Nucleic acid molecule for inhibiting or reducing expression of target gene angptl3 and use thereof
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-08-13
- Publication Date
- 2026-04-09
AI Technical Summary
Current inhibitors targeting ANGPTL3 are not sufficiently effective in reducing its expression, and there is a need for a more targeted and efficient siRNA medicament to treat hyperlipidemia-related diseases.
Development of nucleic acid molecules, specifically siRNAs with modified sequences and delivery systems, such as GalNAc-conjugated siRNAs, to inhibit ANGPTL3 expression in liver cells, using 2’-O-methyl and 2’-fluoro modifications and phosphorothioate linkages, combined with targeted delivery vectors like GalNAc vectors and liposomes.
The modified siRNAs effectively inhibit ANGPTL3 expression by up to 100%, reducing serum levels of LDL-C, VLDL-C, and triglycerides, thereby preventing and treating dyslipidemia and cardiometabolic diseases.
Smart Images

Figure CN2025114467_09042026_PF_FP_ABST
Abstract
Description
Nucleic acid molecule for inhibiting or reducing expression of target gene ANGPTL3 and use thereofTechnical Field
[0001] The present application relates to the field of siRNAs, and in particular, to a nucleic acid molecule for inhibiting or reducing the expression of target gene ANGPTL3 and use thereof.Background
[0002] Angiopoietin-like 3 (ANGPTL3) is a key regulator of serum lipid and lipoprotein metabolism, is mainly expressed in the liver, and plays a role in regulating lipid metabolism by inhibiting lipoprotein lipase (LPL) and endothelial lipase (EL) . LPL and EL play a key role in the catabolism of triglyceride (TG) , high-density lipoprotein cholesterol (HDL-C) and very low-density lipoprotein cholesterol (VLDL-C) . Inactivating mutations of the ANGPTL3 gene may lead to a decrease in TG, HDL-C, and LDL-C, thereby reducing the risk of developing atherosclerotic cardiovascular disease (ASCVD) . Thus, inhibiting the activity or expression of ANGPTL3 can be used as a lipid-lowering strategy.
[0003] Different types of inhibitors targeting ANGPTL3 have been developed, wherein GalNAc-conjugated siRNA medicaments have been proved to have excellent targeting performance on the liver, and have good tolerance and long-lasting efficacy. Therefore, there is a need to develop an siRNA medicament for the target, and provide a candidate medicament for treating related diseases caused by hyperlipidemia.Summary
[0004] On this basis, the object of the present application is to provide a nucleic acid molecule and a use thereof. The nucleic acid molecule has biological activity of effectively inhibiting or reducing the expression of target gene ANGPTL3.
[0005] In a first aspect of the present application, provided is a nucleic acid molecule for inhibiting or reducing the expression of a target gene ANGPTL3, comprising a sense strand and an antisense strand, wherein the siRNA is at least one pair selected from the following sequences or modified sequences thereof:
[0006] A3-038: the sense strand thereof is as shown in SEQ ID NO: 75, and the antisense strand thereof is as shown in SEQ ID NO: 76;
[0007] A3-041: the sense strand thereof is as shown in SEQ ID NO: 81, and the antisense strand thereof is as shown in SEQ ID NO: 82; or
[0008] A3-043: the sense strand thereof is as shown in SEQ ID NO: 118, and the antisense strand thereof is as shown in SEQ ID NO: 119; or
[0009] A3-044: the sense strand thereof is as shown in SEQ ID NO: 120, and the antisense strand thereof is as shown in SEQ ID NO: 121.
[0010] SEQ ID NO: 118: UCAAACCAAUGAAAUCAAAGA,
[0011] SEQ ID NO: 119: UCUUUGAUUUCAUUGGUUUGAAG.
[0012] SEQ ID NO: 120: UCUUUGAUUUCACUGGUUACUCAACUCAAA,
[0013] SEQ ID NO: 121: UUUGAGUUGAGUUCAAGUUGAAAUCAAAGA.
[0014] In some examples, bases of the sense strand are modified, the modifications comprises 2’-O-methyl modification on bases at positions 1 to 6, 8, 12, 14, and 1 to 6 from the 3’ end, 2’ -fluoro modification on bases at positions 7, 9, and 11, and both phosphodiester linkages between positions 1 and 2, between position 2 and 3 from the 3’ end are replaced by phosphorothioate linkages.
[0015] In some examples, bases of the antisense strand are modified, the modifications in the antisense strand comprise 2’ -O-methyl modification on bases at positions 1, 3, 5, 7, 11, 13, 15, 1 to 5 from the 3’ end, and 7 from the 3’ end, 2’ -fluoro modification on bases at positions 2, 6, 8, 14, and 8 from the 3’ end, and both phosphodiester linkages between position 1 and 2, between position 2 and 3, and between positions 1 and 2, between position 2 and 3 from the 3’ end are replaced by phosphorothioate linkages.
[0016] In some examples, the sense strand is any one selected from:
[0017] mGmCmAmAmAmCfCmAfGmUfGmAfAmAfUmCmAmAmA*mG*mA (SEQ ID NO: 85) ,
[0018] mGmCmAmAmAmCfCmAfGfUfGmAmAmAmUmCmAmAmA*mG*mA (SEQ ID NO: 86) ,
[0019] mGmUmCmAmCmUfUmGfAmAfCmUfCmAfAmCmUmCmA*mA*mA (SEQ ID NO: 87) ,
[0020] mGmUmCmAmCmUfUmGfAfAfCmUmCmAmAmCmUmCmA*mA*mA (SEQ ID NO: 88) ,
[0021] mGmCmAmAmAmCfCmAfGfUfGmAfAmAfUmCmAmAmA*mG*mA (SEQ ID NO: 89) ,
[0022] UCUUUGAUUUCACUGGUUACUCAAmCmUmCmAmAmA (SEQ ID NO: 113) ,
[0023] mG*mU*mC*mAmCmUfUmGfAmAfCmUfCmAfAmCmUmCmAmAmA (SEQ ID NO: 90) ,
[0024] mG*mU*mCmAmCmUfUmGfAfAfCmUmCmAmAmCmUmCmAmAmA (SEQ ID NO: 91) ,
[0025] mG*mU*mCmAmCmUfUmGfAmAfCmUfCmAfAmCmUmCmA*mA*mA (SEQ ID NO: 92) ,
[0026] mG*mU*mC*mAmCmUfUmGfAfAfCmUmCmAmAmCmUmCmA*mA*mA (SEQ ID NO: 93) ,
[0027] wherein, f: 2’ -fluoro modification, m: 2’ -O-methyl modification, and *: nucleotides located on the left and right sides of *are connected by a phosphorothioate linkage.
[0028] In some examples, the antisense strand is at least one selected from:
[0029] mU*fC*mUmUmUfGmAfUmUfUmCmAmCfUmGfGmUmUmUmGmC*mA*mG (SEQ ID NO: 94) ,
[0030] mU*fC*mUfUmUfGmAfUfUmUmCmAmCfUmGfGmUfUmUmGmC*mA*mG (SEQ ID NO: 95) ,
[0031] mU*fC*mUmUmUfGmAfUmUfUmCfAmCfUmGfGmUfUmUmGmC*mA*mG (SEQ ID NO: 96) ,
[0032] mU*fU*mUmGmAfGmUfUmGfAmGmUmUfCmAfAmGmUmGmAmC*mA*mU (SEQ ID NO: 97) ,
[0033] mU*fU*mUfGmAfGmUfUfGmAmGmUmUfCmAfAmGfUmGmAmC*mA*mU (SEQ ID NO: 98) ,
[0034] mU*fU*mUmGmAfGmUfUmGfAmGfUmUfCmAfAmGfUmGmAmC*mA*mU (SEQ ID NO: 99) ,
[0035] mU*fC*mUfUmUfGmAfUmUfUmCfAmCfUmGfGmUfUmUmGmC*mA*mG (SEQ ID NO: 100) ,
[0036] UUUGAGUUGAGUUCAAGUUGAAAUmCmAmAmAmGmA (SEQ ID NO: 114) ,
[0037] VP*fU*mU*fGmAfGmUfUfGmAmGmUmUfCmAfAmGfUmGmA*mC*mA*mU (SEQ ID NO: 101) ,
[0038] VP*fU*mUmGmAfGmUfUmGfAmGmUmUfCmAfAmGmUmGmAmC*mA*mU (SEQ ID NO: 102) ,
[0039] VP*fU*mUfGmAfGmUfUfGmAmGmUmUfCmAfAmGfUmGmAmC*mA*mU (SEQ ID NO: 103) ,
[0040] VP*dT*mUfGmAfGmUdT*fGmAmGmUmUfCmAfAmGdT*mGmAmC*mA*mU (SEQ ID NO: 104) ,
[0041] VP*fU*mUfGmAfGmUdT*fGmAmGmUmUfCmAfAmGdT*mGmAmC*mA*mU (SEQ ID NO: 105) ,
[0042] VP*fU*mU*mGmAfGmUfUmGfAmGmUmUfCmAfAmGmUmGmA*mC*mA*mU (SEQ ID NO: 106) ,
[0043] VP*fU*mU*mGmAfGmUfUmGfAmGmUmUdC*mAfAmGmUmGmA*mC*mA*mU (SEQ ID NO: 107) ,
[0044] VP*fU*mU*mGmAfGmUfUmGdA*mGmUmUdC*mAdA*mGmUmGmA*mC*mA*mU (SEQ ID NO: 108) ;
[0045] wherein f: 2’ -fluoro modification, m: 2’ -O-methyl modification, *: nucleotides located on the left and right sides of *are connected by a phosphorothioate linkage, and VP: 2’-O-methyl-5’ - [ (E) -vinylphosphonate] -3’ -phosphate-uridine.
[0046] In some preferred examples, the siRNA is at least one pair of modified sequences selected from:
[0047] A3-041-2: the sense strand thereof is as shown in mGmUmCmAmCmUfUmGfAmAfCmUfCmAfAmCmUmCmA*mA*mA (SEQ ID NO: 87) , and the antisense strand thereof is as shown in mU*fU*mUfGmAfGmUfUfGmAmGmUmUfCmAfAmGfUmGmAmC*mA*mU (SEQ ID NO: 98) ; and
[0048] A3-041-4: the sense strand thereof is as shown in mGmUmCmAmCmUfUmGfAfAfCmUmCmAmAmCmUmCmA*mA*mA (SEQ ID NO: 88) , and the antisense strand thereof is as shown in mU*fU*mUmGmAfGmUfUmGfAmGmUmUfCmAfAmGmUmGmAmC*mA*mU (SEQ ID NO: 97) .
[0049] In a second aspect of the present application, provided is use of any of the described nucleic acid molecules in the preparation of a biological formulation or pharmaceutical formulation for inhibiting or reducing the expression of target gene ANGPTL3.
[0050] In a third aspect of the present application, provided is a conjugate for inhibiting or reducing the expression of target gene ANGPTL3, comprising any of the described nucleic acid molecules and a targeted delivery ligand linked to the nucleic acid molecule.
[0051] As to the targeted delivery ligand or other types of delivery vectors of the present application, a known N-acetyl galactosamine derivative (Galnac vector) can be selected as the ligand, and other types of delivery vectors such as liposomes specifically delivered to liver cells can be used in the present application as long as the delivery of the siRNA can be achieved.
[0052] In some examples, the ligand is linked to the sense strand of the nucleic acid molecule, and the structure of the ligand is
[0053] wherein R1 is a moiety binding to an asialoglycoprotein receptor (ASGPR) ;
[0054] R2 is -CH2-, C6-14 aryl, C2-6 alkenyl, or C2-6 alkynyl;
[0055] R3 is -O-, C6-14 aryl, or 3 to 10-membered heterocyclyl;
[0056] R4 is -CH2-, C6-14 aryl, or 3 to 10-membered heterocyclyl;
[0057] R5 is -OH, -COOH or
[0058] PG is a carboxyl protecting group;
[0059] PG2 is a hydroxyl protecting group;
[0060] a, b, c, and d are each independently any integer of 1-10; and n is any integer of 1-3.
[0061] In some examples, the terminal of the R1 moiety is galactose or N-acetylgalactosamine; and the R1 moiety is any one selected from the following structures:
[0062] wherein q and q’ are each independently any integer of 1-10.
[0063] In some examples, the carboxyl protecting group is selected from succinate ester, pentafluorophenol ester, and wherein h is any integer of 1-5.
[0064] In some examples, the hydroxyl protecting group is selected from silyl, monomethoxytrityl (MMTr) , 4, 4’ -dimethoxytrityl (DMTr) , and trityl; and optionally, the silyl is selected from t-butyldimethylsilyl ether (TBMDS) , t-butyldiphenylsilyl (TBDPS) , and triisopropylsilyl ether (TIPS) .
[0065] In some examples, the compound has the following structure:
[0066] In some examples, the conjugate formed by linking the sense strand to the ligand compound is:
[0067] wherein,
[0068] R1 is a moiety binding to ASGPR;
[0069] R2 is -CH2-, C6-14 aryl, C2-6 alkenyl, or C2-6 alkynyl;
[0070] R3 is -O-, C6-14 aryl, or 3 to 10-membered heterocyclyl;
[0071] R4 is -CH2-, C6-14 aryl, or 3 to 10-membered heterocyclyl;
[0072] R is O or S;
[0073] Rx is an siRNA;
[0074] a, b, c, and d are each independently any integer of 1-10; and
[0075] n is any integer of 1-3.
[0076] In a fourth aspect, provided is use of any of the described conjugates in the preparation of a product for preventing or alleviating or treating diseases related to the expression of target gene ANGPTL3.
[0077] In some examples, the product is a biological formulation or pharmaceutical formulation.
[0078] In a fifth aspect of the present application, provided is a pharmaceutical composition, wherein active ingredients of the pharmaceutical composition comprise any of the described conjugates for inhibiting or reducing the expression of target gene ANGPTL3 and a pharmaceutically acceptable excipient.
[0079] In a sixth aspect of the present application, provided is a method for inhibiting or reducing the expression of the target gene ANGPTL3, wherein the method comprises administering to a subject a suitable dose of any of the described nucleic acid molecule, any of the described conjugate, and / or any of the described pharmaceutical composition.
[0080] In a seventh aspect of the present application, provided is a method for inhibiting or reducing the expression of target gene ANGPTL3 in cells, comprising the steps of:
[0081] (1) obtaining cells to be transfected and any of the described nucleic acid molecule, any of the described conjugate, and any of the described pharmaceutical composition;
[0082] (2) mixing the nucleic acid molecule or the conjugate or the pharmaceutical composition with the cells to be transfected and transfecting the cells; and
[0083] (3) performing cell culture.
[0084] In some examples, the cells are in a subject, or the cells are cells in vitro of a subject.
[0085] In some examples, the subject is a mammal, and preferably, the mammal is human.
[0086] In some of these examples, target gene ANGPTL3 expression is inhibited by at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, or about 100%.
[0087] The nucleic acid molecule or conjugate is used for preparing a product for preventing or treating diseases mediated by target gene ANGPTL3. The diseases mediated by target gene ANGPTL3s include, but are not limited to, dyslipidemia diseases, cerebrovascular diseases, and cardiometabolic diseases. The nucleic acid molecule or conjugate or the biological formulation or the pharmaceutical formulation comprising these substances are used to reduce the level of LDL-C, VLDL-C, HDL-C, and triglycerides (TG) in vivo of a subject or in cells.
[0088] The dyslipidemia diseases include hyperlipidemia, hypertriglyceridemia or high low-density lipoprotein (LDL) .
[0089] For example, cardiometabolic diseases associated with dyslipidemia are prevented or treated or preventively treated, such as hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid, cholesterol metabolism, atherosclerosis, type II diabetes, thrombosis, coronary heart disease, heart stroke, brain stroke, aortic stenosis, coronary artery disease, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, homozygous or heterozygous familial hypercholesterolemia, statins resistant hypercholesterolemia, or other metabolic related disorders and diseases.
[0090] According to the present application, a plurality of siRNAs capable of inhibiting the expression of target gene ANGPTL3 are screened through extensive research and experiments on nucleic acid molecules (siRNA sequence) , and on this basis, appropriate modifications are made to improve the silencing capability of the target and reduce the activity of non-targets. Moreover, a self-developed delivery system enables the siRNA to be delivered to the liver for targeted effects. The nucleic acid molecules and conjugates are expected to be used in the clinical prevention and treatment of diseases such as dyslipidemia diseases, cerebrovascular diseases, and cardiometabolic diseases associated with ANGPTL3 target gene.Brief Description of the Drawings
[0091] Fig. 1 is a schematic representation of the results of expression inhibition of ANGPTL3 gene by A3-041-2 siRNA.
[0092] Fig. 2 is a schematic representation of the results of expression inhibition of ANGPTL3 gene by A3-041-4 siRNA.
[0093] Fig. 3 is a schematic representation of the results of expression inhibition of ANGPTL3 gene by A3-038-6 siRNA.
[0094] Fig. 4 is a schematic representation of the results of expression inhibition of ANGPTL3 gene by A3-038-6-1 siRNA.
[0095] Fig. 5 is a schematic representation of the results of expression inhibition of ANGPTL3 gene by A3-038-6-2 siRNA.
[0096] Fig. 6 shows the serum TG change following administration in Experiment 1 of Example 4.
[0097] Fig. 7 shows the ANGPTL3 mRNA change in liver following administration in Experiment 1 of Example 4.
[0098] Fig. 8 shows the serum TG change following administration in Experiment 2 of Example 4.
[0099] Fig. 9 shows the ANGPTL3 mRNA change in liver following administration in Experiment 2 of Example 4.
[0100] Fig. 10 shows the serum TG change following administration of Example 5.
[0101] Fig. 11 shows the ANGPTL3 mRNA change in liver following administration of Example 5.
[0102] Fig. 12 shows the serum TG change following administration in Experiment 3 of Example 4.
[0103] Fig. 13 shows the serum TG change following administration in Experiment 3 of Example 4.
[0104] Fig. 14 shows the ANGPTL3 mRNA change in liver following administration in Experiment 3 of Example 4.
[0105] Fig. 15 shows the serum ANGPTL3 protein variation 18 days post-administration in Experiment 3 of Example 4.
[0106] Detailed Description of the Embodiments
[0107] In order to facilitate understanding of the present application, the present application will be described more fully hereinafter. The present application may be implemented in many different forms, and is not limited to the embodiments described herein. Rather, the purpose of providing these examples is to make the understanding of the disclosure of the present application more thorough and comprehensive.
[0108] The following examples do not specify experimental procedures under specific conditions, generally under conventional conditions, for example, in the fourth edition of Molecular Cloning: A Laboratory Manual edited by Green and Sambrook, which has been published in 2013, or as suggested by the manufacturer. The various chemicals commonly used in the Examples are commercially available products.
[0109] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by a person skilled belonging to the technical field of the present application. The terminology used in the description of the present application is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. As used herein, the term “and / or” includes any and all combinations of one or more of the associated listed items.
[0110] In the present disclosure, the terms “induce” , “inhibit” , “enhance” , “raise” , “increase” , “decrease” , or “reduce” , and the like, generally indicate a quantitative difference between two states. For example, “an amount effective to inhibit the activity or expression of ANGPTL3” means that the level of activity or expression of ANGPTL3 in a treated sample will be lower than the level of activity or expression of ANGPTL3 in an untreated sample. The terms “decrease” and “reduce” can be used interchangeably and generally mean any change less than the original. “Decrease” and “reduce” are relative terms that require comparison before and after measurement, “Decrease” and “reduce” include complete exhaustion.
[0111] In certain embodiments, the term “reduce” can be detected by standard methods known in the prior art, such as those described herein, and the expression level / amount of a gene or a gene product, for example, a protein or a biomarker, in a first sample is reduced by about 5%to 95%or total of 100%as compared to the expression level / amount of the corresponding gene or gene product, for example, protein or biomarker, in a second sample. In certain embodiments, the term “reduce” refers to a decrease in the expression level / amount of a gene or biomarker in a test sample, wherein the decrease refers to at least about 0.9 -to 0.01-fold the expression level / amount of the corresponding gene or biomarker.
[0112] In the present application, the term “expression” generally means the process by which a gene eventually produces a protein. Expression includes, but is not limited to, transcription, post-transcriptional modification (for example, splicing, polyadenylation, addition of a 5’ -cap) , and translation.
[0113] In the present application, the term "pharmaceutically acceptable" generally refers to one or more non-toxic substances that do not interfere with the effectiveness of the biological activity of an active ingredient. Also included are sterile water, saline, and the like. Such formulations may typically comprises a salt, an excipient, a buffer, a preservative, a compatible carrier, and optionally other therapeutic agent. When used in medicine, the salt should be a pharmaceutically acceptable salt, but pharmaceutically acceptable salts can conveniently be prepared using non-pharmaceutically acceptable salts, which cannot be excluded from the scope of the application. Such pharmacologically and pharmaceutically acceptable salt includes salts prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, boric acid, formic acid, malonic acid, succinic acid, and the like. The pharmaceutically acceptable salt can also be prepared as an alkali metal or alkaline earth metal salt, such as sodium, potassium or calcium salt.
[0114] In the present application, the term “preventing and / or treating” not only includes preventing and / or treating diseases, but also generally includes preventing the onset of diseases, slowing or reversing the progression of the diseases, preventing or slowing the onset of one or more symptoms associated with the diseases, reducing and / or alleviating one or more symptoms associated with the diseases, reducing the severity and / or duration of the diseases and / or any symptoms associated therewith and / or preventing further increases in the severity of the diseases and / or any symptoms associated therewith, preventing, reducing or reversing any physiological injuries caused by the diseases, and generally any pharmacological effects that are beneficial to the patient being treated. The RNAi agent or pharmaceutical composition of the present application forms a viable therapeutic agent which does not need to complete cure or eradicate any symptoms or manifestations of the diseases. As recognized in the relevant art, medicaments used as therapeutic agents can reduce the severity of given disease states, but do not need to eliminate every manifestation of the diseases to be considered useful therapeutic agents. Similarly, a prophylactically administered treatment constitutes a viable prophylactic agent that does not require complete efficacy to prevent the onset of conditions. Simply reducing the effects of the diseases in the subject (for example, by reducing the number or severity of symptoms, or by increasing the effectiveness of another treatment, or by producing another beneficial effect) , or reducing the likelihood that the disease will occur or worsen, is sufficient
[0115] In the present application, the term “administration” generally means introducing a pharmaceutical formulation of the present application into the body of a subject by any route of introduction or delivery. Any method known to a person skilled in the art for contacting a cell, organ or tissue with the medicament may be employed. Such administration may include, without limitation, intravenous, intraarterial, intranasal, intraperitoneal, intramuscular, subcutaneous, or oral administration. The daily dose may be divided into one, two or more suitable forms of dose to administer at one, two or more times during a certain period of time.
[0116] In the present application, the term “contacting” generally means that two or more different types of substances are contacted together in any order, in any manner and for any time. Contacting can occur in vivo, ex vivo, or in vitro. In some embodiments, it can mean that the RNAi agent or composition of the present application is in direct contact with a cell or tissue. In other embodiments, the term refers to contacting a cell or tissue indirectly with the RNAi agent or composition of the present application. For example, the method of the present application includes a method wherein a subject contacts the RNAi agent or composition of the present application, and then the RNAi agent or composition contacts a cell or tissue by diffusion or any other active or passive transport process known in the art by which the compound circulates in vivo.
[0117] In the present application, the term “effective amount” or “effective dosage” generally refers to an amount sufficient to achieve, or at least partially achieve, the desired effect. A “therapeutically effective amount” or “therapeutically effective dosage” of the medicament or therapeutic agent is generally any amount of medicament that, when used alone or in combination with another therapeutic agent, promotes disease regression as evidenced by a reduction in the severity of disease symptoms, an increase in the frequency and duration of disease symptom-free periods, or by prevention of damage or disability due to illness. A “prophylactically effective amount” or “prophylactically effective dosage” of a medicament generally refers to an amount of the medicament that inhibits the development or recurrence of a disease when administered, alone or in combination with another therapeutic agent, to a subject at risk of developing or recurrence of the disease. In certain embodiments, an “effective amount” refers to the amount of the RNAi agent that produces intended pharmacologic, curative, or prophylactic results.
[0118] In the present application, the term “subject” generally refers to human or non-human animals (including mammals) such as humans, non-human primates (apes, gibbons, gorillas, chimpanzees, pongidae, and macaques) , domestic animals (dogs and cats) , farm animals (horses, cattle, goats, sheep and pigs) , and laboratory animals (mice, rats, rabbits, and guinea pigs) in need of diagnosis, prognosis, amelioration, prevention and / or treatment of diseases. Human subjects include fetal, neonatal, infant, adolescent and adult subjects. Subjects include animal disease models.
[0119] To make the objects, technical solutions, and advantages of the present application more comprehensible, the present application is further described in detail through the following embodiments and in conjunction with the accompanying drawings.
[0120] Example 1 -Unmodified ANGPTL3 siRNA in vitro screening
[0121] Experimental materials
[0122] HuH7 cells (SCSP-526, National Collection of Authenticated Cell Cultures, Chinese Academy of Sciences) , Lipofectamine 3000 Transfection Reagent (Thermo Fisher, L3000015) , Serum-Reduction Medium Optim-MEM (Gibco, 31985-070) , DMEM (Gibco, C11995500BT) , FBS (Gibco, 10270-106) , negative control siRNA NC (Ribobio, siM211215011852) and NC002 (Ribobio, RD20221011171701) , siRNA samples (having sequences as shown in Table 1) , MagZol Reagent (Magen, R4801) , Bugle-Loop miRNA qRT-PCR Starter kit (RiboBio, C10211-2) , 24-well plate (Corning, 3524) , CO2 incubator (Memmert, ICO150) , fluorescence quantitative PCR instrument (BioRad, CFX DUET) , etc.
[0123] Table 1 Sequences of siRNA samples
[0124] Experimental procedures
[0125] HuH7 cells (SCSP-526, National Collection of Authenticated Cell Cultures, Chinese Academy of Sciences) were cultured, and the cell density before transfection was about 30-50%, which is relatively uniform. All siRNA samples were each formulated into 20 μM stock solutions and set up as an experimental group. In addition to the experimental group, a normal cell control group (Blank) , a transfection reagent control group (Mock) , a negative control group 1 (NC, Ribobio, siM211215011852) , and a negative control group 2 (NC002, Ribobio, RD20221011171701) were set up. Cells were transfected with reference to Lipofectamine 3000 transfection reagent (Thermo Fisher, L3000015) instructions. There were 3 replicates for both the experimental and control groups.
[0126] Total RNAs were extracted following MagZol Reagent (Magen, R4801) instructions.
[0127] Reverse transcription was performed with reference to Bugle-Loop miRNA qRT-PCR Starter kit (RiboBio, C10211-2) instructions.
[0128] Human housekeeping gene actin was used as an internal reference gene, the upstream primer sequence of the actin gene was 5’ -TCAAGATCATTGCTCCTCCTGAG-3’ (SEQ ID NO: 109) , and the downstream primer sequence was 5’ -ACATCTGCTGGAAGGTGGACA-3’ (SEQ ID NO: 110) . The upstream primer sequence of the human ANGPTL3 gene was 5’-CTTCCAAGCCAAGAGCACCA-3’ (SEQ ID NO: 111) , and the downstream primer sequence was 5’-CATGAAAAACTTGAGAGTTGCTGG-3’ (SEQ ID NO: 112) . Real-time fluorescence quantitative PCR reaction was performed using 2X SYBR Green Mix (RiboBio, C10211-2) and fluorescence quantitative PCR instrument (BioRad, CFX DUET) . After the PCR reaction, the Ct error of 9 replicates (3 transfection replicates x 3 QPCR replicate wells) of a sample should be within ±0.5. Then, the relative expression changes of the target gene was analyzed after transfection of siRNA, by using β-actin as the internal reference gene and the negative control group NC for normalization.
[0129] Table 2. ANGPTL3 relative expression 48 hours after transfection of unmodified siRNAs by HuH-7 cells
[0130] Example 2 -In vitro screening of chemically modified ANGPTL3 siRNAs
[0131] The sequences of A3-038 and A3-041 were chemically modified, and the modified sequences are shown in Table 3.
[0132] Table 3 Modified siRNA sequences
[0133] N: a general term for unmodified ribonucleotides, including A: adenine ribonucleotide, G: guanine ribonucleotide, C: cytosine ribonucleotide, U: uracil ribonucleotide.
[0134] dN: a general term of unmodified deoxyribonucleotides, including dA: deoxyadenosine nucleotide, dG: deoxyguanosine nucleotide, dC: deoxycytidine nucleotide, and dT: deoxythymine nucleotide.
[0135] fN: 2’ -fluoro modified ribonucleotide.
[0136] mN: 2’ -O-methyl modified ribonucleotide.
[0137] *: nucleotides located on the left and right sides of *are connected by a phosphorothioate linkage.
[0138] Modified double-stranded siRNAs were transfected into HuH-7 cells for in vitro effectiveness screening, three experiments were repeated, and reference can be made to example 1 for the experiment method. The experimental results were as follows.
[0139] Table 4. ANGPTL3 relative expression 48 hours after transfection of chemically modified siRNAs in HuH-7 cells
[0140] Example 3 –IC50 evaluation of siRNA activity
[0141] On the basis of the sequence of A3-038-6, the proportion of the fluorine modification in the sense strand was changed to obtain A3-038-6-1 and A3-038-6-2. The sequences were shown in Table 5.
[0142] Table 5 siRNA sequences after changing the proportion of the fluoro modification in the sense strand
[0143] N: a general term for unmodified ribonucleotides, including A: adenine ribonucleotide, G: guanine ribonucleotide, C: cytosine ribonucleotide, U: uracil ribonucleotide.
[0144] dN: a general term of unmodified deoxyribonucleotides, including dA: deoxyadenosine nucleotide, dG: deoxyguanosine nucleotide, dC: deoxycytidine nucleotide, and dT: deoxythymine nucleotide
[0145] fN: 2’ -fluoro modified ribonucleotide.
[0146] mN: 2’ -O-methyl modified ribonucleotide.
[0147] *: nucleotides located on the left and right sides of *are connected by a phosphorothioate linkage.
[0148] The IC50 values of A3-041-2, A3-041-4, A3-038-6, A3-038-6-1, and A3-038-6-2 were determined as follows: HuH-7 cells were digested with 0.25%trypsin and adjusted to an appropriate concentration for seeding into a 24-well cell culture plate. Cell transfection was performed using LipofectamineTM 3000 Transfection Reagent (Thermo Fisher, L3000015) following the procedure instructions provided by the manufacturer. siRNA transfection concentrations were 100, 50, 10, 2, 0.4, 0.08, 0.016, 0.0032, and 0.00064 nM. In addition to the siRNA transfection group, a normal cell control group (Blank) , a transfection reagent control group (Mock) , and a negative control group (NC, Ribobio, siM211215011852) were set. Three transfection replicate wells were provided for each siRNA and control group. After 48 hours of transfection, the culture medium was removed, and cells were collected for RNA extraction. The RNA extraction was performed using the MagZol Reagent (Magen, R4801) extraction reagent, and the procedure was performed following the instructions of the manufacturer. cDNA was synthesized using the Bugle-Loop miRNA qRT-PCR Starter kit (RiboBio, C10211-2) according to the instructions, and ANGPTL3 gene relative expression assays were performed using the Bugle-Loop miRNA qRT-PCR Starter kit (RiboBio, C10211-2) using a fluorescent quantitative PCR instrument (BioRad, CFX DUET) . Normalization was performed on the negative control group, and the expression inhibition percentage of ANGPTL3 gene was calculated for different concentrations of siRNAs compared with the negative control group. A dosage-effect curve was plotted, and the half inhibition rate, i.e. IC50, was calculated. Please refer to Figs. 1-5 for the results.
[0149] Table 6. Expression inhibition percentage of ANGPTL3 gene by different concentrations of siRNAs (%)
[0150] Example 4-Validation of hypolipidemic efficacy in rats in vivo
[0151] 1. Preparation of ligand compounds: The ligand compounds were selected from GalNac-5, GalNac-13, and L96. For the specific preparation steps of GalNac-5 and GalNac-13, reference was made to Chinese patent application 202110073911.7.
[0152] 2. Modifying siRNA by ligand compound: by making further modifications on the basis of A3-038-6, A3-041-2 and A3-041-4 mentioned above, sequences as shown in table 7 were obtained, and the sequences were respectively modified with GalNac-5, GalNac-13 and L96 to form conjugates.
[0153] Table 7 Ligand compound modified siRNAs
[0154] N: a general term for unmodified ribonucleotides, including A: adenine ribonucleotide, G: guanine ribonucleotide, C: cytosine ribonucleotide, U: uracil ribonucleotide.
[0155] dN: a general term of unmodified deoxyribonucleotides, including dA: deoxyadenosine nucleotide, dG: deoxyguanosine nucleotide, dC: deoxycytidine nucleotide, and dT: deoxythymine nucleotide
[0156] fN: 2’ -fluoro modified ribonucleotide.
[0157] mN: 2’ -O-methyl modified ribonucleotide.
[0158] *: nucleotides located on the left and right sides of *are connected by a phosphorothioate linkage.
[0159] VP: VP modified mU.
[0160] Microplate reader (Tecan, Infinite 200 pro)
[0161] Experimental method
[0162] (Experiment 1) Verification of A3-041-2a-5 and A3-041-4g-5:
[0163] Male SD rats aged 7-9 weeks (Guangdong Charles River Experimental Animal Technology Co., Ltd. ) were selected and randomly divided into 5 groups (A1, B1, C1, D1, and E1) according to the body weight of the animals, with 15 rats in each group. After grouping, groups B1 and C1 were subcutaneously injected with A3-041-2a-5 once, and groups D1 and E1 were subcutaneously injected with A3-041-4g-5 once, the dosage of groups B1 and D1 was 10 mg / kg, the dosage of groups C1 and E1 was 20 mg / kg, the administration volume was 5 mL / kg, and group A1 was subcutaneously injected with an equal volume of normal saline.
[0164] Animals were fasted but given water for 4 h before blood collection. Blood was collected from the jugular vein of each group of animals on the 7th, 14th, 21st, and 28th days after administration, serum was separated to detect serum TG content, and serum ANGPTL3 protein was also detected in the samples on the 14th day. Liver was dissected from 3 animals in each group on the 7th, 14th, 21st, and 28th days after administration to detect ANGPTL3 mRNA expression in the liver. Serum TG was detected using a triglyceride (TG) assay kit (Nanjing Jiancheng Bioengineering Institute, A110-1-1) according to the kit instructions. Serum ANGPTL3 protein was detected using an ANGPTL3 ELISA Kit (arigo, ARG81898) according to the kit instructions. The mRNA expression of ANGPTL3 in liver was detected by fluorescence quantitative PCR. During the liver tissue RNA extraction, the total RNAs were extracted from liver tissue using MagZol Reagent (Magen, R4801) according to the manufacturer's instructions. cDNA and PCR were synthesized using Bugle-Loop miRNA qRT-PCR Starter kit (RiboBio, C10211-2) according to the instructions, and were detected by fluorescence quantitative PCR instrument (BioRad, CFX DUET) .
[0165] (Experiment 2) Verification of A3-041-4a-13, A3-041-4b-13, A3-041-4c-13, A3-041-4d-13, A3-041-4e-13, and A3-041-4f-13:
[0166] Male SD rats aged 7-9 weeks (Guangdong Charles River Experimental Animal Technology Co., Ltd. ) were selected and randomly divided into 8 groups (A2, B2, C2, D2, E2, F2, G2, and H2 groups) according to the body weight of the animals, with 15 rats in each group. After grouping, groups B2, C2, D2, E2, F2, G2, and H2 were subcutaneously injected with A3-041-4a-13, A3-041-4b-13, A3-041-4c-13, A3-041-4d-13, A3-041-4e-13, A3-041-4f-13, and A3-041-4-5 once, the dosage of administration was 10 mg / kg, and the administration volume was 5 mL / kg, and group A2 was subcutaneously injected with an equal volume of normal saline.
[0167] Animals were fasted but given water for 4 h before blood collection. Blood was collected from the jugular vein of each group of animals on the 14th and 28th days after administration, serum was separated to detect serum TG content. Liver was dissected from 3 animals in each group on the 14th and 28th days after administration to detect ANGPTL3 mRNA expression in the liver. Serum TG was detected using a triglyceride (TG) assay kit (Nanjing Jiancheng Bioengineering Institute, A110-1-1) according to the kit instructions. The mRNA expression of ANGPTL3 in liver was detected by fluorescence quantitative PCR. During the liver tissue RNA extraction, the total RNAs were extracted from liver tissue using MagZol Reagent (Magen, R4801) according to the manufacturer's instructions. cDNA and PCR were synthesized using Bugle-Loop miRNA qRT-PCR Starter kit (RiboBio, C10211-2) according to the instructions, and were detected by fluorescence quantitative PCR instrument (BioRad, CFX DUET) .
[0168] (Experiment 3) Verification of A3-038-6a-L96, A3-041-4a-L96 and A3-041-2a-L96
[0169] Male SD rats aged 7-9 weeks (Guangdong Charles River Experimental Animal Technology Co., Ltd. ) were selected and randomly divided into 4 groups (A, B, C and D groups) according to the body weight of the animals, with 9 rats in each group. After grouping, groups B, C and D were subcutaneously injected with A3-038-6a-L96, A3-041-4a-L96 and A3-041-2a-L96 once, the dosage of administration was 9 mg / kg, and the administration volume was 5 mL / kg, and group A was subcutaneously injected with an equal volume of normal saline.
[0170] Animals were fasted but given water for 4 h before blood collection. Blood was collected from the jugular vein of each group of animals on the 7th and 14th days after administration, serum was separated to detect serum TG and TC content respectively. Liver was dissected from 3 animals in each group on the 7th and 14th days after administration to detect ANGPTL3 mRNA expression in the liver. On the 18th day, serum was isolated from the remaining 3 animals to detect ANGPTL3 protein. Serum TG was detected using a triglyceride (TG) assay kit (Nanjing Jiancheng Bioengineering Institute, A110-1-1) according to the kit instructions. Serum TC was detected using a total cholesterol (TCH / T-CHO) assay kit (Nanjing Jiancheng Bioengineering Institute, A111-1-1) according to the kit instructions. Serum ANGPTL3 protein was detected using the Mouse / Rat Angiopoietin-Like Protein 3 ELISA (BioVendor, RAG011 R) according to the kit instructions. The mRNA expression of ANGPTL3 in liver was detected by fluorescence quantitative PCR. During the liver tissue RNA extraction, the total RNAs were extracted from liver tissue using MagZol Reagent (Magen, R4801) according to the manufacturer's instructions. cDNA and PCR were synthesized using Bugle-Loop miRNA qRT-PCR Starter kit (RiboBio, C10211-2) according to the instructions, and were detected by fluorescence quantitative PCR instrument (BioRad, CFX DUET) .
[0171] The results of Experiment 1 were shown in Figs. 6 and 7 and Table 8, the results of Experiment 2 were shown in Figs. 8 and 9, and the results of Experiment 3 were shown in Figs. 12 to 15.
[0172] Table 8. Changes of serum ANGPTL3 protein 28 days after administration (pooled serum, n=6)
[0173] Example 5-positive control
[0174] Male SD rats aged 7-9 weeks were selected and randomly divided into 4 groups according to the body weight of the animals, with 15 rats in each group. After grouping, groups B, C and D were respectively subcutaneously injected with A3-041-2a-5, A3-041-4g-5 and AD-52720-L96 once (using the sequence in US Patent US11525138B2 as a positive control: GfuCfaCfuUfgAfAfCfuCfaAfcUfcAfaAf (SEQ ID NO: 117) , the ligand being L96) , the dosage of administration was 10 mg / kg, and the administration volume was 5 mL / kg, and group A was subcutaneously injected with an equal volume of normal saline. Animals were fasted but given water for 4 h before blood collection. Blood was collected from the jugular vein of each group of animals on the 14th and 28th days after administration, serum was separated to detect serum TG and TC content respectively. Liver was dissected from 3 animals in each group on the 14th and 28th days after administration to detect ANGPTL3 mRNA expression in the liver. Serum TG was detected using a triglyceride (TG) assay kit (Nanjing Jiancheng Bioengineering Institute, A110-1-1) according to the kit instructions. The mRNA expression of ANGPTL3 in liver was detected by fluorescence quantitative PCR. During the liver tissue RNA extraction, the total RNAs were extracted from liver tissue using MagZol Reagent (Magen, R4801) according to the manufacturer's instructions. cDNA and PCR were synthesized using Bugle-Loop miRNA qRT-PCR Starter kit (RiboBio, C10211-2) according to the instructions, and were detected by fluorescence quantitative PCR instrument (BioRad, CFX DUET) .
[0175] Reference is made to Figs. 10 and 11 for the results. Both A3-041-2a-5 and A3-041-4g-5 can significantly inhibit the expression of ANGPTL3 after administration, can reduce the content of serum TG, and have a better effect than the positive control AD-52720-L96.
[0176] Various technical features of the described examples can be combined in any way, and in order to make the description brief, not all possible combinations of the technical features in the described examples are described. However, as long as the combinations of these technical features are not contradictory, all of the technical features should be considered to fall within the scope of the disclosure of the present description.
Claims
1.A nucleic acid molecule for inhibiting or reducing the expression of target gene ANGPTL3, which is an siRNA comprising a sense strand and an antisense strand, wherein the siRNA is at least one pair selected from the following sequences or modified sequences thereof:A3-038: the sense strand thereof is as shown in SEQ ID NO: 75, and the antisense strand thereof is as shown in SEQ ID NO: 76;A3-041: the sense strand thereof is as shown in SEQ ID NO: 81, and the antisense strand thereof is as shown in SEQ ID NO: 82; or;A3-043: the sense strand thereof is as shown in SEQ ID NO: 118, and the antisense strand thereof is as shown in SEQ ID NO: 119; orA3-044: the sense strand thereof is as shown in SEQ ID NO: 120, and the antisense strand thereof is as shown in SEQ ID NO: 121.2.The nucleic acid molecule according to claim 1, wherein bases of the sense strand are modified, the modifications comprises 2’-O-methyl modification on bases at positions 1 to 6, 8, 12, 14, and 1 to 6 from the 3’ end, 2’-fluoro modification on bases at positions 7, 9, and 11, and both phosphodiester linkages between positions 1 and 2, between position 2 and 3 from the 3’ end are replaced by phosphorothioate linkages.3.The nucleic acid molecule according to claim 1 or 2, wherein bases of the antisense strand are modified, the modifications in the antisense strand comprise 2’-O-methyl modification on bases at positions 1, 3, 5, 7, 11, 13, 15, 1 to 5 from the 3’ end, and 7 from the 3’ end, 2’-fluoro modification on bases at positions 2, 6, 8, 14, and 8 from the 3’ end, and both phosphodiester linkages between position 1 and 2, between position 2 and 3, and between positions 1 and 2, between position 2 and 3 from the 3’ end are replaced by phosphorothioate linkages.4.The nucleic acid molecule according to claim 3, wherein the sense strand is any one selected from:SEQ ID NO: 85: mGmCmAmAmAmCfCmAfGmUfGmAfAmAfUmCmAmAmA*mG*mA,SEQ ID NO: 86: mGmCmAmAmAmCfCmAfGfUfGmAmAmAmUmCmAmAmA*mG*mA,SEQ ID NO: 87: mGmUmCmAmCmUfUmGfAmAfCmUfCmAfAmCmUmCmA*mA*mA,SEQ ID NO: 88: mGmUmCmAmCmUfUmGfAfAfCmUmCmAmAmCmUmCmA*mA*mA,SEQ ID NO: 89: mGmCmAmAmAmCfCmAfGfUfGmAfAmAfUmCmAmAmA*mG*mA,SEQ ID NO: 113: UCUUUGAUUUCACUGGUUACUCAAmCmUmCmAmAmA,SEQ ID NO: 90: mG*mU*mC*mAmCmUfUmGfAmAfCmUfCmAfAmCmUmCmAmAmA,SEQ ID NO: 91: mG*mU*mCmAmCmUfUmGfAfAfCmUmCmAmAmCmUmCmAmAmA,SEQ ID NO: 92: mG*mU*mCmAmCmUfUmGfAmAfCmUfCmAfAmCmUmCmA*mA*mA,SEQ ID NO: 93: mG*mU*mC*mAmCmUfUmGfAfAfCmUmCmAmAmCmUmCmA*mA*mA,SEQ ID NO: 115: mU*mC*mAmAmAmCfCmAfAfUfGmAmAmAmUmCmAmAmA*mG*mA,SEQ ID NO: 122: mG*mC*mAmAmAmCfCmAfGfUfGmAmAmAmUmCmAmAmA*mG*mA;wherein, f stands for 2’-fluoro modification, m stands for 2’-O-methyl modification, and *: stands for nucleotides located on the left and right sides of *are connected by a phosphorothioate linkage.5.The nucleic acid molecule according to claim 4, wherein the antisense strand is at least one selected from:SEQ ID NO: 94: mU*fC*mUmUmUfGmAfUmUfUmCmAmCfUmGfGmUmUmUmGmC*mA*mG,SEQ ID NO: 95: mU*fC*mUfUmUfGmAfUfUmUmCmAmCfUmGfGmUfUmUmGmC*mA*mG,SEQ ID NO: 96: mU*fC*mUmUmUfGmAfUmUfUmCfAmCfUmGfGmUfUmUmGmC*mA*mG,SEQ ID NO: 97: mU*fU*mUmGmAfGmUfUmGfAmGmUmUfCmAfAmGmUmGmAmC*mA*mU,SEQ ID NO: 98: mU*fU*mUfGmAfGmUfUfGmAmGmUmUfCmAfAmGfUmGmAmC*mA*mU,SEQ ID NO: 99: mU*fU*mUmGmAfGmUfUmGfAmGfUmUfCmAfAmGfUmGmAmC*mA*mU,SEQ ID NO: 100: mU*fC*mUfUmUfGmAfUmUfUmCfAmCfUmGfGmUfUmUmGmC*mA*mG,SEQ ID NO: 114: UUUGAGUUGAGUUCAAGUUGAAAUmCmAmAmAmGmA,SEQ ID NO: 101: VP*fU*mU*fGmAfGmUfUfGmAmGmUmUfCmAfAmGfUmGmA*mC*mA*mU,SEQ ID NO: 102: VP*fU*mUmGmAfGmUfUmGfAmGmUmUfCmAfAmGmUmGmAmC*mA*mU,SEQ ID NO: 103: VP*fU*mUfGmAfGmUfUfGmAmGmUmUfCmAfAmGfUmGmAmC*mA*mU,SEQ ID NO: 104: VP*dT*mUfGmAfGmUdT*fGmAmGmUmUfCmAfAmGdT*mGmAmC*mA*mU,SEQ ID NO: 105: VP*fU*mUfGmAfGmUdT*fGmAmGmUmUfCmAfAmGdT*mGmAmC*mA*mU,SEQ ID NO: 106: VP*fU*mU*mGmAfGmUfUmGfAmGmUmUfCmAfAmGmUmGmA*mC*mA*mU,SEQ ID NO: 107: VP*fU*mU*mGmAfGmUfUmGfAmGmUmUdC*mAfAmGmUmGmA*mC*mA*mU,SEQ ID NO: 108: VP*fU*mU*mGmAfGmUfUmGdA*mGmUmUdC*mAdA*mGmUmGmA*mC*mA*mU,SEQ ID NO: 116: VP*fC*mUmUmUfGmAfUmUfUmCfAmUfUmGfGmUfUmUmGmA*mA*mG,SEQ ID NO: 123: VP*fC*mUmUmUfGmAfUmUfUmCfAmCfUmGfGmUfUmUmGmC*mA*mG;wherein f stands for 2’-fluoro modification, m stands for 2’-O-methyl modification, *stands for nucleotides located on the left and right sides of *are connected by a phosphorothioate linkage, and VP: 2’-O-methyl-5’- [ (E) -vinylphosphonate] -3’-phosphate-uridine .6.The nucleic acid molecule according to claim 4 or 5, wherein the siRNA is at least one pair of modified sequences selected from:A3-041-2:the sense strand thereof is as shown in SEQ ID NO: 87: mGmUmCmAmCmUfUmGfAmAfCmUfCmAfAmCmUmCmA*mA*mA, andthe antisense strand thereof is as shown in SEQ ID NO: 98: mU*fU*mUfGmAfGmUfUfGmAmGmUmUfCmAfAmGfUmGmAmC*mA*mU; andA3-041-4:the sense strand thereof is as shown in SEQ ID NO: 88: mGmUmCmAmCmUfUmGfAfAfCmUmCmAmAmCmUmCmA*mA*mA, andthe antisense strand thereof is as shown in SEQ ID NO: 97: mU*fU*mUmGmAfGmUfUmGfAmGmUmUfCmAfAmGmUmGmAmC*mA*mU.7.Use of the nucleic acid molecule according to any one of claims 1-6 in the preparation of a biological formulation or pharmaceutical formulation for inhibiting or reducing the expression of target gene ANGPTL3.8.A conjugate for inhibiting or reducing the expression of target gene ANGPTL3, comprising the nucleic acid molecule according to any one of claims 1-7 and a targeted delivery ligand linked to the nucleic acid molecule.9.The conjugate according to claim 8, wherein the ligand is linked to the sense strand of the nucleic acid molecule, and the structure of the ligand is wherein R1 is a moiety binding to an asialoglycoprotein receptor (ASGPR) ;R2 is -CH2-, C6-14 aryl, C2-6 alkenyl, or C2-6 alkynyl;R3 is-O-, C6-14 aryl, or 3 to 10-membered heterocyclyl;R4 is -CH2-, C6-14 aryl, or 3 to 10-membered heterocyclyl;R5 is -OH, or -COOH, PG is a carboxyl protecting group;PG2 is a hydroxyl protecting group;a, b, c, and d are each independently any integer of 1-10; and n is any integer of 1-3.10.The sequence according to claim 9, wherein the terminal of the R1 moiety is galactose or N-acetylgalactosamine; and the R1 moiety is any one selected from the following structures: wherein q and q’a re each independently any integer of 1-10.11.The conjugate according to claim 9, wherein the carboxyl protecting group is selected from succinate ester, pentafluorophenol ester, or wherein h is any integer of 1-5.12.The conjugate according to claim 9, wherein the hydroxyl protecting group is selected from silyl, monomethoxytrityl (MMTr) , 4, 4’-dimethoxytrityl (DMTr) , and trityl; and optionally, the silyl is selected from t-butyldimethylsilyl ether (TBMDS) , t-butyldiphenylsilyl (TBDPS) , and triisopropylsilyl ether (TIPS) .13.The conjugate according to any one of claims 9-12, wherein the compound has the following structure: 14.The conjugate according to claim 8, wherein the conjugate formed by linking the sense strand to the ligand compound is: wherein,R1 is a moiety binding to ASGPR;R2 is -CH2-, C6-14 aryl, C2-6 alkenyl, or C2-6 alkynyl;R3 is-O-, C6-14 aryl, or 3 to 10-membered heterocyclyl;R4 is -CH2-, C6-14 aryl, or 3 to 10-membered heterocyclyl;R is O or S;Rx is an siRNA;a, b, c, and d are each independently any integer of 1-10; andn is any integer of 1-3.15.Use of the conjugate according to any one of claims 8-14 in the preparation of a product for preventing or alleviating or treating diseases related to the expression of target gene ANGPTL3, wherein preferably, the product is a biological formulation or pharmaceutical formulation.16.The use according to claim 15, wherein the diseases related to the expression of target gene ANGPTL3 comprise dyslipidemia diseases, cerebrovascular diseases, and cardiometabolic diseases; preferably,the dyslipidemia diseases include hyperlipidemia, hypertriglyceridemia or high low-density lipoprotein disorder; andthe cerebrovascular diseases or cardiometabolic diseases include hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid, cholesterol metabolism, atherosclerosis, type II diabetes, thrombosis, coronary heart disease, heart stroke, brain stroke, aortic stenosis, coronary artery diseases, non-alcoholic steatohepatitis, non-alcoholic fatty liver diseases, homozygous or heterozygous familial hypercholesterolemia, statins-resistant hypercholesterolemia, or other metabolic related disorders and diseases.17.A pharmaceutical composition, wherein active ingredients of the pharmaceutical composition comprise the conjugate for inhibiting or reducing the expression of target gene ANGPTL3 according to any one of claims 8-14 and a pharmaceutically acceptable excipient.18.A method for inhibiting or reducing the expression of the target gene ANGPTL3, wherein the method comprises administering to a subject a suitable dose of the conjugate for inhibiting or reducing the expression of target gene ANGPTL3 according to any one of claims 8-14 and / or the pharmaceutical composition of claim 17.19.A method for inhibiting or reducing the expression of target gene ANGPTL3 in cells, comprising the steps of:(1) obtaining cells to be transfected and the nucleic acid molecule according to any one of claims 1-6, the conjugate according to any one of claims 8-14, or the pharmaceutical composition according to claim 17;(2) mixing the nucleic acid molecule or the conjugate or the pharmaceutical composition with the cells to be transfected and transfecting the cells; and(3) performing cell culture.20.The conjugate according to any one of claims 8-14 for use as a medicament.21.The conjugate according to any one of claims 8-14 for use in a method for preventing or alleviating or treating diseases related to the expression of target gene ANGPTL3, wherein preferably, the product is a biological formulation or pharmaceutical formulation.22.The conjugate for use in a method according to claim 21, wherein the diseases related to the expression of target gene ANGPTL3 comprise dyslipidemia diseases, cerebrovascular diseases, and cardiometabolic diseases; preferably,the dyslipidemia diseases include hyperlipidemia, hypertriglyceridemia or high low-density lipoprotein disorder; andthe cerebrovascular diseases or cardiometabolic diseases include hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid, cholesterol metabolism, atherosclerosis, type II diabetes, thrombosis, coronary heart disease, heart stroke, brain stroke, aortic stenosis, coronary artery diseases, non-alcoholic steatohepatitis, non-alcoholic fatty liver diseases, homozygous or heterozygous familial hypercholesterolemia, statins-resistant hypercholesterolemia, or other metabolic related disorders and diseases.
Citation Information
Patent Citations
Double-stranded siRNA (small interfering ribonucleic acid) analogue for inhibiting expression of vasculature-like protein 3, and preparation method and application of double-stranded siRNA analogue
CN118185932A
Angiopoietin-like 3 (angptl3) irna compostions and methods of use thereof
WO2012177784A2
Novel RNA compositions and methods for inhibiting angptl3
WO2022079222A1
Ligand compounds, conjugates, and applications thereof
WO2022155814A1
Angiopoietin-like 3 (angptl3) irna compositions and methods of use thereof
WO2022187435A1