Antisense oligonucleotides targeting calpain-2

Administering antisense oligonucleotides targeting CAPN2 gene expression addresses the lack of effective ALS treatments by reducing calpain-2, improving muscle and respiratory function, and increasing survival time.

WO2026036030A1PCT designated stage Publication Date: 2026-02-12AMYLYX PHARMA
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/041265
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-02-11
Filing Date
2025-08-08
Publication Date
2026-02-12

AI Technical Summary

Technical Problem

Current treatments for amyotrophic lateral sclerosis (ALS) focus on symptom management, lacking effective options to treat, prevent, or ameliorate the neurodegenerative disease.

Method used

Administering antisense oligonucleotides targeting the CAPN2 gene to inhibit calpain-2 expression, using a specific nucleobase sequence with 2’-O-methoxy ethylribose modified nucleosides and phosphorothioate linkages, to treat or prevent ALS symptoms and slow disease progression.

Benefits of technology

Reduces ALS disease progression, improves muscle and respiratory function, prevents adverse events, and increases survival time by effectively targeting calpain-2 expression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025041265_12022026_PF_FP_ABST
    Figure US2025041265_12022026_PF_FP_ABST
Patent Text Reader

Abstract

Provided herein are methods and compositions for treating at least one symptom of ALS, slowing ALS disease progression, or reducing the deterioration of one or more bodily functions affected by ALS in a subject. The methods can include administering to the subject an antisense oligonucleotide that targets calpain-2, which is encoded by the CAPN2 gene.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Atorney Docket No. 38709-0130W01

[0002] ANTISENSE OLIGONUCLEOTIDES TARGETING CALPAIN-2

[0003] CROSS-REFERENCE TO RELATED APPLICATIONS

[0004] The present application claims priority to U.S. Provisional Application No. 63 / 681,394, filed on August 9, 2024, U.S. Provisional Application No. 63 / 685,385, filed on August 21, 2024, U.S. Provisional Application No. 63 / 708,286, filed on October 17, 2024, and U.S. Provisional Application No. 63 / 756,984, filed on February 11, 2025, the contents of all of which are herein incorporated by reference in their entirety.

[0005] SEQUENCE LISTING

[0006] This application contains a Sequence Listing that has been submitted electronically as an XML file named 38709-0130W01_SL_ST26.xml. The XML file, created on August 6, 2025, is 1,912 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety.

[0007] TECHNICAL FIELD

[0008] The present application relates generally to dosage regimens for the clinical use of antisense oligonucleotides, or salts thereof, that reduce expression of the CAPN2 gene, which encodes Calpain-2, in a human subject in need thereof, e.g., adults with amyotrophic lateral sclerosis (ALS). Such methods are useful to treat, prevent, or ameliorate ALS by inhibiting expression of CAPN2.

[0009] BACKGROUND

[0010] ALS is the most prevalent progressive motor neuron disease. ALS causes the progressive degeneration of motor neurons, resulting in rapidly progressing muscle weakness and atrophy that eventually leads to partial or total paralysis. Median survival from symptom onset is 2 to 3 years, with respiratory failure being the predominant cause of death. ALS treatment currently centers on symptom management. Currently lacking are acceptable options for treating such neurodegenerative diseases. It is therefore an object herein to provide methods for the treatment of such diseases. Atorney Docket No. 38709-0130W01

[0011] SUMMARY

[0012] This disclosure relates, in part, to dosage regimens of antisense oligonucleotides that reduce expression of the CAPN2 gene, which encodes calpain-2, and the use of such antisense oligonucleotides, or salts thereof, to inhibit expression of CAPN2 and to treat, prevent, or ameliorate one or more symptoms in ALS in a human subject.

[0013] In some embodiments, provided herein are methods of treating at least one symptom of amyotrophic lateral sclerosis in a human subject in need thereof, the method comprising administering to the human subject by intrathecal administration a pharmaceutical composition in an amount sufficient to deliver a fixed dose of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide comprises ATCAGTTTCTGTAGGCTTCC (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16- 20 are 2’ -O-methoxy ethylribose modified nucleosides, wherein the intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5 -methylcytosine.

[0014] In some embodiments, provided herein are methods of reducing the ALS disease progression rate of a human subject having one or more symptoms of ALS, the method comprising: administering to the human subject an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide comprises ATCAGTTTCTGTAGGCTTCC (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16- 20 are 2’ -O-methoxy ethylribose modified nucleosides, wherein the intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5 -methylcytosine in a fixed dose of sufficient to thereby reduce the average points lost per month on the Amyotrophic Lateral Sclerosis Functional Rating Scale (ALSFRS-R) by the human subject as compared to a control human subject not receiving the administration.

[0015] In some embodiments, provided herein are methods of reducing the deterioration of muscle strength, maintaining muscle strength, or improving muscle strength, in a human subject having one or more symptoms of ALS, the method comprising: administering to the human subject an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide comprises ATCAGTTTCTGTAGGCTTCC (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 are 2’ -O-methoxy ethylribose modified nucleosides, wherein the intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 Atorney Docket No. 38709-0130W01 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5-methylcytosine in a fixed dose of sufficient to thereby reduce the deterioration of muscle strength, maintain muscle strength, or improve muscle strength, in the human subject. In some instances, the muscle strength is lower limb strength, upper limb strength, or grip strength. In some instances, the muscle strength is that of the quadriceps, biceps, hamstrings, triceps, or anterior tibialis. In some instances, wherein, before, during, and / or after administration, the muscle strength is assessed by hand held dynamometry (HHD), hand grip strength dynamometry, manual muscle testing (MMT), electrical impedance myography (EIM), Maximum Voluntary Isometric Contraction Testing (MVICT), motor unit number estimation (MUNE), Accurate Test of Limb Isometric Strength (ATLIS), or a combination thereof. In some instances, the muscle strength is assessed by ATLIS.

[0016] In some embodiments, also provided are methods of reducing the deterioration of respiratory muscle function, maintaining respiratory muscle function, or improving respiratory muscle function in a human subject having one or more symptoms of ALS, the method comprising: administering to the human subject an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide comprises ATCAGTTTCTGTAGGCTTCC (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16- 20 are 2’ -O-methoxy ethylribose modified nucleosides, wherein the intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5-methylcytosine in a fixed dose of sufficient to thereby reduce the deterioration of respiratory muscle function, maintain respiratory muscle function, or improve respiratory muscle function in the human subject. In some instances, wherein, before, during, and / or after administration, the respiratory muscle function in the human subject is assessed by evaluation of the human subject’s vital capacity (VC), maximum mid-expiratory flow rate (MMERF), forced vital capacity (FVC), slow vital capacity (SVC), forced expiratory volume in 1 second (FEVi), or a combination thereof. In some instances, the respiratory muscle function in the human subject is assessed by evaluation of the human subject’s SVC.

[0017] In some embodiments, also provided are methods of preventing or reducing at least one serious adverse event in a human subject having one or more symptoms of ALS, the method comprising: administering to the human subject an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide comprises Atorney Docket No. 38709-0130W01

[0018] ATCAGTTTCTGTAGGCTTCC (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16- 20 are 2’ -O-methoxy ethylribose modified nucleosides, wherein the intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5 -methylcytosine in a fixed dose of sufficient to thereby prevent or reduce at least one serious adverse event in the human subject. In some instances, the at least one serious adverse event is a respiratory adverse event, a fall, or a laceration injury.

[0019] In some embodiments, also provided are methods of reducing the deterioration of fine motor skill, maintaining fine motor skill, or improving fine motor skill in a human subject having one or more symptoms of ALS, the method comprising: administering to the human subject an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide comprises ATCAGTTTCTGTAGGCTTCC (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 are 2’ -O-methoxy ethylribose modified nucleosides, wherein the intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5- methylcytosine in a fixed dose of sufficient to thereby reduce the deterioration of fine motor skill, maintain fine motor skill, or improve fine motor skill in the human subject. In some instances, the fine motor skill is assessed using ALSFRS-R.

[0020] In some embodiments, also provided are methods of slowing ALS disease progression in a human subject having one or more symptoms of ALS, the method comprising: administering to the human subject an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide comprises ATCAGTTTCTGTAGGCTTCC (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 are 2 ’-O-methoxy ethylribose modified nucleosides, wherein the intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5-methylcytosine in a fixed dose of sufficient to thereby slow ALS disease progression in the human subject.

[0021] In some embodiments, also provided are methods of increasing survival time of a human subject having one or more symptoms of ALS, the method comprising: administering to the human subject an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide comprises ATCAGTTTCTGTAGGCTTCC (SEQ ID NO:1), Atorney Docket No. 38709-0130W01 wherein each of nucleosides 1-5 and 16-20 are 2’ -O-methoxy ethylribose modified nucleosides, wherein the intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5-methylcytosine in a fixed dose of sufficient to thereby increase survival time of the human subject.

[0022] In some embodiments of any of the above-described methods, the human subject has been diagnosed with ALS for about 24 months or less or has shown one or more symptoms of ALS for about 24 months or less.

[0023] In some embodiments of any of the above-described methods, the human subject has been diagnosed with definite or clinically probable ALS based on the revised EL Escorial criteria.

[0024] In some embodiments, also provided are methods comprising: administering to a human subject at risk for developing ALS an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide comprises ATCAGTTTCTGTAGGCTTCC (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16- 20 are 2’ -O-methoxy ethylribose modified nucleosides, wherein the intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5-methylcytosine in a fixed dose of sufficient to thereby prevent or delay the onset of ALS. In some instances, the human subject is determined to be at risk for developing ALS by evaluating the level of a biomarker in a biological sample obtained from the human subject. In some instances, the biomarker is calpain-2, phosphorylated neurofilament heavy chain (pNF-H), neurofilament light chain (NfL), spectrin breakdown product 145 (SBDP-145), S100-P, cy statin C, chitotriosidase, p75ECD, ketones, or creatinine. In some instances, the biological sample is cerebral spinal fluid (CSF), urine, or blood. In some instances, the biological sample is plasma or serum. In some instances, the biological sample is brain (e.g., the motor cortex). In some embodiments, the biological sample is spinal cord. In some instances, the human subject is determined to be at risk for developing ALS by identifying a mutation in one or more genes selected from the group consisting of: SOL) / , C9ORF72, ANG, TARDBP, VCP, VAPB, SQSIM1, DCTN1, FUS, UNC13A, ATXN2, HNRNPA1, CHCHI)10, M()BP, C21ORF2, NEK1, TUBA4A, TBK1, MATR3, PFN1, UBQLN2, TAF15, OP' / N' , TDP-43, and CHI3L1. Atorney Docket No. 38709-0130W01

[0025] In some embodiments of any of the above-described methods, the antisense oligonucleotide has the following structure: or a pharmaceutically acceptable salt thereof.

[0026] In some embodiments of any of the above-described methods, the antisense oligonucleotide is the sodiated form (sodiated salt form). Atorney Docket No. 38709-0130W01

[0027] In some embodiments of any of the above-described methods, the antisense oligonucleotide has the following structure:

[0028] In some embodiments of any of the above-described methods, the fixed dose is between about 5 mg to about 125 mg of the antisense oligonucleotide. In some instances, the Atorney Docket No. 38709-0130W01 fixed dose is about 6.25 mg, about 12.5 mg, about 25 mg, about 50 mg, about 100 mg, or about 120 mg of the antisense oligonucleotide. In some instances, the fixed dose is about 12.5 mg of the antisense oligonucleotide. In some instances, the fixed dose is about 25 mg of the antisense oligonucleotide. In some instances, the fixed dose is about 50 mg of the antisense oligonucleotide. In some instances, the fixed dose is about 100 mg of the antisense oligonucleotide. In some instances, the fixed dose does not exceed 100 mg.

[0029] In some embodiments of any of the above-described methods, the human subject has been on a stable regimen of riluzole and / or edaravone for at least 30 days prior to administration of the antisense oligonucleotide. In some embodiments of any of the abovedescribed methods, the human subject was previously on a regimen of riluzole and / or edaravone and has ceased the regimen for at least 30 days prior to administration of the antisense oligonucleotide.

[0030] In some embodiments of any of the above-described methods, administration of antisense oligonucleotide results in a reduction of CAPN2 mRNA levels in the human subject’s cerebral spinal fluid (CSF), plasma, serum, brain (e.g., motor cortex), and / or spinal cord. In some instances, the reduction is about 10%, about 15%, about 20%, about 25%, about 30%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% as compared to a baseline level of CAPN2 mRNA (i.e., a level before administration of the antisense oligonucleotide).

[0031] In some embodiments of any of the above-described methods, administration of antisense oligonucleotide results in a reduction of calpain-2 polypeptide levels in the human subject’s CSF, plasma, the brain (e.g., the motor cortex), and / or the spinal cord. In some instances, the reduction is about 10%, about 15%, about 20%, about 25%, about 30%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% as compared to a baseline level of calpain-2 polypeptide levels (i.e., a level before administration of the antisense oligonucleotide).

[0032] In some embodiments of any of the above-described methods, administration of antisense oligonucleotide results in a reduction of NfL polypeptide levels in the human subject’s CSF, plasma, serum, brain (e.g., motor cortex), or spinal cord. In some instances, the reduction is about 10%, about 15%, about 20%, about 25%, about 30%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% as compared to a baseline level of NfL polypeptide levels (i.e., a level before administration of the antisense oligonucleotide). Atorney Docket No. 38709-0130W01

[0033] In some embodiments of any of the above-described methods, administration of antisense oligonucleotide results in a reduction of SBDP-145 polypeptide levels in the human subject’s CSF, plasma, serum, brain (e.g., motor cortex), or spinal cord. In some instances, the reduction is about 10%, about 15%, about 20%, about 25%, about 30%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% as compared to a baseline level of SBDP-145 polypeptide levels (i.e., a level before administration of the antisense oligonucleotide).

[0034] In some embodiments of any of the above-described methods, the human subject is administered repeat doses of the fixed dose of the antisense oligonucleotide about every 28 days (or about every 4 weeks). In some embodiments, the human subject is administered repeat doses of the fixed dose of the antisense oligonucleotide at least 25 days apart (i.e., no less than 25 days apart).

[0035] Unless otherwise defined, all terms of art, notations, and other scientific terms or terminology used herein are intended to have the meanings commonly understood by those of skill in the art to which this application pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art.

[0036] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.

[0037] Certain ranges are presented herein with numerical values being preceded by the term “about.” The term “about” is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating unrecited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number.

[0038] It is appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single Atorney Docket No. 38709-0130W01 embodiment. Conversely, various features of the disclosure, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to the disclosure are specifically embraced by the present disclosure and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all subcombinations of the various embodiments and elements thereof are also specifically embraced by the present disclosure and are disclosed herein just as if each and every such sub- combination was individually and explicitly disclosed herein.

[0039] Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0040] DESCRIPTION OF DRAWINGS

[0041] FIG. 1 is a schematic of the study described in Example 9. FIG. 1 A shows that Dosing Days occur on Days 1, 29, 57, and 85 during the treatment period. Participants will be monitored for at least 24 hours after the dose on Day 1 and at least 6 hours after each other dose. Triangles denote safety follow up visits (Day 8, 20, 36, 48, 64, and 92). Arrows denote CSF sampling via lumbar puncture on Dosing Days and at End of Study visit / Early Termination Visit Telephone visits will assess concomitant medications and adverse events as noted in the Schedule of Activities. FIG. IB shows that four sequential dose levels are planned with 12 participants randomized 3: 1 to Compound A or placebo. The sponsor, in consultation with the DEC, may modify these planned dose levels as well as add additional dose levels not exceeding 100 mg based on the totality of the data.

[0042] DETAILED DESCRIPTION

[0043] This disclosure features methods of using antisense oligonucleotides, or salts thereof, that reduce expression of the CAPN2 gene, which encodes calpain-2, to treat, prevent, or ameliorate one or more symptoms of amyotrophic lateral sclerosis (ALS) in a subject. Antisense oligonucleotides targeting CAPN2 mRNA have been previously described in WO 2023 / 220087, which is incorporated herein by reference in its entirety. Atorney Docket No. 38709-0130W01

[0044] Although the precise cause of ALS is unknown, ALS is strongly characterized by nerve cell death and inflammation. Together these processes form a toxic cycle that is a key driver of progressive neurological decline. The present disclosure provides methods of treating at least one symptom of ALS, methods of reducing ALS disease progression; and methods of reducing the deterioration of one or more bodily functions affected by ALS, maintaining one or more bodily functions affected by ALS, or improving one or more bodily functions affected by ALS. Also provided are methods of preventing or reducing at least one serious adverse events associated with ALS or its treating, and methods of increasing survival time a human subject having one or more symptoms of ALS. The methods include administering a therapeutically effective amount of antisense oligonucleotide that targets calpain-2 to a subject.

[0045] The terms “amyotrophic lateral sclerosis” and “ALS” are used interchangeably herein, and include all of the classifications of ALS known in the art, including, but not limited to classical ALS (e.g., ALS that affects both lower and upper motor neurons), Primary Lateral Sclerosis (PLS, e.g., those that affect only the upper motor neurons), Progressive Bulbar Palsy (PBP or Bulbar Onset, a version of ALS that typically begins with difficulties swallowing, chewing and speaking) and Progressive Muscular Atrophy (PMA, typically affecting only the lower motor neurons). The terms include sporadic and familial (hereditary) ALS, ALS at any rate of progression (e.g., rapid, non-slow or slow progression) and ALS at any stage (e.g., prior to onset, at onset and late stages of ALS).

[0046] Calpain-2 (encoded by the CAPN2 gene)

[0047] In some embodiments, CAPN2 and calpain-2 refer to a gene and a gene product thereof, respectively. CAPN2 and calpain-2 are used to refer to a nucleic acid sequence (e.g., a CAPN2 DNA sequence or a CAPN2 RNA sequence), a transcript (e.g., a CAPN2 mRNA), or a protein encoded by CAPN2 (e.g., a calpain-2 polypeptide from a species, which may be known as CAPN2, CANP2, CANPL2, mCANP, CANPrnl, calpain-2, calpain 2, m-calpain, millimolar-calpain, calpain M-type, calpain-2 large subunit, calpain 2 (m / 11) large subunit, calpain large polypeptide L2, calpain-2 catalytic subunit, calcium-activated neural proteinase 2, or CANP 2. Various CAPN2 sequences including variants thereof are readily available to those of skill in the art. Various technologies, e.g., assays, cells, animal models, etc., have also been reported and can be utilized for characterization and / or assessment of provided technologies (e.g., oligonucleotides, compositions, methods, etc.) in accordance with the present disclosure. Atorney Docket No. 38709-0130W01

[0048] The CAPN2 gene is reported to encode a calpain-2 protein, which according to various reports comprises 622 or 700 amino acids, depending on isoform, and primarily localizes to cellular cytoplasm and cellular plasma membrane in a variety of tissues including those of a central nervous system (CNS). It has been reported that in some embodiments human calpain-2 comprises multiple domains including, from N-terminal region to C- terminal region: (i) an alpha helix; (ii) a CysPc domain comprising a first protease core domain (PCI) and a second protease core domain (PC2); (iii) a calpain-type beta-sandwich (CBSW) domain; and (iv) a penta-EF-hand in the catalytic large subunit (PEF(L)) domain. Calpain-2 proteins from other species e.g., monkeys, rats, and mice, have been reported to comprise various conserved domains as human calpain-2.

[0049] Calpain-2 belongs to a family of calcium-dependent proteases, and has been reported to cleave a multitude of protein targets including, e.g., actin, cytoplasmic polyadenylation element-binding protein 3 (CPEB3), p35, phosphatase and tensin homolog deleted on chromosome 10 (PTEN), protein tyrosine phosphatase (PTPN13; also known as Fas- associated protein-1 (FAP1)), spectrin, TDP-43, neurofilament-light chain (Wang et al., Expert Opin. Ther. Targets, 2018; Baudry, Curr. Neur opharm acol., 2019), etc. Activation of calpain-2 has been reported to involve relatively high concentrations of calcium ion (Ca2+), with reported ranges comprising near-millimolar amounts, e.g., 400-800 pM. In addition, some studies have suggested that calpain-2 may be capable of being activated by phosphorylation by epidermal growth factor (EGF) or brain-derived neurotrophic factor (BDNF) via extracellular signal-regulated kinase (ERK) (Glading et al., Mol. Cell Biol., 2004; Zadran et al., J. Neurosci., 2010). Calpain-2 has been reported as a regulator of synaptic plasticity and possibly limiting such plasticity (Baudry and Bi, Trends Neurosci., 2017), and has been reported to be involved in exci totoxi city as inhibition of calpain-2 has reduced such toxicity (Wang et al., J. Neurosci., 2013).

[0050] Dysregulation of calpain-2 has been reported to be associated with various forms of neurodegeneration, such as amyotrophic lateral sclerosis (ALS). As such, calpain-2 may be a potential therapeutic target for treatment of ALS. The NCBI Gene ID for CAPN2 is 824 (www.ncbi.nlm.nih.gov / gene / 824).

[0051] Compound A

[0052] Compound A is a 5-10-5 MOE gapmer, having the sequence of (from 5’ to 3’) ATCAGTTTCTGTAGGCTTCC (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16- 20 are 2’ -O-methoxy ethylribose modified nucleosides, wherein the intemucleoside linkages Atorney Docket No. 38709-0130W01 between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5 -methylcytosine.

[0053] In some instances, Compound A is described by the following chemical notation: / 52MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / *T*T*T* / iMe- dC / *T*G*T*A*G*G* / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErC / ; wherein: Atorney Docket No. 38709-0130W01

[0054] * is -O-P(O)(SH)-O-; Atorney Docket No. 38709-0130W01

[0055] Atorney Docket No. 38709-0130W01

[0056] In some embodiments, Compound A is depicted by the following chemical structure: Atorney Docket No. 38709-0130W01

[0057] In some embodiments, Compound A is a pharmaceutically acceptable salt, and in certain embodiments, it is the sodiated form.

[0058] In some embodiments, the sodiated form of Compound A is depicted by the following chemical structure: Atorney Docket No. 38709-0130W01

[0059] Conjugated Antisense Oligonucleotides

[0060] Antisense oligonucleotides of this disclosure may be covalently linked to one or more moieties or conjugates. Various additional chemical moieties, e.g., targeting moieties, carbohydrate moieties, lipid moieties, etc. are known in the art and can be utilized in accordance with the present disclosure to modulate properties and / or activities of oligonucleotides, e.g., stability, half life, activities, delivery, pharmacodynamics properties, pharmacokinetic properties, etc. In some embodiments, certain additional chemical moieties facilitate delivery of oligonucleotides to desired cells, tissues and / or organs, including but not limited the cells of the central nervous system. In some embodiments, certain additional chemical moieties facilitate internalization of oligonucleotides. In some embodiments, certain additional chemical moieties increase oligonucleotide stability. In some embodiments, the present disclosure provides technologies for incorporating various additional chemical moieties into oligonucleotides. In some embodiments, additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Antisense oligonucleotides can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense oligonucleotides to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense oligonucleotide having terminal nucleic acid from exonuclease degradation, and can help in delivery and / or localization within a cell. The cap can be present at the 5 ’-terminus (5 ’-cap), or at the 3’- terminus (3 ’-cap), or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3’ and 5 ’stabilizing groups that can be used to cap one or both ends of an antisense oligonucleotide to impart nuclease stability are known in the art.

[0061] Compositions and Methods for Formulating Pharmaceutical Compositions

[0062] Various technologies are available in the art to manufacture provided oligonucleotide and may be utilized in accordance with the present disclosure. For example, in some embodiments, oligonucleotides are manufactured on solid support using phosphoramidites. In some embodiments, oligonucleotides are manufactured in solution. In some embodiments, manufacturing of oligonucleotides comprise multiple cycles, in each of which one or more nucleoside units, typically one, are added. In some embodiments, a cycle comprises coupling of a phosphoramidite, blocking unreacted 5 ’-OH groups, modification (e.g., sulfurization), Atorney Docket No. 38709-0130W01 and / or de-blocking protected 5’-OH groups in newly coupled nucleosides. In some embodiments, modification may be performed at the end of cycles when certain lengths of oligonucleotides are achieved.

[0063] Antisense oligonucleotides or salts thereof of this disclosure may be admixed with any pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

[0064] An antisense oligonucleotide, or salt thereof, targeted to a CAPN2 nucleic acid can be used in pharmaceutical compositions by combining the antisense oligonucleotide, or salt thereof, with a suitable pharmaceutically acceptable diluent or carrier.

[0065] An antisense oligonucleotide, or salt thereof, described herein may be formulated as a pharmaceutical composition for intrathecal administration to a subject.

[0066] Pharmaceutical compositions comprising antisense oligonucleotides of this disclosure encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense oligonucleotides and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0067] Diagnosis and subject selection

[0068] In one aspect, provided herein are methods of treating at least one symptom of ALS in a human subject. Also provided are methods of reducing the ALS disease progression rate; methods of improving, maintaining, or slowing down the deterioration of muscle strength, respiratory muscle function or fine motor skills associated with ALS; methods of preventing or reducing serious adverse events associated with ALS or its treatment; and methods of increasing survival time of a human subject having one or more symptoms of ALS. Also provided herein are methods of treating or preventing at least one symptom of benign fasciculation syndrome (BFS) or Cramp-fasciculation syndrome (CFS) in a human subject.

[0069] Any of the human subjects in the methods described herein may exhibit one or more symptoms associated with ALS, or have been diagnosed with ALS. In some embodiments, the subjects may be suspected as having ALS, and / or at risk for developing ALS. Atorney Docket No. 38709-0130W01

[0070] Some embodiments of any of the methods described herein can further include determining that a human subject has or is at risk for developing ALS, diagnosing a human subject as having or at risk for developing ALS, or selecting a human subject having or at risk for developing ALS. Likewise, some embodiments of any of the methods described herein can further include determining that a human subject has or is at risk for developing BFS or CFS, diagnosing a human subject as having or at risk for developing BFS or CFS, or selecting a human subject having or at risk for developing BFS or CFS.

[0071] In some embodiments of any of the methods described herein, the human subject has shown one or more symptoms of ALS for about 24 months or less (e.g., about 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 month, or 1 week or less). In some embodiments, the subject has shown one or more symptoms of ALS for about 36 months or less (e.g., about 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, or 25 months or less).

[0072] The order and type of ALS symptoms displayed by a subject may depend on which motor neurons in the body are damaged first, and consequently which muscles in the body are damaged first. For example, bulbar onset, limb onset, or respiratory onset ALS may present with similar or different symptoms. In general, ALS symptoms may include muscle weakness or atrophy (e.g., affecting upper body, lower body, and / or speech), muscle fasciculation (twitching), cramping, or stiffness of affected muscles. Early symptoms of ALS may include those of the arms or legs, difficulty in speaking clearly or swallowing (e.g., in bulbar onset ALS). Other symptoms include loss of tongue mobility, respiratory difficulties, difficulty breathing or abnormal pulmonary function, difficulty chewing, and / or difficulty walking (e.g., resulting in stumbling). Subjects may have respiratory muscle weakness as the initial manifestation of ALS symptoms. Such subjects may have very poor prognosis. In some subjects, the time of onset of respiratory muscle weakness can be used as a prognostic factor.

[0073] ALS symptoms can also be classified by the part of the neuronal system that is degenerated, namely, upper motor neurons or lower motor neurons. Lower motor neuron degeneration manifests, for instance, as weakness or wasting in one or more of the bulbar, cervical, thoracic, and / or lumbosacral regions. Upper motor neuron degeneration can include increased tendon reflexes, spasticity, pseudo bulbar features, Hoffmann reflex, extensor plantar response, and exaggerated reflexes (hyperreflexia) including an overactive gag reflex. Progression of neuronal degeneration or muscle weakness is a hallmark of the disease. Accordingly, some embodiments of the present disclosure provide a method of ameliorating at least one symptom of lower motor neuron degeneration, at least one symptom of upper motor neuron degeneration, or at least one symptom from each of lower motor neuron Atorney Docket No. 38709-0130W01 degeneration and upper motor neuron degeneration. In some embodiments of any of the methods described herein, symptom onset can be determined based on information from subject and / or subject’s family members. In some embodiments, the median time from symptom onset to diagnosis is about 12 months.

[0074] In some instances, the human subject has been diagnosed with ALS. For example, the subject may have been diagnosed with ALS for about 24 months or less (e.g., about 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 month or less). For example, the subject may have been diagnosed with ALS for 1 week or less, or on the same day that the presently disclosed treatments are administered. The subject may have been diagnosed with ALS for longer than about 24 months (e.g., longer than about 28, 32, 36, 40, 44, 48, 52, 56, 60, 64, 68, 72, 76, or 80 months). Methods of diagnosing ALS are known in the art. For example, the subject can be diagnosed based on clinical history, family history, physical or neurological examinations (e.g., signs of lower motor neuron or upper motor neuron degeneration). The subject can be confirmed or identified, e.g. by a healthcare professional, as having ALS. Multiple parties may be included in the process of diagnosis. For example, where samples are obtained from a subject as part of a diagnosis, a first party can obtain a sample from a subject and a second party can test the sample. In some embodiments of any of the human subjects described herein, the subject is diagnosed, selected, or referred by a medical practitioner (e.g., a general practitioner).

[0075] In some embodiments, the subject fulfills the El Escorial criteria for probable or definite ALS, i.e. the subject presents:

[0076] 1. Signs of lower motor neuron (LMN) degeneration by clinical, electrophysiological or neuropathologic examination;

[0077] 2. Signs of upper motor neuron (UMN) degeneration by clinical examination; and

[0078] 3. Progressive spread of signs within a region or to other regions, together with the absence of:

[0079] Electrophysiological evidence of other disease processes that might explain the signs of LMN and / or UMN degenerations; and

[0080] Neuroimaging evidence of other disease processes that might explain the observed clinical and electrophysiological signs.

[0081] Under the El Escorial criteria, signs of LMN and UMN degeneration in four regions are evaluated, including brainstem, cervical, thoracic, and lumbrasacral spinal cord of the central nervous system. The subject may be determined to be one of the following categories: Atorney Docket No. 38709-0130W01

[0082] A. Clinically Definite ALS, defined on clinical evidence alone by the presence of UMN, as well as LMN signs, in three regions.

[0083] B. Clinically Probable ALS, defined on clinical evidence alone by UMN and LMN signs in at least two regions with some UMN signs necessarily rostral to (above) the LMN signs.

[0084] C. Clinically Probable ALS - Laboratory-supported, defined when clinical signs of UMN and LMN dysfunction are in only one region, or when UMN signs alone are present in one region, and LMN signs defined by EMG criteria are present in at least two limbs, with proper application of neuroimaging and clinical laboratory protocols to exclude other causes.

[0085] D. Clinically Possible ALS, defined when clinical signs of UMN and LMN dysfunction are found together in only one region or UMN signs are found alone in two or more regions; or LMN signs are found rostral to UMN signs and the diagnosis of Clinically Probable - Laboratory-supported.

[0086] In some embodiments, the subject has clinically definite ALS (e.g., based on the El Escorial criteria).

[0087] The subject can be evaluated and / or diagnosed using the Revised Amyotrophic Lateral Sclerosis Functional Rating Scale (ALSFRS-R). The ALSFRS-R is an ordinal rating scale (ratings 0-4) used to determine subjects' assessment of their capability and independence in 12 functional activities relevant in ALS. ALSFRS-R scores calculated at diagnosis can be compared to scores throughout time to determine the speed of progression. Change in ALSFRS-R scores can be correlated with change in strength over time, and can be associated with quality of life measures and predicted survival. ALSFRS-R demonstrates a linear mean slope and can be used as a prognostic indicator (See e.g., Berry et al. Amyotroph Lateral Scler Frontotemporal Degener 2014;15: 1-8; Traynor et al., Neurology 63: 1933-1935, 2004; Simon et al., Ann Neurol 76:643-657, 2014; and Moore et al. Amyotroph Lateral Scler Other Motor Neuron Disord 4:42, 2003).

[0088] In the ALSFRS-R, functions mediated by cervical, trunk, lumbosacral, and respiratory muscles are each assessed by 3 items. Each item is scored from 0-4, with 4 reflecting no involvement by the disease and 0 reflecting maximal involvement. The item scores are added to give a total. Total scores reflect the impact of ALS, with the following exemplary categorization:

[0089] >40 (minimal to mild); 39-30 (mild to moderate); < 30 (moderate to severe); < 20 (advanced disease). Atorney Docket No. 38709-0130W01

[0090] For example, a subject can have an ALSFRS-R score (e.g., a baseline ALSFRS-R score) of 40 or more (e.g., at least 41, 42, 43, 44, 45, 46, 47, or 48), between 30 and 39, inclusive (e.g., 31, 32, 33, 34, 35, 36, 37, or 38), or 30 or less (e.g., 21, 22, 23, 24, 25, 26, 27, 28, or 29). In some embodiments of any of the methods described herein, the subject has an ALSFRS-R score (e.g., a baseline ALSFRS-R score) of 40 or less (e.g., 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10 or less). In some embodiments, the subject has an ALSFRS-R score (e.g., a baseline ALSFRS-R score) of 20 or less (e.g., 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5 or less).

[0091] As ALS is a progressive disease, all patients generally will progress over time. However, a large degree of inter-subject variability exists in the rate of progression, as some subjects die or require respiratory support within months while others have relatively prolonged survival. The subjects described herein may have rapid progression ALS or slow progression ALS. The rate of functional decline in a subject with ALS can be measured by the change in ALSFRS-R score per month. For example, the score can decrease by about 1.02 (±2.3) points per month.

[0092] One predictor of patient progression is the patient’s previous rate of disease progression (AFS), which can be calculated as: AFS=(48 - ALSFRS-R score at the time of evaluation) / duration from onset to time of evaluation (month). The AFS score represents the number of ALSFRS-R points lost per month since symptom onset, and can be a significant predictor of progression and / or survival in subjects with ALS (See e.g., Labra et al. J Neurol Neurosurg Psychiatry 87:628-632, 2016 and Kimura et al. Neurology 66:265-267, 2006). The subject may have had a disease progression rate (AFS) of about 0.50 or less (e.g., about 0.45, 0.40, 0.35, 0.30, 0.25, 0.20, 0.15, or 0.10 or less); between about 0.50 and about 1.20 inclusive (e.g., about 0.55, 0.60, 0.65, 0.70, 0.75, 0.80, 0.85, 0.90, 0.95, 1.00, 1.05, 1.10, or 1.15); or about 1.20 or greater (e.g., about 1.25, 1.30, 1.35, 1.40, 1.45, 1.50, 1.55, 1.60, 1.75, 1.80, 1.85, 1.90, 1.95, or 2.00 or greater). In some embodiments of any of the methods described herein, the subject can have an ALS disease progression rate (AFS) of about 0.50 or greater (e.g., about 0.55, 0.60, 0.65, 0.70, 0.75, 0.80, 0.85, 0.90, 0.95, 1.00, 1.05, 1.10, 1.15, 1.20, 1.25, 1.30, 1.35, 1.40, 1.45, 1.50, 1.55, 1.60, 1.75, 1.80, 1.85, 1.90, 1.95, or 2.00 or greater). However, it should be noted that the AFS score is a predictor of patient progression, and may under or overestimate a patient’s progression once under evaluation.

[0093] In some embodiments, since initial evaluation, the subject has lost on average about 0.8 to about 2 (e.g., about 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, or 1.9) ALSFRS-R points per month over 3-12 months. In some embodiments, the subject has lost on average Atorney Docket No. 38709-0130W01 more than about 1.2 ALSFRS-R points per month over 3-12 months since initial evaluation. The subject may have had a decline of at least 3 points (e.g., at least 4, 6, 8, 10, 12, 14, 16, 20, 24, 28, or 32 points) in ALSFRS-R score over 3-12 months since initial evaluation. In some embodiments, the subject has lost on average about 0.8 to about 2 (e.g., about 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, or 1.9) ALSFRS-R points per month over the previous 3- 12 months. In some embodiments, the subject has lost on average more than about 1.2 (e.g., more than about 1.5, 1.8, 2.0, 2.5, or 3) ALSFRS-R points per month over the previous 3-12 months.

[0094] In some embodiments of any of the methods described herein, a marker (e.g., the presence or level of a marker) in a sample obtained from the subject may be used for ALS diagnosis or prognosis, and to track disease activity and treatment responses. Suitable samples include, for example, cells, tissues, muscles, body fluids such as blood (also referred to herein as plasma and used interchangeably throughout), urine, and / or cerebral spinal fluid (CSF) samples. For instance, levels of phosphorylated neurofilament heavy subunit (pNF-H) or neurofilament light chain (NfL) in CSF and / or blood (e.g., the plasma component of blood) can be used as a biomarker for ALS diagnosis, prognosis, or to track disease activity or treatment outcomes. pNF-H is a main component of the neuronal cytoskeleton and is released into the CSF and the bloodstream with neuronal damage. Levels of pNF-H may correlate with the level of axonal loss and / or burden of motor neuron dysfunction (See, e.g., De Schaepdryver et al. Journal of Neurology, Neurosurgery & Psychiatry 2018;89:367-373).

[0095] In some embodiments, the concentration of pNF-H in the CSF and / or blood of a subject with ALS is significantly increased in the early disease stage. Higher levels of pNF-H in the plasma, serum and / or CSF may be associated with faster ALS progression (e.g., faster decline in ALSFRS-R), and / or shorter survival. pNF-H concentration in plasma may be higher in ALS subjects with bulbar onset than those with spinal onset. In some cases, an imbalance between the relative expression levels of the neurofilament heavy and light chain subunits can be used for ALS diagnosis, prognosis, or tracking disease progression. pNF-H and NfL can be detected e.g., in the CSF, plasma and / or serum using known methods in the art, such as but not limited to enzyme-linked immunosorbent assay (ELISA) and Simoa assays (See e.g., Shaw et al. Biochemical and Biophysical Research Communications 336: 1268-1277, 2005; Ganesalingam et al. Amyotroph Lateral Scler Frontotemporal Degener 14(2): 146-9, 2013; De Schaepdryver et al. Annals of Clinical and Translational Neurology 6(10): 1971-1979, 2019; Wilke et al. Clin Chem Lab Med 57(10): 1556-1564, 2019; Poesen et al. Front Neurol 9: 1167, 2018; Pawlitzki et al. Front. Atorney Docket No. 38709-0130W01

[0096] Neurol. 9: 1037, 2018; Gille et al. Neuropathol Appl Neurobiol 45(3):291-304, 2019). Commercialized pNF-H detection assays can also be used, such as those developed by EnCor Biotechnology, BioVendor, and Millipore-EMD. Commercial NfL assay kits based on the Simoa technology, such as those produced by Quanterix can also be used (See, e.g., Thouvenot et al. European Journal of Neurology 27:251-257, 2020). Factors affecting pNF-H and NfL levels or their detection in serum and / or plasma in relation to disease course may differ from those in CSF. The levels of neurofilament (e.g. pNF-H and / or NfL) in the CSF and serum may be correlated (See, e.g., Wilke et al. Clin Chem Lab Med 57(10): 1556-1564, 2019).

[0097] Subjects in the methods described herein may have a CSF or blood pNF-H level of about 300 pg / mL or higher (e.g., about 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050, 2100, 2150, 2200, 2250, 2300, 2350, 2400, 2450, 2500, 2550, 2600, 2650, 2700, 2750, 2800, 2850, 2900, 3000, 3200, 3500, 3800, or 4000 pg / mL or higher). In some embodiments, the serum pNF-H level of subjects in the methods described herein can be about 70 to about 1200 pg / mL (e.g., about 70 to about 1000, about 70 to about 800, about 80 to about 600, or about 90 to about 400 pg / mL). In some embodiments, the CSF pNF-H levels of subjects in the methods described herein can be about 1000 to about 5000 pg / mL (e.g., about 1500 to about 4000, or about 2000 to about 3000 pg / mL).

[0098] Subjects of the present disclosure may have a CSF or blood (e.g., plasma or serum) level of NfL of about 50 pg / mL or higher (e.g., about 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, or 250 pg / mL or higher). In some embodiments, the serum NfL level of subjects in the methods described herein can be about 50 to about 300 pg / mL (e.g., about 50 to about 280, about 50 to about 250, about 50 to about 200, about 50 to about 150, about 50 to about 100, about 100 to about 300, about 100 to about 250, about 100 to about 200, about 100 to about 150, about 150 to about 300, about 150 to about 250, about 150 to about 200, about 200 to about 300, about 200 to about 250, or about 250 to about 300 pg / mL). In some embodiments, the CSF NfL level of subjects in the methods described herein can be about 2000 to about 40,000 pg / mL (e.g., about 2000 to about 35,000, about 2000 to about 30,000, about 2000 to about 25,000, about 2000 to about 20,000, about 2000 to about 15,000, about 2000 to about 10,000, about 2000 to about 8000, about 2000 to about 6000, about 2000 to about 4000, about 4000 to about 40,000, about 4000 to about 35,000, about 4000 to about 30,000, about 4000 to about 25,000, about 4000 to Atorney Docket No. 38709-0130W01 about 20,000, about 4000 to about 15,000, about 4000 to about 10,000, about 4000 to about 8000, about 4000 to about 6000, about 6000 to about 40,000, about 6000 to about 35,000, about 6000 to about 30,000, about 6000 to about 25,000, about 6000 to about 20,000, about 6000 to about 15,000, about 6000 to about 10,000, about 6000 to about 8000, about 8000 to about 40,000, about 8000 to about 35,000, about 8000 to about 30,000, about 8000 to about 25,000, about 8000 to about 20,000, about 8000 to about 15,000, about 8000 to about 10,000, about 10,000 to about 40,000, about 10,000 to about 35,000, about 10,000 to about 30,000, about 10,000 to about 25,000, about 10,000 to about 20,000, about 10,000 to about 15,000, about 15,000 to about 40,000, about 15,000 to about 35,000, about 15,000 to about 30,000, about 15,000 to about 25,000, about 15,000 to about 20,000, about 20,000 to about 40,000, about 20,000 to about 35,000, about 20,000 to about 30,000, about 20,000 to about 25,000, about 25,000 to about 40,000, about 25,000 to about 35,000, about 25,000 to about 30,000, about 30,000 to about 40,000, about 30,000 to about 35,000, or about 35,000 to about 40,000 pg / mL).

[0099] Subjects of the present disclosure may have a CSF, a blood, or muscle level of spectrin breakdown product 145 (SBDP-145) that is elevated as compared to a subject who does not have or is not suspected of having ALS (see, e.g., Pritt ML, Hall DG, Jordan WH, Ballard DW, Wang KK, Muller UR, Watson DE. Initial biological qualification of SBDP-145 as a biomarker of compound-induced neurodegeneration in the rat. Toxicol Sci. 2014 Oct;141(2):398-408. doi: 10.1093 / toxsci / kful36. Epub 2014 Jul 11. PMID: 25015659; PMCID: PMC4833023). In some embodiments, SBDP-145 levels can be measured by methods known in the art (e.g., ELISA).

[0100] Subjects of the present disclosure may have a CSF, a blood, a brain (e.g., motor cortex), a spinal cord, or a muscle level of CAPN2 mRNA and / or calpain-2 protein that is elevated as compared to a subject who does not have or is not suspected of having ALS.

[0101] Subjects of the present disclosure may have a CSF, a blood, or spinal cord (e.g., protein) level of TDP-43 cleavage products that is elevated as compared to a subject who does not have or is not suspected of having ALS (see, e.g., Yamashita T, Hideyama T, Hachiga K, Teramoto S, Takano J, Iwata N, Saido TC, Kwak S. A role for calpain-dependent cleavage of TDP-43 in amyotrophic lateral sclerosis pathology. Nat Commun. 2012;3: 1307. doi: 10.1038 / ncomms2303. PMID: 23250437, incorporated herein by reference).

[0102] Additional biomarkers useful for ALS diagnosis, prognosis, and disease progression monitoring are contemplated herein, including but are not limited to, CSF levels of S100-P, cystatin C, and chitotriosidase (CHIT) (See e.g., Chen et al. BMC Neurol 16: 173, 2016). Atorney Docket No. 38709-0130W01

[0103] Serum levels of uric acid can be used as a biomarker for prognosing ALS (See e.g., Atassi et al. Neurology 83(19): 1719-1725, 2014). Akt phosphorylation can also be used as a biomarker for prognosing ALS (See e.g., WO2012 / 160563). In some embodiments, urine levels of p75ECD and ketones can be used as a biomarker for ALS diagnosis (See e.g., Shepheard et al. Neurology 88: 1137-1143, 2017). Serum and urine levels of creatinine can also be used as a biomarker. Other useful blood, CSF, neurophysiological, and neuroradiological biomarkers for ALS are described in e.g., Turner et al. Lancet Neurol 8:94-109, 2009. Any of the markers described herein can be used for diagnosing a subject as having ALS, or determining that a subject is at risk for developing ALS.

[0104] A subject may also be identified as having ALS, or at risk for developing ALS, based on genetic analysis. Genetic variants associated with ALS are known in the art (See., e.g., Taylor et al. Nature 539: 197-206, 2016; Brown and Al-Chalabi N Engl J Med 377: 162-72, 2017; and http: / / alsod.iop.kcl.ac.uk). In some embodiments of any of the methods described herein, the subject can carry mutations in one or more genes associated with familial and / or sporadic ALS. Exemplary genes associated with ALS include but are not limited to: ANG, TARDBP, VCP, VAPB, SQSIM1, DCTN1, FUS, UNC13A, ATXN2, HNRNPA1, CHCHDIO, MOBP, C21ORF2, NEK1, TUBA4A, TBK1, MATR3, PFN1, U OLN2, TA Fl 5, OPTN, TDP- 43, and DAO. Additional description of genes associated with ALS can be found at Therrien et al. Curr Neurol Neurosci Rep 16:59-71, 2016; Peters et al. J Clin Invest 125:2548, 2015, and Pottier et al. J Neurochem, 138:Suppl 1:32-53, 2016. Genetic variants associated with ALS can affect the ALS progression rate in a subject, the pharmacokinetics of the administered compounds in a subject, and / or the efficacy of the administered compounds for a subject.

[0105] The subject may have a mutation in the gene encoding CuZn-Superoxide Dismutase (SOD1). Mutation results in the SOD1 protein being more prone to aggregation, resulting in the deposition of cellular inclusions that contain misfolded SOD1 aggregates (See e.g., Andersen et al., Nature Reviews Neurology 7:603-615, 2011). Over 100 different mutations in SOD1 have been linked to inherited ALS, many of which result in a single amino acid substitution in the protein. In some embodiments, the SOD1 mutation is A4V (i.e., a substitution of valine for alanine at position 4). SOD1 mutations are further described in, e.g., Rosen et al. Hum. Mol. Genet. 3, 981-987,1994 and Rosen et al. Nature 362:59-62, 1993. In some embodiments, the subject has a mutation in the C9ORF72 gene. Repeat expansions in the C9ORF72 gene are a frequent cause of ALS, with both loss of function of C9ORF72 and gain of toxic function of the repeats being implicated in ALS (See e.g., Balendra and Isaacs, Atorney Docket No. 38709-0130W01

[0106] Nature Reviews Neurology 14:544-558, 2018). The methods described herein can include, prior to administration of the antisense oligonucleotide (i.e., Compound A), detecting a SOD1 mutations and / or a C9ORF72 mutation in the subject. Methods for screening for mutations are well known in the art. Suitable methods include, but are not limited to, genetic sequencing. See, e.g., Hou et al. Scientific Reports 6:32478, 2016; and Vajda et al. Neurology 88: 1-9, 2017.

[0107] Skilled practitioners will appreciate that certain factors can affect the bioavailability and metabolism of the administered compounds for a subject, and can make adjustments accordingly. These include but are not limited to liver function (e.g. levels of liver enzymes), renal function, and gallbladder function (e.g., ion absorption and secretion, levels of cholesterol transport proteins). There can be variability in the levels of exposure each subject has for the administered compound (e.g., Compound A), differences in the levels of excretion, and in the pharmacokinetics of the compounds in the subjects being treated. Any of the factors described herein may affect drug exposure by the subject. For instance, decreased clearance of the compounds can result in increased drug exposure, while improved renal function can reduce the actual drug exposure. The extent of drug exposure may be correlated with the subject’s response to the administered compounds and the outcome of the treatment.

[0108] The subject can be e.g., older than 18 years of age (e.g., between 18-100, 18-90, 18- 80, 18-70, 18-60, 18-50, 18-40, 18-30, 18-25, 25-100, 25-90, 25-80, 25-70, 25-60, 25-50, 25- 40, 25-30, 30-100, 30-90, 30-80, 30-70, 30-60, 30-50, 30-40, 40-100, 40-90, 40-80, 40-70, 40-60, 40-50, 50-100, 50-90, 50-80, 50-70, 50-60, 60-100, 60-90, 60-80, 60-70, 70-100, 70- 90, 70-80, 80-100, 80-90, or 90-100 years of age). The subject can have a BMI of between 18.5-30 kg / m2 (e.g., between 18.5-28, 18.5-26, 18.5-24, 18.5-22, 18.5-20, 20-30, 20-28, 20- 26, 20-24, 20-22, 22-30, 22-28, 22-26, 22-24, 24-30, 24-28, 24-26, 26-30, 26-28, or 28-30 kg / m2). Having a mutation in any of the ALS-associated genes described herein or presenting with any of the biomarkers described herein may suggest that a subject is at risk for developing ALS. Such subjects can be treated with the methods provided herein for preventative and prophylaxis purposes.

[0109] In some embodiments, the subjects have one or more symptoms of benign fasciculation syndrome (BFS) and / or cramp-fasciculation syndrome (CFS). BFS and CFS are peripheral nerve hyperexcitability disorders, and can cause fasciculations, cramps, pain, fatigue, muscle stiffness, and paresthesia. Methods of identifying subjects with these disorders are known in the art, such as by clinical examination and electromyography. Atorney Docket No. 38709-0130W01

[0110] Methods of Treatment

[0111] The present disclosure provides methods of treating ALS in a subject, or ameliorating at least one symptom of ALS in a subject, or prophylactically treating a subject at risk for developing ALS (e.g., a subject with a family history of ALS) or a subject suspected to be developing ALS (e.g., a subject displaying at least one symptom of ALS, a symptom of upper motor neuron degeneration, and / or a symptom of lower motor neuron degeneration, but not enough symptoms at that time to support a full diagnosis of ALS).

[0112] Also provided are methods of ameliorating at least one symptom of lower motor neuron degeneration, at least one symptom of upper motor neuron degeneration, or at least one symptom from each of lower motor neuron degeneration and upper motor neuron degeneration in a subject.

[0113] Some embodiments of the present disclosure provide methods of slowing ALS disease progression (e.g., reducing the ALS disease progression rate); and methods of reducing deterioration of muscle strength, respiratory muscle / pulmonary function and / or fine motor skill, as well as methods of maintaining or improving muscle strength, respiratory muscle / pulmonary function and / or fine motor skill.

[0114] Also provided herein are methods of preventing or reducing at least one adverse events (e.g., serious adverse events) associated with ALS or its treatment; and methods of increasing survival time of a human subject having one or more symptoms of ALS.

[0115] This disclosure further provides methods of treating at least one symptom of bulbar- onset ALS in a human subject. Also provided are methods of ameliorating at least one symptom of benign fasciculation syndrome or cramp fasciculation syndrome.

[0116] The methods described herein include administering to the subject a therapeutically effective amount of Compound A. As noted above, Compound A is a 5-10-5 MOE gapmer, having the sequence of (from 5’ to 3’) ATCAGTTTCTGTAGGCTTCC (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 are 2’ -O-methoxy ethylribose modified nucleosides, wherein the intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5-methylcytosine. In some embodiments, the methods described herein include administering to a subject a dose (e.g., a fixed dose) of about 5 mg to about 125 mg of Compound A. In some embodiments, the methods described herein include administering to a subject about 5 mg, about 6.25 mg, about 10 mg, about 10.5 mg, about 11 mg, about 11.5 mg, about 12 mg, about 12.5 mg, about 13 mg, about 13.5 mg, about 14 mg, about 14.5 mg, about Atorney Docket No. 38709-0130W01

[0117] 15 mg, about 15.5 mg, about 16 mg, about 16.5 mg, about 17 mg, about 18.5 mg, about 19 mg, about 19.5 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 100 mg, about 110 mg, about 105 mg, about 110 mg, about 115 mg, about 120 mg, or about 125 mg of Compound A. In some embodiments, methods described herein include administering to a subject no more than 100 mg of Compound A.

[0118] Treatment methods can include a single administration, multiple administrations, and repeating administration as required for the prophylaxis or treatment of ALS, or at least one symptom of ALS. The duration of prophylaxis treatment can be a single dosage or the treatment may continue (e.g., multiple dosages), e.g., for weeks, months, years or indefinitely for the lifespan of the subject. For example, a subject at risk for ALS may be treated with the methods provided herein for days, weeks, months, or even years so as to prevent the disease from occurring or fulminating. In some embodiments of any of the methods described herein, Compound A is administered to a subject at a dose (e.g., a fixed dose) of about 5 mg to about 125 mg (e.g., about 6.25 mg, about 12.5 mg, about 25 mg, about 50 mg, or about 100 mg) about every 4 weeks (e.g., about every 28 days). In some embodiments of any of the methods described herein, Compound A is administered to a subject at a dose (e.g., a fixed dose) of about 12.5 mg, about 25 mg, about 50 mg, and / or about 100 mg about every 4 weeks (e.g., about every 28 days). In other words, in some embodiments, Compound A is administered to a subject on day 1 and then about every 4 weeks or about every 28 days (e.g., the subject is administered Compound A on day 1, on day 29 (+ / - 3 days), on day 57 (+ / - 3 days), on day 85 (+ / - 3 days), on day 113 (+ / - 3 days), and so on). In some embodiments, the human subject is administered repeat doses of the fixed dose of Compound A at least 25 days apart (z.e., no less than 25 days apart). In some embodiments, the human subject is administered a dose of Compound A that does not exceed 100 mg.

[0119] In some embodiments treatment methods can include assessing a level of disease in the subject prior to treatment, during treatment, and / or after treatment. The treatment provided herein can be administered repeatedly (e.g., administered weekly or monthly). In some embodiments, treatment can continue until a decrease in the level of disease in the subject is detected. The methods provided herein may in some embodiments begin to show efficacy (e.g., alleviating one or more symptoms of ALS, improvement as measured by the ALSFRS-R, or maintenance of an ALSFRS-R rating) less than 60 days (e.g., less than 50, 45, Atorney Docket No. 38709-0130W01

[0120] 40, 35, 30, 25, 20, 15, or 10 days) after the initial administration, or after less than 60 administrations (e.g., less than 50, 45, 40, 35, 30, 25, 20, 15, or 10 administrations).

[0121] In some embodiments of any of the methods described herein, the subject is diagnosed with ALS, at risk for developing ALS, or suspected as having ALS. The subject may, for example, have been diagnosed with ALS for 24 months or less (e.g., any of the subranges within this range described herein). For example, the subject may have been diagnosed with ALS for 1 week or less, or on the same day that the presently disclosed treatments are administered. The subject may have shown one or more symptoms (e.g., ALS symptom onset is defined as the onset of weakness (in the limbs, bulbar region, or trunk). Weakness in the bulbar region includes dysarthria and dysphagia) of ALS for 24 months or less (e.g., any of the subranges within this range described herein).

[0122] Methods described in the present disclosure can include treatment of ALS per se, as well as treatment for one or more symptoms of ALS. “Treating” ALS does not require 100% abolition of the disease or disease symptoms in the subject. Any relief or reduction in the severity of symptoms or features of the disease is contemplated. “Treating” ALS also refers to a delay in onset of symptoms (e.g., in prophylaxis treatment) or delay in progression of symptoms or the loss of function associated with the disease. “Treating” ALS also refers to eliminating or reducing one or more side effects of a treatment (e.g. those caused by any of the therapeutic agents for treating ALS disclosed herein or known in the art). “Treating” ALS also refers to eliminating or reducing one or more direct or indirect effects of ALS disease progression, such as an increase in the number of falls, lacerations, or GI issues. The subject may not exhibit signs of ALS but may be at risk for ALS. For instance, the subject may carry mutations in genes associated with ALS, have family history of having ALS, or have elevated biomarker levels suggesting a risk of developing ALS. The subject may exhibit early signs of the disease or display symptoms of established or progressive disease. The disclosure contemplates any degree of delay in the onset of symptoms, alleviation of one or more symptoms of the disease, or delay in the progression of any one or more disease symptoms (e.g., any improvement as measured by ALSFRS-R, or maintenance of an ALSFRS-R rating (signaling delayed disease progression)). Any relief or reduction in the severity of symptoms or features of benign fasciculation syndrome and cramp-fasciculation syndrome are also contemplated herein.

[0123] The treatment provided in the present disclosure can be initiated at any stage during disease progression. For example, treatment can be initiated prior to onset (e.g., for subjects at risk for developing ALS), at symptom onset or immediately following detection of ALS Attorney Docket No. 38709-0130W01 symptoms, upon observation of any one or more symptoms (e.g., muscle weakness, muscle fasciculations, and / or muscle cramping) that would lead a skilled practitioner to suspect that the subject may be developing ALS. Treatment can also be initiated at later stages. For example, treatment may be initiated at progressive stages of the disease, e.g., when muscle weakness and atrophy spread to different parts of the body and the subject has increasing problems with moving. At or prior to treatment initiation, the subject may suffer from tight and stiff muscles (spasticity), from exaggerated reflexes (hyperreflexia), from muscle weakness and atrophy, from muscle cramps, and / or from fleeting twitches of muscles that can be seen under the skin (fasciculations), difficulty swallowing (dysphagia), speaking or forming words (dysarthria).

[0124] Methods of Administration

[0125] In certain embodiments, an antisense oligonucleotide, or a salt thereof (e.g., Compound A), is administered to the human subject with a syringe for intrathecal delivery. In another embodiment, an antisense oligonucleotide, or a salt thereof (e.g., Compound A), is administered to the human subject with a pump for intrathecal delivery. Thus, this disclosure also provides a pump or syringe comprising a sterile preparation of the antisense oligonucleotide, or a salt thereof (e.g., Compound A). The syringe or pump can be adapted for intrathecal administration of the antisense oligonucleotide, or a salt thereof. In some cases, the syringe or pump delivers a fixed dose(s) (e.g., about 12.5 mg or 12.5 mg, about 25 mg or 25 mg, about 50 mg or 50 mg, about 100 mg or 100 mg, or about 120 mg or 120 mg) of the antisense oligonucleotide. The disclosure also provides a pump or syringe comprising a sterile preparation of a pharmaceutical composition comprising an antisense oligonucleotide, or a salt thereof (e.g., Compound A). The syringe or pump can be adapted for intrathecal administration of the pharmaceutical composition. In some cases, the syringe or pump delivers a fixed dose(s) (e.g., about 12.5 mg or 12.5 mg, about 25 mg or 25 mg, about 50 mg or 50 mg, about 100 mg or 100 mg, or about 120 mg or 120 mg) of the antisense oligonucleotide of the pharmaceutical composition. In a particular embodiment, the pump or syringe comprises a sterile preparation of an antisense oligonucleotide, or salt thereof, wherein the syringe or pump is adapted for intrathecal administration of an antisense oligonucleotide, or a salt thereof (e.g., Compound A), at a fixed dose of 12.5 mg, 25 mg, 50 mg, or 100 mg of the antisense oligonucleotide.

[0126] In some embodiments of any the methods described herein, prior to dose administration, approximately 15 mL (or about 10 ml, about 11 ml, about 12 ml, about 13 ml, Attorney Docket No. 38709-0130W01 about 14 ml, about 15 ml, about 16 ml, about 17 ml, about 18 ml, about 19 ml, or about 20 ml) of a subject’s CSF is collected via lumbar puncture procedure, subsequently the antisense oligonucleotide is delivered intrathecally to the subject in about 15 mL of vehicle solution as a bolus injection over a period of 1 to 5 minutes (e.g., 1 to 3 minutes). Subsequently, the subject is then administered an intrathecal flush containing the vehicle solution alone (about 3 ml, about 4 ml, about 5 ml, about 6 ml. about 7 ml, about 8 ml, about 9 ml, or about 10 ml).

[0127] Following administration, the subject can be evaluated to detect, assess, or determine their level of disease. In some embodiments, treatment can continue until a change (e.g., reduction) in the level of disease in the subject is detected.

[0128] Symptom and Outcome Measurements

[0129] Methods of evaluating symptoms, monitoring ALS progression and / or evaluating the subject’s response to the treatment methods are described herein. Non-limiting examples include physical evaluation by a physician, weight, Electrocardiogram (ECG), ALS Functional Rating Scale (ALSFRS or ALSFRS-R) score, respiratory function, muscle strength, cognitive / behavioral function, quality of life, and speech analysis.

[0130] Respiratory function of the subject can be measured by e.g. vital capacity (including forced vital capacity and slow vital capacity), maximum mid-expiratory flow rate (MMERF), forced vital capacity (FVC), and forced expiratory volume in 1 second (FEVi). Muscle strength can be evaluated by e.g. hand held dynamometry (HHD), hand grip strength dynamometry, manual muscle testing (MMT), electrical impedance myography (EIM), Maximum Voluntary Isometric Contraction Testing (MVICT), motor unit number estimation (MUNE), Accurate Test of Limb Isometric Strength (ATLIS), or a combination thereof. Cognitive / behavior function can be evaluated by e.g. the ALS Depression Inventory (ADI- 12), the Beck Depression Inventory (BDI), and the Hospital Anxiety Depression Scale (HADS) questionnaires. Quality of life can be evaluated by e.g. the ALS Assessment Questionnaire (ALSAQ-40). The Akt level, Akt phosphorylation and / or pAktdAkt ratio can also be used to evaluate a subject’s disease progression and response to treatment (See e.g., WO2012 / 160563).

[0131] Muscle strength

[0132] The muscle strength of a subject can be evaluated using known methods in the art. Quantitative strength measures generally demonstrate a linear, predictable strength loss within an ALS patient. Tufts Quantitative Neuromuscular Examination (TQNE) can be used Atorney Docket No. 38709-0130W01 to provide quantitative measurements using a fixed strain gauge. TQNE measures isometric strength of 20 muscle groups and produces interval strength data in both strong and weak muscles (See e.g., Andres et al., Neurology 36:937-941, 1986). Hand-held dynamometry (HHD) tests isometric strength of specific muscles in the arms and legs and produces interval level data (See e.g., Shefne JM, Neurotherapeutics 14: 154-160, 2017).

[0133] Accurate Test of Limb Isometric Strength (ATLIS) can be used to measure both strong and weak muscle groups using a fixed, wireless load cell (See e.g., Andres et al., Muscle Nerve 56(4):710-715, 2017). Force in twelve muscle groups are evaluated in an ATLIS testing, which reflect the subject’s strength in the lower limbs, upper limbs, as well as the subject’s grip strength. In some embodiments, ATLIS testing detects changes in muscle strength before any change in function is observed.

[0134] The methods provided herein may improve, maintain, or slow down the deterioration of a subject’s muscle strength (e.g., lower limb strength, upper limb strength, or grip strength), as evaluated by any of the suitable methods described herein. In some embodiments, the methods may result in improvement of the subject’s upper limb strength more significantly than other muscle groups. For example, the effect on muscle strength can be reflected in one or more muscle groups selected from quadriceps, biceps, hamstrings, triceps, and anterior tibialis.

[0135] In some embodiments of any of the methods of improving, maintaining, or slowing down the deterioration of muscle strength in a human subject having one or more symptoms of ALS described herein, the muscle strength is assessed by HHD, hand grip strength dynamometry, MMT, EIM, MVICT, MUNE, ATLIS, or a combination thereof, before, during and / or after the administration of the antisense oligonucleotide described herein (i.e., Compound A).

[0136] In some embodiments, the muscle strength is assessed by ATLIS. The total ATLIS score as well as the upper extremity and lower extremity ATLIS scores can be assessed. The methods of the present disclosure can result in a rate of decline in the total ATLIS score of a subject of about 3.50 PPN / month or less (e.g., about 3.45, 3.40, 3.35, 3.30, 3.25, 3.20, 3.15, 3.10, 3.05, 3.00 PPN / month or less). The methods of the present disclosure can also results in a reduction of the mean rate of decline in the total ATLIS score of a subject by at least about 0.2 PPN / month (e.g., at least about 0.25, 0.30, 0.35, 0.40, 0.45, or 0.50 PPN / month) as compared to a control subject not receiving the administration. The mean rate of decline in the upper extremity ATLIS score of a subject can be reduced by at least about 0.50 PPN / month (e.g., at least about 0.55, 0.60, 0.65, 0.70, 0.75, 0.80, 0.85, or 0.90 PPN / month) Attorney Docket No. 38709-0130W01 as compared to a control subject not receiving the administration described herein. The mean rate of decline in the lower extremity ATLIS score of a subject can be reduced by at least about 0.20 PPN / month (e.g., at least about 0.25, 0.30, 0.35, 0.40, 0.45, 0.50, 0.55, or 0.60 PPN / month) as compared to a control subject not receiving the administration described herein. In some embodiments, improvement or maintenance of the subject’s muscle strength may begin to occur less than 60 days (e.g., less than 55, 50, 45, 40, 30, 25, or 20 days) following the initial administration. PPN represents the percentage of predicted normal strength based on age, sex weight and height.

[0137] Pulmonary function

[0138] ALS is a progressive neurodegenerative disease that ultimately leads to respiratory failure and death. Pulmonary function tests, such as but not limited to vital capacity (VC), maximum mid-expiratory flow rate (MMERF), forced vital capacity (FVC), slow vital capacity (SVC), and forced expiratory volume in 1 second (FEVi), can be used to monitor ALS progression and / or the subject’s response to treatment. On average, the rate of respiratory function decline of an ALS patient measured by Vital Capacity (VC) can be about 2.24% of predicted (±6.9) per month. In some embodiments, measures from pulmonary function tests are associated with survival (See e.g., Moufavi et al. Iran J Neurol 13(3): 131— 137, 2014). Additional measures, such as maximal inspiratory and expiratory pressures, arterial blood gas measurements, and overnight oximetry, may provide earlier evidence of dysfunction. Comparison of vital capacity in the upright and supine positions may also provide an earlier indication of weakening ventilatory muscle strength.

[0139] The methods provided herein may improve or maintain the subject’s respiratory muscle and / or pulmonary function, or slow down the deterioration of the subject’s respiratory muscle and / or pulmonary function. A subject’s respiratory muscle and / or pulmonary function can be evaluated by any of the suitable methods described herein or otherwise known in the art. In some embodiments, the respiratory muscle function of a human subject is assessed based on the subject’s SVC. In some embodiments of any of the methods of improving, maintaining, or slowing down the deterioration of respiratory muscle function in a human subject described herein, the treatment results in a mean rate of decline in the SVC of the subject of about 3.50 PPN / month or less (e.g., about 3.45, 3.40, 3.35, 3.30, 3.25, 3.20, 3.15, 3.10, 3.05, or 3.00 PPN / month or less). In some embodiments, the treatment reduces the mean rate of decline in the SVC of the subject by at least about 0.5 PPN / month (e.g., at least about 0.55, 0.60, 0.65, 0.70, 0.75, 0.80, 0.85, 0.90, 0.95, or 1.00 PPN / month) as compared to Atorney Docket No. 38709-0130W01 a control subject not receiving the treatment. In some embodiments, improvement or maintenance of the subject’s pulmonary function may begin to occur less than 60 days (e.g., less than 55, 50, 45, 40, 30, 25, or 20 days) following the initial administration. In some embodiments, the subject’s pulmonary function progresses less than expected after fewer than 60 days following the initial administration.

[0140] ALSFRS-R

[0141] Methods provided herein may reduce disease progression rate wherein the average ALSFRS-R points lost per month by the subject is reduced by at least about 0.2 (e.g., at least about 0.25, 0.30, 0.35, 0.40, 0.45, 0.50, 0.55, 0.60, 0.65, 0.70, 0.75, 0.80, 0.85, 0.90, 0.95, 1.0, 1.05, 1.1, 1.15, 1.2, 1.25, 1.3, 1.35, 1.4, 1.45 or 1.5) as compared to a control subject not receiving the treatment. The methods provided herein may slow down the progression in one or more categories evaluated by the ALSFRS scale, including: speech, salivation, swallowing, handwriting, Cutting Food and Handling Utensils, Dressing and Hygiene, Turning in Bed and Adjusting Bed Clothes, Walking, Climbing Stairs, Dyspnea, Orthopnea, Respiratory Insufficiency. In some embodiments, the methods provided herein improve or slow down deterioration of a subject’s fine motor function, as evaluated by one or more categories of the ALSFRS-R scale (e.g., handwriting, cutting food and handling utensils, or dressing and hygiene).

[0142] Biomarkers

[0143] The levels of biomarkers in the subject’s CSF or blood samples are useful indicators of the subject’s ALS progression and responsiveness to the methods of treatment provided herein. Biomarkers such as but not limited to, CAPN2, phosphorylated neurofilament heavy chain (pNF-H), neurofilament medium chain, neurofilament light chain (NFL), S100-P, cystatin C, chitotriosidase, CRP, TDP-43, uric acid, and certain micro RNAs, can be analyzed for this purpose. Urinalysis can also be used for assessing the subject’s response to treatment. Levels of biomarkers such as but not limited to p75ECD and ketones in the urine sample can be analyzed. Levels of creatinine can be measured in the urine and blood samples. In some embodiments, the methods provided herein result in increased or decreased ketone levels in the subject’s urine sample. Medical imaging, including but not limited to MRI and PET imaging of markers such as Translocator protein (TSPO), may also be utilized.

[0144] Methods provided herein may reduce CAPN2 mRNA levels and / or calpain-2 protein levels (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some Atorney Docket No. 38709-0130W01 embodiments, methods described herein reduce levels and / or activities calpain-2 RNA transcripts (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, provided oligonucleotides and compositions provide knockdown of calpain-2 mRNA (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, methods described herein reduce levels of calpain-2 polypeptides (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, provided methods reduce levels of calpain-2 activities, e.g., protease activities (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, reduction of calpain-2 mRNA and / or polypeptide levels (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle) increases mRNA and / or polypeptide levels of a calpain-2 target. In some embodiments, reduction of calpain-2 mRNA and / or polypeptide levels (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle) increases mRNA and / or polypeptide levels of calpastatin. Calpain-2 has been reported to interact with various partners, e.g., TDP- 43 and other ALS biomarkers. In some embodiments, the present disclosure provide methods for modulating interaction between calpain-2 and a partner (e.g., TDP-43).

[0145] In some embodiments, the methods described herein result in a reduction of at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% (or any increment in between) of CAPN2 mRNA levels as compared to a baseline level of CAPN2 mRNA level (i.e., the baseline level is the level of CAPN2 mRNA that a subject exhibits immediately prior to administration of Compound A). In some embodiments, CAPN2 mRNA is reduced by at least about 10% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 15% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 20% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 25% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 30% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 35% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 40% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 45% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or Atorney Docket No. 38709-0130W01 muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 50% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 55% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 60% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 65% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 70% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 75%. In some embodiments, CAPN2 mRNA is reduced by at least about 80% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 85% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 90% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 95% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle).

[0146] In some embodiments, the methods described herein result in a reduction of at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% (or any increment in between) of calpain-2 polypeptide (i.e., protein) levels as compared to a baseline level of calpain-2 polypeptide level (i.e., the baseline level is the level of calpain-2 polypeptide) that a subject exhibits immediately prior to administration of Compound A). In some embodiments, calpain-2 polypeptide is reduced by at least about 10% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 15% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 20% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 25% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 30% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 35% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 40% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 Atorney Docket No. 38709-0130W01 polypeptide is reduced by at least about 45% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 50% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 55% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 60% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 65% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 70% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 75% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 80% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 85% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 90% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 95% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle).

[0147] In some embodiments, calpain-2 cleaves neurofilament (e.g., alters the levels of neurofilament). In some embodiments wherein Compound A reduces calpain-2 levels, neurofilament levels are subsequently reduced.

[0148] In some embodiments, the methods described herein result in a reduction of at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% (or any increment in between) of NfL polypeptide (i.e., protein) levels as compared to a baseline level of NfL polypeptide level (i.e., the baseline level is the level of NfL polypeptide) that a subject exhibits immediately prior to administration of Compound A). In some embodiments, NfL polypeptide is reduced by at least about 10% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 15% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 20% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 25% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 30% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 35% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced Atorney Docket No. 38709-0130W01 by at least about 40% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 45% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 50% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 55% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 60% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 65% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 70% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 75% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 80% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 85% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 90% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 95% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% in muscle, serum, brain (e.g., the motor cortex), or the spinal cord.

[0149] In some embodiments, the methods described herein result in a reduction of at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% (or any increment in between) of SBDP-145 levels as compared to a baseline level of SBDP-145 (i.e., the baseline level is the level of SBDP-145 that a subject exhibits immediately prior to administration of Compound A). In some embodiments, SBDP-145 is reduced by at least about 10% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 15% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 20% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 25% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 30% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 35% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 40% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 45% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 50% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 55% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 60% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 65% (in the CSF or blood). In some embodiments, SBDP-145 is Attorney Docket No. 38709-0130W01 reduced by at least about 70% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 75% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 80% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 85% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 90% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 95% (in the CSF or blood). In some embodiments, full-length spectrin levels are not changed after administration of Compound A.

[0150] In some embodiments, a reduction of any of the biomarkers described herein is assessed at or after about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,

[0151] 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46,

[0152] 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60„ 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71,

[0153] 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96,

[0154] 97, 98, 99, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, or more than 150 days; about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, or more than 55 weeks; about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more than 12 months; or about 1, 2, 3, 4, 5, or more than 5 years following administering or delivering a provided oligonucleotide by any of the methods described herein.

[0155] Survival Time

[0156] The average survival time for an ALS patient may vary. The median survival time can be about 30 to about 32 months from symptom onset, or about 14 to about 20 months from diagnosis. The survival time of subjects with bulbar-onset ALS can be about 6 months to about 84 months from symptom onset, with a median of about 27 months. The methods provided herein may in some embodiments increase survival for a subject having ALS by at least one month (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 28, 32, 36, 40, 50, 60, 70, 80, or 90 months). Methods provided herein may in some embodiments delay the onset of ventilator-dependency or tracheostomy by at least one month (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 28, 32, 36, 40, 50, 60, 70, 80, or 90 months).

[0157] Adverse events

[0158] Subjects treated with any of the methods provided herein may present fewer adverse events (e.g., any of the adverse events disclosed herein), or present one or more of the Atorney Docket No. 38709-0130W01 adverse events to a lesser degree than control subjects not receiving the treatment. Exemplary adverse events include gastrointestinal related adverse events (e.g., abdominal pain, gastritis, nausea and vomiting, constipation, rectal bleeding, peptic ulcer disease, and pancreatitis); hematologic adverse events (e.g., aplastic anemia and ecchymosis); cardiovascular adverse events (e.g., arrhythmia and edema); renal adverse events (e.g., renal tubular acidosis); psychiatric adverse events (e.g., depression); skin adverse events (e.g., rash); and miscellaneous adverse events (e.g., syncope and weight gain). In some embodiments, the methods provided herein do not result in, or result in minimal symptoms of, constipation, neck pain, headache, falling, dry mouth, muscular weakness, falls, laceration, and Alanine Aminotransferase (ALT) increase. In some embodiments, the adverse events are serious adverse events, such as but not limited to respiratory adverse events, falls, or lacerations.

[0159] In some embodiments, the methods provided herein are more effective in treating subjects that are about 18 to about 50 years old (e.g., about 18 to about 45, about 18 to about 40, about 18 to about 35, about 18 to about 30, about 18 to about 25, or about 18 to about 22 years old), as compared to subjects 50 years or older (e.g., 55, 60, 65, 70, 75, or 80 years or older). In some embodiments, the methods provided herein are more effective in treating subjects who have been diagnosed with ALS and / or who showed ALS symptom onset less than about 24 months (e.g., less than about 22, 20, 18, 16, 14, 12, 10, 8, 6, 4, 2, or 1 month), as compared to subjects who has been diagnosed with ALS and / or who showed ALS symptom onset more than about 24 months (e.g., more than about 26, 28, 30, 32, 34, 36, 40, 45, 50, 55, or 60 months). In some embodiments, the methods provided herein are more effective in treating subjects who have been diagnosed with ALS and / or who showed ALS symptom onset more than about 24 months (e.g., more than about 26, 28, 30, 32, 34, 36, 40, 45, 50, 55, or 60 months), as compared to subjects who has been diagnosed with ALS and / or who showed ALS symptom less than about 24 months (e.g., less than about 22, 20, 18, 16, 14, 12, 10, 8, 6, 4, 2, or 1 month).

[0160] Pharmacokinetics and Pharmacodynamics of Compound A

[0161] In one aspect, provided herein are methods for treating at least one symptom of ALS in a subject, or methods of administering a composition comprising Compound A to a subject having at least one symptom of ALS, wherein the method comprises: (a) administering to the subject a composition comprising a dose of Compound A, (b) determining that the subject Atorney Docket No. 38709-0130W01 has a certain levels of Cmax, Tmax, T1 / 2, AUCo-iast, and / or AUCo-® for Compound A, and (c) administering to the subject an additional dose of the composition.

[0162] The methods can include determining that the subject has a Cmax (maximum concentration, obtained directly from the observed concentration versus time data) for Compound A of about 400 ng / mL to about 1000 ng / mL (e.g. about 450 ng / mL to about 950 ng / mL, 450 ng / mL to about 900 ng / mL, 450 ng / mL to about 850 ng / mL, about 450 ng / mL to about 800 ng / mL, 450 ng / mL to about 750 ng / mL, about 450 ng / mL to about 700 ng / mL, 450 ng / mL to about 650 ng / mL, about 450 ng / mL to about 600 ng / mL, 450 ng / mL to about 550 ng / mL, about 450 ng / mL to about 500 ng / mL, about 450 ng / mL to about 1000 ng / mL, about 475 ng / mL to about 1000 ng / mL, about 500 ng / mL to about 1000 ng / mL, about 525 ng / mL to about 1000 ng / mL, about 550 ng / mL to about 1000 ng / mL, about 575 ng / mL to about 1000 ng / mL, about 600 ng / mL to about 1000 ng / mL, about 625 ng / mL to about 1000 ng / mL, about 650 ng / mL to about 1000 ng / mL, about 675 ng / mL to about 1000 ng / mL, about 675 ng / mL to about 1000 ng / mL, about 700 ng / mL to about 1000 ng / mL, about 725 ng / mL to about 1000 ng / mL, about 750 ng / mL to about 1000 ng / mL, about 775 ng / mL to about 1000 ng / mL, about 800 ng / mL to about 1000 ng / mL, about 825 ng / mL to about 1000 ng / mL, about 850 ng / mL to about 1000 ng / mL, about 875 ng / mL to about 1000 ng / mL, about 900 ng / mL to about 1000 ng / mL, about 925 ng / mL to about 1000 ng / mL, about 950 ng / mL to about 1000 ng / mL, about 975 ng / mL to about 1000 ng / mL, or any increment in between).

[0163] The methods can include determining that the subject has a Tmax (time to Cmax) for Compound A of about 0.5 hrs to 8 hrs (e.g. about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8 hrs, or any increment in between).

[0164] The methods can include determining that the subject has a T1 / 2 (time required for plasma concentration of Compound A to decrease by 50%) for Compound A of about 1 hrs to 9 hrs (e.g. about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9 hrs, or any increment in between).

[0165] The methods can include determining that the subject has an AUCo-iast (area under the plasma concentration-time curve from time zero to the time of the last quantifiable concentration, calculated by linear up / log down trapezoidal summation) for Compound A of about 2000 ng*h / mL to about 40000 ng*h / mL (e.g. about 2500 ng*h / mL to about 40000 ng*h / mL, about 3000 ng*h / mL to about 40000 ng*h / mL, about 3500 ng*h / mL to about 40000 ng*h / mL, about 4000 ng*h / mL to about 40000 ng*h / mL, about 4500 ng*h / mL to about 40000 ng*h / mL, about 5000 ng*h / mL to about 40000 ng*h / mL, about 5500 ng*h / mL Atorney Docket No. 38709-0130W01 to about 40000 ng*h / mL, about 6000 ng*h / mL to about 40000 ng*h / mL, about 6500 ng*h / mL to about 40000 ng*h / mL, about 7000 ng*h / mL to about 40000 ng*h / mL, about 7500 ng*h / mL to about 40000 ng*h / mL, about 8000 ng*h / mL to about 40000 ng*h / mL, about 8500 ng*h / mL to about 40000 ng*h / mL, about 9000 ng*h / mL to about 40000 ng*h / mL, about 9500 ng*h / mL to about 40000 ng*h / mL, about 10000 ng*h / mL to about 40000 ng*h / mL, about 15000 ng*h / mL to about 40000 ng*h / mL, about 20000 ng*h / mL to about 40000 ng*h / mL, about 25000 ng*h / mL to about 40000 ng*h / mL, about 30000 ng*h / mL to about 40000 ng*h / mL, about 35000 ng*h / mL to about 40000 ng*h / mL, or any increment in between).

[0166] The methods can include determining that the subject has a AUCo-® (after the first dose, area under the plasma concentration-time curve from time zero extrapolated to infinity, calculated by linear up / log down trapezoidal summation) for Compound A of about 3000 ng*h / mL to about 50000 ng*h / mL (e.g. about 3500 ng*h / mL to about 50000 ng*h / mL, about 4000 ng*h / mL to about 50000 ng*h / mL, about 4500 ng*h / mL to about 50000 ng*h / mL, about 5000 ng*h / mL to about 50000 ng*h / mL, about 5500 ng*h / mL to about 50000 ng*h / mL, about 6000 ng*h / mL to about 50000 ng*h / mL, about 6500 ng*h / mL to about 50000 ng*h / mL, about 7000 ng*h / mL to about 50000 ng*h / mL, about 7500 ng*h / mL to about 50000 ng*h / mL, about 8000 ng*h / mL to about 50000 ng*h / mL, about 8500 ng*h / mL to about 50000 ng*h / mL, about 9000 ng*h / mL to about 50000 ng*h / mL, about 9500 ng*h / mL to about 50000 ng*h / mL, about 10000 ng*h / mL to about 50000 ng*h / mL, about 15000 ng*h / mL to about 50000 ng*h / mL, about 20000 ng*h / mL to about 50000 ng*h / mL, about 25000 ng*h / mL to about 50000 ng*h / mL, about 30000 ng*h / mL to about 50000 ng*h / mL, about 35000 ng*h / mL to about 50000 ng*h / mL, about 40000 ng*h / mL to about 50000 ng*h / mL, about 45000 ng*h / mL to about 50000 ng*h / mL, or any increment in between).

[0167] In some embodiments of any of the methods described herein, step (a) can include administering Compound A at a fixed dose of about 5 mg to about 125 mg (e.g., about 6.25 mg, about 12.5 mg, about 25 mg, about 50 mg, or about 100 mg) about every 4 weeks (e.g., about every 28 days). In other words, in some embodiments, Compound A is administered to a subject on day 1 and then about every 4 weeks or about every 28 days (e.g., the subject is administered Compound A on day 1, on day 29 (+ / - 3 days), on day 57 (+ / - 3 days), on day 85 (+ / - 3 days), on day 113 (+ / - 3 days), and so on). Step (b) of the methods described herein can include obtaining a blood sample from the subject about 30 minutes to about 8 hours (e.g. about 1, 2, 3, 4, 5, 6, or 7 hours) after each dose (i.e., after receiving a dose on day 1, on day Attorney Docket No. 38709-0130W01

[0168] 29 (+ / - 3 days), on day 57 (+ / - 3 days), on day 85 (+ / - 3 days), on day 113 (+ / - 3 days), and so on) of the composition comprising Compound A. In some embodiments, the human subject is administered repeat doses of Compound A at least 25 days apart (z.e., no less than 25 days apart). In some embodiments, the human subject is administered repeat doses of Compound A that do not exceed 100 mg per dose.

[0169] Assays

[0170] RNA Isolation

[0171] RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s recommended protocols.

[0172] Analysis of inhibition of target levels or expression

[0173] Inhibition of levels or expression of a CAPN2 nucleic acid can be assayed in a variety of ways known in the art. For example, target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitaive real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM 7600, 7700, or 7900 Sequence Detection System, available from PE- Applied Biosystems, Foster City, CA and used according to manufacturer’s instructions.

[0174] Quantitative Real-Time PCR Analysis of Target RNA Levels

[0175] Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer’s instructions. Methods of quantitative real-time PCR are well known in the art.

[0176] Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification. The RT and real-time PCR reactions are performed sequentially in the same sample well. RT and real-time PCR reagents may be obtained from Invitrogen (Carlsbad, CA). RT real-time-PCR reactions are carried out by methods well known to those skilled in the art. Attorney Docket No. 38709-0130W01

[0177] Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN RNA quantification reagent (Invetrogen, Inc. Eugene, OR). Methods of RNA quantification by RIBOGREEN are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN fluorescence.

[0178] Probes and primers are designed to hybridize to a CAPN2 nucleic acid. Methods for designing real-time PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS Software (Applied Biosystems, Foster City, CA).

[0179] Analysis of Protein Levels

[0180] Antisense inhibition of CAPN2 nucleic acids can be assessed by measuring calpain-2 protein levels. Protein levels of calpain-2 can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), ELISA, quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art. In certain embodiments, the compounds herein provide improved reduction in protein levels.

[0181] In vivo testing of antisense compounds

[0182] Antisense compounds, for example, modified oligonucleotides, are tested in animals to assess their ability to inhibit expression of CAPN2 and produce phenotypic changes, such as, improved motor function. In certain embodiments, motor function is measured by walking initiation analysis, rotarod, grip strength, pole climb, open field performance, balance beam, hindpaw footprint testing in the animal. Testing may be performed in normal animals, or in experimental disease models. For administration to animals, oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate-buffered saline. Atorney Docket No. 38709-0130W01

[0183] Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, and subcutaneous. Oligonucleotide dosage and dosing frequency depends upon multiple factors such as, but not limited to, route of administration and animal body weight. Following a period of treatment with oligonucleotides, RNA is isolated from CNS tissue or CSF and changes in CAPN2 nucleic acid expression are measured.

[0184] Additional Therapeutic Agents

[0185] The methods described herein can further include administering to the subject one or more additional therapeutic agents, e.g. in amounts effective for treating or achieving a modulation of at least one symptom of ALS. Any known ALS therapeutic agents known in the art can be used as an additional therapeutic agent. Exemplary therapeutic agents include riluzole (C8H5F3N2OS, e.g. sold under the trade names Rilutek® and Tiglutik®), edaravone (e.g. sold under the trade names Radicava® and Radicut®), tofersen (e.g., sold under the trade name Qalsody®), dextromethorphan, anticholinergic medications, and psychiatric medications (e.g. antidepressants, antipsychotics, anxiolytics / hypnotics, mood stabilizers, and stimulants).

[0186] In some embodiments, a subject has started and maintained at a stable regimen another ALS therapeutic agent (e.g., riluzole and / or edaravone) for at least 30 days prior to starting administration of Compound A.

[0187] EXAMPLES

[0188] Additional embodiments are disclosed in further detail in the following examples, which are provided by way of illustration and are not in any way intended to limit the scope of this disclosure or the claims.

[0189] Example 1: 28-Day Repeat-Dose Study in Sprague Dawley Rats

[0190] Male and female rats were administered the vehicle or test article, Compound A, at a single dose on study day 0 (SDO) and study day 28 (SD28) (±3 days), with necropsy on study days 31-35 (SD31-35). Dose groups included vehicle, 0.06 mg, 0.12 mg, 0.24 mg, and 0.59 mg Compound A. Plasma samples were isolated at 0.83, 0.5, 1, 2, 6, and 24 hours post dose on SDO and SD28 and measured for test article concentration via LC-MS / MS. The experimental design for the study is summarized in Table 1 below: Atorney Docket No. 38709-0130W01

[0191] Table 1: Experimental Design for Non-GLP 28-Day Repeat-Dose Study in Rat

[0192] Concentrations of Compound A in plasma indicated a dose-dependent response with peak levels (Cmax >12,000 ng / mL at 0.59 mg dose) at 0.083 hours post-dosing on SD0. Slightly higher variability of Compound A plasma concentrations was observed on SD28, with High dose peak concentrations at 0.5 hours post-dosing (Cmax >10,000 ng / mL at 0.59 mg dose). Toxicokinetic (TK) parameters of Compound A obtained by analysis of mean plasma concentration data are further summarized in Table 2.

[0193] Table 2: Toxicokinetics of Compound A in Rat Plasma with 28-day Intrathecal Exposure

[0194] NR = Not reported because reporting criteria (number of points Az >2, R2adjusted > 0.75, % AUC extrapolated < 20) not met Atorney Docket No. 38709-0130W01

[0195] Example 2: 12-Week Repeat-Dose Study in Sprague Dawley Rats

[0196] The TK profile of Compound A was evaluated following IT administration to Sprague Dawley rats every 28 days for 12 weeks as described in Table 3.

[0197] Table 3: Experimental Design of GLP 12-Week Repeat-Dose Study in Rat

[0198] Following multiple IT dose administration, Compound A was rapidly distributed to the plasma with a median Tmax ranging from 5 to 30 minutes, indicating that Compound A reaches plasma shortly after IT administration. After reaching maximum concentration, plasma concentrations decreased steadily and remained quantifiable until 6 hrs in all doses. In both doses, the peak (Cmax) and extent of exposure (AUCiast) values increased with increasing doses, in a dose proportional manner. There is no accumulation on Day 84 in all doses. Additionally, plasma half-life, clearance and volume of distribution were all independent of dose after multiple dose administration.

[0199] CSF samples were collected at necropsy. On SD85 (one day following the last IT dose), Compound A concentrations in the CSF were highest in animals that received the High dose (>2000 ng / mL), relative to Mid (35-177 ng / mL) and Low (50-206 ng / mL) dose animals. The highest ratio of mean CSF to mean plasma terminal concentration was obtained at the High dose of Compound A (males = 217 and females = 141).

[0200] TK parameters of Compound A obtained by analysis of mean plasma concentration data are further summarized in Table 4.

[0201] Table 4: Toxicokinetics of Compound A in Rat Plasma with 12-Week Intrathecal

[0202] Exposure Atorney Docket No. 38709-0130W01

[0203] NR = Not reported because reporting criteria (number of points Az >2, R2adjusted > 0.75, % AUC extrapolated < 20) not met

[0204] Example 3: 28-Day Repeat-Dose Study in Non-Human Primates

[0205] The TK profile of Compound A was evaluated following IT administration of repeat doses to cynomolgus monkeys. Male and female monkeys were administered the vehicle or the test article, Compound A, at a single dose on SDO and SD28, with necropsy on SD31-35. Dose groups included vehicle, 3.5 mg (Low), and 11.7 mg (High). One animal per sex per dose group was used for this study. The experimental design for the study is summarized in Table 5.

[0206] Table 5: Experimental Design for Non-GLP 28-Day Repeat-Dose Study in NHP

[0207] Plasma samples were isolated on SDO and SD28 at 0.083, 0.5, 1, 2, 6, and 24 hours after dosing. Concentrations of Compound A in plasma indicate a dose-dependent response with mean peak levels at 4 hours post-dosing on SDO (Cmax=l,750 ng / mL) and SD28 (Cmax=3,130 ng / mL) for the 11.7 mg (High) dose group. In both cases, plasma levels of Compound A were mostly cleared by 24 hours post-dosing. All vehicle-treated samples were below the lower quantification limit. Peak levels of Compound A in plasma samples from the 3.5 mg (Low) dose group were reached at 1.5 hours post- dose on both SDO (Cmax=568 ng / mL) and SD28 (Cmax=470 ng / mL).

[0208] CSF samples were collected just prior to dosing on SDO, SD8, SD14, SD21, SD28 and at necropsy. Following the first dose on SDO, quantifiable concentrations of Compound Attorney Docket No. 38709-0130W01

[0209] A were measured in the CSF of all High dose animals at all time points, indicating that Compound A remained in the CSF up to 28 days post-dosing. Animals received a second dose of TA on SD28 following CSF collection, which resulted in increased Compound A concentrations in the CSF of both Low dose and High dose animals when the CSF was collected again on SD34 (6 days following the SD28 dose).

[0210] TK parameters of Compound A obtained by analysis of mean plasma concentration data are further summarized in Table 6.

[0211] Table 6: Toxicokinetics of Compound A in NHP Plasma with 28-day Intrathecal

[0212] Exposure

[0213] NC = not calculated because reporting criteria not met (3 consecutive decreasing concentrations after Cmax, adjusted R2 > 0.8 and AUC % extrapolated < 20%) not metaarithmetic mean (standard deviation), for Tl / 2 and AUCinf, no standard deviation is calculablebgeometric mean (standard deviation)

[0214] Example 4: 12-Week Repeat-Dose Study in Non-Human Primates

[0215] The TK profile of Compound A was evaluated following IT administration to cynomolgus monkeys every 28 days for 12 weeks as described in Table 7.

[0216] Table 7: Experimental Design for GLP 12-Week Repeat-Dose Study in NHP

[0217] Following single or repeat intrathecal administration, absorption of Compound A in plasma was relatively fast after a single dose on SDO (Tmax ~ 0.5-2 h) and moderate after multiple doses on SD85 (Tmax ~ 0.5 - 6h). In general, Cmaxand AUCiast values dose- Atorney Docket No. 38709-0130W01 normalized to the target dose were approximately equivalent (less than 2-fold difference in ratios) for males and females. Compound A total exposure and peak exposure was generally dose proportional or greater than dose proportional across the dose range of 3.45-15 mg target dose. In general, no accumulation was observed after repeated doses of Compound A. Terminal elimination half-life of Compound A in plasma was approximately 3-9 h.

[0218] CSF concentrations of Compound A were obtained from all animals prior to dosing on SDO, SD28, SD56 and SD84 and terminal samples were obtained at necropsy (approximately 24 hours after the fourth intrathecal dose of Compound A on SD84). Except for two samples, CSF concentrations of Compound A on Day 0 were below the quantification limit (BQL, <10 ng / mL). On Days 28, 56, and 84, CSF concentrations for both males and females were approximately 11-16 ng / mL for the Low dose group (3.45 mg target dose), approximately 11-37 ng / mL for the Mid dose group (11.65 mg target dose), and approximately 12 - 42 ng / mL for the High dose group (15 mg target dose). At necropsy, CSF concentrations of Compound A were higher in females (1410, 11200, and 5370 ng / mL) vs males (695, 1510, and 1520 ng / mL) for the Low, Mid, and High doses, respectively. The ratio of mean CSF to plasma terminal concentrations was similar for males and females at the Low dose (approximately 40-45), 6-fold higher in females vs males for the Mid dose (137 vs 22.8), and 4.3-fold higher for females vs males for the High dose (56.1 vs 13).

[0219] The toxicokinetic parameters for Compound A in plasma are further summarized in Table 8.

[0220] Table 8: Toxicokinetic Parameters of Compound A in NHP Plasma in a GLP 12-week

[0221] NR = not reported because reporting criteria (number of points <z >2, R2adjusted > 0.75, AUC % extrapolated < 20) not metaarithmetic meanbgeometric mean Attorney Docket No. 38709-0130W01

[0222] Example 5: Protein Binding of Compound A in Sprague Dawley Rat, Cynomolgus Monkey, and Human Plasma

[0223] The in vitro plasma protein binding of Compound A was assessed in Sprague-Dawley rat, cynomolgus monkey and human blank plasma using ultracentrifugation. Compound A (10 and 50 pM) was highly bound to plasma proteins in tested species (Table 9). The average percent bound of Compound A in human, rat, and monkey plasma ranged from 95.1-99.6% with an average percent recovery range of 94.6-103%. Compound A plasma protein binding was also tested at 0.5, 1, and 5 pM, but the compound signal from the 5 hr. post-spin supernatant samples was below the level of quantification and average percent bound could not be derived.

[0224] Table 9: Compound A Average Percent Bound in Plasma by Species

[0225] ND: Not determined due to below the level of quantification of test article in the post-spin supernatantsa10% plasma in nuclease-free water was used for the incubation

[0226] Example 6: Evaluation of Compound A as Direct and Time-Dependent Inhibitors of Cytochrome P450 (1A2, 2B6, 2C8, 2C9, 2C19, 2D6 and 3A) Enzymes in Human Hepatocytes

[0227] The objective of this study was to characterize the potential of Compound A to cause direct inhibition (DI) or time-dependent inhibition of the major cytochrome P450s (CYPs 1A2, 2B6, 2C8, 2C9, 2C19, 2D6, and 3A) in suspended human hepatocytes using standard probe substrates. DI was assessed at a range of Compound A concentrations (0.01 to 10 pM) by monitoring CYP-specific metabolite formation and calculating the concentration that caused a 50% reduction in the formation rate (IC50). Time-dependent inhibition was assessed using the “IC50-shift” method in which the IC50 values were determined following 30 min pre-incubations of suspended human hepatocytes in the presence and absence of the test article prior to addition of probe substrates.

[0228] Compound A did not inhibit CYP1 A2, CYP2B6, CYP2C8, CYP2C9, CYP2C19, CYP2D6 or CYP3 A activities in suspended human hepatocytes at the highest concentration tested (10 pM). Atorney Docket No. 38709-0130W01

[0229] No IC50 shift was observed with any of the tested enzymes upon 30 min preincubation of Compound A in suspended human hepatocytes before addition of probe substrates.

[0230] In summary, Compound A was neither a direct nor a time-dependent inhibitor of the common hepatic drug metabolizing CYP enzymes when tested up to a concentration of 10 pM in suspended human hepatocytes.

[0231] Example 7: In Vitro CYP Induction of Compound A in Cryopreserved Plateable Human Hepatocytes

[0232] The potential for Compound A to induce CYPs 1 A2, 2B6, and 3A4 was investigated with cryopreserved plateable primary human hepatocytes. The mRNA levels were determined by RT-qPCR and cytotoxicity was evaluated by lactate dehydrogenase (LDH) release.

[0233] Treatment with Compound A (0.3, 1, and 10 pM) did not produce an induction (< 2- fold) in mRNA levels of CYP1 A2, CYP2B6, or CYP3A4 compared to the vehicle controls at any concentration tested or in any lot used. Under the same experimental conditions, positive and negative controls performed as expected. The percentage of LDH release in all treatment groups was < 8.75% of the total LDH. Therefore, treatment with Compound A or positive and negative controls did not cause cytotoxicity at the concentrations used during the study.

[0234] In conclusion, Compound A is not an inducer for CYP1 A2, CYP2B6, and CYP3A4 in cryopreserved plateable primary human hepatocytes up to 10 pM.

[0235] Example 8: Interactions of Compound A with Drug Transporters In Vitro

[0236] The objective of this study was to investigate the potential for Compound A to be a substrate or inhibitor of clinically relevant human drug transporters, including P-gp, BCRP, OATP1B1, OATP1B3, OAT1, OAT3, OCT2, MATE1, MATE2-K, and BSEP. Samples were subjected to solid phase extraction and supernatant analyzed by liquid chromatography / tandem mass spectrometry (LC-MS / MS).

[0237] Compound A did not show ATP-dependent uptake in human BSEP-membrane vesicles, with signal- to-noise ratios of approximately 1. The positive control substrate showed the expected S / N ratio and an ATP-dependent uptake activity. Therefore, Compound A was not a substrate of P-gp, BCRP, OATP1B1, OATP1B3, OAT1, OAT3, OCT2, MATE1, MATE2-K and BSEP. Atorney Docket No. 38709-0130W01

[0238] Compound A did not show inhibition of P-gp, BCRP, OATP1B1, OATP1B3, OAT3, OCT2, MATE1, MAKE2-K and BSEP (IC50 > 10 pM). Compound A was a potent inhibitor of OAT1- mediated uptake of para-amino Hippurate with an IC50 value of 0.0206 pM.

[0239] Table 10: Summary of Compound A Drug Transporter Interaction Data

[0240] P-gly coprotein (P-gp, also known as MDR1), breast cancer resistance protein (BCRP), organic anion transporting polypeptide(s) 1B1 (OATP1B1) and 1B3 (OATP1B3), organic anion transporter(s) 1 (OAT1) and 3 (OAT3), organic cation transporter 2 (OCT2), multidrug and toxin extrusion protein(s) 1 (MATE1) and 2-K (MATE2-K), and bile salt export pump (BSEP)

[0241] Example 9: Evaluation of the safety, tolerability, efficacy and activity of Compound A, for treatment of ALS

[0242] Study Rationale

[0243] Pharmacology and toxicology data in rats and NHPs indicate that Compound A is well tolerated. This Phase 1, randomized, double-blind, placebo-controlled, MAD study in participants with ALS will evaluate the safety, tolerability, PK profile, and PD of a range of multiple intrathecal Compound A doses from a projected minimal pharmacologic dose to either a maximum tolerated dose or the highest planned dose of lOOmg.

[0244] This is a first-in-human MAD study in participants living with ALS with a focus on participant safety. This design is rational given the prolonged time between doses and the rarity of this patient population. The study is designed to capture the information that would ordinarily be obtained in two separate studies - a single ascending dose (SAD) study and a MAD study. The length of the dosing interval makes this design feasible. With Study Drug dosing at 28-day intervals, there is sufficient time to conduct comprehensive safety, tolerability and pharmacokinetic evaluations in each participant after the first dose. This is Atorney Docket No. 38709-0130W01 comparable to the evaluation that would be conducted in a SAD study. At the conclusion of this 28-day period, monthly dosing will continue (in the absence of DLT to Study Drug) for three additional doses, allowing for evaluation of safety, tolerability and pharmacokinetics during a multiple-dose regimen. This design, which eliminates the need for a SAD study, is appropriate because of the nature of the participant under investigation (severe disabilities and limited period of survival after diagnosis). These are rare patients with a devastating disease, and the Study Drug has to be administered by IT injection. Therefore, it is important to maximize the amount of information from and potential benefit to each participant enrolled in each study conducted in this rare population facing urgent morbidities and mortality.

[0245] This study is also designed to gather important pharmacodynamic and biomarker information which may help in future dose selection and may provide initial evidence for a potential therapeutic effect. A schematic of the study is shown in FIG. 1.

[0246] The data obtained from all parts of the study will guide clinical dosing parameters investigated in subsequent clinical studies with Compound A.

[0247] Rationale for the Dosing Regimen of Compound A

[0248] Compound A is administered intrathecally and subsequent distribution outside of the IT space is expected to be limited. Additionally, the only adverse effects observed in GLP- compliant repeat-dose studies were localized effects in the rat following IT administration of Compound A. Therefore, the safe starting dose in the planned Phase 1 study, A0114-001, is informed by the concentration of Compound A in the CSF after normalization between species according to CSF volumes. Normalization of dose levels in the non-human primate (NHP) and rat to the human based on CSF volume scaling is referred to as calculation of the human equivalent dose (HED).

[0249] The no observed adverse effects level (NOAEL) in the GLP 12-week repeat-dose studies conducted by the Sponsor was 15 mg for NHP and 0.24 mg for rat. The corresponding HEDs following CSF volume scaling are 150 mg and 144 mg, respectively. The two species can thus be considered similarly sensitive for the purposes of starting dose determination, and both HEDs provide a greater than 10-fold safety margin to the clinical study starting dose of 12.5 mg. The calculations are shown in Table 11. Atorney Docket No. 38709-0130W01

[0250] Table 11 Safety Margin by Human Equivalent Dose Based on Data from GLP 12-Week NHP Toxicology Study (Example 4) and GLP 12-Week Rat Toxicology Study (Example 2) bSafety margins are calculated relative to clinical study starting dose of 12.5 mg administered IT in 15 mL dose volume.

[0251] The safe starting dose also considers the local concentration of Compound A at the injection site. The injection concentration at the NOAEL in the GLP 12-week repeat-dose studies conducted by the Sponsor is 7.5 mg / mL for NHP and 4.8 mg / mL for rat. When compared to the injection concentration of the starting dose in the planned clinical study (0.83 mg / mL), a minimum safety margin of 5.8-fold is obtained. The calculations are shown in Table 12Error! Reference source not found..

[0252] Table 12 Safety Margin by Local Concentration Based on Data from FY23-201 (GLP 12-Week NHP Toxicology Study) and FY23-202 (GLP 12-Week Rat Toxicology Study)

[0253] Potential Benefits and Risks

[0254] ALS is a rapidly progressing and debilitating disease. Despite currently available treatments which produce clinically meaningful reductions in loss of function and improved survival, no cure exists, and ALS remains uniformly fatal. ALS causes the progressive degeneration of motor neurons, resulting in rapidly progressing muscle weakness and atrophy Atorney Docket No. 38709-0130W01 that eventually leads to partial or total paralysis; on average, the disease is fatal within just 3 to 5 years.

[0255] Axonal degeneration is one of the primary processes underlying ALS pathogenesis, and calpain-2 plays a critical role in this pathway. Furthermore, calpain-2 activity has been closely linked with the processing of NfL, an important biomarker in ALS. Thus, the inhibition of calpain-2 by RNase H-mediated degradation of the CAPN2 mRNA transcript may mitigate axonal degeneration and yield therapeutic benefit for people living with ALS.

[0256] This is a first in human, Phase 1 study and the potential risks in people are unknown. Repeat-dose, GLP-compliant toxicology studies demonstrated limited microscopic histopathologic changes in the lumbar region in the highest dose (0.59 mg) in rats. All doses were well-tolerated in the non-human primates with no adverse findings. Procedural risks of lumbar puncture and intrathecal injections include post-lumbar puncture headache. In addition, some other intrathecal ASOs at high doses have been associated with myelitis, radiculitis, increased intracranial pressure, and aseptic meningitis, but these adverse reactions were not observed in nonclinical studies of Compound A. Based on the mechanism of action of Compound A, information from nonclinical studies, the potential risks derived from products of a similar pharmacological class, and risk mitigation measures implemented in the study (e.g. Inclusion / exclusion criteria, safety monitoring criteria, evaluation of DLTs, DEC review etc.), the anticipated benefit-risk balance is considered to be favorable for enrollment and treatment of participants in this study.

[0257] OBJECTIVES AND ENDPOINTS

[0258] Primary Objective

[0259] The primary objective of this study is to evaluate the safety and tolerability of Compound A in adult participants living with ALS.

[0260] Primary Endpoints:

[0261] ■ Incidence of AEs and SAEs and dose limiting toxi cities DLTs.

[0262] ■ Incidence of abnormalities in clinical laboratory assessments, vital signs, physical and neurological examinations, and ECGs.

[0263] Secondary Objective

[0264] The secondary objective of this study is to evaluate the PK of Compound A.

[0265] Secondary Endpoint:

[0266] ■ PK concentrations, including plasma and CSF levels of Compound A. Atorney Docket No. 38709-0130W01

[0267] Tertiary Objectives:

[0268] The tertiary objectives of this study are to evaluate the effects of Compound A on levels of plasma and CSF biomarkers as well as functional measures of ALS disease progression.

[0269] Tertiary Endpoints:

[0270] ■ Change from baseline at dosing days and end of study in CSF calpain-2 levels.

[0271] ■ Change from baseline at dosing days and end of study in CSF and plasma NfL.

[0272] ■ Change from baseline at dosing days and end of study in CSF pharmacodynamic measures of ALS.

[0273] ■ Change from baseline at dosing days and end of study in plasma pharmacodynamic measures of ALS.

[0274] ■ Change from baseline at dosing days and end of study in ALSFRS-R.

[0275] ■ Change from baseline at dosing days and end of study in SVC.

[0276] STUDY DESIGN

[0277] Overall Study Design and Plan

[0278] This is a Phase 1, randomized, double-blind, placebo-controlled multiple-ascending- dose study evaluating the safety, tolerability, PK, and PD of Compound A, in approximately 48 adult participants with ALS.

[0279] This study will examine multiple dose levels of Compound A, sequentially, in approximately 48 participants. Each cohort will comprise 12 participants, with 9 participants randomized to receive Compound A and 3 participants randomized to receive placebo. The first 2 participants at each dose level (1 on Compound A and 1 on placebo) will be dosed as a sentinel group. An approximately 48-hour safety review period will follow the sentinel dosing period before dosing of the next participant is approved. The remaining study participants in each cohort will have doses administered with staggered timing meaning no two participants will be given their first dose on the same day. Currently, 4 dose levels of Compound A are planned, with the option for additional dose levels to be added not to exceed 100 mg based on ongoing data review, in consultation with the DEC. Compound A or placebo will be administered once every 4 weeks by intrathecal bolus injection for a total of up to 4 doses per dose level. Treatment will be administered on Day 1, followed by repeat dosing every 4 weeks at approximately Day 29, Day 57 and Day 85 followed by an approximately 60-day safety follow-up period. Atorney Docket No. 38709-0130W01

[0280] After study completion, an open-label extension study of Compound A may be implemented based on review of safety, tolerability, PK, and PD findings.

[0281] Study Duration and Follow-up

[0282] The duration of the study for each participant will be approximately 25 weeks, comprising up to a 4-week screening period, an approximately 13-week treatment period, and an approximately 8-week safety follow-up period.

[0283] Protocol Adherence

[0284] Each Site Investigator must adhere to the protocol detailed in this document and agree that any changes to the protocol must be approved by the IRB / IEC. Each Site Investigator will be responsible for enrolling only those study participants who have met protocol eligibility criteria.

[0285] STUDY POPULATION o Inclusion Criteria

[0286] To be eligible to participate in this study, potential participants must meet the following criteria at Screening or at the timepoint otherwise specified:

[0287] 1. Ability to understand the purpose and risks of this study, willingness to comply with the protocol for the duration of the study and to provide informed consent in accordance with local laws and regulations;

[0288] 2. Male or female, at least 18 years of age;

[0289] 3. Diagnosis of clinically definite or clinically probable ALS, made by a physician who is experienced with management of ALS, as defined by the World Federation of Neurology revised El Escorial criteria (laboratory supported diagnosis of probable ALS is not accepted);

[0290] 4. Time since onset of first symptom of ALS should be <24 months prior to randomization. Date of ALS symptom onset is defined as the onset of weakness (in the limbs, bulbar region, or trunk). Weakness in the bulbar region includes dysarthria and dysphagia;

[0291] 5. If the participant is to be treated with riluzole and / or edaravone before or during the course of the trial, then treatment must be previously started and maintained at a stable regimen for at least 30 days prior to the Day 1 Visit through the end of the study;

[0292] 6. Women of childbearing potential (e.g., not post-menopausal for at least one year or surgically sterile) must agree to use an acceptable birth control method for the duration of the trial and 60 days after the last dose of Study Drug or be of non-childbearing potential as described below.

[0293] Acceptable contraception methods for use in this trial are: Atorney Docket No. 38709-0130W01 a. Hormonal methods, such as birth control pills, patches, injections, vaginal ring, or implants b. Intrauterine device c. True abstinence (i.e., refraining from heterosexual intercourse when this is in line with the preferred and usual lifestyle of the subject). Periodic abstinence (e.g., calendar, ovulation, sympothermal, post-ovulation methods) is not acceptable d. Bilateral tubal occlusion or ligation e. Unique partner who is surgically sterile (men) or not of childbearing potential (female)

[0294] Women of non-childbearing potential, defined as 12 months of spontaneous amenorrhea or 6 months of spontaneous amenorrhea with serum FSH levels >40 mIU / ml or 6 weeks postsurgical bilateral oophorectomy with or without hysterectomy, will not be required to use a birth control method.

[0295] 7. Female participants or female partners of male participants must not be pregnant or planning to become pregnant nor participate in oocyte donation or storage for the duration of the trial through 60 days after the last dose of Study Drug for female participants and through 90 days after the last dose of Study Drug for female partners of male participants;

[0296] 8. Male participants must agree to practice contraception and abstain from sperm donation for the duration of the trial and for at least 90 days after last dose of Study Drug. o Exclusion Criteria

[0297] Participants who meet any of the following criteria at screening (or at timepoint otherwise specified) will be excluded from enrollment in the study:

[0298] 1. Presence of tracheostomy or permanent assisted ventilation; defined as >22 hours daily of mechanical ventilation for more than 1 week (7 days);

[0299] 2. SVC less than 75%;

[0300] 3. Abnormal liver function defined as aspartate aminotransferase and / or alanine aminotransferase > 3 times the upper limit of the normal (ULN) or total bilirubin > 1.5 times the ULN (obtained within 4 weeks of first dose) except when a result of Gilbert syndrome;

[0301] 4. Renal insufficiency as defined by estimated glomerular filtration rate (eGFR) < 60 mL / min / 1.73m2(obtained within 4 weeks of first dose);

[0302] 5. Abnormal coagulation parameters including platelet count, international normalized ratio, prothrombin time, and activated partial thromboplastin time. Coagulation tests may be repeated once at the discretion of the Investigator. For normal ranges, please Atorney Docket No. 38709-0130W01 refer to the appropriate laboratory reference material (Laboratory Manual or local documentation);

[0303] 6. Pregnant women (confirmed by a pregnancy test within 7 days prior to first dose) or women currently breastfeeding;

[0304] 7. Current or previous clinically significant, unstable medical condition (other than ALS), that in the opinion of the Investigator may significantly impact a participant’s safety or ability to comply with the protocol (e.g., cardiovascular instability, systemic infection, untreated thyroid dysfunction);

[0305] 8. Any clinically significant abnormalities in physical / neurological examination, vital signs, laboratory tests, or ECG, which in the opinion of the Investigator may impact safety of the participant or protocol assessments;

[0306] 9. Presence of unstable psychiatric disease, severe active psychiatric illness, cognitive impairment, dementia, diagnosis of another neurodegenerative disease (e.g., Parkinson disease or Alzheimer’s disease), or substance abuse that would impair ability of the participant to provide informed consent or comply with study procedures, in the opinion of the Investigator;

[0307] 10. Current or previous enrollment in another trial involving use of an investigational therapy, within 5.5 plasma half-lives of the investigational agent, or 30 days after the last dose of the investigational agent, whichever is longer, prior to the Day 1 Visit;

[0308] 11. Current or previous treatment with small interfering ribonucleic acid, stem cell therapy, any ASO or gene therapy. Study participants will not be permitted to enroll in more than one cohort of this study;

[0309] 12. Current or anticipated need, in the opinion of the Investigator, of a Diaphragm Pacing System during the study period;

[0310] 13. Currently or previously treated within the last 30 days (or 5 half-lives, whichever is longer) from first dose at the Day 1 Visit or planned exposure during the treatment period to any prohibited medications listed in the protocol;

[0311] 14. History of or known seropositivity for human immunodeficiency virus (HIV); known to have active hepatitis B and / or C infection, evidenced by detected hepatitis B surface antigen (HBsAg), hepatitis B core antibody and / or hepatitis C ribonucleic acid (HCV- RNA);

[0312] 15. Any contraindications for lumbar puncture or repeated intrathecal injection (e.g., vascular abnormalities, neoplasms, or other anatomical abnormalities) and / or Atorney Docket No. 38709-0130W01 underlying disorders of the coagulation cascade, platelet function, or platelet count (e.g., hemophilia, Von Willebrand’s disease, liver disease);

[0313] 16. Prior severe reaction or known hypersensitivity to oligonucleotides or any component of Study Drug.

[0314] ENROLLMENT, REGISTRATION AND RANDOMIZATION o Screening and Enrollment

[0315] Participants (or their legally authorized representative [e.g., spouse], where applicable) must provide informed consent before any screening tests are performed. At the time of consent, the participant will be considered enrolled into the study and will be assigned a unique identification number before any study procedures, including screening procedures, are performed. This number will be used to identify the participant throughout the trial and must be used on all study documentation related to that participant. The participant identification number must remain constant throughout the entire study. In the event the participant is re-consented and re-screened, the participant must be given a new identification number. Participant identification numbers, once assigned, will not be re-used. o Randomization

[0316] Participants will be randomized on Day 1 after all pre-dose assessments have been completed and the Investigator has verified that participants are eligible per inclusion and exclusion criteria. No participant may begin treatment prior to assignment of a unique identification number and randomization. Any participant identification numbers that are assigned will not be reused, even if the participant does not receive treatment. Participants who withdraw from the study prior to completing the final follow-up visit may be replaced at the discretion of the Sponsor. Study participants may not enroll in more than one cohort.

[0317] Eligible participants will be randomized centrally by an automated system to receive Compound A or placebo. Within each cohort, 9 participants will be randomized to receive Compound A and 3 participants randomized to receive placebo. o Blinding and Unblinding

[0318] This is a randomized, double-blind, placebo-controlled study.

[0319] Investigators, study staff, and study participants will be blinded to the randomized study treatment assignments.

[0320] To maintain the study blind, it is imperative that participant treatment assignments are not shared with the participants, their families, or any member of the study team, either at the study site or at the Sponsor, except designated Sponsor personnel. Atorney Docket No. 38709-0130W01

[0321] To make informed decisions regarding dose escalation, no earlier than 15 days after the last participant of a cohort has been administered their second dose, the DEC and designated Sponsor personnel may be unblinded in order to review all safety and available PK and PD data, to assess safety and tolerability. Further information is included in the DEC charter.

[0322] Emergency Unblinding

[0323] In a medical emergency when knowledge of the participant’s treatment assignment may influence the participant’s clinical care, the Investigator and, if applicable, the designated Sponsor personnel may access the participant’s treatment assignment through an automated system. The Sponsor will be informed of the unblinding of a participant within 24 hours. The Investigator must document the reasons for unblinding in the participant’s source documents. The Investigator is strongly advised not to divulge the participant’s treatment assignment to any individual not directly involved in managing the medical emergency, nor to personnel involved with the analysis and conduct of the study. The Investigator can contact the Sponsor to discuss such situations.

[0324] STUDY TREATMENT o Delivery of Product to Site Pharmacy and Product Labeling

[0325] ■ Study Drug

[0326] Study Drug (Compound A or placebo) will be supplied by the Sponsor to the site pharmacy, with one box per participant containing one clear glass vial with either Compound A in vehicle or placebo (vehicle alone). Study treatment for each participant will also include a separate box containing one clear glass vial of the vehicle alone to be used as diluent, and a separate box containing one clear glass vial of the vehicle alone to be used as flush. Compound A will be diluted with the vehicle to target concentrations as outlined in Section “Dosage and Administration of Investigational Product for Participant” and administered intrathecally.

[0327] The vehicle is a buffer solution suitable for intrathecal administration. o Product Storage and Stability

[0328] All investigational drug supplies are stored in a locked, safe area with access limited to authorized study staff. The drug product, placebo, and vehicle should be stored at 2 to 8°C, and time out of refrigeration should be minimized. Specific instructions on product storage and stability will be provided in the Investigational Product / Pharmacy Manual. Atorney Docket No. 38709-0130W01 o Study Treatment Supplies Accountability Procedures

[0329] Study treatment supplies accountability will be performed throughout the study and at the completion of the study. Upon receipt of the study treatment supplies (Study Drug and vehicle), an inventory must be performed by the person accepting the shipment. It is important that the designated study staff counts and verifies that the shipment contains all the items noted in the shipment documentation. Any damaged or unusable study treatment supplies in a shipment will be documented in the study files. The Site Investigator must notify the Study Sponsor or their designee of any damaged or unusable study treatment supplies that were provided to the Site Investigator’s site in accordance with instructions provided in the Pharmacy Manual.

[0330] Full and current records of study treatment supplies accountability will be maintained in the study files, including all those received, stored, dispensed, returned, or destroyed. At the completion of the study, there will be a final reconciliation of study treatment supplies. Any discrepancies noted will be investigated, resolved, and documented prior to return or destruction. Study treatment supplies may be destroyed on site per documented local institution procedures only after completion of reconciliation and verification by the Study Sponsor or designee. o Dosage and Administration of Investigational Product for Participant

[0331] The site personnel will provide details of the intrathecal administration to the participants. Intrathecal administration will be performed by qualified, experienced medical personnel per institutional guidelines, which may include imaging guided administration procedures with or without contrast.

[0332] All participants will receive Study Drug, administered via intrathecal injection once every 4 weeks as detailed in Section “Study Treatment Administration”. There are 4 planned dose levels that will be investigated, based upon DEC recommendations and ongoing review of safety, tolerability, PK and PD data. The Sponsor, in consultation with the DEC, may modify these planned dose levels as well as add additional dose levels based on the totality of the data; however, dose escalation will not exceed two times the previous dose and the dose level will not exceed 100 mg.

[0333] PARTICIPANT DISCONTINUATION AND WITHDRAWAL o Participant Discontinuation from Treatment with Study Drug or from Participation within the Study

[0334] Participants will be discontinued from the treatment with Study Drug for any of the following reasons: Atorney Docket No. 38709-0130W01

[0335] • For the safety of the participant, including the occurrence of any SAE or AE that, in the opinion of the investigator, may jeopardize the safety of the participant (including but not limited to hepatoxicity, renal toxicity, thrombocytopenia, coagulopathy, and hypersensitivity reactions). o For renal toxicity, if the participant has an increase in creatinine of >1.5x ULN without a clear, alternative cause (i.e. dehydration) o For thrombocytopenia, if the participant has platelets <50,000 / mm3o For coagulopathy, if the participant has INR >1.5x upper limit of normal or aPTT >1.5x upper limit of normal, without a clear, alternative cause o For hepatotoxicity, if the participant has ALT or AST >3x upper limit of normal without a clear, alternative cause

[0336] • The participant wishes to discontinue study treatment.

[0337] • Significant concurrent illness or requirement for prohibited medication

[0338] • Participant becomes pregnant

[0339] • Participant lost to follow-up

[0340] • Participant unwillingness or inability to adhere to the protocol

[0341] • At the discretion / decision of the Investigator for benefit-risk considerations

[0342] • Termination of the study by the Sponsor, regulatory agency or IRB.

[0343] The primary reason for discontinuation of study treatment must be recorded in the participant’s electronic case report form (eCRF). Early discontinuation of Study Drug for any of the above reasons should be distinguished from withdrawal of consent by the participant to participate in any further trial-related activities.

[0344] Discontinue Study Drug

[0345] Participants who discontinue Study Drug progress to the follow-up period and will complete a Telephone Visit approximately 19 days after their last dose of Study Drug and the Early Termination Visit approximately 60 days after the last dose of Study Drug to monitor for emerging AEs and assess the outcome / resolution of the AEs that were present upon discontinuation of Study Drug. Participants who have laboratory abnormalities or another AE and discontinue Study Drug for their safety will be monitored and treated as medically appropriate through resolution.

[0346] Withdrawal of Consent

[0347] Participants who indicate potential intent to withdraw consent to the study will be asked to attend the Early Termination Visit as soon as possible to monitor for emerging AEs Atorney Docket No. 38709-0130W01 and assess the outcome / resolution of the AEs that were present upon discontinuation of Study Drug. o Participant Replacement

[0348] Participants who withdraw or drop out prior to completing the final follow-up visit may be replaced at the discretion of the Sponsor. Up to approximately 8 replacement participants may be enrolled (approximately 2 per cohort). A replacement participant will be assigned a distinct participant number and be assigned the same treatment sequence as the participant they are replacing.

[0349] STUDY ASSESSMENTS AND PROCEDURES

[0350] Study procedures and their timing are summarized in the Schedule of Activities in Table 13; details of Assessments follow.

[0351] Table 13 Schedule of Activities: Multiple Ascending Dose

[0352] Screening and Day 1 - Day 36 Atorney Docket No. 38709-0130W01 Atorney Docket No. 38709-0130W01

[0353] Day 48 - Day 92 and Follow-up Period (Day 104 - Day 145) Atorney Docket No. 38709-0130W01

[0354] AE = adverse event; ALSFRS-R = Amyotrophic Lateral Sclerosis Functional Rating Scale - Revised; CSF = cerebrospinal fluid; C-SSRS = Columbia Suicide Severity Rating Scale; ‘s ECG = electrocardiogram, FSH = follicle-stimulating hormone; PK = pharmacokinetic(s); RNA = ribonucleic acid; SAE = serious adverse event; SVC = slow vital capacity;

[0355] WOCBP = woman of child-bearing potential. a. Screening assessments can be performed over multiple days within the 30 days screening period (need not be consecutive). b. All assessments are to be collected prior to lumbar puncture. c. All participants will be observed for at least 24 hours post-dose after the first dose. d. Includes genetic / future research consent. Participants who agreed to the optional genomics biomarker sampling question in the consent form and provided an optional Genomics Biomarker Sample during Visit 1 of Screening do not need to provide another Genomics Biomarker Sample later. e. Including blood samples for human immunodeficiency virus, hepatitis C virus, and hepatitis B virus tests, and platelet and coagulation tests. Platelet and coagulation tests may be repeated once if, in the opinion of the Atorney Docket No. 38709-0130W01

[0356] Investigator, the values of the initial tests are only slightly out of range. f. To be performed pre-dose. g. To be performed on dosing days pre-dose (within 2 hours of dosing) and at approximately 2, 4, and 6 hours post-dose (+ / - 15 minutes). h. Triplicate 12-lead (paper) ECGs will be obtained after the participant has rested in a supine position for at least 10 minutes. The first ECG will be interpreted, and the last 2 will be checked for consistency and quality. i. To be assessed just prior to drawing blood samples at pre-dose, and approximately 2 hours post-dose (+ / - 15 minutes). j. Limited physical examination will be conducted at the Investigator’s discretion. k. For women of childbearing potential only; to be performed pre-dose on Dosing Visits and approximately every 30 days between Day 85 and the End of Study Visit. l. The FSH test is only performed if necessary to assess conformance with inclusion criteria #6. Women with at least 6 months and less than 12 months of spontaneous amenorrhea are considered to be of non-childbearing potential if the FSH level is >40 mIU / ml. m. Use the “Since Last Visit” version of C-SSRS; to be performed pre-dose on Dosing Days. n. Lumbar puncture will be performed to collect CSF samples for PK, pharmacodynamic, safety, and biomarker analysis. CSF safety labs will include red blood cell count, white blood cell count, protein, and glucose. o. To be collected pre-dose. p. If screening chemistry and urinalysis assessments were drawn within 14 days prior to Day 1, then chemistry and urinalysis assessments do not need to be repeated pre-dose on Day 1. q. The pre-dose coagulation and platelet count tests should be performed the same day as dosing and the results must be reviewed before each lumbar puncture can be performed. r. Participants will remain under observation in the clinic for at least 24 hours following the first dose of study drug administration and for approximately 6 hours following subsequent doses and / or lumbar puncture procedure. s. Dosing Days must be completed no less than 25 days apart. If a Dosing Day visit (Days 29, 57, or 85) is delayed by more than 3 days, all subsequent Dosing Days must be adjusted in order to maintain the minimum 25-day dosing interval, and the Medical Monitor should be consulted. t. To be performed on dosing days at pre-dose (within 60 minutes of dosing) and at approximately 2H (+ / -5 minutes), 4H (+ / - 5 minutes), and 6H (+ / -10 minutes) post-dose as well as Day 2 at 24H (+ / - 30 minutes) post-dose. o Assessments

[0357] ■ Informed Consent

[0358] This study will be conducted in compliance with Title 21 Part 50 of the US CFR, Federal Regulations and ICH Guidance Documents pertaining to informed consent. At the Screening Visit, prior to initiation of any study -related procedures, participants will be informed about the nature and purpose of the study, participation / termination conditions, and risks and benefits. The informed consent includes optional consent for genomics testing and for future research. Participants will be given adequate time to ask questions and become familiar with the study prior to providing consent to participate. Participants will give their written consent to participate in the study and will be provided with a copy of the fully executed consent form for their records.

[0359] ■ Study Participant ID Card

[0360] Participants will be provided with a Study Participant ID Card at their Screening Visit and be instructed to carry this card on their person for the remainder of their trial participation and to present this card to other medical professionals when receiving non-trial related medical care.

[0361] ■ Optional Genomics Biomarker Sample

[0362] An optional genomics biomarker sample may be collected at the Screening visit. Atorney Docket No. 38709-0130W01

[0363] Specific instructions regarding the collection, processing, storage and shipment of these samples will be provided in the Laboratory Manual.

[0364] ■ Clinical Laboratory Samples to Verify Eligibility

[0365] Participants will provide clinical laboratory samples to verify eligibility at the Screening visit. The samples will include blood samples for human immunodeficiency virus, hepatitis C virus, and hepatitis B virus tests, hematology, chemistry, and coagulation tests. Platelet and coagulation tests may be repeated once if, in the opinion of the Investigator, the values of the initial tests are only slightly out of range.

[0366] The following laboratory tests or their functional equivalent will be performed as safety laboratory assessments to verify eligibility:

[0367] ■ Hematology with differential panel: complete blood count with differential (hematocrit, hemoglobin, platelet count, reticulocyte count, total red blood cells (RBCs), mean corpuscular hemoglobin, red blood cell distribution width, mean corpuscular volume, mean cell hemoglobin concentration, total white blood cells (WBCs), and WBCs and differential)

[0368] ■ Blood chemistry panel / Liver function tests: alanine aminotransferase, aspartate aminotransferase, albumin, alkaline phosphatase, lactate dehydrogenase, bicarbonate, blood urea nitrogen, calcium, chloride, creatinine, glucose, magnesium, phosphate, potassium, sodium, Uric acid, total and direct bilirubin, lipase, amylase, thyroid stimulating hormone, and total protein

[0369] ■ Coagulation: prothrombin time, international normalized ratio (INR), activated partial thromboplastin time

[0370] ■ Urinalysis: albumin, bilirubin, Urobilinogen, blood, clarity, color, glucose, ketones, nitrate, pH, protein, specific gravity, urobilinogen, RBCs and WBCs screen

[0371] ■ Serum / urine human chorionic gonadotrophin (hCG) for WOCBP

[0372] ■ Admission to Inpatient Facility

[0373] Participants will be admitted to the inpatient facility on Day 1 for their first dose of Study Drug. In order to be admitted, participants must have signed an ICF, and had eligibility verified during Screening visit(s). Admission will be less than 30 days after commencement of the Screening period.

[0374] ■ Slow Vital Capacity (SVC)

[0375] SVC is a measure of lung function using the maximal amount of air exhaled in a relaxed expiration from full inspiration to residual volume; exhalation should be terminated after 15 seconds. SVC will be done at site on the study-specific clinic spirometer under Atorney Docket No. 38709-0130W01 supervision of site personnel. SVC is required for inclusion in the study, and subsequent SVC assessments must be attempted; however, if a participant is too weak to provide an accurate reading in the opinion of the Investigator, this must be recorded as such in eCRF.

[0376] SVC will be conducted at the Screening Visit, at the Pre-dose Study Day 1 visit, Predose on Dosing Days 29, 57, and 85, at the Safety Visits on Days 8, 36, 64, and 92, and subsequently at the Day 145 final visit, or early termination visit.

[0377] ■ Inclusion / Exclusion Criteria Review

[0378] At the Screening Visit and Pre-dose on Day 1, the eligibility of the participant to take part in this study will be reviewed confirming all inclusion criteria and exclusion criteria.

[0379] ■ Medical History / Demographics

[0380] Medical history will include significant, recent (5 year) medical history, including chronic and acute medical conditions during this period. Demographic information will include year of birth, sex, and racial / ethnic background.

[0381] At the Screening Visit and at the Pre-dose Study Day 1 visit, participants will provide information on their demographics, past medical history, including ALS and cardiac history, as well as concomitant medication usage.

[0382] ■ Concomitant Medication and Procedures Review

[0383] Any medication and / or procedures that the participant is currently taking and / or had recently performed or is scheduled to have performed is reviewed and recorded.

[0384] Concomitant medications and / or procedures will be reviewed at the Screening Visit, and at Pre-dose Study Day 1 visit, at Dosing Days 29, 57, and 85 and at Safety Visits on Days 8, 36, 64, and 92 visits, as well as the Follow-up visits via telephone on Days 3, 20, 30, 48, 58, 76, 86, and 104, and at the final Day 145 visit, or at an early termination visit.

[0385] ■ Vital Signs, Height, and Weight

[0386] Vital signs will be obtained after the participant has been in a seated position for several minutes. Vital signs, including systolic and diastolic blood pressure, pulse rate (radial artery ) / minute, respiratory rate / minute, and temperature will be assessed. Height will be measured and recorded at the Screening Visit only. Weight will be measured at the Screening Visit, at Pre-dose Study Day 1 visit, and at the Day 145 visit, or at an early termination visit. It may be omitted if the site does not have access to the required equipment (e.g., if the participant is in a wheelchair).

[0387] Vital signs will be obtained at the Screening Visit, pre-dose and at 2, 4 and 6 hours post dose on Study Day 1, on Day 2 during the inpatient period, and pre-dose and at 2, 4 and 6 hours post-dose on Dosing Days 29, 57 and 85. Vital signs will also be assessed at Safety Atorney Docket No. 38709-0130W01

[0388] Days 8, 20, 36, 48, 64, and 92, and at the Day 145 visits, or at an early termination visit. The pre-dose vital signs measurements will be taken <2 hours before dosing. Post-dose vital signs measurements will be taken ± 15 min from the nominal post-dose time points.

[0389] ■ 12-Lead ECG

[0390] Triplicate 12-lead (paper) ECGs will be obtained after the participant has rested in a supine position for at least 10 minutes. The first ECG will be interpreted, and the last 2 will be checked for consistency and quality. The ECG test includes heart rate, PR interval, QRS interval, QT interval, QTc interval using Fridericia’s formula, and RR interval. Only qualitative interpretation of ECG results will be assessed by the Investigator for abnormalities at Screening.

[0391] ECGs will be conducted at the Screening Visit, and prior to drawing blood samples at Pre-dose Study Day 1 visit and at approximately 2 hours post-dose, and at Study Day 2. ECGs will also be conducted prior to drawing blood samples and at approximately 2 hours post-dose on Dosing Days 29, 57, and 85, at Safety Visits on Days 8, 36, 64, and 92, and at the Day 145 visit, or at an early termination visit. Post-dose ECG measurements will be taken ± 15 min from the nominal post-dose time points.

[0392] ■ Physical Examination

[0393] The first 2 physical examinations will be comprehensive. Subsequent physical examinations after the first two may be limited and conducted at the discretion of the Investigator.

[0394] A physical examination will be conducted at the Screening Visit, and at Pre-dose Study Day 1 visit, and may be conducted on Day 2 post-dose day during the dosing inpatient period and at dosing Days 29, 57, and 85, and at the Day 145 visit, or at an early termination visit. On Safety Visits on Days 8, 36, 64, and 92, a limited physical examination may be conducted at the Investigator’s discretion.

[0395] ■ Neurological Examination

[0396] A neurological examination will be performed and recorded. Examination will include assessment of mental status, cranial nerves, motor and sensory function, reflexes, coordination, and stance / gait.

[0397] A neurological examination will be conducted at the Screening Visit, at Pre-dose Study Day 1 visit, at Post-Dose Study Day 2 during the dosing inpatient period, at pre-dose on dosing Days 29, 57, and 85, at Safety Visits on Days 8, 36, 64, and 92, and at the Day 145 visit, or at an early termination visit. Atorney Docket No. 38709-0130W01

[0398] ■ Urine / Serum Pregnancy Test for WOCBP

[0399] A urine or serum pregnancy test will be conducted for WOCBP only. Additional pregnancy testing for WOCBP may be performed throughout the study and as required per local and / or institutional regulations.

[0400] A urine or serum pregnancy test will be conducted at the Screening Visit, and at Predose Study Day 1 visit, and pre-dose on Dosing Days 29, 57, 85, and at least approximately monthly between the Day 85 and Day 145 visits or at an early termination visit.

[0401] ■ Follicle-stimulating Hormone (FSH) Test

[0402] A follicle-stimulating hormone test will be conducted at the Screening Visit only if necessary to assess conformance with inclusion criteria #6. Women with at least 6 months and less than 12 months of spontaneous amenorrhea are of non-childbearing potential if the FSH level is >40 mIU / ml.

[0403] ■ ALSFRS-R (Amyotrophic Lateral Sclerosis Functional Rating Scale - Revised)

[0404] The ALSFRS-R is an ordinal rating scale (ratings 0-4) used to determine participants' assessment of their capability and independence in 12 functional activities in 4 functional domains including respiratory, bulbar function, gross motor skills, and fine motor skills. All 12 activities are relevant to ALS. All ALSFRS-R evaluators must be certified by an Sponsor- approved provider. For a given participant, the site should make every effort to utilize the same rater for the duration of the study.

[0405] The ALSFRS-R will be conducted at the Screening Visit, and at the Pre-dose Study Day 1 visit, and pre-dose on Dosing Days 29, 57, and 85, and at the Day 145 final visit, or early termination visit.

[0406] ■ Columbia Suicide Severity Rating Scale (C-SSRS)

[0407] The US FDA recommends the use of a suicidality assessment instrument that maps to the Columbia Classification Algorithm for Suicide Assessment (C-CASA) (Posner, 2007). The C-CASA was developed to assist the FDA in coding suicidality data accumulated during the conduct of clinical trials of antidepressant drugs. One such assessment instrument is the Columbia Suicide Severity Rating Scale (C-SSRS). The C-SSRS involves a series of probing questions to inquire about possible suicidal thinking and behavior.

[0408] At the Pre-dose Day 1 Visit, the C-SSRS Baseline version will be administered. This version is used to assess suicidality over the participant’s lifetime. Atorney Docket No. 38709-0130W01

[0409] The “Since Last Visit” version of the C-SSRS will be administered pre-dose on Dosing Days 29, 57, and 85, and at the Day 145 final visit, or early termination visit. This version of the scale assesses suicidality since the participant’s previous assessment.

[0410] ■ Safety Laboratory Assessments

[0411] The following laboratory tests or their functional equivalent will be performed as safety laboratory assessments:

[0412] ■ Hematology with differential panel: complete blood count with differential (hematocrit, hemoglobin, platelet count, reticulocyte count, total RBCs, mean corpuscular hemoglobin (MCH), Red blood cell distribution width (RDW), Mean corpuscular volume (MCV), Mean cell hemoglobin concentration (MCHC), total white blood cells (WBCs), and WBCs and differential)

[0413] ■ Blood chemistry panel / Liver function tests: alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin, alkaline phosphatase (ALP), Lactate dehydrogenase (LDH), bicarbonate, blood urea nitrogen (BUN), calcium, chloride, creatinine, glucose, magnesium, phosphate, potassium, sodium, Uric acid, total and direct bilirubin, lipase, amylase, thyroid stimulating hormone, and total protein

[0414] ■ Coagulation: Prothrombin time (PT), International normalized ratio (INR), Activated partial thromboplastin time (APTT)

[0415] ■ Urinalysis: albumin, bilirubin, Urobilinogen, blood, clarity, color, glucose, ketones, nitrate, pH, protein, specific gravity, urobilinogen, RBCs and WBC screen

[0416] ■ Serum / urine hCG for women of childbearing potential (WOCBP)

[0417] Safety laboratory assessments (Clinical Laboratory Samples for Chemistry and Urinalysis) will be obtained at the Screening Visit, on Study Day 1 visit pre-dose (within 60 minutes of dosing) and at 2 hours(+ / - 5 minutes), 4 hours (+ / - 5 minutes), and 6 hours (+ / - 10 minutes) post-dose, on Day 2 during the dosing inpatient period and pre-dose (within 60 minutes of dosing) and at 2 hours (+ / - 5 minutes), 4 hours (+ / - 5 minutes), and 6 hours (+ / - 10 minutes) post-dose on Dosing Days 29, 57 and 85. Safety laboratory assessments will also be assessed on Safety Visits on Days 8, 36, 64, and 92, and on the Day 145 visits, or at an early termination visit.

[0418] The Investigator or delegated personnel must review the laboratory report, document this review, and record any clinically relevant changes occurring during the study in the AE section of the eCRF. The laboratory reports must be filed with the source documents.

[0419] All laboratory tests with values considered clinically significantly abnormal during participation in the study after the dose of study treatment should be monitored until the Atorney Docket No. 38709-0130W01 values return to normal or baseline, are no longer considered clinically significant or are deemed chronically stable by the Investigator or Medical Monitor. If such values do not return to normal / baseline within a period of time judged reasonable by the Investigator, the etiology should be identified, and the Sponsor notified.

[0420] ■ Cerebral Spinal Fluid (CSF) Samples

[0421] Lumbar puncture will be performed to collect an approximately 15 mL CSF sample pre-dose for PK, pharmacodynamic, safety, and biomarker analysis. CSF will be used for standard laboratory measurement of red blood cell count, white blood cell count, glucose, protein and Compound A pharmacokinetic analyses. Key tertiary biomarkers will include calpain-2 and NfL. Remaining CSF will be stored for investigation of possible biomarkers of ALS, calpain-2 activity, the pharmacodynamic effects of Compound A, or future research.

[0422] CSF will be collected at the Pre-dose Study Day 1 visit, and pre-dose on Dosing Days 29, 57, and 85, and subsequently at the Day 145 final visit, or early termination visit.

[0423] After CSF collection and administration of the Study Drug, participants will be required to lie flat for at least 30 minutes after dosing. Participants will remain under observation in the clinic for approximately 24 hours following the first lumbar puncture procedure / dose on Day 1. On Days 29, 57, and 85, participants will remain under observation in the clinic for approximately 6 hours following the lumbar puncture procedure / dose and will also receive a safety follow-up telephone call approximately 24 hours after. Specific instructions regarding the collection, processing, storage and shipment of these samples will be provided in the Laboratory Manual.

[0424] ■ Blood Samples for Biomarkers

[0425] Blood samples for biomarkers will be collected at Pre-dose Study Day 1 visit and at pre-dose and prior to the lumbar puncture procedure on Dosing Days 29, 57, and 85, and subsequently at the Day 145 final visit, or early termination visit.

[0426] ■ Blood Samples for Plasma Pharmacokinetics

[0427] Blood samples for plasma PK will be collected at the Pre-dose (within 60 minutes of dosing) Study Day 1, 29, 57, and 85 visit and post-dose on Study Day 1, 29, 57, and 85 at approximately 2 hours (+ / - 5 minutes), 4 hours (+ / - 5 minutes), and 6 hours (+ / - 10 minutes) post-dose as well as Day 2 at 24 hours (+ / - 30 minutes) post-dose. Blood samples for plasma PK will also be collected at the final Day 145 visit, or at an early termination visit.

[0428] ■ Discharge from Inpatient Facility

[0429] On Study Day 2, at least 24 hours post-dose, after observation and all assessments are completed, participants will be released from the Inpatient Facility. Atorney Docket No. 38709-0130W01

[0430] ■ Adverse Event and Serious Adverse Event Monitoring and Review

[0431] Throughout the course of the study, every effort must be made to remain alert to possible AEs and SAEs. If an AE occurs, the first concern should be for the safety of the participant. If necessary, appropriate medical intervention should be provided. For the definitions of AEs and SAEs see Section “Neurological Examination”. o Recruitment and Screening

[0432] At the Screening Visit, informed consent will be obtained. At this screening visit, the study protocol will be explained to the individual and the individual will be asked questions to determine their eligibility, level of interest and to collect baseline data. Participants who are considered potential candidates for the study will sign an IRB approved ICF. Participants will be screened in a sequential fashion and excluded from further evaluation if they do not meet eligibility criteria at any point. Participants who fail screening for safety laboratory assessments or SVC may be retested once during the 30-day screening period, at the discretion of the Investigator, following discussion with the Medical Monitor.

[0433] A participant may have the Screening period extended by 2 weeks, following discussion with the Medical Monitor, for unexpected operational or logistical delays. Otherwise, if an eligible participant’s Screening period is beyond 30 days, the participant will be required to be re-consented, re-screened and assigned a new participant number.

[0434] The following tasks will be completed during the screening period:

[0435] ■ Written Informed Consent will be obtained before any protocol related activities are initiated

[0436] • Blood samples for laboratory assessments to verify eligibility

[0437] • SVC

[0438] • Demographic information: Year of birth, sex, racial / ethnic background

[0439] • Significant recent (5 year) medical history, including chronic and acute medical conditions during this period and concomitant medications

[0440] • Vital signs and height and weight

[0441] • 12 lead ECG

[0442] • Physical and neurological examination

[0443] • Urine / Serum Pregnancy Test for women of childbearing potential

[0444] • FSH to confirm non-childbearing potential in postmenopausal female subjects

[0445] • ALSFRS-R questionnaire

[0446] • Optional genomics biomarker sample Atorney Docket No. 38709-0130W01

[0447] All screening evaluations must be completed and reviewed by the Investigator to confirm that potential participants meet all eligibility criteria.

[0448] The participant will be instructed to contact the site personnel if there are any questions regarding these restrictions or if any of these restrictions have been breached. o Study Treatment Administration

[0449] This study will examine dose levels of Study Drug (Compound A or placebo), sequentially, in up to 48 participants. Participants will be enrolled in cohorts of 12, with 9 participants randomized to receive Compound A and 3 participants randomized to receive placebo. More detailed information regarding the Study Drug is available in Section “Study Treatment”. Currently, 4 dose levels are planned, with the option for additional dose levels to be added not to exceed 100 mg based on ongoing data review, in consultation with the DEC. Participants will receive Study Drug, administered via intrathecal injection once every 4 weeks + / - 3 days. Participants must not receive Study Drug less than 25 days apart for safety of the participant. Participants in dose level 1 will be administered up to 4 doses of 12.5mg of Compound A or placebo. Participants in dose levels 2, 3, and 4 will receive up to 4 doses of either placebo or 25mg, 50mg, and lOOmg of Compound A, respectively. The Sponsor, in consultation with the DEC, may modify these planned dose levels as well as add additional dose levels based on the totality of the data; however, no dose escalation will exceed two times the previous dose level and the dose level will not exceed 100 mg.

[0450] Prior to dose administration, approximately 15 mL of CSF will be collected via lumbar puncture procedure. Participants will then receive a 15 mL intrathecal bolus of Study Drug, over 1-3 minutes followed by an intrathecal 5 mL vehicle flush. Depending on local and institutional guidelines, anesthesia or sedation may be used for the lumbar puncture procedure. After initial CSF collection and administration of the dose and the vehicle flush, participants will be required to lie flat for at least 30 minutes after dosing.

[0451] Same day platelet and coagulation laboratory assessments will be reviewed prior to administration of every dose throughout the study.

[0452] For the first dose visit, each participant will remain as an inpatient at the study site for a minimum of 24 hours for observation and post-dose plasma PK measurements. For subsequent dosing visits, participants will remain at the study site for a minimum of 6 hours following each dose for observation and post-dose plasma PK measurements. Participants will also receive a safety follow-up telephone call approximately 24 hours after the procedure. Atorney Docket No. 38709-0130W01

[0453] The prescribed dosage, timing, and mode of administration may not be changed except in the case of emergence of dose limiting AE. Any departures from the intended regimen must be recorded in the eCRFs.

[0454] ■ Dose Escalation Committee (DEC)

[0455] A DEC will be utilized for the study. The Committee will receive and review appropriate data and monitor the safety of participants in this study, through regular and / or ad hoc meetings as specified in the DEC charter. At minimum, the committee will meet no earlier than 15 days after the last participant of a cohort has been administered their second dose. The DEC will make recommendations regarding dose escalation and dose termination decisions for the study. In addition, the DEC Chair may call ad hoc meetings as necessary, to provide recommendations on management of new or emerging safety concerns, if any of the DLTs or stopping criteria are met, and to make other recommendations on the study as appropriate.

[0456] Further details are documented in the DEC Charter.

[0457] ■ Dose Escalation

[0458] Beginning with Cohort 2, dose administration in the cohort may commence only after the following minimum requirements are met in the prior cohort:

[0459] • All participants in the prior cohort have been enrolled

[0460] • All available participants in the prior cohort have received multiple doses of Study Drug such that the cumulative dose received by each participant is equal to or greater than the dose level planned for participants in the new cohort.

[0461] • Participant safety in the prior cohort has been monitored for at least 15 days posttreatment after receipt of the cumulative dose that meets or exceeds the dose planned for the new cohort and those data are available for review.

[0462] • Safety data in the prior cohort has been reviewed by the DEC and Sponsor and the DEC has recommended initiation of the new cohort.

[0463] The DEC will advise on suitability of each potential dose escalation throughout the study. Decisions to escalate, terminate, or otherwise modify the dose will be considered by the DEC no earlier than 15 days after the last participant of a cohort has been administered their second dose (e.g., approximately after Day 44 for the final participant in the cohort). Dose escalation and dose termination decisions as well as participant allocation across dose levels will be determined by the DEC. The DEC may also consider blinded review of accumulating CSF pharmacokinetic data and compare those data to Compound A levels that are expected to Atorney Docket No. 38709-0130W01 produce a pharmacologic effect. Based on this review, the dose level(s) for future cohort(s) may be adjusted. The maximum dose level will not exceed lOOmg.

[0464] Ad hoc DEC meetings may be scheduled at the discretion of the Sponsor based on the totality of the data. Detailed information regarding the DEC may be found in the DEC Charter.

[0465] A DLT will be defined as an AE that, in the judgment of the DEC and / or the Sponsor, is of sufficient significance to be dose limiting, is related to study treatment (i.e. the AE is substantially less likely to occur in subjects not treated with study treatment) and is not a known: 1) sign or symptom of ALS, 2) effect of the lumbar puncture procedure, 3) event related to a concomitant medication, or 4) event related to a pre-existing condition. o Study Visit - Day 1

[0466] The Schedule of Activities (Table 13) and Section “Assessments” indicate all of the tasks with detailed descriptions of the assessments that will be completed during the visit. After a successful Screening visit, the participant will be instructed to present to the site and be instructed regarding the administration of the first dose. All Screening visit procedures and eligibility verification must be done before starting the Study Day 1 visit procedures. Participants will remain under observation in the clinic for at least 24 hours following the first dose and / or lumbar puncture procedure. After the initial 24-hour dosing inpatient period, the participant will be instructed before leaving the site about their follow-up visits. o Subsequent Study Visits

[0467] For the subsequent Dosing Day visits, the Schedule of Activities (Table 13) and Section “Assessments” indicate all of the tasks with detailed descriptions of the assessments that will be completed during each visit. The participant will be instructed to present to the site and be instructed regarding the subsequent dosing visits on Days 29, 57, and 85 (Section “Study Treatment Administration”). Following the subsequent doses / lumbar puncture procedures, participants will be observed for approximately 6 hours. Participants will also receive a safety follow-up telephone call approximately 24 hours after each dose / lumbar puncture procedure. After the 6-hour observation period, the participant will be instructed before leaving the site about their subsequent follow-up visits including the Safety visits (Days 8, 36, 64, and 92). In addition, the participants will be instructed regarding telephone follow-up visits (Days 3, 20, 30, 48, 58, 76, 86, and 104) and the final Day 145 final visit or an early termination visit.

[0468] Minimum Dosing Interval

[0469] Dosing Days are to be completed no less than 25 days apart. If a participant’s Dosing Day visit (Days 29, 57, or 85) is delayed by more than 3 days, all subsequent Dosing Days Atorney Docket No. 38709-0130W01 and Safety Visits must be adjusted to maintain the minimum 25-day dosing interval, and the Medical Monitor should be consulted.

[0470] Unscheduled Visits

[0471] Unscheduled visits, if deemed necessary, may occur at any time at the discretion of the Investigator and / or the study personnel. o Management of AEs

[0472] Initial management of treatment emergent AEs intolerable to the patient and possibly related to Study Drug, in the opinion of the Investigator, occurring during treatment may be managed by the Investigator, who may decide at any time to interrupt Study Drug treatment.

[0473] If the event is classified as severe or is an SAE, dosing will be suspended for all active participants in accordance with the study stopping rules. o Study Stopping Rules

[0474] 1. Dose Suspension

[0475] Cohort Suspension Rules:

[0476] If one participant experiences any severe AE or SAE, dosing will be suspended for all active participants. All available safety and PK data will be reviewed by the Dose Escalation Committee and / or the Sponsor to determine whether dosing may resume and whether changes to the study protocol are needed (e.g., dose modification). Depending on the nature, severity, suspected on- or off-target toxicity, outcome and frequency of the event, a decision (documented with supporting rationale) will be made to proceed with one of the following:

[0477] • Request additional safety data

[0478] • Continue dosing remaining participants within the cohort

[0479] • Enroll additional participants to the current cohort

[0480] • Proceed with the planned dose escalation in the next cohort

[0481] • Enroll additional participants to previous (lower-dose) cohort

[0482] • Stop the study

[0483] The review will also include available preliminary PK data from the preceding cohort(s).

[0484] Dosing of the cohort cannot resume until the DEC and / or Sponsor complete the safety evaluation and the Investigator has received written approval from the Sponsor to resume dosing. Atorney Docket No. 38709-0130W01

[0485] 2. Dose Termination

[0486] After evaluation of safety, tolerability, and PK data by the DEC and / or Sponsor, further dosing at the current level and dose escalation will be terminated if any of the following is observed:

[0487] • Two similar SAEs (unless unrelated to Compound A upon medical review) are reported for 2 separate participants on active study treatment within the same cohort.

[0488] • Three or more similar AEs (unless unrelated to Compound A upon medical review) in

[0489] 3 separate participants that are either not tolerable as reported by the participants or deemed a medically unacceptable risk by the Investigator, DEC, and Sponsor.

[0490] • Sponsor requests that dosing be terminated.

[0491] The review will also include available preliminary PK data from the preceding cohort(s). Dosing of the cohort cannot resume until the DEC and / or Sponsor complete the safety evaluation and the Investigator has received written approval from the Sponsor to resume dosing. o Study Termination

[0492] The study will be terminated if no dose is deemed to be safe by the DEC and / or the Sponsor. The Sponsor may terminate this study at any time, after informing the Investigator. The Investigator will be notified by the Sponsor if the study is placed on hold, completed, or closed. o Study Completion

[0493] Study completion is defined as when the last participant experiences the last / final visit (Day 145 final visit or an early termination visit). o Pharmacokinetics and Pharmacodynamics

[0494] ■ Determination of Drug Concentration

[0495] Samples will be analyzed in a Sponsor-contracted laboratory using appropriate, validated bioanalytical methods. Full details of the bioanalytical methods will be described in a separate Bioanalytical Report.

[0496] Remaining plasma and CSF samples may be subjected to further analysis by the Sponsor or designee for the purpose of the development of additional bioanalytical assays and / or to investigate the presence of metabolites. Samples collected for analyses of Compound A in plasma and CSF may also be used to evaluate safety or efficacy aspects related to concerns arising during or after the study.

[0497] ■ Derivation of Pharmacokinetic Variables Atorney Docket No. 38709-0130W01

[0498] PK parameters will be derived using noncompartmental methods with Phoenix® WinNonlin® Version 8.0 or higher (Certara, L.P. Princeton, New Jersey, United States of America). Actual elapsed time from dosing will be used for the final plasma PK parameter calculations after database lock.

[0499] ■ Pharmacokinetic Parameters

[0500] The PK parameters listed in Table 11 below will be determined for Compound A, when feasible.

[0501] Table 11 Plasma Pharmacokinetic Parameters

[0502] Additional PK parameters may be calculated at the discretion of the clinical pharmacologist. o Concomitant Therapy and Procedure

[0503] A concomitant therapy is any drug or substance administered between Day 1 and the final study visit (Day 145 final visit or an early termination visit). A concomitant procedure is any therapeutic intervention (e.g., surgery / biopsy, physical therapy) or diagnostic assessment (e.g., blood gas measurement, bacterial cultures) performed between Day 1 and the final study visit (Day 145 final visit or an early termination visit),

[0504] ■ Recording of Concomitant Therapy

[0505] All concomitant medications or treatments received for any reason from the first day (Day 1) of Study Drug administration until the final study visit (Day 145 final visit or an early termination visit) will be recorded in the eCRFs along with reason for use; dates of administration including start and end dates; dosage information including dose and frequency. Atorney Docket No. 38709-0130W01

[0506] ■ Allowed Prior and Concomitant Therapy

[0507] If the participant is to be treated with riluzole and / or edaravone before or during the course of the trial, then treatment must be previously started and maintained at a stable regimen for at least 30 days prior to the Day 1 Visit through the end of the study. Concomitant medication for symptom management during the study is at the discretion of the Investigator. Participants with questions about allowed concomitant therapy should seek medical guidance from the Investigator. Daily intake of all concomitant vitamins and supplements should be stabilized at least 14 days prior to Day 1. Doses of vitamins, minerals, and supplements greater than the recommended daily dose should be discouraged during the study.

[0508] ■ Prohibited Medications and Contraindications

[0509] Any antiplatelet or anticoagulant medication (e.g., aspirin, clopidogrel) is prohibited from 7 days before to 48 hours after each lumbar puncture procedure.

[0510] Off-label use of any disease-modifying treatment for ALS is prohibited for the duration of the study.

[0511] Subjects should be instructed to contact their Investigator before taking any new medications, including nonprescription drugs and herbal preparations.

[0512] Except for Compound A, any investigational therapy being used by the participant for the treatment of ALS is prohibited beginning 30 days (or 5 half-lives, whichever is longer) prior to the Day 1 Visit and throughout the trial.

[0513] Use of any gene or cellular therapy (such as NurOwn, Q-Cells, T regulatory therapy) prior to this trial excludes participants from enrollment. These are also prohibited during the trial.

[0514] Participants are permitted to use vitamins and over the counter supplements, but at the standard medical amounts and participants should not change dosage beginning 14 days (or 5 half-lives, whichever is longer) prior to the study first dose and throughout the trial.

[0515] If an Investigator learns that a participant has begun therapy with any prohibited medication in conflict with the requirements of this section, this should be reported to the Medical Monitor immediately, and the Investigator should make the determination whether to stop Study Drug or the prohibited medication immediately, taking into account the health, safety and preference of the participant. o Safety and Adverse Events

[0516] Planned time points for all safety assessments are provided in the Study Schedule of Activities (Table 13). The AE definitions and reporting procedures provided in this protocol Atorney Docket No. 38709-0130W01 comply with all applicable regulations and ICH guidelines, country-specific regulatory requirements relating to safety reporting to the regulatory authority, and IRBs / IECs.

[0517] ■ Definition and Classification of Adverse Events

[0518] An AE is any untoward medical occurrence in a participant that occurs either before dosing (referred to as a pre-dose AE and included in medical history) or once a medicinal product has been administered, including occurrences which are not necessarily caused by or related to that product.

[0519] An adverse drug reaction is any AE where a causal relationship with the Study Drug is at least a reasonable possibility (possibly related or related).

[0520] AEs will be monitored from the time immediately following first dose of Study Drug until the Final Safety Follow-up Visit at Day 145 ± 3 days, approximately 60 days after the last dose of Study Drug.

[0521] For adverse events, the event’s severity is characterized by one of the following:

[0522] • Grade 1: Mild AE (asymptomatic or mild symptoms; clinical or diagnostic observations only; intervention not indicated)

[0523] • Grade 2: Moderate AE (minimal, local or noninvasive intervention indicated; limiting age-appropriate instrumental activities of daily living)

[0524] • Grade 3: Severe or medically significant AE (not immediately lifethreatening; hospitalization or prolongation of hospitalization indicated; disabling; limiting self-care activities of daily living)

[0525] • Grade 4: Life-threatening AE (urgent intervention indicated)

[0526] • Grade 5: Death related to AE

[0527] ■ Assessment of Causality

[0528] Every effort should be made by the Investigator to try to explain each AE and assess its relationship, if any, to the Study Drug. The temporal relationship of the event to Study Drug administration should be considered in the causality assessment (i.e., if the event starts soon after Study Drug administration and resolves when the Study Drug is stopped).

[0529] The relationship of the AE to the investigational product should be specified by the Investigator, using the following definitions:

[0530] • Not Related: Concomitant illness, accident or event with no reasonable association with treatment.

[0531] • Unlikely Related: The reaction has little or no temporal sequence from administration of the Study Drug, and / or a more likely alternative etiology exists. Atorney Docket No. 38709-0130W01

[0532] • Possibly Related: The reaction follows a reasonably temporal sequence from administration of the Study Drug and follows a known response pattern to the suspected Study Drug; the reaction could have been produced by the Study Drug or could have been produced by the participant’s clinical state or by other modes of therapy administered to the participant.

[0533] • Probably Related: The reaction follows a reasonably temporal sequence from administration of the Study Drug; is confirmed by discontinuation of the Study Drug or by rechallenge; and cannot be reasonably explained by the known characteristics of the participant’s clinical state.

[0534] • Definitely Related: The reaction follows a reasonable temporal sequence from administration of Study Drug; that follows a known or expected response pattern to the Study Drug; and that is confirmed by improvement on stopping or reducing the dosage of the Study Drug, and reappearance of the reaction on repeated exposure.

[0535] ■ Recording Adverse Events

[0536] The Investigator will carefully monitor each participant throughout the trial for possible AEs. All AEs will be documented on eCRFs designed specifically for this purpose. It is important to report all AEs, especially those that result in permanent discontinuation of the investigational product being studied, whether serious or non-serious.

[0537] AEs will be recorded from the time immediately following the first dose of Study Drug until the Final Safety Follow-up Visit at Day 145 ± 3 days, approximately 60 days after the last dose of Study Drug.. During each study visit, the participant will be questioned directly regarding the occurrence of any adverse medical event. All AEs, whether ascribed to study procedures or not, will be documented immediately in the eCRF.

[0538] The following information will be collected for each treatment emergent AE:

[0539] 1. Type of event;

[0540] 2. Date of onset and resolution (duration);

[0541] 3. Severity (mild, moderate, severe);

[0542] 4. Seriousness (does the event meet the above definition for an SAE);

[0543] 5. Causality, relation to investigational product and disease;

[0544] 6. Action taken regarding investigational product;

[0545] 7. Outcome.

[0546] All treatment emergent AEs are recorded into the electronic data capture system within 48 hours of the site learning of a new AE or receiving an update on an existing AE. Atorney Docket No. 38709-0130W01

[0547] Any participant who discontinues from the study due to an AE will be followed up until the outcome is determined and written reports provided by the Investigator.

[0548] ■ Serious Adverse Events

[0549] An SAE is defined as any untoward medical occurrence that at any dose:

[0550] ■ Results in death

[0551] ■ Is life-threatening

[0552] ■ Requires hospitalization or prolongation of existing hospitalization

[0553] NOTE: The following hospitalizations are not considered SAEs in the Sponsor’s clinical studies:

[0554] - a visit to the emergency room or other hospital department <24 hours, that does not result in admission (unless considered an important medical or life- threatening event)

[0555] - elective surgery, planned prior to signing consent

[0556] - admissions as per protocol for a planned medical / surgical procedure

[0557] - routine health assessment requiring admission for baseline / trending of health status (e.g., routine colonoscopy)

[0558] - medical / surgical admission other than to remedy ill health and planned prior to entry into the study. Appropriate documentation is required in these cases.

[0559] - admission encountered for another life circumstance that carries no bearing on health status and requires no medical / surgical intervention (e.g., lack of housing, economic inadequacy, caregiver respite, family circumstances, administrative reason)

[0560] ■ Results in persistent or significant disability or incapacity

[0561] ■ Consists of a congenital anomaly or birth defect

[0562] ■ An important medical event as recognized (defined as a medical event(s) that may not be immediately life threatening or result in death or hospitalization but, based upon appropriate medical and scientific judgment, may jeopardize the participant or may require intervention [e.g., medical, surgical] to prevent one of the other serious outcomes listed in the definition above). Examples of such events include, but are not limited to, intensive treatment in an emergency room or at home for allergic bronchospasm; blood dyscrasias or convulsions that do not result in hospitalization.

[0563] ■ Suspected Unexpected Serious Adverse Reactions

[0564] Suspected unexpected serious adverse reactions (SUSARs) are AEs that are believed to be related to an investigational product and are both unexpected (i.e., the nature or severity Atorney Docket No. 38709-0130W01 is not expected from the information provided in the Investigator’s Brochure) and serious. Reporting of a SUSAR is to be expedited to the IRB and to the appropriate regulatory authorities and Investigators following local and global guidelines and requirements.

[0565] ■ Method of Detecting AEs and SAEs

[0566] Care will be taken not to introduce bias when detecting AEs and / or SAEs. Open- ended and non-leading verbal questioning of the participant is the preferred method to inquire about AE occurrences.

[0567] ■ Follow-up of AEs and SAEs

[0568] Follow-up for AEs / SAEs is required until resolution or stabilization. If an ongoing SAE changes in its intensity or relationship to study treatment or if new information becomes available, the SAE report must be updated and submitted within 24 hours to the Sponsor using the same procedure used for transmitting the initial SAE report.

[0569] Any participant who discontinues from the study due to an AE will be followed up until the outcome is determined and written reports provided by the investigator.

[0570] ■ Reporting Requirements for SAEs

[0571] The study site team will monitor for and track SAEs whether related or not to the study procedures / interventions and / or to participation in the study. Such events will be reported to the Principal Investigator and reported to IRB per their requirements and pre- established written procedures.

[0572] The following events are considered reportable events and must be reported immediately, without undue delay, or no later than 24 hours of the site being notified of the event.

[0573] • All events that meet the above criteria for SAEs

[0574] • Participant or participant’ s partner pregnancy

[0575] Prompt notification from the Investigator to the Sponsor of SAEs within 24 hours of the site becoming aware of the event is essential so that legal obligations and ethical responsibilities towards the safety of participants and the safety of a product under clinical investigation are met.

[0576] An Investigator who receives an Investigator safety report describing SAEs or other specific safety information (e.g., summary or listing of SAEs) from the Sponsor will file it along with the Investigator’s Brochure and will notify the IRB / IEC, if appropriate according to local requirements. Atorney Docket No. 38709-0130W01

[0577] The Sponsor will report SAEs to regulatory authorities and ethics committees according to local applicable laws and requirements.

[0578] ■ Procedures for Handling Special Situations Pregnancy

[0579] Pregnancy in a study participant (or their partner, if relevant) must be reported to the Sponsor within 24 hours of the site becoming aware of the pregnancy. Participants who become pregnant during the study must be discontinued from the Study Drug.

[0580] While pregnancy itself is not considered an AE or SAE, any pregnancy complication, elective or spontaneous abortion, stillbirth or congenital anomaly is considered an SAE and must be reported to the Sponsor within 24 hours of the site becoming aware of the event.

[0581] A participant (or their partner, if relevant) who becomes pregnant while on study will be followed until the end of the pregnancy only if on blinded treatment, or if they have been unblinded and have received active drug. The infant will be followed for 1 year after birth, provided informed consent is obtained. A separate ICF will be provided to explain these follow-up activities.

[0582] Any post-study pregnancy related SAE considered reasonably related to the study treatment by the Investigator will be reported to the Sponsor. While the Investigator is not obligated to actively seek this information in former participants, he or she may learn of an SAE through spontaneous reporting.

[0583] Overdose

[0584] An overdose is any dose of study treatment administered to a participant that exceeds the dose assigned to the participant according to the protocol.

[0585] Overdoses are not considered AEs and should not be recorded as an AE on the CRF; however, all overdoses must be reported to the Sponsor via email within 24 hours of the site becoming aware of the overdose. If an overdose results in an AE, the AE must be recorded. If an overdose results in an SAE, the Sponsor must be notified of the overdose via email and the SAE form must be completed and emailed to Sponsor. All study treatment-related dosing information must be recorded on the dosing CRF.

[0586] Death

[0587] Death is an outcome of an event. The event that resulted in death should be recorded on the appropriate CRF. All causes of death must be reported as SAEs within 24 hours of the site becoming aware of the event. The Investigator should make every effort to obtain and send death certificates and autopsy reports to the Sponsor. The term death should be reported as an SAE only if the cause of death is not known and cannot be determined. Atorney Docket No. 38709-0130W01

[0588] Disease Progression

[0589] Complications of progressive disease will be recorded as AEs (e.g. dysphagia or fall).

[0590] Elective Surgery

[0591] Elective surgery for placement of feeding tube or other planned procedures will be recorded but not considered as AEs. However, complications related to these procedures will be considered AEs.

[0592] ■ Collection of Samples

[0593] Instructions for the collection and handling of biological samples will be provided in the Laboratory Manual. Blood samples will be taken either by direct venipuncture or an indwelling cannula inserted in a forearm vein. The actual date and time (24-hour clock time) of each sample will be recorded. The time and date of last study treatment administration and the participant’s most recent ingestion of food will also be recorded in the eCRF. If possible, it is recommended to draw PK samples at similar timepoints between Study Visits.

[0594] STATISTICAL CONSIDERATIONS o Sample Size Determination

[0595] No formal hypotheses testing will be conducted in this study. The sample size is selected to ensure that the safety tolerability, pharmacokinetics and pharmacodynamics will be adequately assessed at each dose level while minimizing unnecessary participant exposure. o Analysis Sets

[0596] In general, all statistical analyses (besides PK) will focus on All Treated Participants, defined as all participants who receive at least 1 dose of Study Drug.

[0597] Analyses will be broken down by dose level. All participants receiving placebo will be pooled for analysis (i.e. considered as a single control group).

[0598] PK analyses will focus on the PK Analysis Set, defined as All Treated Participants who have at least 1 quantifiable Compound A concentration collected post-dose without important protocol deviations / violations or events thought to significantly affect the PK.

[0599] Demographics and baseline characteristics will be summarized, as will disposition events. o Statistical Analyses

[0600] Full details for the analysis of all primary, secondary, and tertiary endpoints will be described in a SAP which will be developed and finalized before database lock.

[0601] Any deviations from or additions to the original analysis plan described in this protocol will be documented in the SAP and clinical study report (CSR). Atorney Docket No. 38709-0130W01

[0602] The primary analysis will be conducted when all treated participants have completed or withdrawn from the study.

[0603] No hypothesis testing or formal inferential procedures are specified for this study; all summaries will be descriptive in nature.

[0604] Unless otherwise specified, “baseline” will be defined as the last measurement of a variable taken prior to the first dose of Study Drug.

[0605] ■ Primary Endpoint Analysis

[0606] Primary endpoints include: the incidence of AEs, SAEs, and DLTs, and the incidence of abnormalities in clinical laboratory assessments, vital signs, physical and neurological examinations, and ECGs.

[0607] AEs, SAEs, and DLTs will be summarized for all treated participants. AEs will be considered “treatment-emergent” if they begin or worsen on or after the first dose of Study Drug. MedDRA will be used for the coding of AEs by system organ class and preferred term. Relatedness to Study Drug will be assessed by the investigator.

[0608] Summary tables describing the number and percentage of participants with various types of AEs will be provided.

[0609] Abnormal results from lab tests, physical or neurological exams, vital signs, and ECGs will be reported as AEs.

[0610] Results from laboratory tests (see Section “Safety Laboratory Assessments”) and their change from baseline will be summarized by visit using the following descriptive statistics: mean, median, standard deviation, minimum and maximum. Summaries of clinically significant abnormalities will also be provided.

[0611] ■ Secondary Endpoint Analysis

[0612] The secondary endpoints are PK concentrations, including plasma and CSF levels of Compound A.

[0613] PK analyses will focus on the PK Analysis Set.

[0614] Individual PK concentrations for plasma and CSF and PK parameters for plasma will be listed. The PK data will be summarized descriptively by using appropriate statistics (e.g., n, arithmetic mean, standard deviation, minimum, median, maximum, geometric mean, and CV%). Graphical presentations will include by-participant and mean concentrations (±standard error) plots which will be presented on linear and semi-logarithmic scales.

[0615] ■ Tertiary Endpoint Analysis

[0616] Tertiary endpoints include change from baseline for the following assessments:

[0617] ■ CSF calpain-2 levels; Atorney Docket No. 38709-0130W01

[0618] ■ CSF and plasma NfL;

[0619] ■ CSF pharmacodynamic measures of ALS;

[0620] ■ Plasma pharmacodynamic measures of ALS;

[0621] ■ ALSFRS-R;

[0622] ■ SVC.

[0623] For the tertiary endpoints, change from baseline summaries will be provided by visit, with descriptive statistics including the mean, median, standard deviation, minimum, and maximum. o Interim Analyses

[0624] Unblinded data analyses may be provided to support DEC assessments of each dose level, including planned dose escalation meetings and any ad-hoc safety review meetings. The results of these analyses will not be shared with study participants or investigators.

[0625] DEC meetings will include the review of safety and tolerability data, including any DLTs experienced by participants.

[0626] OTHER EMBODIMENTS

[0627] While the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

Atorney Docket No. 38709-0130W01WHAT IS CLAIMED IS:

1. A method of treating at least one symptom of amyotrophic lateral sclerosis (ALS) in a human subject in need thereof, the method comprising administering to the human subject by intrathecal administration a pharmaceutical composition in an amount sufficient to deliver a fixed dose of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide comprises ATCAGTTTCTGTAGGCTTCC (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 are 2’ -O-methoxy ethylribose modified nucleosides, wherein the intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5-methylcytosine.

2. A method of reducing the ALS disease progression rate of a human subject having one or more symptoms of ALS, the method comprising: administering to the human subject an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide comprises ATCAGTTTCTGTAGGCTTCC (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16- 20 are 2’ -O-methoxy ethylribose modified nucleosides, wherein the intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5-methylcytosine in a fixed dose of sufficient to thereby reduce the average ALSFRS-R points lost per month by the human subject as compared to a control subject not receiving the administration.

3. A method of reducing the deterioration of muscle strength, maintaining muscle strength, or improving muscle strength, in a human subject having one or more symptoms of ALS, the method comprising: administering to the human subject an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide comprises ATCAGTTTCTGTAGGCTTCC (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16- 20 are 2’ -O-methoxy ethylribose modified nucleosides, wherein the intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 areAtorney Docket No. 38709-0130W01 phosphorothioate linkages, and wherein each cytosine is a 5 -methylcytosine in a fixed dose of sufficient to thereby reduce the deterioration of muscle strength, maintain muscle strength, or improve muscle strength, in the human subject.

4. The method of claim 3, wherein the muscle strength is lower limb strength, upper limb strength, or grip strength.

5. The method of claim 3, wherein the muscle strength is that of the quadriceps, biceps, hamstrings, triceps, or anterior tibialis.

6. The method of claim 3, wherein, before, during, and / or after administration, the muscle strength is assessed by hand held dynamometry (HHD), hand grip strength dynamometry, manual muscle testing (MMT), electrical impedance myography (EIM), Maximum Voluntary Isometric Contraction Testing (MVICT), motor unit number estimation (MUNE), Accurate Test of Limb Isometric Strength (ATLIS), or a combination thereof.

7. The method of claim 6, wherein the muscle strength is assessed by ATLIS.

8. A method of reducing the deterioration of respiratory muscle function, maintaining respiratory muscle function, or improving respiratory muscle function in a human subject having one or more symptoms of ALS, the method comprising: administering to the human subject an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide comprises ATCAGTTTCTGTAGGCTTCC (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16- 20 are 2’ -O-methoxy ethylribose modified nucleosides, wherein the intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5-methylcytosine in a fixed dose of sufficient to thereby reduce the deterioration of respiratory muscle function, maintain respiratory muscle function, or improve respiratory muscle function in the human subject.

9. The method of claim 8, wherein, before, during, and / or after administration, the respiratory muscle function in the human subject is assessed by evaluation of the human subject’s vital capacity (VC), maximum mid-expiratory flow rate (MMERF), forced vitalAtorney Docket No. 38709-0130W01 capacity (FVC), slow vital capacity (SVC), forced expiratory volume in 1 second (FEVi), or a combination thereof.

10. The method of claim 8, wherein the respiratory muscle function in the human subject is assessed by evaluation of the human subject’s SVC.

11. A method of preventing or reducing at least one serious adverse event in a human subject having one or more symptoms of ALS, the method comprising: administering to the human subject an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide comprises ATCAGTTTCTGTAGGCTTCC (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16- 20 are 2’ -O-methoxy ethylribose modified nucleosides, wherein the intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5-methylcytosine in a fixed dose of sufficient to thereby prevent or reduce at least one serious adverse event in the human subject.

12. The method of claim 11, wherein the at least one serious adverse event is a respiratory adverse event, a fall, or a laceration injury.

13. A method of reducing the deterioration of fine motor skill, maintaining fine motor skill, or improving fine motor skill in a human subject having one or more symptoms of ALS, the method comprising: administering to the human subject an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide comprises ATCAGTTTCTGTAGGCTTCC (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16- 20 are 2’ -O-methoxy ethylribose modified nucleosides, wherein the intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5-methylcytosine in a fixed dose of sufficient to thereby reduce the deterioration of fine motor skill, maintain fine motor skill, or improve fine motor skill in the human subject.Atorney Docket No. 38709-0130W0114. The method of claim 13, wherein the fine motor skill is assessed using ALSFRS- R.

15. A method of slowing ALS disease progression in a human subject having one or more symptoms of ALS, the method comprising: administering to the human subject an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide comprises ATCAGTTTCTGTAGGCTTCC (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16- 20 are 2’ -O-methoxy ethylribose modified nucleosides, wherein the intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5-methylcytosine in a fixed dose of sufficient to thereby slow ALS disease progression in the human subject.

16. A method of increasing survival time of a human subject having one or more symptoms of ALS, the method comprising: administering to the human subject an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide comprises ATCAGTTTCTGTAGGCTTCC (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16- 20 are 2’ -O-methoxy ethylribose modified nucleosides, wherein the intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5-methylcytosine in a fixed dose of sufficient to thereby increase survival time of the human subject.

17. The method of any one of claims 1 to 16, wherein the human subject has been diagnosed with ALS for about 24 months or less or has shown one or more symptoms of ALS for about 24 months or less.

18. The method of any one of claims 1 to 17, wherein the human subject has been diagnosed with definite or clinically probable ALS based on the revised EL Escorial criteria.

19. A method comprising:Atorney Docket No. 38709-0130W01 administering to a human subject at risk for developing ALS an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide comprises ATCAGTTTCTGTAGGCTTCC (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16- 20 are 2’ -O-methoxy ethylribose modified nucleosides, wherein the intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5 -methylcytosine in a fixed dose of sufficient to thereby prevent or delay the onset of ALS.

20. The method of claim 19, wherein the human subject is determined to be at risk for developing ALS by evaluating the level of a biomarker in a biological sample obtained from the human subject.

21. The method of claim 20, wherein the biomarker is calpain-2, phosphorylated neurofilament heavy chain (pNF-H), neurofilament light chain (NfL), spectrin breakdown product 145 (SBDP-145), S100-P, cy statin C, chitotriosidase, p75ECD, ketones, or creatinine.

22. The method of claim 20, wherein the biological sample is cerebral spinal fluid (CSF), urine, or blood.

23. The method of claim 20, wherein the human subject is determined to be at risk for developing ALS by identifying a mutation in one or more genes selected from the group consisting of: SOL) / , C9ORF72, ANG, TARDBP, VCP, VAPB, SQSIM1, DCTN1, FUS, UNC13A, ATXN2, HNRNPA1, CHCHDIO, MOBP, C21ORF2, NEK1, TUBA4A, TBK1, MATR3, PFN1, UBQLN2, TAF15, OP' / N' , ID P-43, and CHI3L1.Atorney Docket No. 38709-0130W0124. The method of any one of claims 1 to 23, wherein the antisense oligonucleotide has the following structure:or a pharmaceutically acceptable salt thereof.Atorney Docket No. 38709-0130W0125. The method of any one of claims 1 to 24, wherein the antisense oligonucleotide has the following structure:

26. The method of any one of claims 1 to 25, wherein the fixed dose is between about 5 mg to about 125 mg of the antisense oligonucleotide.

27. The method of claim 26, wherein the fixed dose is about 6.25 mg, 12.5 mg, about 25 mg, about 50 mg, about 100 mg, or about 120 mg of the antisense oligonucleotide.

28. The method of claim 27, wherein the fixed dose is about 12.5 mg of the antisense oligonucleotide.

29. The method of claim 27, wherein the fixed dose is about 25 mg of the antisense oligonucleotide.

30. The method of claim 27, wherein the fixed dose is about 50 mg of the antisense oligonucleotide.Atorney Docket No. 38709-0130W0131. The method of claim 27, wherein the fixed dose is about 100 mg of the antisense oligonucleotide.

32. The method of claim 27, wherein the fixed dose does not exceed 100 mg of the antisense oligonucleotide.

33. The method of any one of claims 1 to 32, wherein the human subject has been on a stable regimen of riluzole and / or edaravone for at least 30 days prior to administration of the antisense oligonucleotide.

34. The method of any one of claims 1 to 33, wherein administration of antisense oligonucleotide results in a reduction of CAPN2 mRNA levels in the human subject’s cerebral spinal fluid (CSF), plasma, serum, brain (e.g., the motor cortex), and / or spinal cord.

35. The method of claim 34, wherein the reduction is about 10%, about 15%, about 20%, about 25%, about 30%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% as compared to a baseline level of CAPN2 mRNA (i.e., a level before administration of the antisense oligonucleotide).

36. The method of any one of claims 1 to 35, wherein administration of antisense oligonucleotide results in a reduction of calpain-2 polypeptide levels in the human subject’s CSF, plasma, serum, brain (e.g., motor cortex), and / or spinal cord.

37. The method of claim 36, wherein the reduction is about 10%, about 15%, about 20%, about 25%, about 30%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% as compared to a baseline calpain-2 polypeptide level (i.e., a level before administration of the antisense oligonucleotide).

38. The method of any one of claims 1 to 37, wherein administration of antisense oligonucleotide results in a reduction of NfL polypeptide levels in the human subject’s CSF, plasma, serum, brain (e.g., motor cortex), and / or spinal cord.Atorney Docket No. 38709-0130W0139. The method of claim 38, wherein the reduction is about 10%, about 15%, about 20%, about 25%, about 30%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% as compared to a baseline NfL polypeptide level (i.e., a level before administration of the antisense oligonucleotide).

40. The method of any one of claims 1 to 39, wherein administration of antisense oligonucleotide results in a reduction of SBDP-145 polypeptide levels in the human subject’s CSF, plasma, serum, brain (e.g., motor cortex), and / or spinal cord.

41. The method of claim 40, wherein the reduction is about 10%, about 15%, about 20%, about 25%, about 30%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% as compared to a baseline SBDP-145 polypeptide level (i.e., a level before administration of the antisense oligonucleotide).

42. The method of any one of claims 1 to 41, wherein the human subject is administered repeat doses of the fixed dose of the antisense oligonucleotide about every 28 days (or about every 4 weeks).

43. The method of any one of claims 1 to 42, wherein the human subject is administered repeat doses of the fixed dose of the antisense oligonucleotide no less than 25 days apart.

Citation Information

Patent Citations

  • Use of AKT phosphorylation as a biomarker for prognosing neurodegenerative diseases and treating same

    WO2012160563A2

  • Oligonucleotide compositions and methods thereof

    WO2023220087A1