Method, data processing arrangement and computer program product for identifying a living being

Abstract

The invention relates to a method for identifying a living being by means of a data processing arrangement, comprising the steps of: determining, taking into consideration a second data set comprising a genetic fingerprint of the living being, a hash value by means of a hashing device, and generating, taking into consideration the hash value, a unique identity marking by means of an identification device. The present invention further relates to a corresponding data processing arrangement and a corresponding computer program product.

Description

[0001] Method, data processing arrangement and computer program product for identifying a living being

[0002] The present invention relates to a method for identifying a living being according to the preamble of claim 1, a data processing arrangement for identifying a living being according to the preamble of claim 15 and a computer program product according to claim 18.

[0003] Current identification systems for individuals are generally based on official identity documents issued by authorities, which, in addition to name and address, may also contain biometric characteristics such as gender, height, eye color, hair color, fingerprints, and a biometric passport photo. This allows for a high degree of probability of identifying a person. However, such biometric characteristics are increasingly being forged. Furthermore, identity documents are only partially suitable for identification in the digital world, for example, for applications to authorities or payments in online shops. While photo or video identification of the person using their identity document or an electronic identification method such as the NFC chip in the German identity card (called eD) is possible, these methods are comparatively complicated and time-consuming for the person wishing to be identified.Furthermore, the biometrics used today are neither tamper-proof nor accurate, nor are they suitable for every user. The false-negative rate of facial recognition and fingerprinting does not allow for the reliable identification of any individual among approximately 8 billion people on our planet. Moreover, some people, for example, due to strenuous physical labor, no longer possess a readable fingerprint.

[0004] One approach to solving this problem is described in the white paper of the WorldCoin Network, which aims to enable a "Proof of Human" or "Proof of Personhood." Such a "Proof of Personhood" would allow the unambiguous identification of a specific individual among eight billion people on this earth. This involves the use of a so-called "Orb," a device for the biometric measurement of a person's iris (see page 17 ff. of the white paper). The complex patterns of the iris (a colored, ring-shaped structure around the pupil) can exhibit differences in the density and distribution of pigments, radial and concentric line patterns, as well as pits, spots, or other microstructures. The structure of the iris is unique to each individual, even identical twins. Another advantage of iris measurement is that it remains largely stable throughout a person's life. Typically, high-resolution infrared cameras are used as sensors for iris scans (see...).(Pages 31 and 32). Although the iris is significantly more accurate as a biometric than, for example, fingerprints and facial recognition, it can also be easily forged. For instance, hackers from the well-known "Chaos Computer Club" succeeded in fooling an iris scanner using a 3D scanner and infrared dye. Furthermore, the iris is not suitable as proof of identity for every user, as not everyone has a healthy iris. Finally, a number of eye diseases, such as cataracts, diabetic retinopathy, and discoloration, can affect the structure of the iris. These diseases can alter the iris structure or...

[0005] Visibility can be impaired, leading to segmentation errors and an increased rate of false negatives. For these reasons, the method is not suitable for capturing all people in the world; that is, it is "not inclusive." Therefore, the Worldcoin Network's claim to reliably perform Proof of Humanity or Proof of Personhood for and among all people on our planet reaches its limits.

[0006] The authors of the WorldCoin white paper strongly advise against using genetic information (“genetic fingerprint”) to identify a person (see page 18, sentences 4 to 5), because this would provide a lot of additional private information and, due to high costs, would not be scalable for a large number of users.

[0007] Based on biometric iris scans, a so-called "World ID" is created, which can be used online (see page 76 ff.). For example, a specially developed cryptocurrency called "Worldcoin" can be exchanged between uniquely identified participants using the World ID. The genetic identification approaches mentioned in the "World Network" white paper are already routinely used for forensic purposes. As explained in the Wikipedia article "DNA Profiling," this involves determining a person's genetic information (DNA) through gene sequencing and identifying gene segments that allow for the unambiguous identification of an individual because these gene segments, in their specific combination, are only negligibly expressed in the same way in one individual and in another.Within the context of the invention, the term "gene segment" generally refers to both coding and non-coding segments for RNAs or proteins. A limitation in forensic applications is identical twins, whose genetic information is identical even at these unique gene segments. The result of such an identification of a unique combination of gene segments is also referred to as a "genetic fingerprint."

[0008] The Wikipedia article "STR Analysis" explains an analysis of a specific type of gene segment, namely "short tandem repeats." These are suitable for uniquely identifying a person and are therefore now standard practice in forensics, for example, to identify suspects based on DNA traces at crime scenes. STR analysis typically uses electrophoresis diagrams or electropherograms and requires visual inspection and further interpretation by an expert to detect artifacts or genetic anomalies during the analysis. Such visual inspection utilizes the capabilities of our eyes. For example, polyphorisms can indicate localized somatic mutations in selected gene sequences, which can distort the STR analysis. Somatic mutations are changes in DNA structure that arise in individual body cells; that is, they are "acquired."These defects are caused by environmental conditions and are not inherited by offspring. Deletions, insertions, or alterations of individual nucleotides or DNA segments (indels) can then occur randomly at different locations in the body. The aforementioned visual inspections and manual interventions, i.e., the personal involvement of an expert, are among the reasons for the comparatively high cost of STR analysis today and currently limit its scalability.

[0009] Cryptocurrencies are known, for example, from publications like the "Bitcoin Whitepaper" and the "Ethereum Whitepaper." These documents describe so-called "blockchains," in which the previous unit of information (block) is used to create the next block using a hashing algorithm, resulting in a tamper-proof chain of blocks. If a block were replaced, its hash value would change, and the blockchain would no longer be logically consistent, which would be easily detectable as manipulation by machines. A hash value is generated using a mathematical hashing function, which maps a data set of any length into a string of a fixed length. The data set can thus be uniquely identified by this string; that is, applying the same hashing algorithm will produce the same hash value again. However, the data set cannot be reconstructed from the hash value.The basic principle is described, for example, in the Wikipedia article "Hash function".

[0010] Starting from the well-known approach of iris identification of humans, the invention aims to provide an alternative method for identifying a living being that is cost-effective, comparatively more forgery-proof, and scalable.

[0011] The invention solves this problem by means of a method according to claim 1.

[0012] The following paragraphs will first provide some definitions of terms. With regard to the data processing steps, the method according to the invention is a computer-implemented method.

[0013] Living being: a living or dead body, especially of an animal or a human, with extractable DNA. First data set: storage form for the organism's genetic information, e.g., a file that codes for a sequence of deoxyribonucleic acid (DNA) in the organism's hereditary information. This can include the entire genome or only specific DNA sequences. If specific DNA sequences are used, preferentially those gene segments (so-called loci) required for determining the genetic fingerprint are included. Typically, the genetic information stored in the first data set is based on a selected cell sample from a human, e.g., skin, blood, or saliva.To rule out the aforementioned potential somatic mutations and corresponding so-called "indels" (a combination of insertion and deletion in mutations within the genome), multiple cell samples can be taken, compared, and consolidated. Additionally, the initial dataset may contain personal data, a so-called "temporary identifier" (i.e., a randomly assigned or pseudonymized code, for example, by the laboratory), or alternative data, because genetic information is typically processed pseudonymously in the testing laboratory.

[0014] First and second communication devices: an interface for sending and / or receiving data. The individual additional devices may also have further communication devices.

[0015] Data transfer between the DNA diagnostic device and the hardware used according to the invention or the service provider can be carried out via an export / import interface, wired or wirelessly, e.g., via Bluetooth or another device interface, a USB stick, a data storage device, a database or other local storage medium, as well as via Wi-Fi, LAN or another network connection in accordance with the respective data security standards. Alternatively, the method can also be embedded in the DNA diagnostic device and in this case does not require data transmission.

[0016] Alternatively, data can also be transmitted via encrypted data transmission, preferably asymmetrically encrypted data transmission, over a computer network such as the internet. A second data set, containing a "genetic fingerprint" of the organism, is a storage format for the organism's genetic information, e.g., a file that identifies the sequence of characteristic markers in the organism's genetic information. Consequently, it does not necessarily have to be an electrophoresis diagram or a coding of the specific sequence of deoxyribonucleic acids, but can also represent this in a more abstract form—e.g., as a sequence of numbers that, for example, indicates a number for a frequently occurring pattern in the genetic information. For instance, when recording short tandem repeats, the respective frequency of each short tandem repeat can be specified (e.g.,3-6-4 for the number of repetitions of the first three STRs (in the form of an allele table). To ensure the quality of the second dataset and avoid the effort of review, artificial intelligence and machine learning methods can be used to detect any artifacts and correct them in the second dataset as needed. This can be done as an alternative or supplement to the aforementioned possible consideration of multiple cell samples in the first dataset. The manual effort of review can thus be saved. Additionally, the second dataset can contain personal data, the so-called "Temporary Identifier" (i.e., a random or pseudonymized identifier assigned by the laboratory, for example), or alternative data, because genetic information is usually processed pseudonymously in the testing laboratory.

[0017] Hash value: a sequence of numbers and / or letters generated from the second data set and, if applicable, other data using a mathematical hashing algorithm. For the hashing algorithm, Keccak256 or comparable mechanisms such as SHA-256, MD5, SHA-1, SHA-2 (including SHA-224, SHA-256, SHA-384, SHA-512, SHA-512 / 224, and SHA-512 / 256), NTLM, Blake2b, and LANMAN can be used. Because artifacts are detected in advance in the second data set and the original sequence is preserved without the indels, this algorithm ensures that the exact same hash value is always reproduced during the hashing process. Hashing can be performed at multiple levels, for example, hashing of the genetic fingerprint, and building on this, hashing of the hash value of the genetic fingerprint together with the hash value of personal data together with a so-called "sait" to create a "super-hash".The inclusion of a string can ensure that an identity identifier can be reproduced or renewed, for example, in the event of theft or misuse. A "string" as defined in the invention is, for example, a randomly generated code for each user's password / passkey, which is added before hashing when a password or passkey is used to increase data security.

[0018] Blockchain: a decentralized network that uses hashing to securely store information in a sequence of information blocks. The term is often used in connection with cryptocurrencies like Bitcoin, but significantly more complex transactions such as smart contracts are also possible (examples: Ethereum, Solana). The data stored can be either coins or tokens. A coin has its own blockchain, such as Bitcoin or Ether, while a token uses an existing blockchain infrastructure (e.g., ERC-20 tokens on Ethereum). Both coins and tokens can be combined with a cryptocurrency, or not. In addition to its function as a cryptocurrency, blockchain can also serve as a decentralized network for storing certain elements of an identity identifier. In this case, for example...The aforementioned “super-hash” is stored as a contract on a blockchain and linked to an address.

[0019] Unique identifier: a sequence of letters and / or numbers that uniquely identifies a person in digital transactions. For example, the aforementioned "super-hash" can serve as a unique identifier.

[0020] Global identity: A data record based on a unique identifier that links to other personal or other information. For example, a global identity can include a user's name, address, gender, age, etc., and serve to identify a user in online transactions. Global identity also enables the unique identification and authentication of an individual in connection with the authorization of so-called digital agents. This allows for the reliable verification of the legitimacy of such AI-based agents or human representatives.

[0021] Device: A device within the meaning of the invention is, for example, a computer with processor resources for data processing, storage resources such as HDDs or SSDs for data storage, and communication resources. A device can be implemented in hardware in a variety of ways, for example, as a computer or server, or as an application-specific integrated circuit (a so-called ASIC). However, a device can also be a component implemented entirely in software, which is used on a web server or as a cloud application (a so-called "as a Service").

[0022] Data processing arrangement: Such an arrangement comprises at least one device, implemented as hardware and / or software, which, in the case of multiple devices, communicate with each other, e.g., via the internet. Some or all of the devices may also be implemented entirely as software components.

[0023] A particular advantage of the method according to the invention is that it overcomes the prejudices of the prior art by ensuring that no personal genetic information is uploaded to the internet or leaves the DNA testing laboratory, but only hash values ​​- which do not allow any conclusions to be drawn about the underlying genetic information of a living being.

[0024] Furthermore, it is advantageous that the unique identifier allows for the creation of a so-called global identity, which a person can use to prove their identity on-site or online and, if necessary, also to verify their name. This can, for example, make access control to security areas (e.g., at banks, military installations, high-security laboratories, or hazardous areas with radioactive, chemical, or biological hazards) more secure. In addition, the use of dangerous machinery or vehicles can be linked to authentication using the global identity.

[0025] In summary, the inventive process has the following advantages:

[0026] - It is cost-effective (i.e., comparable in cost to or cheaper than biometric methods used today, such as fingerprinting, facial recognition, and iris scanning), and

[0027] - is comparatively even more forgery-proof (compared to the biometric methods used today), and

[0028] - is even more accurate (in terms of the unambiguous and reliable identification of an individual as a genuine "proof of personhood" among at least eight billion people on Earth, and taking into account the aforementioned problem of "identical twins"), and

[0029] - is compliant with data protection regulations (i.e., it solves the aforementioned problem of handling genetic information in a legally compliant and protected manner) and

[0030] - is scalable and largely eliminates the need for manual interventions, e.g., by experts, in the analysis.

[0031] - The procedure to be specified is also "inclusive", i.e. applicable to every user, and therefore does not exclude any people.

[0032] Another advantage of this inventive method is that, due to the comparatively high accuracy of genetic fingerprinting and the inclusivity of the biometric method, such a global identity allows for the unambiguous identification of an individual among eight billion people on Earth (in modern parlance, "proof of personhood"). Based on this "proof of personhood" property, the unique identification can be continuously monitored from a risk perspective, for example, with regard to theft or forgery. Such risk monitoring can be supported by artificial intelligence, which aims to recognize specific theft or forgery patterns. The intended innovation is both quantum-resistant and FID02-compliant, in accordance with the requirements currently demanded by the BSI and ENISA. Finally, it enables so-called zero-knowledge proofs (ZKP), i.e., authentication without disclosing personal data.These are further advantages of the invention.

[0033] In a preferred embodiment of the method according to the invention, a first data set containing genetic information of the organism is received by means of a first communication device, and a second data set containing the genetic fingerprint is determined from the first data set using a fingerprinting device, and the second data set is transmitted to the hashing device. This process mirrors a method in which only gene sequencing without determining the genetic fingerprint takes place directly in the laboratory. This only occurs after the first data set has been transmitted to the fingerprinting device. Preferably, the fingerprinting device and the hashing device are located within the laboratory operator's sphere of influence and are thus subject to strict government control with regard to burglary and data security.

[0034] In a further preferred embodiment of the method according to the invention, the second data set containing the genetic fingerprint is received by means of a second communication device, and the second data set is transmitted to the hashing device. Compared to the previous embodiment, this process reflects an alternative method in which, in addition to gene sequencing, the determination of the genetic fingerprint also takes place in the laboratory or within the laboratory operator's sphere of influence. The genetic information is thus preprocessed to obtain the genetic fingerprint. This ensures that only the genetic fingerprint is transmitted, which no longer represents a more complete analysis of the entire genome or comprehensive DNA sequences of the organism, so that, for example, no conclusions can be drawn about diseases.Here too, the fingerprinting and hashing facilities are located within the laboratory operator's sphere of influence and are therefore subject to strict government control with regard to burglary and data security.

[0035] In a further preferred embodiment of the method according to the invention, the first data set is determined using a gene sequencing device. The source data can originate from DNA diagnostics performed by sequencing instruments (e.g., NGS, Sanger), STR analyzers (e.g., PCR-based, capillary electrophoresis), or multi-purpose instruments (sequencing and STR). Any storage medium can be interposed. This is advantageous because the required sequencing information can be provided by a variety of different gene sequencing devices.

[0036] Preferably, the second data set is transferred by converting both the genetic information and the additional pseudonym (such as the temporary identifier) ​​into a QR code using a hashing method. The resulting two QR codes can then be processed further. The use of QR codes and the associated intentional "media break" in data transmission ensures that no external access to the laboratory's network is possible. This approach also further increases security because, immediately after sequencing in the laboratory, no DNA data is transmitted that could allow conclusions to be drawn about, for example, diseases or kinship relationships. Because laboratories for the DNA sequencing of human DNA are strictly regulated by the state (especially by genetic diagnostics and data protection laws), manipulation or data theft is significantly more difficult in such an environment.This is a major advantage over, for example, systems with IRIS scans, which cannot be performed in such a highly regulated environment, and in extreme cases can be performed by anyone in any location.

[0037] The determination of short tandem repeat (STR) data (if DNA sequences are provided as input) can be performed using various tools such as capillary electrophoresis (e.g., Applied Biosystems gene analyzers, ABI PRISM 310 / 3130 / 3500), PCR-based systems (e.g., STR kits), STR analysis software (e.g., GeneMapper, STRmix, PowerPlex), and / or online databases and tools (e.g., DSMZCellDive, ATCC STR Profiling). External software and / or online databases can be integrated.

[0038] In another preferred embodiment of the method according to the invention, the living being is a human being. This is the preferred application of the method. However, the approach of the invention can also be used to create tamper-proof digital identities for other living beings, provided they have DNA with sufficiently large differences between individual members of a population to create a unique genetic fingerprint. For example, primates or other animals with DNA very similar to that of humans could also be distinguished in this way, for example, to counteract the illegal wildlife trade. Valuable animals such as racehorses, racing camels, breeding pigeons, or ornamental fish such as koi can also be given a digital identity to, for example, enable resale via decentralized exchanges using blockchains. The same applies to the sperm and / or ova of breeding animals such as breeding bulls or stallions.

[0039] In a further preferred embodiment of the method according to the invention, the genetic fingerprint is determined based on short tandem repeats in the DNA. Preferably, at least 13 short tandem repeats (STRs) are detected, and even more preferably at least 25 STRs are detected.

[0040] For example, a subset or all of the following human gene loci can be used for genetic fingerprinting. Codis, ESS, and GlobalFiler are currently available standards for STR analysis in the USA and Europe.

[0041] CSF1 PO (CODIS, GlobalFiler)

[0042] D1S1656 (CODIS, ESS, GlobalFiler)

[0043] D2S1338 (CODIS, GlobalFiler)

[0044] D2S441 (CODIS, ESS, GlobalFiler)

[0045] D3S1358 (CODIS, ESS, GlobalFiler) D5S818 (CODIS, GlobalFiler)

[0046] D7S820 (CODIS, GlobalFiler)

[0047] D8S1179 (CODIS, ESS, GlobalFiler)

[0048] D10S1248 (CODIS, ESS, GlobalFiler)

[0049] D12S391 (CODIS, ESS, GlobalFiler)

[0050] D13S317 (CODIS, GlobalFiler) D16S539 (CODIS, GlobalFiler) D18S51 (CODIS, ESS, GlobalFiler) D19S433 (CODIS, GlobalFiler) D21S11 (CODIS, ESS, GlobalFiler) D22S1045 (CODIS, ESS) FGA (CODIS, ESS, GlobalFiler) Penta D (CODIS, GlobalFiler) Penta E (CODIS, GlobalFiler) TH01 (CODIS, ESS, GlobalFiler) TPOX (CODIS, GlobalFiler) vWA (CODIS, ESS, GlobalFiler) DYS391 (GlobalFiler) SE33 (GlobalFiler)

[0051] Amelogenin (ESS, GlobalFiler) -dieser Marker ermöglicht die Geschlechtsbestimmung.

[0052] Alternatively or additionally to short tandem repeats (STRs), complete genomic data, DNA sequences, single nucleotide polymorphisms (SNPs), a variable number of tandem repeats (VNTR), or alternative data can be used for the organism's genetic information. Established file formats such as FASTA, FASTQ, GenBank, GFF, BAM / SAM, VCF, BED, or alternative formats can be used to document the genetic information. If the genetic information relates to STR determination, it can be based on FSA, HID, CSV, XML, STRmix, or another format for STR data. In principle, any type of data format can be used effectively within the scope of the invention, as long as it is always ensured that all genetic information is recorded using the same data format. This guarantees reliable further processing.Should a data format be changed during the ongoing operation of the further issuance of global identities, version control would have to be carried out accordingly.

[0053] The determination of genetic markers using SNP or restriction fragment length polymorphism (RFLP) analyses, STR analyses or VNTR analyses can also be used as an alternative or additional method to advantage.

[0054] In a further preferred embodiment of the method according to the invention, a identifier of the first data record is transmitted to a cloud application together with the hash value. The identifier is exchanged for additional personal information, and a personal hash value is determined. For example, the first identifier is transmitted as a QR code. One or more of the following can be considered as additional personal information: first name, last name, address, age, place of birth, eye color, height, and gender. Both hashes together (as a kind of super-hash) form the basis of the global identity. The global identity is therefore a "multi-layer hash," whereby only certain layers are stored in the blockchain.

[0055] In a further preferred embodiment of the method according to the invention, at least one of these additional pieces of personal information is taken into account when determining the hash value: the identifier of the first data record, first name, last name, address, age, place of birth, eye color, height, and sex. This is advantageous because, with the help of the additional personal information, even identical twins who have the same DNA within the measurement accuracy of the genetic fingerprint can be distinguished (except for physical characteristics such as age, place of birth, eye color, height, sex, etc.). The use of the identifier of the first data record (a so-called "temporary identifier"), which is usually assigned by the hospital or laboratory that initiates or performs the gene sequencing, is particularly preferred. This is typically a random sequence of letters or numbers.This is therefore not a code that reveals any personal information about the individual. The inventive method thus overcomes the prejudices of the prior art that genetic sequencing would process further personal information and simultaneously enables the differentiation of identical twins. Identical twins would otherwise receive different markers during laboratory analysis of their DNA.

[0056] In a further preferred embodiment of the method according to the invention, a person hash value is determined using the hashing device, taking into account at least one of the following additional personal information: the identifier of the first data record, first name, last name, address, age, place of birth, eye color, height, and gender. This alternative embodiment achieves essentially the same advantages as described above for the preceding embodiment, with the difference that two independent hash values ​​are generated and used in the further course of the method to create the global identity.

[0057] In a further preferred embodiment of the method according to the invention, the second data set and the additional personal information are stored exclusively locally on the hashing device, which is operated as a device within the sphere of influence of an identification service provider. An identification service provider is, for example, a laboratory operator who also operates the necessary gene sequencing equipment. The identification service provider may, for example, receive financial incentives to operate, in addition to performing gene sequencing, a device that includes, in particular, the hashing device and calculates the unique identifier based on the genetic fingerprint and, if applicable, other data. This ensures that genetic information does not leave a laboratory that is typically subject to strict regulations regarding data protection.Only the hash value, which does not allow any conclusions to be drawn about the underlying genetic information, is transmitted outside the laboratory. As an alternative to the aforementioned embodiment, the second data set and the additional personal information, or their respective hash values, can also be processed in a software layer that connects all components of the invention. This is particularly useful and feasible for performing a deduplication step to determine whether a global identity has already been created using the available genetic information. This prevents a person from having multiple global identities.

[0058] In a further preferred embodiment of the method according to the invention, the unique identifier is used to establish a global identity on a platform. The platform can be a website with an associated database, a cloud application, or a blockchain. For this purpose, the hash value generated based on the genetic fingerprint is examined for duplicates (i.e., a so-called "duplication test"), meaning that any collisions / matches of the hash values ​​are detected, indicating that the individual in question has already been assigned a global identity. The global identity therefore includes the unique identifier and links it to a user's personal information, such as their name. With the global identity, a user can securely identify themselves as a specific person in digital transactions.

[0059] The following table shows a preferred information flow (from top to bottom, i.e., the start of the process is in the first row).

[0060] In a further development of the aforementioned implementation, a token is used for global identity. This can be, for example, storage space on a public blockchain or a non-fungible token (NFT). An NFT is a unique token on a blockchain, not identical to any other token. On Ethereum, the most well-known platform for NFTs, the ERC-721 standard is typically used.

[0061] In a preferred embodiment of the method according to the invention, in addition to the aforementioned use of the blockchain, a predetermined number of coins and / or tokens of a newly created cryptocurrency are assigned to the global identity. This is advantageous because it provides every user who identifies themselves using the method according to the invention with a financial incentive to use the global identity.

[0062] In principle, the invention distinguishes between the use of the blockchain for storage purposes and an optional additional incentive via crypto tokens or coins, i.e., the provision of additional incentives within the system. If a cryptocurrency is introduced as an incentive, this function can be implemented via separate contracts on the same blockchain or, alternatively, on a different blockchain than the one intended for storage.

[0063] In this approach, a single blockchain (e.g., Ethereum or Solana) or a single type of token can be used to store the global identity and for the application of a coin or token for transactions on a blockchain, as described in this embodiment. Alternatively, two different blockchains or coins and / or tokens can be used for storing the identity and for transactions.

[0064] This is the case when the coins or tokens have economic value, for example, initially only very small amounts of dollars or euros, but which can increase in value due to suitable "tokenomics" (i.e., the economics of the tokens). This can be achieved, for example, through deflationary control of the token supply, by "consuming" more tokens in transactions (so-called "bums") than are newly issued. The use of the coins or tokens as proof of voting rights (so-called "governance" function) with regard to the further development of digital identity and tokenomics is also advantageous.

[0065] In a preferred embodiment of the method according to the invention, one of the following blockchains is used: proprietary blockchain, Ethereum, Solana, Cardano, Binance Smart Chain, Polkadot, Avalanche, NEAR Protocol, Algorand, Cosmos, Second Layer Chains, Arbitrum, Optimism, Polygon. A proprietary blockchain offers the advantage of providing the operator of the method according to the invention with comparatively greater control over the blockchain and its tokenomics.

[0066] The present invention is compliant with EU Regulation 2023 / 1114 (MICA), which regulates the use of crypto-assets in the EU.

[0067] In principle, all of the aforementioned implementations, i.e., regardless of whether a blockchain is used, can employ a so-called wallet to store data. If a blockchain is used, the data can include, for example, a global identity, an NFT, coins, or tokens. Such a blockchain-based wallet can be stored locally on a mobile phone, desktop computer, laptop, or other end-user device, or it can be stored on dedicated hardware (a so-called "cold wallet"). A cold wallet is not connected to the internet except for transactions and stores the data in strongly encrypted form, making manipulation difficult or even impossible. Furthermore, an internet-based wallet ("hot wallet") can also be used, which accesses a server on the internet.

[0068] This offers significant advantages over previous solutions for identifying individuals. The system facilitates fair "airdrops" of crypto tokens, provides protection against bot / Sybil attacks (attacks on a distributed system where an attacker creates multiple fake identities—so-called "Sybil accounts"—to manipulate the system) on social media, and enables a fairer distribution of limited resources. Furthermore, global identity can facilitate global democratic processes and innovative forms of governance, such as squared voting (where people not only cast a vote but the intensity of their preferences is also taken into account), and could ultimately form the basis for a AI-funded universal basic income (UBI).

[0069] To use the system according to the invention, individuals can download a wallet app that supports the creation, storage, and use of a global identity. Users can connect to a device, a central software layer, and / or blockchain for processing DNA biometric data or its hash values ​​to verify the global identity. For example, the devices, software layer, and / or blockchain are operated by a network of independent local companies or democratically by a group of individuals, such as DNA diagnostic laboratories or token holders. The device, software layer, and / or blockchain uses DNA biometric data or its hash values ​​to verify the user's identity and issue a verified global identity.

[0070] For identity verification to be effective, a unique identity must be confirmed. If a global identity can be obtained more than once and passed on to individuals, companies, or even AI bots with malicious intent, it cannot be considered reliable and will not fulfill its intended function. Therefore, it is highly advantageous if, within the framework of the inventive method, a duplication of global identities is detected, for example, based on the hash values ​​of genetic information already used for a global identity. In this case, no second identity will be created. This process, also known as deduplication, thus increases confidence in the inventive solution.

[0071] Instead of centralized deduplation checks or collision tests (as the core of the PoP) in the software layer (e.g., cloud), distributed analytics (so-called "fererated analytics") across the various facilities (fingerprint facility, etc.) can also be used to advantage.

[0072] The global identity should also not be transferable to other users or bots with the user's consent, so that it cannot be easily used for fraud.

[0073] In a preferred embodiment of the method according to the invention, the global identity is restored after loss and / or compromise of access data by using one of the following mechanisms: User-managed backup, social recovery, key recovery, reissuance of a global identity.

[0074] User-managed backups use stored, encrypted backups of the user's login credentials. This allows users to restore their login information, for example, in case of a lost or stolen device. Social recovery allows login credentials to be restored with the help of friends and family (e.g., as with multi-signature solutions for storing cryptographic keys within a user group, where, for example, 3 out of 5 or 2 out of 3 users must sign off on a transaction like the recovery described here).

[0075] In the event of key recovery, the provider of the inventive method assists, enabling a user to regain access to their original login credentials. If the user proves their identity, for example with a national identity document and / or a renewed genetic test, the issuer of the global identity can provide assistance.

[0076] If reissuance is required, for example in the case of identity theft, a global identity can be invalidated. A new global identity can then be created. This process is analogous to a credit card being blocked and subsequently reissued by a provider. In a preferred version of the invention, the aforementioned string is renewed, hashed together with the personal data, and then, together with the STR hash, formed the renewed super-hash as a renewed unique identifier.

[0077] In a further development of the inventive method, global identities created with the help of an unlawfully acting issuer are revoked. Thus, for example, an entire group of identities created by a compromised or malicious actor can be removed from circulation.

[0078] In a further preferred embodiment of the method according to the invention, the global identity expires after a predetermined period. This predetermined period can be, for example, 20 years, or even more preferably, 30 years. However, a shorter period can also be provided, for example, 10 years, in order to regularly offer global identities that have been improved with regard to security. Alternatively, the period can also be linked to a statistically expected remaining lifespan of the organism. If, for example, the global identity is created for an animal that is expected to live only 10 more years, a period corresponding to the expected remaining lifespan plus a safety margin of, for example, 5 years, i.e., a total of 15 years, can be defined.Even in humans, for example, a safety margin of 10 years can be provided for a 75-year-old man with a statistical life expectancy of 80 years, so that the global identity expires after 15 years and must be reissued.

[0079] In a further preferred embodiment of the method according to the invention, methods and indicators for determining the liveness of the living being ("Liveness Detection") can be used in addition to or as an alternative to the residual lifetime of a global identity described above, and checked for authenticity or attempts at deception by means of AI.

[0080] In a further preferred embodiment of the method according to the invention, the global identity is used for authentication in online transactions. An online transaction can, for example, include the purchase of a train or plane ticket, an application for a service from a public authority, the signing of a contract, proof of age, or the transfer of a token or coin. So-called trust "services," such as confirmation of a person's age, a signature, or a payment transaction, are also suitable transactions within the meaning of the invention. This is advantageous because it allows a user to prove that they are carrying out the digital transaction as a specific individual.

[0081] In a further preferred embodiment of the inventive method, a person is authenticated without disclosing personal data. This corresponds to a so-called "zero-knowledge proof." For example, online voting in elections can be based solely on the global identity. To protect anonymous voting, after separating the vote and the identity, the latter is stored by the election administrator in a storage medium ("one source of truth") to prevent the eligible voter from voting again in person at the polling station.

[0082] In a further preferred embodiment of the method according to the invention, a plausibility check is performed when using the global identity by taking the location of the identification event into account. Analogous to the use of credit cards, this can prevent the use of the global identity in unexpected locations or locations on a blacklist defined by the user or the provider, or alternatively, allow it, but only in conjunction with, for example, a government-issued identification document as an additional security measure. For instance, if a user typically only uses the global identity in Germany and then uses it to purchase a car in Rio de Janeiro, this is implausible.

[0083] As part of the plausibility check, additional authentication using government-issued identification documents such as passports, national identity cards, or driver's licenses may be required. This support for identification via global identity through government-issued identification documents is a further advantage of the invention compared to previous systems. This allows for the use of a genetic fingerprint or a corresponding STR hash value of a person, as well as a photo comparison with the person's appearance and / or a verification of other characteristics such as name, title, place of residence, age, height, eye color, gender, etc. Linking the unique identifier to national identification documents for identity verification during the identity creation process ensures that the unique identifier supports and secures national identification documents using a particularly secure protocol.This is a significant advantage over other identification methods that either operate at the national level (e.g., eID, German identity card) or compete with national identity documents (e.g., World ID). Additionally, national identity documents and other multi-factor authentication (MFA) methods can be used to secure access to the corresponding wallet. In a further preferred embodiment of the method according to the invention, a password is required when using the global identity. This password is known only to the holder of the global identity, thus providing an additional layer of security.

[0084] As a result, a thief would need to know not only the victim's global identity but also the victim's personal data and / or password in order to use the global identity to carry out a transaction such as a transfer of financial value.

[0085] As an alternative to using a password when using global identity, the Passkey method can also be used.

[0086] In a further preferred embodiment of the method according to the invention, a current security status of the system according to the invention is provided to a user. This is the previously mentioned possibility of continuous risk monitoring based on the proof-of-personhood properties of the invention. For example, the current security status is displayed in an app. Multiple security levels can be provided, for instance.

[0087] At security level 5, the highest level, there is no problem and the global identity can be used as intended.

[0088] In the event of a cyberattack on a component such as an identification app or a wallet, security level 4 is assigned. This can be overcome by re-authentication or re-registration.

[0089] In the event of a cyberattack on an application hosted on the internet or in the cloud by the provider, security level 3 is assigned. This can be overcome by a security update for the cloud and / or wallet.

[0090] In the event of a loss of a global identity, security level 2 is assigned. This can be overcome by issuing a new identity.

[0091] In the event of theft or forgery of the global identity, security level 1 is assigned. This can be overcome by revoking the global identity. In a further preferred embodiment of the method according to the invention, the online transactions include the transfer of decentralized financial assets. This is an advantage because, with the invention, it can be demonstrably proven that a human being has initiated the transaction and not, for example, a so-called trading bot.

[0092] In a further preferred embodiment of the method according to the invention, the global identity provides proof of identity, confirming that the user is a human. Such a so-called "proof of personhood," i.e., the verification of the existence or conflict of an identity among 8 billion people, is a key application of the invention.

[0093] Within the scope of the invention, an artificial intelligence method can also be used to examine the underlying DNA for genetic fingerprinting. This allows polymorphisms in the underlying DNA to be detected for the identification of the organism. Human DNA can change throughout a person's life due to external influences. Somatic mutations occur during cell division and DNA repair processes, altering the integrity of the DNA throughout a person's lifespan. Deletions, insertions, or conversions of individual nucleotides or DNA segments (so-called "indels") can occur randomly at various locations in the body. Using the CSF1 PO STR as an example, the following mutations could occur:

[0094] Original sequence:

[0095] ATCT ATCT ATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT

[0096] Conversion:

[0097] ATCT ATGT ATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT

[0098] Insertion:

[0099] ATCT ATCGT ATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT

[0100] Deletion:

[0101] ATCT ATT ATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT Even though the probability of this occurrence is not very high, it is not zero. If this happens to a person who was previously issued a unique identifier, there is a small probability that a test of that person after the mutation occurs will not reproduce the same hash value. Due to the great importance of consistent identity identification, a solution should exist to address this potential problem.

[0102] In a further preferred embodiment of the method according to the invention, a machine learning method is used to detect polymorphisms in the DNA of the organism. In particular, the DNA segments required for genetic fingerprinting can be examined and, if necessary, corrected to obtain a consistent genetic fingerprint. The aim of the machine learning method is to detect and mark these changes and to reproduce the original sequence. In this way, an exactly identical hash value can be reproduced both with and without any potentially present "indel" sequences.

[0103] Extensive dummy sequence data (in so-called latent representation) can be used as training data for the machine learning process. This data can be compared with the actual motif frequencies they represent. "Decoys" can also be used; these are sequence data in which the frequencies / sequences are reversed. In the next step, real STR sequence data is used for training. Mutations can also be introduced into the real data to provide a control group.

[0104] The machine learning process can employ so-called "decision trees," in particular a "random forest" method. Alternatively, a neural network (deep learning) can be used. Common data formats such as "fasta" or "fastq" are used. Alternatively, an Excel format imported as a .csv file can be used. Extensive tests have already been conducted to evaluate the machine learning process in its trained state. For example, 1000 * 25 * 2 = 50000 STR sequences were generated based on a human reference genome. Subsequently, 1 percent mutations were introduced into this data, and the software was tested with them. Currently, regular expression type checking is performed.

[0105] In a further preferred embodiment of the method according to the invention, tokens and / or smart contracts on a blockchain are used to record decision-making authority for machine learning processes employed within or outside the context of identifying the individual. The recorded decision-making authority makes it possible to verify at any given time whether an artificial intelligence is authorized to trigger actions (e.g., to delete a global identity or to conduct transactions with appropriate authorization for a person) in the respective process step. If the AI ​​system is not authorized, a manual step by a human is required to trigger the next action. By publishing the rules for decision-making authority on the blockchain, they are publicly viewable and verifiable at any time, which prevents fraud and increases security.

[0106] AI governance has the task of monitoring AI systems to ensure their use is compliant with laws, ethical, and responsible. Effective AI governance is becoming increasingly important because, with the growing capabilities of AI systems, they increasingly challenge human authority by making decisions for individuals—sometimes unconsciously and unintentionally. This is particularly true for so-called digital agents or AI agents, which aim to comprehensively support individuals in all aspects of daily life and beyond. AI agents can, for example, manage the flow of information between different business applications and backend systems (e.g., coordinating the creation of an application via applications like Notes, then Word, DocuSign, and finally Excel). Current approaches to AI governance (such as IBM WatsonX) address this issue.AI governance tools (such as CalypsoAl, Copyleaks, and G2 AI governance tools) primarily attempt to establish appropriate principles and transparency. They reach their limits insofar as they formulate general principles. The question of the extent to which an AI system has been authorized to act on behalf of a person in a specific way in a given individual case remains unanswered; that is, it is not specifically addressed by existing AI governance approaches.

[0107] The invention addresses the specific issue of authorizing a computer system and, in this respect, complements the existing governance framework. Unique identification (creation and upgrading of an identity), secure authentication (proof of the individual's identity to third parties), transparent authorization (granting decision-making authority or power of attorney to the computer system), and legitimation (proof of the computer system's power of attorney) are closely interrelated, as it is insufficient to demonstrate certain powers of attorney if the authorizing individual is not clearly identified. The authorized computer system must be able to reliably demonstrate the fact and scope of its authorization in order to act legitimately.Similar to a commercial register for companies, which records the powers of attorney for managing directors and authorized signatories, the invention uses Web3 tokens and smart contracts—depending on the scope and complexity of the power of attorney—in the form of a public, partially public, or private blockchain, depending on the group of affected parties, to represent the powers of action and decision-making of AI systems. In this sense, the invention creates a "commercial register for AI systems" that globally discloses the powers of action of digital agents. This is particularly—but not exclusively—necessary for AI systems in a high-risk category, for example, as defined by EU AI legislation. The scope of the actually granted decision-making powers, i.e., the respective delegation of authority, is thus (partially / within the group of affected parties) public and verifiable by third parties (e.g.,(e.g., by referencing such a Web3-based AI registry in an organization's website's purchasing guidelines, in a QR code of a CRM chatbot, on an AI agent's subscription page, etc.). The tokens and smart contracts are thus bound to the global identity, while zero-knowledge proofs can be maintained. Ultimately, such AI governance, which addresses the delegation of human authority—that is, the permission to make decisions—also serves to safeguard the identity of the individual concerned. The protection of identity and authority together therefore secures the sovereignty of the individual or an organization.

[0108] The invention, in turn, controls the above AI governance through independent AI support, on the one hand at the level of individual AI systems or agents, in particular through:

[0109] • AI-based selection of the appropriate contract type among different smart contract and / or token types

[0110] • Intelligent contract and token management:

[0111] Automation of the creation, monitoring, and management of smart contracts or tokens. This may also involve the use of apps such as Alchemy, Infura, Etherscan (for example, Ethereum), and / or Solana Program Library, Solana Web3.js (for example, Solana), and / or Binance Smart Chain (BSC).

[0112] • Verification processes:

[0113] Validation of transactions and data recorded in the blockchain, including ongoing assessment and risk management.

[0114] • Prediction and decision-making:

[0115] Identifying patterns and trends in blockchain data and making informed decisions based on them

[0116] • Resource optimization:

[0117] Optimizing resource utilization within a blockchain network,

[0118] On the other hand, the invention controls the above AI governance through independent AI support at the AI ​​system or agent-spanning level, in particular through:

[0119] • Intelligent selection of AI systems or agents suitable for a specific application

[0120] • AI-based evaluation and selection of the various available contract types between AI systems or agents • Setting up and conducting performance comparisons of the capabilities between different AI systems or agents

[0121] • Intelligent verification of security levels between different AI systems or agents

[0122] • Evaluation and “scoring” of different providers or operators of AI systems in specific application areas

[0123] In this sense, the independent AI support of the invention is provided by a kind of "super-agent" or "meta-agent" who operates, develops, and orchestrates a "marketplace for AI systems" or digital agents.

[0124] Based on the known approach of iris identification of humans, the invention further aims to provide an alternative data processing arrangement for the identification of a living being that is cost-effective, comparatively more forgery-proof and scalable for use in digital transactions.

[0125] In a further preferred embodiment of the method according to the invention, a hashing method that is protected against decryption by quantum computers is also used. Such a method is also called a "post-quantum method." There are several specific post-quantum cryptographic algorithms that can be considered as alternatives to currently used hashing methods such as SCH256, for example, lattice-based methods such as CRYSTALS-Kyber, CRYSTALS-Dilithium, FALCON, SPHINCS+, and NTRU. These algorithms are currently being standardized and are designed to be secure against attacks by quantum computers. For the purposes of the invention, the aforementioned post-quantum algorithms are to be understood as hashing methods.

[0126] The invention solves this problem by means of a data processing arrangement according to claim 15. Preferred embodiments are set forth in dependent claims 16 and 17. These offer essentially the same advantages as those described at the outset for the method according to the invention. Based on the known approach of iris identification of humans, the invention further aims to provide a computer program for identifying a living being that is cost-effective, comparatively more forgery-proof, and scalable for use in digital transactions.

[0127] The invention solves this problem by means of a computer program product according to claim 18. This results in essentially the same advantages as explained at the outset for the method according to the invention.

[0128] To further explain the invention, a schematic representation is shown below.

[0129] Figure 1 shows an embodiment of the system according to the invention.

[0130] The preferred embodiments illustrated in the figures can be freely combined with the embodiments described at the outset. They do not restrict the meaning of the terms and concepts used.

[0131] Figure 1 shows an example 1 of an implementation of the invention. In a genetic analysis laboratory 3, human DNA 9 is processed in a gene sequencing device 20, which is then further processed in a device 4 operated within the laboratory operator's sphere of influence 16. The identity information is transmitted to a Web3 platform 5 and then to a wallet 6. The genetic analysis laboratory 3 and the device 4 are located within the laboratory operator's sphere of influence 16 and are therefore subject to the strictest regulations with regard to the data security of personal information.

[0132] The Web3 platform 5 is located within the sphere of influence of the operator of the identification service 18 according to the invention, while the wallet 6 is located within the sphere of influence of the user of the global identity 19.

[0133] Furthermore, exemplary implementations of the components described are shown: the device 4 is exemplary as a black box 7 which has computer hardware and software for performing calculations, and the wallet 6 can be used as an app on a commercially available smartphone 8.

[0134] All components 3, 4, 5, 6 of the system according to the invention are linked via a software layer 2, through which data records can be exchanged via communication links 27, either as an alternative or in addition to direct data communication. This redundancy increases the availability and reliability of the system. The software layer 2 is preferably also assigned to a direct or indirect sphere of influence of the operator of the identification service 18 according to the invention.

[0135] Following gene sequencing, at least 13 gene loci of short tandem repeats 10 can be directly determined and transmitted as a second data set 25 to the device 4 via a data communication link 22. In this variant, a fingerprinting device is operated directly in the gene laboratory to determine the genetic fingerprint. Alternatively, the determined genetic information, at least in the regions of the DNA relevant for the short tandem repeats, can be transmitted as a first data set 23 to the device 4 via a data communication link 21. There, the gene loci of the short tandem repeats are then evaluated or determined in the standard manner using a fingerprinting device 11. In this case, the second data set 25 is subsequently provided.

[0136] The second data set 25 now contains information on the person's genetic fingerprint and is used in a hashing facility 12 to determine a hash value 24. This hash value 24 is considered in an identification facility 13 to obtain a unique identifier 26. For example, analogous to the processing of the genetic information into a hash value, an additional hash value is also created taking into account additional personal information, in particular an identifier from the first data set (i.e., a laboratory-generated, pseudo-anonymized string for identifying the DNA sample). Both hash values ​​can be provided as so-called "Quick Response Codes" (QR codes) 13 to create the unique identifier 26 for software layer 2. The verification of whether a unique identifier 26 already exists or not, i.e.,The Proof-of-Personhood process is carried out by software layer 2, which then transmits the results back to facility 4 or the operator of the genetic testing laboratory 16 as a kind of "approval" for the further process 13. Software layer 2 can be a centrally operated server or a so-called "decentralized application," which in turn is operated on a blockchain.

[0137] By taking additional personal information into account, it is possible to distinguish between identical twins. This is because identical twins have different markings on their DNA samples from the laboratory.

[0138] The unique identifier 26 is created in software layer 2 and transmitted to the Web3 platform 5. It enables the creation of a global identity 14, which, in addition to the unique identifier 26, also links an address on the blockchain as a contract. As mentioned previously, identity documents such as passports, national identity cards, and driver's licenses can also be linked to the unique identifier 26 in software layer 2 using their serial numbers. Thus, the global identity 14 is not decoupled from government identification systems but can be used in conjunction with them to prevent fraud. For example, a user can identify themselves as a specific person, either in person or online, using the global identity 14, and further confirm this by presenting the identification document (or, correspondingly, with video ID or photo ID online).

[0139] The global identity 14 can thus increase the security of transactions by using the blockchain address and together with government identification documents, secures the government identification document using a particularly secure protocol and does not compete with government systems.

[0140] In conjunction with the global identity 14, transactions with crypto assets can also be carried out on the same or an alternative Web3 platform 5. Furthermore, the global identity 14 can be stored securely in a blockchain, and its origin can be verified at any time using the corresponding address.

[0141] Finally, the global identity 14 can also be transferred to the wallet 6 via software layer 2, in order to be able to carry out transactions there (with or without recourse to the blockchain for authentication purposes) as a then verified human being.

[0142] The following table provides an overview of the different stages of using identity verification and the technology that can be used for this purpose:

Claims

Claims 1. Method for identifying a living being by means of a data processing arrangement (12,13), comprising the steps: Determining a hash value (24) taking into account a second data set (25) with a genetic fingerprint of the organism using a hashing device (12), and Generating a unique identifier (26) taking into account the hash value (25) using an identification device (13).

2. The method according to claim 1, characterized by the steps: Receiving an initial data set (23) containing genetic information of the organism using an initial communication device, and Determining the second data set (25) with the genetic fingerprint based on the first data set (23) using a fingerprinting device (11), and transmitting the second data set (25) to the hashing device (12).

3. The method according to claim 1, characterized by the steps: Receiving the second data set (25) containing the genetic fingerprint via a second communication device, and Transmitting the second data set (25) to the hashing facility (12).

4. Method according to one of the preceding claims, characterized in that the genetic fingerprint is determined using short tandem repeats (10) in the DNA.

5. Method according to one of the preceding claims, characterized in that at least one of these additional personal information pieces of information is taken into account when determining the hash value (24): Identification of the first data record, first name, last name, address, age, place of birth, eye color, height, gender.

6. Method according to claim 5, characterized in that the second data set (25) and the additional personal information exclusively locally on the hashing- 35 The hashing device (12) is stored, the hashing device (12) being operated as a device within the control of an identification service provider (16).

7. Method according to one of the preceding claims, characterized in that the unique identification mark (26) is used for setting up a global identity (14) on an Internet platform (5).

8. Method according to claim 7, characterized in that a predetermined number of coins and / or tokens of a blockchain of the global identity (14) is assigned.

9. Method according to claim 8, characterized in that one of the following blockchains is used for the blockchain: proprietary blockchain, Ethereum, Solana, Cardano, Binance Smart Chain, Polkadot, Avalanche, NEAR Protocol, Algorand, Cosmos, Second Layer Chains, Arbitrum, Optimism, Polygon.

10. Method according to one of claims 7 to 8, characterized in that the global identity is used for authentication in online transactions.

11. Method according to one of claims 9 or 10, characterized in that the online transactions comprise a transfer of decentralized financial assets.

12. Method according to one of the preceding claims, characterized in that the authentication of a person is carried out without disclosing personal data.

13. Method according to one of the preceding claims, characterized in that a method is used for the hashing method which is protected against decryption with quantum computers.

14. Method according to one of the preceding claims, characterized in that a machine learning method is used to detect polymorphisms in the DNA of the organism. 36 15. Data processing arrangement (12, 13) for identifying a living being, comprising: a hashing device (12) configured to determine a hash value (24) taking into account a second data set (25) containing a genetic fingerprint of the living being, and - an identification device (13) that is trained to generate a unique identifier (26) taking into account the hash value (24).

16. Data processing arrangement (12, 13) according to claim 15, comprising: a first communication device for receiving a first data set (23) containing genetic information of the living being, and a fingerprinting device (11) configured to determine the second data set (25) containing the genetic fingerprint from the first data set (23), and to transmit the second data set (25) to the hashing device (12).

17. Data processing arrangement according to claim 16, characterized in that the fingerprinting device (11) is configured to determine the genetic fingerprint based on short tandem repeats in the DNA.

18. Computer program product comprising instructions which, when the program is executed by a computer, cause it to execute a method according to any one of claims 1 to 14.

Images