Formulations containing antisense oligonucleotides targeting calpain-2
Stable antisense oligonucleotide formulations with controlled impurities and electrolytes ensure effective and safe intrathecal delivery of calpain-2 targeting oligonucleotides, addressing formulation instability in existing technologies.
Patent Information
- Application Number
- PCT/US2025/041268
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-08-09
- Filing Date
- 2025-08-08
- Publication Date
- 2026-02-12
AI Technical Summary
Existing formulations of antisense oligonucleotides targeting calpain-2 do not adequately control impurity levels and stability, particularly for intrathecal administration, which is crucial for therapeutic applications.
Formulations comprising antisense oligonucleotides with specific nucleobase sequences and internucleoside linkages, along with precise concentrations of electrolytes and buffering agents, are developed to maintain stability and reduce impurities, ensuring consistent efficacy over extended storage periods.
The formulations achieve stable and effective antisense oligonucleotide concentrations with controlled impurity levels, maintaining therapeutic potency and safety for intrathecal use over 1 to 48 months, even under varying storage conditions.
Smart Images

Figure IMGF000005_0001 
Figure IMGF000006_0001 
Figure IMGF000017_0001
Abstract
Description
[0001] Attorney Docket No.38709-0131WO1 FORMULATIONS CONTAINING ANTISENSE OLIGONUCLEOTIDES TARGETING CALPAIN-2 CROSS-REFERENCE TO RELATED APPLICATIONS The present application claims priority to U.S. Provisional Application No. 63 / 681,429, filed on August 9, 2024, the contents of which are herein incorporated by reference in its entirety. SEQUENCE LISTING This application contains a Sequence Listing that has been submitted electronically as an XML file named 38709-0131WO1_SL_ST26.xml. The XML file, created on August 6, 2025, is 1,936 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety. TECHNICAL FIELD The present disclosure relates to pharmaceutical compositions and formulations comprising antisense oligonucleotides, or salts thereof, that reduce expression of the CAPN2 gene, which encodes calpain-2. BACKGROUND Oligonucleotides are useful in various applications, e.g., therapeutic, diagnostic, and / or research applications. For example, oligonucleotides targeting various genes can be useful for treatment of conditions, disorders or diseases related to such target genes. Formulations comprising these oligonucleotides are therefore necessary. SUMMARY The present disclosure relates to compositions comprising antisense oligonucleotides that reduce expression of the CAPN2 gene, which encodes calpain-2, and formulations (e.g., pharmaceutical formulations) comprising those compositions. The present disclosure also relates to pharmaceutical formulations comprising antisense oligonucleotides targeting CAPN2 expression (referred to herein as “Compound A”), with levels of particular impurities specified by their HPLC relative retention time (RRT, relative to Compound A), a dosage form thereof, and methods for detecting one Attorney Docket No.38709-0131WO1 or more impurities within the above-described pharmaceutical composition and / or dosage form. In some embodiments, provided herein are formulations comprising: an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide comprises ATCAGTTTCTGTAGGCTTCC (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 are 2’-O-methoxyethylribose modified nucleosides, wherein the internucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5-methylcytosine; and at least one of a pharmaceutically acceptable carrier or diluent comprising physiological levels of one or more electrolytes, one or more buffering agents, and / or one or more solvents suitable for intrathecal injection. In some instances, the one or more electrolytes comprise: sodium chloride, potassium chloride, calcium chloride dihydrate, and / or magnesium chloride hexahydrate. In some instances, the one or more buffering agents comprise di-sodium phosphate and / or monosodium phosphate. In some instances, the solvent comprises water. In some instances, the formulation further comprises one or more pH adjusting buffers. In some instances, the pH adjusting buffers comprise hydrochloric acid and / or sodium hydroxide. In some instances, the concentration of the antisense oligonucleotide is about 5 mg / ml to about 30 mg / ml. In some instances, the concentration is about 10 mg / ml to about 25 mg / ml. In some instances, the concentration is about 20 mg / ml. In some instances, the formulation comprises the following: (a) 5 mg / ml to 30 mg / ml of the antisense oligonucleotide, (b) 5 mg / ml to about 15 mg / ml of sodium chloride, (c) 0.1 mg / ml to about 1 mg / ml of potassium chloride, (d) 0.1 mg / ml to about 1 mg / ml of calcium chloride dihydrate, (e) 0.1 mg / ml to about 1 mg / ml of magnesium chloride hexahydrate, (f) 0.05 mg / ml to about 1 mg / ml of di-sodium phosphate, (g) 0.01 mg / ml to about 0.1 mg / ml of monosodium phosphate, (h) sodium hydroxide, as needed for buffering, (i) hydrochloric acid, as needed for buffering, and (j) Quantum satis amount of water. Attorney Docket No.38709-0131WO1 In some instances, the formulation comprises the following: (a) 20 mg / ml of the antisense oligonucleotide, (b) 8.77 mg / ml of sodium chloride, (c) 0.22 mg / ml of potassium chloride, (d) 0.21 mg / ml of calcium chloride dihydrate, (e) 0.16 mg / ml of magnesium chloride hexahydrate, (f) 0.11 mg / ml of di-sodium phosphate, (g) 0.03 mg / ml of monosodium phosphate, (h) sodium hydroxide, as needed for buffering, (i) hydrochloric acid, as needed for buffering, and Quantum satis amount of water.
[0002] Attorney Docket No.38709-0131WO1 In some embodiments, the antisense oligonucleotide has the following structure: , or a pharmaceutically acceptable salt thereof. In some instances, the antisense oligonucleotide is the sodiated form (sodiated salt form). Attorney Docket No.38709-0131WO1 In some embodiments, the antisense oligonucleotide has the following structure: . In some embodiments, of any of the above-described embodiments, the formulation comprises one or more impurities relative to the antisense oligonucleotide. In some embodiments, of any of the above-described embodiments, the formulation comprises not more than about 15% (e.g., not more than about 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, or 15%) impurities. In some Attorney Docket No.38709-0131WO1 embodiments, of any of the above-described embodiments, the formulation comprises not more than about 11% (e.g., 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, or 11%) impurities having an RRT of < 1.00. In some embodiments, of any of the above- described embodiments, the formulation comprises not more than about 4% (e.g., not more than about 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, or 4%) impurities having an RRT of > 1.00. In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 0.17% (e.g., 0.15%, 0.16%, or 0.17%) of an impurity having a relative retention time (RRT) of about 0.240 to about 0.250 (e.g., about 0.244, about 0.245, about 0.246, about 0.247, about 0.248, about 0.249, or about 0.250). In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 0.30% (e.g., 0.21%, 0.23%, 0.24%, 0.25%, 0.26%, 0.27%, 0.28%, 0.29%, or 0.30%) of an impurity having an RRT of about 0.310 to about 0.320 (e.g., about 0.310, about 0.311, about 0.312, about 0.313, about 0.314, about 0.315, about 0.316, about 0.317, about 0.318, about 0.319, or about 0.320). In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 0.23% (e.g., 0.21%, 0.22%, or 0.23%) of an impurity having an RRT of about 0.345 to about 0.355 (e.g., about 0.349, about 0.350, about 0.351, about 0.352, about 0.353, about 0.354, or about 0.355). In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 0.13% (e.g., 0.11%, 0.12%, or 0.13%) of an impurity having an RRT of about 0.380 to about 0.390 (e.g., about 0.380, about 0.381, about 0.382, about 0.383, about 0.384, about 0.385, about 0.386, about 0.387, about 0.388, about 0.389, or about 0.390). In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 0.46% (e.g., 0.37%, 0.38%, 0.39%, 0.40%, 0.41%, 0.42%, 0.43%, 0.44%, 0.45%, or 0.46%) of an impurity having an RRT of about 0.425 to about 0.440 (e.g., about 0.425, about 0.426, about 0.427, about 0.428, about 0.429, about 0.430, about 0.431, about 0.432, about 0.433, about 0.434, about 0.435, about 0.436, about 0.437, about 0.438, about 0.439, or about 0.440). Attorney Docket No.38709-0131WO1 In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 0.23% (e.g., 0.17%, 0.18%, 0.19%, 0.20%, 0.21%, 0.22%, or 0.23%) of an impurity having an RRT of about 0.450 to about 0.465 (e.g., about 0.450, about 0.451, about 0.452, about 0.453, about 0.454, about 0.455, about 0.456, about 0.457, about 0.458, about 0.459, about 0.460, about 0.461, about 0.462, about 0.463, about 0.464, or about 0.465). In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 0.10% of an impurity having an RRT of about 0.475 to about 0.485 (e.g., about 0.475, about 0.476, about 0.477, about 0.478, about 0.479, about 0.480, about 0.481, about 0.482, about 0.483, about 0.484, or about 0.485). In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 0.74% (e.g., 0.60%, 0.61%, 0.62%, 0.63%, 0.64%, 0.65%, 0.66%, 0.67%, 0.68%, 0.69%, 0.70%, 0.71%, 0.72%, 0.73%, or 0.74%) of an impurity having an RRT of about 0.510 to about 0.525 (e.g., about 0.510, about 0.511, about 0.512, about 0.513, about 0.514, about 0.515, about 0.516, about 0.517, about 0.518, about 0.519, about 0.520, about 0.521, about 0.522, about 0.523, about 0.524, or about 0.525). In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 0.65% (e.g., 0.60%, 0.61%, 0.62%, 0.63%, 0.64%, or 0.65%) of an impurity having an RRT of about 0.510 to about 0.525 (e.g., about 0.510, about 0.511, about 0.512, about 0.513, about 0.514, about 0.515, about 0.516, about 0.517, about 0.518, about 0.519, about 0.520, about 0.521, about 0.522, about 0.523, about 0.524, or about 0.525). In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 0.59% (e.g., 0.55%, 0.56%, 0.57%, 0.58%, or 0.59%) of an impurity having an RRT of about 0.565 to about 0.580 (e.g., about 0.565, about 0.566, about 0.567, about 0.568, about 0.569, about 0.570, about 0.571, about 0.572, about 0.573, about 0.574, about 0.575, about 0.576, about 0.577, about 0.578, about 0.579, or about 0.580). In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 0.76% (e.g., 0.68%, 0.69%, 0.70%, 0.71%, 0.72%, 0.73%, 0.74%, 0.75%, or 0.76%) of an impurity having an RRT of about Attorney Docket No.38709-0131WO1 0.590 to about 0.605 (e.g., about 0.590, about 0.591, about 0.592, about 0.593, about 0.594, about 0.595, about 0.596, about 0.597, about 0.598, about 0.599, about 0.600, about 0.601, about 0.602, about 0.603, about 0.604, or about 0.605). In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 1.14% (e.g., 1.06%, 1.07%, 1.08%, 1.09%, 1.10%, 1.11%, 1.12%, 1.13%, 1.14%) of an impurity having an RRT of about 0.630 to about 0.645 (e.g., about 0.630, about 0.631, about 0.632, about 0.633, about 0.634, about 0.635, about 0.636, about 0.637, about 0.638, about 0.639, about 0.640, about 0.641, about 0.642, about 0.643, about 0.644, or about 0.645). In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 0.41% (e.g., 0.33%, 0.34%, 0.35%, 0.36%, 0.37%, 0.38%, 0.39%, 0.40%, or 0.41%) of an impurity having an RRT of about 0.670 to about 0.685 (e.g., about 0.670, about 0.671, about 0.672, about 0.673, about 0.674, about 0.675, about 0.676, about 0.677, about 0.678, about 0.679, about 0.680, about 0.681, about 0.681, about 0.683, about 0.684, or about 0.685). In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 0.88% (e.g., 0.83%, 0.84%, 0.85%, 0.86%, 0.87%, or 0.88%) of an impurity having an RRT of about 0.740 to about 0.755 (e.g., about 0.740, about 0.741, about 0.742, about 0.743, about 0.744, about 0.745, about 0.746, about 0.747, about 0.748, about 0.749, about 0.750, about 0.751, about 0.752, about 0.753, about 0.754, or about 0.755). In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 0.53% (e.g., 0.51%, 0.52%, or 0.53%) of an impurity having an RRT of about 0.815 to about 0.825 (e.g., about 0.815, about 0.816, about 0.817, about 0.818, about 0.819, about 0.820, about 0.821, about 0.822, about 0.823, about 0.824, or about 0.825). In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 0.58% (e.g., 0.55%, 0.56%, 0.57%, or 0.58%) of an impurity having an RRT of about 0.920 to about 0.930 (e.g., about 0.920, about 0.921, about 0.922, about 0.923, about 0.924, about 0.925, about 0.926, about 0.927, about 0.928, about 0.929, or about 0.930). In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 3.71% (e.g., 3.60%, 3.61%, 3.62%, 3.63%, Attorney Docket No.38709-0131WO1 3.64%, 3.65%, 3.66%, 3.67%, 3.68%, 3.69%, 3.70%, or 3.71%) of an impurity having an RRT of about 0.960 to about 0.965 (e.g., about 0.960, about 0.961, about 0.962, about 0.963, about 0.964, or about 0.965). In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 0.56% (e.g., 0.55% or 0.56%) of an impurity having an RRT of about 0.920 to about 0.930 (e.g., about 0.920, about 0.921, about 0.922, about 0.923, about 0.924, about 0.925, about 0.926, about 0.927, about 0.928 about 0.929, or about 0.930). In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 1.13% (e.g., 0.49%, 0.51%, 0.54%, 0.55%, 1.13%) of an impurity having an RRT of about 1.075 to about 1.085 (e.g., about 1.0795, about 1.076, about 1.077, about 1.078, about 1.079, about 1.080, about 1.081, about 1.082, about 1.083, about 1.084). In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 0.84% (e.g., 0.77%, 0.78%, 0.79%, about 0.80%, about 0.81%, 0.82%, 0.83%, or 0.84%) of an impurity having an RRT of about 1.125 to about 1.135 (e.g., about 1.125, about 1.126, about 1.127, about 1.128, about 1.129, about 1.130, about 1.131, about 1.132, about 1.133, about 1.134, or about 1.135). In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 0.28% (e.g., 0.21%, 0.22%, 0.23%, 0.24%, 0.25%, 0.26%, 0.27%, or 0.28%) of an impurity having an RRT of about 1.160 to about 1.175 (e.g., about 1.160, about 1.161, about 1.162, about 1.163, about 1.164, about 1.165, about 1.166, about 1.167, about 1.168, about 1.169, about 1.170, about 1.172, about 1.172, about 1.173, about 1.174, or about 1.175). In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 0.17% (e.g., 0.13%, 0.14%, 0.15%, 0.16%, or 0.17%) of an impurity having an RRT of about 1.205 to about 1.260 (e.g., about 1.206, about 1.208, about 1.210, about 1.214, about 1.215, about 1.256). In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 0.11% of an impurity having an RRT of about 1.275 to about 1.280 (e.g., about 1.275, about 1.276, about 1.277, about 1.278, about 1.279, or about 1.280). Attorney Docket No.38709-0131WO1 In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 0.17% (e.g., 0.13%, 0.14%, 0.15%, 0.16%, or 0.17%) of an impurity having an RRT of about 1.305 to about 1.325 (e.g., about 1.305, about 1.306, about 1.307, about 1.308, about 1.309, about 1.310, about 1.311, about 1.312, about 1.313, about 1.314, about 1.315, about 1.316, about 1.317, about 1.318, about 1.319, about 1.320, about 1.321, about 1.322, about 1.323, about 1.324, or about 1.325). In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 0.17% (e.g., 0.11%, 0.12%, 0.13%, 0.14%, 0.15%, 0.16%, or 0.17%) of an impurity having an RRT of about 1.355 to about 1.380 (e.g., about 1.355, about 1.356, about 1.357, about 1.358, about 1.359, about 1.360, about 1.361, about 1.362, about 1.363, about 1.364, about 1.365, about 1.366, about 1.367, about 1.368, about 1.369, about 1.370, about 1.371, about 1.372, about 1.373, about 1.374, about 1.375, about 1.376, about 1.377, about 1.378, about 1.379, or about 1.380). In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 0.14% (e.g., 0.10%, 0.12%, 0.13%, or 0.14%) of an impurity having an RRT of about 1.560 to about 1.570 (e.g., about 1.560, about 1.561, about 1.562, about 1.563, about 1.564, about 1.565, about 1.566, about 1.567, about 1.568, about 1.569, or about 1.570). In some embodiments, of any of the above-described embodiments, the formulation comprises not more than 0.14% (e.g., 0.10%, 0.11%, 0.12%, 0.13%, or 0.14%) of an impurity having an RRT of about 1.610 to about 1.640 (e.g., about 1.610, about 1.611, about 1.612, about 1.613, about 1.614, about 1.615, about 1.616, about 1.617, about 1.618, about 1.619, about 1.620, about 1.621, about 1.622, about 1.623, about 1.624, about 1.625, about 1.626, about 1.627, about 1.628, about 1.629, about 1.630, about 1.631, about 1.632, about 1.633, about 1.634, about 1.635, about 1.636, about 1.637, about 1.638, about 1.639, or about 1.640). In some embodiments, the amount of each impurity is determined after about 1 month to about 48 months (or any increment in between) of storage at about 5°C. In some embodiments, the amount of each impurity is determined after about 1 month to about 48 months (or any increment in between) of storage at about 25°C and about 60% relative humidity. In some embodiments, the amount of each impurity is Attorney Docket No.38709-0131WO1 determined after about 1 month to about 48 months (or any increment in between) of storage at about 40°C and about 75% relative humidity. In some embodiments, of any of the above-described embodiments, the formulation is formulated as a solution for intrathecal administration. In some embodiments, of any of the above-described embodiments, the concentration of the antisense oligonucleotide in the formulation is substantially the same concentration as the initial concentration after about 1 month to about 48 months (or any increment in between) of storage at about 5°C. In some embodiments, of any of the above-described embodiments, the concentration of the antisense oligonucleotide in the formulation is substantially the same concentration as the initial concentration after about 1 month to about 48 months (or any increment in between) of storage at about 25°C and about 60% relative humidity. In some embodiments, of any of the above-described embodiments, the concentration of the antisense oligonucleotide in the formulation is substantially the same concentration as the initial concentration after about 1 month to about 48 months (or any increment in between) of storage at about 40°C and about 75% relative humidity. In some embodiments, of any of the above-described embodiments, the formulation is considered stable if the formulation comprises one or more of the following properties: (a) the appearance is clear to opalescent, colorless to yellow liquid, and is practically free of visible particles, (b) the retention time of Compound A in the formulation comprising Compound A is consistent with the retention time of reference standard comprising Compound A (which is a standard that was generated with one of the first lots of Compound A made), (c) the concentration of Compound A remains about 18 mg / ml to about 22.0 mg / ml, (d) the amount of sub-visible particulate matter that has a size of > 10 μm remains ≤ 6000 particles per vial, (e) the amount of sub-visible particulate matter that has a size of > 25 μm remains ≤ 600 particles per vial, (f) the amount of endotoxin remains ≤ 0.5 EU / mL, (g) the formulation remains sterile and uncontaminated, (h) the pH remains between about 6.8 to about 7.6, and / or (i) the osmolality remains about 294 to about 360 mOsm / kg. In some instances, any one of the properties is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 Attorney Docket No.38709-0131WO1 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 5+3°C. In some instances, any one of the properties is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 25+2°C and about 60+5% relative humidity. In some instances, any one of the properties is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 40+2°C and about 75+5% relative humidity. In some instances, any one of the properties is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 40°C to about 60°C and about 60% to 75% relative humidity. Unless otherwise defined, all terms of art, notations, and other scientific terms or terminology used herein are intended to have the meanings commonly understood by those of skill in the art to which this application pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art. Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or Attorney Docket No.38709-0131WO1 intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure. Certain ranges are presented herein with numerical values being preceded by the term “about.” The term “about” is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating unrecited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number. It is appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the disclosure, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to the disclosure are specifically embraced by the present disclosure and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub-combinations of the various embodiments and elements thereof are also specifically embraced by the present disclosure and are disclosed herein just as if each and every such sub- combination was individually and explicitly disclosed herein. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. DETAILED DESCRIPTION Provided herein are compositions comprising antisense oligonucleotides that reduce expression of the CAPN2 gene, which encodes calpain-2, and formulations Attorney Docket No.38709-0131WO1 (e.g., pharmaceutical formulations) comprising those compositions. Antisense oligonucleotides targeting CAPN2 mRNA have been previously described in WO 2023 / 220087, which is incorporated herein by reference in its entirety. Calpain-2 (encoded by the CAPN2 gene) In some embodiments, CAPN2 and calpain-2 refer to a gene and a gene product thereof, respectively. CAPN2 and calpain-2 are used to refer to a nucleic acid sequence (e.g., a CAPN2 DNA sequence or a CAPN2 RNA sequence, a transcript (e.g., a CAPN2 mRNA), or a protein encoded by CAPN2 (e.g., a calpain-2 polypeptide from a species, which may be known as CAPN2, CANP2, CANPL2, mCANP, CANPml, calpain-2, calpain 2, m-calpain, millimolar-calpain, calpain M- type, calpain-2 large subunit, calpain 2 (m / ll) large subunit, calpain large polypeptide L2, calpain-2 catalytic subunit, calcium-activated neural proteinase 2, or CANP 2). Various CAPN2 sequences including variants thereof are readily available to those of skill in the art. Various technologies, e.g., assays, cells, animal models, etc., have also been reported and can be utilized for characterization and / or assessment of provided technologies (e.g., oligonucleotides, compositions, methods, etc.) in accordance with the present disclosure. The CAPN2 gene is reported to encode a calpain-2 protein, which according to various reports comprises 622 or 700 amino acids, depending on isoform, and primarily localizes to cellular cytoplasm and cellular plasma membrane in a variety of tissues including those of a central nervous system (CNS). It has been reported that in some embodiments human calpain-2 comprises multiple domains including, from N- terminal region to C-terminal region: (i) an alpha helix; (ii) a CysPc domain comprising a first protease core domain (PC1) and a second protease core domain (PC2); (iii) a calpain-type beta-sandwich (CBSW) domain; and (iv) a penta-EF-hand in the catalytic large subunit (PEF(L)) domain. Calpain-2 proteins from other species e.g., monkeys, rats, and mice, have been reported to comprise various conserved domains as human calpain-2. Calpain-2 belongs to a family of calcium-dependent proteases, and has been reported to cleave a multitude of protein targets including, e.g., actin, cytoplasmic polyadenylation element-binding protein 3 (CPEB3), p35, phosphatase and tensin homolog deleted on chromosome 10 (PTEN), protein tyrosine phosphatase (PTPN13; Attorney Docket No.38709-0131WO1 also known as Fas-associated protein-1 (FAP1)), spectrin, TDP-43, neurofilament- light chain (Wang et al., Expert Opin. Ther. Targets, 2018; Baudry, Curr. Neuropharmacol., 2019), etc. Activation of calpain-2 has been reported to involve relatively high concentrations of calcium ion (Ca2+), with reported ranges comprising near-millimolar amounts, e.g., 400-800 µM. In addition, some studies have suggested that calpain-2 may be capable of being activated by phosphorylation by epidermal growth factor (EGF) or brain-derived neurotrophic factor (BDNF) via extracellular signal-regulated kinase (ERK) (Glading et al., Mol. Cell Biol., 2004; Zadran et al., J. Neurosci., 2010). Calpain-2 has been reported as a regulator of synaptic plasticity and possibly limiting such plasticity (Baudry and Bi, Trends Neurosci., 2017) and has been reported to be involved in excitotoxicity as inhibition of calpain-2 has reduced such toxicity (Wang et al., J. Neurosci., 2013). Dysregulation of calpain-2 has been reported to be associated with various forms of neurodegeneration, such as amyotrophic lateral sclerosis (ALS). As such, calpain-2 may be a potential therapeutic target for treatment of ALS. The NCBI Gene ID for CAPN2 is 824 (www.ncbi.nlm.nih.gov / gene / 824). Compound A Compound A is a 5-10-5 MOE gapmer, having the sequence of (from 5’ to 3’) ATCAGTTTCTGTAGGCTTCC (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 are 2’-O-methoxyethylribose modified nucleosides, wherein the internucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5-methylcytosine. In some instances, Compound A is described by the following chemical notation: / 52MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / *T*T*T* / iMe- dC / *T*G*T*A*G*G* / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErC / ; wherein: Attorney Docket No.38709-0131WO1 Attorney Docket No.38709-0131WO1 Attorney Docket No.38709-0131WO1
[0003] Attorney Docket No.38709-0131WO1 In some embodiments, Compound A is depicted by the following chemical structure: . Attorney Docket No.38709-0131WO1 In some embodiments, Compound A is a pharmaceutically acceptable salt, and in certain embodiments, it is the sodiated form. In some embodiments, the sodiated form of Compound A is depicted by the following chemical structure: . Conjugated Antisense Oligonucleotides Antisense oligonucleotides of this disclosure may be covalently linked to one or more moieties or conjugates. Various additional chemical moieties, e.g., targeting moieties, carbohydrate moieties, lipid moieties, etc. are known in the art and can be Attorney Docket No.38709-0131WO1 utilized in accordance with the present disclosure to modulate properties and / or activities of oligonucleotides, e.g., stability, half life, activities, delivery, pharmacodynamics properties, pharmacokinetic properties, etc. In some embodiments, certain additional chemical moieties facilitate delivery of oligonucleotides to desired cells, tissues and / or organs, including but not limited the cells of the central nervous system. In some embodiments, certain additional chemical moieties facilitate internalization of oligonucleotides. In some embodiments, certain additional chemical moieties increase oligonucleotide stability. In some embodiments, the present disclosure provides technologies for incorporating various additional chemical moieties into oligonucleotides. In some embodiments, additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Antisense oligonucleotides can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense oligonucleotides to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense oligonucleotide having terminal nucleic acid from exonuclease degradation, and can help in delivery and / or localization within a cell. The cap can be present at the 5’-terminus (5’-cap), or at the 3’-terminus (3’-cap), or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3’ and 5’stabilizing groups that can be used to cap one or both ends of an antisense oligonucleotide to impart nuclease stability are known in the art. Artificial CSF (aCSF) Also described herein are artificial cerebrospinal fluid formulations (i.e., aCSF formulations). In certain embodiments, the aCSF can include one or more of the following ingredients: physiological levels of one or more electrolytes (e.g., sodium, potassium, calcium, magnesium, chlorine, phosphorous, or bicarbonate), one or more buffering agents (e.g., to help improve stability of the formulation), and / or one or more solvents suitable for intrathecal injection (e.g., water). In some embodiments, the aCSF can include a sugar (e.g., glucose). In some embodiments, the aCSF does not include a sugar (e.g., glucose). In some instances, the aCSF can also include one Attorney Docket No.38709-0131WO1 or more pH adjusting buffers (e.g., pharmaceutically acceptable acids, bases or buffers in order to maintain a pH of 6.8 to 7.7 (e.g., a pH of 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, or 7.7)). In some embodiments, the formulations described herein have a pH of about 7.1 to about 7.3. In some embodiments, the formulations described herein have a pH of 7.2. In some embodiments, the aCSF can include one or more of the following electrolytes: sodium chloride, potassium chloride, calcium chloride dihydrate, and / or magnesium chloride hexahydrate. In some embodiments, sodium chloride can be included in the aCSF in an amount of about 5 mg / ml to about 15 mg / ml (e.g., about 5 mg / ml, about 6 mg / ml, about 7 mg / ml, about 8 mg / ml, about 9 mg / ml, about 10 mg / ml, about 11 mg / ml, about 12 mg / ml, about 13 mg / ml, about 14 mg / ml, about 15 mg / ml, or any increment in between). In some embodiments, potassium chloride can be included in the aCSF in an amount of about 0.1 mg / ml to about 1 mg / ml (e.g., about 0.1 mg / ml, about 0.2 mg / ml, about 0.3 mg / ml, about 0.4 mg / ml, about 0.5 mg / ml, about 0.6 mg / ml, about 0.7 mg / ml, about 0.8 mg / ml, about 0.9 mg / ml, about 1.0 mg / ml, or any increment in between). In some embodiments, calcium chloride dihydrate can be included in the aCSF in an amount of about 0.1 mg / ml to about 1 mg / ml (e.g., about 0.1 mg / ml, about 0.2 mg / ml, about 0.3 mg / ml, about 0.4 mg / ml, about 0.5 mg / ml, about 0.6 mg / ml, about 0.7 mg / ml, about 0.8 mg / ml, about 0.9 mg / ml, about 1.0 mg / ml, or any increment in between). In some embodiments, magnesium chloride hexahydrate can be included in the aCSF in an amount of about 0.1 mg / ml to about 1 mg / ml (e.g., about 0.1 mg / ml, about 0.2 mg / ml, about 0.3 mg / ml, about 0.4 mg / ml, about 0.5 mg / ml, about 0.6 mg / ml, about 0.7 mg / ml, about 0.8 mg / ml, about 0.9 mg / ml, about 1.0 mg / ml, or any increment in between). In some embodiments, the aCSF can include one or more of the following buffers: di-sodium phosphate and / or monosodium phosphate. In some embodiments, di-sodium phosphate can be included in the aCSF in an amount of about 0.05 mg / ml to about 1.0 mg / ml (e.g., about, 0.05, about 0.1 mg / ml, about 0.2 mg / ml, about 0.3 mg / ml, about 0.4 mg / ml, about 0.5 mg / ml, about 0.6 mg / ml, about 0.7 mg / ml, about 0.8 mg / ml, about 0.9 mg / ml, about 1.0 mg / ml, or any increment in between). In some embodiments, monosodium phosphate can be included in the aCSF in an amount of about 0.01 mg / ml to about 0.1 mg / ml (e.g., about 0.01 mg / ml, about 0.02 mg / ml, about 0.03 mg / ml, about 0.04 mg / ml, about 0.05 mg / ml, about 0.06 mg / ml, about 0.07 Attorney Docket No.38709-0131WO1 mg / ml, about 0.08 mg / ml, about 0.09 mg / ml, about 0.1 mg / ml, or any increment in between). In some embodiments, the aCSF can include one or more of the following pH adjusting buffers: hydrochloric acid and / or sodium hydroxide in any amount as needed to achieve a pH of 6.8 to 7.7 (e.g., a pH of 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, or 7.7). In some embodiments, the aCSF can include a solvent, such as water and in an amount as needed (Quantum satis). In some embodiments, 1.0 mL of aCSF can include the following components at the specified amounts in Table 1. Table 1: aCSF Components and Quantities. Formulations comprising Compound A In certain embodiments, the present invention provides pharmaceutical compositions comprising one or more antisense compound (e.g., Compound A, as described above). In certain embodiments, such pharmaceutical composition comprises a sterile saline solution and one or more antisense compound (e.g., Compound A, as described above). In certain embodiments, such pharmaceutical Attorney Docket No.38709-0131WO1 composition consists of a sterile saline solution and one or more antisense compound (e.g., Compound A, as described above). In certain embodiments, antisense compounds (e.g., Compound A, as described above) can be admixed with pharmaceutically acceptable active and / or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered. In certain embodiments antisense compounds can be utilized in pharmaceutical compositions by combining such oligomeric compounds (e.g., Compound A, as described above) with a suitable pharmaceutically acceptable diluent or carrier. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS). PBS is a diluent suitable for use in compositions to be delivered parenterally. Accordingly, in certain embodiments, employed in the methods described herein is a pharmaceutical composition comprising an antisense compound and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is PBS. In certain embodiments, the pharmaceutically acceptable diluent is aCSF. Pharmaceutical formulations comprising antisense compounds can encompass any pharmaceutically acceptable salts, esters, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising antisense compounds comprise one or more oligonucleotide (e.g., Compound A, as described above) which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. A prodrug can include the incorporation of additional nucleosides at one or both ends of an oligomeric compound which are cleaved by endogenous nucleases within the body, to form the active antisense oligomeric compound. Lipid-based vectors have been used in nucleic acid therapies in a variety of methods. For example, in one method, the nucleic acid is introduced into preformed Attorney Docket No.38709-0131WO1 liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In another method, DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. Certain preparations are described in Akinc et al., Nature Biotechnology 26, 561-569 (1 May 2008), which is herein incorporated by reference in its entirety. In certain embodiments, the pharmaceutically acceptable diluent is aCSF. In certain embodiments, aCSF is a commercially available (e.g., such as the one sold by Tocris Bioscience). In certain embodiments, the aCSF can be the one described above in the “Artificial CSF (aCSF)” section. In certain embodiments, the formulations comprising the antisense oligonucleotide in the aCSF solution comprises a specific concentration of the antisense oligonucleotide. In some embodiments, the formulation can comprise a concentration of Compound A of about 5 mg / ml to about 30 mg / ml (e.g., about 5 mg / ml, about 6 mg / ml, about 7 mg / ml, about 8 mg / ml, about 9 mg / ml, about 10 mg / ml, about 11 mg / ml, about 12 mg / ml, about 13 mg / ml, about 14 mg / ml, about 15 mg / ml, about 16 mg / ml, about 17 mg / ml, about 18 mg / ml, about 19 mg / ml, about 20mg / ml, about 21 mg / ml ̧about 22 mg / ml ̧about 23 mg / ml ̧about 24 mg / ml ̧about 25mg / ml ̧about 26 mg / ml, about 27 mg / ml, about 28 mg / ml ̧about 29 mg / ml ̧about 30mg / ml, or any increment in between). In some embodiments, the formulation comprising Compound A in an aCSF solution is administered to a subject at a specific dose. In some embodiments, the dose is about 10 mg to about 125 mg of Compound A (e.g., about 10 mg, about 10.5 mg, about 11 mg, about 11.5 mg, about 12 mg, about 12.5 mg, about 13 mg, about 13.5 mg, about 14 mg, about 14.5 mg, about 15 mg, about 15.5 mg, about 16 mg, about 16.5 mg, about 17 mg, about 18.5 mg, about 19 mg, about 19.5 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 100 mg, about 110 mg, about 105 mg, about 110 mg, about 115 mg, about 120 mg, about 125 mg, or any increment in between). In some embodiments, the formulation comprising a concentration of Compound A, as noted above, is provided in a vial of about 5 ml to about 20 ml aCSF (e.g., about 5 ml, about 6 ml, about 7 ml, about 8 ml, about 9 ml, about 10 ml, about Attorney Docket No.38709-0131WO1 11 ml, about 12 ml, about 13 ml, about 14 ml, about 15 ml, about 16 ml, about 17 ml, about 18 ml, about 19 ml, about 20 ml, or any increment in between of aCSF). In some embodiments, the formulation comprising a Compound A includes the following: 5 mg / ml to 30 mg / ml of the antisense oligonucleotide (e.g., about 5 mg / ml, about 6 mg / ml, about 7 mg / ml, about 8 mg / ml, about 9 mg / ml, about 10 mg / ml, about 11 mg / ml, about 12 mg / ml, about 13 mg / ml, about 14 mg / ml, about 15 mg / ml, about 16 mg / ml, about 17 mg / ml, about 18 mg / ml, about 19 mg / ml, about 20mg / ml, about 21 mg / ml ̧about 22 mg / ml ̧about 23 mg / ml ̧about 24 mg / ml ̧about 25mg / ml ̧about 26 mg / ml, about 27 mg / ml, about 28 mg / ml ̧about 29 mg / ml ̧about 30mg / ml, or any increment in between), 5 mg / ml to about 15 mg / ml of sodium chloride (e.g., about 5 mg / ml, about 6 mg / ml, about 7 mg / ml, about 8 mg / ml, about 9 mg / ml, about 10 mg / ml, about 11 mg / ml, about 12 mg / ml, about 13 mg / ml, about 14 mg / ml, about 15 mg / ml, or any increment in between), 0.1 mg / ml to about 1 mg / ml of potassium chloride (e.g., about 0.1 mg / ml, about 0.2 mg / ml, about 0.3 mg / ml, about 0.4 mg / ml, about 0.5 mg / ml, about 0.6 mg / ml, about 0.7 mg / ml, about 0.8 mg / ml, about 0.9 mg / ml, about 1.0 mg / ml, or any increment in between), 0.1 mg / ml to about 1 mg / ml of calcium chloride dihydrate (e.g., about 0.1 mg / ml, about 0.2 mg / ml, about 0.3 mg / ml, about 0.4 mg / ml, about 0.5 mg / ml, about 0.6 mg / ml, about 0.7 mg / ml, about 0.8 mg / ml, about 0.9 mg / ml, about 1.0 mg / ml, or any increment in between), 0.1 mg / ml to about 1 mg / ml of magnesium chloride hexahydrate (e.g., about 0.1 mg / ml, about 0.2 mg / ml, about 0.3 mg / ml, about 0.4 mg / ml, about 0.5 mg / ml, about 0.6 mg / ml, about 0.7 mg / ml, about 0.8 mg / ml, about 0.9 mg / ml, about 1.0 mg / ml, or any increment in between), 0.05 mg / ml to about 1 mg / ml of di-sodium phosphate (e.g., about, 0.05, about 0.1 mg / ml, about 0.2 mg / ml, about 0.3 mg / ml, about 0.4 mg / ml, about 0.5 mg / ml, about 0.6 mg / ml, about 0.7 mg / ml, about 0.8 mg / ml, about 0.9 mg / ml, about 1.0 mg / ml, or any increment in between), 0.01 mg / ml to about 0.1 mg / ml of monosodium phosphate (e.g., about 0.01 mg / ml, about 0.02 mg / ml, about 0.03 mg / ml, about 0.04 mg / ml, about 0.05 mg / ml, about 0.06 mg / ml, about 0.07 mg / ml, about 0.08 mg / ml, about 0.09 mg / ml, about 0.1 mg / ml, or any increment in between), sodium hydroxide and hydrochloric acid are included as needed for buffering to achieve a pH between 6.8 to 7.7 (e.g., a pH of 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, or 7.7), and Quantum satis amount of Water. Attorney Docket No.38709-0131WO1 Any of the therapeutic compositions disclosed herein can be formulated for sale in the US, imported into the US, and / or exported from the US. The pharmaceutical compositions can be included in a kit, a container, a pack, a dispenser, and / or with instructions for administration. In some aspects, the invention provides kits that include the compositions or formulations comprising the antisense oligonucleotide (e.g., Compound A, as described herein). In some embodiments, the kit includes the following: 1) a first vial with the antisense oligonucleotide in a solution of aCSF, 2) a second vial with a solution of aCSF for diluting the antisense oligonucleotide in the first solution to an appropriate concentration, 3) a third vial with a solution of aCSF for a flushing step. The kit can also include instructions for the physician and / or patient, syringes, needles, box, bottles, vials, etc. In some embodiments, a single vial can contain an amount of the antisense oligonucleotide (e.g., Compound A) such that the concentration of the antisense oligonucleotide (e.g., Compound A) such is about 5 mg / ml to about 30 mg / ml, and wherein the antisense oligonucleotide (e.g., Compound A) such in an aCSF solution comprising: sodium chloride in an amount of about 5 mg / ml to about 15 mg / ml, potassium chloride in an amount of about 0.1 mg / ml to about 1 mg / ml, calcium chloride dihydrate in an amount of about 0.1 mg / ml to about 1 mg / ml, magnesium chloride hexahydrate in an amount of about 0.1 mg / ml to about 1 mg / ml, di-sodium phosphate in an amount of about 0.05 mg / ml to about 1.0 mg / ml, monosodium phosphate in an amount of about 0.01 mg / ml to about 0.1 mg / ml, hydrochloric acid and sodium hydroxide in an amount sufficient to achieve a pH of 6.8 to 7.7, and a Q.S. amount of water. In some embodiments, the first vial containing the antisense oligonucleotide (e.g., Compound A, as described herein) has a total volume of about 5 ml to about 6 ml (e.g., 5.6 ml) and includes the components shown in Table 2. Table 2: Components and Quantities in Compound A formulation. Attorney Docket No.38709-0131WO1 Manufacturing of Formulations comprising Antisense Oligonucleotides In some embodiments, the aCSF solution can be manufactured according to GMP standards using equipment and manufacturing facilities suitable for the manufacture of sterile injectable products. Methods for manufacturing an aCSF solution and formulations comprising an antisense oligonucleotide in an aCSF solution are known in the art. Formulations comprising the aCSF and the antisense oligonucleotide are made by adding the antisense oligonucleotide to the aCSF solution. In some instances, the antisense oligonucleotide can be lyphophilized prior to dissolving it in the aCSF solution. Stability of Compound A In certain embodiments, the stability of the pharmaceutical formulations comprising one or more antisense compound (e.g., Compound A) is assessed. Some embodiments provide a formulation comprising Compound A in an aCSF solution as described above. In some embodiments, the stability of the formulation comprising the antisense compound (e.g., Compound A) can be assessed by observing one or more of the following characteristics / properties over a period of time: appearance, retention time of Compound A as compared to a reference standard (which is a standard that was generated with one of the first lots of Compound A made), concentration of Compound A, purity, presence of sub-visible particulate matter that is > 10 μm, presence of sub-visible particulate matter that is > 25 μm, bacteria by presence of endotoxin, sterility, pH, osmolality, CCIT, and / or presence of one of more impurities. In some embodiments, a formulation comprising Compound A in a solution of aCSF is stable if the appearance of the formulation comprising Compound A is clear to opalescent, colorless to yellow liquid, and is practically free of visible particles over time. In some instances, the appearance is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 Attorney Docket No.38709-0131WO1 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 5+3°C. In some instances, the appearance is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 25+2°C and about 60+5% relative humidity. In some instances, the appearance is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 40+2°C and about 75+5% relative humidity. In some instances, the appearance is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 40°C to about 60°C (and any increment in between) and about 60% to 75% relative humidity (and any increment in between). In some embodiments, a formulation comprising Compound A in a solution of aCSF is stable if the retention time of Compound A in the formulation comprising Compound A is consistent with the retention time of reference standard (which is a standard that was generated with one of the first lots of Compound A made) comprising Compound A over time. In some instances, the retention time of Compound A in the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 Attorney Docket No.38709-0131WO1 months, after about 36 months, after about 48 months, or more of storage at about 5+3°C. In some instances, the retention time of Compound A in the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 25+2°C and about 60+5% relative humidity. In some instances, the retention time of Compound A in the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 40+2°C and about 75+5% relative humidity. In some instances, the retention time of Compound A in the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 40°C to about 60°C (and any increment in between) and about 60% to 75% relative humidity (and any increment in between). In some embodiments, a formulation comprising Compound A in a solution of aCSF is stable if the concentration of Compound A in the formulation remains about 18 mg / ml to about 22.0 mg / ml over time. In some instances, the concentration of Compound A in the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 5+3°C. In some instances, the concentration of Compound A in the formulation is determined after Attorney Docket No.38709-0131WO1 about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 25+2°C and about 60+5% relative humidity. In some instances, the concentration of Compound A in the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 40+2°C and about 75+5% relative humidity. In some instances, the concentration of Compound A in the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 40°C to about 60°C (and any increment in between) and about 60% to 75% relative humidity (and any increment in between). In some embodiments, a formulation comprising Compound A in a solution of aCSF is stable if the amount of sub-visible particulate matter that has a size of > 10 μm in the formulation comprising Compound A remains ≤ 6000 particles per vial over time. In some instances, the amount of sub-visible particulate matter that has a size of > 10 μm in the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 5+3°C. In some instances, the amount of sub-visible particulate matter that has a size of > 10 μm in the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after Attorney Docket No.38709-0131WO1 about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 25+2°C and about 60+5% relative humidity. In some instances, the amount of sub-visible particulate matter that has a size of > 10 μm in the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 40+2°C and about 75+5% relative humidity. In some instances, the amount of sub-visible particulate matter that has a size of > 10 μm in the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 40°C to about 60°C (and any increment in between) and about 60% to 75% relative humidity (and any increment in between). In some embodiments, a formulation comprising Compound A in a solution of aCSF is stable if the amount of sub-visible particulate matter that has a size of > 25 μm in the formulation comprising Compound A remains ≤ 600 particles per vial over time. In some instances, the amount of sub-visible particulate matter that has a size of > 25 μm in the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 5+3°C. In some instances, the amount of sub-visible particulate matter that has a size of > 25 μm in the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about Attorney Docket No.38709-0131WO1 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 25+2°C and about 60+5% relative humidity. In some instances, the amount of sub-visible particulate matter that has a size of > 25 μm in the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 40+2°C and about 75+5% relative humidity. In some instances, the amount of sub- visible particulate matter that has a size of > 25 μm in the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 40°C to about 60°C (and any increment in between) and about 60% to 75% relative humidity (and any increment in between). In some embodiments, a formulation comprising Compound A in a solution of aCSF is stable if the amount of endotoxin (checking for presence of gram-negative bacteria) in the formulation comprising Compound A remains ≤ 0.5 EU / mL over time. In some instances, the amount of endotoxin in the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 5+3°C. In some instances, the amount of endotoxin in the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after Attorney Docket No.38709-0131WO1 about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 25+2°C and about 60+5% relative humidity. In some instances, the amount of endotoxin in the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 40+2°C and about 75+5% relative humidity. In some instances, the amount of endotoxin in the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 40°C to about 60°C (and any increment in between) and about 60% to 75% relative humidity (and any increment in between). In some embodiments, a formulation comprising Compound A in a solution of aCSF is stable if the formulation comprising Compound A remains sterile (i.e., no growth; “no growth” indicates no growth of microorganisms at the end of the sterility testing inoculation period. Sterility is a USP test (USP<71>), where the product is passed through a membrane filter and then inoculated in media (as a growth promotion test). At the end of incubation, the product is examined for microbial growth) over time. In some instances, the sterility of the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 36 months, or more of storage at about 5+3°C. In some instances, the sterility of the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about Attorney Docket No.38709-0131WO1 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 25+2°C and about 60+5% relative humidity. In some instances, the sterility of the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 40+2°C and about 75+5% relative humidity. In some instances, the sterility of the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 40°C to about 60°C (and any increment in between) and about 60% to 75% relative humidity (and any increment in between). In some embodiments, a formulation comprising Compound A in a solution of aCSF is stable if the Container Closure Integrity Testing (CCIT) assessed over time indicates no change in pressure (CCIT is a test that pressure tests the integrity of the container closure (6R vial and stopper). Blue dye is introduced and monitored if there is any ingress into the vial). In some instances, the CCIT of the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 5+3°C. In some instances, the CCIT of the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 25+2°C and about 60+5% relative humidity. In some Attorney Docket No.38709-0131WO1 instances, the CCIT of the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 40+2°C and about 75+5% relative humidity. In some instances, the CCIT of the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 40°C to about 60°C (and any increment in between) and about 60% to 75% relative humidity (and any increment in between). In some embodiments, a formulation comprising Compound A in a solution of aCSF is stable if the pH of the formulation comprising Compound A remains between about 6.8 to about 7.6 over time. In some instances, the pH of the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 5+3°C. In some instances, the pH of the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 25+2°C and about 60+5% relative humidity. In some instances, the pH of the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about Attorney Docket No.38709-0131WO1 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 40+2°C and about 75+5% relative humidity. In some instances, the pH of the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 40°C to about 60°C (and any increment in between) and about 60% to 75% relative humidity (and any increment in between). In some embodiments, a formulation comprising Compound A in a solution of aCSF is stable if the osmolality of the formulation comprising Compound A remains 294 to 360 mOsm / kg over time. In some instances, the osmolality of the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 5+3°C. In some instances, the osmolality of the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 25+2°C and about 60+5% relative humidity. In some instances, the osmolality of the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 40+2°C and about 75+5% relative humidity. In some instances, the osmolality of the formulation is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 Attorney Docket No.38709-0131WO1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 40°C to about 60°C (and any increment in between) and about 60% to 75% relative humidity (and any increment in between). The current analytical controls for the formulation comprising Compound A (i.e., the drug substance) include testing designed to monitor product-related impurities via ion-pair reversed-phase ultra-high-performance liquid chromatography (IPRP- HPLC) and liquid chromatography-mass spectrometry (LC-MS) at release testing. Potential oligonucleotide impurities include: · short mers (“n-x“) (due to incomplete removal of dimethoxyl trityl (DMT) group due to unreacted sites with dichloroacetic acid (DCA), failed coupling due to unreacted sites with BMT in CAN, and / or failed capping of unreacted coupling sites with Cap A and Cap B), · long mers (“n+x”) (due to over coupling or double coupling due to the acidity of BMT in ACN, causing premature removal of the new DMT protecting group and coupling an additional amidite during coupling recycling), · depurination species (minus A or minus G) (due to depurination due to detritylation DCA treatment), · PS-PO (due to incomplete thiolation during synthesis and / or sulfur loss due to treatment with N3 / EtOH). Process Related Impurities: Drug substance process-related impurities may be introduced into the drug substance product stream from raw materials, including starting materials, reagents, solvents, and from small molecule side products during the drug substance manufacturing process. Solid-phase synthesis operates in a cyclical fashion, with multiple flow-through reactions, recirculation, and washing steps during each elongation cycle. Therefore, any unreactive process-related impurity would be removed from the synthesis column during one of the many flow-through reactions and / or washing steps. Any unreactive process-related impurity not cleared through the synthesis column would be reduced and / or removed from the drug substance product stream via one of the three subsequent purification steps. Of the three subsequent Attorney Docket No.38709-0131WO1 purification steps, two orthogonal mechanisms for separation are utilized after cleavage and deprotection: a) size exclusion separation via TFF in the crude and final ultrafiltration unit operations and b) charge-based separation via anion exchange purification. Both are effective in the removal of unreactive small molecules. In some embodiments, the formulation comprising Compound A can comprise one or more impurities having a certain relative retention time (RRT). Percentage is the relative % peak area. The area under the peak is integrated for each impurity peak to determine the relative % of impurities compared to the amount of Compound A present. In some embodiments, of any of the above-described embodiments, the formulation comprises one or more impurities relative to the antisense oligonucleotide. In some embodiments, the formulation comprises not more than about 20% (e.g., not more than about 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, or 20%) impurities. In some embodiments, the formulation comprises not more than about 15% (e.g., not more than about 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, or 15%) impurities. In some embodiments, the formulation comprises not more than about 15% (e.g., 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, or 15%) impurities having an RRT of < 1.00. In some embodiments, the formulation comprises not more than about 11% (e.g., 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, or 11%) impurities having an RRT of < 1.00. In some embodiments, the formulation comprises not more than about 5% (e.g., not more than about 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, or 5%) impurities having an RRT of > 1.00. In some embodiments, the formulation comprises not more than about 4% (e.g., not more than about 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, or 4%) impurities having an RRT of > 1.00. In some embodiments, the formulation comprises not more than 0.17% (e.g., 0.15%, 0.16%, or 0.17%) of an impurity having an RRT of about 0.240 to about 0.250 (e.g., about 0.240, about 0.241, about 0.242, about 0.243, about 0.244, about 0.245, about 0.246, about 0.247, about 0.248, about 0.249, or about 0.250). In some embodiments, the formulation comprises not more than 0.30% (e.g., 0.21%, 0.22% 0.23%, 0.24%, 0.25%, 0.26%, 0.27%, 0.28%, 0.29%, or 0.30%) of an impurity having an RRT of about 0.310 to about 0.320 (e.g., about 0.310, about 0.311, Attorney Docket No.38709-0131WO1 about 0.312, about 0.313, about 0.314, about 0.315, about 0.316, about 0.317, about 0.318, about 0.319, or about 0.320). In some embodiments, the formulation comprises not more than 0.23% (e.g., 0.21%, 0.22%, or 0.23%) of an impurity having an RRT of about 0.345 to about 0.355 (e.g., about 0.346, about 0.347, about 0.348, about 0.349, about 0.350, about 0.351, about 0.352, about 0.353, about 0.354, or about 0.355). In some embodiments, the formulation comprises not more than 0.13% (e.g., 0.11%, 0.12%, or 0.13%) of an impurity having an RRT of about 0.380 to about 0.390 (e.g., about 0.380, about 0.381, about 0.382, about 0.383, about 0.384, about 0.385, about 0.386, about 0.387, about 0.388 about 0.389, or about 0.390). In some embodiments, the formulation comprises not more than 0.46% (e.g., 0.37%, 0.38%, 0.39%, 0.40%, 0.41%, 0.42%, 0.43%, 0.44%, 0.45%, or 0.46%) of an impurity having an RRT of about 0.425 to about 0.440 (e.g., about 0.425, about 0.426, about 0.427, about 0.428, about 0.429, about 0.430, about 0.431, about 0.432, about 0.433, about 0.434, about 0.435, about 0.436, about 0.437, or about 0.438). In some embodiments, the formulation comprises not more than 0.23% (e.g., 0.17%, 0.18%, 0.19%, 0.20%, 0.21%, 0.22%, or 0.23%) of an impurity having an RRT of about 0.450 to about 0.465 (e.g., about 0.451, about 0.452, about 0.453, about 0.454, about 0.455, about 0.456, about 0.457, about 0.458, about 0.459, about 0.460, or about 0.461). In some embodiments, the formulation comprises not more than 0.10% of an impurity having an RRT of about 0.475 to about 0.485 (e.g., about 0.475, about 0.476, about 0.477, about 0.478, about 0.479, about 0.480, about 0.481, about 0.482, about 0.483, about 0.484, or about 0.485). In some embodiments, the formulation comprises not more than 0.74% (e.g., 0.60%, 0.61%, 0.62%, 0.63%, 0.64%, 0.65%, 0.66%, 0.67%, 0.68%, 0.69%, 0.70%, 0.71%, 0.72%, 0.73%, or 0.74%) of an impurity having an RRT of about 0.510 to about 0.525 (e.g., about 0.510, about 0.511, about 0.512, about 0.513, about 0.514, about 0.515, about 0.516, about 0.517, about 0.518, about 0.519, about 0.520, about 0.521, about 0.522, about 0.523, about 0.524, or about 0.525). In some embodiments, the formulation comprises not more than 0.65% (e.g., 0.60%, 0.61%, 0.62%, 0.63%, 0.64%, or 0.65%) of an impurity having an RRT of about 0.510 to about 0.525 (e.g., about 0.510, about 0.511, about 0.512, about 0.513, Attorney Docket No.38709-0131WO1 about 0.514, about 0.515, about 0.516, about 0.517, about 0.518, about 0.519, about 0.520, about 0.521, about 0.522, about 0.523, about 0.524, or about 0.525). In some embodiments, the formulation comprises not more than 0.59% (e.g., 0.55%, 0.57%, 0.58%, or 0.59%) of an impurity having an RRT of about 0.565 to about 0.580 (e.g., about 0.565, about 0.566, about 0.567, about 0.568, about 0.569, about 0.570, about 0.571, about 0.572, about 0.573, about 0.574, about 0.575, or about 0.576). In some embodiments, the formulation comprises not more than 0.76% (e.g., 0.68%, 0.69%, 0.70%, 0.71%, 0.72%, 0.73%, 0.74%, 0.75%, or 0.76%) of an impurity having an RRT of about 0.590 to about 0.605 (e.g., about 0.590, about 0.591, about 0.592, about 0.593, about 0.594, about 0.595, about 0.596, about 0.597, about 0.598, about 0.599, about 0.600, about 0.601, about 0.602, about 0.603, about 0.604, or about 0.605). In some embodiments, the formulation comprises not more than 1.14% (e.g., 1.06%, 1.07%, 1.08%, 1.09%, 1.10%, 1.11%, 1.12%, 1.13%, or 1.14%) of an impurity having an RRT of about 0.630 to about 0.645 (e.g., about 0.630, about 0.631, about 0.632, about 0.633, about 0.634, about 0.635, about 0.636, about 0.637, about 0.638, about 0.639, about 0.640, about 0.641, about 0.642, about 0.643, about 0.644, or about 0.645). In some embodiments, the formulation comprises not more than 0.41% (e.g., 0.33%, 0.34%, 0.35%, 0.36%, 0.37%, 0.38%, 0.39%, 0.40%, or 0.41%) of an impurity having an RRT of about 0.670 to about 0.685 (e.g., about 0.670, about 0.671, about 0.672, about 0.673, about 0.674, about 0.675, about 0.676, about 0.677, about 0.678, about 0.679, about 0.680, about 0.681, about 0.682, about 0.683, about 0.684, or about 0.685). In some embodiments, the formulation comprises not more than 0.88% (e.g., 0.83%, 0.84%, 0.85%, 0.86%, 0.87%, or 0.88%) of an impurity having an RRT of about 0.740 to about 0.755 (e.g., about 0.741, about 0.742, about 0.743, about 0.744, about 0.745, about 0.746, about 0.747, about 0.748, about 0.749, about 0.750, about 0.751, about 0.752, about 0.753, about 0.754, or about 0.755). In some embodiments, the formulation comprises not more than 0.53% (e.g., 0.51%, 0.52%, or 0.53%) of an impurity having an RRT of about 0.815 to about 0.825 Attorney Docket No.38709-0131WO1 (e.g., about 0.815, about 0.816, about 0.817, about 0.818, about 0.819, about 0.820, about 0.821, about 0.822, about 0.823, about 0.824, or about 0.825). In some embodiments, the formulation comprises not more than 0.58% (e.g., 0.55%, 0.56%, 0.57%, or 0.58%) of an impurity having an RRT of about 0.920 to about 0.930 (e.g., about 0.920, about 0.921, about 0.922, about 0.923, about 0.924, about 0.925, about 0.926, about 0.927, about 0.928, about 0.929, or about 0.930). In some embodiments, the formulation comprises not more than 3.71% (e.g., 3.60%, 3.61%, 3.62%, 3.63%, 3.64%, 3.65%, 3.66%, 3.67%, 3.68%, 3.69%, 3.70%, or 3.71%) of an impurity having an RRT of about 0.960 to about 0.965 (e.g., about 0.960, about 0.961, about 0.962, about 0.963, about 0.964, or about 0.965). In some embodiments, the formulation comprises not more than 0.56% (e.g., 0.55%, or 0.56%) of an impurity having an RRT of about 0.920 to about 0.930 (e.g., about 0.920, about 0.921, about 0.922, about 0.923, about 0.924, about 0.925, about 0.926, about 0.927, about 0.928, about 0.929, or about 0.930). In some embodiments, the formulation comprises not more than 1.13% (e.g., 49% to 1.13%, including any increment in between; e.g., 0.49%, 0.51%, 0.54%, 0.55%, or 1.13%) of an impurity having an RRT of about 1.075 to about 1.085 (e.g., about 1.075, about 1.076, about 1.077, about 1.078, about 1.079, about 1.080, about 1.081, about 1.082, about 1.083, about 1.084, or about 1.085). In some embodiments, the formulation comprises not more than 0.84% (e.g., 0.77%, 0.78%, 0.79%, 0.82%, 0.83%, or 0.84%) of an impurity having an RRT of about 1.125 to about 1.135 (e.g., about 1.125, about 1.126, about 1.127, about 1.128, about 1.129, about 1.130, about 1.131, about 1.132, about 1.133, about 1.134, or about 1.135). In some embodiments, the formulation comprises not more than 0.28% (e.g., 0.21%, 0.22%, 0.23%, 0.24%, 0.25%, 0.26%, 0.27%, or 0.28%) of an impurity having an RRT of about 1.160 to about 1.175 (e.g., about 1.160, about 1.161, about 1.162, about 1.163, about 1.164, about 1.165, about 1.166, about 1.167, about 1.168, about 1.169, about 1.170, about 1.171, about 1.172, about 1.173, or about 1.174). In some embodiments, the formulation comprises not more than 0.17% (e.g., 0.13%, 0.14%, 0.15%, 0.16%, or 0.17%) of an impurity having an RRT of about 1.205 to about 1.260 (e.g., about 1.205, about 1.206, about 1.207, about 1.208, about 1.209, about 1.210, about 1.211, about 1.212, about 1.213, about 1.214, about 1.215, Attorney Docket No.38709-0131WO1 about 1.216, about 1.217, about 1.218, about 1.219, about 1.220, about 1.221, about 1.222, about 1.223, about 1.224, about 1.225, about 1.226, about 1.227, about 1.228, about 1.229, about 1.230, about 1.231, about 1.232, about 1.233, about 1.234, about 1.235, about 1.236, about 1.237, about 1.238, about 1.239, about 1.240, about 1.241, about 1.242, about 1.243, about 1.244, about 1.245, about 1.246, about 1.247, about 1.248, about 1.249, about 1.250, about 1.251, about 1.252, about 1.253, about 1.254, about 1.255, about 1.256, about 1.256, about 1.257, about 1.258, about 1.259, or about 1.260). In some embodiments, the formulation comprises not more than 0.11% of an impurity having an RRT of about 1.275 to about 1.280 (e.g., about 1.275, about 1.276, about 1.277, about 1.278, about 1.279, or about 1.280). In some embodiments, the formulation comprises not more than 0.17% (e.g., 0.13%, 0.14%, 0.15%, 0.16%, or 0.17%) of an impurity having an RRT of about 1.305 to about 1.325 (e.g., about 1.305, about 1.306, about 1.307, about 1.308, about 1.309, about 1.310, about 1.311, about 1.312, about 1.313, about 1.314, about 1.315, about 1.316, about 1.317, about 1.318, about 1.319, about 1.320, about 1.321, about 1.322, about 1.323, about 1.324, or about 1.325). In some embodiments, the formulation comprises not more than 0.17% (e.g., 0.11%, 0.12%, 0.13%, 0.14%, 0.15%, 0.16%, or 0.17%) of an impurity having an RRT of about 1.355 to about 1.380 (e.g., about 1.355, about 1.356, about 1.357, about 1.358, about 1.359, about 1.360, about 1.361, about 1.362, about 1.363, about 1.364, about 1.365, about 1.366, about 1.367, about 1.368, about 1.369, about 1.370, about 1.371, about 1.372, about 1.373, about 1.374, about 1.375, about 1.376, about 1.377, about 1.378, about 1.379, or about 1.380). In some embodiments, the formulation comprises not more than 0.14% (e.g., 0.10%, 0.12%, 0.13%, or 0.14%) of an impurity having an RRT of about 1.560 to about 1.570 (e.g., about 1.560, about 1.561, about 1.562, about 1.563, about 1.564, about 1.565, about 1.566, about 1.567, about 1.568, about 1.569, or about 1.570). In some embodiments, the formulation comprises not more than 0.14% (e.g., 0.10%, 0.11%, 0.12%, 0.13%, or 0.14%) of an impurity having an RRT of about 1.610 to about 1.640 (e.g., about 1.610, about 1.611, about 1.612, about 1.613, about 1.614, about 1.615, about 1.616, about 1.617, about 1.618, about 1.619, about 1.620, about 1.621, about 1.622, about 1.623, about 1.624, about 1.625, about 1.626, about Attorney Docket No.38709-0131WO1 1.627, about 1.628, about 1.629, about 1.630, about 1.631, about 1.632, about 1.633, about 1.634, about 1.635, about 1.636, about 1.637, about 1.638, about 1.639, or about 1.640). In some embodiments, the amount of each impurity as described above is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 30 months, after about 36 months, after about 48 months, or more of storage at about 5+3°C. In some embodiments, the amount of each impurity as described above is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 36 months, or more of storage at about 25+2°C and about 60+5% relative humidity. In some embodiments, the amount of each impurity as described above is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 36 months, or more of storage at about 40+2°C and about 75+5% relative humidity. In some instances, the amount of each impurity as described above is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month, after about 2 months, after about 3 months, after about 4 months, after about 5 months, after about 6 months, after about 7 months, after about 8 months, after about 9 months, after about 12 months, after about 15 months, after about 18 months, after about 24 months, after about 36 months, or more of storage at about 40°C to about 60°C (and any increment in between) and about 60% to 75% relative humidity (and any increment in between). Attorney Docket No.38709-0131WO1 Methods of Administration In certain embodiments, pharmaceutical formulations comprising one or more antisense compound are administered to a subject. In certain embodiments, such pharmaceutical formulations are administered by injection. In certain embodiments, such pharmaceutical formulations are administered by infusion. In certain embodiments, an antisense oligonucleotide, or a salt thereof (e.g., Compound A), is administered to the human subject with a syringe for intrathecal delivery. In another embodiment, an antisense oligonucleotide, or a salt thereof (e.g., Compound A), is administered to the human subject with a pump for intrathecal delivery. Thus, this disclosure also provides a pump or syringe comprising a sterile preparation of the antisense oligonucleotide, or a salt thereof (e.g., Compound A). The syringe or pump can be adapted for intrathecal administration of the antisense oligonucleotide, or a salt thereof. In some cases, the syringe or pump delivers a dose(s) (e.g., about 12.5 mg or 12 mg, about 25 mg or 25 mg, about 50 mg or 50 mg, or about 100 mg or 100 mg) of the antisense oligonucleotide. The disclosure also provides a pump or syringe comprising a sterile preparation of a pharmaceutical composition comprising an antisense oligonucleotide, or a salt thereof (e.g., Compound A). The syringe or pump can be adapted for intrathecal administration of the pharmaceutical composition. In some cases, the syringe or pump delivers a dose(s) (e.g., about 12.5 mg or 12 mg, about 25 mg or 25 mg, about 50 mg or 50 mg, or about 100 mg or 100 mg) of the antisense oligonucleotide of the pharmaceutical composition. In a particular embodiment, the pump or syringe comprises a sterile preparation of an antisense oligonucleotide, or salt thereof, wherein the syringe or pump is adapted for intrathecal administration of an antisense oligonucleotide, or a salt thereof (e.g., Compound A), at a dose of 12.5 mg, 25 mg, 50 mg, or 100 mg of the antisense oligonucleotide. In certain embodiments, pharmaceutical formulations are administered by injection or infusion into the CSF. In certain such embodiments, pharmaceutical formulations are administered by direct injection or infusion into the spine. In certain embodiments, pharmaceutical formulations are administered by injection or infusion into the brain. In certain embodiments, pharmaceutical formulations are administered by intrathecal (IT) injection or infusion rather than into the spinal cord tissue itself. In certain embodiments, such pharmaceutical formulations are administered Attorney Docket No.38709-0131WO1 systemically. In certain embodiments, pharmaceutical formulations are administered subcutaneously. In certain embodiments, pharmaceutical formulations are administered intravenously. In certain embodiments, pharmaceutical formulations are administered by intramuscular injection. In certain embodiments, pharmaceutical formulations are administered both directly to the CSF (e.g., IT and / or ICV injection and / or infusion) and systemically. In certain embodiments, a certain amount of a subject’s CSF is removed via lumbar puncture procedure prior to administration with the pharmaceutical formulations described herein. For example, about 10 to about 20 ml (e.g., about 10 ml, about 11 ml, about 12 ml, about 13 ml, about 14 ml, about 15 ml, about 16 ml, about 17 ml, about 18 ml, about 19 ml, about 20 ml) of the subject’s CSF is removed. Subsequently, the formulation comprising the antisense oligonucleotide, as described herein, is administered intrathecally to the subject over a period of 1 to 5 minutes (e.g., 1 to 3 minutes). Subsequently, the subject is then administered an intrathecal flush containing the aCSF solution alone (about 3 ml, about 4 ml, about 5 ml, about 6 ml. about 7 ml, about 8 ml, about 9 ml, or about 10 ml). Following administration, the subject can be evaluated to detect, assess, or determine their level of disease. In some embodiments, treatment can continue until a change (e.g., reduction) in the level of disease in the subject is detected. Methods of Treatment The present disclosure provides methods of treating ALS in a subject, or ameliorating at least one symptom of ALS in a subject, or prophylactically treating a subject at risk for developing ALS (e.g., a subject with a family history of ALS) or a subject suspected to be developing ALS (e.g., a subject displaying at least one symptom of ALS, a symptom of upper motor neuron degeneration, and / or a symptom of lower motor neuron degeneration, but not enough symptoms at that time to support a full diagnosis of ALS). Also provided are methods of ameliorating at least one symptom of lower motor neuron degeneration, at least one symptom of upper motor neuron degeneration, or at least one symptom from each of lower motor neuron degeneration and upper motor neuron degeneration in a subject. Attorney Docket No.38709-0131WO1 Some embodiments of the present disclosure provide methods of slowing ALS disease progression (e.g., reducing the ALS disease progression rate); and methods of reducing deterioration of muscle strength, respiratory muscle / pulmonary function and / or fine motor skill, as well as methods of maintaining or improving muscle strength, respiratory muscle / pulmonary function and / or fine motor skill. Also provided herein are methods of preventing or reducing at least one adverse events (e.g., serious adverse events) associated with ALS or its treatment; and methods of increasing survival time of a human subject having one or more symptoms of ALS. This disclosure further provides methods of treating at least one symptom of bulbar-onset ALS in a human subject. Also provided are methods of ameliorating at least one symptom of benign fasciculation syndrome or cramp fasciculation syndrome. The methods described herein include administering to the subject a therapeutically effective amount of Compound A. As noted above, Compound A is a 5-10-5 MOE gapmer, having the sequence of (from 5’ to 3’) ATCAGTTTCTGTAGGCTTCC (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 are 2’-O-methoxyethylribose modified nucleosides, wherein the internucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5-methylcytosine. In some embodiments, the methods described herein include administering to a subject a dose of about 10 mg to about 125 mg of Compound A. In some embodiments, the methods described herein include administering to a subject about 10 mg, about 10.5 mg, about 11 mg, about 11.5 mg, about 12 mg, about 12.5 mg, about 13 mg, about 13.5 mg, about 14 mg, about 14.5 mg, about 15 mg, about 15.5 mg, about 16 mg, about 16.5 mg, about 17 mg, about 18.5 mg, about 19 mg, about 19.5 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 100 mg, about 110 mg, about 105 mg, about 110 mg, about 115 mg, about 120 mg, about 125 mg. Attorney Docket No.38709-0131WO1 Treatment methods can include a single administration, multiple administrations, and repeating administration as required for the prophylaxis or treatment of ALS, or at least one symptom of ALS. The duration of prophylaxis treatment can be a single dosage or the treatment may continue (e.g., multiple dosages), e.g., for weeks, months, years or indefinitely for the lifespan of the subject. For example, a subject at risk for ALS may be treated with the methods provided herein for days, weeks, months, or even years so as to prevent the disease from occurring or fulminating. In some embodiments of any of the methods described herein, Compound A is administered to a subject at a dose of about 10 mg to about 125 mg (e.g., about 12.5 mg, about 25 mg, about 50 mg, about 100 mg) about every 4 weeks (e.g., about every 28 days). In other words, in some embodiments, Compound A is administered to a subject on day 1 and then about every 4 weeks or about every 28 days (e.g., the subject is administered Compound A on day 1, on day 29 (+ / - 3 days), on day 57 (+ / - 3 days), on day 85 (+ / - 3 days), on day 113 (+ / - 3 days), and so on). In some embodiments treatment methods can include assessing a level of disease in the subject prior to treatment, during treatment, and / or after treatment. The treatment provided herein can be administered repeatedly (e.g., administered weekly or monthly). In some embodiments, treatment can continue until a decrease in the level of disease in the subject is detected. The methods provided herein may in some embodiments begin to show efficacy (e.g., alleviating one or more symptoms of ALS, improvement as measured by the ALSFRS-R, or maintenance of an ALSFRS-R rating) less than 60 days (e.g., less than 50, 45, 40, 35, 30, 25, 20, 15, or 10 days) after the initial administration, or after less than 60 administrations (e.g., less than 50, 45, 40, 35, 30, 25, 20, 15, or 10 administrations). In some embodiments of any of the methods described herein, the subject is diagnosed with ALS, at risk for developing ALS, or suspected as having ALS. The subject may, for example, have been diagnosed with ALS for 24 months or less (e.g., any of the subranges within this range described herein). For example, the subject may have been diagnosed with ALS for 1 week or less, or on the same day that the presently disclosed treatments are administered. The subject may have shown one or more symptoms (e.g., ALS symptom onset is defined as the onset of weakness (in the limbs, bulbar region, or trunk). Weakness in the bulbar region includes dysarthria and Attorney Docket No.38709-0131WO1 dysphagia) of ALS for 24 months or less (e.g., any of the subranges within this range described herein). Methods described in the present disclosure can include treatment of ALS per se, as well as treatment for one or more symptoms of ALS. “Treating” ALS does not require 100% abolition of the disease or disease symptoms in the subject. Any relief or reduction in the severity of symptoms or features of the disease is contemplated. “Treating” ALS also refers to a delay in onset of symptoms (e.g., in prophylaxis treatment) or delay in progression of symptoms or the loss of function associated with the disease. “Treating” ALS also refers to eliminating or reducing one or more side effects of a treatment (e.g. those caused by any of the therapeutic agents for treating ALS disclosed herein or known in the art). “Treating” ALS also refers to eliminating or reducing one or more direct or indirect effects of ALS disease progression, such as an increase in the number of falls, lacerations, or GI issues. The subject may not exhibit signs of ALS but may be at risk for ALS. For instance, the subject may carry mutations in genes associated with ALS, have family history of having ALS, or have elevated biomarker levels suggesting a risk of developing ALS. The subject may exhibit early signs of the disease or display symptoms of established or progressive disease. The disclosure contemplates any degree of delay in the onset of symptoms, alleviation of one or more symptoms of the disease, or delay in the progression of any one or more disease symptoms (e.g., any improvement as measured by ALSFRS-R, or maintenance of an ALSFRS-R rating (signaling delayed disease progression)). Any relief or reduction in the severity of symptoms or features of benign fasciculation syndrome and cramp-fasciculation syndrome are also contemplated herein. The treatment provided in the present disclosure can be initiated at any stage during disease progression. For example, treatment can be initiated prior to onset (e.g., for subjects at risk for developing ALS), at symptom onset or immediately following detection of ALS symptoms, upon observation of any one or more symptoms (e.g., muscle weakness, muscle fasciculations, and / or muscle cramping) that would lead a skilled practitioner to suspect that the subject may be developing ALS. Treatment can also be initiated at later stages. For example, treatment may be initiated at progressive stages of the disease, e.g., when muscle weakness and atrophy spread to different parts of the body and the subject has increasing problems with moving. At or prior to treatment initiation, the subject may suffer from tight and stiff muscles (spasticity), Attorney Docket No.38709-0131WO1 from exaggerated reflexes (hyperreflexia), from muscle weakness and atrophy, from muscle cramps, and / or from fleeting twitches of muscles that can be seen under the skin (fasciculations), difficulty swallowing (dysphagia), speaking or forming words (dysarthria). Symptom and Outcome Measurements Methods of evaluating symptoms, monitoring ALS progression and / or evaluating the subject’s response to the treatment methods are described herein. Non- limiting examples include physical evaluation by a physician, weight, Electrocardiogram (ECG), ALS Functional Rating Scale (ALSFRS or ALSFRS-R) score, respiratory function, muscle strength, cognitive / behavioral function, quality of life, and speech analysis. Respiratory function of the subject can be measured by e.g. vital capacity (including forced vital capacity and slow vital capacity), maximum mid-expiratory flow rate (MMERF), forced vital capacity (FVC), and forced expiratory volume in 1 second (FEV1). Muscle strength can be evaluated by e.g. hand held dynamometry (HHD), hand grip strength dynamometry, manual muscle testing (MMT), electrical impedance myography (EIM), Maximum Voluntary Isometric Contraction Testing (MVICT), motor unit number estimation (MUNE), Accurate Test of Limb Isometric Strength (ATLIS), or a combination thereof. Cognitive / behavior function can be evaluated by e.g. the ALS Depression Inventory (ADI- 12), the Beck Depression Inventory (BDI), and the Hospital Anxiety Depression Scale (HADS) questionnaires. Quality of life can be evaluated by e.g. the ALS Assessment Questionnaire (ALSAQ- 40). The Akt level, Akt phosphorylation and / or pAktdAkt ratio can also be used to evaluate a subject’s disease progression and response to treatment (See e.g., WO2012 / 160563). Muscle strength The muscle strength of a subject can be evaluated using known methods in the art. Quantitative strength measures generally demonstrate a linear, predictable strength loss within an ALS patient. Tufts Quantitative Neuromuscular Examination (TQNE) can be used to provide quantitative measurements using a fixed strain gauge. TQNE measures isometric strength of 20 muscle groups and produces interval Attorney Docket No.38709-0131WO1 strength data in both strong and weak muscles (See e.g., Andres et al., Neurology 36:937–941, 1986). Hand-held dynamometry (HHD) tests isometric strength of specific muscles in the arms and legs and produces interval level data (See e.g., Shefne JM, Neurotherapeutics 14:154–160, 2017). Accurate Test of Limb Isometric Strength (ATLIS) can be used to measure both strong and weak muscle groups using a fixed, wireless load cell (See e.g., Andres et al., Muscle Nerve 56(4):710-715, 2017). Force in twelve muscle groups are evaluated in an ATLIS testing, which reflect the subject’s strength in the lower limbs, upper limbs, as well as the subject’s grip strength. In some embodiments, ATLIS testing detects changes in muscle strength before any change in function is observed. The methods provided herein may improve, maintain, or slow down the deterioration of a subject’s muscle strength (e.g., lower limb strength, upper limb strength, or grip strength), as evaluated by any of the suitable methods described herein. In some embodiments, the methods may result in improvement of the subject’s upper limb strength more significantly than other muscle groups. For example, the effect on muscle strength can be reflected in one or more muscle groups selected from quadriceps, biceps, hamstrings, triceps, and anterior tibialis. In some embodiments of any of the methods of improving, maintaining, or slowing down the deterioration of muscle strength in a human subject having one or more symptoms of ALS described herein, the muscle strength is assessed by HHD, hand grip strength dynamometry, MMT, EIM, MVICT, MUNE, ATLIS, or a combination thereof, before, during and / or after the administration of the antisense oligonucleotide described herein (i.e., Compound A). In some embodiments, the muscle strength is assessed by ATLIS. The total ATLIS score as well as the upper extremity and lower extremity ATLIS scores can be assessed. The methods of the present disclosure can result in a rate of decline in the total ATLIS score of a subject of about 3.50 PPN / month or less (e.g., about 3.45, 3.40, 3.35, 3.30, 3.25, 3.20, 3.15, 3.10, 3.05, 3.00 PPN / month or less). The methods of the present disclosure can also results in a reduction of the mean rate of decline in the total ATLIS score of a subject by at least about 0.2 PPN / month (e.g., at least about 0.25, 0.30, 0.35, 0.40, 0.45, or 0.50 PPN / month) as compared to a control subject not receiving the administration. The mean rate of decline in the upper extremity ATLIS score of a subject can be reduced by at least about 0.50 PPN / month (e.g., at least Attorney Docket No.38709-0131WO1 about 0.55, 0.60, 0.65, 0.70, 0.75, 0.80, 0.85, or 0.90 PPN / month) as compared to a control subject not receiving the administration described herein. The mean rate of decline in the lower extremity ATLIS score of a subject can be reduced by at least about 0.20 PPN / month (e.g., at least about 0.25, 0.30, 0.35, 0.40, 0.45, 0.50, 0.55, or 0.60 PPN / month) as compared to a control subject not receiving the administration described herein. In some embodiments, improvement or maintenance of the subject’s muscle strength may begin to occur less than 60 days (e.g., less than 55, 50, 45, 40, 30, 25, or 20 days) following the initial administration. PPN represents the percentage of predicted normal strength based on age, sex weight and height. Pulmonary function ALS is a progressive neurodegenerative disease that ultimately leads to respiratory failure and death. Pulmonary function tests, such as but not limited to vital capacity (VC), maximum mid-expiratory flow rate (MMERF), forced vital capacity (FVC), slow vital capacity (SVC), and forced expiratory volume in 1 second (FEV1), can be used to monitor ALS progression and / or the subject’s response to treatment. On average, the rate of respiratory function decline of an ALS patient measured by Vital Capacity (VC) can be about 2.24% of predicted (±6.9) per month. In some embodiments, measures from pulmonary function tests are associated with survival (See e.g., Moufavi et al. Iran J Neurol 13(3): 131–137, 2014). Additional measures, such as maximal inspiratory and expiratory pressures, arterial blood gas measurements, and overnight oximetry, may provide earlier evidence of dysfunction. Comparison of vital capacity in the upright and supine positions may also provide an earlier indication of weakening ventilatory muscle strength. The methods provided herein may improve or maintain the subject’s respiratory muscle and / or pulmonary function or slow down the deterioration of the subject’s respiratory muscle and / or pulmonary function. A subject’s respiratory muscle and / or pulmonary function can be evaluated by any of the suitable methods described herein or otherwise known in the art. In some embodiments, the respiratory muscle function of a human subject is assessed based on the subject’s SVC. In some embodiments of any of the methods of improving, maintaining, or slowing down the deterioration of respiratory muscle function in a human subject described herein, the treatment results in a mean rate of decline in the SVC of the subject of about 3.50 Attorney Docket No.38709-0131WO1 PPN / month or less (e.g., about 3.45, 3.40, 3.35, 3.30, 3.25, 3.20, 3.15, 3.10, 3.05, or 3.00 PPN / month or less). In some embodiments, the treatment reduces the mean rate of decline in the SVC of the subject by at least about 0.5 PPN / month (e.g., at least about 0.55, 0.60, 0.65, 0.70, 0.75, 0.80, 0.85, 0.90, 0.95, or 1.00 PPN / month) as compared to a control subject not receiving the treatment. In some embodiments, improvement or maintenance of the subject’s pulmonary function may begin to occur less than 60 days (e.g., less than 55, 50, 45, 40, 30, 25, or 20 days) following the initial administration. In some embodiments, the subject’s pulmonary function progresses less than expected after fewer than 60 days following the initial administration. ALSFRS-R Methods provided herein may reduce disease progression rate wherein the average ALSFRS-R points lost per month by the subject is reduced by at least about 0.2 (e.g., at least about 0.25, 0.30, 0.35, 0.40, 0.45, 0.50, 0.55, 0.60, 0.65, 0.70, 0.75, 0.80, 0.85, 0.90, 0.95, 1.0, 1.05, 1.1, 1.15, 1.2, 1.25, 1.3, 1.35, 1.4, 1.45 or 1.5) as compared to a control subject not receiving the treatment. The methods provided herein may slow down the progression in one or more categories evaluated by the ALSFRS scale, including: speech, salivation, swallowing, handwriting, Cutting Food and Handling Utensils, Dressing and Hygiene, Turning in Bed and Adjusting Bed Clothes, Walking, Climbing Stairs, Dyspnea, Orthopnea, Respiratory Insufficiency. In some embodiments, the methods provided herein improve or slow down deterioration of a subject’s fine motor function, as evaluated by one or more categories of the ALSFRS-R scale (e.g., handwriting, cutting food and handling utensils, or dressing and hygiene). Biomarkers The levels of biomarkers in the subject’s CSF or blood samples are useful indicators of the subject’s ALS progression and responsiveness to the methods of treatment provided herein. Biomarkers such as but not limited to, CAPN2, phosphorylated neurofilament heavy chain (pNF-H), neurofilament medium chain, neurofilament light chain (NFL), S100-β, cystatin C, chitotriosidase, CRP, TDP-43, uric acid, and certain micro RNAs, can be analyzed for this purpose. Urinalysis can Attorney Docket No.38709-0131WO1 also be used for assessing the subject’s response to treatment. Levels of biomarkers such as but not limited to p75ECD and ketones in the urine sample can be analyzed. Levels of creatinine can be measured in the urine and blood samples. In some embodiments, the methods provided herein result in increased or decreased ketone levels in the subject’s urine sample. Medical imaging, including but not limited to MRI and PET imaging of markers such as Translocator protein (TSPO), may also be utilized. Methods provided herein may reduce CAPN2 mRNA levels and / or calpain-2 protein levels (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, methods described herein reduce levels and / or activities calpain-2 RNA transcripts (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, provided oligonucleotides and compositions provide knockdown of calpain-2 mRNA (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, methods described herein reduce levels of calpain-2 polypeptides (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, provided methods reduce levels of calpain-2 activities, e.g., protease activities (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, reduction of calpain-2 mRNA and / or polypeptide levels (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle) increases mRNA and / or polypeptide levels of a calpain-2 target. In some embodiments, reduction of calpain-2 mRNA and / or polypeptide levels (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle) increases mRNA and / or polypeptide levels of calpastatin. Calpain-2 has been reported to interact with various partners, e.g., TDP-43 and other ALS biomarkers. In some embodiments, the present disclosure provide methods for modulating interaction between calpain-2 and a partner (e.g., TDP-43). In some embodiments, the methods described herein result in a reduction of at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% (or any increment in between) of CAPN2 mRNA levels as compared to a baseline level of CAPN2 mRNA level (i.e., the baseline level is the level of CAPN2 mRNA that a subject exhibits immediately prior to administration of Compound A). In some embodiments, CAPN2 mRNA is reduced by Attorney Docket No.38709-0131WO1 at least about 10% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 15% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 20% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 25% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 30% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 35% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 40% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 45% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 50% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 55% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 60% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 65% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 70% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 75%. In some embodiments, CAPN2 mRNA is reduced by at least about 80% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 85% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 90% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, CAPN2 mRNA is reduced by at least about 95% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, the methods described herein result in a reduction of at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 70%, about 75%, about 80%, about Attorney Docket No.38709-0131WO1 85%, about 90%, or about 95% (or any increment in between) of calpain-2 polypeptide (i.e., protein) levels as compared to a baseline level of calpain-2 polypeptide level (i.e., the baseline level is the level of calpain-2 polypeptide) that a subject exhibits immediately prior to administration of Compound A). In some embodiments, calpain-2 polypeptide is reduced by at least about 10% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 15% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 20% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 25% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 30% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 35% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 40% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 45% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 50% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 55% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 60% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 65% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 70% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 75% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 80% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 85% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 90% (in the Attorney Docket No.38709-0131WO1 CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 polypeptide is reduced by at least about 95% (in the CSF, blood, brain (e.g., motor cortex), spinal cord, or muscle). In some embodiments, calpain-2 cleaves neurofilament (e.g., alters the levels of neurofilament). In some embodiments wherein Compound A reduces calpain-2 levels, neurofilament levels are subsequently reduced. In some embodiments, the methods described herein result in a reduction of at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% (or any increment in between) of NfL polypeptide (i.e., protein) levels as compared to a baseline level of NfL polypeptide level (i.e., the baseline level is the level of NfL polypeptide) that a subject exhibits immediately prior to administration of Compound A). In some embodiments, NfL polypeptide is reduced by at least about 10% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 15% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 20% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 25% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 30% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 35% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 40% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 45% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 50% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 55% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 60% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 65% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 70% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 75% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 80% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 85% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 90% (in the CSF or plasma). In some Attorney Docket No.38709-0131WO1 embodiments, NfL polypeptide is reduced by at least about 95% (in the CSF or plasma). In some embodiments, NfL polypeptide is reduced by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% in muscle, serum, brain (e.g., the motor cortex), or the spinal cord. In some embodiments, the methods described herein result in a reduction of at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% (or any increment in between) of SBDP-145 levels as compared to a baseline level of SBDP-145 (i.e., the baseline level is the level of SBDP-145 that a subject exhibits immediately prior to administration of Compound A). In some embodiments, SBDP-145 is reduced by at least about 10% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 15% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 20% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 25% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 30% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 35% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 40% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 45% (in the CSF or blood). In some embodiments, SBDP- 145 is reduced by at least about 50% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 55% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 60% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 65% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 70% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 75% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 80% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 85% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 90% (in the CSF or blood). In some embodiments, SBDP-145 is reduced by at least about 95% (in the CSF or blood). In some embodiments, a reduction of any of the biomarkers described herein is assessed at or after about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, Attorney Docket No.38709-0131WO1 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60,, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, or more than 150 days; about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, or more than 55 weeks; about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more than 12 months; or about 1, 2, 3, 4, 5, or more than 5 years following administering or delivering a provided oligonucleotide by any of the methods described herein. Survival Time The average survival time for an ALS patient may vary. The median survival time can be about 30 to about 32 months from symptom onset, or about 14 to about 20 months from diagnosis. The survival time of subjects with bulbar-onset ALS can be about 6 months to about 84 months from symptom onset, with a median of about 27 months. The methods provided herein may in some embodiments increase survival for a subject having ALS by at least one month (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 28, 32, 36, 40, 50, 60, 70, 80, or 90 months). Methods provided herein may in some embodiments delay the onset of ventilator-dependency or tracheostomy by at least one month (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 28, 32, 36, 40, 50, 60, 70, 80, or 90 months). Adverse events Subjects treated with any of the methods provided herein may present fewer adverse events (e.g., any of the adverse events disclosed herein), or present one or more of the adverse events to a lesser degree than control subjects not receiving the treatment. Exemplary adverse events include gastrointestinal related adverse events (e.g., abdominal pain, gastritis, nausea and vomiting, constipation, rectal bleeding, peptic ulcer disease, and pancreatitis); hematologic adverse events (e.g., aplastic anemia and ecchymosis); cardiovascular adverse events (e.g., arrhythmia and edema); renal adverse events (e.g., renal tubular acidosis); psychiatric adverse events (e.g., depression); skin adverse events (e.g., rash); and miscellaneous adverse events (e.g., Attorney Docket No.38709-0131WO1 syncope and weight gain). In some embodiments, the methods provided herein do not result in, or result in minimal symptoms of, constipation, neck pain, headache, falling, dry mouth, muscular weakness, falls, laceration, and Alanine Aminotransferase (ALT) increase. In some embodiments, the adverse events are serious adverse events, such as but not limited to respiratory adverse events, falls, or lacerations. In some embodiments, the methods provided herein are more effective in treating subjects that are about 18 to about 50 years old (e.g., about 18 to about 45, about 18 to about 40, about 18 to about 35, about 18 to about 30, about 18 to about 25, or about 18 to about 22 years old), as compared to subjects 50 years or older (e.g., 55, 60, 65, 70, 75, or 80 years or older). In some embodiments, the methods provided herein are more effective in treating subjects who have been diagnosed with ALS and / or who showed ALS symptom onset less than about 24 months (e.g., less than about 22, 20, 18, 16, 14, 12, 10, 8, 6, 4, 2, or 1 month), as compared to subjects who has been diagnosed with ALS and / or who showed ALS symptom onset more than about 24 months (e.g., more than about 26, 28, 30, 32, 34, 36, 40, 45, 50, 55, or 60 months). In some embodiments, the methods provided herein are more effective in treating subjects who have been diagnosed with ALS and / or who showed ALS symptom onset more than about 24 months (e.g., more than about 26, 28, 30, 32, 34, 36, 40, 45, 50, 55, or 60 months), as compared to subjects who has been diagnosed with ALS and / or who showed ALS symptom less than about 24 months (e.g., less than about 22, 20, 18, 16, 14, 12, 10, 8, 6, 4, 2, or 1 month). Pharmacokinetics and Pharmacodynamics of Compound A In one aspect, provided herein are methods for treating at least one symptom of ALS in a subject, or methods of administering a composition comprising Compound A to a subject having at least one symptom of ALS, wherein the method comprises: (a) administering to the subject a composition comprising a dose of Compound A, (b) determining that the subject has a certain levels of Cmax, Tmax, T1 / 2, AUC0-last, and / or AUC0-∞for Compound A, and (c) administering to the subject an additional dose of the composition. Attorney Docket No.38709-0131WO1 The methods can include determining that the subject has a Cmax(maximum concentration, obtained directly from the observed concentration versus time data) for Compound A of about 400 ng / mL to about 1000 ng / mL (e.g. about 450 ng / mL to about 950 ng / mL, 450 ng / mL to about 900 ng / mL, 450 ng / mL to about 850 ng / mL, about 450 ng / mL to about 800 ng / mL, 450 ng / mL to about 750 ng / mL, about 450 ng / mL to about 700 ng / mL, 450 ng / mL to about 650 ng / mL, about 450 ng / mL to about 600 ng / mL, 450 ng / mL to about 550 ng / mL, about 450 ng / mL to about 500 ng / mL, about 450 ng / mL to about 1000 ng / mL, about 475 ng / mL to about 1000 ng / mL, about 500 ng / mL to about 1000 ng / mL, about 525 ng / mL to about 1000 ng / mL, about 550 ng / mL to about 1000 ng / mL, about 575 ng / mL to about 1000 ng / mL, about 600 ng / mL to about 1000 ng / mL, about 625 ng / mL to about 1000 ng / mL, about 650 ng / mL to about 1000 ng / mL, about 675 ng / mL to about 1000 ng / mL, about 675 ng / mL to about 1000 ng / mL, about 700 ng / mL to about 1000 ng / mL, about 725 ng / mL to about 1000 ng / mL, about 750 ng / mL to about 1000 ng / mL, about 775 ng / mL to about 1000 ng / mL, about 800 ng / mL to about 1000 ng / mL, about 825 ng / mL to about 1000 ng / mL, about 850 ng / mL to about 1000 ng / mL, about 875 ng / mL to about 1000 ng / mL, about 900 ng / mL to about 1000 ng / mL, about 925 ng / mL to about 1000 ng / mL, about 950 ng / mL to about 1000 ng / mL, about 975 ng / mL to about 1000 ng / mL, or any increment in between). The methods can include determining that the subject has a Tmax(time to Cmax) for Compound A of about 0.5 hrs to 8 hrs (e.g. about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8 hrs, or any increment in between). The methods can include determining that the subject has a T1 / 2(time required for plasma concentration of Compound A to decrease by 50%) for Compound A of about 1 hrs to 9 hrs (e.g. about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9 hrs, or any increment in between). The methods can include determining that the subject has an AUC0-last (area under the plasma concentration-time curve from time zero to the time of the last quantifiable concentration, calculated by linear up / log down trapezoidal summation) for Compound A of about 2000 ng*h / mL to about 40000 ng*h / mL (e.g. about 2500 ng*h / mL to about 40000 ng*h / mL, about 3000 ng*h / mL to about 40000 ng*h / mL, about 3500 ng*h / mL to about 40000 ng*h / mL, about 4000 ng*h / mL to about 40000 Attorney Docket No.38709-0131WO1 ng*h / mL, about 4500 ng*h / mL to about 40000 ng*h / mL, about 5000 ng*h / mL to about 40000 ng*h / mL, about 5500 ng*h / mL to about 40000 ng*h / mL, about 6000 ng*h / mL to about 40000 ng*h / mL, about 6500 ng*h / mL to about 40000 ng*h / mL, about 7000 ng*h / mL to about 40000 ng*h / mL, about 7500 ng*h / mL to about 40000 ng*h / mL, about 8000 ng*h / mL to about 40000 ng*h / mL, about 8500 ng*h / mL to about 40000 ng*h / mL, about 9000 ng*h / mL to about 40000 ng*h / mL, about 9500 ng*h / mL to about 40000 ng*h / mL, about 10000 ng*h / mL to about 40000 ng*h / mL, about 15000 ng*h / mL to about 40000 ng*h / mL, about 20000 ng*h / mL to about 40000 ng*h / mL, about 25000 ng*h / mL to about 40000 ng*h / mL, about 30000 ng*h / mL to about 40000 ng*h / mL, about 35000 ng*h / mL to about 40000 ng*h / mL, or any increment in between). The methods can include determining that the subject has a AUC0-∞ (after the first dose, area under the plasma concentration-time curve from time zero extrapolated to infinity, calculated by linear up / log down trapezoidal summation) for Compound A of about 3000 ng*h / mL to about 50000 ng*h / mL (e.g. about 3500 ng*h / mL to about 50000 ng*h / mL, about 4000 ng*h / mL to about 50000 ng*h / mL, about 4500 ng*h / mL to about 50000 ng*h / mL, about 5000 ng*h / mL to about 50000 ng*h / mL, about 5500 ng*h / mL to about 50000 ng*h / mL, about 6000 ng*h / mL to about 50000 ng*h / mL, about 6500 ng*h / mL to about 50000 ng*h / mL, about 7000 ng*h / mL to about 50000 ng*h / mL, about 7500 ng*h / mL to about 50000 ng*h / mL, about 8000 ng*h / mL to about 50000 ng*h / mL, about 8500 ng*h / mL to about 50000 ng*h / mL, about 9000 ng*h / mL to about 50000 ng*h / mL, about 9500 ng*h / mL to about 50000 ng*h / mL, about 10000 ng*h / mL to about 50000 ng*h / mL, about 15000 ng*h / mL to about 50000 ng*h / mL, about 20000 ng*h / mL to about 50000 ng*h / mL, about 25000 ng*h / mL to about 50000 ng*h / mL, about 30000 ng*h / mL to about 50000 ng*h / mL, about 35000 ng*h / mL to about 50000 ng*h / mL, about 40000 ng*h / mL to about 50000 ng*h / mL, about 45000 ng*h / mL to about 50000 ng*h / mL, or any increment in between). In some embodiments of any of the methods described herein, step (a) can include administering Compound A at a dose of about 10 mg to about 125 mg (e.g., about 12.5 mg, about 25 mg, about 50 mg, about 100 mg) about every 4 weeks (e.g., about every 28 days). In other words, in some embodiments, Compound A is administered to a subject on day 1 and then about every 4 weeks or about every 28 Attorney Docket No.38709-0131WO1 days (e.g., the subject is administered Compound A on day 1, on day 29 (+ / - 3 days), on day 57 (+ / - 3 days), on day 85 (+ / - 3 days), on day 113 (+ / - 3 days), and so on). Step (b) of the methods described herein can include obtaining a blood sample from the subject about 30 minutes to about 8 hours (e.g. about 1, 2, 3, 4, 5, 6, or 7 hours) after each dose (i.e., after receiving a dose on day 1, on day 29 (+ / - 3 days), on day 57 (+ / - 3 days), on day 85 (+ / - 3 days), on day 113 (+ / - 3 days), and so on) of the composition comprising Compound A. The disclosures of all publications cited herein are expressly incorporated herein by reference, each in its entirety, to the same extent as if each were incorporated by reference individually. It is to be understood that while the disclosure has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the disclosure, which is defined by the scope of the appended claims. The following are numbered embodiments intended to further illustrate, but not limit, the scope of the disclosure. EXAMPLES Example 1: Stability Studies for Compound A Stability studies have been conducted for the Compound A drug product (Compound A in aCSF formulation). Each 6R glass vial of Compound A contains the components shown in Table 3. Table 3: Components of Compound A Formulation. Attorney Docket No.38709-0131WO1 The drug product was stored long-term in a 6R glass vial with a rubber stopper and flip cap at 5±3°C and protected from light. Stability testing for the drug product lot was performed per the methods as described below. Analytical Procedures The specification for Compound A drug product incorporates appropriate tests for a parenteral dosage form. All analytical methods have been qualified or validated as suitable for use in this phase of development. Appearance (Pharmacopoeia of Europe and Japan (Ph. Eur., JP.), incorporated herein by reference in its entirety) The physical state and color of the material is evaluated visually per Ph. Eur. / JP. pH (Potentiometry, USP<791>, Ph. Eur., JP., incorporated herein by reference in its entirety) The pH is determined by potentiometry per USP<791> / Ph. Eur. / JP. Osmolality (Freezing Point Depression, USP<785>, Ph. Eur., JP., incorporated herein by reference in its entirety) The osmolality is determined using freezing point depression per USP <785> / Ph. Eur. / JP. Sub-visible Particles (USP<788>, Ph. Eur., JP., incorporated herein by reference in its entirety) The sub-visible particulate matter is determined by light obscuration per USP<788> / Ph. Eur. / JP at the channels of ≥ 10 µm and ≥ 25 µm. Bacterial Endotoxins (USP<85>, Ph. Eur., JP., incorporated herein by reference in its entirety) The bacterial endotoxins are measured using Limulus-Amoebocyte-Lysate (LAL-Test) kinetic turbidimetric assay per USP <85> / Ph. Eur. / JP. Attorney Docket No.38709-0131WO1 Sterility (USP<71>, Ph. Eur., JP., incorporated herein by reference in its entirety) The sterility is determined using membrane filtration method per USP <71> / Ph. Eur. / JP. Extractable Volume (USP<697>, Ph. Eur., JP., incorporated herein by reference in its entirety) The extractable volume is determined per USP <697> / Ph. Eur. / JP. Assay (USP<857>, (Pharmacopoeia of Europe (Ph. Eur.), incorporated herein by reference in its entirety) The assay (concentration) is determined by UV absorption of a 0.04mg / mL solution in aCSF at 260nm with the experimental extinction coefficient and is corrected by purity according to the following formula: Assay (mg / mL) = [F * Abs260nm * Mfree acid (g / mol) * Purity (%)] / [εfree acid (1 / (mM * cm)) * 1(cm) * 100000] Where: F = [c(DP solution)] / [c(mean value from 2nmeasuring solutions)] Abs260nm = absorption at 260 nm Mree acid = molec -1 f ular weight of free acid form = 7188.89 g mol c = concentration Purity (%) = Purity by IPRP-HPLC – N+1 impurity content by LC-MS ε = experimental extinction coefficie - free acid nt in aCSF = 152.164 mM1cm-1Identity by Retention Time (IPRP-HPLC) The identity is determined by an ion-pair reversed-phase high-performance liquid chromatography method (IPRP-HPLC). The retention time of Compound A in the sample is compared with the retention time of reference material. Attorney Docket No.38709-0131WO1 Purity and Impurities (IPRP-HPLC) An ion-pair reversed-phase high-performance liquid chromatography coupled with ultraviolet detection method (IP-RP-UHPLC-UV) is used for the analysis of purity and impurity of the drug product by measuring at a wavelength of 260 nm and using a C18 reversed-phase column with two eluent buffer system. Relative retention times (RRT) to the respective full-length product (FLP) are calculated, and peak areas of the parent compound and the related impurities are determined for purity / impurity analysis. The impurities are grouped based on their relative retention times (RRT). The peaks eluted before the FLP (RRT<1.000) are considered as Group A, and the peaks eluted after the FLP (RRT>1.000) are considered as Group B. The percentage of each group relative to FLP is reported. Elemental Impurities (USP<233>, Ph. Eur. 2.2.58, Ph. Eur. 2.4.20, incorporated herein by reference in its entirety) Elemental impurities are determined by oxidative degradation of the sample matrix followed by mineralization and dissolution of the analyte. Analyte concentrations in the test solution are determined by ICP-MS measurement per USP<233> / Ph. Eur. Specifications The specifications for the drug product are presented in Table 4 below. Table 4: Compound A Drug Product Specifications. Attorney Docket No.38709-0131WO1 Attorney Docket No.38709-0131WO1 a Group A corresponds to the sum of all impurities with RRT<1.000.b Group B corresponds to the sum of all impurities with RRT>1.000.c Total Impurities = 100%-Purity(%).Abbreviations: EU = endotoxin unit; IPRP-HPLC = ion-pairing, reversed-phase, high- performance liquid chromatography; NLT = Not Less Than; NMT = Not More Than; Ph. Eur. = European Pharmacopoeia; RRT = relative retention time; USP = United States Pharmacopoeia; UV = ultraviolet Data Stability data are available for 12 months at the long-term 5±3°C, accelerated 25±2°C / 60±5% relative humidity (RH), and 6 months at the stressed 40±2°C / 75±5% RH storage conditions and the data is summarized in Table 5, Table 6, and Table 7, below respectively.
[0004] Attorney Docket No.38709-0131WO1 orP, serrse ,f eyllbist eneg 0adeil ts6 1ullrlrColuqasi co vitis .9.72.01.2 cilcitc frano 1 8 1Daro p Crp ofy ,tr lc aocna atiro ettnotsr w,ylla felsenofdnue shitne en h ofec0.2 % L0.trtl)atrtmotpeir aecelseseoldillrleucio bqtcee ilcsiiethito eot eltst ito en erTn er2om / 0aeout p mserolusmnipimsh n ntietmeftg8 rapeera peermorcCaolyilarrfvae ito Ae it0.m T R%Ru PcC p p e oocprCasocwrer8 L(1 NSAata eD mi) t ny noiAp )Bptieotit artu 00 uli ct nnenoyr0.orbatsearteec tG1G nirS Taepro use< s:p y Teb C Pi(tirRitir5AytuelityapR(upbnessAmImIadIT Attorney Docket No.38709-0131WO1 %aer a1.02.02.01.03.02.D 0 N6.05.06.00.13.08.05.05.06.34.07.02.01.D 0 N T 64 81 35 58 23 85 91 27 99 04 0 0 1 8 3 4 1 2 0 R2.3 3 3 4 4D5 5 5 68 6 5 7 2 082 096 098 003 116 111 12D R 0.0.0.0.0.0 N.0.0.0.0.0. . . . . . . .1 N a er%a trodna%p ae0. eTra0 R 2 R R a erayt% ir0 u1.P- 0 0≥0s1eitirup mI Attorney Docket No.38709-0131WO1 a3 . 1 h 1 D D 0 N N1.0Te6 0 R R1.R Rro 95 5 N N 7 N N M 3.D D 1t1 N N6.1 o N:2 1.0 D 1 g T h 01.0 N1.0tk / M w 7mN 1 05.0or1. sO R;4 <G7 m Nn6 4 4 oa3 6 .5.D 2 6.N 72 h 1 1 N 1 3 Tss / 0f eL 00sere / s reLht6.6g 0l ni0el ni5.w7 3 k / oen n(yoeotdithr s) emto 6citat0c≤ran6 itatn0 m / oro om≤Ug t ts ssearto ait eugiot r etsN:poc≤rapocE o8.4 N 6 9O 2 m Plb mnietnihtysTL N;ete elatlaulb cu ait c citaytilrrmrrmniyp eet a tilp ltaµ0p eett µx 5otiliHalTIp A bl aorp o Ctim1 bm2detmC o si≥isvi≥ n E Ss-vONb - b:u S u SA / N Attorney Docket No.38709-0131WO1 Table 6: Stability Data Summary for Drug Product Lot A under Conditions of 25±2°C / 60±5%RH. Attorney Docket No.38709-0131WO1 Attorney Docket No.38709-0131WO1 N / A: Not Applicable; NLT: Not Less Than; NMT: Not More Than; NT = Not Tested; ND = None Detected
[0005] Attorney Docket No.38709-0131WO1 Table 7: Stability Data Summary for Drug Product Lot A under conditions of 40±2°C / 75±5%RH. Attorney Docket No.38709-0131WO1 N / A: Not Applicable; NLT: Not Less Than; NMT: Not More Than; NT = Not Tested; ND = None Detected This Example thus shows that Compound A formulations, as described herein, are stable across multiple storage conditions.
Claims
Attorney Docket No.38709-0131WO1 WHAT IS CLAIMED IS:
1. A formulation comprising: an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide comprises ATCAGTTTCTGTAGGCTTCC (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 are 2’-O-methoxyethylribose modified nucleosides, wherein the internucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5-methylcytosine; and at least one of a pharmaceutically acceptable carrier or diluent comprising physiological levels of one or more electrolytes, one or more buffering agents, and / or one or more solvents suitable for intrathecal injection.
2. The formulation of claim 1, wherein the one or more electrolytes comprise: sodium chloride, potassium chloride, calcium chloride dihydrate, and / or magnesium chloride hexahydrate.
3. The formulation of claim 1 or 2, wherein the one or more buffering agents comprise: di-sodium phosphate, monosodium phosphate.
4. The formulation of any one of claims 1 to 3, wherein the solvent comprises water.
5. The formulation of any one of claims 1 to 4, further comprising one or more pH adjusting buffers.
6. The formulation of claim 5, wherein the pH adjusting buffers comprise hydrochloric acid and / or sodium hydroxide.
7. The formulation of any one of claims 1 to 6, wherein the concentration of the antisense oligonucleotide is about 5 mg / ml to about 30 mg / ml.Attorney Docket No.38709-0131WO1 8. The formulation of claim 7, wherein the concentration is about 10 mg / ml to about 25 mg / ml.
9. The formulation of claim 7 or claim 8, wherein the concentration is about 20 mg / ml.
10. The formulation of any one of claims 1 to 7, wherein the formulation comprises the following: (a) 5 mg / ml to 30 mg / ml of the antisense oligonucleotide, (b) 5 mg / ml to about 15 mg / ml of sodium chloride, (c) 0.1 mg / ml to about 1 mg / ml of potassium chloride, (d) 0.1 mg / ml to about 1 mg / ml of calcium chloride dihydrate, (e) 0.1 mg / ml to about 1 mg / ml of magnesium chloride hexahydrate, (f) 0.05 mg / ml to about 1 mg / ml of di-sodium phosphate, (g) 0.01 mg / ml to about 0.1 mg / ml of monosodium phosphate, (h) sodium hydroxide; as needed for buffering, (i) hydrochloric acid; as needed for buffering, and (j) Quantum satis amount of water.
11. The formulation of claim 10, wherein the formulation comprises the following: (a) 20 mg / ml of the antisense oligonucleotide, (b) 8.77 mg / ml of sodium chloride, (c) 0.22 mg / ml of potassium chloride, (d) 0.21 mg / ml of calcium chloride dihydrate, (e) 0.16 mg / ml of magnesium chloride hexahydrate, (f) 0.11 mg / ml of di-sodium phosphate, (g) 0.03 mg / ml of monosodium phosphate, (h) sodium hydroxide; as needed for buffering, (i) hydrochloric acid; as needed for buffering, and (j) Quantum satis amount of water.Attorney Docket No.38709-0131WO1 12. The formulation of any one of claims 1 to 10, wherein the antisenseoligonucleotide has the following structure:, or a pharmaceutically acceptable salt thereof.Attorney Docket No.38709-0131WO1 13. The formulation of any one of claims 1 to 12, wherein the antisense oligonucleotide has the following structure:.
14. The formulation of any one of claims 1 to 13, wherein the formulation comprises one or more impurities relative to the antisense oligonucleotide.
15. The formulation of claim 14, wherein the formulation comprises not more than about 15% impurities.
16. The formulation of claim 14 or 15, wherein the formulation comprises not more than about 11% impurities having a relative retention time (RRT) of < 1.
00.
17. The formulation of any one of claims 14 to 16, wherein the formulation comprises not more than about 4% impurities having an RRT of > 1.
00.
18. The formulation of any one of claims 14 to 17, wherein the formulation comprises not more than: (a) 0.17% of an impurity having an RRT of about 0.240 to about 0.250;Attorney Docket No.38709-0131WO1 (b) 0.30% of an impurity having an RRT of about 0.310 to about 0.320; (c) 0.23% of an impurity having an RRT of about 0.345 to about 0.355; (d) 0.13% of an impurity having an RRT of about 0.380 to about 0.390; (e) 0.46% of an impurity having an RRT of about 0.425 to about 0.440; (f) 0.23% of an impurity having an RRT of about 0.450 to about 0.465; (g) 0.10% of an impurity having an RRT of about 0.475 to about 0.485; (h) 0.74% of an impurity having an RRT of about 0.510 to about 0.525; (i) 0.65% of an impurity having an RRT of about 0.510 to about 0.525; (j) 0.59% of an impurity having an RRT of about 0.565 to about 0.580; (k) 0.76% of an impurity having an RRT of about 0.590 to about 0.605; (l) 1.14% of an impurity having an RRT of about 0.630 to about 0.645; (m) 0.41% of an impurity having an RRT of about 0.670 to about 0.685; (n) 0.88% of an impurity having an RRT of about 0.740 to about 0.755; (o) 0.53% of an impurity having an RRT of about 0.815 to about 0.825; (p) 0.58% of an impurity having an RRT of about 0.920 to about 0.930; (q) 3.71% of an impurity having an RRT of about 0.960 to about 0.965; (r) 0.56% of an impurity having an RRT of about 0.920 to about 0.930; (s) 1.13% of an impurity having an RRT of about 1.075 to about 1.085; (t) 0.84% of an impurity having an RRT of about 1.125 to about 1.135; (u) 0.28% of an impurity having an RRT of about 1.160 to about 1.175; (v) 0.17% of an impurity having an RRT of about 1.205 to about 1.260; (w) 0.11% of an impurity having an RRT of about 1.275 to about 1.280; (x) 0.17% of an impurity having an RRT of about 1.305 to about 1.325; (y) 0.17% of an impurity having an RRT of about 1.355 to about 1.380; (z) 0.14% of an impurity having an RRT of about 1.560 to about 1.570; and / or (aa) 0.14% of an impurity having an RRT of about 1.610 to about 1.
640.
19. The formulation of any one of claims 14 to 18, wherein the amount of each impurity is determined after about 1 month to about 48 months (or any increment in between) of storage at (a) about 5°C, (b) about 25°C and about 60% relative humidity, or (c) about 40°C and about 75% relative humidity.Attorney Docket No.38709-0131WO1 20. The formulation of any one of claims 1 to 19, wherein the formulation is formulated as a solution for intrathecal administration.
21. The formulation of any one of claims 1 to 20, wherein the concentration of the antisense oligonucleotide in the formulation is substantially the same concentration as the initial concentration after about 1 month to about 48 months (or any increment in between) of storage at (a) about 5°C, (b) about 25°C and about 60% relative humidity, or (c) about 40°C and about 75% relative humidity.
22. The formulation of any one of claims 1 to 13, wherein the formulation is considered stable if the formulation comprises one or more of the following properties: (a) the appearance is clear to opalescent, colorless to yellow liquid, and is practically free of visible particles, (b) the retention time of Compound A in the formulation comprising Compound A is consistent with the retention time of reference standard comprising Compound A (which is a standard that was generated with one of the first lots of Compound A made), (c) the concentration of Compound A remains about 18 mg / ml to about 22.0 mg / ml, (d) the amount of sub-visible particulate matter that has a size of > 10 μm remains ≤ 6000 particles per vial, (e) the amount of sub-visible particulate matter that has a size of > 25 μm remains ≤ 600 particles per vial, (f) the amount of endotoxin remains ≤ 0.5 EU / mL, (g) the formulation remains sterile and uncontaminated, (h) the pH remains between about 6.8 to about 7.6, and / or (i) the osmolality remains about 294 to about 360 mOsm / kg.
23. The formulation of claim 22, wherein any one of the properties is determined after about 1 week, after about 2 weeks, after about 3 weeks, after about 1 month to about 48 months (or any increment in between) of storage at (a) about 5+3°C, (b) about 25+2°C and about 60+5% relative humidity, (c) about 40+2°C andAttorney Docket No.38709-0131WO1 about 75+5% relative humidity, or (d) about 40°C to about 60°C and about 60% to about 75% relative humidity.
Citation Information
Patent Citations
Use of AKT phosphorylation as a biomarker for prognosing neurodegenerative diseases and treating same
WO2012160563A2
Compositions and methods for modulation of SMN2 splicing in a subject
WO2014110291A1
Antisense oligomers for treatment of conditions and diseases
WO2021113541A1
Oligonucleotide compositions and methods thereof
WO2023220087A1