCTCTTCTCGCTAACCAAACCGGTAACCCCGCTTATTAAAAGCATTCTGTAACAA AGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCAT TTTTATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACT GTTTCTCCATSEQ ID NO 27LENGTH: 708TYPE: DNAORGANISM: ArtificialFEATURE: Homing Endonuclease proteinOTHER INFORMATION: LScel endonuclease protein coding sequence (codon optimized) SEQUENCE:ATGAAAAACATTAAAAAAAACCAGGTGATGAACCTGGGCCCGAACAGCAAACTG CTGAAAGAATATAAAAGCCAGCTGATTGAACTGAACATTGAACAGTTTGAAGCG GGCATTGGCCTGATTCTGGGCGATGCGTATATTCGCAGCCGCGATGAAGGCAAAACCTATTGCATGCAGTTTGAATGGAAAAACAAAGCGTATATGGATCATGTGTGCC TGCTGTATGATCAGTGGGTGCTGAGCCCGCCGCATAAAAAAGAACGCGTGAACC ATCTGGGCAACCTGGTGATTACCTGGGGCGCGCAGACCTTTAAACATCAGGCGTTTAACAAACTGGCGAACCTGTTTATTGTGAACAACAAAAAAACCATTCCGAACAACCTGGTGGAAAACTATCTGACCCCGATGAGCCTGGCGTATTGGTTTATGGATGATGGCGGCAAATGGGATTATAACAAAAACAGCACCAACAAAAGCATTGTGCTGAACACCCAGAGCTTTACCTTTGAAGAAGTGGAATATCTGGTGAAAGGCCTGCGCAACAAATTTCAGCTGAACTGCTATGTGAAAATTAACAAAAACAAACCGATTATTTATATTGATAGCATGAGCTATCTGATTTTTTATAACCTGATTAAACCGTATCTGATTCCGCAGATGATGTATAAACTGCCGAACACCATTAGCAGCGAAACCTTTCTGAAATGASEQ ID NO 28LENGTH: 48TYPE: DNAORGANISM: ArtificialFEATURE: Prokaryotic Transcription TerminatorOTHER INFORMATION: T7 TerminatorSEQUENCE:CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGSEQ ID NO 29LENGTH: 94TYPE: DNAORGANISM: ArtificialFEATURE: GR-SYTE AptamerOTHER INFORMATION: DNA aptamer. Binds to Glucagon Receptor on the surface of a number of cell types.SEQUENCE:TGATTCGGTGGCAATCCTGAGTGACGCAGCAGATAAGTAGGTATCCGTTTGAAAAACTTTTCTGACCGTCCGACTATAGACACGGTGGCTTAGTSEQ ID NO 30LENGTH: 25TYPE: DNAORGANISM: ArtificialFEATURE: Region of parental plasmidOTHER INFORMATION: Site of recombinationSEQUENCE:GTTCAGCTTTCTTGTACAAAGTTGGSEQ ID NO 31LENGTH: 25TYPE: DNAORGANISM: ArtificialFEATURE: Region of parental plasmidOTHER INFORMATION: Site of recombinationSEQUENCE:GGTTGAAACATGTTTTTTCGACTTGSEQ ID NO 32LENGTH: 25TYPE: DNAORGANISM: ArtificialFEATURE: Recombination between DI (SEQ ID NO 5) and Al (SEQ ID NO 30)OTHER INFORMATION: Product of recombination.SEQUENCE:ACCCAGCTTTCTTGTACAAAGTTGGSEQ ID NO 33LENGTH: 25TYPE: DNAORGANISM: ArtificialFEATURE: Recombination between D2 (SEQ ID NO 4) and A2 (SEQ ID NO 31)OTHER INFORMATION: Product of recombination.SEQUENCE:GGTTGAAAGTACAAAAAAGCAGGCTSEQ ID NO 34LENGTH: 25TYPE: DNAORGANISM: ArtificialFEATURE: Recombination between Al (SEQ ID NO 1) and DI (SEQ ID NO 5), left end.OTHER INFORMATION: Product of recombination.SEQUENCE:GTTCAGCTTTCTTGTACAAAGTGGTSEQ ID NO 35LENGTH: 16TYPE: DNAORGANISM: ArtificialFEATURE: Loop as ssDNA by recombination between Al (SEQ ID NO 30) and DI (SEQ ID NO 5), left end.OTHER INFORMATION: ssDNA loop-end of a dsDNA fragment, product of recombination.SEQUENCE:TAATCGTATTTATAATSEQ ID NO 36LENGTH: 25TYPE: DNAORGANISM: ArtificialFEATURE: Recombination between A2 (SEQ ID NO 31) and D2 (SEQ ID NO 4), right end.OTHER INFORMATION: Product of recombination.SEQUENCE:CAAGTCGAAAAAACATGAAACTTGTSEQ ID NO 37LENGTH: 16TYPE: DNAORGANISM: ArtificialFEATURE: Loop as ssDNA by recombination between A2 (SEQ ID NO 31) and D2 (SEQ ID NO 5), right end.OTHER INFORMATION: ssDNA loop-end of a dsDNA fragment, product of recombination.SEQUENCE:TAATATTTATGCTAATSEQ ID NO 38LENGTH: 21TYPE: DNAORGANISM: ArtificialFEATURE: PCR primer.OTHER INFORMATION: Primer Forward.SEQUENCE:TTTCCACACCAACCGGTAGGCSEQ ID NO 39LENGTH: 21TYPE: DNAORGANISM: ArtificialFEATURE: PCR primer.OTHER INFORMATION: Primer Reverse.SEQUENCE:GCCGGCGTACAGGTCACTAATSEQ ID NO 40LENGTH: 21TYPE: DNAORGANISM: ArtificialFEATURE: PCR primer.OTHER INFORMATION: Primer Forward.SEQUENCE:AAAGGTGTGGTTGGCCATCCGSEQ ID NO 41LENGTH: 17TYPE: DNAORGANISM: ArtificialFEATURE: PCR primer.OTHER INFORMATION: Primer Reverse.SEQUENCE:GTCAGCAACCAACCGGTSEQ ID NO 42LENGTH: 23TYPE: DNAORGANISM: ArtificialFEATURE: PCR primer.OTHER INFORMATION: Primer Forward.SEQUENCE:TGGAGTTCCGCGTTACATAACTTSEQ ID NO 43LENGTH: 21TYPE: DNAORGANISM: ArtificialFEATURE: PCR primer.OTHER INFORMATION: Primer Reverse.SEQUENCE:AGACTGCAGGCTCTAGATTCG

Claims

CLAIMSWHAT IS CLAIMED IS:

1. A nanostructure-ended double-stranded covalently-closed linear DNA molecule in vivo manufacturing system comprising: a recombinant cell comprising: a repressor protein module comprising: a first bacterial constitutive promoter, a first ribosome binding site, a first repressor protein coding sequence, a second ribosome binding site, a second repressor protein coding sequence, and a first bacterial terminator; a recombinase-reverse transcriptase module comprising: a first bacterial inducible promoter, a third ribosome binding site, a recombinase coding sequence, a fourth ribosome binding site, a reverse transcriptase coding sequence, and a second bacterial terminator; and a homing endonuclease module comprising: a second bacterial inducible promoter, a fifth ribosome binding site, a homing endonuclease coding sequence, and a third bacterial terminator; and a parental plasmid DNA platform, housed in the recombinant cell, comprising: a retron module comprising: a left retron unit comprising: a first parental bacterial constitutive promoter, a multi-copy single-stranded RNA (msr) sequence, a 5 ’-multi-copy singlestranded DNA (msd) sequence, a left sense stem recombination sequence (L- SSR), a left DNA nanostructure sequence (L-DNS) inserted in a first multiple cloning site (MCS 1), a left antisense stem recombination sequence (L-ASR), complementary to the L-SSR sequence, a 3’ -msd sequence, and a first parental bacterial terminator; and a right retron unit comprising: a second parental bacterial constitutive promoter, a msr sequence, a 5’ -msd sequence, a right sense stem recombination sequence (R-SSR), a right DNA nanostructure sequence (R-DNS) inserted in a second multiple cloning site (MCS 2), a right antisense stem recombination sequence (R-ASR), complementary to the R-SSR sequence, a -msd sequence, and a second parental bacterial terminator;a linear module comprising: a first acceptor recombinase recognition sequence (Al ), a sequence selected from a DNA spacer and an expression cassette inserted in a third multiple cloning site (MCS 3), and a second acceptor recombinase recognition sequence (A2); and a bacterial backbone comprising: a parental bacterial origin of replication, a parental selection marker, and a parental homing endonuclease recognition sequence (HRE), wherein the retron units, linear module, and bacterial backbone are contained in at least one cloned parental plasmid DNA.

2. The manufacturing system of claim 1, wherein the repressor protein module, recombinase-reverse transcriptase module, and homing endonuclease module are contained in a helper plasmid along with a bacterial backbone comprising: a helper bacterial origin of replication, a helper selection marker, and a helper homing endonuclease recognition sequence (HRE).

3. The manufacturing system of claim 1, wherein the linear module has an expression cassette inserted in the multiple cloning site MCS 3 comprising: an eukaryotic enhancer; an eukaryotic promoter; an eukaryotic coding sequence (CDS); and an eukaryotic terminator / polyadenylation signal.

4. The manufacturing system of claim 3, wherein the expression cassette further comprises at least one of: a 5’ untranslated region; a 3 ’ untranslated region; an internal ribosome entry site (IRES); and an m6A induced ribosome engagement site (MIRES).

5. The manufacturing system of claim 1, wherein the linear module further comprises at least one of: a scaffold matrix attachment region (S / MAR); and a DNA nuclear targeting sequence (DNTS).

6. The manufacturing system of claim 1, wherein the linear module comprises a DNA spacer sequence with at least one base pair inserted in the multiple cloning site MCS 3.

7. The manufacturing system of claim 1 , wherein the linear module may further comprise one or more eukaryotic origins of replication (ORIs).

8. An engineered parental circular covalently closed synthetic plasmid DNA platform usable for manufacturing nanostructure-ended double-stranded covalently-closed linear DNA molecules, comprising: a retron module comprising: a left retron unit comprising: a first parental bacterial constitutive promoter, a multicopy single-stranded RNA (msr) sequence, a 5’- multi-copy single-stranded DNA (msd) sequence, a left sense stem recombination sequence (L-SSR), a first multiple cloning site (MCS 1), a left antisense stem recombination sequence (L-ASR), complementary to the L-SSR sequence, a 3’ -msd sequence, and a first parental bacterial terminator; and a right retron unit comprising: a second parental bacterial constitutive promoter, a msr sequence, a 5’ -msd sequence, a right sense stem recombination sequence (R- SSR), a second multiple cloning site (MCS 2), a right antisense stem recombination sequence (R-ASR), complementary to the R-SSR sequence, a 3’ -msd sequence, and a second parental bacterial terminator; a linear module comprising: a first acceptor recombinase recognition sequence (Al), a third multiple cloning site (MCS 3), and a second acceptor recombinase recognition sequence (A2); and a bacterial backbone comprising: a parental bacterial origin of replication, a parental selection marker, and a parental homing endonuclease recognition sequence (HRE), wherein the retron units, linear module, and bacterial backbone are contained in at least one parental plasmid DNA.

9. The engineered parental circular covalently closed synthetic plasmid DNA platform of claim 8, wherein the linear module has an expression cassette, inserted in the multiple cloning site MCS 3, comprising: an eukaryotic enhancer; an eukaryotic promoter; an eukaryotic coding sequence (CDS); andan eukaryotic terminator / polyadenylation signal.

10. The engineered parental circular covalently closed synthetic plasmid DNA platform of claim 9, wherein the expression cassette further comprises at least one of: a 5’ untranslated region; a 3’ untranslated region; an internal ribosome entry site (IRES); and an m6A induced ribosome engagement site (MIRES).

11. The engineered parental circular covalently closed synthetic plasmid DNA platform of claim 9, wherein the Linear Module further comprises at least one of: a scaffold matrix atachment region (SZMAR); and a DNA nuclear targeting sequence (DNTS).

12. The engineered parental circular covalently closed synthetic plasmid DNA platform of claim 8, wherein the multiple cloning site 3 (MCS3) has a DNA spacer, with at least one base pair, inserted in it.

13. The engineered parental circular covalently closed synthetic plasmid DNA of claim 8, wherein the linear module may further comprise one or more eukaryotic origins of replication (ORIs).

14. The engineered parental circular covalently closed synthetic plasmid DNA of claim 8, wherein the DNA nanostructure sequences are selected from the group consisting of: a DNA loop, a DNA aptamer, a DNAzyme, and a DNA Cage preceded by a suitable restriction endonuclease recognition sequence.

15. A nanostructure-ended double-stranded covalently-closed linear DNA molecule in vivo manufacturing process comprising the steps of:

1. cloning DNA nanostructured sequences (DNS) in multiple cloning sites 1 (MCS1) and 2 (MCS2), and a sequence selected from a DNA spacer and an expression cassette in multiple cloning site 3 (MCS3) of a parental plasmid platform comprising: a retron module comprising: a left retron unit comprising: a first parental bacterial constitutive promoter, a multi-copy single-stranded RNA (msr) sequence, a 5 ’-multi-copy singlestranded DNA (msd) sequence, a left sense stem recombination sequence (L- SSR), a first multiple cloning site (MCS 1), a left antisense stem recombination sequence (L-ASR), complementary to the L-SSR sequence, a 3’ -msd sequence, and a first parental bacterial terminator; and a right retron unit comprising: a second parental bacterial constitutive promoter, a msr sequence, a 5’ -msd sequence, a right sense stem recombination sequence (R-SSR), a second multiple cloning site (MCS 2), a right antisense stem recombination sequence (R-ASR), complementary to the R-SSR sequence, a 3’- msd sequence, and a second parental bacterial terminator; a linear module comprising: a first acceptor recombinase recognition sequence (Al), a third multiple cloning site (MCS 3), and a second acceptor recombinase recognition sequence (A2); and a bacterial backbone comprising: a parental bacterial origin of replication, a parental selection marker, and a parental homing endonuclease recognition sequence (HRE);2. transforming a recombinant cell with the parental plasmid of step 1, in order to allow the constitutive promoters to transcribe retron RNA molecules from the retron units, the recombinant cell comprising: a repressor protein module comprising: a first helper bacterial constitutive promoter, a first helper ribosome binding site, a first repressor protein coding sequence, a second helper ribosome binding site, a second repressor protein coding sequence, and a first helper bacterial terminator; a recombinase-reverse transcriptase module comprising: a first helper bacterial inducible promoter, a third helper ribosome binding site, a recombinase coding sequence, a fourth helper ribosome binding site, a reverse transcriptase coding sequence, and a second helper bacterial terminator; and a homing endonuclease module comprising: a second helper bacterial inducible promoter, a fifth helper ribosome binding site, a homing endonuclease coding sequence, and a third helper bacterial terminator;3. promoting the expression of the reverse transcriptase encoded in the recombinant cell by the addition of a suitable inducer, in order for the reverse transcriptase to recognize the retron RNA molecule templates and generate left and right retron donor DNA molecules, comprising a nanostructured DNA end and a donorsequence (d), wherein the nanostructured DNA is formed by the DNS sequence and the donor sequence is formed by the annealing of ASR and SSR;4. promoting the expression of the recombinase protein encoded in the recombinant cell by the addition of a suitable inducer, in order for the recombinase to produce a recombination of the left and right retron donor DNA molecules with the first and second acceptor recombination sequences contained in the linear module of the parental plasmid platform so as to generate nanostructure-ended double-stranded covalently-closed linear DNA molecules;5. promoting the expression of the homing endonuclease encoded in the recombinant cell by addition of a suitable inducer in order to produce double-strand cuts in the homing endonuclease recognition sequences on residual DNA molecules; and6. isolating the resulting nanostructure-ended double-stranded linear covalently closed DNA molecules from the recombinant cell.

16. A nanostructure-ended double-stranded covalently-closed linear DNA molecule wherein said molecule is obtainable by the process of claim 15.

Citation Information

Patent Citations

  • Hairpin loop ended self-complementary double-stranded covalently closed linear DNA vector, manufacturing system and process, and uses of said resulting DNA vector

    US20230128316A1

  • Circular RNA platforms, uses thereof, and their manufacturing processes from engineered DNA

    US20230235337A1

  • Engineered retrons and methods of use

    WO2024044723A1