Engineered CD9 antibodies and their use

Abstract

This disclosure provides an antibody constructs that specifically bind CD9 with high affinity. These antibody constructs include a set of novel heavy chain and light chain complementarity determining regions (CDRs) sequences, optionally humanized variable regions, and engineered Fc region of the heavy chain constant region in order to eliminate undesirable platelet activation. The present invention also provides methods for diagnosing and treating conditions including cancer characterized by the aberrant expression of CD9 in the pertinent tissue and cells through the use of these anti-CD9 antibody constructs.

Description

ENGINEERED CD9 ANTIBODIES AND THEIR USEBACKGROUND OF THE INVENTION

[0001] The CD9 antigen is a 24 kDa tetraspanin membrane protein that contains four putative transmembrane domains, short N-and C-terminal cytoplasmic domains, a small intracellular loop, and two extracellular loops. CD9 is expressed on the surface of a large number of mammalian cell types, such as epithelial cells, endothelial cells, smooth muscle cells, hematopoietic cells, in addition to malignant cells of different origins. Due to its participation in a wide variety of important cellular functions including cell adhesion and migration, cancer progression and metastasis, immune and allergic responses, and viral infection, CD9 is attracting increased attention in the context of biomedical research and development of new therapeutic strategies for CD9-dependent diseases, especially for CD9+ cancers such as leukemia.

[0002] Cancer-related causes are among the top reasons of death in developed nations. In the US alone, the number of new cases of cancer of any type averages about 450 per 100,000 people per year, and the number of deaths averages about 170 per 100,000 people per year. Cancer is a disease with a high mortality rate: while about 1, 700,000 newly diagnosed cancer cases are expected each year, over 600,000 deaths annually are attributable to various types of cancer. Based on data from recent years, it is estimated that over 38%of the population will be diagnosed with cancer at some point during their lifetime.

[0003] Because of the prevalence of cancer, its social and economical impact, and the significant role CD9 plays in the pathology of cancer, there exists an urgent need for new and more effective methods for treating cancer by targeting CD9. This invention fulfills this and other related needs. BRIEF SUMMARY OF THE INVENTION

[0004] This disclosure provides compositions of various modified antibody constructs including single-chain variable fragments (scFvs) and humanized monoclonal antibodies derived from two newly characterized anti-CD9 monoclonal antibodies that specifically bind to human CD9 protein with high affinity. Also provided are methods for treating CD9-related diseases using the CD9 antibody construct of this invention to target CD9-expressing cells, including those of CD9-positive cancers, such as blood cancers including leukemia, especially B-cell acute lymphoblastic leukemia (B-ALL) , as well as solid tumors.

[0005] As such, in a first aspect, this invention provides an anti-CD9 antibody construct that specifically binds CD9 and comprises antibody heavy chain and light chain complementarity determining regions (CDRs) having the amino acid sequences of (1) SEQ ID NOs: 5-7 and 8-10; or (2) SEQ ID NOs: 11-13 and 14-16, respectively. The anti-CD9 antibody construct of this invention may be a polypeptide in the entirety, or it may be a polypeptide with at least one other polypeptide or a non-polypeptide component conjugated to it.

[0006] In some embodiments, the CD9 antibody construct of this invention comprises an antibody heavy chain variable region (VH) and an antibody light chain variable region (VL) , each comprising the amino acid sequence set forth in (1) SEQ ID NOs: 1 and 2; or (2) SEQ ID NOs: 3 and 4, respectively. In some embodiments, the CD9 antibody construct of this invention comprises a VH and a VL, each comprising the amino acid sequence set forth in (1) SEQ ID NOs: 20 and 21; or (2) SEQ ID NOs: 22 and 23, respectively. In some embodiments, the CD9 antibody construct is an anti-CD9 single chain antibody or single chain variable fragment (scFv) , for example, it specifically binds CD9 and comprises an antibody heavy chain and light chain variable regions comprising the CDRs having the amino acid sequences set forth in SEQ ID NOs: 5-7 and 8-10 or SEQ ID NOs: 11-13 and 14-16, respectively. In some embodiments, the antibody construct of this invention is a chimeric antigen receptor (CAR) construct generated from the anti-CD9 monoclonal antibodies or scFv disclosed above and herein, comprises the amino acid sequences set forth in SEQ ID NOs: 1 and 2 or SEQ ID NOs: 3 and 4 (humanized heavy chain and light chain variable region amino acid sequences) or SEQ ID NOs: 20 and 21 or SEQ ID NOs: 22 and 23 (murine antibody VH and VL amino acid sequences) . In some embodiments, the CD9 antibody construct of this invention is a full-length IgG, a bispecific T cell engager (BiTE) , or an antibody drug conjugate (ADC) . In some embodiments, the CD9 antibody construct is a full-length IgG antibody comprising a modified (N297A substitution) antibody heavy chain constant region. For example, the anti-CD9 IgG antibody comprises the amino acid sequences set forth in SEQ ID NOs: 5-7 and 8-10 or SEQ ID NOs: 11-13 and 14-16 as the antibody heavy chain and light chain CDRs, respectively, preferably the amino acid sequences set forth in SEQ ID NOs: 1 and 2 or SEQ ID NOs: 3 and 4 as the antibody heavy chain and light chain variable regions, respectively, along with the amino acid sequence set forth in SEQ ID NO: 17 as the antibody heavy chain constant region and the amino acid sequence set forth in SEQ ID NO: 18 as the antibody light chain constant region.

[0007] In a second aspect, the present invention provides a nucleic acid comprising a polynucleotide sequence encoding the anti-CD9 antibody construct, a fusion polypeptide comprising the anti-CD9 antibody construct described above and herein, for example, an anti-CD9 scFv or anti-CD9 CAR construct. The nucleic acid may comprise an expression cassette comprising a promoter operably linked to the polynucleotide sequence encoding the anti-CD9 antibody construct or its fusion polypeptide. In some cases, the nucleic acid is in the form of a vector, such as an expression vector including a plasmid or a viral vector.

[0008] In some embodiments, the nucleic acid is contained and present within a host cell, either in the form of a free vector or in the form of DNA sequence permanently integrated into the host cell genome. The presence of such nucleic acid ensures the expression of the anti-CD9 antibody construct of this invention, e.g., an anti-CD9 scFv or anti-CD9 CAR construct. In some embodiments, the host cell is a T cell or natural killer (NK) cell. In some embodiments, the host cell is a T cell expressing a CAR construct comprising the amino acid sequence set forth in SEQ ID NOs: 1 and 2 or SEQ ID NOs: 3 and 4.

[0009] In a third aspect, the present invention provides a conjugate comprising the CD9 antibody construct of the present invention. The conjugate includes a polypeptide component, i.e., the anti-CD9 antibody fusion polypeptide of this invention, and one or more conjugation partners, which may or may not be a protein in nature. For example, the conjugation partner may be a solid support, a detectable moiety, or a therapeutic agent. In some embodiments, the conjugate includes an anti-CD9 antibody construct, such as an anti-CD9 scFv, and a therapeutic agent, such as an anti-cancer agent. In this connection, compositions are also provided, which comprise the CD9 antibody construct of this invention, its encoding nucleic acid, including in the form of an expression cassette or vector, a host cell containing the nucleic acid and / or expressing the anti-CD9 antibody construct, or the conjugate comprising the anti-CD9 antibody fusion polypeptide of this invention joined with a conjugation partner, which may be another polypeptide or of a non-protein chemical nature.

[0010] In a fourth aspect, the present invention provides a method for killing, or inhibiting growth or proliferation CD9-expressing cells. The method includes a step of contacting CD9-expressing cells, e.g., CD9-positive cancer cells, with a composition comprising an effective amount of an anti-CD9 antibody construct, which may or may not be conjugated with a therapeutic agent, e.g., anti-cancer agent, or an adequate number of T cells expressing the CD9 antibody CAR construct or other type of host cells expressing the anti-CD9 humanized antibodies described above and herein, e.g., comprising the amino acid sequence of SEQ ID NOs: 1 and 2 or SEQ ID NOs: 3 and 4.

[0011] In some embodiments, the CD9+ cells being targeted by the claimed methods are cancer cells characterized by their CD9 expression, for example, leukemia (e.g., B-cell acute lymphoblastic leukemia or B-ALL) cells. In some embodiments, the cancer cells are located in a patient’s body. In some embodiments, the method further include these steps, prior to the step of contacting CD9-expressing cells (e.g., CD9-positive cancer cells) with a composition comprising an adequate number of T cells expressing the CD9 antibody CAR construct, (i) isolating T cells from a patient; (ii) transducing the T cells with the nucleic acid encoding the anti-CD9 CAR construct; (iii) cultivating the T cells ex vivo to expanding T cells expressing the anti-CD9 CAR construct comprising, from its N-terminus, an anti-CD9 scFv, a CD8 or CD28 transmembrane domain, a CD28 or 4-1BB costimulatory domain, and a CD3ζ T cell activating domain, and (iv) administering the expanded T cells in sufficient number back into the patient’s body. Exemplary CAR constructs comprise the amino acid sequence set forth in SEQ ID NOs: 1 and 2 or SEQ ID NOs: 3 and 4. In some embodiments, for the purpose of treating CD9-positive cancer, a patient in need for the treatment is administered an effective amount of an anti-CD9 antibody construct (e.g., optionally conjugated with an anti-cancer therapeutic agent) or T cells expressing the anti-CD9 CAR construct described above and herein, and the administering step comprises injection, e.g., by subcutaneous, intravenous, intramuscular, intraperitoneal, or intratumoral injection.

[0012] In a fifth aspect, the present invention provides a kit for treating a disease or condition characterized by CD9 expression, for example, CD9+ cancers. The kit often includes a first container containing a first composition comprising an effective amount of an anti-CD9 antibody construct (e.g., optionally conjugated with a therapeutic agent) or an adequate number of host cells expressing an anti-CD9 antibody construct (such as T cells expressing a CAR comprising, for example, from its N-terminus, an anti-CD9 scFv, a CD8 or CD28 transmembrane domain, a CD28 or 4-1BB costimulatory domain, and a CD3ζ T cell activating domain) , and a second container containing a second composition comprising an effective amount of another therapeutic agent known for its efficacy for treating the disease or condition, such as a chemotherapeutic or immunotherapeutic agent. In some embodiments, the CD9+ cancer is leukemia such as B-cell acute lymphoblastic leukemia (B-ALL) . In some embodiments, the first or second composition is formulated for injection, e.g., for subcutaneous, intravenous, intramuscular, intraperitoneal, or intratumoral injection. In some cases, the kit may further comprise an instruction manual providing instructions for user to properly use the kit.

[0013] In a sixth aspect, the present invention provides an antibody construct that specifically binds human CD9. The antibody constructs comprises three heavy chain CDR sequences selected from the group consisting of amino acid sequences having at least 80%, at least 85%, at least 88%, at least 90%, or at least 95%sequence identity to any one of SEQ ID NO: 5-7, 11-13; and light chain CDR sequences selected from the group consisting of amino acid sequences having at least 80%, at least 85%, at least 88%, at least 90%, or at least 95%sequence identity to any one of SEQ ID NO: 8-10, 14-16. In some embodiments, the antibody construct comprises a heavy chain CDR1 sequence having at least 80%sequence identity to SEQ ID NO: 5 or SEQ ID NO: 11; a heavy chain CDR2 sequence having at least 80%sequence identity to SEQ ID NO: 6 or SEQ ID NO: 12; a heavy chain CDR3 sequence having at least 80%sequence identity to SEQ ID NO: 7 or SEQ ID NO: 13; a light chain CDR1 sequence having at least 80%sequence identity to SEQ ID NO: 8 or SEQ ID NO: 14; a light chain CDR2 sequence having at least 80%sequence identity to SEQ ID NO: 9 or SEQ ID NO: 15; a light chain CDR3 sequence having at least 80%sequence identity to SEQ ID NO: 10 or SEQ ID NO: 16. In some embodiments, the antibody construct comprises a heavy chain variable region that has at least 80%sequence identity to SEQ ID NO: 1, and a light chain variable region that has at least 80%sequence identity to SEQ ID NO: 2. In some embodiments, the antibody construct comprises a heavy chain variable region that has at least 80%sequence identity to SEQ ID NO: 3, and a light chain variable region that has at least 80%sequence identity to SEQ ID NO: 4. In some embodiments, the antibody construct comprises a heavy chain variable region that has at least 80%sequence identity to SEQ ID NO: 20, and a light chain variable region that has at least 80%sequence identity to SEQ ID NO: 21. In some embodiments, the antibody construct comprises a heavy chain variable region that has at least 80%sequence identity to SEQ ID NO: 22, and a light chain variable region that has at least 80%sequence identity to SEQ ID NO: 23.

[0014] In some embodiments, the antibody construct further comprises a Fc domain, and the Fc domain comprises one or more amino acid substitutions. In some embodiments, the one or more amino acid substitutions are at one or more positions selected from L234, L235, N297, G236, P329, and P331. In some embodiments, the Fc domain comprises an amino acid substitution at position N297. Preferably, the N297 is substituted with alanine, i.e. the antibody construct comprises a N297A. In some embodiments, the antibody construct comprises an amino acid sequence that has at least 80%, at least 85%, at least 90%, or at least 95%sequence identity to SEQ ID NO: 17, SEQ ID NO: 30 or SEQ ID NO: 31.

[0015] In a seventh aspect, the present invention provides a pharmaceutical composition comprising the antibody construct as described herein.

[0016] In an eighth aspect, the present invention provided a method for treating a CD9-associated disease in a subject, comprising administering an effective amount of the antibody conjugate as described herein, or the pharmaceutical composition as described herein to the subject. The CD9-associated disease may be a cancer or a non-cancerous disease. In embodiments wherein the disease is a cancer, the cancer is a blood cancer or a solid tumor. In embodiments where the cancer is a blood cancer which may be leukemia or lymphoma. Preferably, the cancer is leukemia. In some embodiments, the leukemia is selected from the group consisting of acute lymphoblastic leukemia (ALL) , acute myeloid leukemia (AML) , acute promyelocytic leukemia (APL) , acute erythroid leukemia, acute megakaryoblastic leukemia, chronic lymphocytic leukemia (CLL) , chronic myeloid leukemia (CML) , chronic myelomonocytic leukemia (CMML) , hairy cell leukemia (HCL) , large granular lymphocytic leukemia (LGLL) , and mast cell leukemia (MCL) ; and preferably is ALL. In particular embodiment, the cancer is B-cell precursor acute lymphoblastic leukemia. The antibody constructs of the present invention have promising effect on suppressing leukemia progression, and improving survival rate of the subject suffering from the cancer. The administration of the antibody conjugate has no or minimal platelet toxicity. In preferred embodiments, the antibody construct comprises one or more amino acid substitutions (or called point mutations) at Fc domain, e.g. the amino acid substitutions as described herein, resulting in no or minimized immunogenicity. In an embodiment, the antibody construct comprises an amino acid sequence that has at least 80%, at least 85%, at least 90%, or at least 95%sequence identity to SEQ ID NO: 17, SEQ ID NO: 30 or SEQ ID NO: 31. In other embodiments where the CD9-associated disease is a non-cancerous disease, the non-cancerous disease is selected from the group consisting of a neurological disorder, an autoimmune disease, an inflammatory disease, an infectious disease, and a hematologic and platelet disorder.BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1A shows the workflow of generating anti-CD9 antibodies using the purified CD9 antigens; Figure 1B shows the purified CD9 antigens in SDS-PAGE; Figure 1C shows ELISA results regarding the CD9 binding activity of the monoclonal antibodies generated; Figure 1D shows the purified IgG of mAb-D and mAb-F; Figure 1E shows the recognition of mAb-D and mAb-F IgG1 antibodies for CD9 extracellular domain; Figure 1F shows the binding specificity of mAb-D and mAb-F against different tumor-expressing antigens; Figure 1G shows the CD9 binding activity of mAb-D and mAb-F, as well as the humanized hAb-D and hAb-F in dose dependent manner; Figure 1H shows the affinity of mAb-D and mAb-F towards CD9 by using results obtained from obtained from biolayer interferometry; Figure 1I shows the results obtained from flow cytometric analysis of murine anti-CD9 antibodies against B-ALL cell lines; Figure IJ shows the results obtained from flow cytometric analysis of murine anti-CD9 antibodies on CD9-overexpressing and CD9-knockout B-ALL cell line models; Figure 1K illustrates that animal model established for testing the effect of mAb-D and mAb-F on leukemia progression and animal survival rate, and the results demonstrates that mAb-D and mAb-F suppressed leukemia progression and doubled animal survival.

[0018] Figure 2A illustrates the process of generating a humanized CD9 antibody based on the identified murine CD9 antibody; Figure 2B shows the purified humanized CD9 antibodies in SDS-PAGE; Figure 2C shows that the humanized CD9 antibodies have no cross-reactivity to antigens CD133 and B7H3; Figure 2D shows the binding activity of humanized CD9 antibodies against CD9 detected with ELISA; Figure 2E shows the binding kinetics of the humanized CD9 antibodies; Figure 2F shows the results obtained from flow cytometric analysis of humanized anti-CD9 antibodies on CD9-overexpressing and CD9-knockout B-ALL cell line models; Figure 2G shows the results of the administration of the humanized CD9 antibodies to the animal model, in which hAb-D and hAb-F retained strong anti-leukemia activities along with substantial survival extension; Figure 2H shows the interferon-γ levels after stimulation of dendritic cells and CD4+ T cells with hAbs in vitro; Figure 2I shows the effect of hAbs on carboxyfluorescein succinimidyl ester (CFSE) -negative CD4+ T cells.

[0019] Figure 3A shows the test for determining the effect of CD9 antibodies on platelet activation; Figure 3B shows the results obtained from the platelet assay; Figure 3C schematically illustrates the position of amino acid substitution on the CD9 antibodies; Figure 3D shows the results obtained from the platelet assay in which the Fc-engineered CD9 antibodies have reduced platelet activation; Figure 3E shows the reduced physical platelet aggregation of Fc-engineered CD9 antibodies by optical aggregometry; Figure 3F demonstrates a set of a transgenic mouse model expressing FcγRIIA on platelets at human physiological level; Figure 3G shows the validity of the animal model in assessing thrombocytopenia; Figure 3H shows that the Fc-engineered CD9 antibody provides no or reduced platelet toxicity.

[0020] Figure 4A shows the results obtained from flow cytometric analysis of the Fc-engineered humanized anti-CD9 antibodies on CD9-overexpressing and CD9-knockout B-ALL cell line models; Figure 4B shows the anti-leukemia efficacy of the Fc-engineered humanized anti-CD9 antibodies; Figure 4C shows that the Fc-engineered humanized anti-CD9 antibodies suppress extramedullary leptomeningeal and testicular leukemia progressing; Figure 4D shows the effect of Fc-engineered humanized anti-CD9 antibodies on splenomegaly; Figure 4E shows the effect of Fc-engineered humanized anti-CD9 antibodies on leukemic burden in major hematopoietic organs including bone marrow, blood, spleen and liver; Figure 4F shows that the Fc-engineered humanized anti-CD9 antibodies can reduce neoplastic burden with prolonged survival duration in hAb-F N297A treated mice and in condition of post-CAR T CD19-negative relapse; Figure 4G shows the effect of Fc-engineered humanized anti-CD9 antibodies on splenomegaly, in case of post-CAR T relapse and in post-blinatumomab relapse; Figure 4H the effect of Fc-engineered humanized anti-CD9 antibodies on leukemic burden in major hematopoietic organs including bone marrow, blood, spleen and liver, in case of post-CAR T relapse and in post-blinatumomab relapse.

[0021] Figure 5A shows that the effect of the Fc-engineered humanized anti-CD9 antibodies on ADCC; Figure 5B shows that the Fc-engineered humanized anti-CD9 antibodies exerted a direct inhibitory effect on cancer cell proliferation; Figure 5C shows that the Fc-engineered humanized anti-CD9 antibodies induced cell death; Figure 5D shows the ADCC%of the Fc-engineered humanized anti-CD9 antibodies and the humanized anti-CD9 antibodies at different concentrations; Figure 5E shows that the Fc-engineered humanized anti-CD9 antibodies induced programmed cell death independently from classical caspase activation.

[0022] Figure 6A shows the binding specificity of Fc-engineered humanized anti-CD9 antibodies of different Fc mutations to cell surface CD9 in CD9-knockout B-ALL cell lines; Figure 6B shows the comparable reduction in platelet aggregation of Fc-engineered CD9 antibodies of different Fc mutants by optical aggregometry; Figure 6C shows the binding of Fc-engineered CD9 antibodies to CD16a-expressing CHO cells; Figure 6D shows the decreased activation of Jurkat-NFAT-CD16a cells by humanized CD9 antibodies with different Fc mutations. DEFINITIONS

[0023] The term “nucleic acid” or “polynucleotide” refers to deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) and polymers thereof in either single-or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) , alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19: 5081 (1991) ; Ohtsuka et al., J. Biol. Chem. 260: 2605-2608 (1985) ; and Rossolini et al., Mol. Cell. Probes 8: 91-98 (1994) ) . The term nucleic acid is used interchangeably with gene, cDNA, and mRNA encoded by a gene.

[0024] The term “gene” means the segment of DNA involved in producing a polypeptide chain. It may include regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons) .

[0025] The term “amino acid” refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, γ-carboxyglutamate, and O-phosphoserine. Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an α carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. “Amino acid mimetics” refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.

[0026] Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.

[0027] “Polypeptide, ” “peptide, ” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues. All three terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymers. As used herein, the terms encompass amino acid chains of any length, including full-length proteins, wherein the amino acid residues are linked by covalent peptide bonds.

[0028] An "antibody" refers to a polypeptide substantially encoded by an immunoglobulin gene or immunoglobulin genes, or fragments thereof, which specifically bind and recognize an analyte (antigen) . The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon and mu constant region genes, as well as the myriad immunoglobulin variable region genes. Light chains are classified as either kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively.

[0029] An exemplary immunoglobulin (antibody) structural unit comprises a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light" (about 25 kD) and one "heavy" chain (about 50-70 kD) . The N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The terms variable light chain (VL) and variable heavy chain (VH) refer to the variable region of the light and heavy chains, respectively.

[0030] Antibodies exist, e.g., as intact immunoglobulins or as a number of well characterized fragments produced by digestion with various peptidases. Thus, for example, pepsin digests an antibody below the disulfide linkages in the hinge region to produce F (ab) '2, a dimer of Fab which itself is a light chain joined to VH-CH1 by a disulfide bond. The F (ab) '2 may be reduced under mild conditions to break the disulfide linkage in the hinge region, thereby converting the F (ab) '2 dimer into an Fab' monomer. The Fab' monomer is essentially an Fab with part of the hinge region (see, Paul (Ed. ) Fundamental Immunology, 3rd Edition, Raven Press, NY (1993) ) . While various antibody fragments are defined in terms of the digestion of an intact antibody, one of skill will appreciate that such fragments may be synthesized de novo either chemically or by utilizing recombinant DNA methodology.

[0031] Further modification of antibodies by recombinant technologies is also well known in the art. For instance, chimeric antibodies combine the antigen binding regions (variable regions) of an antibody from one animal with the constant regions of an antibody from another animal. Generally, the antigen binding regions are derived from a non-human animal, while the constant regions are drawn from human antibodies. The presence of the human constant regions reduces the likelihood that the antibody will be rejected as foreign by a human recipient. On the other hand, "humanized" antibodies combine an even smaller portion of the non-human antibody with human components. Generally, a humanized antibody comprises the hypervariable regions, or complementarity determining regions (CDR) , of a non-human antibody grafted onto the appropriate framework regions of a human antibody. Antigen binding sites may be wild type or modified by one or more amino acid substitutions, e.g., modified to resemble human immunoglobulin more closely. Both chimeric and humanized antibodies are made using recombinant techniques, which are well-known in the art (see, e.g., Jones et al. (1986) Nature 321: 522-525) .

[0032] Thus, the term "antibody" or “antibody construct” as used herein, also includes antibody fragments either produced by the modification of whole antibodies or antibodies synthesized de novo using recombinant DNA methodologies (e.g., a Fab', a F (ab) '2, a single chain fragment variable or scFv, a chimeric or humanized antibody, and a chimeric antigen receptor or CAR) that retain the ability to specifically bind the same intended target antigen. For example, an scFv is composed of a VH and a VL connected by a peptide linker of a relatively short length (e.g., up to 25 amino acids) , whereas a CAR is a recombinant fusion protein composed of an antigen-binding domain (typically an scFv) linked to (typically via a peptide linker) one or more signaling domains for activating immune cells (e.g., T cells or NK cells) .

[0033] As used herein, a “chimeric antigen receptor” or “CAR” describes a single chain polypeptide comprising at least three domains: an extracellular antigen-binding ectodomain, a transmembrane domain, and an intracellular endodomain. The extracellular ectodomain includes a heavy chain variable region (VH) and a light chain variable region (VL) of an antibody (e.g., a single chain antibody or scFv) . The intracellular endodomain acts to transmit intracellular signals triggered by the binding of an antigen (e.g., CD9) to the extracellular ectodomain. Thus, the CAR endodomain contains at least one signaling domain capable of activating an effector cell, for example, a T cell. As CAR constructs are designed for use in T cells, they are also termed chimeric T cell receptor. The term CAR T is often used to collectively refer to a CAR construct (polypeptide) and T cells expressing the construct. For a review of the CAR T construct design and evolution, see Enblad et al., Human Gene Therapy 26 (8) : 498-505, 2015. In the first generation CAR constructs, the intracellular signaling domain contains only the CD3ζ chain of a T cell receptor (TCR) complex, whereas the second and third generation CAR constructs include one and two (respectively) costimulatory domains, e.g., CD28, 4-1BB, in addition to CD3ζ. Thus, CAR constructs have one effector cell (e.g., T cell) signaling domain, one transmembrane domain (e.g., CD28 transmembrane domain) , and at least one signaling domains (e.g., CD3ζ signaling domain) . “Chimeric antigen receptor (CAR) therapy” refers to the use of CAR constructs for therapeutic purposes, including for adoptive cell therapy, a therapeutic approach that typically includes first isolation from a patient and ex vivo expansion and / or manipulation of immune effector cells (e.g., NK cells or T cells) prior to eventual re-infusion of these cells back to the same patient. One example of such use is for the treatment of cancer. Cells used in CAR therapy are typically autologous (taken from the same individual patient and then put back to the same person) but can be allogeneic (taken from one individual and put into another, different individual of the same species, e.g., both humans, especially with similar genetic background) under some circumstances. Cells may be manipulated to express CAR constructs using any one of the well-known methodologies in the art, for example, transformation by a nucleic acid (in the form or DNA or RNA) , transfection by a viral vector, electroporation, etc.

[0034] As used herein, the term “complementarity determining region” or “CDR” refers to three relatively short stretches of amino acid sequences located within each of an antibody variable regions of the heavy chain and the light chain (VH and VL) . The three CDRs in each of the VH and VL are designated CDR1, CDR2 and CDR3, from the N-terminus to the C-terminus, with a full set of CDRs encompassing all six CDRs for both heavy and light chains. The identification of CDRs and numbering of amino acid residues can be based on different numbering systems, among which the commonly used being the Kabat numbering scheme, although alternatives are also know in the art (e.g., the Chothia numbering system) .

[0035] In contrast to the CDRs, “framework” or “framework region” refers to the amino acid sequences within a VH or VL other than the CDRs. The presence of three CDRs on each of the heavy and light chains divides the framework regions into four sub-regions (FR1, FR2, FR3, and FR4) on each of VH and VL, with CDR1 positioned between FR1 and FR2, CDR2 between FR2 and FR3, and CDR3 between FR3 and FR4. When used collectively and not specifying any particular sub-regions as FR1, FR2, FR3, or FR4, the term “framework” or “framework region” is used to refer to the entirety of all FRs together within the variable region of each or both of the heavy chain and light chain.

[0036] The “Fc domain” of an antibody refers to a pair of polypeptide chains comprising a heavy chain domain of the antibody construct or antibody molecule. The Fc domain is the responsible for interacting with Fc receptors on immune cells and other molecules like complement proteins, allowing the activation of immune responses. For example, the Fc domain of immunoglobulin G (IgG) molecule is a dimer, and each of Fc polypeptides comprises CH2 and CH3 of the IgG heavy chain constant regions. The two Fc polypeptides of the Fc domain are capable of stable association with each other. In an embodiment, the antibody construct disclosed herein comprises a Fc domain. In one embodiment, the Fc domain is an IgG Fc domain, such as an IgG1 Fc domain. In another embodiment, the Fc domain is an IgG4 Fc domain. Preferably, the Fc domain is a human Fc domain including, but not limited to, a human IgG1 Fc domain.

[0037] The term “immunoassay” describes an assay that uses an antibody to specifically bind an antigen. The immunoassay is characterized by the use of specific binding properties of a particular antibody to identify, isolate, target, and / or detect the presence or quantity of the antigen.

[0038] The phrase “specifically binds, ” when used to describe the binding relationship between an antibody and its target antigen, refers to a binding reaction that is determinative of the presence of the antigen (e.g., CD9) in a heterogeneous population of proteins and other biologics. Thus, under designated immunoassay conditions, the specified antibodies bind to a particular polypeptide at least two times the background and do not substantially bind in a significant amount to other polypeptides or other antigens present in the sample. Specific binding to an antibody under such conditions may require an antibody that is selected for its specificity for a particular protein. For example, antibodies raised to a CD9 protein can be selected to obtain only those antibodies that are specifically immunoreactive with that specific protein CD9 and not with other proteins including related proteins, e.g., other variants or homologs of the CD9 protein. This selection may be achieved by subtracting out antibodies that cross-react with molecules. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein. For example, solid-phase ELISA immunoassays are routinely used to select antibodies specifically immunoreactive with a protein (see, e.g., Harlow &Lane, Antibodies, A Laboratory Manual (1988) for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity) . Typically, a specific binding reaction (e.g., between the target antigen CD9 and a CD9-specific antibody) will yield at least twice of the background signal or noise (e.g., between a non-target antigen and the CD9-specific antibody) and more typically more than 5, 10, 20, 50, or up to 100 times the background.

[0039] A "label, " "detectable label, " or "detectable moiety" is a composition detectable by radiological, spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means. For example, useful labels include radioisotopes such as 32P, fluorescent dyes, electron-dense reagents, enzymes (e.g., as commonly used in an ELISA) , biotin, digoxigenin, or haptens and proteins that can be made detectable, e.g., by incorporating a radioactive component into a polypeptide or used to detect antibodies specifically reactive with the polypeptide. Typically a detectable label is a heterologous moiety attached to a probe or a molecule (e.g., a protein or nucleic acid) with defined binding characteristics (e.g., a polypeptide with a known binding specificity or a polynucleotide) , so as to allow the presence of the probe / molecule (and therefore its binding target) to be readily detectable. The heterologous nature of the label ensures that it has an origin different from that of the probe or molecule that it labels, such that the probe / molecule attached with the detectable label does not constitute a naturally occurring composition (e.g., a naturally occurring polynucleotide or polypeptide sequence) .

[0040] The term “recombinant” when used with reference, e.g., to a cell, or a nucleic acid, protein, or vector, indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified. Thus, for example, recombinant cells express genes that are not found within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed or not expressed at all.

[0041] As used herein, the term “cancer” encompasses various malignant neoplasms characterized by the proliferation of anaplastic cells that tend to invade surrounding tissue and metastasize to new body sites. Non-limiting examples of different types of cancer suitable for treatment using the compositions and methods of the present invention include colorectal cancer, colon cancer, anal cancer, liver cancer, ovarian cancer, breast cancer, lung cancer, bladder cancer, thyroid cancer, pleural cancer, pancreatic cancer, cervical cancer, prostate cancer, testicular cancer, bile duct cancer, gastrointestinal carcinoid tumors, esophageal cancer, gall bladder cancer, rectal cancer, appendix cancer, small intestine cancer, stomach (gastric) cancer, renal cancer (e.g., renal cell carcinoma) , cancer of the central nervous system, skin cancer, oral squamous cell carcinoma, choriocarcinomas, head and neck cancers, bone cancer, osteogenic sarcomas, fibrosarcoma, neuroblastoma, glioma, melanoma, leukemia (e.g., acute lymphoblastic leukemia, acute lymphocytic leukemia, chronic lymphocytic leukemia, acute myelogenous leukemia, chronic myelogenous leukemia, or hairy cell leukemia) , lymphoma (e.g., non-Hodgkin's lymphoma, Hodgkin's lymphoma, B-cell lymphoma, or Burkitt's lymphoma) , and multiple myeloma.

[0042] The term "immunotherapy" refers to any treatment that uses certain parts of a patient's immune system to fight diseases such as cancer. The patient's own immune system is stimulated (or suppressed) , with administration of one or more agents for that purpose. In some cases, the immunotherapy is "targeted" or cancer cell-specific. In other cases, immunotherapy can be "untargeted, " which refers to administration of agents that do not selectively interact with immune system cells, yet modulates immune system function. Representative examples of untargeted therapies include, without limitation, chemotherapy, gene therapy, and radiation therapy.

[0043] Immunotherapy is one form of targeted therapy that may comprise, for example, the use of cancer vaccines and / or sensitized antigen presenting cells. For example, an oncolytic virus is a virus that is able to infect and lyse cancer cells, while leaving normal cells unharmed, making them potentially useful in cancer therapy. Replication of oncolytic viruses both facilitates tumor cell destruction and also produces dose amplification at the tumor site. They may also act as vectors for anticancer genes, allowing them to be specifically delivered to the tumor site. The immunotherapy can involve passive immunity for short-term protection of a host, achieved by the administration of pre-formed antibody directed against a cancer antigen or disease antigen (e.g., administration of a monoclonal antibody, optionally linked to a chemotherapeutic agent or toxin, to a tumor antigen) . For example, anti-VEGF and mTOR inhibitors are known to be effective in treating renal cell carcinoma. Immunotherapy can also focus on using the cytotoxic lymphocyte-recognized epitopes of cancer cell lines. Alternatively, antisense polynucleotides, ribozymes, RNA interference molecules, triple helix polynucleotides and the like, can be used to selectively modulate biomolecules that are linked to the initiation, progression, and / or pathology of a tumor or cancer.

[0044] The term "immunogenic chemotherapy" refers to any chemotherapy that has been demonstrated to induce immunogenic cell death, a state that is detectable by the release of one or more damage-associated molecular pattern (DAMP) molecules, including, but not limited to, calreticulin, ATP and HMGB1 (see, e.g., Kroemer et al. (2013) , Annu. Rev. Immunol., 31: 51-72) . In addition, the term "immunogenic chemotherapy" further refers to any chemotherapy that results in priming the immune system such that it leads to enhanced immune activity towards cancer. Specific representative examples of consensus immunogenic chemotherapies include 5'-fluorouracil, anthracyclines, such as doxorubicin, and the platinum drug, oxaliplatin, among others.

[0045] The term "inhibiting" or "inhibition, " as used herein, refers to any detectable negative effect on a target biological process, such as RNA / protein expression of a target gene, the biological activity of a target protein, protein-protein specific binding or interaction, cellular signal transduction, cell proliferation, presence / level of an organism especially a micro-organism, any measurable biomarker, bio-parameter, or symptom in a subject, and the like. Typically, an inhibition is reflected in a decrease of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%or greater in the target process (e.g., a target cell proliferation rate) , or any one of the downstream parameters mentioned above, when compared to a control. “Inhibition” further includes a 100%reduction, i.e., a complete elimination, prevention, or abolition of a target biological process or signal or disease / symptom. The other relative terms such as “suppressing, ” “suppression, ” “reducing, ” and “reduction” are used in a similar fashion in this disclosure to refer to decreases to different levels (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%or greater decrease compared to a control level) up to complete elimination of a target biological process or signal or disease / symptom. On the other hand, terms such as “activate, ” “activating, ” “activation, ” “increase, ” “increasing, ” “promote, ” “promoting, ” “enhance, ” “enhancing, ” or “enhancement” are used in this disclosure to encompass positive changes at different levels (e.g., at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, or greater such as 3, 5, 8, 10, 20-fold increase compared to a control level in a target process, signal, or symptom / disease incidence.

[0046] As used in this application, an "increase" or a "decrease" refers to a detectable positive or negative change in quantity from a comparison control, e.g., an established standard control (such as an average rate of proliferation of a certain cell type) , prior to a certain event (e.g., exposure to an agent regulating cellular proliferation) . An increase is a positive change that is typically at least 10%, or at least 20%, or 50%, or 100%, and can be as high as at least 2-fold or at least 5-fold or even 10-fold of the control value. Similarly, a decrease is a negative change that is typically at least 10%, or at least 20%, 30%, or 50%, or even as high as at least 80%or 90%of the control value. Other terms indicating quantitative changes or differences from a comparative basis, such as "more, " "less, " "higher, " and "lower, " as well as terms indicating an action to cause such changes or differences, such as "increase, " "promote, " "enhance, " "decrease, " "inhibit, " and "suppress, " are used in this application in the same fashion as described above. In contrast, the term "substantially the same" or "substantially lack of change" indicates little to no change in quantity from the standard control value, typically within ± 10%of the standard control, or within ± 5%, 2%, or even less variation from the standard control.

[0047] As used herein, an "effective amount" or a "therapeutically effective amount" means the amount of an active agent that, when administered to a subject or patient for treating a disorder, is sufficient to prevent, reduce the frequency of, or alleviate the symptoms of the disorder. The effective amount will vary depending on a variety of the factors, such as a particular compound or bioactive agent used, the disease and its severity, the age, weight, and other factors of the subject to be treated. Amelioration of a symptom of a particular condition by administration of a pharmaceutical composition described herein refers to any lessening, whether permanent or temporary, that can be associated with the administration of the pharmaceutical composition. For example, the quantity of a therapeutic agent-conjugated anti-CD9 antibody construct administered is considered therapeutically effective for treating a condition involving undesired CD9 expression when administration results in eliminated symptoms, delayed onset of symptoms, or reduced frequency or severity of symptoms including disease progression, for example, in the case of treating CD9-positive cancer, as indicated in tumor mass, metastasis, morbidity and mortality, etc. The exact amount “effective” for achieving a desired therapeutic effect will depend on the nature of the therapeutic agent, the manner of administration, and the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992) ; Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999) ; and Pickar, Dosage Calculations (1999) ) .

[0048] As used herein, the term "treatment" or "treating" includes both therapeutic and preventative measures taken to address the presence of a disease or condition or the risk of developing such disease or condition at a later time. It encompasses therapeutic or preventive measures for alleviating ongoing symptoms, inhibiting or slowing disease progression, delaying of onset of symptoms, or eliminating or reducing side-effects caused by such disease or condition. A preventive measure in this context and its variations do not require 100%elimination of the occurrence of an event; rather, they refer to a suppression or reduction in the likelihood or severity of such occurrence or a delay in such occurrence.

[0049] A “subject, ” or "subject in need of treatment, " as used herein, refers to an individual who seeks medical attention due to risk of, or actual sufferance from, a condition involving an undesirable or abnormal, excessive expression of CD9. The term subject can include both animals, especially mammals, and humans. Subjects or individuals in need of treatment include those that demonstrate symptoms caused by or related to CD9 expression, e.g., undesirable or inappropriate cell proliferation, such as tumor and especially malignant tumor / cancer including leukemia or lymphoma or are at risk of later developing these conditions and / or related symptoms.

[0050] A "pharmaceutically acceptable" or "pharmacologically acceptable" excipient is a substance that is not biologically harmful or otherwise undesirable, i.e., the excipient may be administered to an individual along with a bioactive agent without causing any undesirable biological effects. Neither would the excipient interact in a deleterious manner with any of the components of the composition in which it is contained.

[0051] The term "excipient" refers to any essentially accessory substance that may be present in the finished dosage form of the composition of this invention. For example, the term "excipient" includes vehicles, binders, disintegrants, fillers (diluents) , lubricants, glidants (flow enhancers) , compression aids, colors, sweeteners, preservatives, suspending / dispersing agents, film formers / coatings, flavors and printing inks.

[0052] The term “consisting essentially of, ” when used in the context of describing a composition containing an active ingredient or multiple active ingredients, refer to the fact that the composition does not contain other ingredients possessing any similar or relevant biological activity of the active ingredient (s) or capable of enhancing or suppressing the activity, whereas one or more inactive ingredients such as physiological or pharmaceutically acceptable excipients may be present in the composition. For example, a composition consisting essentially of active agents effective for treating a CD9-positive cancer by suppressing CD9-positive cell proliferation and / or survival in a subject is a composition that does not contain any other agents that may have any detectable positive or negative effect on the same target process (e.g., efficacy in treating CD9+cancer or suppression of CD9+ cell proliferation / survival) or that may increase or decrease to any measurable extent of the disease severity or outcome among the receiving subjects.

[0053] A “promoter” is defined as an array of polynucleotide control sequences that direct transcription of another polynucleotide sequence. As used herein, a promoter includes necessary polynucleotide sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element. A promoter also optionally includes distal enhancer or repressor elements, which can be located as much as several thousand base pairs from the start site of transcription. A “constitutive” promoter is a promoter that is active under most environmental and developmental conditions. In contrast, an “inducible” promoter is a promoter that rendered active by environmental or developmental regulation and under certain specific environmental or developmental conditions. The term “operably linked” refers to a functional linkage between a polynucleotide expression control sequence (such as a promoter, or array of transcription factor binding sites) and another polynucleotide sequence (such as a protein-coding sequence) , wherein the expression control sequence directs transcription of the second polynucleotide sequence.

[0054] An “expression cassette” is a nucleic acid construct, generated recombinantly or synthetically, with a series of specified polynucleotide elements that permit transcription of a particular polynucleotide sequence in a host cell or in an in vitro transcription system (e.g., partially reconstituted cell lysate) . An expression cassette may be the entirety or a part of a plasmid, viral genome, or other replicable nucleic acid construct such as episome. Typically, an expression cassette includes a polynucleotide sequence to be transcribed, operably linked to a promoter.

[0055] As used herein, the term “heterologous” is used to describe the relationship of two elements placed adjacent to each other in a construct, referring to these two elements such as two polynucleotide sequences (e.g., a promoter sequence and a polypeptide-encoding sequence) or two polypeptide sequences (e.g., a signal peptide sequence and another peptide sequence) being from two different natural origins, such that these two elements are not found in the same relative positions in nature. Thus, a “heterologous promoter” for a gene refers to a promoter that is not naturally operably linked to that gene. Similarly, a “heterologous polypeptide” or “heterologous polynucleotide” to one particular protein or its encoding sequence is one derived from an origin different from the protein’s origin. The fusion of two heterologous polypeptide (or polynucleotide) sequences does not result in a longer polypeptide (or polynucleotide) sequence that can be found in nature as an intact protein (or naturally occurring nucleotide sequence) or a segment thereof.

[0056] The term "conjugated with" or "coupled to" describes any construction whereby the polypeptide, e.g., a polypeptide of this invention comprising an antigen-bind site capable of specifically binding to CD9, is covalently or non-covalently linked, attached, or joined at its N-or C-terminus or at any side reactive group to a moiety that may serve as a solid support, a detectable element, or a therapeutically active agent for the purpose of detecting, isolating, or imaging of target cells or tissue or for the purpose of treating a relevant medical condition.

[0057] The term “about” denotes a range of + / -10%of a pre-determined value. For example, “about 10” indicates a range of 90%to 110%of 10, i.e., 9 to 11.DETAILED DESCRIPTION OF THE INVENTIONI. Introduction

[0058] The present invention relates to compositions and methods for treating diseases, disorders, or conditions associated with dysregulated expression of the CD9 antigen. The invention provides a novel single-chain variable fragment (scFv) that specifically binds to CD9 protein. The invention also provides fully humanized IgG antibodies containing a modification in the heavy chain constant region that specifically target CD9 with significantly reduced side effects such as undesired platelet activation. II. Recombinant Technology in General

[0059] Basic texts disclosing general methods and techniques in the field of recombinant genetics include Sambrook and Russell, Molecular Cloning, A Laboratory Manual (3rd ed. 2001) ; Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990) ; and Ausubel et al., eds., Current Protocols in Molecular Biology (1994) .

[0060] For nucleic acids, sizes are given in either kilobases (kb) or base pairs (bp) . These are estimates derived from agarose or acrylamide gel electrophoresis, from sequenced nucleic acids, or from published DNA sequences. For proteins, sizes are given in kilodaltons (kDa) or amino acid residue numbers. Proteins sizes are estimated from gel electrophoresis, from sequenced proteins, from derived amino acid sequences, or from published protein sequences.

[0061] Oligonucleotides that are not commercially available can be chemically synthesized, e.g., according to the solid phase phosphoramidite triester method first described by Beaucage &Caruthers, Tetrahedron Lett. 22: 1859-1862 (1981) , using an automated synthesizer, as described in Van Devanter et. al., Nucleic Acids Res. 12: 6159-6168 (1984) . Purification of oligonucleotides is performed using any art-recognized strategy, e.g., native acrylamide gel electrophoresis or anion-exchange HPLC as described in Pearson &Reanier, J. Chrom. 255: 137-149 (1983) . Polynucleotide sequences such as synthetic oligonucleotides can be verified using well-established methodologies, e.g., the chain termination method for sequencing double-stranded templates of Wallace et al., Gene 16: 21-26 (1981) . III. CD9 Antibody Constructs

[0062] The present invention relates to the making and use of antibody constructs that specifically recognize and bind the CD9 protein. In particular, a CD9 antibody construct is derived from an anti-CD9 monoclonal antibody, termed mAb-D or mAb-F, contains at least one set of six CDRs, three in each of the VH and VL, and therefore retains the binding specificity and / or affinity of the original monoclonal antibody for the CD9 antigen. The CDRs can be found in SEQ ID NOs: 5-10 as the first set, derived from mAb-D, and SEQ ID NOs: 11-16 as the second set, derived from mAb-F. The invention also provides antibody constructs having VH CDRs that has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%sequence identity to any of SEQ ID Nos: 5-10; and VL CDRs that has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%sequence identity to any of SEQ ID Nos: 11-16.

[0063] The anti-CD9 antibody constructs of this invention in some cases are characterized by the presence of at least one or both of the full variable region of the heavy chain and light chain, see SEQ ID NOs: 1, 2, 3, and 4. Preferably, the CD9 antibody constructs of this invention is humanized. In some embodiments, the CD9 antibody constructs herein comprising a heavy chain variable region that has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 1, 3, 20 or 22, and a light chain variable region that has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 2, 4, 21 or 23.

[0064] In some embodiments, the CD9 antibody constructs have a Fc domain, when including the heavy chain constant region. In some embodiments, the Fc domain comprises a modification, such as an amino acid substitution. The modification may be, for example, a modification that alters effector function, a modification that alters the binding ability of the antibody construct to protein A, or the like. In some embodiments, the Fc domain comprises one or more amino acid substitutions at one or more positions selected from L234, L235, N297, G236, P329, and P331. In some embodiments, the Fc domain comprises one or more amino acid substitutions at one or more positions selected from L234, L235, G239, P329 and N297.

[0065] In a more specific embodiment, the Fc domain comprises an amino acid substitution at N297. The original amino acid asparagine (N) at position 297 is substituted with alanine (A) , glutamine (Q) , aspartic acid (D) , or glycine (G) . Preferably, the amino acid substitution is N297A, i.e. the original amino acid asparagine (N) at position 297 is substituted with amino acid alanine (A) . In a particular embodiment, the antibody construct comprises an amino acid sequence as shown in SEQ ID NO: 17, i.e. having N297A, or an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%sequence identity to SEQ ID NO: 17.

[0066] In another embodiment, the Fc domain comprises amino acid substitutions at L234, L235, N297 and P329. Preferably, the amino acid substitutions include, but are not limited to, L234A, L235A, N297A and P329G, i.e. the original amino acid leucine (L) at position 234 and 235 are substituted with amino acid alanine (A) , and the amino acid asparagine (N) at position 297 is substituted with amino acid alanine (A) , as well as the amino acid proline (P) at position 329 is substituted with amino acid glycine (G) . In a particular embodiment, the antibody construct comprises an amino acid sequence as shown in SEQ ID NO: 31, i.e. having L234A, L235A, N297A and P329G (denoted as “AAAG” ) , or an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%sequence identity to SEQ ID NO: 31.

[0067] In a further embodiment, the Fc domain comprises amino acid substitutions at L234, L235, and G326. Preferably, the amino acid substitutions include, but are not limited to, L234S, L235T, and G236R, i.e. the original amino acid leucine (L) at position 234 and 235 are substituted with amino acid serine (S) and amino acid threonine (T) respectively, and the amino acid glycine (G) at position 236 is substituted with amino acid arginine (R) . In a particular embodiment, the antibody construct comprises an amino acid sequence as shown in SEQ ID NO: 30, i.e. having L234S, L235T, and G236R (denoted as “STR” ) , or an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%sequence identity to SEQ ID NO: 30.

[0068] It would be appreciated that additional modifications in the Fc region that can be made to the anti-CD9 antibody construct of this invention include, but are not limited to, S228P, N297D, N297A, N297Q, N297G, L234A, L234F, L234S, L235E, L235A, L235T, G236A, G236R, G237A, D265A, G236R, D265A, K322A, L328R, P329A, P329G, E233P, L234V, L234A, L235A, L235E, G237A, S267K, P238S, H268A, A330S, P331S, V309L, L234A / L235A, L234F / L235E, L234S / L235T, and S228P / L235E.

[0069] Modifications and changes can be made in the structure or sequence of the antibody constructs disclosed herein, provided that such changes do not compromise their desired functional characteristics. Changes, like conservative amino acid substitutions, can be introduced without significantly affecting the biological activity or interactive capacity of the molecule. A polypeptide’s function is primarily determined by its interactive nature, certain sequence variations can be implemented while still yielding a construct with comparable properties and performance to the original. A. scFv and CAR

[0070] One embodiment of the CD9 antibody construct of the present invention is a single chain antibody or scFv, where at least one full set of six CDRs, i.e., CDR1-3 from each of the VH and VL of the original monoclonal antibody mAb-D or mAb-F, is retained. The framework regions of each of the VH and VL are optionally modified, such as for humanization purposes. In some cases, at least one copy of each of the full length VH and VL is retained. They may be connected directly or optionally connected through a peptide linker, which has a length of 2-30 amino acids, usually no more than 20 or 25 amino acids. An exemplary scFv of the present invention is described herein has an amino acid sequence comprising SEQ ID NOs: 1 and 2 or SEQ ID NOs: 3 and 4.

[0071] Another embodiment of the CD9 antibody construct of the present invention is a chimeric antigen receptor or CAR, which includes at least an extracellular antigen-binding ectodomain, a transmembrane domain, and an intracellular endodomain. The extracellular ectodomain contains the antigen-binding site, characterized by the presence of at least one full set of six CDRs, i.e., CDR1-3 from each of the VH and VL of the original monoclonal antibody mAb-D or mAb-F. For example, the ectodomain may comprise the anti-CD9 scFv as described above and herein. On the other hand, the intracellular signaling domain includes at least the CD3ζ chain of a T cell receptor (TCR) complex, optionally one and two additional costimulatory domains. In one example, the CAR construct of the present invention includes anti-CD9 scFv, CD8 or CD28 transmembrane domain, CD28 or 4-1BB costimulatory domain, and CD3ζ T cell activating domain. One or more peptide linkers may be used between any two adjacent domains of the CAR construct. B. Conjugates

[0072] In view of the prevalence of CD9 expression in various conditions and diseases, especially in different types of cancers, and the desirable binding profile of the CD9 antibody constructs of this invention, different forms of conjugates can be devised for use in the detection of CD9 and in targeted delivery of therapeutic agents to CD9+ cells, thus providing new and effective means in the diagnosis and treatment of conditions and diseases involving aberrant CD9 expression.

[0073] More specifically, the CD9 antibody construct of this invention as a polypeptide-based construct can be conjugated with a variety of additional moieties, polypeptide or non-polypeptide in nature, depending on the intended use of the conjugated CD9 antibody construct. Such a conjugate may involve a polypeptide of this invention, comprising an antigen-bind site capable of specifically binding to CD9, being linked, attached, or joined at its N-or C-terminus or at any side reactive group to a moiety to serve as a solid support, a detectable element, or a therapeutically active agent. The linkage may be provided by way of a covalent bond or a non-covalent bond, e.g., through the binding action between a known binding pair, such as biotin-streptavidin or SpyCatcher-SpyTag pair, with one binding partner affixed to the polypeptide of this invention and the other binding partner affixed to the moiety to be conjugated to the polypeptide of this invention. Once made, the conjugate may be used for the purpose of detecting, isolating, imaging, or killing of CD9-expressing cells or tissues or for the purpose of treating a medical condition involving CD9 expression. In this regard, a detectable moiety produces a signal permitting easy detection by radiological, spectroscopic, photochemical, biochemical, immunochemical, chemical, or other means. Therapeutic moieties suitable for use in this invention may include known effective agents for treating conditions or diseases involving CD9 expression, such as anti-cancer therapeutic agents known in the art or described herein, e.g., for radiotherapy, chemotherapy, immunotherapy and the like. IV. Nucleic Acids and Host Cells

[0074] Upon completion of designing a CD9 antibody construct of this invention (or its conjugate in the fusion polypeptide form) , a nucleic acid comprising a polynucleotide sequence encoding the construct (or its conjugate) may be constructed. Such nucleic acid may be in the form of DNA or RNA. In some cases, the nucleic acid takes the form of an expression cassette in which the coding sequence is operably linked to a promoter, typically heterologous promoter, directing the transcription and / or expression of the CD9 antibody construct. In some embodiments, the nucleic acid is a vector, especially an expression vector, encoding the CD9 antibody construct, such as a plasmid or a viral vector. A. Expression Cassettes and Vectors

[0075] To obtain high level expression of a nucleic acid construct encoding a desired polypeptide, one typically subclones a polynucleotide sequence encoding the polypeptide into an expression cassette, e.g., an expression vector, that contains a strong promoter to direct transcription, a transcription / translation terminator, and a ribosome binding site for translational initiation. Suitable promoters are well known in the art and described, e.g., in Sambrook and Russell, supra, and Ausubel et al., supra. Eukaryotic and prokaryotic expression systems for bacterial, mammalian, yeast, insect, or plant cells are well known in the art and are also commercially available. Kits for such expression systems are commercially available. One exemplary eukaryotic expression vector is an adenoviral vector, an adeno-associated vector, a lentiviral vector, or a retroviral vector. B. Host Cells and Recombinant Protein Expression

[0076] In the context of practicing the present invention, a broad variety of host cells, prokaryotic or eukaryotic, may be used for the expression and / or production of an anti-CD9 antibody construct of this invention. The choice of host cells will depend on the specific purpose of the expression, for example, whether it is for making an antibody construct (e.g., an anti-CD9 IgG or scFv) or for producing T cells expressing an anti-CD9 CAR construct to be used in CAR-T therapy.

[0077] Standard transfection methods can be used to produce bacterial, mammalian, yeast, insect, or plant cell lines that express large quantities of a recombinant polypeptide (e.g., a CD9 antibody construct) , which is then purified using standard techniques (see, e.g., Colley et al., J. Biol. Chem. 264: 17619-17622 (1989) ; Guide to Protein Purification, in Methods in Enzymology, vol. 182 (Deutscher, ed., 1990) ) . Transformation of eukaryotic and prokaryotic cells are performed according to standard techniques (see, e.g., Morrison, J. Bact. 132: 349-351 (1977) ; Clark-Curtiss &Curtiss, Methods in Enzymology 101: 347-362 (Wu et al., eds, 1983) .

[0078] Any of the well-known procedures for introducing foreign nucleotide sequences into host cells may be used. These include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, liposomes, microinjection, plasma vectors, viral vectors and any of the other well-known methods for introducing a polynucleotide sequence encoding a protein of interest into a host cell (see, e.g., Sambrook and Russell, supra) . It is only necessary that the particular genetic engineering procedure used be capable of successfully introducing at least one coding sequence into the host cell capable of expressing the recombinant polypeptide.

[0079] When a recombinant polypeptide, e.g., an anti-CD9 scFv of this invention, is expressed in host cells in satisfying quantity, its isolation / purification can follow the standard protein purification procedure including solubility fractionation, size differential filtration, and column chromatography, as well as various immunoassay-based methods.

[0080] For the purpose of producing recombinant immune effector cells expressing a CD9 CAR construct, such as CAR-T cells of this invention, typically the desired type of immune effector cells, such as natural killer (NK) cells and T cells, including cytotoxic T lymphocytes (CTLs) and regulatory T cells, is first isolated from the peripheral mononuclear cells (PBMCs) taken from a patient being treated for a condition or disease characterized by the inappropriate expression of CD9. Alternatively, the immune effector cells may be obtained from another human subject, preferably with a genetic background similar to that of the intended recipient. The isolated cells are then transformed or transfected with an expression vector, e.g., a viral vector derived from an adenovirus, an adeno-associated virus (AAV) , a lentivirus, or a retrovirus, encoding the anti-CD9 CAR construct such that sufficient CD9 expression level can be detected and verified on the surface of these cells. The manipulated immune effector cells, now steadily expressing the anti-CD9 CAR construct on their cell surface, are then cultivated for expansion ex vivo to reach an adequate quantity before they are administered back to the patient. Typically, roughly in the range of about 5x104 to about 5x107 of such CAR T cells are re-infused into the patient during each application. For example, about 1x105 to about 3x107, about 3x105 to about 3x107, about 2x105 to about 2x107, about 5x106 to about 1x107 CAR T cells are administered in each infusion. IV. Pharmaceutical Compositions and Administration

[0081] The present invention also provides pharmaceutical compositions or physiological compositions comprising an effective amount of a CD9 antibody construct, e.g., an anti-CD9 IgG or scFv or a conjugate thereof, that can target CD9-expressing cells and in both prophylactic and therapeutic applications to address conditions and diseases involving aberrant CD9 expression, e.g., different types of cancers. Such pharmaceutical or physiological compositions also include one or more pharmaceutically or physiologically acceptable excipients or carriers. Pharmaceutical compositions of the invention are suitable for use in a variety of drug delivery systems. Suitable formulations for use in the present invention are found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Philadelphia, PA, 17th ed. (1985) . For a brief review of methods for drug delivery, see, Langer, Science 249: 1527-1533 (1990) .

[0082] The pharmaceutical compositions of the present invention can be administered by various routes, e.g., subcutaneously, transdermally, intramuscularly, intravenously, intraperitoneally, or intratumorally. The preferred routes of administering the pharmaceutical compositions are through injection, especially local delivery by injection (e.g., intratumoral injection) to a relevant organ or tissue in a patient suffering from a solid tumor involving excessive and undesirable cellular proliferation at daily doses of about 10-100,000 μg, about 100-10,000 μg, or about 1,000-5,000 μg of the recombinantly produced an anti-CD9 antibody construct or conjugate for a 70 kg adult human per day. The appropriate dose may be administered in a single daily dose or as divided doses presented at appropriate intervals, for example as two, three, four, or more subdoses per day.

[0083] For preparing pharmaceutical compositions containing a CD9 antibody construct or conjugate thereof, one or more inert and pharmaceutically acceptable carriers are used. The pharmaceutical carrier (s) can be in any form, although liquid form is preferred for formulations intended for injection. Suitable carriers include, for example, magnesium carbonate, magnesium stearate, talc, lactose, sugar, pectin, dextrin, starch, tragacanth, methyl cellulose, sodium carboxymethyl cellulose, a low-melting wax, cocoa butter, and the like.

[0084] Liquid pharmaceutical compositions include, for example, solutions, suspensions, and emulsions suitable for injection. Sterile buffer solutions of the active component (e.g., a recombinantly anti-CD9 antibody construct or conjugate) or sterile solutions of the active component in solvents comprising water, buffered water, saline, PBS, ethanol, or propylene glycol are examples of liquid compositions suitable for parenteral administration. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents, wetting agents, detergents, and the like.

[0085] Sterile solutions can be prepared by dissolving the active component in the desired solvent system, and then passing the resulting solution through a membrane filter to sterilize it or, alternatively, by dissolving the sterile active component in a previously sterilized solvent under sterile conditions. The resulting aqueous solutions may be packaged for use as is, or lyophilized, the lyophilized preparation being combined with a sterile aqueous carrier prior to administration. The pH of the preparations typically will be between 3 and 11, more preferably from 5 to 9, and most preferably from 7 to 8.

[0086] The pharmaceutical compositions of a CD9 antibody construct or a conjugate thereof can be administered for prophylactic and / or therapeutic purposes. In therapeutic applications, compositions are administered to a patient already suffering from a condition that involves excessive and undesirable cellular proliferation in an amount sufficient to prevent, cure, reverse, or at least partially slow or arrest the symptoms of the condition and its complications, such as the onset, progression, duration, and severity of the disease. An amount adequate to accomplish this is defined as a "therapeutically effective dose. " Amounts effective for this use will depend on the severity of the disease or condition and the weight and general state of the patient, but generally range from about 10-100,000 μg, about 100-10,000 μg, or about 1,000-5,000 μg of the CD9 antibody construct or a conjugate thereof per day for a 70 kg patient, with dosages from 1-1500 μg to about 20-100 μg of the anti-CD9 antibody or conjugate per day per kg for a patient being more commonly used.

[0087] In prophylactic applications, pharmaceutical compositions containing an adequate amount of a CD9 antibody construct or conjugate are administered to a patient susceptible to or otherwise at heightened risk of developing a disease or condition caused or exacerbated by undesirable and excessive cellular proliferation, in an amount sufficient to delay or prevent the onset of the symptoms. Such an amount is defined to be a "prophylactically effective dose. " In this use, the precise amounts of the anti-CD9 antibody construct again depend on the patient's state of health and weight, but generally range from about 10-100,000 μg, about 100-10,000 μg, or about 1,000-5,000 μg of the CD9 antibody construct or a conjugate thereof per day for a 70 kg patient, with dosages from 1-1500 μg to about 20-100 μg of the CD9 antibody or conjugate per day per kg for a patient being more commonly used.

[0088] Single or multiple administrations of the compositions can be carried out with dose levels and pattern being selected by the treating physician. In any event, the pharmaceutical formulations should provide a quantity of the CD9 antibody construct of this invention or its conjugate sufficient to effectively address at least one targeted symptom of a condition or disease involving CD9 expression in the patient, either therapeutically or prophylactically. V. Anti-Cancer Therapeutic Agents

[0089] One potential use of the anti-CD9 antibody construct of this invention or a conjugate thereof is the treatment of cancers where the relevant tissues or cells exhibit aberrant CD9 expression, which may include various types of blood cancers (such as leukemia or lymphoma) or solid tumors (such as pancreatic cancer or ovarian cancer) .

[0090] In such applications, one or more of these previously known effective anti-cancer therapeutic agents, including those named in this application, may be administered concurrently with the CD9 antibody construct or its conjugate to subjects in need of treatment. Optionally, the agent (s) may be used in combination with the CD9 antibody construct of the present invention (e.g., an anti-CD9 IgG, scFv or its conjugate) to suppress cancer growth, inhibit cancer metastasis, and facilitate remission from the disease. In the case of combination therapy, all of the active agents may be administered concurrently each in an effective amount, either together in a single composition or separately in two or more different compositions.

[0091] For example, various chemotherapeutic agents are known to be effective for use to treat various cancers. As used herein, a “chemotherapeutic agent” encompasses any chemical compound exhibiting suppressive effect against cancer cells, thus useful in the treatment of cancer. Classes of chemotherapeutic agents include, but are not limited to: alkylating agents, antimetabolites, kinase inhibitors, spindle poison plant alkaloids, cytoxic / antitumor antibiotics, topoisomerase inhibitors, photosensitizers, anti-estrogens and selective estrogen receptor modulators (SERMs) , anti-progesterones, estrogen receptor down-regulators (ERDs) , estrogen receptor antagonists, leutinizing hormone-releasing hormone agonists, anti-androgens, aromatase inhibitors, EGFR inhibitors, VEGF inhibitors, and anti-sense oligonucleotides that inhibit expression of genes implicated in abnormal cell proliferation or tumor growth. Chemotherapeutic agents useful in the treatment methods disclosed herein also include cytostatic and / or cytotoxic agents.

[0092] Exemplary anti-cancer therapeutic agents include alkylating agents such as altretamine, bendamustine, busulfan, carboquone, carmustine, chlorambucil, chlormethine, chlorozotocin, cyclophosphamide, dacarbazine, fotemustine, ifosfamide, lomustine, melphalan, melphalan flufenamide, mitobronitol, nimustine, nitrosoureas, pipobroman, ranimustine, semustine, streptozotocin, temozolomide, thiotepa, treosulfan, triaziquone, triethylenemelamine, trofosfamide, and uramustine; anthracyclines such as aclarubicin, daunorubicin, doxorubicin, epirubicin, idarubicin, mitoxantrone, pirarubicin, valrubicin, and zorubicin; cytoskeletal disruptors (taxanes) such as abraxane, cabazitaxel, docetaxel, larotaxel, paclitaxel, taxotere, and tesetaxel; epothilones such as ixabepilone; histone deacetylase inhibitors such as vorinostat, romidepsin, and inhibitors of topoisomerase I such as belotecan, camptothecin, exatecan, gimatecan, irinotecan, and topotecan; inhibitors of topoisomerase II such as etoposide, teniposide, and tafluposide; kinase inhibitors such as bortezomib, erlotinib, gefitinib, imatinib, dasatinib, ponatinib, ruxolitinib, vemurafenib, and vismodegib; BCL-2 inhibitors such as venetoclax and navitoclax; nucleotide analogs and precursor analogs such as azacitidine, azathioprine, capecitabine, cytarabine, doxifluridine, fluorouracil, gemcitabine, hydroxyurea, mercaptopurine, methotrexate, and tioguanine (formerly thioguanine) ; peptide antibiotics such as actinomycin and bleomycin; platinum-based agents such as carboplatin, cisplatin, dicycloplatin, oxaliplatin, nedaplatin, and satraplatin; retinoids such as alitretinoin, bexarotene, and tretinoin; glucocorticoids such as prednisone and dexamethasone, and vinca alkaloids and derivatives such as vinblastine, vincristine, vindesine, and vinorelbine.

[0093] In addition to targeting CD9, other immunotherapeutic approaches may also be used in combination for cancer treatment. In accordance with the strategy of active immunotherapy, for example, monoclonal antibodies and their conjugates can be used to target other cancer markers. They include adotrastuzumab (HER2) , alemtuzumab (CD52) , bevaclzumab (VEGF) , brentuximab (CD30) , capromab (PSMA) , cetuximab (EGFR) , elotuzumab (SLAMF7) , ibritumomab (CD20) , necitumumab (EGFR) , blinatumomab (CD19) , obinutumab (CD20) , ofatumumab (CD20) , olaratumab (PDGFRA) , panitumumab (EGFR) , pertuzumab (HER2) , ramucirumab (VEGFR2) , rituximab (CD20) , trastuzumab (HER-2) , inotuzumab-ozogamicin (CD22) , gemtuzumab-ozogamicin (CD33) , and bevacizumab-awwb (VEGF) . Moreover, checkpoint inhibitors and cytokines can be used in accordance with the strategy of passive immunotherapy. Currently approved checkpoint inhibitors target molecules CTLA4, PD-1, and PD-L1, including ipilimumab (CTLA4) , nivolumab, pembrolizumab, cemiplimab, spartalizumab (PD-1) , atezolizumab, avelumab, and durvalumab (PD-L1) . Cytokines for use in the treatment of cancer and associated conditions include granulocyte colony-stimulating factor (G-CSF) , granulocyte macrophage colony-stimulating factor (GM-CSF) , interleukin-2 (IL-2) , and interleukin-11 (IL-11) . VI. Kits and Compositions

[0094] The invention provides compositions and kits comprising the anti-CD9 antibody construct of this invention for practicing the methods described herein for detecting / assessing CD9 expression in cells or tissues, for isolating CD9 protein, and for treating diseases or conditions relating to CD9 expression, including various types of malignancy.

[0095] Kits for carrying out assays for detecting / assessing CD9 expression or for isolating CD9 protein typically include one container containing a CD9 antibody construct (e.g., an anti-CD9 IgG or scFv) , optionally conjugated to a solid support or a detectable moiety, such that the specific binding relationship between the CD9 antibody construct and CD9 would permit ready isolation and / or detection of CD9 protein, both qualitatively and quantitatively, especially in an environment where another similar or homologous protein might be present. In embodiments where the CD9 antibody construct is not conjugated to any moiety to facilitate isolation or detection, the kits often contain a second container containing a detection agent that is able to specifically detect the presence of the anti-CD9 antibody construct.

[0096] Typically, the kits for detection or isolation of CD9 also include one or more appropriate controls, indicative of the presence of CD9 protein in a certain amount or below a detection threshold for the protein. In some cases such control (s) may be provided in the form of one or more physical samples, whereas in other cases the control (s) may be provided as a set value or values. In addition, the kits of this invention may provide instruction manuals to guide users in first processing test samples and then assessing the expression profile of CD9 protein or isolating CD9 protein from the samples.

[0097] Kits for practicing the methods described herein to treat a disease or condition caused or exacerbated by CD9 expression via administering a CD9 antibody construct or a conjugate thereof to a subject in need thereof. Both therapeutic use and prophylactic use are contemplated, i.e., a subject with or without a disease diagnosis may be treated, for example, once the presence and / or risk of the disease has been assessed according to the methods described herein and the subject is deemed to likely benefit from the treatment.

[0098] Kits for therapeutic use of a CD9 antibody construct or a conjugate thereof typically include one container containing a composition comprising the CD9 antibody construct, its conjugate, or a host cell expressing a CD9 antibody construct (e.g., anti-CD9 CAR T cell) . Typically, such composition is formulated for delivering the anti-CD9 antibody construct, its conjugate, or a host cell expressing a CD9 antibody construct, e.g., by injection such as via subcutaneous, intravenous, intramuscular, intraperitoneal, or intratumoral means. In some cases, the CD9 antibody construct is conjugated with a therapeutic agent effective for treating conditions and diseases involving CD9 expression, including cancer, such that a targeted delivery of the therapeutic agent can be achieved. In some cases, especially when host cells expressing a CD9 antibody construct are included in the kits, at least one, possibly two or more additional containers may be included in the kits, each container containing at least one therapeutic agent known for its effectiveness in treating a condition or disease characterized by inappropriate CD9 expression or CD9 overexpression. For example, when treatment of malignancy is sought, one or more anti-cancer therapeutic agents may be included in the kits. In particular, any one or more of the anti-cancer therapeutic agents known / used in the medical field or described herein may be included, especially chemotherapeutic drugs, e.g., drugs capable of killing or suppressing cells that are actively undergoing proliferation, and immunotherapeutic agents, e.g., checkpoint inhibitors and therapeutic antibodies.

[0099] Further, the kits of this invention may provide instruction manuals to guide users in the proper administration of the composition comprising the CD9 antibody construct, its conjugate (e.g., anti-CD9 conjugated with a therapeutic agent) , or a host cell expressing a CD9 antibody construct (e.g., anti-CD9 CAR T cell) to a subject deemed in need of such treatment by a physician (e.g., a person suffering from a condition involving CD9 expression, including certain types of malignancy including leukemia such as B-ALL) , the schedule (e.g., dose and frequency of administration) and route of administration, and the like. EXAMPLES

[0100] The following examples are provided by way of illustration only and not by way of limitation. Those of skill in the art will readily recognize a variety of non-critical parameters that could be changed or modified to yield essentially similar results.

[0101] The invention relates to the fields of biology, immunology and medicine. Despite significant progress in CD19 / CD22-based immunotherapies, the outcomes of patients with relapse / refractory acute lymphoblastic leukemia (ALL) remains suboptimal owing to non-durable remission and treatment resistance. Meanwhile, tetraspanin CD9 endows proven prognostic relevance in ALL that could be targeted by blocking monoclonal antibodies with profound preclinical efficacy. However, platelet toxicities associated with CD9 antibodies resulting in severe thrombocytopenia and lethal thrombosis have largely hampered their clinical translation. This may be attributed to their off-target Fc region binding and activation of the FcγRIIA receptor in close proximity to CD9 on platelet surface. This invention presents novel CD9-binding compounds and therapeutic applications thereof. The disclosure is directed to a biological entity, either isolated, synthetic or recombinant antibody, or functional part or functional equivalent thereof specific to the tetraspanin transmembrane protein CD9, compositions, moieties and modifications comprising such antibody or functional part or functional equivalent; methods for binding and inhibiting CD9; and method of uses in the modulation, diagnosis, treatment and prevention of CD9-dependent diseases and processes. I. INTRODUCTION

[0102] While risk-directed frontline therapies have significantly improved remission rates in B-cell precursor acute lymphoblastic leukemia (BCP-ALL) , prognosis for patients developing relapsed / refractory disease remains dismal [1, 2, 3] . Advent of CD19-and CD22-targeting immunotherapies, including bispecific T cell engager (BiTE) blinatumomab, antibody-drug conjugate inotuzumab ozogamicin and chimeric antigen receptor (CAR) T cells therapies, has rejuvenated the management landscape of relapsed / refractory leukemia, achieving remarkable initial responses of over 80%of relapsed / refractory patients [4-7] . Yet, these immunotherapies are hindered by limited durability, suggestive by only one-third of patients ultimately achieve durable remission 5 years after CAR T infusion [8, 9] accompanied by treatment-associated antigen downmodulation witnessed in significant relapsing population [10, 11] , leaving no viable therapeutic options.

[0103] CD9, a surface protein of the tetraspanin superfamily, has been reported in implicating various cancers through mediating carcinogenesis, tumor progression, metastasis pleiotropically in disease-dependent manner [12-15, 23] . In context of BCP-ALL, CD9 plays an oncogenic role in leukemic stem cell initiation, development and renewal [16-18] , leukemia dissemination and engraftment [18, 19] and chemoresistance

[0020] . Prognostic significance of CD9 has been well documented in multiple multi-center studies [21, 22, 24] , where CD9 expression confers unfavorable clinical outcomes and an increased risk of relapse. Notably, CD9 is highly expressed in 88.5%of B-ALL cases

[0022] , thereby highlighting CD9 targeting as a sound and well-established approach collectively. Since the discovery of CD9 in 1981

[0025] , several studies have explored its therapeutic potential through antibody-mediated blockage, demonstrating promising preclinical anti-leukemic activity [21, 26] . However, clinical progression of CD9-targeted therapies is largely hindered by critical safety concerns of immunogenicity and lethal thrombo-toxicity, evidenced by acute thrombocytopenia and fatal pulmonary thrombosis occurring within 5 minutes after a single-dose CD9 antibody infusion in non-human primate models and transgenic mice [27-28] . Consequently, no CD9-targeted therapy has entered clinical avenue over the past four decades despite its exceptional biological activities.

[0104] Early evidence has suggested that platelet toxicity arose from off-targeting interactions between the Fc region of CD9 antibody with Fcγreceptor IIA (FcγRIIA) in proximity to CD9 expressed on platelets [29, 30] , thereby triggering rapid aggregation and coagulation. The present invention provides Fc-engineered humanized antibodies (hAb-D and hAb-F) that can mitigate platelet toxicity or prevent platelet activation. These antibodies features novel CDR sequences and exhibits remarkable binding affinity and specificity for CD9 as well as highly potent anti-leukemia activity. In particular, they exert direct potent anti-leukemic activity in refractory B-ALL resistant to existing immunotherapies. Crucially, they do not trigger platelet activation compared to existing antibodies such as ALB6. In addition, unlike AT1412, hAb-D and hAb-F does not require ADCC function for leukemia killing.

[0105] The antibodies modified with Fc variants, such as N297A, displays significantly reduced platelet complications. In multiple models, our antibody does not trigger platelet activation, aggregation, and thrombocytopenia. This helps clear the largest hurdle preventing CD9 antibodies from being placed into clinical applications. Furthermore, our antibody has demonstrated limited immunogenicity compared to existing murine antibodies due to its humanized nature, which significantly lowers the risk of adverse immune reactions upon administration and enhances its safety profile in human subjects. The present invention provides a treatment modality especially for patients with CD19-negative relapse with safer profile, thereby addressing a critical gap in current management of resistant B-ALL. Based on the examples, The antibody constructs of the present invention therefore provide unexpected technical effects as follows: (1) reductions in thrombocyte binding but retain activities towards leukemia; (2) suppressing leukemia progression and proliferation; (3) inducing apoptosis and cell death of cancer cells; (4) inducing homotypic aggregation; (5) prolonging lifespan of a subject suffering from cancer; (6) have no or minimized platelet toxicity, i.e. reduced immunogenicity. II. METHODOLOGY A. CD9 protein purification

[0106] Amino acid sequence of large extracellular loop (LEL or EC2) of CD9 was sequenced and was cloned into the eukaryotic expression vector pSectag B. His and Fc tags were incorporated to the expression vector for antigen detection and purification. The constructed CD9 antigen expression vector was transformed into E. coli for amplification and expressed in 293 Freestyle cells cultured in FreeStyle 293 Expression Medium (Gibco) . Culture supernatant containing the expressed CD9-EC2 protein was collected after 72 hours and proteins were purified by affinity chromatography using Ni-NTA resin for His-tagged protein and protein A for the Fc-tagged protein. Purity of CD9-EC2 protein was validated by SDS-PAGE prior to further experiments. B. Immunization, hybridoma generation and selection

[0107] BALB / c mice at age of 6-8 weeks were immunized with subcutaneous injection of the expressed recombinant protein CD9-murine Fc (mFc) emulsified with Freund’s adjuvant, followed by administration of a booster dose every 2-week-interval till serum antibody titer reaching 1: 1000. Splenocytes were harvested and fused with SP2 / 0 myeloma cells using polyethylene glycol (PEG) to generate hybridomas. Positive hybridomas lines were selected by hypoxanthine-aminopterin-thymidine (HAT) medium culturing and were screened for CD9 antigen binding using ELISA following 2-week selection. Total RNA was extracted from the selected hybridoma cells using Trizol reagent, and cDNA was synthesized via reverse transcription following standard procedures. Variable region sequences of the heavy and light chains of CD9 antibodies were probed with specific PCR primers designed based on references, amplified and sequenced using Sanger sequencing. C. Production of monoclonal CD9 antibodies

[0108] To generate murine CD9-specific antibodies, the selected hybridoma cell lines of murine antibodies were expanded in a base medium (BasalMedia, Shanghai, China) . For production of humanized IgG1 protein, variable region sequences of humanized anti-CD9 antibodies were cloned into single peptide human IgG1 constant regions containing mammalian cell expression vector, subsequent to the expression in 293freestyle host cells using polyethylenimine (PEI; MW 25000, Polysciences, Warrington, PA, USA) . Culture supernatants were collected for Protein A (GE Healthcare, Chicago, IL, USA) purification to obtain monoclonal IgG1 proteins against CD9. Purity of anti-CD9 antibodies was validated via SDS-PAGE. D. Humanization and complementarity-determining regions (CDR) grafting

[0109] Sequences of the 6 CDR regions of the murine CD9 antibody heavy and light chains were determined using the Kabat definition scheme. Template of humanization for heavy and light chains were chosen based on the alignment with sequences in the international ImMunoGeneTics information   (IMGT) database for structural compatibility and functionality. The identified CDR regions of murine antibodies were transplanted into the respective humanization templates. Key amino acid residues in the framework regions (FR) were reverted to the corresponding human residues. The humanized CD9 sequences containing the transplanted CDR and the modified FR were synthesized and confirmed via Sanger sequencing. E. Human cell lines

[0110] BCP-ALL cell lines 697, BV-173, SEM (DSMZ, Braunchweig, Germany) and Reh (ATCC, Manassas, VA, USA) were maintained in RPMI-1640 medium (Gibco, Waltham, MA, USA) supplemented with 10%fetal bovine serum (FBS; Gibco) and 1%Penicillin-Streptomycin (10,000 U / mL; Gibco) at initial densities of 2-3×106  / mL in 37℃ under 5%CO2 with saturating humidity, and were sub-cultured every 3-4 days. Mycoplasma contamination and immunophenotypes were routinely tested, and cells between passage of 5th to 30th were utilized for experiment. F. Primary BCP-ALL patient bone marrow sample

[0111] Ethical approval was obtained from The Joint Chinese University of Hong Kong (CUHK) Hospital Authority New Territories East Cluster (NTEC) Clinical Research Ethics Committee, in accordance with the Declaration of Helsinki. Human bone marrow aspirate samples were obtained from patients with refractory BCP-ALL at second relapse subsequent to anti-CD19 CAR T or blinatumomab treatment in the Prince of Wales Hospital, Hong Kong between 2017 to 2019. Subjects were initially enrolled in CCCG ALL 2015 study. Subject with post-CAR T therapy relapse was managed according to ALL R3 induction protocol and treated with inotuzumab ozogamicin and CD19-targeting CAR T therapy at first relapse; while subject relapsing from blinatumomab was managed with CCCG Relapsed ALL 2007 protocol and received blinatumomab and bone marrow transplant at prior relapse.

[0112] Mononuclear leukemic blast cells were recovered by density gradient centrifugation over Ficoll-Paque Plus (GE Healthcare Chicago, IL, USA) . Surface CD9, CD10, CD19 and CD45 expression were characterized with fluorochrome-conjugated CD9 (M-L13; BD Biosciences, San Jose, CA, USA) , CD10 (HI10a; BD Biosciences) , CD19 (HIB19; BD Biosciences) , and CD45 (J. 33; Beckman Coulter) antibodies by flow cytometry (LSRFortessa; BD Biosciences) . Dead cells were identified by 7-amino-actinomycin D (7-AAD) co-staining and excluded from analyses using FlowJo software packages (TreeStar, Ashland, OR, USA) . G. Lentiviral vectors &transduction

[0113] To validate specificity towards human CD9, CD9 was overexpressed and knocked-out in CD9 low-expressing Reh and CD9 high-expressing 697 cell line respectively with lentiviral transduction. For CD9 overexpression, human CD9 full-length open reading frame (Open Biosystems, Huntsville, AL, USA) was inserted into the pRSC-SFFV-E2A-GFP-Wpre lentiviral backbone by PCR cloning and verified by Sanger sequencing (ABI 3130 Genetic Analyzer, Applied Biosystem, Foster City, CA, USA) . For CD9 knockout, single-guide RNA (sgRNA) targeting human CD9 (GGGATATTCCCACAAGGATG, SEQ ID NO: 24) or a non-targeting sgRNA (GCACTCACATCGCTACATCA, SEQ ID NO: 25) was incorporated into the pRSC-U6-SFFV-Cas9-E2A-GFP-Wpre lentiviral backbone. VSVG-pseudotyped vectors were packaged in 293T cells (ATCC) . Functional viral titers were determined by HT1080 cells (ATCC) transduction followed by flow cytometry analysis. Reh was transduced with control GFP-only or CD9-GFP lentiviral vectors, whereas 697 was transduced with sgRNA-GFP control or CD9 sgRNA-GFP lentiviral vectors for 48 hours at multiplicity of infection (MOI) of 4-8 in RetroNectin-precoated (50 μg / mL; Takara Bio Inc., Shiga, Japan) non-tissue culture treated plate. Stable cell lines were generated by puromycin selection (1 μg / mL; Life Technologies) . CD9 expression was verified after transduction with flow cytometry using APC-conjugated CD9 antibodies (M-L13; BD Biosciences) . H. Antigen affinity and specificity of CD9 monoclonal antibodies

[0114] To assess the binding affinity and specificity to CD9 extracellular domain, murine and humanized CD9 antibodies or control Fc fragments at serial concentrations were incubated with soluble CD9 antigen-coated ELISA plate for 2 hours, followed by detection with HRP-labelled secondary antibodies (Jackson ImmunoResearch, Philadelphia, PA, USA) determined at absorbance at 450nm. Antigen cross-reactivity was determined by ELISA plate immobilized with soluble CD9, CD22, Her2, IGF-1, CD133, B7-H3 antigens.

[0115] In context of lymphoblasts, BV-173 (CD9-high expressing) , SEM (CD9-intermediate expressing) and Reh (CD9-low expressing) BCP-ALL cell lines (1×105 cells) were incubated with murine IgG1 control (clone 11711; R&D Systems) , commercially available monoclonal human CD9-specific murine antibodies clone M-L13 (BD Biosciences) , ALB6 (Beckman Coulter) and MM2 / 57 (Thermo Fisher) , or in-house CD9 murine or human antibodies D &F at 1 μg for 30 minutes in 4℃. To validate CD9 binding specificity, CD9-GFP overexpressing Reh cells and CD9 sgRNA-GFP knock-out 697 cells were incubated with murine or human IgG1 control (R&D Systems) or CD9 specific antibodies (1 μg) . Antibody binding towards surface CD9 proteins were detected using PE or APC-conjugated F (ab') 2 goat anti-mouse IgG (H+L) secondary antibody (0.2 μg; Invitrogen) for antibodies of murine origin, or F (ab') 2 fragment goat anti-human Fcγ fragment specific IgG secondary antibody (Jackson ImmunoResearch, West Grove, PA, USA) for humanized antibodies. Corresponding isotype controls were employed to define negative populations. Surface CD9 protein expression was detected by flow cytometry and analyzed with FlowJo software packages (TreeStar) . Comparative CD9 specificity was defined by percentage of positivity and mean fluorescence intensities. I. Antigen binding kinetics of CD9 monoclonal antibodies

[0116] Biolayer interferometry (BLI) was employed to measure binding kinetics of anti-CD9 single-chain variable fragment (scFv) against CD9 using  QKe BLI Biosensor System (Sartorius,  Germany) . Anti-mouse Fc biosensor chips were used for CD9 antigen immobilization. ScFvss with range from 0.1nM to 100nM were injected on the sensor chip for real-time monitoring of the association phase, followed by the dissociation phase. Binding kinetics parameters including equilibrium dissociation constant (Kd) , association rate constant (Ka) and dissociation rate constant (Kdis) were derived from binding curves fitted to Langmuir binding model using Octet System Data Analysis software version 12 (Sartorius) . J. In vivo efficacy evaluation

[0117] Immunodeficient NOD. CB17-Prkdcscid / J (NOD / SCID) mice were purchased from the Jackson Laboratory (Bar Harbor, ME, USA) and bred in the Laboratory Animal Services Centre of The Chinese University of Hong Kong till reaching 8 to 11 weeks for experiment.

[0118] In proof-of-concept experiment, female NOD / SCID mice were sublethally irradiated at 250 cGy (Gammacell 1000 Elite Irradiator; MDS Nordion, Ottawa, ON, Canada) 24 hours prior to intravenous infusion of puromycin-selected (1 μg / mL; Life Technologies) , firefly luciferase-transduced (Addgene, Cambridge, MA, USA) BCP-ALL 697 cell line (5×106 cells) . Mice were block randomized to receive intraperitoneal injection of the in-house generated CD9 antibodies (1 mg / kg) , commercial murine CD9 antibody (clone ALB6; 1 mg / kg; Beckman Coulter) or control IgG1 murine / human antibody (clone 11711 [murine] ; 1 mg / kg; R&D Systems, Minneapolis, MN, USA) on day 3, 7, 10 and 14 post-transplantation of BCP-ALL cells without blinding. Systemic leukemic load was evaluated twice weekly starting from Day 7 using the IVIS 200 In Vivo Imaging System (Xenogen, Alameda, CA, USA) . D-Luciferin (150 mg / kg; Promega, Madison, WI, USA) were intraperitoneally applied 15 minutes in advance to signal acquisition followed by anaesthetization with 2.5%isoflurane (Zowtis, Parippany, NJ, USA) . Luminescence signals were captured as photon emission / second / cm2 using the Living Image software (Xenogen) . Survival was measured at animal death or sacrificed when humane endpoints were reached, noted by ≥20%weight loss, obvious distress or hindleg paralysis. Extramedullary leukemic engraftment in central nervous system and testes were determined with male NOD / SCID mice by luminescence imaging on resected tissues following above treatment schema.

[0119] In demonstration of clinical relevance, splenocytes of patient-derived xenograft developed from primary bone marrow blast of BCP-ALL patients at post-anti-CD19 chimeric antigen receptor T cell relapse (7.4 ×106 cells) and post-blinatumomab relapse (6.6×106 cells) were intravenously infused to sublethally irradiated NOD / SCID mice and were intraperitoneally treated with Fc-modified CD9 antibodies or human IgG1 control (1 mg / kg) twice per week for two consecutive week starting from day 3 post-splenocyte transplantation. Local leukemic burden was assessed in parallel when humane endpoints were reached by the control group. Single-cell suspension of bone marrow, peripheral blood, spleen and liver were prepared, and non-specific binding were blocked with anti-mouse CD16 / CD32 antibodies (2.4G2; BD Biosciences) and human FcR blocking reagent (Miltenyi Biotec, Bergisch Gladbach, North Rhine-Westphalia, Germany) . Leukemic cells were labelled with anti-human CD10 (HI10a; BD Biosciences) , CD19 (HIB19; BD Biosciences) and CD45 (J. 33; Beckman Coulter, Brea, CA, USA) and blast CD9 expression were detected with CD9 (M-L13; BD Biosciences) after dead cell exclusion with 7-aminoactinomycin D (BD Biosciences) co-staining by flow cytometric analysis. Size and weight of spleen and liver are measured at point of euthanasia or decease for signs of hepatomegaly (>0.7g) or splenomegaly (>0.05g) . Survival was recorded at death or euthanized at humane endpoints.

[0120] All animal experiments were conducted in accordance with procedures approved by the Animal Experimentation Ethics Committee of The Chinese University of Hong Kong. K. Interferon gamma (IFN-γ) release assay

[0121] To assess immunogenicity, dendritic cell-primed CD4+ T cells were prepared from peripheral blood mononuclear cells isolated from healthy human donors using Ficoll-Paque density gradient centrifugation (GE Healthcare, Chicago, IL, USA) . Monocytes were differentiated into DCs by culturing in RPMI-1640 medium supplemented with 10%FBS, GM-CSF (100 ng / mL) , and IL-4 (50 ng / mL) for 5-7 days, while CD4+ T cells were purified using magnetic bead separation according to manufacturer’s instruction (Miltenyi Biotec) and co-cultured with autologous dendritic cells at a 10: 1 ratio for antigen presentation. Co-cultures were incubated with humanized CD9 antibodies at concentrations of 0.1, 1, 10, and 100 μg / mL. DC-negative CD4+ T cells served as the negative control, and 50 μg / mL ovalbumin (OVA) was used as a positive control. After 72 hours of incubation, supernatants were collected and analyzed for interferon-gamma (IFN-γ) secretion using human IFN-γ ELISA kit (R&D Systems) according to the manufacturer’s instructions. Absorbance was measured at 450 nm, and cytokine concentrations were quantified using a standard curve generated from recombinant IFN-γ. L. CD4+ T cell proliferation assay

[0122] CD4+ T cell proliferation against CD9 antibodies was evaluated using a carboxyfluorescein succinimidyl ester (CFSE) dilution assay. CD4+ T cells were labeled with 5 μM CFSE (Thermo Fisher) for 10 minutes at 37℃ in the dark and co-cultured with autologous dendritic cells prepared as described above. Co-cultures were treated with humanized CD9 antibodies D and F at concentrations of 0.1, 1, 10, and 100 μg / mL, dendritic cell-negative CFSE-labeled CD4+ T cells or OVA (50 μg / mL) . Cells were harvested and stained with anti-CD4 antibodies (BD Pharmingen) after 5 days and analyze by flow cytometry to determine CFSE negative populations indicative for proliferation. M. Platelet isolation

[0123] Peripheral blood from healthy human donors was collected into vacutainer tubes containing 3.2%sodium citrate as anticoagulant (Greiner Bio-One, Kremsmünster,  Germany) . Written informed consent was obtained from all donors before the collection. Platelet-rich plasma (PRP) was obtained with slow centrifugation at 135g for 15 minutes at room temperature and was transferred to a new tube for stabilization for 30 minutes protected from light. Fast centrifugation at 900g for 10 minutes was performed on the remaining blood samples to obtain platelet-poor plasma (PPP) . Platelet concentration was measured with DxH 520 Hematology Analyzer (Beckman Coulter) and was adjusted to 250 x 103 / μL with PPP. Fresh PRP and PPP obtained within 4 hours from phlebotomy were used for experiments. N. Platelet activation assay

[0124] PRP (2.5 x 107 cells) was incubated with human IgG1 control (10 μg / mL; R&D Systems) or CD9 antibodies in forms of scFv, Fab or IgG1 (10μg / mL) for 15 minutes in dark. Agonist Adenosine 5'-diphosphate (ADP; 40uM; MedChemExpress, Monmouth Junction, NJ, USA) served as positive control for platelet activation. Platelets were then fixed with 1%paraformaldehyde solution (Thermo Fisher, Waltham, MA, USA) for 5 minutes to prevent further activation. Fc receptors on platelet surface were blocked by human Fc blocking agent (Miltenyi) to avoid non-specific binding. Platelets were marked by human-specific CD41 (HIP8; BioLegend, San Diego, CA, USA) and CD61 (VI-PL2; BD Biosciences) antibodies and degree of platelet activation was determined by P-selectin (CD62P) expression (AK4; BioLegend) measured by flow cytometry. O. Platelet aggregometry

[0125] Platelet aggregation was determined by reduction in optical density in plasma with  Model 700 Whole Blood / Optical Lumi-Aggregometer (Chrono-log Corporation, Havertown, PA, USA) . 200 uL fresh PRP (250 x 103 / μL) was transferred to aggregometer cuvette (Chrono-log Corporation) and stirred with siliconized stir bars (Chrono-log Corporation) at 1200 rpm to achieve effective distribution of agonists. Optical density detected in PPP served as the baseline of the measurement. Percentage of aggregation denoted by the maximum amplitude in light transmission across PRP and speed of aggregation denoted by slope of aggregation were measured across a 10-minute timeframe upon the addition of human IgG1 control (R&D Systems) or human CD9 antibodies (0.25μg; 10μg / mL) , with murine CD9 antibody ALB6 (Beckman Coulter) known to induce platelet aggregation as positive control. PRP from 3 independent donors was evaluated for statistical significance. P. Thrombocytopenia transgenic xenograft model and genotyping

[0126] B6; SJL-Tg (FCGR2A) 11Mkz / J (human FcγRIIA transgenic) mice were obtained from the Jackson Laboratory and reared in the Laboratory Animal Services Centre facilities of The Chinese University of Hong Kong. Mating strategy involved in crossing of wild-type B6; SJL mice with hemizygous FcγRIIA transgenic mice was employed to establish the desired hemizygous FcγRIIA transgenic thrombocytopenia model. Ear tissues from bred progenies at three-to-four weeks of age were biopsied for genotyping. Total DNA of tissues were extracted with DNeasy Blood &Tissue Kit (Qiagen, Hilden, Germany) . Extracted DNA (111 ng) was amplified with PCR set with primers for transgene-specific and internal positive control sequences, HF Buffer (Thermo Fisher) , 10mM dNTPs mix (Thermo Fisher) and PhusionTM High-Fidelity DNA Polymerase (0.4 U; Thermo Fisher) . PCR amplification was performed on Applied Biosystems Veriti 96 Well Thermal Cycler (Applied Biosystems, Waltham, MA, USA) at 98℃, 30 seconds, 10 cycles of 98℃, 10 seconds, 65℃, 30 seconds, 68℃, 30 seconds, 28 cycles of 98℃, 10 seconds, 60℃, 30 seconds, 72℃, 10 seconds, and 72℃, 10 minutes. Amplified DNA fragments of FcγRIIA transgene and internal positive control were separated by gel electrophoresis of 3%agarose gel (Beijing Baygene Biotech Co, Shanghai, China) prepared from TAE buffer (Invitrogen, Waltham, MA, USA) , and were visualized using SYBRTM Safe DNA Gel Stain (Invitrogen) with ChemiDoc MP Imaging System (Bio-rad, Hercules, CA, USA) . Table 1. Primers for genotyping of B6; SJL-Tg (FCGR2A) 11Mkz / J FcγRIIA transgenic mice.

[0127] Hemizygous FcγRIIA transgenic female mice aged five-to-seven week and weighted between 15-20 g were pretreated intraperitoneally with anti-mouse CD16 / CD32 antibodies (50μg; 2.4G2; BD Biosciences) to block splenic clearance 24 hours before intravenous injection of human IgG1 control (R&D Systems) or CD9 antibodies (100 μg) . Platelet count in peripheral blood (100μl) was evaluated at 24 hours prior to (baseline) , and 24 and 168 hours subsequent to antibodies injection using DxH 520 hematology analyzer (Beckman Coulter) for short-and long-term effects on platelet numbers. Q. NK cells isolation and culture

[0128] Peripheral blood was collected from 3 healthy donors and written informed consent was obtained from donors. Mononuclear cells were isolated by density-gradient centrifugation on Ficoll-Paque Plus (GE Healthcare, Chicago, IL, USA) . CD56+ NK cells were isolated with NK Cell Isolation Kit (Miltenyi Biotec) according to the manufacturer's instructions by negative, microbead-based labelling and column-based cell separation. Purities of enriched CD3-CD56+ NK cells were confirmed by flow cytometry stained with human CD3 (clone: UCHT1; Beckman Coulter) and CD56 (clone: HCD56; BioLegend) targeting antibodies.

[0129] NK cells (1×106 cells) were stimulated with anti-biotin MACSiBeadTM particles (5×105; Miltenyi Biotec) and cultured in serum-free ImmunoCultTM NK Cell Expansion medium (STEMCELL Technologies, Vancouver, British Columbia, Canada) supplemented with ImmunoCultTM NK Cell Expansion Supplement (STEMCELL Technologies) in ImmunoCultTM NK Cell Expansion Coating Material (STEMCELL Technologies) coated-non tissue culture treated plate for 6 days. Cultures were inspected every 4 days and were maintained at a density of 1-1.5×106 / mL at every inspection by adding fresh medium to achieve optimal expansion until 14 days post-stimulation for assays. R. Antibody-dependent cellular cytotoxicity (ADCC)

[0130] ADCC was determined by bioluminescence imaging (BLI) -based luciferase assay. Firefly luciferase-transduced 697 cells (1×104 cells) as target cells were co-cultured with activated NK cells as effector cells at effector-to-target ratio of 5: 1 in a total reaction volume of 200uL in a 96-well white opaque culture plate. ADCC was initiated by the addition of human IgG1 control or CD9 antibodies (0.001-10 μg / mL) and the plate was incubated for 4 hours at 37℃. Anti-CD38 monoclonal antibody Daratumumab (MedChemExpress) served as the positive control for ADCC. D-luciferin (30 μg; Promega) was added by the end of the incubation and incubated at 37℃ for 15 minutes. Bioluminescence measured in relative luminescence units (LRU) emitted by viable target cells was captured by BioTek Synergy HTX Multimode Reader (Agilent Technologies, Santa Clara, CA, USA) . Spontaneous cell death was referred to target cell death induced without the addition of antibodies and effector cells, whereas maximum cell death was induced by target cell lysing with LDH lysis buffer. Percentage of cytotoxicity was calculated as (LRU spontaneous cell death –LRU experimental)  /  (LRU spontaneous cell death –LRU maximum cell death) × 100. The percentage of ADCC was determined as cytotoxicity (%) with antibody –cytotoxicity (%) without antibody. Measurement was conducted in 3 replicated wells. S. Cell proliferation and apoptotic assays

[0131] 697 and Reh cells (2.5×104 cells) were treated with 10 μg / mL human IgG1 control, humanized CD9 or CD38 antibodies and were cultured for 8 days. Cumulative expansion and number of viable cells were assessed every other day with Trypan Blue counting (Gibco) . Percentage of apoptotic cell death was quantified with Annexin V for early cell death and 7-AAD for late-stage apoptosis (BD Biosciences) staining on day 8 by flow cytometry. T. Homotypic aggregation assay

[0132] Green florescence protein (GFP) -expressing 697 cells (1×106 cells) were incubated with 10 μg / mL human IgG1 control, anti-CD9 or anti-CD38 antibodies for 4 hours in 37℃. Degree of homotypic aggregation were observed with THUNDER Imaging Systems (Leica Microsystems, Wetzlar, Germany) for GFP-emitting cells in 4 randomized fields from 3 independent experiments. U. Western blotting

[0133] Whole cell lysate was extracted from human IgG1 control, CD9 antibodies (10μg / mL) or vincristine (0.1μM) -treated 697 cells (2.5×104 cells) in radioimmunoprecipitation assay (RIPA) buffer (MedChemExpress) supplemented with pyrophosphate and inorganic phosphate inhibitors. Protein concentrations were determined using the Lowry assay (Bio-rad) according to manufacturer’s instructions. Proteins (80μg) were separated with standard SDS-PAGE procedures and detected for PARP, full-form and cleaved initiator caspases (caspase-3, caspase-6, caspase-7) and effector caspases (caspase-8, caspase-9) probing with specific antibodies and HRP-conjugated secondary antibodies (Cell Signaling Technology, Danvers, MA, USA) . Band visualization was achieved with ECL substrates (Cell Signaling Technology) and captured with Alliance Q9 Advanced Chemiluminescence Imager (Uvitec, Cambridge, UK) .V. Binding and activation assay for CD16-expressing cells

[0134] To evaluate antibody binding to CD16a, biotinylated Fc-engineered CD9 antibodies (100ng) were incubated with CD16a-expressing CHO cells for 30 minutes. Cells were treated with APC-conjugated streptavidin to detect bound antibodies and detected by CytoFlex S Flow Cytometer (Beckman Coulter) .

[0135] Jurkat-NFAT-CD16a reporter cells were used to evaluate the functional activation induced by humanized CD9 antibodies with different Fc mutations. Cells (1×105) were incubated with the CD9 antibodies (10μg / mL) for 16 hours in 37℃ to allow CD16a engagement. Activation was measured by quantifying NFAT-driven reporter signal intensity using flow cytometry. Mean fluorescence intensity (MFI) was used as the readout to compare activation levels across different Fc variants. V. Statistical analysis

[0136] All statistical analyses were performed using IBM SPSS Statistics version 20 (IBM, Armonk, NY, USA) . In vitro experiments involving CD9 antibodies treatments were presented as mean ± standard error of the mean. Differences among treatment groups were assessed using one-way analysis of variance (ANOVA) , followed by Tukey’s post hoc test for multiple comparisons. P-value < 0.05 was considered statistically significant. For in vivo animal survival studies, Kaplan-Meier survival analysis was performed to evaluate survival distributions across experimental groups. Survival differences were assessed using the Mantel-Cox log-rank test with a threshold for significance at P < 0.05. EXMPLE 1 Generation of murine CD9 monoclonal antibodies

[0137] Murine CD9 monoclonal antibodies were generated by conventional hybridoma technology (Figure 1A) . The second extracellular domain (EC2) of CD9 antigen known to modulate various vital cellular functions including cell adhesion was selected as the target antigen. The amino acid sequence of the CD9-EC2 region is set forth in SEQ ID NO: 19. BALB / c mice were immunized with purified CD9-EC2 expressed from eukaryotic cells (Figure 1B) and positive monoclonal hybridoma lines were selected based on CD9 binding abilities determined using enzyme-linked immunosorbent assay (ELISA) . From rounds of subcloning and panning, three clones demonstrating highest CD9 antigen binding were identified and sequenced (Figure 1C) . Due to the identical sequences shared by two clones, two distinct sets of heavy and light chain variable region sequences were identified, resulting in two murine antibodies namely mAb-D and mAb-F with novel complementarity-determining regions (CDRs) derived from respective amino acids sequences (Figure 1D) .

[0138] Recognition of mAb-D and mAb-F IgG1 antibodies for CD9 extracellular domain was confirmed by robust binding to soluble CD9 but not to immobilized human Fc fragments (Figure 1E) . Binding specificity was assessed using different tumor-expressing antigens and the two murine antibodies did not exhibit cross-reactivity to other irrelevant antigens (Figure 1F) , thereby highlighting their targeted affinity. Both mAb-D and mAb-F demonstrated similarly high affinity towards CD9, characterized by rapid, strong and stable binding kinetics as indicated by affinity constant values obtained from biolayer interferometry (Figure 1H) . Comparatively, mAb-F showed a higher Ka (5.33x105) and lower Kdis (1.86x10-7) , implying a faster association and longer binding duration compared to mAb-D (Table 2) . Table 2. Binding rate constants and affinities of anti-CD9 scFvs against CD9

[0139] Specificity of murine mAbs was additionally evaluated in the context of lymphoblasts with differential surface CD9 expressions, revealing comparable CD9-dependent reactivity patterns towards CD9low Reh, CD9intermediate SEM and CD9high RS4; 11 B-ALL cell lines alongside three commercially available CD9 antibodies M-L13, ALB6 and MM2 / 57 (Figure 1I) , with specificity further reinforced using CD9-overexpressing and CD9-knockout B-ALL cell line models (Figure 1J) . In the B-ALL cell line-derived NOD / SCID mouse xenograft model, administration of mAb-D and mAb-F profoundly suppressed leukemia progression and doubled animal survival to a degree akin to commercialized ALB6 antibodies (Figure 1K) . Taken together, the murine mAbs of the present invention are proven to be specific and highly active CD9 antibodies. EXAMPLE 2 Humanization of murine CD9 antibodies

[0140] To minimize immunogenicity, CDR regions of murine mAbs were transplanted into humanization templates selected from the IMGT database based on sequence alignment with the 6 CDR regions of heavy and light chains of murine mAbs. Human antibody variable region lineage sequence IGHV1-206+IGHJ401 was chosen as the template for humanization of the heavy chain of both mAbs, while IGKV1-NL101+IGKJ201 and IGKV1-1201+IGKJ201 were selected as template for light chain of mAb-D and mAb-F respectively. Corresponding humanized CD9 antibody (hAb) sequences named hAb-D and hAb-F were obtained following CDR grafting onto selected human IgG1 framework and key framework region residue replacement (Figure 2A, 2B) . The amino acid sequences for the VH and VL of murine Ab-D and murine Ab-F are set forth in SEQ ID NO:20, SEQ ID NO: 21, SEQ ID NO: 22, and SEQ ID NO: 23, respectively. The amino acid sequences for the VH and VL of hAb-D and hAb-F are set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, respectively.

[0141] In accordance with murine mAbs, humanized IgGs of hAb-D &hAb-F exhibited similar CD9 binding in dose dependent manner detected with ELISA (Figure 2D) and absence of cross-reactivity to two irrelevant antigens CD133 and B7H3 (Figure 2C) . Similar binding kinetics were observed in humanized antibodies as indicated by comparable Kd values to those of murine antibodies (Figure 2E, Table 1) and binding specificity confirmed with CD9 overexpression and knock-out models (Figure 2F) . Activity wise, hAb-D and hAb-F retained strong anti-leukemia activities along with substantial survival extension (Figure 2G) . Noteworthy, upon stimulation of dendritic cells and CD4+ T cells with hAbs in vitro, no significant increase in interferon-γ levels (Figure 2H) and carboxyfluorescein succinimidyl ester (CFSE) -negative CD4+ T cells (Figure 2I) were detected, indicating no activation nor antigen-stimulated proliferation elicited in antigen-presenting immune cells in response to hAbs exposure. These findings underscore the preserved specificity and activity while diminishing immunogenic potential following humanization. EXAMPLE 3 Platelet toxicity of CD9 antibodies is overcome by Fc domain engineering

[0142] Long-reported platelet toxicities of CD9 antibodies may arise from either on-target binding of its Fab domain to CD9 on platelets or off-target binding of its Fc domain to FcγRIIA receptor in close proximity to CD9

[0030] . To assure the underlying cause of toxicities, the degree of platelet activation was assessed, the initiating step of coagulation cascade, with P-selectin (CD62P) level as an index upon hAbs administration ex vivo (Figure 3A) . Virtually all platelets were activated within 30 minutes after exposure to hAb-D and hAb-F IgG (Figure 3B) . Importantly, this phenomenon was absent when platelets were exposed to hAbs (Fab) 2 or scFv fragments, therefore reassuring the toxicity is mediated by its Fc domain and hence offers a solid rationale for commencing antibody engineering.

[0143] A point mutation was introduced at the Fc domain of hAbs IgG to substitute the amino acid at position 297 from asparagine (N) to alanine (A) to achieve aglycosylation (N297A) , which is used to diminish Fc receptor binding (Figure 3C)

[0031] . A series of experiments were designed to focus on sequential platelet activation, aggregation and systemic thrombocytopenia modelling to comprehensively assess the platelet toxicity of N297A-engineered hAbs IgG.

[0144] Surprisingly, platelet activation was completely extinguished by N297A engineering compared with non-engineered version, as reflected by the absence of phenotypic CD62P expression by flow cytometry (5.1±0.9%vs. 89.6±4.8%, P<0.0001, Figure 3D) and physical platelet aggregation by optical aggregometry (AUC: 18.9-29.5 vs. 382-395, P=0.0016, Figure 3E) . Recognizing the crucial role of the FcγRIIA receptor in platelet activation, a transgenic mouse model expressing FcγRIIA on platelets at human physiological level (Figure 3F) was established with proven validity in assessing thrombocytopenia systemically as outlined in previous studies (Figure 3G)

[0028] . Severe thrombocytopenia and lethal shock were significantly mitigated upon N297A modification in hAb-D compared to the non-engineered counterparts 24 hours after intravenous hAb administration (Figure 3H) , demonstrating that Fc modification markedly attenuates platelet toxicity. Critically, both CD9 specificity and anti-leukemia efficacy were fully retained after N297A Fc engineering (Figure 4A, 4B) , rendering N297A-modified hAbs as a specific, efficacious and safe CD9-targeting humanized antibodies for advanced development. In addition, hAbs-N297A manifested potent activity in suppressing extramedullary leptomeningeal and testicular leukemia progressing harnessing its potential for tackling extramedullary manifestations (Figure 4C) . EXAMPLE 4 Fc-engineered CD9 antibodies are effective in patient-derived xenografts of resistant B-ALL

[0145] In pursuit of exploring potential clinical applications, the efficacy of hAb-N297A was evaluated in patient-derived xenograft developed from post-CD19 CAR T therapy and post-blinatumomab refractory individuals experiencing CD19 negative modulation, a condition currently deemed incurable. Blasts of these patients exhibited CD19 expression below 10%while demonstrating over 85%CD9 expression and harbored high-risk cytogenetic abnormalities including TCF3-HLF (Post-CD19 CAR T patient) . Administration of hAb-N297A significantly reduced splenomegaly by 74.8±4.9% (Figure 4D) in case of post-CAR T relapse and 84.1±1.7%in post-blinatumomab relapse (Figure 4G) . Strikingly, leukemic burden in major hematopoietic organs including bone marrow, blood, spleen and liver were drastically suppressed by over 98%upon hAb-N297A treatment in both conditions (Figure 4E, 4H) . Reduction of neoplastic burden was accompanied by prolonged survival duration from 27 days to 62 days in hAb-D N297A-treated and 53 days in hAb-F N297A treated mice (Figure 4F) in condition of post-CAR T CD19-negative relapse. Notably, surface CD9 remained detectable in leukemic cells obtained from animals treated with hAb-N297A at disease relapse (data not shown) , highlighting the preserved sensitivity to CD9 reinduction following CD9-targeted therapies. EXAMPLE 5 CD9 antibodies exerts direct apoptotic effect on leukemia and does not require ADCC

[0146] Given that antibody-dependent cellular cytotoxicity (ADCC) is a primary mechanism of actions for majority of therapeutic mAbs, the capacity of the hAbs of the present invention in inducing ADCC was assessed. Similar to the CD38-directed antibody daratumumab known for its ADCC capability, non-engineered hAb-D and hAb-F are effective in evoking ADCC (Figure 5A) . However, following the N297A modification, extent of ADCC was markedly diminished, suggesting a decrease in Fc receptors interaction on effector cells crucial in eliciting ADCC. In spite of impairment of ADCC after Fc engineering, hAb-N297A exerted a direct inhibitory effect on proliferation (Figure 5B) and induced direct cell death (Figure 5C) in CD9high 697 cells without impacting on CD9low Reh cells, whereas such direct effects were not observed with the ADCC-dependent daratumumab. Morphologically, addition of hAb-N297A induced homotypic adhesion in 697 cells, a typical feature of type II antibody that associated with cell death, contrarily absent in type I antibody daratumumab (Figure 5D) . Importantly, programmed cell death induced by N297A-engineered hAb-D and hAb-F were independent of classical caspase activation (Figure 5E) , suggesting the dependence on a novel form of direct cell death associated with CD9-targeting therapy. EXAMPLE 6 Enhanced Fc mutations recapitulate platelet toxicity mitigation while preserving target specificity

[0147] To achieve complete abrogation of Fc-mediated interactions and prevent off-target platelet activation, we introduced additional Fc mutations beyond the previously validated N297A. Additional Fc variants of STR (L234S-L235T-G236R) and AAAG (L234A-L235A-N297A-P329G) were engineered to further suppress Fcγ receptor engagement on the basis of hAb-D. The heavy chain constant region of the Fc variant of STR has an amino acid sequence as set forth in SEQ ID NO: 30, and the heavy chain constant region of the Fc variant of AAAG has an amino acid sequence as set forth in SEQ ID NO: 31. Similar to N297A, human platelet aggregation assay confirmed that both STR-and AAAG-modified CD9 antibodies effectively prevented platelet aggregation (Figure 6B) without compromising CD9-targeted specificity (Figure 6A) , underscoring the robustness of Fc engineering in enhancing therapeutic safety. EXAMPLE 7 Fc mutated CD9 antibodies impair CD16a binding and attenuate ADCC

[0148] Fc region of IgG antibodies plays a critical role in immune cell activation by engaging Fc receptors such as CD16a (FcγRIIIa) , which is prominently expressed on NK cells and mediates ADCC. Following Fc engineering of humanized anti-CD9 antibodies, a marked reduction in binding to CD16a-expressing CHO cells was observed (Figure 6C) . These engineered variants also showed diminished activation of Jurkat-NFAT-CD16a reporter cells for ADCC with markedly lower NFAT-driven fluorescence intensity compared to wild type humanized CD9 antibodies (Figure 6D) . These results indicate that Fc modifications on CD9 antibodies essentially disrupt CD16a engagement and potentially reducing ADCC-related immune responses. REFERENCES 1. Mullighan, C.G., Molecular genetics of B-precursor acute lymphoblastic leukemia. J Clin Invest, 2012. 122 (10) : p. 3407-15. 2. Bhojwani, D. and C.H. Pui, Relapsed childhood acute lymphoblastic leukaemia. Lancet Oncol, 2013. 14 (6) : p. e205-17. 3. Hoelzer, D., et al., Acute lymphoblastic leukaemia in adult patients: ESMO Clinical Practice Guidelines for diagnosis, treatment and follow- up.Ann Oncol, 2016.27 (suppl 5) : p. v69-v82. 4. DasGupta, R.K., et al., A review of CD19-targeted immunotherapies for relapsed or refractory acute lymphoblastic leukemia. J Oncol  Pharm Pract, 2018.24 (6) : p. 453-467. 5. Aureli, A., et al., Acute Lymphoblastic Leukemia Immunotherapy Treatment: Now, Next, and Beyond. Cancers (Basel) , 2023. 15 (13) . 6. Maude, S.L., et al., Tisagenlecleucel in Children and Young Adults with B-Cell Lymphoblastic Leukemia. N Engl J Med, 2018. 378 (5) : p.  439-448. 7. Shah, B.D., et al., KTE-X19 for relapsed or refractory adult B-cell acute lymphoblastic leukaemia: phase 2 results of the single-arm, open- label, multicentre ZUMA-3 study. Lancet, 2021. 398 (10299) : p. 491-502. 8. Cappell, K.M. and J.N. Kochenderfer, Long-term outcomes following CAR T cell therapy: what we know so far. Nat Rev Clin Oncol,  2023. 20 (6) : p. 359-371. 9. Xu, X., et al., Mechanisms of Relapse After CD19 CAR T-Cell Therapy for Acute Lymphoblastic Leukemia and Its Prevention and  Treatment Strategies. Front Immunol, 2019. 10: p. 2664. 10. Sotillo, E., et al., Convergence of Acquired Mutations and Alternative Splicing of CD19 Enables Resistance to CART-19 Immunotherapy.  Cancer Discov, 2015. 5 (12) : p. 1282-95. 11. Orlando, E.J., et al., Genetic mechanisms of target antigen loss in CAR19 therapy of acute lymphoblastic leukemia. Nat Med, 2018.24 (10) : p. 1504-1506. 12. Zoller, M., Tetraspanins: push and pull in suppressing and promoting metastasis. Nat Rev Cancer, 2009. 9 (1) : p. 40-55. 13. Kischel, P., et al., Overexpression of CD9 in human breast cancer cells promotes the development of bone metastases. Anticancer Res,  2012. 32 (12) : p. 5211-20. 14. Hori, H., et al., CD9 expression in gastric cancer and its significance. J Surg Res, 2004. 117 (2) : p. 208-15. 15. Kohmo, S., et al., Cell surface tetraspanin CD9 mediates chemoresistance in small cell lung cancer. Cancer Res, 2010. 70 (20) : p. 8025-35. 16. Nishida, H., et al., CD9 correlates with cancer stem cell potentials in human B-acute lymphoblastic leukemia cells. Biochem Biophys Res  Commun, 2009. 382 (1) : p. 57-62. 17. Aoki, Y., et al., Identification of CD34+ and CD34-leukemia-initiating cells in MLL-rearranged human acute lymphoblastic leukemia.  Blood, 2015. 125 (6) : p. 967-80. 18. Yamazaki, H., et al., Regulation of cancer stem cell properties by CD9 in human B-acute lymphoblastic leukemia. Biochem Biophys Res  Commun, 2011. 409 (1) : p. 14-21. 19. Arnaud, M.P., et al., CD9, a key actor in the dissemination of lymphoblastic leukemia, modulating CXCR4-mediated migration via RAC1  signaling. Blood, 2015. 126 (15) : p. 1802-12. 20. Liu, Y., et al., CD9, a potential leukemia stem cell marker, regulates drug resistance and leukemia development in acute myeloid leukemia.  Stem Cell Res Ther, 2021. 12 (1) : p. 86. 21. Leung, K.T., et al., CD9 blockade suppresses disease progression of high-risk pediatric B-cell precursor acute lymphoblastic leukemia and  enhances chemosensitivity. Leukemia, 2020. 34 (3) : p. 709-720. 22. Leung, K.T., et al., Prognostic implications of CD9 in childhood acute lymphoblastic leukemia: insights from a nationwide multicenter  study in China. Leukemia, 2024. 38 (2) : p. 250-257. 23. Hemler, M.E., Tetraspanin proteins promote multiple cancer stages. Nat Rev Cancer, 2014. 14 (1) : p. 49-60. 24. Liang, P., et al., CD9 expression indicates a poor outcome in acute lymphoblastic leukemia. Cancer Biomark, 2018. 21 (4) : p. 781-786. 25. Andrews, P.W., B.B. Knowles, and P.N. Goodfellow, A human cell-surface antigen defined by a monoclonal antibody and controlled by a  gene on chromosome 12. Somatic Cell Genet, 1981. 7 (4) : p. 435-43. 26. Bradstock, K.F., et al., Transplantation of monoclonal antibody-purged autologous bone marrow for treatment of poor risk common acute  lymphoblastic leukemia. Aust N Z J Med, 1987. 17 (3) : p. 283-9. 27. Kawakatsu, T., et al., Antithrombotic effect of an anti-glycoprotein IIB / IIIA antibody in primate lethal thrombosis. Thromb Res, 1993.  70 (3) : p. 245-54. 28. Taylor, S.M., et al., Thrombosis and shock induced by activating antiplatelet antibodies in human FcγRIIA transgenic mice: the interplay  among antibody, spleen, and Fc receptor. Blood, 2000. 96 (13) : p. 4254-4260. 29. De Reys, S., et al., Human platelet aggregation by murine monoclonal antiplatelet antibodies is subtype-dependent. Blood, 1993. 81 (7) : p.  1792-1800. 30. Griffith, L., et al., Platelet activation by immobilized monoclonal antibody: evidence for a CD9 proximal signal. Blood, 1991. 78 (7) : p.  1753-1759. 31. Borrok, M.J., et al., Revisiting the role of glycosylation in the structure of human IgG Fc. ACS Chem Biol, 2012. 7 (9) : p. 1596-602.

[0149] All patents, patent applications, and other publications, including GenBank Accession Numbers or similar sequence identification numbers, cited in this application are incorporated by reference in the entirety of their contents for all purposes.

Claims

1.A CD9 antibody construct that specifically binds human CD9 and comprises antibody heavy chain and light chain complementarity determining regions (CDRs) having the amino acid sequences set forth in (1) SEQ ID NOs: 5-10 or (2) SEQ ID NOs: 11-16, respectively.2.The CD9 antibody construct of claim 1, comprising an antibody heavy chain variable region (VH) and light chain variable region (VL) , each comprising the amino acid sequence set forth in SEQ ID NO: 1 or 2, respectively.3.The CD9 antibody construct of claim 1, comprising an antibody heavy chain variable region (VH) and light chain variable region (VL) , each comprising the amino acid sequence set forth in SEQ ID NO: 3 or 4, respectively.4.The CD9 antibody construct of any one of claims 1-3, comprising a heavy chain constant region having the amino acid sequence set forth in SEQ ID NO: 17 and / or a light chain constant region having the amino acid sequence set forth in SEQ ID NO: 18.5.The CD9 antibody construct of any one of claims 1-3, comprising a heavy chain variable region, a light chain variable region, a heavy chain constant region, and a light chain constant region having the amino acid sequences set forth in (1) SEQ ID NOs: 1, 2, 17, and 18; or (2) SEQ ID NOs: 3, 4, 17, and 18, respectively.6.The CD9 antibody construct of any one of claims 1-3, which is an anti-CD9 single chain variable fragment (scFv) , a full-length IgG, a bispecific T cell engager (BiTE) , an antibody drug conjugate (ADC) , or a chimeric antigen receptor (CAR) construct.7.A nucleic acid comprising a polynucleotide sequence encoding the CD9 antibody construct any one of claims 1-6.8.The nucleic acid of claim 7, which is an expression cassette comprising a promoter operably linked to the polynucleotide sequence.9.The nucleic acid of claim 7 or 8, which is a plasmid or a viral vector.10.A host cell comprising the nucleic acid of any one of claims 7-9 or the CD9 antibody construct of any one of claims 1-6.11.The host cell of claim 10, which is a T cell or natural killer (NK) cell.12.The host cell of claim 11, wherein the CD9 antibody construct is an scFv or a CAR construct.13.A conjugate comprising the CD9 antibody construct of any one of claims 1-6 and a solid support, a detectable moiety, or a therapeutic agent.14.The conjugate of claim 13, wherein the CD9 antibody construct is an scFv or a full-length IgG, and wherein the therapeutic agent comprises an anti-cancer therapeutic agent.15.A composition comprising the CD9 antibody construct of any one of claims 1-6, the nucleic acid of any one of claims 7-9, the host cell of any one of claims 10-12, or the conjugate of claim 13 or 14.16.A method for killing, or inhibiting growth or proliferation of a cell expressing CD9, comprising contacting cancer cells with the composition of claim 15.17.The method of claim 16, wherein the cell expressing CD9 is a cancer cell.18.The method of claim 17, wherein the cancer is a blood cancer or a solid tumor.19.The method of claim 17 or 18, wherein the cancer cell is located in a patient’s body.20.The method of claim 19, comprising administering the composition to the patient by subcutaneous, intravenous, intramuscular, intraperitoneal, or intratumoral injection.21.A kit for treating cancer, comprising:(1) a first container containing a first composition comprising an effective amount of the composition of claim 15; and(2) a second container containing a second composition comprising an effective amount of another anti-cancer therapeutic agent.22.The kit of claim 21, wherein the cancer is a blood cancer or a solid tumor.23.The kit of any one of claims 21 or 22, wherein the first composition is formulated for injection.24.The kit of claim 23, wherein the injection is subcutaneous, intravenous, intramuscular, intraperitoneal, or intratumoral injection.25.The kit of any one of claims 21-24, further comprising an instruction manual for using the kit.26.An antibody construct that specifically binds human CD9, comprising:a heavy chain CDR1 sequence having at least 80%sequence identity to SEQ ID NO: 5 or SEQ ID NO: 11;a heavy chain CDR2 sequence having at least 80%sequence identity to SEQ ID NO: 6 or SEQ ID NO: 12;a heavy chain CDR3 sequence having at least 80%sequence identity to SEQ ID NO: 7 or SEQ ID NO: 13;a light chain CDR1 sequence having at least 80%sequence identity to SEQ ID NO: 8 or SEQ ID NO: 14;a light chain CDR2 sequence having at least 80%sequence identity to SEQ ID NO: 9 or SEQ ID NO: 15;a light chain CDR3 sequence having at least 80%sequence identity to SEQ ID NO: 10 or SEQ ID NO: 16.27.The antibody construct of claim 26, comprising a heavy chain variable region that has at least 80%sequence identity to SEQ ID NO: 1, and a light chain variable region that has at least 80%sequence identity to SEQ ID NO: 2.28.The antibody construct of claim 26, comprising a heavy chain variable region that has at least 80%sequence identity to SEQ ID NO: 3, and a light chain variable region that has at least 80%sequence identity to SEQ ID NO: 4.29.The antibody construct of claim 26, comprising a heavy chain variable region that has at least 80%sequence identity to SEQ ID NO: 20, and a light chain variable region that has at least 80%sequence identity to SEQ ID NO: 21.30.The antibody construct of claim 26, comprising a heavy chain variable region that has at least 80%sequence identity to SEQ ID NO: 22, and a light chain variable region that has at least 80%sequence identity to SEQ ID NO: 23.31.The antibody construct of any one of claims 26 to 30, further comprising a Fc domain, wherein the Fc domain comprising one or more amino acid substitutions.32.The antibody construct of claim 31, wherein the one or more amino acid substitutions are at one or more positions selected from L234, L235, N297, G236, P329, and P331.33.The antibody construct of claim 32, wherein the Fc domain comprises an amino acid substitution at position N297.34.The antibody construct of claim 32, wherein the position N297 is substituted with alanine.35.A pharmaceutical composition comprising the antibody construct of any one of claims 26-34.36.A method for treating a CD9-associated disease in a subject, comprising administering an effective amount of the antibody conjugate of any one of claims 26-34, or the pharmaceutical composition of claim 35 to the subject.37.The method of claim 36, wherein the CD9-associated disease is a cancer.38.The method of claim 37, wherein the cancer is a blood cancer or a solid tumor.39.The method of claim 37, wherein the cancer is leukemia.40.The method of claim 36, wherein the CD9-associated disease is selected from the group consisting of a neurological disorder, an autoimmune disease, an inflammatory disease, an infectious disease, and a hematologic and platelet disorder.41.The method of claim 36, wherein the administration of the antibody conjugate has no or minimal platelet toxicity.42.The method of claim 36, wherein the antibody construct comprises one or more amino acid substitutions at Fc domain.43.The method of claim 42, wherein the antibody construct comprises an amino acid sequence that has at least 80%sequence identity to SEQ ID NO:17, SEQ ID NO:30 or SEQ ID NO:31.

Images