Methods of treatment with GPRC5d antibodies with enhanced effector function

Abstract

Herein are methods of treating multiple myeloma in a subject comprising administering GPRC5D antibodies with enhanced antibody-dependent cellular cytotoxicity (ADCC) and enhanced complement-dependent cytotoxicity (CDC). The antibodies described in the methods are afucosylated and comprise K248E and T437R mutations (designated as "RE mutations") per the EU numbering system.

Description

Attorney Docket No.: JBI6924WOPCT1 METHODS OF TREATMENT WITH GPRC5D ANTIBODIES WITH ENHANCED EFFECTOR FUNCTION CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of United States Provisional Application SerialNumbers 63 / 686,278 filed on August 23, 2024 and 63 / 808,129 filed on May 19, 2025. The entire contents of the above-referenced applications are incorporated herein by reference in their entirety. SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submittedelectronically in XML file format and is hereby incorporated by reference in its entirety. Said XML copy, created on August 18, 2025, is named JBI6942WOPCT1_SL.xml and is 26,981 bytes in size. TECHNICAL FIELD

[0003] Provided herein are methods of treating multiple myeloma using GPRC5D antibodieswith enhanced antibody-dependent cellular cytotoxicity (ADCC) and enhanced complement- dependent cytotoxicity (CDC). BACKGROUND

[0004] Multiple myeloma is a malignant plasma cell disorder that accounts for approximately10% of all hematologic cancers, making it the second most common hematologic malignancy (Kyle RA et al., Blood.111(6):2962-2972 (2008); Ali SA et al., Blood.128(13):1688-1700 (2016)).

[0005] Over the past decade, the treatment landscape for multiple myeloma (MM) hasundergone significant changes. Despite these improvements, MM remains incurable, with patients often becoming refractory to existing treatments and progressing after multiple lines of therapy (Mateos MV et al., Leukemia.36(5):1371-1376 (2022)). Improved medical treatments are needed for the MM patients, more specifically those that are triple class exposed (Mateos MV et al., Leukemia.36(5):1371-1376 (2022)).Attorney Docket No.: JBI6924WOPCT1 SUMMARY

[0006] In one aspect, provided herein is a method of treating a multiple myeloma in a subject inneed thereof, the method comprising administering a therapeutically effective amount of an antibody or an antigen-binding fragment thereof specifically binding to GPRC5D, wherein the antibody or the antigen binding fragment thereof comprises: a heavy chain complementarity determining region 1 (CDR1), a heavy chain complementarity determining region 2 (CDR2), and a heavy chain complementarity determining region 3 (CDR3) comprising the amino acid sequences of SEQ ID NO: 6, 7, and 8, respectively; and a light chain complementarity determining region 1 (CDR1), a light chain complementarity determining region 2 (CDR2), and a light chain complementarity determining region 3 (CDR3) comprising the amino acid sequences of SEQ ID NO: 9, 10, and 11, respectively; a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprising the amino acid sequences of SEQ ID NO: 12, 13, and 8, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 9, 10, and 11, respectively; a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprising the amino acid sequences of SEQ ID NO: 14, 15, and 8, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 9, 10, and 11, respectively; a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprising the amino acid sequences of SEQ ID NO: 16, 17, and 18, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 19, 20, and 11, respectively; or a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprising the amino acid sequences of SEQ ID NO: 21, 22, and 23, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 24, 25, and 26, respectively.Attorney Docket No.: JBI6924WOPCT1

[0007] In some embodiments, the antibody or the antigen binding fragment thereof comprises aheavy chain variable region (VH) comprising an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1.

[0008] In some embodiments, the antibody or the antigen binding fragment thereof comprises aVH comprising SEQ ID NO: 1.

[0009] In some embodiments, the antibody or the antigen binding fragment thereof comprises alight chain variable region (VL) comprising an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2.

[0010] In some embodiments, the antibody or the antigen binding fragment thereof comprises aVL comprising SEQ ID NO: 2.

[0011] In some embodiments, the antibody or the antigen binding fragment thereof comprises aheavy chain variable region (VH) comprising SEQ ID NO: 1, and a light chain variable region (VL) comprising SEQ ID NO: 2.

[0012] In some embodiments, the antibody or the antigen-binding fragment thereof is an IgG.

[0013] In some embodiments, the antibody or the antigen-binding fragment thereof comprises anIgG1 isotype Fc region.

[0014] In some embodiments, the IgG1 isotype Fc region comprises K248E and T437R (RE)mutations as per the EU numbering system.

[0015] In some embodiments, the antibody or the antigen-binding fragment thereof isafucosylated.

[0016] In some embodiments, the antibody or the antigen-binding fragment thereof has enhancedantibody-dependent cellular cytotoxicity (ADCC) activity as compared with a fucosylated antibody or an antigen-binding fragment thereof.

[0017] In some embodiments, the antibody or the antigen-binding fragment thereof hasantibody-dependent cellular phagocytosis (ADCP) activity.

[0018] In some embodiments, the antibody or the antigen-binding fragment thereof comprisesone or more mutations which promote heterodimerization.

[0019] In some embodiments, the antibody or the antigen-binding fragment thereof furthercomprises knob-into-hole (KiH) mutations.

[0020] In some embodiments, the IgG1 isotype Fc region further comprises H435R and Y436Fmutations per the EU numbering system.Attorney Docket No.: JBI6924WOPCT1

[0021] In some embodiments, the antibody or the antigen binding fragment thereof is amonovalent antibody or an antigen binding fragment thereof.

[0022] In some embodiments, the monovalent antibody or the antigen-binding fragment thereofhas enhanced antibody-dependent cellular cytotoxicity (ADCC) activity and enhanced complement-dependent cytotoxicity (CDC) as compared with a fucosylated divalent antibody or an antigen-binding fragment thereof withoutK248Eand T437R (RE) mutations.

[0023] In some embodiments, the monovalent antibody or the antigen-binding fragment thereofcomprises an Fc domain and a Fab.

[0024] In some embodiments, the monovalent antibody or the antigen binding fragment thereofcomprises: a. a heavy chain complementarity determining region 1 (CDR1), a heavy chaincomplementarity determining region 2 (CDR2), and a heavy chain complementarity determining region 3 (CDR3) comprising the amino acid sequences of SEQ ID NO: 6, 7, and 8, respectively; and a light chain complementarity determining region 1 (CDR1), a light chain complementarity determining region 2 (CDR2), and a light chain complementarity determining region 3 (CDR3) comprising the amino acid sequences of SEQ ID NO: 9, 10, and 11, respectively; b. a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprisingthe amino acid sequences of SEQ ID NO: 12, 13, and 8, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 9, 10, and 11, respectively; c. a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprisingthe amino acid sequences of SEQ ID NO: 14, 15, and 8, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 9, 10, and 11, respectively; d. a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprisingthe amino acid sequences of SEQ ID NO: 16, 17, and 18, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 19, 20, and 11, respectively; orAttorney Docket No.: JBI6924WOPCT1 e. a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprisingthe amino acid sequences of SEQ ID NO: 21, 22, and 23, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 24, 25, and 26, respectively.

[0025] In some embodiments, the monovalent antibody or the antigen binding fragment thereofcomprises a heavy chain variable region (VH) comprising an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1.

[0026] In some embodiments, the monovalent antibody or the antigen binding fragment thereofcomprises a VH comprising SEQ ID NO: 1.

[0027] In some embodiments, the monovalent antibody or the antigen binding fragment thereofcomprises a light chain variable region (VL) comprising an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2.

[0028] In some embodiments, the monovalent antibody or the antigen binding fragment thereofcomprises a VL comprising SEQ ID NO: 2.

[0029] In some embodiments, the monovalent antibody or the antigen binding fragment thereofcomprises a heavy chain variable region (VH) comprising SEQ ID NO: 1, and a light chain variable region (VL) comprising SEQ ID NO: 2.

[0030] In some embodiments, the monovalent antibody or the antigen-binding fragment thereofcomprises a first heavy chain (HC1), a second heavy chain (HC2), and a second light chain (LC2).

[0031] In some embodiments, the HC1 of the monovalent antibody or the antigen bindingfragment thereof comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 3.

[0032] In some embodiments, the HC1 of the monovalent antibody or the antigen bindingfragment thereof comprises SEQ ID NO: 3.

[0033] In some embodiments, the HC2 of the monovalent antibody or the antigen bindingfragment thereof comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4.

[0034] In some embodiments, the HC2 of the monovalent antibody or the antigen bindingfragment thereof comprises SEQ ID NO: 4.Attorney Docket No.: JBI6924WOPCT1

[0035] In some embodiments, the LC2 of the monovalent antibody or the antigen bindingfragment thereof comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5.

[0036] In some embodiments, the LC2 of the monovalent antibody or the antigen bindingfragment thereof comprises SEQ ID NO: 5.

[0037] In one aspect, provided herein is a method of treating a multiple myeloma in a subject inneed thereof, the method comprising administering a therapeutically effective amount of a monovalent antibody or an antigen-binding fragment thereof specifically binding to GPRC5D, comprising a first heavy chain comprising SEQ ID NO: 3, a second heavy chain comprising SEQ ID NO: 4, and a second light chain comprising SEQ ID NO: 5.

[0038] In another aspect, provided herein is a method of treating a multiple myeloma in a subjectin need thereof, the method comprising administering a therapeutically effective amount of a pharmaceutical composition comprising the antibody, the monovalent antibody, or the antigen- binding fragment thereof of the present disclosure, and a pharmaceutically acceptable carrier.

[0039] In some embodiments, the multiple myeloma is characterized by the expression ofGPRC5D.

[0040] In some embodiments, the multiple myeloma is relapsed.

[0041] In some embodiments, the multiple myeloma is refractory.

[0042] In some embodiments, the antibody, the monovalent antibody, or the antigen bindingfragment thereof is administered to the subject as a monotherapy to treat the multiple myeloma.

[0043] In some embodiments, the subject is eighteen years of age or older.

[0044] In some embodiments, the subject has received at least one prior lines of therapy formultiple myeloma.

[0045] In some embodiments, the at least one prior line of therapy for multiple myelomacomprises one or more of: a proteasome inhibitor, an immunomodulatory agent and an anti- CD38 monoclonal antibody.

[0046] In some embodiments, prior to the administration of the antibody or the antigen-bindingfragment thereof specifically binding to GPRC5D, the subject has one or more of: a) a serum monoclonal paraprotein (M-protein) level >0.5 g / dL; b) a urine M-protein level >200 mg / 24 hours;Attorney Docket No.: JBI6924WOPCT1 c) a light chain multiple myeloma: serum immunoglobulin free light chain (FLC) >10 mg / dL and abnormal serum immunoglobulin kappa-lambda FLC ratio; d) hemoglobin ≥8 g / dL (≥5 mmol / L) without a red blood cell transfusion within 7 days of being tested; e) absolute neutrophil count ≥1×109 / L without use of granulocyte colony stimulating factor (G-CSF) within 7 days of being tested; or f) platelets ≥50×109 / L without transfusion support within 7 days of being tested.

[0047] In some embodiments, prior to the administration of the antibody or the antigen-bindingfragment thereof specifically binding to GPRC5D, the subject does not have: a) active plasma cell leukemia, Waldenström’s macroglobulinemia, polyneuropathy, organomegaly, endocrinopathy, M-protein, and skin changes syndrome (POEMS), or immunoglobulin light chain amyloidosis; b) non-hematologic toxicity from prior anticancer therapy that has not resolved to baseline level or to ≤Grade 1; c) known loss of expression of GPRC5D antigen; d) known allergies, hypersensitivity, or intolerance to excipients of the antibody, the monovalent antibody or the antigen-binding fragment thereof; or e) pulmonary compromise requiring supplemental oxygen used to maintain adequate oxygenation.

[0048] In some embodiments, the method results in no or minimal natural killer (NK) cellfratricide.

[0049] In some embodiments, the therapeutically effective amount of the antibody, themonovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of at least about 20 mg per dose administration.

[0050] In some embodiments, the therapeutically effective amount of the antibody, themonovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 20 mg to about 1700 mg per dose administration.

[0051] In some embodiments, the therapeutically effective amount of the antibody, themonovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose ranging from about 20 mg to about 1620 mg per dose administration.Attorney Docket No.: JBI6924WOPCT1

[0052] In some embodiments, the therapeutically effective amount of the antibody, themonovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 50 mg to about 1700 mg per dose administration.

[0053] In some embodiments, the therapeutically effective amount of the antibody, themonovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 100 mg to about 1700 mg per dose administration.

[0054] In some embodiments, the therapeutically effective amount of the antibody, themonovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 105 mg to about 250 mg per dose administration.

[0055] In some embodiments, the therapeutically effective amount of the antibody, themonovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 250 mg to about 1700 mg per dose administration.

[0056] In some embodiments, the therapeutically effective amount of the antibody, themonovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose ranging from about 350 mg to about 840 mg per dose administration.

[0057] In some embodiments, the therapeutically effective amount of the antibody, themonovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 500 mg to about 1700 mg per dose administration.

[0058] In some embodiments, the therapeutically effective amount of the antibody, themonovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 1000 mg to about 1700 mg per dose administration.

[0059] In some embodiments, the therapeutically effective amount of the antibody, themonovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 20 mg per dose administration.

[0060] In some embodiments, the therapeutically effective amount of the antibody, themonovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 60 mg per dose administration.

[0061] In some embodiments, the therapeutically effective amount of the antibody, themonovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 180 mg per dose administration.Attorney Docket No.: JBI6924WOPCT1

[0062] In some embodiments, the therapeutically effective amount of the antibody, themonovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 540 mg per dose administration.

[0063] In some embodiments, the therapeutically effective amount of the antibody, themonovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 1620 mg per dose administration.

[0064] In some embodiments, the therapeutically effective amount of the antibody, themonovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose ranging from about 5 mg / kg to about 12 mg / kg per dose administration.

[0065] In some embodiments, the antibody, the monovalent antibody, or the antigen-bindingfragment thereof is administered subcutaneously.

[0066] In some embodiments, the antibody, the monovalent antibody, or the antigen-bindingfragment thereof is administered at a frequency ranging from once every three weeks to once every week.

[0067] In some embodiments, the antibody, the monovalent antibody, or the antigen-bindingfragment thereof is administered at a frequency of once every three weeks.

[0068] In some embodiments, the antibody, the monovalent antibody, or the antigen-bindingfragment thereof is administered at a frequency of once every two weeks.

[0069] In some embodiments, the antibody, the monovalent antibody, or the antigen-bindingfragment thereof is administered at a frequency of once every week.

[0070] In some embodiments, the antibody, the monovalent antibody, or the antigen-bindingfragment thereof is administered until remission of multiple myeloma is achieved in a subject.

[0071] In some embodiments, the method achieves a partial response (PR), very good partialresponse (VGPR), complete response (CR) or stringent complete response (sCR) in the subject, according to International Myeloma Working Group (IMWG) criteria.

[0072] In some embodiments, the method achieves a very good partial response (VGPR),complete response (CR) or stringent complete response (sCR) in the subject, according to International Myeloma Working Group (IMWG) criteria.

[0073] In some embodiments, the method achieves a complete response (CR) or stringentcomplete response (sCR) in the subject, according to International Myeloma Working Group (IMWG) criteria.Attorney Docket No.: JBI6924WOPCT1

[0074] In some embodiments, the method achieves a stringent complete response (sCR) in thesubject, according to International Myeloma Working Group (IMWG) criteria.

[0075] In some embodiments, the method does not induce a Treatment-Related toxicity in thesubject.

[0076] In some embodiments, the probability that the dose limiting toxicity (DLT) rate is of28%, or exceeds 28% in a cohort of at least 20 subjects is lower than 95%.

[0077] In some embodiments, the cancer is significantly reduced in the subject.

[0078] In some embodiments, the method increases the overall response rate (ORR).

[0079] In some embodiments, the ORR includes the proportion of patients whose tumor issignificantly reduced or is destroyed in a cohort of at least 20 patients, compared to a prior line of therapy.

[0080] In some embodiments, the treatment increases the progression free survival (PFS) in thesubject, particularly compared to a prior line of therapy.

[0081] In some embodiments, the treatment increases the duration of response (DoR).

[0082] In some embodiments, the DoR is the length of time that a tumor continues to respond totreatment without the cancer growing or spreading in the subject, particularly compared to a prior line of therapy.

[0083] In some embodiments, the prior line of therapy comprises one or more of: anadministration of a proteasome inhibitor, an immunomodulatory agent, and / or an anti-CD38 therapy.

[0084] In some embodiments, the method comprises the administration of a prior orconcomitant therapy.

[0085] In some embodiments, the prior or concomitant therapy comprises a glucocorticoid, anantihistamine, an antipyretic, a H2-antagonist, and / or an anti-emetic.

[0086] In some embodiments, the multiple myeloma is a relapsed and / or refractory multiplemyeloma.

[0087] In some embodiments, the subject is a human subject.

[0088] In one aspect, provided herein is an antibody or antigen-binding fragment thereofspecifically binding to GPRC5D, as defined in some embodiments, for use in the method of any of the some embodiments.Attorney Docket No.: JBI6924WOPCT1 BRIEF DESCRIPTION OF THE FIGURES

[0089] FIG. 1 illustrates a monovalent antibody targeting GPRC5D with an enhanced effectorfunction. Fab, fragment antigen-binding; Fc, fragment crystallizable; GPRC5D, G-protein coupled receptor Family^C Group^5 Member^D; CDC-enhancing mutations, K248E and T437R; RF, H435R and Y436F.

[0090] FIG. 2 shows the impact of valency, CDC-enhancing mutations, and afucoslyation onCDC.

[0091] FIG. 3 shows the CDC screening results of human anti-GPRC5D antibodies. MM.1Rcells were incubated with human anti-GPRC5D antibodies in the presence of human serum for 24 hours. Cell viability was determined using CellTiter-Glo®. Data represent mean ± SEM, 3 technical replicates.

[0092] FIG. 4 depicts the CDC screening results of rat anti-GPRC5D antibodies. MM.1R cellswere incubated with rat anti-GPRC5D antibodies in the presence of human serum for 24 hours and cell viability was determined using CellTiter-Glo®. Data represent mean ± SEM, 3 technical replicates.

[0093] FIG. 5 shows the CDC screening results of humanized anti-GPRC5D antibodies.MM.1R cells were incubated with humanized anti-GPRC5D antibodies in the presence of human serum for 24 hours and cell viability was determined using CellTiter-Glo®. Data represent mean ± SEM, 3 technical replicates. Data represent mean ± SEM, 3 technical replicates.

[0094] FIG. 6 shows the CDC screening results of human biparatopic anti-GPRC5D antibodies.MM.1R cells were incubated with bivalent biparatopic anti-GPRC5D antibodies in the presence of human serum for 24 hours and cell viability was determined using CellTiter-Glo®. Data represent mean ± SEM, 3 technical replicates. Data represent mean ± SEM, 3 technical replicates.

[0095] FIG. 7 illustrates the CDC screening results depicting the variants of human anti-GPRC5D antibodies derived from GP5B66 and GP5B82 clones. MM.1R cells were incubated with various bivalent and bivalent monospecific anti-GPRC5D antibodies with CDC-enhancing mutations and afucosylated (AFU) in the presence of human serum for 24 hours and cell viability was determined using CellTiter-Glo®. Data represent mean ± SEM, 3 technical replicates. Data represent mean ± SEM, 3 technical replicates.Attorney Docket No.: JBI6924WOPCT1

[0096] FIG. 8 presents the ADCC screening results of human anti-GPRC5D antibodies. MM.1Rcells were incubated with a set of 4 monovalent anti-GPRC5D antibodies and primary healthy donor peripheral NK cells at an effector to target ratio of 5:1 for 48 hours. Using flow cytometry, ADCC activity was compared to bivalent positive control antibody, GC5B1231 and negative control isotypes, B23B259 (bivalent) and B23B293.001 (monovalent). Data represent mean ± SEM, n=2 NK donors.

[0097] FIG. 9 presents the ADCC screening results of rat anti-GPRC5D antibodies. MM.1Rcells were incubated with monovalent rat anti-GPRC5D antibodies and primary healthy donor peripheral NK cells at an effector to target ratio of 5:1 for 48 hours, using flow cytometry with negative control isotypes, B23B259 (bivalent) and B23B293.001 (monovalent). Data represent mean ± SEM, n=2 NK donors.

[0098] FIG. 10 shows the ADCC screening results of humanized anti-GPRC5D antibodiesderived from the previous rat anti-GPRC5D antibodies. MM.1R cells were incubated with monovalent humanized anti-GPRC5D antibodies and primary healthy donor peripheral NK cells at an effector to target ratio of 5:1 for 48 hours, using flow cytometry with the positive control monovalent anti-GPRC5D antibody, GC5B1552 and negative control isotype, and B23B293 (monovalent). Data represent mean ± SEM, n=2 NK donors.

[0099] FIG. 11 shows the ADCC screening results of human anti-GPRC5D antibody variantsderived from the GP5B66 clone. MM.1R cells were incubated with monovalent humanized anti- GPRC5D antibodies and primary healthy donor peripheral NK cells at an effector to target ratio of 5:1 for 48 hours, using flow cytometry with isotype control antibodies B23B293 (monovalent) and B23B259 (bivalent). Data represent mean ± SEM, n=2 NK donors.

[0100] FIG.12 shows the ADCC screening results of human anti-GPRC5D antibody variantsderived from the GP5B82 clone. MM.1R cells were incubated with monovalent (GC5B1552 and GC5B1509) and bivalent (GC5B776 and GC5B768) humanized anti-GPRC5D antibodies and primary healthy donor peripheral NK cells at an effector to target ratio of 5:1 for 48 hours, using flow cytometry with isotype control antibodies B23B293 (monovalent) and B23B259 (bivalent). Data represent mean ± SEM, n=2 NK donors.

[0101] FIG. 13A, FIG. 13B, FIG. 13C, and FIG. 13D depict the ADCP activity of anti-GPRC5Dantibody clone GC5B1552 against a panel of GPRC5D+cell lines. GC5B1552 and isotype control (B23B293) were added at various concentrations (0.005 to 300 nM) with CFSE-labeledAttorney Docket No.: JBI6924WOPCT1 target cells and primary healthy donor M1-macrophages cells (healthy donor CD14+human monocytes were differentiated for 6 days in rhM-CSF and then 1 day in rhIFN-γ; n=5 for H929 (FIG.13A) and MM.1R (FIG.13B); n=6 for H929 GPRC5D KO and H929 BCMA KO (FIG. 13D); 3:1 E:T ratio). After 2 hours, flow cytometry was used to identify CFSE-labeled target cells fluorescing in the FITC channel; macrophages were identified as CD11b+. Percent phagocytosis = ([phagocytosed target cells] / [phagocytosed target cells + non-phagocytosed target cells]) ×100. Mean ± SEM is shown.

[0102] FIG. 14A-E shows the effect of GC5B1552.AFU.001 on growth of disseminated OPM-2luc human MM xenografts in the absence or presence of NK-92.CD16 cells in mice. BLI, bioluminescence imaging; CD, cluster of differentiation; luc, luciferase; NK, natural killer; p, photons; SEM, standard error of the mean; sr, steradian. Disseminated OPM-2 luc tumors were imaged for bioluminescence (BLI) once weekly and the results presented as average radiance (p / s / cm² / sr) ± SEM (n=7-10 / group). FIG.14B and D depict graphs on logarithmic scale, FIG.14C and E on linear scale. Groups engrafted with NK- 92.CD16 cells are shown in FIG.14D and E, while groups that did not receive NK-92.CD16 cells are shown in FIG.14B and C. Tumor cells were implanted on Day 0 for all groups and NK- 92.CD16 cells were implanted on Days 13, 20, and 27 for half the groups. Treatment with GC5B1552.AFU.001 or B23B293.001 control antibodies is represented by line underneath X- axis. * Denotes significant difference of GC5B1552.AFU.001-treated groups on Day 53 (n≥7 / group) versus the control group. Dotted line represents naïve animal. Error bars may not be visible due to size of symbols.

[0103] FIG. 15 shows the effect of GC5B1552.AFU.001 on growth of MM.1S luc human MMxenografts in the absence or presence of NK-92.CD16 cells in mice. BLI, bioluminescence imaging; CD, cluster of differentiation; luc, luciferase; NK, natural killer; p, photons; SEM, standard error of the mean; sr, steradian. Disseminated MM.1S luc tumors were imaged for bioluminescence (BLI) twice weekly and the results presented as average radiance (p / s / cm² / sr) ± SEM (n=9-10 / group). FIG15B – E shows extended observations of tumor growth. FIG.15B and D depict graphs on logarithmic scale, FIG.15C and E on linear scale. Groups engrafted with NK-92.CD16 cells are shown in FIG.15D and E, while groups that did not receive NK-92.CD16 cells are shown in FIG.15B and C. Treatment with GC5B1552.AFU.001 or B23B293.001 control antibodies is represented by line underneath X-axis. * Denotes significant difference ofAttorney Docket No.: JBI6924WOPCT1 GC5B1552.AFU.001-treated groups on Day 28 (n ≥ 9 / group) versus the control group. Dotted line represents naïve animal. Error bars may not be visible due to size of symbols.

[0104] FIG. 16A, FIG. 16B, FIG.16C, FIG. 16D, FIG. 16E, and FIG. 16F illustrate the kineticcell binding of GPRC5D hits on H929 (FIG.16A, FIG.16C, and FIG.16E)) or MM.1R (FIG. 16B, FIG.16D, and FIG.16F) cells for 1, 3, 5, and 24hr at 37°C at 50 nM, 5 nM and 0.5 nM.

[0105] FIG. 17 presents individual serum GC5B1552.AFU concentration-time profiles followinga single IV dose of 0.5 mg / kg of GC5B1552.AFU in cynomolgus monkeys (Group 1).

[0106] FIG. 18 presents individual serum GC5B1509.AFU concentration-time profiles followinga single IV dose of 0.5 mg / kg of GC5B1509.AFU in cynomolgus monkeys (Group 2).

[0107] FIG. 19 shows mean (SD) serum GC5B1231.AFU concentrations-time profiles followinga single dose of GC5B1231.AFU in cynomolgus monkeys.

[0108] FIG. 20 presents individual serum GC5B1231.AFU concentrations-time profilesfollowing a single IV dose of 1 mg / kg of GC5B1231.AFU in Cynomolgus Monkeys (Group 1).

[0109] FIG. 21 presents individual serum GC5B1231.AFU concentrations-time profilesfollowing a single IV dose of 10 mg / kg of GC5B1231.AFU in cynomolgus monkeys (Group 2).

[0110] FIG. 22 presents individual serum GC5B1231.AFU concentrations-time profilesfollowing a single SC dose of 10 mg / kg of GC5B1231.AFU in cynomolgus monkeys (Group 3).

[0111] FIG. 23 presents GC5B1552.AFU eEF mechanisms of action. ADCC, antibody-dependent cellular cytotoxicity; ADCP, antibody-dependent cellular phagocytosis; CDC, complement-dependent cytotoxicity; GPRC5D, G-protein-coupled receptor Family C Group 5 Member D; MM, multiple myeloma; NK, natural killer.

[0112] FIG. 24 presents GC5B1552.AFU NK-mediated cytotoxicity of GPRC5D+ MM celllines. ADCC, antibody-dependent cellular cytotoxicity; CFSE, carboxyfluorescein; E:T, effector-to-target; GPRC5D, G-protein-coupled receptor family C group 5 member D; NK, natural killer; SEM, standard error of the mean. NK cells from healthy donors (n=5) were tested in an ADCC assay with the indicated cell lines and antibodies at an E:T ratio of 5:1 for 48 hours. Target cells were identified as live / dead with a CFSE cell stain. Data are averaged (single point per condition per donor) and means ± SEM are graphed.

[0113] FIG. 25 presents GC5B1552.AFU-mediated CDC activity of GPRC5D+ MM cell lines.CDC, complement-dependent cytotoxicity; GPRC5D; RLU, relative light units; SEM, standard error of the mean. Indicated cell lines were tested in CDC assays with GC5B1552.AFU andAttorney Docket No.: JBI6924WOPCT1 isotype control using 40% qualified pooled healthy donor human serum for 24 hours, MM.1R (n=6), JIM-3 (n=3) and AMO-1 (n=3). CellTiter-Glo®reagent was used to assess viability and expressed as percent viability, calculated as [RLU treated / RLU untreated]×100. Means±SEM are graphed.

[0114] FIG. 26 presents GC5B1552.AFU-mediated ADCP activity of GPRC5D+ MM cell lines.ADCP, antibody-dependent cellular phagocytosis; CD, cluster of differentiation; CFSE, carboxyfluorescein; E:T, effector-to-target; GPRC5D, G-protein coupled receptor Family C Group 5 Member D; MM, multiple myeloma; SEM, standard error of the mean. Healthy donor M1-macrophages differentiated from CD14+human monocytes (MM.1R; n=5; H929, n=5) were tested in ADCP assays with the indicated CFSE-labelled cell lines at a 3:1 E:T ratio for 2 hours in the presence of the indicated antibodies. Target cell phagocytosis was calculated as: ([phagocytosed target cells] / [phagocytosed target cells + non-phagocytosed target cells]) ×100. Data are averaged (single point per condition per donor) and means ± SEM are graphed.

[0115] FIG. 27A and FIG. 27B present GC5B1552.AFU-mediated ADCC (27A) and CDC (27B)of MM BMMC CD138+plasma cells. ADCC, antibody-dependent cellular cytotoxicity; CDC, complement-dependent cellular cytotoxicity; BMMC, bone marrow mononuclear cells; CD, cluster of differentiation; MM, multiple myeloma. MM BMMCs (1×105cells / well) were tested in ADCC assays (5×104cells / well healthy donor NK cells; 24 hours) and CDC (40% qualified pooled normal human serum; 2 hours). Percent CD138 plasma cell depletion from ADCC and CDC assays were calculated as: (number of live CD138+ cells in the presence of antibody / number of live CD138+ cells in the presence of no antibody) ×100. A single point per condition per donor is graphed. A single point per condition per donor is graphed.

[0116] FIG. 28 presents the effect of GC5B1552.AFU on survival of OPM-2-luc disseminatedestablished xenograft tumors in the absence of NK-92.CD16 cells in mice. CD, cluster of differentiation; luc, luciferase; NK, natural killer; Tumor cells were implanted on Day 0 Treatment with GC5B1552.AFU or isotype control antibodies is represented by line underneath X axis. Error bars can not be visible due to size of symbols. *Denotes significant difference (p<0.05) in survival of GC5B1552.AFU-treated groups versus the respective control group.

[0117] FIG. 29A and FIG. 29B present the effect of GC5B1552.AFU on survival of MM.1S-lucdisseminated established xenograft tumors without or with NK-92.CD16 cell engraftment, respectively, in mice. CD, cluster of differentiation; IV, intravenous; luc, luciferase; NK, naturalAttorney Docket No.: JBI6924WOPCT1 killer; Tumor cells were implanted on Day 0 and NK-92.CD16 cells were implanted IV on Days 13, 20, and 37 in half of the mice. Treatment with GC5B1552.AFU or isotype control antibodies is represented by line underneath X axis. * Denotes significant difference (p<0.05) in survival of GC5B1552.AFU-treated groups versus the respective control group.

[0118] FIG. 30A and FIG. 30B present effect of GC5B1552.AFU on body weight of micebearing MM.1S-luc disseminated established xenografts in the absence or presence of NK- 92.CD16 cells (Study ONC2022-032). CD, cluster of differentiation; luc, luciferase; NK, natural killer; SEM, standard error of the mean. Group body weights are graphed as mean ± SEM (n=10 / group). Tumor cells were implanted on Day 0. NK-92.CD16 cells were implanted on Days 3, 10, and 17 (FIG.30B). Treatment with GC5B1552.AFU or isotype control antibodies was on Days 4, 11, and 18 (represented by line underneath X-axis) in animals with (FIG.30B) or without (FIG.30A) engrafted NK-92.CD16 cells. Data are displayed while at least two thirds of the animals remained in the group.

[0119] FIG. 31A and FIG. 31B present the effect of GC5B1552.AFU on body weight of micebearing OPM-2-luc disseminated established xenografts in the presence or absence of NK- 92.CD16 cells (Study ONC2022-134). CD, cluster of differentiation; NK, natural killer; SEM, standard error of the mean. Group body weights are graphed as mean ± SEM (n=10 / group). Tumor cells were implanted on Day 0. NK-92.CD16 cells were implanted on Days 13, 20, and 27 (FIG.31B). Treatment with GC5B1552.AFU or isotype control antibodies was on Days 14, 18, 21, 25, 28, 32, 36, 39, 42, 46, 49 (represented by line underneath X-axis) in animals with (FIG.31B) or without (FIG.31A) engrafted NK-92.CD16 cells. Data are displayed while at least two thirds of the animals remained in the group.

[0120] FIG. 32 presents the effect of GC5B1552.AFU on MM.1S-luc disseminated establishedxenograft tumor burden in the presence or absence of NK-92.CD16 cells in mice (Study ONC2022-032). CD, cluster of differentiation; luc, luciferase; Max, maximum; Min, minimum; NK, natural killer; p, photons; sr, steradian. Representative dorsal bioluminescence images from 1-5 mice per group on indicated study days. Tumor cells were implanted on Day 0 for all groups and NK-92.CD16 cells were implanted on Days 3, 10, and 17 for half the groups. Treatment with GC5B1552.AFU or isotype control antibodies was on Days 4, 11, and 18.

[0121] FIG. 33 presents the effect of GC5B1552.AFU on growth of OPM-2-luc Disseminatedestablished xenograft tumor burden in the presence or absence of NK-92.CD16 cells in miceAttorney Docket No.: JBI6924WOPCT1 (Study ONC2022-134). CD, cluster of differentiation; luc, luciferase; Max, maximum; Min, minimum; NK, natural killer; p, photons; sr, steradian. Representative dorsal bioluminescence images from 5 mice per group over time. Tumor cells were implanted on Day 0 for all groups and NK-92.CD16 cells were implanted on Days 13, 20, and 27 for half the groups. Treatment with GC5B1552.AFU or isotype control antibodies was on Days 14, 18, 21, 25, 28, 32, 36, 39, 42, 46, 49.

[0122] FIG. 34 presents the effect of GC5B1552.AFU on the elimination of OPM-2-luc tumorburden in the presence of NK-92.CD16 cells in mice (Study ONC2022-134). CD, cluster of differentiation; luc, luciferase; Max, maximum; Min, minimum; NK, natural killer; p, photons; sr, steradian. Ventral and dorsal bioluminescence images from all mice per group on Day 53 set at a threshold of 600 counts. Tumor cells were implanted on Day 0 and NK-92.CD16 cells were implanted on Days 13, 20, and 27 for all groups. Treatment with GC5B1552.AFU or isotype control antibodies was on Days 14, 18, 21, 25, 28, 32, 36, 39, 42, 46, 49. Complete responses (represented by circles around mice) have no detectable tumor (<600 counts) on ventral and dorsal images.

[0123] FIG. 35 presents PK exposure of GC5B1552.AFU in whole blood of MM.1S-luc tumor-bearing mice in the absence or presence of NK-92.CD16 cells (Study ONC2022-032). PK, pharmacokinetic; SEM, standard error of the mean. Drug concentrations are graphed as the mean ± SEM (n=5 per group and per time point). MM.1S-luc tumor cells were implanted on Day 0, NK cells were implanted on Day 3, 10, and 17, and dosing occurred on Days 4, 11, and 18, (graphed as 0, 168, and 336 hours after the first dose). Whole blood samples were taken at 24, and 168 hours post first dose and third dose (graphed as 24, 168, 360, and 504 hours after the first dose). The 168-, and 504-hour time points were trough concentrations (indicated by arrows) from blood collected pre-dose on those days. Dotted line on graph represents detection limit.

[0124] FIG. 36 presents PK exposure of GC5B1552.AFU in whole blood of OPM-2-luc tumor-bearing mice in the absence or presence of NK-92.CD16 cells (Study ONC2022-134). PK, pharmacokinetic; SEM, standard error of the mean. Drug concentrations are graphed as the mean ± SEM (n=5 per group and per time point). OPM-2-luc tumor cells were implanted on Day 0, NK cells were implanted on Day 13, 20, and 27, and dosing occurred on Days 14, 18, 21, 25, 28, 32, 36, 39, 42, 46, and 49 (graphed as 0, 96, 168, 264, 336, 432, 528, 600, 672, 768, and 840 hours after the first dose). Whole blood samples were taken at 24, and 96 hours post firstAttorney Docket No.: JBI6924WOPCT1 dose, 6th, and last dose (graphed as 24, 96, 456, 528, 864, and 936 hours after the first dose). The 96-, 528-, and 936-hour time points were trough concentrations (indicated by arrows) from blood collected pre-dose on those days. Dotted line on graph represents detection limit. DETAILED DESCRIPTION

[0125] The present disclosure relates to antibodies or antigen-binding fragments that specificallybind to GPRC5D, a critical target for multiple myeloma treatment. DEFINITIONS

[0126] Techniques and procedures described or referenced herein include those that aregenerally well understood and / or commonly employed using conventional methodology by those skilled in the art, such as, for example, the widely utilized methodologies described in Sambrook et al., Molecular Cloning: A Laboratory Manual (3d ed.2001); Current Protocols in Molecular Biology (Ausubel et al. eds., 2003); Therapeutic Monoclonal Antibodies: From Bench to Clinic (An ed.2009); Monoclonal Antibodies: Methods and Protocols (Albitar ed.2010); and Antibody Engineering Vols 1 and 2 (Kontermann and Dübel eds., 2d ed.2010).

[0127] Unless otherwise defined herein, technical and scientific terms used in the presentdescription have the meanings that are commonly understood by those of ordinary skill in the art. For purposes of interpreting this specification, the following description of terms will apply and whenever appropriate, terms used in the singular will also include the plural and vice versa. In the event that any description of a term set forth conflicts with any document incorporated herein by reference, the description of the term set forth below shall control.

[0128] In an attempt to help the reader of the present application, the description has beenseparated in various paragraphs or sections. These separations are not considered as disconnecting the substance of a paragraph or section from the substance of another paragraph or section. To the contrary, the present description encompasses all the combinations of the various sections, paragraphs and sentences that can be contemplated.

[0129] The terms “polypeptide” and “peptide” and “protein” are used interchangeably herein andrefer to polymers of amino acids of any length. The polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; forAttorney Docket No.: JBI6924WOPCT1 example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid, including but not limited to, unnatural amino acids, as well as other modifications known in the art. It is understood that, because the polypeptides of this disclosure may be based upon antibodies or other members of the immunoglobulin superfamily, in certain embodiments, a “polypeptide” can occur as a single chain or as two or more associated chains.

[0130] The term “antibody,” “immunoglobulin,” or “Ig” is used interchangeably herein, and isused in the broadest sense and specifically covers, for example, monoclonal antibodies (including agonist, antagonist, neutralizing antibodies, full length or intact monoclonal antibodies), antibody compositions with polyepitopic or monoepitopic specificity, polyclonal or monovalent antibodies, multivalent antibodies, multispecific antibodies (e.g., bispecific antibodies so long as they exhibit the desired biological activity), formed from at least two intact antibodies, single chain antibodies, and fragments thereof (e.g., domain antibodies), as described below. An antibody can be human, humanized, chimeric and / or affinity matured, as well as an antibody from other species, for example, mouse, rabbit, llama, etc. The term “antibody” is intended to include a polypeptide product of B cells within the immunoglobulin class of polypeptides that is able to bind to a specific molecular antigen and is composed of two identical pairs of polypeptide chains, wherein each pair has one heavy chain (about 50-70 kDa) and one light chain (about 25 kDa), each amino-terminal portion of each chain includes a variable region of about 100 to about 130 or more amino acids, and each carboxy-terminal portion of each chain includes a constant region. See, e.g., Antibody Engineering (Borrebaeck ed., 2d ed.1995); and Kuby, Immunology (3d ed.1997). Antibodies also include, but are not limited to, synthetic antibodies, recombinantly produced antibodies, antibodies including from Camelidae species (e.g., llama or alpaca) or their humanized variants, intrabodies, anti-idiotypic (anti-Id) antibodies, and functional fragments (e.g., antigen binding fragments) of any of the above, which refers to a portion of an antibody heavy or light chain polypeptide that retains some or all of the binding activity of the antibody from which the fragment was derived. Non-limiting examples of functional fragments (e.g., antigen binding fragments) include single-chain Fvs (scFv) (e.g., including monospecific, bispecific, etc.), Fab fragments, F(ab’) fragments, F(ab)2fragments, F(ab’)2fragments, disulfide-linked Fvs (dsFv), Fd fragments, Fv fragments, diabody, triabody,Attorney Docket No.: JBI6924WOPCT1 tetrabody, and minibody. In particular, antibodies provided herein include immunoglobulin molecules and immunologically active portions of immunoglobulin molecules. The antibodies provided herein can be of any class (e.g., IgG, IgE, IgM, IgD, and IgA) or any subclass (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2) of immunoglobulin molecule. Antibodies may be agonistic antibodies or antagonistic antibodies.Antibodies may be neither agonistic nor antagonistic.

[0131] “Antigen-binding fragment” refers to a portion of the protein that binds an antigen.Antigen binding fragments may be synthetic, enzymatically obtainable or genetically engineered polypeptides and include portions of an immunoglobulin that bind an antigen, such as VH, the VL, the VH and the VL, Fab, Fab’, F(ab’)2, Fd and Fv fragments, domain antibodies (dAb) consisting of one VH domain or one VL domain, shark variable IgNAR domains, camelized VH domains, VHH domains, minimal recognition units consisting of the amino acid residues that mimic the CDRs of an antibody, such as FR3-CDR3-FR4 portions, the HCDR1, the HCDR2 and / or the HCDR3 and the LCDR1, the LCDR2 and / or the LCDR3, alternative scaffolds that bind an antigen, and multispecific proteins comprising the antigen binding fragments. Antigen binding fragments (such as VH and VL) may be linked together via a synthetic linker to form various types of single antibody designs where the VH / VL domains may pair intramolecularly, or intermolecularly in those cases when the VH and VL domains are expressed by separate single chains, to form a monovalent antigen binding domain, such as single chain Fv (scFv), stapled single chain Fv (spFv), or diabody. Antigen binding fragments may also be conjugated to other antibodies, proteins, antigen-binding fragments or alternative scaffolds which may be monospecific or multispecific to engineer bispecific and multispecific proteins.

[0132] An “antigen” is a structure to which an antibody can selectively bind. A target antigenmay be a polypeptide, carbohydrate, nucleic acid, lipid, hapten, or other naturally occurring or synthetic compound. In some embodiments, the target antigen is a polypeptide. In certain embodiments, an antigen is associated with a cell, for example, is present on or in a cell.

[0133] The terms “binds” or “binding” refer to an interaction between molecules including, forexample, to form a complex. Interactions can be, for example, non-covalent interactions including hydrogen bonds, ionic bonds, hydrophobic interactions, and / or van der Waals interactions. A complex can also include the binding of two or more molecules held together by covalent or non-covalent bonds, interactions, or forces. The strength of the total non-covalentAttorney Docket No.: JBI6924WOPCT1 interactions between a single antigen-binding site on an antibody and a single epitope of a target molecule, such as an antigen, is the affinity of the antibody or functional fragment for that epitope. The ratio of dissociation rate (koff) to association rate (kon) of a binding molecule (e.g., an antibody) to a monovalent antigen (koff / kon) is the dissociation constant KD, which is inversely related to affinity. The lower the KD value, the higher the affinity of the antibody. The value of KD varies for different complexes of antibody and antigen and depends on both kon and koff. The dissociation constant KDfor an antibody provided herein can be determined using any method provided herein or any other method well known to those skilled in the art. The affinity at one binding site does not always reflect the true strength of the interaction between an antibody and an antigen. When complex antigens containing multiple, repeating antigenic determinants, such as a polyvalent antigen, come in contact with antibodies containing multiple binding sites, the interaction of antibody with antigen at one site will increase the probability of a reaction at a second site. The strength of such multiple interactions between a multivalent antibody and antigen is called the avidity.

[0134] In some embodiments, the target antigen is GPRC5D (G protein-coupled receptor class Cgroup 5 member D). GPRC5D is a 7-transmembrane receptor protein that is classified as a Type C G-protein-coupled receptor based on the sequence homology score. GPRC5D is an orphan receptor whose ligand and signaling mechanisms are yet to be identified (Atamaniuk et al., Eur J Clin Invest.42(9):953-960 (2012); Smithet al., Sci Transl Med.11(485):eaau7746 (2019); Pillarisetti et al., Blood 135(15):1232-1243 (2020)). The GPRC5D receptor is a 354 amino acid protein with a short 27 amino acid N-terminus unlike other family members (Brauner-Osbourne et al., Biochim Biophys Acta.1518(3):237-248(2001)). In normal tissues, GPRC5D protein expression has been demonstrated on a subset of normal plasma cells (in lymphoid organs and in interstitial and tissue-resident plasma cells), and in other normal tissues such as the epithelial cells of hair follicles and eccrine sweat glands in skin and filiform papillae (keratinized structures) of the tongue (Pillarisetti et al., Blood 135(15):1232-1243 (2020); Goldsmith et al., Clinical Lymphoma Myeloma and Leukemia.21(2):P91 (2021); Verkleij et al., Blood Adv. 5(8):2196-2215 (2021)). GPRC5D mRNA is predominantly expressed in cells with a plasma cell phenotype and is also expressed in all malignant plasma cells from subjects with MM (Atamaniuk et al., Eur J Clin Invest.42(9):953-960 (2012); Frigyesi et al., Blood.123(9):1336- 1340 (2014); Kodama et al., Mol Cancer Ther.18(9):1555-1564(2019)). It is found at highAttorney Docket No.: JBI6924WOPCT1 expression levels in malignant plasma cells from patients with MM and is associated with poor prognosis (Verkleij et al., Blood Adv.5(8):2196-2215 (2021)). Levels of GPRC5D expression in patients with MM correlated well with plasma cell burden and genetic aberrations such as retinoblastoma 1 deletion (Atamaniuk et al., Eur J Clin Invest.42(9):953-960 (2012); Frigyesi et al., Blood.123(9):1336-1340 (2014); Verkleij et al., Blood Adv.5(8):2196-2215 (2021)). Currently, other treatment modalities targeting GPRC5D are being explored in MM patients, including cluster of differentiation (CD)3 bispecific antibodies and chimeric antigen receptor-T- cell therapies, and have led to approved therapies such as Talvey.

[0135] In connection with the antibodies or antigen-binding fragments described herein termssuch as “specifically binding to,” and analogous terms are also used interchangeably herein and refer to antibodies or antigen-binding fragments that specifically bind to an antigen, such as a polypeptide. Antibodies or antigen-binding fragments that binds to or specifically binds to an antigen can be identified, for example, by immunoassays, Octet®, Biacore®, or other techniques known to those of skill in the art. In some embodiments, antibodies or antigen-binding fragments binds to or specifically binds to an antigen when it binds to an antigen with higher affinity than to any cross-reactive antigen as determined using experimental techniques, such as radioimmunoassay (RIA) and enzyme linked immunosorbent assay (ELISA). Typically, a specific or selective reaction will be at least twice background signal or noise and may be more than 10 times background. See, e.g., Fundamental Immunology 332-36 (Paul ed., 2d ed.1989) for a discussion regarding binding specificity. In certain embodiments, the extent of binding of an antibody or antigen-binding fragment to a “non-target” protein is less than about 10% of the binding of the antibody or antigen-binding fragment to its particular target antigen, for example, as determined by fluorescence activated cell sorting (FACS) analysis or RIA. An antibody or antigen-binding fragment that binds to an antigen includes one that is capable of binding the antigen with sufficient affinity such that the antibody or antigen-binding fragment is useful, for example, as a therapeutic and / or diagnostic agent in targeting the antigen. In certain embodiments, an antibody or antigen-binding fragment that binds to an antigen has a dissociation constant (KD) of less than or equal to 1 μM, 800 nM, 600 nM, 550 nM, 500 nM, 300 nM, 250 nM, 100 nM, 50 nM, 10 nM, 5 nM, 4 nM, 3 nM, 2 nM, 1 nM, 0.9 nM, 0.8 nM, 0.7 nM, 0.6 nM, 0.5 nM, 0.4 nM, 0.3 nM, 0.2 nM, or 0.1 nM. In certain embodiments, an antibody or antigen-Attorney Docket No.: JBI6924WOPCT1 binding fragment binds to an epitope of an antigen that is conserved among the antigen from different species.

[0136] In certain embodiments, the antibodies or antigen-binding fragments can compriseportions of “humanized” forms of nonhuman (e.g., camelid, murine, non-human primate) antibodies that include sequences from human immunoglobulins (e.g., recipient antibody) in which the native CDR residues are replaced by residues from the corresponding CDR of a nonhuman species (e.g., donor antibody) such as camelid, mouse, rat, rabbit, or nonhuman primate having the desired specificity, affinity, and capacity. In some instances, one or more FR region residues of the human immunoglobulin sequences are replaced by corresponding nonhuman residues. Furthermore, humanized antibodies can comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance. A humanized antibody heavy or light chain can comprise substantially all of at least one or more variable regions, in which all or substantially all of the CDRs correspond to those of a nonhuman immunoglobulin and all or substantially all of the FRs are those of a human immunoglobulin sequence. In certain embodiments, the humanized antibody will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. For further details, see, Jones et al., Nature 321:522-25 (1986); Riechmann et al., Nature 332:323-29 (1988); Presta, Curr. Op. Struct. Biol.2:593-96 (1992); Carter et al., Proc. Natl. Acad. Sci. USA 89:4285-89 (1992); U.S. Pat. Nos: 6,800,738; 6,719,971; 6,639,055; 6,407,213; and 6,054,297.

[0137] In certain embodiments, the antibodies or antigen-binding fragments can compriseportions of a “fully human antibody” or “human antibody,” wherein the terms are used interchangeably herein and refer to an antibody that comprises a human variable region and, for example, a human constant region. In specific embodiments, the terms refer to an antibody that comprises a variable region and constant region of human origin. “Fully human” antibodies, in certain embodiments, can also encompass antibodies which bind polypeptides and are encoded by nucleic acid sequences which are naturally occurring somatic variants of human germline immunoglobulin nucleic acid sequence. The term “fully human antibody” includes antibodies having variable and constant regions corresponding to human germline immunoglobulin sequences as described by Kabat et al. (See Kabat et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIHAttorney Docket No.: JBI6924WOPCT1 Publication No.91-3242). A “human antibody” is one that possesses an amino acid sequence which corresponds to that of an antibody produced by a human and / or has been made using any of the techniques for making human antibodies. This definition of a human antibody specifically excludes a humanized antibody comprising non-human antigen-binding residues. Human antibodies can be produced using various techniques known in the art, including phage-display libraries (Hoogenboom and Winter, J. Mol. Biol.227:381 (1991); Marks et al., J. Mol. Biol. 222:581 (1991)) and yeast display libraries (Chao et al., Nature Protocols 1: 755-68 (2006)). Also available for the preparation of human monoclonal antibodies are methods described in Cole et al., Monoclonal Antibodies and Cancer Therapy 77 (1985); Boerner et al., J. Immunol. 147(1):86-95 (1991); and van Dijk and van de Winkel, Curr. Opin. Pharmacol.5: 368-74 (2001). Human antibodies can be prepared by administering the antigen to a transgenic animal that has been modified to produce such antibodies in response to antigenic challenge, but whose endogenous loci have been disabled, e.g., mice (see, e.g., Jakobovits, Curr. Opin. Biotechnol. 6(5):561-66 (1995); Brüggemann and Taussing, Curr. Opin. Biotechnol.8(4):455-58 (1997); and U.S. Pat. Nos.6,075,181 and 6,150,584 regarding XENOMOUSETMtechnology). See also, for example, Li et al., Proc. Natl. Acad. Sci. USA 103:3557-62 (2006) regarding human antibodies generated via a human B-cell hybridoma technology.

[0138] In certain embodiments, the antibodies or antigen-binding fragments can comprise aportion of a “monoclonal antibody,” wherein the term as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, e.g., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts or well-known post-translational modifications such as amino acid isomerization or deamidation, methionine oxidation or asparagine or glutamine deamidation, each monoclonal antibody will typically recognize a single epitope on the antigen. In specific embodiments, a “monoclonal antibody,” as used herein, is an antibody produced by a single hybridoma or other cell. The term “monoclonal” is not limited to any particular method for making the antibody. For example, the monoclonal antibodies useful in the present disclosure may be prepared by the hybridoma methodology first described by Kohler et al., Nature 256:495 (1975), or may be made using recombinant DNA methods in bacterial or eukaryotic animal or plant cells (see, e.g., U.S. Pat. No.4,816,567). The “monoclonal antibodies” may also be isolated from phage antibody libraries using the techniques described inAttorney Docket No.: JBI6924WOPCT1 Clackson et al., Nature 352:624-28 (1991) and Marks et al., J. Mol. Biol.222:581-97 (1991), for example. Other methods for the preparation of clonal cell lines and of monoclonal antibodies expressed thereby are well known in the art. See, e.g., Short Protocols in Molecular Biology (Ausubel et al. eds., 5th ed.2002).

[0139] A typical 4-chain antibody unit is a heterotetrameric glycoprotein composed of twoidentical light (L) chains and two identical heavy (H) chains. In the case of IgGs, the 4-chain unit is generally about 150,000 daltons. Each L chain is linked to an H chain by one covalent disulfide bond, while the two H chains are linked to each other by one or more disulfide bonds depending on the H chain isotype. Each H and L chain also has regularly spaced intrachain disulfide bridges. Each H chain has at the N-terminus, a variable domain (VH) followed by three constant domains (CH) for each of the α and γ chains and four CH domains for μ and ε isotypes. Each L chain has at the N-terminus, a variable domain (VL) followed by a constant domain (CL) at its other end. The VL is aligned with the VH, and the CL is aligned with the first constant domain of the heavy chain (CH1). Particular amino acid residues are believed to form an interface between the light chain and heavy chain variable domains. The pairing of a VH and VL together forms a single antigen-binding site. For the structure and properties of the differentclasses of antibodies, see, for example, Basic and Clinical Immunology 71 (Stites et al. eds., 8thed.1994); and Immunobiology (Janeway et al. eds., 5thed.2001).

[0140] The term “Fab” or “Fab region” refers to an antibody region that binds to antigens. Aconventional IgG usually comprises two Fab regions, each residing on one of the two arms of the Y-shaped IgG structure. Each Fab region is typically composed of one variable region and one constant region of each of the heavy and the light chain. More specifically, the variable region and the constant region of the heavy chain in a Fab region are VH and CH1 regions, and the variable region and the constant region of the light chain in a Fab region are VL and CL regions. The VH, CH1, VL, and CL in a Fab region can be arranged in various ways to confer an antigen binding capability according to the present disclosure. For example, VH and CH1 regions can be on one polypeptide, and VL and CL regions can be on a separate polypeptide, similarly to a Fab region of a conventional IgG. Alternatively, VH, CH1, VL and CL regions can all be on the same polypeptide and oriented in different orders as described in more detail the sections below.

[0141] The term “variable region,” “variable domain,” “V region,” or “V domain” refers to aportion of the light or heavy chains of an antibody that is generally located at the amino-terminalAttorney Docket No.: JBI6924WOPCT1 of the light or heavy chain and has a length of about 120 to 130 amino acids in the heavy chain and about 100 to 110 amino acids in the light chain, and are used in the binding and specificity of each particular antibody for its particular antigen. The variable region of the heavy chain may be referred to as “VH.” The variable region of the light chain may be referred to as “VL.” The term “variable” refers to the fact that certain segments of the variable regions differ extensively in sequence among antibodies. The V region mediates antigen binding and defines specificity of a particular antibody for its particular antigen. However, the variability is not evenly distributed across the 110-amino acid span of the variable regions. Instead, the V regions consist of less variable (e.g., relatively invariant) stretches called framework regions (FRs) of about 15-30 amino acids separated by shorter regions of greater variability (e.g., extreme variability) called “hypervariable regions” that are each about 9-12 amino acids long. The variable regions of heavy and light chains each comprise four FRs, largely adopting a β sheet configuration, connected by three hypervariable regions, which form loops connecting, and in some cases form part of, the β sheet structure. The hypervariable regions in each chain are held together in close proximity by the FRs and, with the hypervariable regions from the other chain, contribute to the formation of the antigen-binding site of antibodies (see, e.g., Kabat et al., Sequences of Proteins of Immunological Interest (5th ed.1991)). The constant regions are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody dependent cellular cytotoxicity (ADCC) and complement dependent cytotoxicity (CDC). The variable regions differ extensively in sequence between different antibodies. In specific embodiments, the variable region is a human variable region.

[0142] The term “heavy chain” when used in reference to an antibody refers to a polypeptidechain of about 50-70 kDa, wherein the amino-terminal portion includes a variable region of about 120 to 130 or more amino acids, and a carboxy-terminal portion includes a constant region. The constant region can be one of five distinct types, (e.g., isotypes) referred to as alpha (α), delta (δ), epsilon (ε), gamma (γ), and mu (µ), based on the amino acid sequence of the heavy chain constant region. The distinct heavy chains differ in size: α, δ, and γ contain approximately 450 amino acids, while µ and ε contain approximately 550 amino acids. When combined with a light chain, these distinct types of heavy chains give rise to five well known classes (e.g., isotypes) of antibodies, IgA, IgD, IgE, IgG, and IgM, respectively, including four subclasses of IgG, namely IgG1, IgG2, IgG3, and IgG4.Attorney Docket No.: JBI6924WOPCT1

[0143] The term “light chain” when used in reference to an antibody refers to a polypeptidechain of about 25 kDa, wherein the amino-terminal portion includes a variable region of about 100 to about 110 or more amino acids, and a carboxy-terminal portion includes a constant region. The approximate length of a light chain is 211 to 217 amino acids. There are two distinct types, referred to as kappa (κ) or lambda (λ) based on the amino acid sequence of the constant domains.

[0144] As used herein, the terms “hypervariable region,” “HVR,” “ComplementarityDetermining Region,” and “CDR” are used interchangeably. A “CDR” refers to one of three hypervariable regions (H1, H2 or H3) within the non-framework region of the immunoglobulin (Ig or antibody) VH β-sheet framework, or one of three hypervariable regions (L1, L2 or L3) within the non-framework region of the antibody VL β-sheet framework. CDR1, CDR2 and CDR3 in VH domain are also referred to as HCDR1, HCDR2 and HCDR3, respectively. CDR1, CDR2 and CDR3 in VL domain are also referred to as LCDR1, LCDR2 and LCDR3, respectively. Accordingly, CDRs are variable region sequences interspersed within the framework region sequences.

[0145] CDR regions are well known to those skilled in the art and have been defined by well-known numbering systems. For example, the Kabat Complementarity Determining Regions (CDRs) are based on sequence variability and are the most commonly used (see, e.g., Kabat et al., supra; Nick Deschacht et al., J Immunol 2010; 184:5696-5704). Chothia refers instead to the location of the structural loops (see, e.g., Chothia and Lesk, J. Mol. Biol.196:901-17 (1987)). The end of the Chothia CDR-H1 loop when numbered using the Kabat numbering convention varies between H32 and H34 depending on the length of the loop (this is because the Kabat numbering scheme places the insertions at H35A and H35B; if neither 35A nor 35B is present, the loop ends at 32; if only 35A is present, the loop ends at 33; if both 35A and 35B are present, the loop ends at 34). The AbM hypervariable regions represent a compromise between the Kabat CDRs and Chothia structural loops, and are used by Oxford Molecular’s AbM antibody modeling software (see, e.g., Antibody Engineering Vol.2 (Kontermann and Dübel eds., 2d ed. 2010)). The “contact” hypervariable regions are based on an analysis of the available complex crystal structures. Another universal numbering system that has been developed and widely adopted is ImMunoGeneTics (IMGT) Information System®(Lafranc et al., Dev. Comp. Immunol.27(1):55-77 (2003)). IMGT is an integrated information system specializing inAttorney Docket No.: JBI6924WOPCT1 immunoglobulins (IG), T-cell receptors (TCR), and major histocompatibility complex (MHC) of human and other vertebrates. Herein, the CDRs are referred to in terms of both the amino acid sequence and the location within the light or heavy chain. As the “location” of the CDRs within the structure of the immunoglobulin variable domain is conserved between species and present in structures called loops, by using numbering systems that align variable domain sequences according to structural features, CDR and framework residues are readily identified. This information can be used in grafting and replacement of CDR residues from immunoglobulins of one species into an acceptor framework from, typically, a human antibody. An additional numbering system (AHon) has been developed by Honegger and Plückthun, J. Mol. Biol.309: 657-70 (2001). Correspondence between the numbering system, including, for example, the Kabat numbering and the IMGT unique numbering system, is well known to one skilled in the art (see, e.g., Kabat, supra; Chothia and Lesk, supra; Martin, supra; Lefranc et al., supra). The residues from each of these hypervariable regions or CDRs are exemplified in Table 1 below. Table 1. Exemplary CDRs According to Various Numbering Systems Loop Kabat AbM Chothia Contact IMGT L26 L32

[0146] The boundaries of a given CDR may vary depending on the scheme used foridentification. Thus, unless otherwise specified, the terms “CDR” and “complementary determining region” of a given antibody or region thereof, such as a variable region, as well asAttorney Docket No.: JBI6924WOPCT1 individual CDRs (e.g., CDR-H1, CDR-H2) of the antibody or region thereof, should be understood to encompass the complementary determining region as defined by any of the known schemes described herein above. In some instances, the scheme for identification of a particular CDR or CDRs is specified, such as the CDR as defined by the IMGT, Kabat, Chothia, or Contact method. In other cases, the particular amino acid sequence of a CDR is given. It should be noted CDR regions may also be defined by a combination of various numbering systems, e.g., a combination of Kabat and Chothia numbering systems, or a combination of Kabat and IMGT numbering systems. Therefore, the term such as “a CDR1 as set forth in a specific VH” includes any CDR1 as defined by the exemplary CDR numbering systems described above, but is not limited thereby. Once a variable region (e.g., a VH or VL) is given, those skilled in the art would understand that CDRs within the region can be defined by different numbering systems or combinations thereof.

[0147] Hypervariable regions may comprise “extended hypervariable regions” as follows: 24-36or 24-34 (L1), 46-56 or 50-56 (L2), and 89-97 or 89-96 (L3) in the VL, and 26-35 or 26-35A (H1), 50-65 or 49-65 (H2), and 93-102, 94-102, or 95-102 (H3) in the VH.

[0148] The term “constant region” or “constant domain” refers to a carboxy terminal portion ofthe light and heavy chain which is not directly involved in binding of the antibody to antigen but exhibits various effector function, such as interaction with the Fc receptor. The term refers to the portion of an immunoglobulin molecule having a more conserved amino acid sequence relative to the other portion of the immunoglobulin, the variable region, which contains the antigen binding site. The constant region may contain the CH1, CH2, and CH3 regions of the heavy chain and the CL region of the light chain.

[0149] The term “framework” or “FR” refers to those variable region residues flanking theCDRs. FR residues are present, for example, in chimeric, humanized, human, domain antibodies, diabodies, linear antibodies, and bispecific antibodies. FR residues are those variable domain residues other than the hypervariable region residues or CDR residues.

[0150] The term “Fc region” herein is used to define a C-terminal region of an immunoglobulinheavy chain, including, for example, native sequence Fc regions, recombinant Fc regions, and variant Fc regions. Although the boundaries of the Fc region of an immunoglobulin heavy chain might vary, the human IgG heavy chain Fc region is often defined to stretch from an amino acid residue at position Cys226, or from Pro230, to the carboxyl-terminus thereof. The C-terminalAttorney Docket No.: JBI6924WOPCT1 lysine (residue 447 according to the EU numbering system) of the Fc region may be removed, for example, during production or purification of the antibody, or by recombinantly engineering the nucleic acid encoding a heavy chain of the antibody. Accordingly, a composition of intact antibodies may comprise antibody populations with all K447 residues removed, antibody populations with no K447 residues removed, and antibody populations having a mixture of antibodies with and without the K447 residue. A “functional Fc region” possesses an “effector function” of a native sequence Fc region. Exemplary “effector functions” include C1q binding; CDC; Fc receptor binding; ADCC; phagocytosis; downregulation of cell surface receptors (e.g., B cell receptor), etc. Such effector functions generally require the Fc region to be combined with a binding region or binding domain (e.g., an antibody variable region or domain) and can be assessed using various assays known to those skilled in the art. A “variant Fc region” comprises an amino acid sequence which differs from that of a native sequence Fc region by virtue of at least one amino acid modification (e.g., substituting, addition, or deletion). In certain embodiments, the variant Fc region has at least one amino acid substitution compared to a native sequence Fc region or to the Fc region of a parent polypeptide, for example, from about one to about ten amino acid substitutions, or from about one to about five amino acid substitutions in a native sequence Fc region or in the Fc region of a parent polypeptide. The variant Fc region herein can possess at least about 80% homology with a native sequence Fc region and / or with an Fc region of a parent polypeptide, or at least about 90% homology therewith, for example, at least about 95% homology therewith.

[0151] The term “variant” when used in relation to an antigen or an antibody may refer to apeptide or polypeptide comprising one or more (such as, for example, about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, or about 1 to about 5) amino acid sequence substitutions, deletions, and / or additions as compared to a native or unmodified sequence. For example, a variant of an anti-GPRC5D antibody may result from one or more (such as, for example, about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, or about 1 to about 5) changes to an amino acid sequence of a native or previously unmodified anti-GPRC5D antibody. Variants may be naturally occurring, such as allelic or splice variants, or may be artificially constructed. Polypeptide variants may be prepared from the corresponding nucleic acid molecules encoding the variants. In specific embodiments, the anti- GPRC5D antibody variant at least retains anti- GPRC5D antibody functional activity,Attorney Docket No.: JBI6924WOPCT1 respectively. In specific embodiments, an anti- GPRC5D antibody variant binds GPRC5D. In certain embodiments, the variant is encoded by a single nucleotide polymorphism (SNP) variant of a nucleic acid molecule that encodes anti- GPRC5D antibody VH or VL regions or subregions, such as one or more CDRs.

[0152] The term “identity” refers to a relationship between the sequences of two or morepolypeptide molecules or two or more nucleic acid molecules, as determined by aligning and comparing the sequences. “Percent (%) amino acid sequence identity” with respect to a reference polypeptide sequence is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the reference polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, or MEGALIGN (DNAStar, Inc.) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

[0153] The meaning of “substantially the same” can differ depending on the context in which theterm is used. Because of the natural sequence variation likely to exist among heavy and light chains and the genes encoding them, one would expect to find some level of variation within the amino acid sequences or the genes encoding the antibodies or antigen-binding fragments described herein, with little or no impact on their unique binding properties (e.g., specificity and affinity). Such an expectation is due in part to the degeneracy of the genetic code, as well as to the evolutionary success of conservative amino acid sequence variations, which do not appreciably alter the nature of the encoded protein. Accordingly, in the context of nucleic acid sequences, “substantially the same” means at least 65% identity between two or more sequences. Preferably, the term refers to at least 70% identity between two or more sequences, more preferably at least 75% identity, more preferably at least 80% identity, more preferably at least 85% identity, more preferably at least 90% identity, more preferably at least 91% identity, more preferably at least 92% identity, more preferably at least 93% identity, more preferably at least 94% identity, more preferably at least 95% identity, more preferably at least 96% identity, moreAttorney Docket No.: JBI6924WOPCT1 preferably at least 97% identity, more preferably at least 98% identity, and more preferably at least 99% or greater identity. The percent identity between two sequences is a function of the number of identical positions shared by the sequences (i.e., % homology = # of identical positions / total # of positions x 100), taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. The percent identity between two nucleotide or amino acid sequences may e.g. be determined using the algorithm of E. Meyers and W. Miller, Comput. Appl. Biosci 4, 11-17 (1988) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. In addition, the percent identity between two amino acid sequences may be determined using the Needleman and Wunsch, J. Mol. Biol.48, 444-453 (1970) algorithm.

[0154] The degree of variation that may occur within the amino acid sequence of a proteinwithout having a substantial effect on protein function is much lower than that of a nucleic acid sequence, since the same degeneracy principles do not apply to amino acid sequences. Accordingly, in the context of an antibody or antigen-binding fragment, “substantially the same” means antibodies or antigen-binding fragments having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the antibodies or antigen-binding fragments described. Other embodiments include GPRC5D specific antibodies, or antigen-binding fragments, that have framework, scaffold, or other non-binding regions that do not share significant identity with the antibodies and antigen-binding fragments described herein, but do incorporate one or more CDRs or other sequences needed to confer binding that are 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to such sequences described herein. A “vector” is a replicon, such as plasmid, phage, cosmid, or virus in which another nucleic acid segment may be operably inserted so as to bring about the replication or expression of the segment.

[0155] The term “valent” as used herein denotes the presence of a specified number of bindingsites in an antigen binding protein. A natural antibody, for example, or a full length antibody has two binding sites and is bivalent. As such, the terms “monovalent,” “trivalent,” “tetravalent,” “pentavalent” and “hexavalent” denote the presence of one binding site, two binding site, three binding sites, four binding sites, five binding sites, and six binding sites, respectively, in an antibody)Attorney Docket No.: JBI6924WOPCT1

[0156] “Polynucleotide” or “nucleic acid,” as used interchangeably herein, refers to polymers ofnucleotides of any length and includes DNA and RNA. The nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and / or their analogs, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase or by a synthetic reaction. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and their analogs. “Oligonucleotide,” as used herein, refers to short, generally single-stranded, synthetic polynucleotides that are generally, but not necessarily, fewer than about 200 nucleotides in length. The terms “oligonucleotide” and “polynucleotide” are not mutually exclusive. The description above for polynucleotides is equally and fully applicable to oligonucleotides. A cell that produces a binding molecule of the present disclosure may include a parent hybridoma cell, as well as bacterial and eukaryotic host cells into which nucleic acids encoding the antibodies have been introduced. Unless specified otherwise, the left-hand end of any single-stranded polynucleotide sequence disclosed herein is the 5’ end; the left-hand direction of double-stranded polynucleotide sequences is referred to as the 5’ direction. The direction of 5’ to 3’ addition of nascent RNA transcripts is referred to as the transcription direction; sequence regions on the DNA strand having the same sequence as the RNA transcript that are 5’ to the 5’ end of the RNA transcript are referred to as “upstream sequences”; sequence regions on the DNA strand having the same sequence as the RNA transcript that are 3’ to the 3’ end of the RNA transcript are referred to as “downstream sequences.”

[0157] Unless otherwise specified, a “polynucleotide sequence encoding an amino acidsequence” includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase polynucleotide sequence that encodes a protein or an RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some versions contain an intron(s).

[0158] The term “vector” refers to a substance that is used to carry or include a nucleic acidsequence, including for example, a nucleic acid sequence encoding an antibody or antigen- binding fragment as described herein, in order to introduce a nucleic acid sequence into a host cell. Vectors applicable for use include, for example, expression vectors, plasmids, phage vectors, viral vectors, episomes, and artificial chromosomes, which can include selection sequences or markers operable for stable integration into a host cell’s chromosome. Additionally, the vectors can include one or more selectable marker genes and appropriateAttorney Docket No.: JBI6924WOPCT1 expression control sequences. Selectable marker genes that can be included, for example, provide resistance to antibiotics or toxins, complement auxotrophic deficiencies, or supply critical nutrients not in the culture media. Expression control sequences can include constitutive and inducible promoters, transcription enhancers, transcription terminators, and the like, which are well known in the art. When two or more nucleic acid molecules are to be co-expressed (e.g., both an antibody heavy and light chain or an antibody VH and VL), both nucleic acid molecules can be inserted, for example, into a single expression vector or in separate expression vectors. For single vector expression, the encoding nucleic acids can be operationally linked to one common expression control sequence or linked to different expression control sequences, such as one inducible promoter and one constitutive promoter. The introduction of nucleic acid molecules into a host cell can be confirmed using methods well known in the art. Such methods include, for example, nucleic acid analysis such as Northern blots or polymerase chain reaction (PCR) amplification of mRNA, immunoblotting for expression of gene products, or other suitable analytical methods to test the expression of an introduced nucleic acid sequence or its corresponding gene product. It is understood by those skilled in the art that the nucleic acid molecules are expressed in a sufficient amount to produce a desired product and it is further understood that expression levels can be optimized to obtain sufficient expression using methods well known in the art.

[0159] The term “host” as used herein refers to an animal, such as a mammal (e.g., a human).

[0160] The term “host cell” as used herein refers to a particular subject cell that may betransfected with a nucleic acid molecule and the progeny or potential progeny of such a cell. Progeny of such a cell may not be identical to the parent cell transfected with the nucleic acid molecule due to mutations or environmental influences that may occur in succeeding generations or integration of the nucleic acid molecule into the host cell genome.

[0161] The term “transfected” or “transformed” or “transduced” as used herein refers to aprocess by which exogenous nucleic acid is transferred or introduced into the host cell. A “transfected” or “transformed” or “transduced” cell is one which has been transfected, transformed or transduced with exogenous nucleic acid. The cell includes the primary subject cell and its progeny.

[0162] The term “pharmaceutically acceptable” as used herein means being approved by aregulatory agency of the Federal or a state government, or listed in United States Pharmacopeia,Attorney Docket No.: JBI6924WOPCT1 European Pharmacopeia, or other generally recognized Pharmacopeia for use in animals, and more particularly in humans.

[0163] “Excipient” means a pharmaceutically acceptable material, composition, or vehicle, suchas a liquid or solid filler, diluent, solvent, or encapsulating material. The term “excipient” can also refer to a diluent, adjuvant (e.g., Freunds’ adjuvant (complete or incomplete) or vehicle.

[0164] In some embodiments, excipients are pharmaceutically acceptable excipients.

[0165] In one embodiment, each component is “pharmaceutically acceptable” in the sense ofbeing compatible with the other ingredients of a pharmaceutical formulation, and suitable for use in contact with the tissue or organ of humans and animals without excessive toxicity, irritation, allergic response, immunogenicity, or other problems or complications, commensurate with a reasonable benefit / risk ratio. See, e.g., Lippincott Williams & Wilkins: Philadelphia, PA, 2005; Handbook of Pharmaceutical Excipients, 6th ed.; Rowe et al., Eds.; The Pharmaceutical Press and the American Pharmaceutical Association: 2009; Handbook of Pharmaceutical Additives, 3rd ed.; Ash and Ash Eds.; Gower Publishing Company: 2007; Pharmaceutical Preformulation and Formulation, 2nd ed.; Gibson Ed.; CRC Press LLC: Boca Raton, FL, 2009. In some embodiments, pharmaceutically acceptable excipients are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed. In some embodiments, a pharmaceutically acceptable excipient is an aqueous pH buffered solution.

[0166] In some embodiments, excipients are sterile liquids.

[0167] The term “effective amount” or "therapeutically effective amount" of is any amount ofthe antibody or pharmaceutical composition described herein that, when used alone or in combination with another therapeutic agent, protects a subject against the onset of a disease or promotes disease regression evidenced by a decrease in severity of disease symptoms, an increase in frequency and duration of disease symptom-free periods, or a prevention of impairment or disability due to the disease affliction. The ability of a therapeutic agent to promote disease regression can be evaluated using a variety of methods known to the skilled practitioner, such as in human subjects during clinical trials, in animal model systems, or by assaying the activity of the agent in in vitro assays.

[0168] The terms “subject” and “patient” may be used interchangeably. As used herein, incertain embodiments, a subject is a mammal, such as a non-primate or a primate (e.g., human). In specific embodiments, the subject is a human. In one embodiment, the subject is a mammal,Attorney Docket No.: JBI6924WOPCT1 e.g., a human, diagnosed with a disease or disorder. In another embodiment, the subject is a mammal, e.g., a human, at risk of developing a disease or disorder.

[0169] “Administer” or “administration” refers to the act of injecting or otherwise physicallydelivering a substance as it exists outside the body into a patient, such as by mucosal, intradermal, intravenous, intramuscular delivery, and / or any other method of physical delivery described herein or known in the art.

[0170] As used herein, the terms “treat,” “treatment” and “treating” refer to the reduction oramelioration of the progression, severity, and / or duration of a disease or condition resulting from the administration of one or more therapies. Treating may be determined by assessing whether there has been a decrease, alleviation and / or mitigation of one or more symptoms associated with the underlying disorder such that an improvement is observed with the patient, despite that the patient may still be afflicted with the underlying disorder. The term “treating” includes both managing and ameliorating the disease. The terms “manage,” “managing,” and “management” refer to the beneficial effects that a subject derives from a therapy which does not necessarily result in a cure of the disease.

[0171] As used herein, the terms “G-protein coupled receptor family C group 5 member D” and“GPRC5D” specifically include the human GPRC5D protein, for example as described in GenBank Accession No. BC069341, NCBI Reference Sequence: NP_061124.1 and UniProtKB / Swiss-Prot Accession No. Q9NZD1 (see also Brauner-Osborne, H. et al.2001, Biochim. Biophys. Acta 1518, 237-248).

[0172] The terms “about” and “approximately” mean within 20%, within 15%, within 10%,within 9%, within 8%, within 7%, within 6%, within 5%, within 4%, within 3%, within 2%, within 1%, or less of a given value or range.

[0173] As used in the present disclosure and claims, the singular forms “a”, “an” and “the”include plural forms unless the context clearly dictates otherwise.

[0174] It is understood that wherever embodiments are described herein with the term“comprising” otherwise analogous embodiments described in terms of “consisting of” and / or “consisting essentially of” are also provided. It is also understood that wherever embodiments are described herein with the phrase “consisting essentially of” otherwise analogous embodiments described in terms of “consisting of” are also provided.Attorney Docket No.: JBI6924WOPCT1

[0175] The term “between” as used in a phrase as such “between A and B” or “between A-B”refers to a range including both A and B.

[0176] The term “and / or” as used in a phrase such as “A and / or B” herein is intended to includeboth A and B; A or B; A (alone); and B (alone). Likewise, the term “and / or” as used in a phrase such as “A, B, and / or C” is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone). GPRC5D ANTIBODIES AND ANTIGEN-BINDING FRAGMENTS

[0177] Described herein are antibodies or antigen-binding fragments specifically bindingGPRC5D. The general structure of an antibody molecule comprises an antigen binding domain, which includes heavy and light chains, and the Fc domain, which serves a variety of functions, including complement fixation and binding antibody receptors.

[0178] The described GPRC5D-specific antibodies or antigen-binding fragments include allisotypes, IgA, IgD, IgE, IgG and IgM, and synthetic multimers of the four-chain immunoglobulin structure. The described antibodies or antigen-binding fragments also include the IgY isotype generally found in hen or turkey serum and hen or turkey egg yolk.

[0179] The GPRC5D-specific antibodies and antigen-binding fragments may be derived fromany species by recombinant means. For example, the antibodies or antigen-binding fragments may be mouse, rat, goat, horse, swine, bovine, chicken, rabbit, camelid, donkey, human, or chimeric versions thereof. For use in administration to humans, non-human derived antibodies or antigen-binding fragments may be genetically or structurally altered to be less antigenic upon administration to a human patient.

[0180] In some embodiments, the antibodies or antigen-binding fragments are chimeric. As usedherein, the term “chimeric” refers to an antibody, or antigen-binding fragment thereof, having at least some portion of at least one variable domain derived from the antibody amino acid sequence of a non-human mammal, a rodent, or a reptile, while the remaining portions of the antibody, or antigen-binding fragment thereof, are derived from a human.

[0181] In some embodiments, the antibodies are humanized antibodies. Humanized antibodiesmay be chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv,Attorney Docket No.: JBI6924WOPCT1 Fab, Fab’, F(ab’)2 or other antigen-binding subsequences of antibodies) that contain minimal sequence derived from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a complementary- determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity, and capacity. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the framework regions are those of a human immunoglobulin sequence. The humanized antibody may include at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.

[0182] The antibodies or antigen-binding fragments described herein can occur in a variety offorms, but will include one or more of the antibody CDRs shown in Table 2. Table 2. List of CDR Regions for a representative GPRC5D antibody Numbering Format Chain CDR1 (SEQ ID NO) CDR2 (SEQ ID NO) CDR3 (SEQ ID NO) ) ) ) Y

[0183] Described herein are antibodies and antigen-binding fragments specifically binding toGPRC5D. In some embodiments, the GPRC5D-specific antibodies or antigen-binding fragments are human, humanized IgG, or derivatives thereof. While the GPRC5D-specific antibodies or antigen-binding fragments exemplified herein are human or humanized, the antibodies or antigen-binding fragments exemplified may be chimerized.Attorney Docket No.: JBI6924WOPCT1

[0184] In some embodiments are provided a GPRC5D-specific antibody, or an antigen-bindingfragment thereof, comprising a heavy chain comprising a CDR1, a CDR2, and a CDR3 of any one of the antibodies described in Table 2. In some embodiments are provided a GPRC5D- specific antibody, or an antigen-binding fragment thereof, comprising a heavy chain comprising a CDR1, a CDR2, and a CDR3 of any one of the antibodies described in Table 2 and a light chain comprising a CDR1, a CDR2, and a CDR3 of any one of the antibodies described in Table 2.

[0185] In some embodiments, the GPRC5D-specific antibodies and antigen-binding fragmentscomprise a heavy chain complementarity determining region 1 (CDR1), a heavy chain complementarity determining region 2 (CDR2), and a heavy chain complementarity determining region 3 (CDR3) comprising the amino acid sequences of SEQ ID NO: 6, 7, and 8, respectively, and a light chain complementarity determining region 1 (CDR1), a light chain complementarity determining region 2 (CDR2), and a light chain complementarity determining region 3 (LCDR3) comprising the amino acid sequences of SEQ ID NO: 9, 10, and 11, respectively. This GPRC5D -specific antibody or antigen-binding fragment may comprise human framework sequences. In some embodiments, the GPRC5D-specific antibodies and antigen-binding fragments comprise a heavy chain variable domain substantially the same as, or identical to, SEQ ID NO: 1 and a light chain variable domain substantially the same as, or identical to, SEQ ID NO: 2. In some embodiments, the GPRC5D-specific antibodies and antigen-binding fragments comprise a heavy chain substantially the same as, or identical to, SEQ ID NO: 3 and a light chain variable domain substantially the same as, or identical to, SEQ ID NO: 5. The CDRs, the heavy chain variable domain, light chain variable domain, the heavy chain, and the light chain of antibodies discussed in this paragraph are suitable for inclusion in multispecific constructs in which one arm is an anti-GPRC5D arm.

[0186] In some embodiments, the GPRC5D-specific antibodies and antigen-binding fragmentscomprise a heavy chain complementarity determining region 1 (CDR1), a heavy chain complementarity determining region 2 (CDR2), and a heavy chain complementarity determining region 3 (CDR3) comprising the amino acid sequences of SEQ ID NO: 12, 13, and 8, respectively, and a light chain complementarity determining region 1 (CDR1), a light chain complementarity determining region 2 (CDR2), and a light chain complementarity determining region 3 (LCDR3) comprising the amino acid sequences of SEQ ID NO: 9, 10, and 11,Attorney Docket No.: JBI6924WOPCT1 respectively. This GPRC5D -specific antibody or antigen-binding fragment may comprise human framework sequences. In some embodiments, the GPRC5D-specific antibodies and antigen-binding fragments comprise a heavy chain variable domain substantially the same as, or identical to, SEQ ID NO: 1 and a light chain variable domain substantially the same as, or identical to, SEQ ID NO: 2. In some embodiments, the GPRC5D-specific antibodies and antigen-binding fragments comprise a heavy chain substantially the same as, or identical to, SEQ ID NO: 3 and a light chain variable domain substantially the same as, or identical to, SEQ ID NO: 5. The CDRs, the heavy chain variable domain, light chain variable domain, the heavy chain, and the light chain of antibodies discussed in this paragraph are suitable for inclusion in multispecific constructs in which one arm is an anti-GPRC5D arm.

[0187] In some embodiments, the GPRC5D-specific antibodies and antigen-binding fragmentscomprise a heavy chain complementarity determining region 1 (CDR1), a heavy chain complementarity determining region 2 (CDR2), and a heavy chain complementarity determining region 3 (CDR3) comprising the amino acid sequences of SEQ ID NO: 14, 15, and 8, respectively, and a light chain complementarity determining region 1 (CDR1), a light chain complementarity determining region 2 (CDR2), and a light chain complementarity determining region 3 (LCDR3) comprising the amino acid sequences of SEQ ID NO: 9, 10, and 11, respectively. This GPRC5D -specific antibody or antigen-binding fragment may comprise human framework sequences. In some embodiments, the GPRC5D-specific antibodies and antigen-binding fragments comprise a heavy chain variable domain substantially the same as, or identical to, SEQ ID NO: 1 and a light chain variable domain substantially the same as, or identical to, SEQ ID NO: 2. In some embodiments, the GPRC5D-specific antibodies and antigen-binding fragments comprise a heavy chain substantially the same as, or identical to, SEQ ID NO: 3 and a light chain variable domain substantially the same as, or identical to, SEQ ID NO: 5. The CDRs, the heavy chain variable domain, light chain variable domain, the heavy chain, and the light chain of antibodies discussed in this paragraph are suitable for inclusion in multispecific constructs in which one arm is an anti-GPRC5D arm.

[0188] In some embodiments, the GPRC5D-specific antibodies and antigen-binding fragmentscomprise a heavy chain complementarity determining region 1 (CDR1), a heavy chain complementarity determining region 2 (CDR2), and a heavy chain complementarity determining region 3 (CDR3) comprising the amino acid sequences of SEQ ID NO: 16, 17, and 18,Attorney Docket No.: JBI6924WOPCT1 respectively, and a light chain complementarity determining region 1 (CDR1), a light chain complementarity determining region 2 (CDR2), and a light chain complementarity determining region 3 (LCDR3) comprising the amino acid sequences of SEQ ID NO: 19, 20, and 11, respectively. This GPRC5D -specific antibody or antigen-binding fragment may comprise human framework sequences. In some embodiments, the GPRC5D-specific antibodies and antigen-binding fragments comprise a heavy chain variable domain substantially the same as, or identical to, SEQ ID NO: 1 and a light chain variable domain substantially the same as, or identical to, SEQ ID NO: 2. In some embodiments, the GPRC5D-specific antibodies and antigen-binding fragments comprise a heavy chain substantially the same as, or identical to, SEQ ID NO: 3 and a light chain variable domain substantially the same as, or identical to, SEQ ID NO: 5. The CDRs, the heavy chain variable domain, light chain variable domain, the heavy chain, and the light chain of antibodies discussed in this paragraph are suitable for inclusion in multispecific constructs in which one arm is an anti-GPRC5D arm.

[0189] In some embodiments, the GPRC5D-specific antibodies and antigen-binding fragmentscomprise a heavy chain complementarity determining region 1 (CDR1), a heavy chain complementarity determining region 2 (CDR2), and a heavy chain complementarity determining region 3 (CDR3) comprising the amino acid sequences of SEQ ID NO: 21, 22, and 23, respectively, and a light chain complementarity determining region 1 (CDR1), a light chain complementarity determining region 2 (CDR2), and a light chain complementarity determining region 3 (LCDR3) comprising the amino acid sequences of SEQ ID NO: 24, 25, and 26, respectively. This GPRC5D -specific antibody or antigen-binding fragment may comprise human framework sequences. In some embodiments, the GPRC5D-specific antibodies and antigen-binding fragments comprise a heavy chain variable domain substantially the same as, or identical to, SEQ ID NO: 1 and a light chain variable domain substantially the same as, or identical to, SEQ ID NO: 2. In some embodiments, the GPRC5D-specific antibodies and antigen-binding fragments comprise a heavy chain substantially the same as, or identical to, SEQ ID NO: 3 and a light chain variable domain substantially the same as, or identical to, SEQ ID NO: 5. The CDRs, the heavy chain variable domain, light chain variable domain, the heavy chain, and the light chain of antibodies discussed in this paragraph are suitable for inclusion in multispecific constructs in which one arm is an anti-GPRC5D arm.Attorney Docket No.: JBI6924WOPCT1

[0190] In some embodiments, the antibodies or antigen-binding fragments are IgG, orderivatives thereof, e.g., IgG1, IgG2, IgG3, and IgG4 isotypes. In some embodiments wherein the antibody is of IgG1 isotype, the antibody comprises an IgG1 Fc region.

[0191] In some embodiments, the antibody or antigen binding fragment thereof comprises aheavy chain variable region (VH) comprising an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1. In some embodiments, the antibody or antigen binding fragment thereof comprises a VH comprising SEQ ID NO: 1. In some embodiments, the antibody or antigen binding fragment thereof comprises a light chain variable region (VL) comprising an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2. In some embodiments, the antibody or antigen binding fragment thereof comprises a VL comprising SEQ ID NO: 2. In some embodiments, the antibody or antigen binding fragment thereof comprises a heavy chain variable region (VH) comprising SEQ ID NO: 1, and a light chain variable region (VL) comprising SEQ ID NO: 2. HUMANIZED GPRC5D ANTIBODIES

[0192] The antibodies described herein include humanized antibodies. Humanized antibodies,such as the humanized antibodies disclosed herein can be produced using a variety of techniques known in the art, including but not limited to, CDR-grafting (European Patent No. EP 239,400; International publication No. WO 91 / 09967; and U.S. Patent Nos.5,225,539, 5,530,101, and 5,585,089), veneering or resurfacing (European Patent Nos. EP 592,106 and EP 519,596; Padlan, Molecular Immunology 28(4 / 5):489-498 (1991); Studnicka et al., Protein Engineering 7(6):805- 814 (1994); and Roguska et al., PNAS 91:969-973 (1994)), chain shuffling (U.S. Patent No. 5,565,332), and techniques disclosed in, e.g., U.S. Pat. No.6,407,213, U.S. Pat. No.5,766,886, WO 9317105, Tan et al., J. Immunol.169:111925 (2002), Caldas et al., Protein Eng.13(5):353- 60 (2000), Morea et al., Methods 20(3):26779 (2000), Baca et al., J. Biol. Chem. 272(16):10678-84 (1997), Roguska et al., Protein Eng.9(10):895904 (1996), Couto et al., Cancer Res.55 (23 Supp):5973s- 5977s (1995), Couto et al., Cancer Res.55(8):1717-22 (1995), Sandhu JS, Gene 150(2):409-10 (1994), and Pedersen et al., J. Mol. Biol.235(3):959-73 (1994). See also U.S. Patent Pub. No. US 2005 / 0042664 A1 (Feb.24, 2005), each of which is incorporated by reference herein in its entirety.Attorney Docket No.: JBI6924WOPCT1

[0193] In some embodiments, antibodies provided herein can be humanized antibodies that bindto GPRC5D, including human GPRC5D. Various methods for humanizing non-human antibodies are known in the art. For example, a humanized antibody can have one or more amino acid residues introduced into it from a source that is non-human. These non-human amino acid residues are often referred to as “import” residues, which are typically taken from an “import” variable domain. Humanization may be performed, for example, following the method of Jones et al., Nature 321:522-25 (1986); Riechmann et al., Nature 332:323-27 (1988); and Verhoeyen et al., Science 239:1534-36 (1988)), by substituting hypervariable region sequences for the corresponding sequences of a human antibody.

[0194] In some cases, the humanized antibodies are constructed by CDR grafting, in which theamino acid sequences of the CDRs of the parent non-human antibody are grafted onto a human antibody framework. For example, Padlan et al. determined that only about one third of the residues in the CDRs actually contact the antigen, and termed these the “specificity determining residues,” or SDRs (Padlan et al., FASEB J.9:133-39 (1995)). In the technique of SDR grafting, only the SDR residues are grafted onto the human antibody framework (see, e.g., Kashmiri et al., Methods 36:25-34 (2005)).

[0195] The choice of human variable domains to be used in making the humanized antibodiescan be important to reduce antigenicity. For example, according to the so-called “best-fit” method, the sequence of the variable domain of a non-human antibody is screened against the entire library of known human variable-domain sequences. The human sequence that is closest to that of the non-human antibody may be selected as the human framework for the humanized antibody (Sims et al., J. Immunol.151:2296-308 (1993); and Chothia et al., J. Mol. Biol. 196:901-17 (1987)). Another method uses a particular framework derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains. The same framework may be used for several different humanized antibodies (Carter et al., Proc. Natl. Acad. Sci. USA 89:4285-89 (1992); and Presta et al., J. Immunol.151:2623-32 (1993)). In some cases, the framework is derived from the consensus sequences of the most abundant human subclasses, VL^ subgroup I (VL^I) and VH subgroup III (VHIII). In another method, human germline genes are used as the source of the framework regions.

[0196] In an alternative paradigm based on comparison of CDRs, called superhumanization, FRhomology is irrelevant. The method consists of comparison of the non-human sequence with theAttorney Docket No.: JBI6924WOPCT1 functional human germline gene repertoire. Those genes encoding the same or closely related canonical structures to the murine sequences are then selected. Next, within the genes sharing the canonical structures with the non-human antibody, those with highest homology within the CDRs are chosen as FR donors. Finally, the non-human CDRs are grafted onto these FRs (see, e.g., Tan et al., J. Immunol.169:1119-25 (2002)).

[0197] It is further generally desirable that antibodies be humanized with retention of theiraffinity for the antigen and other favorable biological properties. To achieve this goal, according to one method, humanized antibodies are prepared by a process of analysis of the parental sequences and various conceptual humanized products using three-dimensional models of the parental and humanized sequences. Three-dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art. Computer programs are available which illustrate and display probable three-dimensional conformational structures of selected candidate immunoglobulin sequences. These include, for example, WAM (Whitelegg and Rees, Protein Eng.13:819-24 (2002)), Modeller (Sali and Blundell, J. Mol. Biol.234:779-815 (1993)), and Swiss PDB Viewer (Guex and Peitsch, Electrophoresis 18:2714-23 (1997)). Inspection of these displays permits analysis of the likely role of the residues in the functioning of the candidate immunoglobulin sequence, e.g., the analysis of residues that influence the ability of the candidate immunoglobulin to bind its antigen. In this way, FR residues can be selected and combined from the recipient and import sequences so that the desired antibody characteristic, such as increased affinity for the target antigen(s), is achieved. In general, the hypervariable region residues are directly and most substantially involved in influencing antigen binding.

[0198] Another method for antibody humanization is based on a metric of antibody humannesstermed Human String Content (HSC). This method compares the mouse sequence with the repertoire of human germline genes, and the differences are scored as HSC. The target sequence is then humanized by maximizing its HSC rather than using a global identity measure to generate multiple diverse humanized variants (Lazar et al., Mol. Immunol.44:1986-98 (2007)).

[0199] In addition to the methods described above, empirical methods may be used to generateand select humanized antibodies. These methods include those that are based upon the generation of large libraries of humanized variants and selection of the best clones using enrichment technologies or high throughput screening techniques. Antibody variants may be isolated from phage, ribosome, and yeast display libraries as well as by bacterial colonyAttorney Docket No.: JBI6924WOPCT1 screening (see, e.g., Hoogenboom, Nat. Biotechnol.23:1105-16 (2005); Dufner et al., Trends Biotechnol.24:523-29 (2006); Feldhaus et al., Nat. Biotechnol.21:163-70 (2003); and Schlapschy et al., Protein Eng. Des. Sel.17:847-60 (2004)).

[0200] In the FR library approach, a collection of residue variants are introduced at specificpositions in the FR followed by screening of the library to select the FR that best supports the grafted CDR. The residues to be substituted may include some or all of the “Vernier” residues identified as potentially contributing to CDR structure (see, e.g., Foote and Winter, J. Mol. Biol. 224:487-99 (1992)), or from the more limited set of target residues identified by Baca et al. J. Biol. Chem.272:10678-84 (1997).

[0201] In FR shuffling, whole FRs are combined with the non-human CDRs instead of creatingcombinatorial libraries of selected residue variants (see, e.g., Dall’Acqua et al., Methods 36:43- 60 (2005)). A one-step FR shuffling process may be used. Such a process has been shown to be efficient, as the resulting antibodies exhibited improved biochemical and physicochemical properties including enhanced expression, increased affinity, and thermal stability (see, e.g., Damschroder et al., Mol. Immunol.44:3049-60 (2007)).

[0202] The “humaneering” method is based on experimental identification of essential minimumspecificity determinants (MSDs) and is based on sequential replacement of non-human fragments into libraries of human FRs and assessment of binding. This methodology typically results in epitope retention and identification of antibodies from multiple subclasses with distinct human V-segment CDRs.

[0203] The “human engineering” method involves altering a non-human antibody or antibodyfragment by making specific changes to the amino acid sequence of the antibody so as to produce a modified antibody with reduced immunogenicity in a human that nonetheless retains the desirable binding properties of the original non-human antibodies. Generally, the technique involves classifying amino acid residues of a non-human antibody as “low risk,” “moderate risk,” or “high risk” residues. The classification is performed using a global risk / reward calculation that evaluates the predicted benefits of making particular substitution (e.g., for immunogenicity in humans) against the risk that the substitution will affect the resulting antibody’s folding. The particular human amino acid residue to be substituted at a given position (e.g., low or moderate risk) of a non-human antibody sequence can be selected by aligning an amino acid sequence from the non-human antibody’s variable regions with the correspondingAttorney Docket No.: JBI6924WOPCT1 region of a specific or consensus human antibody sequence. The amino acid residues at low or moderate risk positions in the non-human sequence can be substituted for the corresponding residues in the human antibody sequence according to the alignment. Techniques for making human engineered proteins are described in greater detail in Studnicka et al., Protein Engineering 7:805-14 (1994); U.S. Pat. Nos.5,766,886; 5,770,196; 5,821,123; and 5,869,619; and PCT Publication WO 93 / 11794.

[0204] A composite human antibody can be generated using, for example, Composite HumanAntibody™ technology (Antitope Ltd., Cambridge, United Kingdom). To generate composite human antibodies, variable region sequences are designed from fragments of multiple human antibody variable region sequences in a manner that avoids T cell epitopes, thereby minimizing the immunogenicity of the resulting antibody.

[0205] A deimmunized antibody is an antibody in which T-cell epitopes have been removed.Methods for making deimmunized antibodies have been described. See, e.g., Jones et al., Methods Mol Biol.525:405-23 (2009), xiv, and De Groot et al., Cell. Immunol.244:148- 153(2006)). Deimmunized antibodies comprise T-cell epitope-depleted variable regions and human constant regions. Briefly, variable regions of an antibody are cloned and T-cell epitopes are subsequently identified by testing overlapping peptides derived from the variable regions of the antibody in a T cell proliferation assay. T cell epitopes are identified via in silico methods to identify peptide binding to human MHC class II. Mutations are introduced in the variable regions to abrogate binding to human MHC class II. Mutated variable regions are then utilized to generate the deimmunized antibody. MUTATIONS, DELETIONS, OR INSERTIONS

[0206] Variations may be a mutation, deletion, or insertion of one or more codons encoding theantibody or polypeptide that results in a change in the amino acid sequence as compared with the original antibody or polypeptide. Sites of interest for substitutional mutagenesis include the CDRs and FRs.

[0207] Amino acid mutations can be the result of replacing one amino acid with another aminoacid having similar structural and / or chemical properties, such as the replacement of a leucine with a serine, e.g., conservative amino acid replacements. Standard techniques known to those of skill in the art can be used to introduce mutations in the nucleotide sequence encoding aAttorney Docket No.: JBI6924WOPCT1 molecule provided herein, including, for example, site-directed mutagenesis and PCR-mediated mutagenesis which results in amino acid mutations. Insertions or deletions may optionally be in the range of about 1 to 5 amino acids. In certain embodiments, the mutation, deletion, or insertion includes fewer than 25 amino acid mutations, fewer than 20 amino acid mutations, fewer than 15 amino acid mutations, fewer than 10 amino acid mutations, fewer than 5 amino acid mutations, fewer than 4 amino acid mutations, fewer than 3 amino acid mutations, or fewer than 2 amino acid mutations relative to the original molecule. In a specific embodiment, the mutation is a conservative amino acid mutation made at one or more predicted non-essential amino acid residues. The variation allowed may be determined by systematically making insertions, deletions, or mutations of amino acids in the sequence and testing the resulting variants for activity exhibited by the parental antibodies.

[0208] Amino acid sequence insertions include amino- and / or carboxyl-terminal fusions rangingin length from one residue to polypeptides containing multiple residues, as well as intrasequence insertions of single or multiple amino acid residues. Examples of terminal insertions include an antibody with an N-terminal methionyl residue.

[0209] Antibodies generated by conservative amino acid substitutions are included in the presentdisclosure. In a conservative amino acid mutation, an amino acid residue is replaced with an amino acid residue having a side chain with a similar charge. As described above, families of amino acid residues having side chains with similar charges have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Alternatively, mutations can be introduced randomly along all or part of the coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for biological activity to identify mutants that retain activity. Following mutagenesis, the encoded protein can be expressed and the activity of the protein can be determined. Conservative (e.g., within an amino acid group with similar properties and / or side chains) substitutions may be made, so as to maintain or not significantly change the properties. Exemplary mutations are shown in Table 3 below.Attorney Docket No.: JBI6924WOPCT1 TABLE 3. Amino Acid Mutations Original Exemplary Original Exemplary Residue Mutations Residue Mutations a;

[0210] Amino acids may be grouped according to similarities in the properties of their sidechains (see, e.g., Lehninger, Biochemistry 73-75 (2d ed.1975)): (1) non-polar: Ala (A), Val (V), Leu (L), Ile (I), Pro (P), Phe (F), Trp (W), Met (M); (2) uncharged polar: Gly (G), Ser (S), Thr (T), Cys (C), Tyr (Y), Asn (N), Gln (Q); (3) acidic: Asp (D), Glu (E); and (4) basic: Lys (K), Arg (R), His(H). Alternatively, naturally occurring residues may be divided into groups based on common side-chain properties: (1) hydrophobic: Norleucine, Met, Ala, Val, Leu, Ile; (2) neutral hydrophilic: Cys, Ser, Thr, Asn, Gln; (3) acidic: Asp, Glu; (4) basic: His, Lys, Arg; (5) residues that influence chain orientation: Gly, Pro; and (6) aromatic: Trp, Tyr, Phe. For example, any cysteine residue not involved in maintaining the proper conformation of the antibody also may be substituted, for example, with another amino acid, such as alanine or serine, to improve the oxidative stability of the molecule and to prevent aberrant crosslinking. Non-conservative mutations will entail exchanging a member of one of these classes for another class.

[0211] One type of substitutional variant involves substituting one or more hypervariable regionresidues of a parent antibody (e.g., a humanized or human antibody). Generally, the resulting variant(s) selected for further study will have modifications (e.g., improvements) in certain biological properties (e.g., increased affinity, reduced immunogenicity) relative to the parentAttorney Docket No.: JBI6924WOPCT1 antibody and / or will have substantially retained certain biological properties of the parent antibody. An exemplary substitutional variant is an affinity matured antibody, which may be conveniently generated, e.g., using phage display-based affinity maturation techniques such as those described herein. Briefly, one or more CDR residues are mutated and the variant antibodies displayed on phage and screened for a particular biological activity (e.g., binding affinity).

[0212] Alterations (e.g., mutations) may be made in CDRs, e.g., to improve antibody affinity.Such alterations may be made in CDR “hotspots,” i.e., residues encoded by codons that undergo mutation at high frequency during the somatic maturation process (see, e.g., Chowdhury, Methods Mol. Biol.207:179-196 (2008)), and / or SDRs (a-CDRs), with the resulting variant antibody or fragment thereof being tested for binding affinity. Affinity maturation by constructing and reselecting from secondary libraries has been described, e.g., in Hoogenboom et al. in Methods in Molecular Biology 178:1-37 (O’Brien et al., ed., Human Press, Totowa, NJ, (2001).) In some embodiments of affinity maturation, diversity is introduced into the variable genes chosen for maturation by any of a variety of methods (e.g., error-prone PCR, chain shuffling, or oligonucleotide-directed mutagenesis). A secondary library is then created. The library is then screened to identify any antibody variants with the desired affinity. Another method to introduce diversity involves CDR-directed approaches, in which several CDR residues (e.g., 4-6 residues at a time) are randomized. CDR residues involved in antigen binding may be specifically identified, e.g., using alanine scanning mutagenesis or modeling. More detailed description regarding affinity maturation is provided in the section below.

[0213] In some embodiments, substitutions, insertions, or deletions may occur within one ormore CDRs so long as such alterations do not substantially reduce the ability of the antibody to bind antigen. For example, conservative alterations (e.g., conservative substitutions as provided herein) that do not substantially reduce binding affinity may be made in CDRs. In some embodiments of the variant antibody sequences provided herein, each CDR either is unaltered, or contains no more than one, two or three amino acid substitutions.

[0214] A useful method for identification of residues or regions of an antibody that may betargeted for mutagenesis is called “alanine scanning mutagenesis” as described by Cunningham and Wells, Science, 244:1081-1085 (1989). In this method, a residue or group of target residues (e.g., charged residues such as Arg, Asp, His, Lys, and Glu) are identified and replaced by aAttorney Docket No.: JBI6924WOPCT1 neutral or negatively charged amino acid (e.g., alanine or polyalanine) to determine whether the interaction of the antibody with antigen is affected. Further substitutions may be introduced at the amino acid locations demonstrating functional sensitivity to the initial substitutions. Alternatively, or additionally, a crystal structure of an antigen-antibody complex to identify contact points between the antibody and antigen. Such contact residues and neighboring residues may be targeted or eliminated as candidates for substitution. Variants may be screened to determine whether they contain the desired properties.

[0215] Amino acid sequence insertions include amino- and / or carboxyl-terminal fusions rangingin length from one residue to polypeptides containing a hundred or more residues, as well as intrasequence insertions of single or multiple amino acid residues. Examples of terminal insertions include an antibody with an N-terminal methionyl residue. Other insertional variants of the antibody molecule include the fusion to the N- or C-terminus of the antibody to an enzyme (e.g., for ADEPT) or a polypeptide which increases the serum half-life of the antibody.

[0216] The variations can be made using methods known in the art such as oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed mutagenesis (see, e.g., Carter, Biochem J.237:1-7 (1986); and Zoller et al., Nucl. Acids Res. 10:6487-500 (1982)), cassette mutagenesis (see, e.g., Wells et al., Gene 34:315-23 (1985)), or other known techniques can be performed on the cloned DNA to produce the antibody variant DNA. Fc MUTATIONS WITH ENHANCED EFFECTOR FUNCTIONS

[0217] The GPRC5D antibodies provided herein have mutations at the lysine at position 248(K248) (EU numbering) and the threonine at position 437 (T437) (EU numbering) in the Fc region. Lysine at position 248 (K248) (EU numbering) and threonine at position 437 (T437) (EU numbering) are both conserved residues in the Fc regions among different IgG subtypes (Zhang, D., et al., supra). Fc mutations, T437R and K248E (EU numbering), were shown to facilitate oligomerization of antibodies upon binding antigens at the cell surface, and possess enhanced effector functions (Zhang, D., et al., supra). T437R and K248E double mutations (“RE mutations”) were shown to confer CDC activity on wildtype IgG1 antibodies that did not possess CDC activity in a dose-dependent manner (Zhang, D., et al., supra; PCT / US21 / 27666, PCT / US22 / 78351, and PCT / US22 / 78355).Attorney Docket No.: JBI6924WOPCT1

[0218] The “EU numbering” or “EU index” is generally used when referring to a residue in animmunoglobulin heavy chain constant region. It refers to the residue numbering of the human IgG1 EU antibody. It is computed by alignment of an antibody sequence with the Eu antibody sequence (Edelman, G. M., et al., Proc Natl Acad Sci U S A, 1969, 63(1):78-85; Kabat, et al., supra), so that each residue that is homologous to a residue in the EU antibody will have the same residue number as that EU residue.

[0219] In some embodiments, the GPRC5D antibodies provided herein have T437R and / orK248E mutations (“RE mutations”). In some embodiments, the GPRC5D antibodies provided herein have T437R and K248E mutations. ANTIBODY-DEPENDENT CELL-MEDIATED CYTOTOXICITY (ADCC), COMPLEMENT- DEPENDENT CYTOTOXICITY (CDC), AND ANTIBODY-DEPENDENT CELLULAR PHAGOCYTOSIS EFFECTOR FUNCTIONS

[0220] The GPRC5D antibodies provided herein have enhanced ADCC activity and enhancedCDC activity as compared with the fucosylated antibody or antigen binding fragment thereof without K248E and T437R (RE) mutations. In some embodiments, the antibody or the antigen- binding fragment thereof has enhanced antibody-dependent cellular cytotoxicity (ADCC) activity as compared with a fucosylated antibody or an antigen-binding fragment thereof. In some embodiments, the monovalent antibody or the antigen-binding fragment thereof has enhanced antibody-dependent cellular cytotoxicity (ADCC) activity and enhanced complement- dependent cytotoxicity (CDC) as compared with a fucosylated divalent antibody or an antigen- binding fragment thereof without K248E and T437R (RE) mutations.

[0221] Therapeutic antibodies bind Fc receptors on the cell surface of effector cells, such asnatural killer (NK) cells, macrophages, mononuclear phagocytes, neutrophils and eosinophils (Saunder, K. O., Front Immunol., 2019, 10:1296), giving rise to important antibody-dependent effector functions, such as antibody-dependent cell-mediated cytotoxicity (ADCC) and antibody- dependent cell-mediated phagocytosis (ADCP). A family of receptors for IgG Fc regions was referred to as the Fcγ receptors (FcγRs) (Cohen-Solal, J. F., Immunol Lett., 2004, 92(3):199- 205), and is comprised of FcγRI; FcγRII, including isoforms FcγRIIa, FcγRIIb, and FcγRIIc; and FcγRIII, including isoforms FcγRIIIa and FcγRIIIb (Jefferis, R. and Lund, J., Immunol Lett., 2002, 82(1-2):57-65).Attorney Docket No.: JBI6924WOPCT1

[0222] Among various effector functions, ADCC and ADCP have been shown to possessclinically significant anti-tumor efficacy. For example, ADCC was shown to be an important mechanism for the anti-tumor efficacy of trastuzumab in vitro, as evidenced by NK cells’ capability to kill trastuzumab-coated tumor cells via a FcγRIII receptor (CD16)-mediated ADCC mechanism (Cooley, S., et al., Exp Hematol., 1999; 27(10):1533-41; Carson, W. E., et al., Eur J Immunol., 2001, 31(10):3016–3025; Kubo, M., et al., Anticancer Res., 2003, 23(6a):4443-9) and in vivo, as evidenced by increased numbers of NK cells in tumor infiltrates after trastuzumab treatment (Clynes, R. A., et al., Nat Med., 2000, 6(4):443-6; Arnould, L., et al., Br J Cancer, 2006, 94(2):259-67). Additionally, macrophage-mediated ADCP has been shown to be important in the anti-tumor efficacy of trastuzumab (Shi, Y., et al., J Immunol., 2015, 194(9):4379-86).

[0223] Antibodies with no or low fucosylation have shown dramatically enhanced ADCCactivity due to the enhancement in their binding capacity to FcγRIIIa binding without any detectable change in CDC or antigen binding capability (Okazaki, A., et al., J Mol Biol., 2004, 336(5):1239-49; Kanda, Y., et al., Glycobiology, 2007, 17(1):104-18). N-oligosaccharides of antibody Fc regions are essential for binding to FcγR, which engages antibody effector functions (Yamane-Ohnuki, N. and Satoh, M., Mabs, 2009, 1(3):230-6).

[0224] The absence of fucose on N-oligosaccharides of antibody Fc regions have been shown todramatically enhance antibodies’ binding capacity to FcγRIIIa receptors present on immune effector cells such as natural killer (NK) cells and macrophages, giving rise to anti-tumor therapeutic effect (Pereira, N. A., et al., supra). The FcγRIIIa receptors bind Fc regions via interactions with the hinge region and the CH2 domain of the Fc (Radaev, S., et al., J Biol Chem., 2001, 276:16469-77; Sondermann, P., et al., Nature, 2000, 406:267-73). The absence of fucose thus eliminates the steric hindrance and enhances the Fc- FcγRIIIa interaction, leading to enhanced effector functions (Pereira, N. A., et al., supra).

[0225] Complement-dependent cytotoxicity (CDC) is another important antibody effectorfunction. In the antibody-dependent classical complement activation pathway, binding between the complement C1q heterohexameric headpiece and an oligomeric antibody complex initiates the proteolytic complement cascade (Wang, G. et al., Mol Cell, 2016, 63:135-45; Diebolder, C. A. et al., Science, 2014, 343:1260-3), which leads to the opsonization of target cells by C3- derived opsonins (e.g., C3b) and generation of potent inflammation mediators (C3a and C5a),Attorney Docket No.: JBI6924WOPCT1 ultimately resulting in the formation of membrane attack complex (MAC), C5b-C9 , on the target cell membrane (Reis, E. S., et al., Nat Rev Immunol., 2018, 18:5-18). CDC has also been shown to possess clinically significant anti-tumor efficacy, e.g., in the anti-CD20 mAb rituximab and anti-CD38 mAb daratumumab (de Weers, M., et al., J Immunol., 2011, 186:1840-8; Lokhorst, H. M., et al., N Engl J Med., 2015, 373:1207-19; Taylor, R. P. and Lindorfer, M. A., Semin Immunol., 2016, 28:309-16).

[0226] Mutations in the Fc region that facilitate antibody oligomerization, such as the REmutations (EU numbering), have been demonstrated to significantly enhance antibody CDC activity (Diebolder, C. A. et al., supra; Zhang, D., et al., supra; PCT / US21 / 27666, PCT / US22 / 78351, and PCT / US22 / 78355 ).

[0227] In some embodiments, the ADCC activity of the present GPRC5D antibodies is 10%higher than GPRC5D antibodies with normal fucosylation. In some embodiments, the ADCC activity of the present GPRC5D antibodies is 20% higher than GPRC5D antibodies with normal fucosylation. In some embodiments, the ADCC activity of the present GPRC5D antibodies is 30% higher than GPRC5D antibodies with normal fucosylation. In some embodiments, the ADCC activity of the present GPRC5D antibodies is 40% higher than GPRC5D antibodies with normal fucosylation. In some embodiments, the ADCC activity of the present GPRC5D antibodies is 50% higher than GPRC5D antibodies with normal fucosylation. In some embodiments, the ADCC activity of the present GPRC5D antibodies is 60% higher than GPRC5D antibodies with normal fucosylation. In some embodiments, the ADCC activity of the present GPRC5D antibodies is 70% higher than GPRC5D antibodies with normal fucosylation. In some embodiments, the ADCC activity of the present GPRC5D antibodies is 80% higher than GPRC5D antibodies with normal fucosylation. In some embodiments, the ADCC activity of the present GPRC5D antibodies is 90% higher than GPRC5D antibodies with normal fucosylation. In some embodiments, the ADCC activity of the present GPRC5D antibodies is more than 2-fold of that of GPRC5D antibodies with normal fucosylation. In some embodiments, the ADCC activity of the present GPRC5D antibodies is more than 3-fold of that of GPRC5D antibodies with normal fucosylation. In some embodiments, the ADCC activity of the present GPRC5D antibodies is more than 4-fold of that of GPRC5D antibodies with normal fucosylation. In some embodiments, the ADCC activity of the present GPRC5D antibodies is more than 5-fold of that of GPRC5D antibodies with normal fucosylation. In some embodiments, the ADCC activity ofAttorney Docket No.: JBI6924WOPCT1 the present GPRC5D antibodies is more than 6-fold of that of GPRC5D antibodies with normal fucosylation. In some embodiments, the ADCC activity of the present GPRC5D antibodies is more than 7-fold of that of GPRC5D antibodies with normal fucosylation. In some embodiments, the ADCC activity of the present GPRC5D antibodies is more than 8-fold of that of GPRC5D antibodies with normal fucosylation. In some embodiments, the ADCC activity of the present GPRC5D antibodies is more than 9-fold of that of GPRC5D antibodies with normal fucosylation. In some embodiments, the ADCC activity of the present GPRC5D antibodies is more than 10-fold of that of GPRC5D antibodies with normal fucosylation.

[0228] In some embodiments, the antibodies described above also have higher CDC activities.In some embodiments, the CDC activity of the present GPRC5D antibodies is 10% higher than GPRC5D antibodies without RE mutations. In some embodiments, the CDC activity of the present GPRC5D antibodies is 20% higher than antibodies without RE mutations. In some embodiments, the CDC activity of the present GPRC5D antibodies is 30% higher than GPRC5D antibodies without RE mutations. In some embodiments, the CDC activity of the present GPRC5D antibodies is 40% higher than GPRC5D antibodies without RE mutations. In some embodiments, the CDC activity of the present GPRC5D antibodies is 50% higher than GPRC5D antibodies without RE mutations. In some embodiments, the CDC activity of the present GPRC5D antibodies is 60% higher than GPRC5D antibodies without RE mutations. In some embodiments, the CDC activity of the present GPRC5D antibodies is 70% higher than GPRC5D antibodies without RE mutations. In some embodiments, the CDC activity of the present GPRC5D antibodies is 80% higher than GPRC5D antibodies without RE mutations. In some embodiments, the CDC activity of the present GPRC5D antibodies is 90% higher than GPRC5D antibodies without RE mutations. In some embodiments, the CDC activity of the present GPRC5D antibodies is more than 2-fold of that of GPRC5D antibodies without RE mutations. In some embodiments, the CDC activity of the present GPRC5D antibodies is more than 3-fold of that of antibodies without RE mutations. In some embodiments, the CDC activity of the present GPRC5D antibodies is more than 4-fold of that of GPRC5D antibodies without RE mutations. In some embodiments, the CDC activity of the present GPRC5D antibodies is more than 5-fold of that of GPRC5D antibodies without RE mutations. In some embodiments, the CDC activity of the present GPRC5D antibodies is more than 6-fold of that of GPRC5D antibodies without RE mutations. In some embodiments, the CDC activity of the presentAttorney Docket No.: JBI6924WOPCT1 GPRC5D antibodies is more than 7-fold of that of GPRC5D antibodies without RE mutations. In some embodiments, the CDC activity of the present GPRC5D antibodies is more than 8-fold of that of GPRC5D antibodies without RE mutations. In some embodiments, the CDC activity of the present GPRC5D antibodies is more than 9-fold of that of GPRC5D antibodies without RE mutations. In some embodiments, the CDC activity of the present GPRC5D antibodies is more than 10-fold of that of GPRC5D antibodies without RE mutations.

[0229] In some embodiments, the ADCC and CDC activities of the present GPRC5D antibodiesare 10% higher than divalent GPRC5D antibodies with normal fucosylation without RE mutations. In some embodiments, the ADCC and CDC activities of the present GPRC5D antibodies are 20% higher than divalent GPRC5D antibodies with normal fucosylation without RE mutations. In some embodiments, the ADCC and CDC activities of the present GPRC5D antibodies are 30% higher than divalent GPRC5D antibodies with normal fucosylation without RE mutations. In some embodiments, the ADCC and CDC activities of the present GPRC5D antibodies are 40% higher than divalent GPRC5D antibodies with normal fucosylation without RE mutations. In some embodiments, the ADCC and CDC activities of the present GPRC5D antibodies are 50% higher than divalent GPRC5D antibodies with normal fucosylation without RE mutations. In some embodiments, the ADCC and CDC activities of the present GPRC5D antibodies are 60% higher than divalent GPRC5D antibodies with normal fucosylation without RE mutations. In some embodiments, the ADCC and CDC activities of the present GPRC5D antibodies are 70% higher than divalent GPRC5D antibodies with normal fucosylation without RE mutations. In some embodiments, the ADCC and CDC activities of the present GPRC5D antibodies are 80% higher than divalent GPRC5D antibodies with normal fucosylation without RE mutations. In some embodiments, the ADCC and CDC activities of the present GPRC5D antibodies are 90% higher than divalent GPRC5D antibodies with normal fucosylation without RE mutations. In some embodiments, the ADCC and CDC activities of the present GPRC5D antibodies are more than 2-fold of that of divalent GPRC5D antibodies with normal fucosylation without RE mutations. In some embodiments, the ADCC and CDC activities of the present GPRC5D antibodies are more than 3-fold of that of divalent GPRC5D antibodies with normal fucosylation without RE mutations. In some embodiments, the ADCC and CDC activities of the present GPRC5D antibodies are more than 4-fold of that of divalent GPRC5D antibodies with normal fucosylation without RE mutations. In some embodiments, the ADCC and CDCAttorney Docket No.: JBI6924WOPCT1 activities of the present GPRC5D antibodies are more than 5-fold of that of divalent GPRC5D antibodies with normal fucosylation without RE mutations. In some embodiments, the ADCC and CDC activities of the present GPRC5D antibodies are more than 6-fold of that of divalent GPRC5D antibodies with normal fucosylation without RE mutations. In some embodiments, the ADCC and CDC activities of the present GPRC5D antibodies are more than 7-fold of that of divalent GPRC5D antibodies with normal fucosylation without RE mutations. In some embodiments, the ADCC and CDC activities of the present GPRC5D antibodies are more than 8- fold of that of divalent GPRC5D antibodies with normal fucosylation without RE mutations. In some embodiments, the ADCC and CDC activities of the present GPRC5D antibodies are more than 9-fold of that of divalent GPRC5D antibodies with normal fucosylation without RE mutations. In some embodiments, the ADCC and CDC activities of the present GPRC5D antibodies are more than 10-fold of that of divalent GPRC5D antibodies with normal fucosylation without RE mutations. KNOB-INTO-HOLE MUTATIONS

[0230] GPRC5D antibodies disclosed herein may comprise different Fc moieties, thus the twosubunits of the Fc domain are typically comprised in two non-identical polypeptide chains. Recombinant co-expression of these polypeptides and subsequent dimerization leads to several possible combinations of the two polypeptides. To improve the yield and purity of bispecific antibodies in recombinant production, it will thus be advantageous to introduce in the Fc domain of the GPRC5D antibody a modification promoting the association of the desired polypeptides.

[0231] Accordingly, in some embodiments, the Fc domain of the GPRC5D antibodies disclosedherein comprise a modification promoting the association of the first and the second subunit of the Fc domain. The site of most extensive protein-protein interaction between the two subunits of a human IgG Fc domain is in the CH3 domain of the Fc domain. Thus, in one embodiment said modification is in the CH3 domain of the Fc domain. In some embodiments, the antibody or the antigen-binding fragment thereof comprises one or more mutations which promote heterodimerization.

[0232] There exist several approaches for modifications in the CH3 domain of the Fc domain toenforce heterodimerization, which are well described e.g., in WO 96 / 27011, WO 98 / 050431, EP 1870459, WO 2007 / 110205, WO 2007 / 147901, WO 2009 / 089004, WO 2010 / 129304, WOAttorney Docket No.: JBI6924WOPCT1 2011 / 90754, WO 2011 / 143545, WO 2012058768, WO 2013157954, WO 2013096291. Typically, in all such approaches the CH3 domain of the first subunit of the Fc domain and the CH3 domain of the second subunit of the Fc domain are both engineered in a complementary manner so that each CH3 domain (or the heavy chain comprising it) can no longer homodimerize with itself but is forced to heterodimerize with the complementarily engineered other CH3 domain (so that the first and second CH3 domain heterodimerize and no homodimers between the two first or the two second CH3 domains are formed). These different approaches for improved heavy chain heterodimerization are contemplated as different alternatives in combination with the heavy-light chain modifications (e.g., VH and VL exchange / replacement in one binding arm and the introduction of substitutions of charged amino acids with opposite charges in the CH1 / CL interface) in the heterodimeric antibody which reduce heavy / light chain mispairing and Bence Jones-type side products.

[0233] In a specific embodiment said modification promoting the association of the first and thesecond subunit of the Fc domain is a so-called “knob-into-hole” modification, comprising a “knob” modification in one of the two subunits of the Fc domain and a “hole” modification in the other one of the two subunits of the Fc domain.

[0234] The knob-into-hole technology is described e.g., in U.S. Pat. Nos. 5,731,168; 7,695,936;Ridgway et al., Prot Eng 9, 617-621 (1996) and Carter, J Immunol Meth 248, 7-15 (2001). Generally, the method involves introducing a protuberance (“knob”) at the interface of a first polypeptide and a corresponding cavity (“hole”) in the interface of a second polypeptide, such that the protuberance can be positioned in the cavity to promote heterodimer formation and hinder homodimer formation. Protuberances are constructed by replacing small amino acid side chains from the interface of the first polypeptide with larger side chains (e.g., tyrosine or tryptophan). Compensatory cavities of identical or similar size to the protuberances are created in the interface of the second polypeptide by replacing large amino acid side chains with smaller ones (e.g., alanine or threonine).

[0235] Accordingly, in some embodiments, in the CH3 domain of the first subunit of the Fcdomain of the GPRC5D antibody an amino acid residue is replaced with an amino acid residue having a larger side chain volume, thereby generating a protuberance within the CH3 domain of the first subunit which is positionable in a cavity within the CH3 domain of the second subunit, and in the CH3 domain of the second subunit of the Fc domain an amino acid residue is replacedAttorney Docket No.: JBI6924WOPCT1 with an amino acid residue having a smaller side chain volume, thereby generating a cavity within the CH3 domain of the second subunit within which the protuberance within the CH3 domain of the first subunit is positionable.

[0236] Preferably said amino acid residue having a larger side chain volume is selected from thegroup consisting of arginine I, phenylalanine (F), tyrosine (Y), and tryptophan (W).

[0237] Preferably said amino acid residue having a smaller side chain volume is selected fromthe group consisting of alanine (A), serine (S), threonine (T), and valine (V).

[0238] The protuberance and cavity can be made by altering the nucleic acid encoding thepolypeptides, e.g., by site-specific mutagenesis, or by peptide synthesis.

[0239] In a specific embodiment, in (the CH3 domain of) the first subunit of the Fc domain (the“knobs” subunit) the threonine residue at position 366 is replaced with a tryptophan residue (T366W), and in (the CH3 domain of) the second subunit of the Fc domain (the “hole” subunit) the tyrosine residue at position 407 is replaced with a valine residue (Y407V). In some embodiments, in the second subunit of the Fc domain additionally the threonine residue at position 366 is replaced with a serine residue (T366S) and the leucine residue at position 368 is replaced with an alanine residue (L368A) (numberings according to Kabat EU index).

[0240] In yet a further embodiment, in the first subunit of the Fc domain additionally the serineresidue at position 354 is replaced with a cysteine residue (S354C) or the glutamic acid residue at position 356 is replaced with a cysteine residue (E356C) (particularly the serine residue at position 354 is replaced with a cysteine residue), and in the second subunit of the Fc domain additionally the tyrosine residue at position 349 is replaced by a cysteine residue (Y349C) (numberings according to Kabat EU index). Introduction of these two cysteine residues results in formation of a disulfide bridge between the two subunits of the Fc domain, further stabilizing the dimer (Carter, J Immunol Methods 248, 7-15 (2001)).

[0241] In some embodiments, the first subunit of the Fc domain comprises the amino acidsubstitutions S354C and T366W, and the second subunit of the Fc domain comprises the amino acid substitutions Y349C, T366S, L368A and Y407V (numbering according to Kabat EU index).

[0242] Other techniques of CH3-modification for enforcing the heterodimerization arecontemplated as alternatives according to the disclosure and are described e.g. in WO 96 / 27011, WO 98 / 050431, EP 1870459, WO 2007 / 110205, WO 2007 / 147901, WO 2009 / 089004, WOAttorney Docket No.: JBI6924WOPCT1 2010 / 129304, WO 2011 / 90754, WO 2011 / 143545, WO 2012 / 058768, WO 2013 / 157954, WO 2013 / 096291.

[0243] In some embodiments, the heterodimerization approach described in EP1870459, is usedalternatively. This approach is based on the introduction of charged amino acids with opposite charges at specific amino acid positions in the CH3 / CH3 domain interface between the two subunits of the Fc domain. One exemplary embodiment for the bispecific antibody of the disclosure are amino acid mutations R409D; K370E in one of the two CH3 domains (of the Fc domain) and amino acid mutations D399K; E357K in the other one of the CH3 domains of the Fc domain (numbering according to Kabat EU index).

[0244] In some embodiments, the GPRC5D antibodies of the present disclosure comprise aminoacid mutation T366W in the CH3 domain of the first subunit of the Fc domain and amino acid mutations T366S, L368A, Y407V in the CH3 domain of the second subunit of the Fc domain, and additionally amino acid mutations R409D; K370E in the CH3 domain of the first subunit of the Fc domain and amino acid mutations D399K; E357K in the CH3 domain of the second subunit of the Fc domain (numberings according to Kabat EU index).

[0245] In some embodiments, the GPRC5D antibodies of the present disclosure comprise aminoacid mutations S354C, T366W in the CH3 domain of the first subunit of the Fc domain and amino acid mutations Y349C, T366S, L368A, Y407V in the CH3 domain of the second subunit of the Fc domain, or said bispecific antibody comprises amino acid mutations Y349C, T366W in the CH3 domain of the first subunit of the Fc domain and amino acid mutations S354C, T366S, L368A, Y407V in the CH3 domains of the second subunit of the Fc domain and additionally amino acid mutations R409D; K370E in the CH3 domain of the first subunit of the Fc domain and amino acid mutations D399K; E357K in the CH3 domain of the second subunit of the Fc domain (all numberings according to Kabat EU index).

[0246] In some embodiments, the heterodimerization approach described in WO 2013 / 157953 isused alternatively. In some embodiments, a first CH3 domain comprises amino acid mutation T366K and a second CH3 domain comprises amino acid mutation L351D (numberings according to Kabat EU index). In a further embodiment, the first CH3 domain comprises further amino acid mutation L351K. In a further embodiment, the second CH3 domain comprises further an amino acid mutation selected from Y349E, Y349D and L368E (preferably L368E) (numberings according to Kabat EU index).Attorney Docket No.: JBI6924WOPCT1

[0247] In some embodiments, the heterodimerization approach described in WO 2012 / 058768 isused alternatively. In one embodiment a first CH3 domain comprises amino acid mutations L351Y, Y407A and a second CH3 domain comprises amino acid mutations T366A, K409F. In a further embodiment the second CH3 domain comprises a further amino acid mutation at position T411, D399, 5400, F405, N390, or K392, e.g. selected from a) T411N, T411R, T411Q, T411K, T411D, T411E or T411W, b) D399R, D399W, D399Y or D399K, c) S400E, 5400D, 5400R, or 5400K, d) F4051, F405M, F405T, F4055, F405V or F405W, e) N390R, N390K or N390D, f) K392V, K392M, K392R, K392L, K392F or K392E (numberings according to Kabat EU index). In a further embodiment a first CH3 domain comprises amino acid mutations L351Y, Y407A and a second CH3 domain comprises amino acid mutations T366V, K409F. In a further embodiment, a first CH3 domain comprises amino acid mutation Y407A and a second CH3 domain comprises amino acid mutations T366A, K409F. In a further embodiment, the second CH3 domain further comprises amino acid mutations K392E, T411E, D399R and 5400R (numberings according to Kabat EU index).

[0248] In some embodiments, the heterodimerization approach described in WO 2011 / 143545 isused alternatively, e.g., with the amino acid modification at a position selected from the group consisting of 368 and 409 (numbering according to Kabat EU index).

[0249] In some embodiments, the heterodimerization approach described in WO 2011 / 090762,which also uses the knobs-into-holes technology described above, is used alternatively. In one embodiment a first CH3 domain comprises amino acid mutation T366W and a second CH3 domain comprises amino acid mutation Y407A. In some embodiments, a first CH3 domain comprises amino acid mutation T366V and a second CH3 domain comprises amino acid mutation Y407T (numberings according to Kabat EU index).

[0250] In some embodiments, the GPRC5D antibody or its Fc domain is of IgG2 subclass andthe heterodimerization approach described in WO 2010 / 129304 is used alternatively.

[0251] In some embodiments, a modification promoting association of the first and the secondsubunit of the Fc domain comprises a modification mediating electrostatic steering effects, e.g. as described in PCT publication WO 2009 / 089004. Generally, this method involves replacement of one or more amino acid residues at the interface of the two Fc domain subunits by charged amino acid residues so that homodimer formation becomes electrostatically unfavorable but heterodimerization electrostatically favorable. In one such embodiment, a first CH3 domainAttorney Docket No.: JBI6924WOPCT1 comprises amino acid substitution of K392 or N392 with a negatively charged amino acid (e.g. glutamic acid I, or aspartic acid (D), preferably K392D or N392D) and a second CH3 domain comprises amino acid substitution of D399, E356, D356, or E357 with a positively charged amino acid (e.g. lysine (K) or arginine I, preferably D399K, E356K, D356K, or E357K, and more preferably D399K and E356K). In a further embodiment, the first CH3 domain further comprises amino acid substitution of K409 or R409 with a negatively charged amino acid (e.g., glutamic acid I, or aspartic acid (D), preferably K409D or R409D). In a further embodiment the first CH3 domain further or alternatively comprises amino acid substitution of K439 and / or K370 with a negatively charged amino acid (e.g., glutamic acid I, or aspartic acid (D)) (all numberings according to Kabat EU index).

[0252] In some embodiments, the heterodimerization approach described in WO 2007 / 147901 isused alternatively. In some embodiments, a first CH3 domain comprises amino acid mutations K253E, D282K, and K322D and a second CH3 domain comprises amino acid mutations D239K, E240K, and K292D (numberings according to Kabat EU index).

[0253] In some embodiments, the heterodimerization approach described in WO 2007 / 110205can be used alternatively.

[0254] In some embodiments, the first subunit of the Fc domain comprises amino acidsubstitutions K392D and K409D, and the second subunit of the Fc domain comprises amino acid substitutions D356K and D399K (numbering according to Kabat EU index). MONOVALENT ANTIBODIES

[0255] In one aspect, provided herein are monovalent antibodies or fragments thereofspecifically binding GPRC5D that carry RE mutations in the Fc region of the monovalent antibodies. As demonstrated in the EXAMPLES section, the combination of the monovalency with the RE mutations further enhances the CDC activity as compared with the RE mutations alone, among other advantages.

[0256] CDC activity requires the activation of the complement cascade, which in turn requiresactivation of complement component Clq by a hexamer of Fc regions co-planar to the surface of the target cell. This in turn requires concurrent binding of five or six antibody molecules in close proximity on the cell surface. Due to the requirement for Fc-mediated antibody oligomerization, CDC activity requires relatively high target receptor densities. With natural IgG antibodies, theAttorney Docket No.: JBI6924WOPCT1 stoichiometry of antibody -to-receptor binding can vary from 1:2 to 1:1 depending on antibody concentration, with the former highly favored due to avidity.

[0257] To maximize the number of antibodies that can bind a given number of cell surfacereceptors, the antibodies provided herein are formatted as monovalent antibodies to force 1:1 antibody-to-receptor binding stoichiometry. This allows more Fc regions to be brought to the surface of the cell with a given number of receptors compared to the natural bivalent IgG. The monovalent antibodies provided herein have more potent CDC activity than their natural bivalent counterparts.

[0258] Standard techniques known to those of skill in the art can be used to formatan antibody as monovalent antibody, including, for example, in vitro expression of recombinant proteins.

[0259] Any monovalent antibody format may be applied in the present constructs as long as theformat confers further enhanced CDC activity via increased oligomerization (e.g., hexamerization) of the binding molecules at a cell surface and / or increased Clq engagement.

[0260] In some embodiments, the monovalent GPRC5D antibody comprises one antigen-bindingarm of no known specificity and another antigen-binding arm specific for GPRC5D.

[0261] In some embodiments, the monovalent GPRC5D antibody comprises an antigen-bindingarm specific for GPRC5D, one antigen-binding arm of no known specificity or left without one binding arm.

[0262] In some embodiments, the GPRC5D binding domain of the monovalent GPRC5Dantibody comprises a VH region and / or a VL region. In some embodiments, the GPRC5D binding domain of the monovalent antibody comprises a Fab fragment. In some embodiment, the GPRC5D binding domain of the monovalent GPRC5D antibody comprises a scFv. In some embodiments, the GPRC5D binding domain of the monovalent antibody comprises a single VH domain. In some embodiment, the GPRC5D binding domain of the monovalent GPRC5D antibody comprises a single VL domain. In some embodiment, the GPRC5D binding domain of the monovalent GPRC5D antibody comprises a protein domain specific for GPRC5D.

[0263] In some embodiments, the GPRC5D antibody or antigen binding fragment thereof is amonovalent antibody or an antigen binding fragment thereof.

[0264] In some embodiments, the monovalent antibody or the antigen-binding fragment thereofcomprises an Fc domain and a Fab.Attorney Docket No.: JBI6924WOPCT1

[0265] In some embodiments, the monovalent antibody or antigen binding fragment thereofcomprises:a. a heavy chain complementarity determining region 1 (CDR1), a heavy chaincomplementarity determining region 2 (CDR2), and a heavy chain complementarity determining region 3 (CDR3) comprising the amino acid sequences of SEQ ID NO: 6, 7, and 8, respectively; and a light chain complementarity determining region 1 (CDR1), a light chain complementarity determining region 2 (CDR2), and a light chain complementarity determining region 3 (CDR3) comprising the amino acid sequences of SEQ ID NO: 9, 10, and 11, respectively;b. a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprising theamino acid sequences of SEQ ID NO: 12, 13, and 8, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 9, 10, and 11, respectively;c. a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprising theamino acid sequences of SEQ ID NO: 14, 15, and 8, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 9, 10, and 11, respectively;d. a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprising theamino acid sequences of SEQ ID NO: 16, 17, and 18, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 19, 20, and 11, respectively; ore. a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprising theamino acid sequences of SEQ ID NO: 21, 22, and 23, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 24, 25, and 26, respectively.

[0266] In some embodiments, the monovalent antibody or antigen binding fragment thereofcomprises a heavy chain variable region (VH) comprising an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1. In some embodiments, the monovalent antibody or antigen binding fragment thereof comprises a VH comprising SEQ ID NO: 1.Attorney Docket No.: JBI6924WOPCT1

[0267] In some embodiments, the monovalent antibody or antigen binding fragment thereofcomprises a light chain variable region (VL) comprising an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2. In some embodiments, the monovalent antibody or antigen binding fragment thereof comprises a VL comprising SEQ ID NO: 2.

[0268] In some embodiments, the monovalent antibody or antigen binding fragment thereofcomprises a heavy chain variable region (VH) comprising SEQ ID NO: 1, and a light chain variable region (VL) comprising SEQ ID NO: 2.

[0269] In some embodiments, the monovalent antibody or the antigen-binding fragment thereofcomprises a first heavy chain (HC1), a second heavy chain (HC2), and a second light chain (LC2). In some embodiments, the monovalent GPRC5D antibody comprises a Fab and a Fc domain, wherein the monovalent GPRC5D antibody comprises a first heavy chain (HC1), a second heavy chain (HC2) and a second light chain (LC2), wherein the HC1 and HC2 form the Fc domain, and the HC2 and the LC2 form the Fab.

[0270] In some embodiments, the monovalent GPRC5D antibody, or antigen-binding fragmentthereof, comprises a first heavy chain (HC1) comprising an amino acid sequence that is substantially the same as, or identical to, SEQ ID NO: 3. In some embodiments, the HC1 of the monovalent antibody or the antigen binding fragment thereof comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 3. In some embodiments, the heavy chain comprises SEQ ID NO: 3. In some embodiments, the heavy chain consists of SEQ ID NO: 3.

[0271] In some embodiments, the monovalent GPRC5D antibody, or antigen-binding fragmentthereof, comprises a second heavy chain (HC2) comprising an amino acid sequence that is substantially the same as, or identical to, SEQ ID NO: 4. In some embodiments, the HC2 of the monovalent antibody or the antigen binding fragment thereof comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4. In some embodiments, the heavy chain comprises SEQ ID NO: 4. In some embodiments, the heavy chain consists of SEQ ID NO: 4.

[0272] In some embodiments, the monovalent GPRC5D antibody, or antigen-binding fragmentthereof, comprises a second light chain (LC2) comprising an amino acid sequence that is substantially the same as, or identical to, SEQ ID NO: 5. In some embodiments, the LC2 of theAttorney Docket No.: JBI6924WOPCT1 monovalent antibody or the antigen binding fragment thereof comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5. In some embodiments, the heavy chain comprises SEQ ID NO: 5. In some embodiments, the heavy chain consists of SEQ ID NO: 5.

[0273] In some embodiments, the monovalent GPRC5D antibody comprises a first heavy chaincomprising SEQ ID NO: 3, a second heavy chain comprising SEQ ID NO: 4, and a second light chain comprising SEQ ID NO: 5.

[0274] In some embodiments, the monovalent GPRC5D antibody comprises a scFv and a Fcdomain, wherein the monovalent GPRC5D antibody comprises two polypeptides; wherein the first polypeptide comprises the scFv at the N-terminus and a domain at the C-terminus that forms the Fc domain with the second polypeptides.

[0275] In some embodiments, the monovalent GPRC5D antibody comprises a single VH domainand a Fc domain, wherein the monovalent GPRC5D antibody comprises two polypeptides; wherein the first polypeptide comprises the single VH domain at the N-terminus and a domain at the C-terminus that forms the Fc domain with the second polypeptides.

[0276] In some embodiments, the monovalent GPRC5D antibody comprises a single VL domainand a Fc domain, wherein the monovalent GPRC5D antibody comprises two polypeptides; wherein the first polypeptide comprises the single VL domain at the N-terminus and a domain at the C-terminus that forms the Fc domain with the second polypeptides.

[0277] In some embodiments, the monovalent GPRC5D antibody comprises a protein domainspecific for GPRC5D and a Fc domain, wherein the monovalent antibody comprises two polypeptides; wherein the first polypeptide comprises the protein domain specific for GPRC5D at the N- terminus and a domain at the C-terminus that forms the Fc domain with the second polypeptides. AFUCOSYLATION

[0278] Antibody glycosylation is a type of posttranslational modification that may occur via theaddition of oligosaccharides to antibodies through two types of covalent linkages: linkages on asparagine residues (N-oligosaccharides) or on serine / threonine residues (O-oligosaccharides) (Alter, G., et al., Semin Immunol., 2018, 39:102-10), and profoundly affect therapeutic functions of antibodies (Walsh, G. and Jefferis, R., Nat. Biotechnol., 2006, 24:1241-52; Jefferis, R., Nat.Attorney Docket No.: JBI6924WOPCT1 Rev. Drug Discov., 2009, 8(3):226-34; Dalziel, M., et al., Science, 2014, 343(6166):1235681). Notably, all IgG antibodies are glycosylated in the Fc region thereof on a conserved Asn-297 residue (Alter G., et al., supra).

[0279] An Asn-297-linked N-oligosaccharide is comprised of a conserved biantennary corestructure (Liu, L., J Pharm Sci., 2015, 104(6):1866-84) consisting of two covalently-linked N- acetylglucosamine (GlcNAc) residues, further linked to a mannose, which links in a 1,3- and 1,6- branching manner to two other mannose residues (Alter, G., et al., supra). Additional monosaccharides, including two galactoses, a fucose, a bisecting GlcNAc, and two sialic acids (Alter, G., et al., supra), may extend the core structure, giving rise to considerable structural and functional heterogeneity (Jefferis, R., Biochem J., 1990, 268(3):529-37; Rudd, P. M., Science, 2001, 291(5512):2370-6; Liu, L., supra). At least 30 structures (glycoforms) for IgG Asn-297- linked N-oligosaccharides have been reported (Alter, G., et al., supra).

[0280] Antibodies expressed in mammalian cells are usually more than 80% fucosylated(Kamoda, S., et al., J Chromatogr A., 2004, 1050(2):211-6; Shinkawa, T., et al., J Biol Chem., 2003, 278(5):3466-73). For example, normal Chinese Hamster Ovary (CHO) cells and HEK293 cells add fucose to 80-98% of Asn-297-linked N-oligosaccharides to IgG antibodies (Shields, R. L. et al., J Biol Chem., 2002, 277(30):26733-40).

[0281] In one aspect, provided herein is a GPRC5D antibody having no fucose in theoligosaccharide attached to its Fc region and having RE mutations in the Fc region. In another aspect, provided herein is a GPRC5D antibody having no fucose in the oligosaccharide attached to its Fc region and having RE mutations in the Fc region.

[0282] Standard techniques known to those of skill in the art, e.g., mass spectrometry, can beused to characterize the Asn297-linked N-oligosaccharides on the antibodies (Pereira, N. A., et al., supra; Shields, R. L. et al., supra). For example, in a matrix-assisted laser desorption / ionization time-of-flight mass spectral (MALDI-TOF-MS) analysis, 50 mg of IgG antibodies were immobilized in MultiScreen 96-well IP plates (Millipore) to polyvinylidene difluoride membranes. Proteins were then reduced using 50 mL of a 0.1 M solution of DTT in RCM buffer (pH 8.6, 3.2 mM EDTA, 360 mM Tris, and 8 M urea). Next, they were incubated in the dark for 30 minutes at 25 °C in RCM buffer containing 0.1 M iodoacetic acid, in order to carboxymethylate the free sulfhydryl groups resulting from the reduction step. Membrane-bound proteins were then incubated for 1 hour at 25 °C in a 1% solution of polyvinylpyrrolidone 360Attorney Docket No.: JBI6924WOPCT1 (Sigma) in water, and their oligosaccharides were cleaved from the proteins by a three-step process: incubation for 3 hours at 37 °C in pH 8.4 Tris acetate buffer (25 mL) containing 32 units of peptide:N-glycosidase F (New England Biolabs, Beverly, MA), addition of 1.5 M acetic acid (2.5 mL) to lower the pH, and incubation for 3 hours at 25 °C (Shields, R. L. et al., J Biol Chem., 2001, 276(9):6591-604).

[0283] In some embodiments, the GPRC5D antibodies provided herein are produced byexpressing a polynucleotide encoding the GPRC5D antibodies or a fragment thereof in a host cell that is deficient in adding a fucose to an oligosaccharide attached to an antibody.

[0284] In mammalian cells, FUT8 encodes the only enzyme, α-1,6 fucosyltransferase, thatcatalyzes core fucosylation, the transfer of a GDP-fucose residue to the innermost GlcNAc via α- 1,6-linkage (Imai-Nishiya, H., et al., BMC Biotechnol., 2007, 7:84). Oligosaccharide fucosylation requires intracellular GDP-fucose as substrate, which is synthesized via the de novo pathway or the salvage pathway in the cytoplasm. In the de novo pathway, GDP-mannose 4,6- dehydratase (GMD) mediates the synthesis of GDP-4-keto-6-deoxy-mannose (GKDM) from GDP-mannose, followed by the synthesis of GDP-fucose mediated by GDP-keto-6- deoxymannose 3,5-epimerase, 4-reductase (FX) (Imai-Nishiya, H., et al., supra). As such, cell lines with deficient GMD enzymes, e.g., CHO Lec13 cells, or reduced α-1,6 fucosyltransferase activity resulting from mutated FUT8 genes, have been shown to generate afucosylated antibodies (Pereira, N. A., et al., Mabs, 2018, 10(5):693-711). For example, antibodies with approximately 10% fucosylation (Shields, R. L. et al., supra) or less can be consistently produced in Lec13 cells (Shields, R. L. et al., supra; Kanda Y., Biotechnol Bioeng., 2006, 94(4):680–8), while increased fucosylation may occur when cells are cultured in a static flask to confluence (Pereira, N. A., et al., supra).

[0285] The addition of a bisecting GlcNAc to the oligosaccharide core structure creates sterichindrance for fucosylation (Alter, G., et al., supra). As such, overexpression of β-1,4-mannosyl- glycoprotein 4-β-N-acetylglucosaminyltransferase (GnT-III), which catalyzes the addition of a bisecting GlcNAc to the innermost mannose, was shown to dramatically reduce Fc fucosylation (Pereira, N. A., et al., supra).

[0286] Moreover, inactivated Golgi GDP-fucose transporter (GFT) gene (Slc35c1) has beenshown to produce afucosylated antibodies, e.g., in CHO-gmt3 cells (Pereira, N. A., et al., supra). Use of biochemical inhibitors of fucosylation, e.g., fucose analogs such as 2-fluorofucose and 5-Attorney Docket No.: JBI6924WOPCT1 alkynylfucose, can also generate afucosylated antibodies (Pereira, N. A., et al., supra). The intermediate GKDM in the de novo fucose synthesis pathway in mammalian cells can be reduced by bacteria GDP-4-keto-6-deoxy mannose reductase (RMD) to GDP-rhamnose, thus bypassing the fucose biosynthesis pathway. Afucosylated antibodies can also be generated in cells in which bacterial RMD is heterologously expressed in the cytosol (Pereira, N. A., et al., supra).

[0287] In some embodiments, the antibodies provided herein are produced by expressing theantibodies in a host cell having a deficiency in any of the above mentioned enzymes. In some embodiments, the host cell has reduced GDP-mannose 4,6-dehydratase (GMD) activity. In some embodiments, the host cell has reduced α-1,6 fucosyltransferase activity. PREPARATION OF ANTIBODIES AND METHOD OF MAKING

[0288] Methods of preparing antibodies have been described. See, e.g., Els Pardon et al, NatureProtocol, 9(3): 674 (2014). Antibodies (such as scFv fragments) may be obtained using methods known in the art such as by immunizing a Camelid species (such as camel or llama) and obtaining hybridomas therefrom, or by cloning a library of antibodies using molecular biology techniques known in the art and subsequent selection by ELISA with individual clones of unselected libraries or by using phage display.

[0289] GPRC5D antibodies provided herein may be produced by culturing cells transformed ortransfected with a vector containing an antibody-encoding nucleic acids. Polynucleotide sequences encoding polypeptide components of the GPRC5D antibody of the present disclosure can be obtained using standard recombinant techniques. Desired polynucleotide sequences may be isolated and sequenced from antibody producing cells such as hybridomas cells or B cells. Alternatively, polynucleotides can be synthesized using nucleotide synthesizer or PCR techniques. Once obtained, sequences encoding the polypeptides are inserted into a recombinant vector capable of replicating and expressing heterologous polynucleotides in host cells. Many vectors that are available and known in the art can be used for the purpose of the present disclosure. Selection of an appropriate vector will depend mainly on the size of the nucleic acids to be inserted into the vector and the particular host cell to be transformed with the vector. Host cells suitable for expressing antibodies of the present disclosure include prokaryotes such as Archaebacteria and Eubacteria, including Gram-negative or Gram-positive organisms, eukaryotic microbes such as filamentous fungi or yeast, invertebrate cells such as insect or plant cells, andAttorney Docket No.: JBI6924WOPCT1 vertebrate cells such as mammalian host cell lines. Host cells are transformed with the above- described expression vectors and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences. GPRC5D antibodies produced by the host cells are purified using standard protein purification methods as known in the art.

[0290] Methods for antibody production including vector construction, expression, andpurification are further described in Plückthun et al., Antibody Engineering: Producing antibodies in Escherichia coli: From PCR to fermentation 203-52 (McCafferty et al. eds., 1996); Kwong and Rader, E. coli Expression and Purification of Fab Antibody Fragments, in Current Protocols in Protein Science (2009); Tachibana and Takekoshi, Production of Antibody Fab Fragments in Escherichia coli, in Antibody Expression and Production (Al-Rubeai ed., 2011); and Therapeutic Monoclonal Antibodies: From Bench to Clinic (An ed., 2009).

[0291] It is, of course, contemplated that alternative methods, which are well known in the art,may be employed to prepare anti-GPRC5D antibodies. For instance, the appropriate amino acid sequence, or portions thereof, may be produced by direct peptide synthesis using solid-phase techniques (see, e.g., Stewart et al., Solid-Phase Peptide Synthesis (1969); and Merrifield, J. Am. Chem. Soc.85:2149-54 (1963)). In vitro protein synthesis may be performed using manual techniques or by automation. Various portions of the anti-GPRC5D antibody may be chemically synthesized separately and combined using chemical or enzymatic methods to produce the desired anti-GPRC5D antibody. Alternatively, antibodies or fusion constructs may be purified from cells or bodily fluids, such as milk, of a transgenic animal engineered to express the antibody, as disclosed, for example, in U.S. Pat. Nos.5,545,807 and 5,827,690. PHARMACEUTICAL COMPOSITIONS

[0292] In one aspect, the present disclosure further provides pharmaceutical compositionscomprising at least one GPRC5D antibody, or antigen binding fragment thereof, of the present disclosure. In some embodiments, a pharmaceutical composition comprises a therapeutically effective amount of a GPRC5D antibody or antigen binding fragment thereof provided herein and a pharmaceutically acceptable excipient. In another aspect, the present disclosure further provides pharmaceutical compositions comprising at least one monovalent GPRC5D antibody, or antigen binding fragment thereof, of the present disclosure. In some embodiments, aAttorney Docket No.: JBI6924WOPCT1 pharmaceutical composition comprises a therapeutically effective amount of a monovalent GPRC5D antibody or antigen binding fragment thereof provided herein and a pharmaceutically acceptable excipient.

[0293] Pharmaceutical compositions comprising a GPRC5D antibody, a monovalent GPRC5Dantibody, or antigen binding fragment thereof are prepared for storage by mixing the fusion protein having the desired degree of purity with optional physiologically acceptable excipients(see, e.g., Remington, Remington’s Pharmaceutical Sciences (18th ed. 1980)) in the form ofaqueous solutions or lyophilized or other dried forms.

[0294] The GPRC5D antibody, a monovalent GPRC5D antibody, or antigen binding fragmentthereof, of the present disclosure may be formulated in any suitable form for delivery to a target cell / tissue, e.g., as microcapsules or macroemulsions (Remington, supra; Park et al., 2005, Molecules 10:146-61; Malik et al., 2007, Curr. Drug. Deliv.4:141-51), as sustained release formulations (Putney and Burke, 1998, Nature Biotechnol.16:153-57), or in liposomes (Maclean et al., 1997, Int. J. Oncol.11:325-32; Kontermann, 2006, Curr. Opin. Mol. Ther.8:39-45).

[0295] A GPRC5D antibody, a monovalent GPRC5D antibody, or antigen binding fragmentthereof provided herein can also be entrapped in microcapsule prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsule and poly-(methylmethacylate) microcapsule, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano- particles, and nanocapsules) or in macroemulsions. Such techniques are disclosed, for example, in Remington, supra.

[0296] Various compositions and delivery systems are known and can be used with an antibodyor antigen binding fragment thereof or fusion construct as described herein. METHODS OF USING THE GPRC5D ANTIBODIES

[0297] In one aspect, provided herein is a method of inhibiting the growth or proliferation of amultiple myeloma comprising administering to the subject the GPRC5D antibodies (including the GPRC5D monovalent antibodies) provided herein to inhibit the growth or proliferation of the multiple myeloma.

[0298] In some embodiments, the GPRC5D antibody provided herein inhibits the growth orproliferation of a multiple myeloma by at least about 10%. In some embodiments, the GPRC5DAttorney Docket No.: JBI6924WOPCT1 antibody provided herein inhibits the growth or proliferation of a multiple myeloma by at least about 20%. In some embodiments, the GPRC5D antibody provided herein inhibits the growth or proliferation of a multiple myeloma by at least about 30%. In some embodiments, the GPRC5D antibody provided herein inhibits the growth or proliferation of a multiple myeloma by at least about 40%. In some embodiments, the GPRC5D antibody provided herein inhibits the growth or proliferation of a multiple myeloma by at least about 50%. In some embodiments, the GPRC5D antibody provided herein inhibits the growth or proliferation of a multiple myeloma by at least about 60%. In some embodiments, the GPRC5D antibody provided herein inhibits the growth or proliferation of a multiple myeloma by at least about 70%. In some embodiments, the GPRC5D antibody provided herein inhibits the growth or proliferation of a multiple myeloma by at least about 80%. In some embodiments, the GPRC5D antibody provided herein inhibits the growth or proliferation of a multiple myeloma by at least about 90%. In some embodiments, the GPRC5D antibody provided herein inhibits the growth or proliferation of a multiple myeloma by at least about 95%.

[0299] In another aspect, provided herein is a method of treating a multiple myeloma comprisingadministering to the subject a GPRC5D antibody or antigen binding fragment thereof provided herein. In another aspect, provided herein is a method of treating a multiple myeloma comprising administering to the subject a monovalent GPRC5D antibody or antigen binding fragment thereof provided herein. In another aspect, provided herein is a method of treating a multiple myeloma in a subject in need thereof, the method comprising administering a therapeutically effective amount of a monovalent antibody or an antigen-binding fragment thereof specifically binding to GPRC5D, comprising a first heavy chain comprising SEQ ID NO: 3, a second heavy chain comprising SEQ ID NO: 4, and a second light chain comprising SEQ ID NO: 5. In another aspect, provided herein is a method of treating a multiple myeloma in a subject in need thereof, the method comprising administering a therapeutically effective amount of a pharmaceutical composition comprising the antibody, the monovalent antibody, or the antigen-binding fragment thereof of as provided herein, and a pharmaceutically acceptable carrier.

[0300] In some embodiments, the multiple myeloma is refractory. In some embodiments, themultiple myeloma is relapsed. In some embodiments, the multiple myeloma is refractory and relapsed.Attorney Docket No.: JBI6924WOPCT1

[0301] Methods of administration and dosing is described in more detail below.

[0302] In another aspect, provided herein is the use of the GPRC5D antibody or antigen bindingfragment provided herein in the manufacture of a medicament for treating a disease or disorder in a subject. In another aspect, provided herein is the use of the monovalent GPRC5D antibody or antigen binding fragment provided herein in the manufacture of a medicament for treating a disease or disorder in a subject.

[0303] In another aspect, provided herein is the use of a pharmaceutical composition providedherein in the manufacture of a medicament for treating a multiple myeloma in a subject.

[0304] In another aspect, provided herein is the use of a GPRC5D antibody (including amonovalent GPRC5D antibody) or antigen binding fragment thereof provided herein in the manufacture of a medicament, wherein the medicament is for use in a method for detecting the presence of a GPRC5D in a biological sample, the method comprising contacting the biological sample with the GPRC5D antibody under conditions permissive for binding of the GPRC5D antibody to the GPRC5D protein, and detecting whether a complex is formed between the antibody and the GPRC5D protein.

[0305] In some embodiments, the multiple myeloma is characterized by the expression ofGPRC5D. In some embodiments, the multiple myeloma is relapsed. In some embodiments, the multiple myeloma is refractory. In some embodiments, the multiple myeloma is relapsed and refractory.

[0306] In some embodiments, the antibody, the monovalent antibody, or the antigen bindingfragment thereof is administered to the subject as a monotherapy to treat the multiple myeloma.

[0307] In some embodiments, the subject is a human subject. In some embodiments, the subjectis eighteen years of age or older.

[0308] In some embodiments, the subject has received at least one prior line of therapy formultiple myeloma. In some embodiments, the at least one prior line of therapy for multiple myeloma comprises one or more of a proteasome inhibitor, an immunomodulatory agent and / or an anti-CD38 monoclonal antibody.

[0309] In some embodiments, prior to the administration of the antibody or the antigen-bindingfragment thereof specifically binding to GPRC5D, the subject has one or more of: a) a serum monoclonal paraprotein (M-protein) level >0.5 g / dL; b) a urine M-protein level >200 mg / 24 hours; c) a light chain multiple myeloma: serum immunoglobulin free light chain (FLC)Attorney Docket No.: JBI6924WOPCT1 >10 mg / dL and abnormal serum immunoglobulin kappa-lambda FLC ratio; d) hemoglobin ≥8 g / dL (≥5 mmol / L) without a red blood cell transfusion within 7 days of being tested; e) absolute neutrophil count ≥1×109 / L without use of granulocyte colony stimulating factor (G- CSF) within 7 days of being tested; or f) platelets ≥50×109 / L without transfusion support within 7 days of being tested.

[0310] In some embodiments, prior to the administration of the antibody or the antigen-bindingfragment thereof specifically binding to GPRC5D, the subject does not have: a) active plasma cell leukemia, Waldenström’s macroglobulinemia, polyneuropathy, organomegaly, endocrinopathy, M-protein, and skin changes syndrome (POEMS), or immunoglobulin light chain amyloidosis; b) non-hematologic toxicity from prior anticancer therapy that has not resolved to baseline level or to ≤Grade 1; c) known loss of expression of GPRC5D antigen; d) known allergies, hypersensitivity, or intolerance to excipients of the antibody, the monovalent antibody or the antigen-binding fragment thereof; or e) pulmonary compromise requiring supplemental oxygen used to maintain adequate oxygenation.

[0311] In some embodiments, there is no or minimal natural killer (NK) cell fratricide.

[0312] In some embodiments, the antibody, the monovalent antibody, or the antigen-bindingfragment thereof is administered to the subject in a therapeutically effective amount.

[0313] In some embodiments, the therapeutically effective amount of the antibody, themonovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of at least about 20 mg per dose administration. In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen- binding fragment thereof comprises or is a therapeutically effective dose of about 20 mg to about 1700 mg per dose administration. In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose ranging from about 20 mg to about 1620 mg per dose administration. In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 50 mg to about 1700 mg per dose administration. In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen- binding fragment thereof comprises or is a therapeutically effective dose of about 100 mg to about 1700 mg per dose administration. In some embodiments, the therapeutically effectiveAttorney Docket No.: JBI6924WOPCT1 amount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 105 mg to about 250 mg per dose administration. In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 250 mg to about 1700 mg per dose administration. In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose ranging from about 350 mg to about 840 mg per dose administration. In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen- binding fragment thereof comprises or is a therapeutically effective dose of about 500 mg to about 1700 mg per dose administration. In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 1000 mg to about 1700 mg per dose administration.

[0314] In some embodiments, the therapeutically effective amount of the antibody, themonovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 20 mg per dose administration, In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 60 mg per dose administration. In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 180 mg per dose administration. In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 540 mg per dose administration. In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 1620 mg per dose administration.

[0315] In some embodiments, the antibody, the monovalent antibody, or the antigen-bindingfragment thereof comprises or is a therapeutically effective dose ranging from about 5 mg / kg to about 12 mg / kg per dose administration.Attorney Docket No.: JBI6924WOPCT1

[0316] In some embodiments, the antibody, the monovalent antibody, or the antigen-bindingfragment thereof is administered subcutaneously. In some embodiments, the therapeutically effective dose of the antibody, the monovalent antibody, or the antigen-binding fragment thereof is administered at a frequency ranging from once every three to weeks to once every week, for example once every three weeks, once every two weeks, or once every week, for example once every two weeks until remission of multiple myeloma is achieved in a subject. In some embodiments, the therapeutically effective dose of the antibody, the monovalent antibody, or the antigen-binding fragment thereof is administered until remission of multiple myeloma is achieved in a subject.

[0317] In some embodiments, the method achieves a partial response (PR), very good partialresponse (VGPR), complete response (CR) or stringent complete response (sCR) in the subject, according to International Myeloma Working Group (IMWG criteria). In some embodiments, the method achieves a very good partial response (VGPR), complete response (CR) or stringent complete response (sCR) in the subject, according to IMWG criteria. In some embodiments, the method achieves a complete response (CR) or stringent complete response (sCR) in the subject, according to IMWG criteria. In some embodiments, the method achieves a stringent complete response (sCR) in the subject, according to IMWG criteria.

[0318] In some embodiments, the method does not induce a Treatment-Related toxicity in thesubject. In some embodiments, the probability that the Dose Limiting Toxicity (DLT) rate is of 28%, or exceeds 28% in a cohort of at least 20 subjects is lower than 95%. In some embodiments, the cancer is significantly reduced in the subject. In some embodiments, the method increases the Overall Response Rate (ORR). In some embodiments, the ORR includes the proportion of patients whose tumor is significantly reduced or is destroyed in a cohort of at least 20 patients, compared to a prior line of therapy. In some embodiments, the treatment increases the Progression Free Survival (PFS) in the subject, particularly compared to a prior line of therapy. In some embodiments, the treatment increases the Duration of response (DoR). In some embodiments, the DoR is the length of time that a tumor continues to respond to treatment without the cancer growing or spreading in the subject, particularly compared to a prior line of therapy. In some embodiments, the prior line of therapy comprises one or more of: an administration of a proteasome inhibitor, an immunomodulatory agent, and an anti-CD38 therapy. In some embodiments, the method comprises the administration of a prior orAttorney Docket No.: JBI6924WOPCT1 concomitant therapy, such as the administration of a glucocorticoid, an antihistamine, an antipyretic, a H2-antagonist, and / or an anti-emetic. In some embodiments, the prior or concomitant therapy comprises a glucocorticoid, an antihistamine, an antipyretic, a H2- antagonist, and / or an anti-emetic. In some embodiments, the multiple myeloma is a relapsed and / or refractory multiple myeloma. In some embodiments, the subject is a human subject.

[0319] In other aspects, the antibodies and fragments thereof or fusion construct of the presentdisclosure are useful for detecting the expression of GPRC5D in a biological sample. The term “detecting” as used herein encompasses quantitative or qualitative detection. In certain embodiments, a biological sample comprises bodily fluid, a cell, or a tissue. Diagnostic assays and methods are described in more detail below. METHODS OF ADMINISTRATION AND DOSING

[0320] In a specific embodiment, provided herein is a composition for use in the preventionand / or treatment of a multiple myeloma comprising a GPRC5D antibody (including a monovalent GPRC5D antibody) or antigen binding fragment thereof provided herein. In one embodiment, provided herein is a composition for use in the treatment of a multiple myeloma, wherein the composition comprises a GPRC5D antibody (including a monovalent GPRC5D antibody) or antigen binding fragment thereof provided herein. In certain embodiments, the subject is a subject in need thereof. In some embodiments, the subject has the multiple myeloma.

[0321] Also provided herein are methods of treating a multiple myeloma by administrating to asubject of a GPRC5D antibody (including a monovalent GPRC5D antibody) or antigen binding fragment thereof provided herein, or pharmaceutical composition comprising an antibody or antigen binding fragment thereof provided herein. In one aspect, the GPRC5D antibody or antigen binding fragment thereof is substantially purified (i.e., substantially free from substances that limit its effect or produce undesired side-effects). The subject administered a therapy can be a mammal such as non-primate (e.g., cows, pigs, horses, cats, dogs, rats etc.) or a primate (e.g., a monkey, such as a cynomolgus macaque monkey, or a human). In one embodiment, the subject is a human. In another embodiment, the subject is a human with a multiple myeloma. In some embodiments, the multiple myeloma is characterized by the expression of GPRC5D. In someAttorney Docket No.: JBI6924WOPCT1 embodiments, the multiple myeloma is relapsed. In some embodiments, the multiple myeloma is refractory. In some embodiments, the multiple myeloma is relapsed and refractory.

[0322] Various delivery systems are known and can be used to administer a prophylactic ortherapeutic agent (e.g., an antibody or antigen binding fragment thereof provided herein). The prophylactic or therapeutic agents, or compositions may be administered by any convenient route. Administration can be systemic or local.

[0323] In a specific embodiment, it may be desirable to administer a prophylactic or therapeuticagent, or a pharmaceutical composition provided herein locally to the area in need of treatment.

[0324] In a specific embodiment, where the composition provided herein is a nucleic acidencoding a prophylactic or therapeutic agent (e.g., an antibody or antigen binding fragment thereof provided herein), the nucleic acid can be administered in vivo to promote expression of its encoded prophylactic or therapeutic agent, by constructing it as part of an appropriate nucleic acid expression vector and administering it so that it becomes intracellular. Alternatively, a nucleic acid can be introduced intracellularly and incorporated within host cell DNA for expression by homologous recombination.

[0325] The compositions provided herein include bulk drug compositions useful in themanufacture of pharmaceutical compositions (e.g., compositions that are suitable for administration to a subject or patient) that can be used in the preparation of unit dosage forms. In an embodiment, a composition provided herein is a pharmaceutical composition. Such compositions comprise a prophylactically or therapeutically effective amount of one or more prophylactic or therapeutic agents (e.g., an antibody or antigen binding fragment thereof provided herein or other prophylactic or therapeutic agent), and a pharmaceutically acceptable excipient. The pharmaceutical compositions can be formulated to be suitable for the route of administration to a subject.

[0326] In a specific embodiment, the term “excipient” can also refer to a diluent, adjuvant (e.g.,Freunds’ adjuvant (complete or incomplete) or vehicle.

[0327] In certain embodiments, the GPRC5D antibody or antigen binding fragment thereofprovided herein are administered prophylactically or therapeutically to a subject. The GPRC5D antibody or antigen binding fragment thereof provided herein can be prophylactically or therapeutically administered to a subject so as to prevent, lessen or ameliorate a multiple myeloma or symptom thereof.Attorney Docket No.: JBI6924WOPCT1

[0328] In some embodiments, the antibody, the monovalent antibody, or the antigen bindingfragment thereof is administered to the subject as a monotherapy to treat the multiple myeloma.

[0329] In some embodiments, the antibody, the monovalent antibody, or the antigen-bindingfragment thereof is administered to the subject in a therapeutically effective amount.

[0330] In some embodiments, the therapeutically effective amount of the antibody, themonovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of at least about 20 mg per dose administration. In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen- binding fragment thereof comprises or is a therapeutically effective dose of about 20 mg to about 1700 mg per dose administration. In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose ranging from about 20 mg to about 1620 mg per dose administration. In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 50 mg to about 1700 mg per dose administration. In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen- binding fragment thereof comprises or is a therapeutically effective dose of about 100 mg to about 1700 mg per dose administration. In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 105 mg to about 250 mg per dose administration. In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 250 mg to about 1700 mg per dose administration. In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose ranging from about 350 mg to about 840 mg per dose administration. In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen- binding fragment thereof comprises or is a therapeutically effective dose of about 500 mg to about 1700 mg per dose administration. In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen-binding fragment thereofAttorney Docket No.: JBI6924WOPCT1 comprises or is a therapeutically effective dose of about 1000 mg to about 1700 mg per dose administration.

[0331] In some embodiments, the therapeutically effective amount of the antibody, themonovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 20 mg per dose administration, In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 60 mg per dose administration. In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 180 mg per dose administration. In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 540 mg per dose administration. In some embodiments, the therapeutically effective amount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 1620 mg per dose administration.

[0332] In some embodiments, the therapeutically effective amount of the antibody, themonovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose ranging from about 5 mg / kg to about 12 mg / kg.

[0333] In some embodiments, the antibody, the monovalent antibody, or the antigen-bindingfragment thereof is administered subcutaneously. In some embodiments, the therapeutically effective dose of the antibody, the monovalent antibody, or the antigen-binding fragment thereof is administered at a frequency ranging from once every three to weeks to once every week, for example once every three weeks, once every two weeks, or once every week, for example once every two weeks until remission of multiple myeloma is achieved in a subject. In some embodiments, the therapeutically effective dose of the antibody, the monovalent antibody, or the antigen-binding fragment thereof is administered until remission of multiple myeloma is achieved in a subject.

[0334] In some embodiments, the method achieves a partial response (PR), very good partialresponse (VGPR), complete response (CR) or stringent complete response (sCR) in the subject, according to International Myeloma Working Group (IMWG criteria). In some embodiments, the method achieves a very good partial response (VGPR), complete response (CR) or stringentAttorney Docket No.: JBI6924WOPCT1 complete response (sCR) in the subject, according to IMWG criteria. In some embodiments, the method achieves a complete response (CR) or stringent complete response (sCR) in the subject, according to IMWG criteria. In some embodiments, the method achieves a stringent complete response (sCR) in the subject, according to IMWG criteria.

[0335] In some embodiments, the method does not induce a Treatment-Related toxicity in thesubject. In some embodiments, the probability that the Dose Limiting Toxicity (DLT) rate is of 28%, or exceeds 28% in a cohort of at least 20 subjects is lower than 95%. In some embodiments, the cancer is significantly reduced in the subject. In some embodiments, the method increases the Overall Response Rate (ORR). In some embodiments, the ORR includes the proportion of patients whose tumor is significantly reduced or is destroyed in a cohort of at least 20 patients, compared to a prior line of therapy. In some embodiments, the treatment increases the Progression Free Survival (PFS) in the subject, particularly compared to a prior line of therapy. In some embodiments, the treatment increases the Duration of response (DoR). In some embodiments, the DoR is the length of time that a tumor continues to respond to treatment without the cancer growing or spreading in the subject, particularly compared to a prior line of therapy. In some embodiments, the prior line of therapy comprises one or more of: an administration of a proteasome inhibitor, an immunomodulatory agent, and an anti-CD38 therapy. In some embodiments, the method comprises the administration of a prior or concomitant therapy, such as the administration of a glucocorticoid, an antihistamine, an antipyretic, a H2-antagonist, and / or an anti-emetic. In some embodiments, the prior or concomitant therapy comprises a glucocorticoid, an antihistamine, an antipyretic, a H2- antagonist, and / or an anti-emetic. In some embodiments, the multiple myeloma is a relapsed and / or refractory multiple myeloma. In some embodiments, the subject is a human subject.

[0336] In some embodiments, an antibody or antigen-binding fragment thereof binding toGPRC5D as described herein can be used in any of the methods of administration as described herein.

[0337] Any embodiments or aspects of the disclosure, which in the description or in the claimsrefer to a method of treatment, are applicable to the manufacture of a medicament for the treatment mutatis mutandis.Attorney Docket No.: JBI6924WOPCT1

[0338] Any embodiments or aspects of the disclosure, which in the description or in the claimsrefer to a method of treatment, are applicable to the compound, composition or pharmaceutical composition for use in the treatment mutatis mutandis. DIAGNOSTIC ASSAYS AND METHODS

[0339] Labeled antibodies, derivatives, and analogs thereof, which specifically bind to aGPRC5D antigen can be used for diagnostic purposes to detect, diagnose, or monitor a GPRC5D -mediated disease. Thus, provided herein are methods for the detection of a GPRC5D -mediated disease comprising: (a) assaying the expression of a GPRC5D antigen in cells or a tissue sample of a subject using one or more antibodies, provided herein that specifically bind to the GPRC5D antigen; and (b) comparing the level of the GPRC5D antigen with a control level, e.g., levels in normal tissue samples (e.g., from a patient not having a GPRC5D-mediated disease, or from the same patient before disease onset), whereby an increase in the assayed level of GPRC5D antigen compared to the control level of the GPRC5D antigen is indicative of a GPRC5D-mediated disease.

[0340] Also provided herein is a diagnostic assay for diagnosing a GPRC5D-mediated diseasecomprising: (a) assaying for the level of a GPRC5D antigen in cells or a tissue sample of an individual using one or more antibodies or fusion constructs, provided herein that immunospecifically bind to a GPRC5D antigen; and (b) comparing the level of the GPRC5D antigen with a control level, e.g., levels in normal tissue samples, whereby an increase in the assayed GPRC5D antigen level compared to the control level of the GPRC5D antigen is indicative of a GPRC5D-mediated disease. In certain embodiments, provided herein is a method of treating a GPRC5D-mediated disease in a subject, comprising: (a) assaying for the level of a GPRC5D antigen in cells or a tissue sample of the subject using one or more antibodies, provided herein that specifically bind to a GPRC5D antigen; and (b) comparing the level of the GPRC5D antigen with a control level, e.g., levels in normal tissue samples, whereby an increase in the assayed GPRC5D antigen level compared to the control level of the GPRC5D antigen is indicative of a GPRC5D-mediated disease. In some embodiments, the method further comprises (c) administering an effective amount of an antibody or fusion constructs, provided herein to the subject identified as having the GPRC5D-mediated disease. A more definitive diagnosis of a GPRC5D-mediated disease may allow health professionals to employ preventative measures orAttorney Docket No.: JBI6924WOPCT1 aggressive treatment earlier thereby preventing the development or further progression of the GPRC5D-mediated disease.

[0341] Antibodies provided herein can be used to assay GPRC5D antigen levels in a biologicalsample using classical immunohistological methods as described herein or as known to those of skill in the art (e.g., see Jalkanen et al., 1985, J. Cell. Biol.101:976-985; and Jalkanen et al., 1987, J. Cell. Biol.105:3087-3096). Other antibody-based methods useful for detecting protein gene expression include immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA). Suitable antibody assay labels are known in the art and include enzyme labels, such as, glucose oxidase; radioisotopes, such as iodine (125I, 121I), carbon (14C), sulfur (35S), tritium (3H), indium (121In), and technetium (99Tc); luminescent labels, such as luminol; and fluorescent labels, such as fluorescein and rhodamine, and biotin.

[0342] One aspect provided herein is the detection and diagnosis of a GPRC5D-mediated diseasein a human. In one embodiment, diagnosis comprises: a) administering (for example, parenterally, subcutaneously, or intraperitoneally) to a subject an effective amount of a labeled antibody, that specifically binds to a GPRC5D antigen; b) waiting for a time interval following the administering for permitting the labeled antibody to concentrate at sites in the subject where the GPRC5D antigen is expressed (and for unbound labeled molecule to be cleared to background level); c) determining background level; and d) detecting the labeled antibody or fusion constructs, in the subject, such that detection of labeled antibody above the background level indicates that the subject has a GPRC5D-mediated disease. Background level can be determined by various methods including, comparing the amount of labeled molecule detected to a standard value previously determined for a particular system.

[0343] It will be understood in the art that the size of the subject and the imaging system usedwill determine the quantity of imaging moiety needed to produce diagnostic images. In the case of a radioisotope moiety, for a human subject, the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of 99Tc. The labeled antibody or fusion constructs will then accumulate at the location of cells which contain the specific protein. In vivo tumor imaging is described in S.W. Burchiel et al., “Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments.” (Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer, S.W. Burchiel and B.A. Rhodes, eds., Masson Publishing Inc. (1982).Attorney Docket No.: JBI6924WOPCT1

[0344] Depending on several variables, including the type of label used and the mode ofadministration, the time interval following the administration for permitting the labeled antibody or fusion constructs, to concentrate at sites in the subject and for unbound labeled antibody or fusion constructs, to be cleared to background level is 6 to 48 hours or 6 to 24 hours or 6 to 12 hours. In another embodiment the time interval following administration is 5 to 20 days or 5 to 10 days.

[0345] In one embodiment, monitoring of a GPRC5D-mediated disease is carried out byrepeating the method for diagnosing the a GPRC5D-mediated disease, for example, one month after initial diagnosis, six months after initial diagnosis, one year after initial diagnosis, etc.

[0346] Presence of the labeled molecule can be detected in the subject using methods known inthe art for in vivo scanning. These methods depend upon the type of label used. Skilled artisans will be able to determine the appropriate method for detecting a particular label. Methods and devices that may be used in the diagnostic methods provided herein include, but are not limited to, computed tomography (CT), whole body scan such as position emission tomography (PET), magnetic resonance imaging (MRI), and sonography.

[0347] In a specific embodiment, the molecule is labeled with a radioisotope and is detected inthe patient using a radiation responsive surgical instrument (Thurston et al., U.S. Patent No. 5,441,050). In another embodiment, the molecule is labeled with a fluorescent compound and is detected in the patient using a fluorescence responsive scanning instrument. In another embodiment, the molecule is labeled with a positron emitting metal and is detected in the patient using positron emission-tomography. In yet another embodiment, the molecule is labeled with a paramagnetic label and is detected in a patient using magnetic resonance imaging (MRI).

[0348] Unless otherwise defined, all technical and scientific terms used herein have the samemeaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, suitable methods and materials are described herein.

[0349] As used herein, numerical values are often presented in a range format throughout thisdocument. The use of a range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention unless the context clearlyAttorney Docket No.: JBI6924WOPCT1 indicates otherwise. Accordingly, the use of a range expressly includes all possible subranges, all individual numerical values within that range, and all numerical values or numerical ranges including integers within such ranges and fractions of the values or the integers within ranges unless the context clearly indicates otherwise. This construction applies regardless of the breadth of the range and in all contexts throughout this patent document. Thus, for example, reference to a range of 90-100% includes 91-99%, 92-98%, 93-95%, 91-98%, 91-97%, 91-96%, 91-95%, 91- 94%, 91-93%, and so forth. Reference to a range of 90-100% also includes 91%, 92%, 93%, 94%, 95%, 95%, 97%, etc., as well as 91.1%, 91.2%, 91.3%, 91.4%, 91.5%, etc., 92.1%, 92.2%, 92.3%, 92.4%, 92.5%, etc., and so forth.

[0350] In addition, reference to a range of 1-3, 3-5, 5-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-110, 110-120, 120-130, 130-140, 140-150, 150-160, 160-170, 170-180, 180-190, 190-200, 200-225, 225-250 includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc. In a further example, reference to a range of 25-250, 250-500, 500- 1,000, 1,000-2,500, 2,500-5,000, 5,000-25,000, 25,000-50,000 includes any numerical value or range within or encompassing such values, e.g., 25, 26, 27, 28, 29…250, 251, 252, 253, 254…500, 501, 502, 503, 504…, etc.

[0351] As also used herein a series of ranges are disclosed throughout this document. The use ofa series of ranges include combinations of the upper and lower ranges to provide another range. This construction applies regardless of the breadth of the range and in all contexts throughout this patent document. Thus, for example, reference to a series of ranges such as 5-10, 10-20, 20- 30, 30-40, 40-50, 50-75, 75-100, 100-150, includes ranges such as 5-20, 5-30, 5-40, 5-50, 5-75, 5-100, 5-150, and 10-30, 10-40, 10-50, 10-75, 10-100, 10-150, and 20-40, 20-50, 20-75, 20-100, 20-150, and so forth.

[0352] For the sake of conciseness, certain abbreviations are used herein. One example is thesingle letter abbreviation to represent amino acid residues. The amino acids and their corresponding three letter and single letter abbreviations are as follows: alanine Ala (A)Attorney Docket No.: JBI6924WOPCT1 glutamic acid Glu (E) glutamine Gln (Q) RATIONALE

[0353] While bispecific antibodies have been shown to be an effective way to target GPRC5Dand generate meaningful clinical responses, one hypothesis why patients eventually relapse is the development of T cell exhaustion. Targeting GPRC5D using novel mechanisms of action could be clinically impactful. Enhanced effector function antibodies are a class of antibodies that are engineered to induce cytotoxicity through various effector functions (Van der Horst et al., Cancers.,12(10):3041(2020)). The antibodies and antigen-binding fragments of the application, such as GC5B1552.AFU, were developed to elicit ADCC, ADCP, and CDC against MM cells (Error! Reference source not found.). GPRC5D is selectively expressed on plasma cells within the hematopoietic compartment unlike CD38 which is expressed on most hematopoietic cell lineages. This is advantageous, since the ADCC mechanism should not be impacted in contrast with anti-CD38 effector function therapeutics that have reduced ADCC activity due to NK cell fratricide (Wang et al., Clin Cancer Res.24(16):4006-4017 (2018)). The antibodies and antigen-binding fragments of the application, such as GC5B1552.AFU, are differentiated from these other MM effector function therapeutics since the antibodies and antigen-binding fragments of the application, such as GC5B1552.AFU, are not postulated to induce NK cellAttorney Docket No.: JBI6924WOPCT1 fratricide, maintaining its ADCC mechanism. Based on the novelty of the antibody design (comprising K248E and T437R (RE) mutations), the antibodies and antigen-binding fragments of the application, such as GC5B1552.AFU, are hypothesized to have enhanced CDC activity against MM cells, as compared with the fucosylated antibody or antigen binding fragment thereof without K248E and T437R (RE) mutations. PHYSICAL, CHEMICAL, AND PHARMACEUTICAL PROPERTIES Product Identification

[0354] GC5B1552.AFU was produced by cultivation of recombinant CHO cells followed byisolation, chromatographic purification, and formulation. The drug substance and drug product were manufactured under current GMP guidelines. The quality control testing was performed for release of both the purified drug substance and the final drug product. Physical and Chemical Characteristics

[0355] GC5B1552.AFU is a fully human sequence-based, monovalent, afucosylated IgG1-likemolecule that binds with high affinity to GPRC5D. In addition, it contains specific point mutations in the Fc region to facilitate oligomerization of complement. Collectively, these modifications were intended to enhance GC5B1552.AFU’s effector functions (ADCC, CDC, and ADCP). Formulation Information

[0356] The drug product was intended for SC administration.SUMMARY OF NON-CLINICAL STUDIES

[0357] GC5B1552.AFU was used as a drug substance to conduct further nonclinical studies asillustrated below in Example 13. GC5B1552.AFU is a fully human sequence-based, monovalent, afucosylated IgG1-like molecule that binds with high affinity to GPRC5D. In addition, GC5B1552.AFU contains specific point mutations in the Fc region to facilitate oligomerization of complement. Collectively, these modifications were intended to enhance GC5B1552.AFU’s effector functions (ADCC, CDC, and ADCP).

[0358] The drug product referred in the Examples herein is a sterile, preservative-freeGC5B1552.AFU antibody at a concentration of 150 mg / mL.Attorney Docket No.: JBI6924WOPCT1 Nonclinical Pharmacology

[0359] In vitro, GC5B1552.AFU demonstrated selective ADCC, CDC, and ADCP mechanismsagainst GPRC5D+ MM cell lines but not GPRC5D- MM cell lines. In vitro, GC5B1552.AFU elicited a cytotoxic effect in multiple myeloma (MM) patient bone marrow plasma cells. In vitro, GC5B1552.AFU did not demonstrate any NK cell fratricide. In vivo, GC5B1552.AFU - mediated significant antitumor activity in two MM disseminated xenograft mouse studies using NK-92.CD16 effector cells.

[0360] The relatively restricted expression of GPRC5D on plasma cells and a few specific celltypes in normal tissues (hair follicles and eccrine sweat glands in skin, and filiform papillae in tongue) makes it a suitable and acceptably low risk target for enhanced effector-mediated therapy to treat plasma cell disorders such as MM.

[0361] Based on sequence homology, tissue expression pattern, and evidence of effector activity,the cynomolgus monkey was identified as the most pharmacologically relevant species.

[0362] GC5B1552.AFU demonstrated high specificity for its primary target, GPRC5D, and nooff-target binding in an in vitro human plasma membrane protein cell array screen against 6,264 human proteins expressed on HEK cells and by confirmatory flow cytometry suggested a low likelihood for off-target liabilities.

[0363] Safety pharmacology assessments were included in the pivotal 3-month repeat-dose studyin cynomolgus monkeys, administered weekly subcutaneous (SC) doses at 30 or 100 mg / kg / dose. Overall, no safety pharmacology-related findings were reported at any dose level tested. Pharmacokinetics and Metabolism in Animals

[0364] Mean clearance and terminal volume of distribution of GC5B1552.AFU after single-doseintravenous (IV) administration in cynomolgus monkeys were estimated as 18.2 mL / day / kg and 154 mL / kg, respectively.

[0365] In cynomolgus monkeys, systemic exposure (Cmax and AUC) to GC5B1552.AFUincreased with the dose in an approximately dose-proportional manner following weekly SC doses of 30 and 100 mg / kg in a 3-month GLP toxicity study.Attorney Docket No.: JBI6924WOPCT1 Toxicology

[0366] Subcutaneous administration of GC5B1552.AFU to cynomolgus monkeys once weeklyfor 3 months at dose levels of 30 and 100 mg / kg / dose was associated with pharmacodynamic decreases in plasma cell-specific gene expression (BCMA and J-chain) in the stomach, colon and / or bone marrow, and non-adverse increases in complement components (C3a, Bb), occasional transient increases in plasma cytokines (IL-1Ra, MCP-1, and MIP-1β), moderate decreases in neutrophils, higher spleen weights (with no microscopic correlate), and microscopic perivascular mononuclear cell infiltration at the injection sites.

[0367] Local tolerance was evaluated as part of the 3-month repeat-dose toxicity study incynomolgus monkeys administered weekly SC injections of GC5B1552.AFU at 30 or 100 mg / kg / dose (2 mL / kg). There were no GC5B1552.AFU -related changes in injection site clinical observations. Perivascular mononuclear cell infiltration noted microscopically at the SC administration sites in both males and females were non-adverse.

[0368] On-target / off-tumor effects of GPRC5D targeting, such as taste disorders and skin andnail toxicities reported clinically for other GPRC5D-targeted therapeutics, are expected to be manageable and monitorable based on the restricted expression of target GPRC5D in normal tissues and lack of GC5B1552.AFU -related adverse findings in the non-clinical toxicology studies.

[0369] All nonclinical studies illustrated herein for GC5B1552.AFU were conducted inaccordance with best scientific principles. Pivotal nonclinical safety studies were conducted in conformance with GLP, 21 CFR, Part 58 and / or the principles of OECD-GLP in a test facility that was part of the national GLP monitoring program of an EU Member State, an Organisation for Economic Co-operation and Development Member Country, or fully adherent to the Mutual Acceptance of Data in the period that the study was conducted.

[0370] The invention is generally disclosed herein using affirmative language to describe thenumerous embodiments. The invention also specifically includes embodiments in which particular subject matter is excluded, in full or in part, such as substances or materials, method steps and conditions, protocols, procedures, assays or analysis. Thus, even though the invention is generally not expressed herein in terms of what the invention does not include, aspects that are not expressly included in the invention are nevertheless disclosed herein.Attorney Docket No.: JBI6924WOPCT1 ENUMERATED EMBODIMENTS (i.e., ENUMERATED ITEMS OF THE APPLICATION)

[0371] 1. A method of treating a multiple myeloma in a subject in need thereof, the methodcomprising administering a therapeutically effective amount of an antibody or an antigen- binding fragment thereof specifically binding to GPRC5D, wherein the antibody or antigen binding fragment thereof comprises:a. a heavy chain complementarity determining region 1 (CDR1), a heavy chaincomplementarity determining region 2 (CDR2), and a heavy chain complementarity determining region 3 (CDR3) comprising the amino acid sequences of SEQ ID NO: 6, 7, and 8, respectively; and a light chain complementarity determining region 1 (CDR1), a light chain complementarity determining region 2 (CDR2), and a light chain complementarity determining region 3 (CDR3) comprising the amino acid sequences of SEQ ID NO: 9, 10, and 11, respectively;b. a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprising theamino acid sequences of SEQ ID NO: 12, 13, and 8, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 9, 10, and 11, respectively;c. a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprising theamino acid sequences of SEQ ID NO: 14, 15, and 8, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 9, 10, and 11, respectively;d. a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprising theamino acid sequences of SEQ ID NO: 16, 17, and 18, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 19, 20, and 11, respectively; ore. a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprising theamino acid sequences of SEQ ID NO: 21, 22, and 23, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 24, 25, and 26, respectively.

[0372] 2. The method of embodiment 1, wherein the antibody or the antigen binding fragmentthereof comprises a heavy chain variable region (VH) comprising an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1.Attorney Docket No.: JBI6924WOPCT1

[0373] 3. The method of embodiment 1 or embodiment 2, wherein the antibody or the antigenbinding fragment thereof comprises a VH comprising SEQ ID NO: 1.

[0374] 4. The method of any one of embodiments 1 to 3, wherein the antibody or the antigenbinding fragment thereof comprises a light chain variable region (VL) comprising an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2.

[0375] 5. The method of any one of embodiments 1 to 4, wherein the antibody or the antigenbinding fragment thereof comprises a VL comprising SEQ ID NO: 2.

[0376] 6. The method of any one of embodiments 1 to 5, wherein the antibody or the antigenbinding fragment thereof comprises a heavy chain variable region (VH) comprising SEQ ID NO: 1, and a light chain variable region (VL) comprising SEQ ID NO: 2.

[0377] 7. The method of any one of embodiments 1 to 6, wherein the antibody or the antigen-binding fragment thereof is an IgG.

[0378] 8. The method of any one of embodiments 1 to 7, wherein the antibody or the antigen-binding fragment thereof comprises an IgG1 isotype Fc region.

[0379] 9. The method of any one of embodiments 1 to 8, wherein the IgG1 isotype Fc regioncomprises K248E and T437R (RE) mutations as per the EU numbering system.

[0380] 10. The method of any one of embodiments 1 to 9, wherein the antibody or the antigen-binding fragment thereof is afucosylated.

[0381] 11. The method of any one of embodiments 1 to 10, wherein the antibody or the antigen-binding fragment thereof has enhanced antibody-dependent cellular cytotoxicity (ADCC) activity as compared with a fucosylated antibody or an antigen-binding fragment thereof.

[0382] 12. The method of any one of embodiments 1 to 11, wherein the antibody or the antigen-binding fragment thereof has antibody-dependent cellular phagocytosis (ADCP) activity.

[0383] 13. The method of any one of embodiments 1 to 12, wherein the antibody or the antigen-binding fragment thereof comprises one or more mutations which promote heterodimerization.

[0384] 14. The method of any one of embodiments 1 to 13, wherein the antibody or the antigen-binding fragment thereof further comprises knob-into-hole (KiH) mutations.

[0385] 15. The method of any one of embodiments 1 to 14, wherein the IgG1 isotype Fc regionfurther comprises H435R and Y436F mutations per the EU numbering system.Attorney Docket No.: JBI6924WOPCT1

[0386] 16. The method of any one of embodiments 1 to 15, wherein the antibody or the antigenbinding fragment thereof is a monovalent antibody or an antigen binding fragment thereof.

[0387] 17. The method of any one of embodiments 1 to 16, wherein the monovalent antibody orthe antigen-binding fragment thereof has enhanced antibody-dependent cellular cytotoxicity (ADCC) activity and enhanced complement-dependent cytotoxicity (CDC) as compared with a fucosylated divalent antibody or an antigen-binding fragment thereof without K248E and T437R (RE) mutations.

[0388] 18. The method of embodiment 17, wherein the monovalent antibody or the antigen-binding fragment thereof comprises an Fc domain and a Fab.

[0389] 19. The method of embodiment 17 or embodiment 18, wherein the monovalent antibodyor the antigen binding fragment thereof comprises:a. a heavy chain complementarity determining region 1 (CDR1), a heavy chaincomplementarity determining region 2 (CDR2), and a heavy chain complementarity determining region 3 (CDR3) comprising the amino acid sequences of SEQ ID NO: 6, 7, and 8, respectively; and a light chain complementarity determining region 1 (CDR1), a light chain complementarity determining region 2 (CDR2), and a light chain complementarity determining region 3 (CDR3) comprising the amino acid sequences of SEQ ID NO: 9, 10, and 11, respectively;b. a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprising theamino acid sequences of SEQ ID NO: 12, 13, and 8, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 9, 10, and 11, respectively;c. a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprising theamino acid sequences of SEQ ID NO: 14, 15, and 8, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 9, 10, and 11, respectively;d. a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprising theamino acid sequences of SEQ ID NO: 16, 17, and 18, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 19, 20, and 11, respectively; ore. a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprising theamino acid sequences of SEQ ID NO: 21, 22, and 23, respectively; andAttorney Docket No.: JBI6924WOPCT1 a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 24, 25, and 26, respectively.

[0390] 20. The method of any one of embodiments 17-19, wherein the monovalent antibody orthe antigen binding fragment thereof comprises a heavy chain variable region (VH) comprising an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1.

[0391] 21. The method of any one of embodiments 17-20, wherein the monovalent antibody orthe antigen binding fragment thereof comprises a VH comprising SEQ ID NO: 1.

[0392] 22. The method of any one of embodiments 17-21, wherein the monovalent antibody orthe antigen binding fragment thereof comprises a light chain variable region (VL) comprising an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2.

[0393] 23. The method of any one of embodiments 17-22, wherein the monovalent antibody orthe antigen binding fragment thereof comprises a VL comprising SEQ ID NO: 2.

[0394] 24. The method of any one of embodiments 17-23, wherein the monovalent antibody orthe antigen binding fragment thereof comprises a heavy chain variable region (VH) comprising SEQ ID NO: 1, and a light chain variable region (VL) comprising SEQ ID NO: 2.

[0395] 25. The method of any one of embodiments 17-24, wherein the monovalent antibody orthe antigen-binding fragment thereof comprises a first heavy chain (HC1), a second heavy chain (HC2), and a second light chain (LC2).

[0396] 26. The method of embodiment 25, wherein the HC1 of the monovalent antibody or theantigen binding fragment thereof comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 3.

[0397] 27. The method of any one of embodiment 25 or embodiment 26, wherein the HC1 of themonovalent antibody or the antigen binding fragment thereof comprises SEQ ID NO: 3.

[0398] 28. The method of any one of embodiments 25-27, wherein the HC2 of the monovalentantibody or the antigen binding fragment thereof comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4.

[0399] 29. The method of any one of embodiments 25-28, wherein the HC2 of the monovalentantibody or the antigen binding fragment thereof comprises SEQ ID NO: 4.Attorney Docket No.: JBI6924WOPCT1

[0400] 30. The method of embodiments 25 or 26, wherein the HC1 of the monovalent antibodyor the antigen binding fragment thereof comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 30.

[0401] 31. The method of embodiments 25, 26, or 30, wherein the HC1 of the monovalentantibody or the antigen binding fragment thereof comprises SEQ ID NO: 30.

[0402] 32. The method of embodiments 25 or 28, wherein the HC2 of the monovalent antibodyor the antigen binding fragment thereof comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 31.

[0403] 33. The method of any one of embodiments 25, 28, or 32, wherein the HC2 of themonovalent antibody or the antigen binding fragment thereof comprises SEQ ID NO: 31.

[0404] 34. The method of any one of embodiments 25-33wherein the LC2 of the monovalentantibody or the antigen binding fragment thereof comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5.

[0405] 35. The method of any one of embodiments 25-34, wherein the LC2 of the monovalentantibody or the antigen binding fragment thereof comprises SEQ ID NO: 5.

[0406] 36. A method of treating a multiple myeloma in a subject in need thereof, the methodcomprising administering a therapeutically effective amount of a monovalent antibody or an antigen-binding fragment thereof specifically binding to GPRC5D, comprising a first heavy chain comprising SEQ ID NO: 3, a second heavy chain comprising SEQ ID NO: 4, and a second light chain comprising SEQ ID NO: 5.

[0407] 37. A method of treating a multiple myeloma in a subject in need thereof, the methodcomprising administering a therapeutically effective amount of a monovalent antibody or an antigen-binding fragment thereof specifically binding to GPRC5D, comprising a first heavy chain comprising SEQ ID NO: 30, a second heavy chain comprising SEQ ID NO: 31, and a second light chain comprising SEQ ID NO: 5.

[0408] 38. A method of treating a multiple myeloma in a subject in need thereof, the methodcomprising administering a therapeutically effective amount of a pharmaceutical composition comprising the antibody, the monovalent antibody, or the antigen-binding fragment thereof of any one of embodiments 1 to 30, and a pharmaceutically acceptable carrier.

[0409] 39. The method of any one of embodiments 1-38, wherein the multiple myeloma ischaracterized by the expression of GPRC5D.Attorney Docket No.: JBI6924WOPCT1

[0410] 40. The method of any one of embodiments 1-39, wherein the multiple myeloma isrelapsed.

[0411] 41. The method of any one of embodiments 1-40, wherein the multiple myeloma isrefractory.

[0412] 42. The method of any one of embodiments 1-41, wherein the antibody, the monovalentantibody, or the antigen binding fragment thereof is administered to the subject as a monotherapy to treat the multiple myeloma.

[0413] 43. The method of any one of embodiments 1-42, wherein the subject is eighteen years ofage or older.

[0414] 44. The method of embodiment 42 or embodiment 43, wherein the subject has received atleast one prior line of therapy for multiple myeloma.

[0415] 45. The method of embodiment 44 wherein the at least one prior line of therapy formultiple myeloma comprises one or more of: a proteasome inhibitor, an immunomodulatory agent and an anti-CD38 monoclonal antibody.

[0416] 46. The method of any one of embodiments 42-45, wherein prior to the administration ofthe antibody or the antigen-binding fragment thereof specifically binding to GPRC5D, the subject has one or more of: a) a serum monoclonal paraprotein (M-protein) level >0.5 g / dL; b) a urine M-protein level >200 mg / 24 hours; c) a light chain multiple myeloma: serum immunoglobulin free light chain (FLC) >10 mg / dL and abnormal serum immunoglobulin kappa-lambda FLC ratio; d) hemoglobin ≥8 g / dL (≥5 mmol / L) without a red blood cell transfusion within 7 days of being tested; e) absolute neutrophil count ≥1×109 / L without use of granulocyte colony stimulating factor (G- CSF) within 7 days of being tested; or f) platelets ≥50×109 / L without transfusion support within 7 days of being tested.

[0417] 47. The method of any one of embodiments 42-46, wherein prior to the administration ofthe antibody or the antigen-binding fragment thereof specifically binding to GPRC5D, the subject does not have:Attorney Docket No.: JBI6924WOPCT1 a) active plasma cell leukemia, Waldenström’s macroglobulinemia, polyneuropathy, organomegaly, endocrinopathy, M-protein, and skin changes syndrome (POEMS), or immunoglobulin light chain amyloidosis; b) non-hematologic toxicity from prior anticancer therapy that has not resolved to baseline level or to ≤Grade 1; c) known loss of expression of GPRC5D antigen; d) known allergies, hypersensitivity, or intolerance to excipients of the antibody, the monovalent antibody or the antigen-binding fragment thereof; or e) pulmonary compromise requiring supplemental oxygen used to maintain adequate oxygenation.

[0418] 48. The method of any one of embodiments 1-47, wherein there is no or minimal naturalkiller (NK) cell fratricide.

[0419] 49. The method of any one of embodiments 1-48, wherein the therapeutically effectiveamount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of at least about 20 mg per dose administration.

[0420] 50. The method of any one of embodiments 1-49, wherein the therapeutically effectiveamount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 20 mg to about 1700 mg per dose administration.

[0421] 51. The method of any one of embodiments 1-50, wherein the therapeutically effectiveamount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose ranging from about 20 mg to about 1620 mg per dose administration.

[0422] 52. The method of any one of embodiments 1-51, wherein the therapeutically effectiveamount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 50 mg to about 1700 mg per dose administration.

[0423] 53. The method of any one of embodiments 1-52, wherein the therapeutically effectiveamount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 100 mg to about 1700 mg per dose administration.Attorney Docket No.: JBI6924WOPCT1

[0424] 54. The method of any one of embodiments 1-53, wherein the therapeutically effectiveamount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 105 mg to about 250 mg per dose administration.

[0425] 55. The method of any one of embodiments 1-54, wherein the therapeutically effectiveamount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 250 mg to about 1700 mg per dose administration.

[0426] 56. The method of any one of embodiments 1-55, wherein the therapeutically effectiveamount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose ranging from about 350 mg to about 840 mg per dose administration.

[0427] 57. The method of any one of embodiments 1-56, wherein the therapeutically effectiveamount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 500 mg to about 1700 mg per dose administration.

[0428] 58. The method of any one of embodiments 1-57, wherein the therapeutically effectiveamount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 1000 mg to about 1700 mg per dose administration.

[0429] 59. The method of any one of embodiments 1-51, wherein the therapeutically effectiveamount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 20 mg per dose administration.

[0430] 60. The method of any one of embodiments 1-52, wherein the therapeutically effectiveamount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 60 mg per dose administration.

[0431] 61. The method of any one of embodiments 1-54, wherein the therapeutically effectiveamount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 180 mg per dose administration.Attorney Docket No.: JBI6924WOPCT1

[0432] 62. The method of any one of embodiments 1-57, wherein the therapeutically effectiveamount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 540 mg per dose administration.

[0433] 63. The method of any one of embodiments 1-58, wherein the therapeutically effectiveamount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 1620 mg per dose administration.

[0434] 64.The method of any one of embodiments 1-63, wherein the therapeutically effectiveamount of the antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose ranging from about 5 mg / kg to about12 mg / kg per dose administration.

[0435] 65. The method of any one of embodiments 1-64, wherein the antibody, the monovalentantibody, or the antigen-binding fragment thereof is administered subcutaneously, for example by subcutaneous injection or by subcutaneous infusion.

[0436] 66. The method of any one of embodiments 1-65, wherein the antibody, monovalentantibody, or antigen-binding fragment thereof is administered at a frequency ranging from once every three to weeks to once every week.

[0437] 67. The method of any one of embodiments 1-66, wherein the antibody, the monovalentantibody, or the antigen-binding fragment thereof is administered at a frequency of once every three weeks.

[0438] 68. The method of any one of embodiments 1-67, wherein the antibody, the monovalentantibody, or the antigen-binding fragment thereof is administered at a frequency of once every two weeks.

[0439] 69. The method of any one of embodiments 1-68, wherein the antibody, the monovalentantibody, or the antigen-binding fragment thereof is administered at a frequency of once every week.

[0440] 70. The method of any one of embodiments 1-69, wherein the antibody, the monovalentantibody, or the antigen-binding fragment thereof is administered until remission of multiple myeloma is achieved in a subject.

[0441] 71. The method of any one of embodiments 1-70, wherein the method achieves a partialresponse (PR), very good partial response (VGPR), complete response (CR) or stringentAttorney Docket No.: JBI6924WOPCT1 complete response (sCR) in the subject, according to International Myeloma Working Group (IMWG) criteria.

[0442] 72. The method of any one of embodiments 1-71, wherein the method achieves a verygood partial response (VGPR), complete response (CR) or stringent complete response (sCR) in the subject, according to International Myeloma Working Group (IMWG) criteria.

[0443] 73. The method of any one of embodiments 1-72, wherein the method achieves acomplete response (CR) or stringent complete response (sCR) in the subject, according to International Myeloma Working Group (IMWG) criteria.

[0444] 74. The method of any one of embodiments 1-73, wherein the method achieves astringent complete response (sCR) in the subject, according to International Myeloma Working Group (IMWG) criteria.

[0445] 75. The method of any one of embodiments 1-74, the method does not induce aTreatment-Related toxicity in the subject.

[0446] 76. The method of any one of embodiments 1-75, wherein the probability that the DoseLimiting Toxicity (DLT) rate is of 28%, or exceeds 28% in a cohort of at least 20 subjects is lower than 95%.

[0447] 77. The method of any one of embodiments 1-76, wherein the cancer is significantlyreduced in the subject.

[0448] 78. The method of any one of embodiments 1-77, wherein the method increases theOverall Response Rate (ORR).

[0449] 79. The method of embodiment 78, wherein the ORR includes the proportion of patientswhose tumor is significantly reduced or is destroyed in a cohort of at least 20 patients, compared to a prior line of therapy.

[0450] 80. The method of any one of embodiments 1-79, wherein the treatment increases theProgression Free Survival (PFS) in the subject, particularly compared to a prior line of therapy.

[0451] 81. The method of any one of embodiments 1-79, wherein the treatment increases theDuration of response (DoR).

[0452] 82. The method of embodiment 81, wherein the DoR is the length of time that a tumorcontinues to respond to treatment without the cancer growing or spreading in the subject, particularly compared to a prior line of therapy.Attorney Docket No.: JBI6924WOPCT1

[0453] 83. The method of any one of embodiments 79-82, wherein the prior line of therapycomprises one or more of an administration of a proteasome inhibitor, an immunomodulatory agent, and an anti-CD38 therapy.

[0454] 84. The method of any one of embodiments 1-83, wherein the method comprises theadministration of a prior or concomitant therapy.

[0455] 85. The method of embodiment 84, wherein the prior or concomitant therapy comprises aglucocorticoid, an antihistamine, an antipyretic, a H2-antagonist, and / or an anti-emetic.

[0456] 86. The method of any one of embodiments 1-85, wherein the multiple myeloma is arelapsed and / or refractory multiple myeloma.

[0457] 87. The method of any one of embodiments 1-86, wherein the subject is a human subject.

[0458] 88. An antibody or antigen-binding fragment thereof specifically binding to GPRC5D, asdefined in any one of embodiments 1-87, for use in the method of any one of embodiments 1-87.

[0459] Any references in the description or in the claims to methods of treatment refer to thecompounds, compositions, pharmaceutical compositions and medicaments for use in a method of treatment of the human (or animal) body by therapy (or for diagnosis).

[0460] Any references in the description or in the claims to methods of treatment refer to the useof the compounds, compositions, pharmaceutical compositions for the manufacture of a medicament for the treatment of the human (or animal) body by therapy (or for diagnosis).

[0461] A number of embodiments have been described. Nevertheless, it will be understood thatvarious modifications may be made without departing from the spirit and scope of the invention. Accordingly, the following examples are intended to illustrate but not limit the scope of invention described in the claims. EXAMPLES EXAMPLE 1. COMPREHENSIVE IMMUNIZATION STRATEGIES AND INNOVATIVE APPROACHES FOR GENERATING ANTI-GPRC5D ANTIBODIES IN RODENT MODELS

[0462] OMT Omnirats (female, rat 3, 4, 5, 9, and 10) underwent weekly immunizations withhuman GPRC5D (huGPRC5D) DNA over a span of 6 weeks. The immunizations involved intramuscular injections with electroporation in each tibialis muscle, with each injectionAttorney Docket No.: JBI6924WOPCT1 containing 200 µg plasmids at 5mg / ml coding GPRC5D (G-protein coupled receptor family C group 5 member D [Homo sapiens], Sequence ID: NP_061124.1) . Rats 9 and 10 additionally received 6 weekly boosts of CpG Adjuvant (InvivoGen ODN1826, Lot V3902-01T; 2mg / mL in 500µL). As a final cell-boost, each rat received RBL-2H3 rat fibroblast cells (ATCC CRL- 2256) expressing huGPRC5D (2 million cells IV and 4 million cells IP).

[0463] Immune sera samples were collected twice during the immunization process (Days 32and 46) and subjected to binding tests via flow cytometry. The tests were performed using HEK293F cells (Thermofisher R79007) expressing huGPRC5D and HEK293F parental cells (negative control).

[0464] On day 46, lymph nodes were harvested from each rat, pooled, homogenized into asingle-cell suspension, and lymphocytes were fused with FO (Follicular B cells) mouse myeloma cell line (ATCC CRL-1646). Hybridoma cells were cultured for 7-14 days.

[0465] Hybridoma supernatants were screened via cell MSD on HEK293F cells expressinghuGPRC5D to detect secreted anti-GPRC5D antibodies. Primary hits were identified as samples with assay signals greater than 5.85-fold the negative control average. A total of 176 samples meeting this criterion were scaled up and re-screened by flow cytometry for binding to MM.1R (ATCC CRL-2975) cells expressing GPRC5D and HEK293F cells expressing huGPRC5D but not HEK293F parental cells. Of these, 108 hits with the desired binding profile were security frozen and advanced for variable region cloning. The variable regions were subsequently sequenced and expressed as human IgG1 antibodies for further characterization.

[0466] In addition to the described immunization campaign, other strategies were explored togenerate anti-GPRC5D antibodies. Ablexis mice, Sprague-Dawley rats, and OMT1 rats were all immunized following a protocol similar to HYB:621 to assess immune responses across rodent strains. Blood was drawn for sera titrations on day 33, and on day 43, lymph nodes from select rodents were harvested for hybridoma fusion. Hybridoma colonies were cultured, supernatants were harvested, and screening was performed by cell MSD on HEK293F cells expressing huGPRC5D. Confirmed hits were further validated for binding by flow cytometry to MM.1R cells and HEK293F cells expressing huGPRC5D. Another round of immunizations was conducted using Ablexis mice, comparing GPRC5D DNA constructs, route of injection, and electroporation strategy.Attorney Docket No.: JBI6924WOPCT1 EXAMPLE 2. A NOVEL FORMAT CONVERSION IMPLEMENTED TO GENERATE ANTIBODIES EXHIBITING OPTIMAL COMPLEMENT-DEPENDENT CYTOTOXICITY (CDC) ACTIVITIES.

[0467] Effective complement-dependent cytotoxicity (CDC) of a therapeutic antibody relies onthe optimal recruitment of complement component 1q (C1q) and the formation of a hexameric Fc arrangement. The potency of CDC activity, particularly in the context of anti-CD20 therapeutic antibodies, is influenced by the interplay of stoichiometry, binding angle, and the flexibility of the Fab arm. These determinants are challenging to predict, making traditional screening of binding and CDC function on bivalent monoclonal antibodies (mAbs) insufficient for generating hits with optimal CDC activities.

[0468] To address this limitation and effectively screen molecules with the greatest CDCpotential, a novel molecular formatting approach was employed for binders selected from various immunization campaigns. The monovalent antibody features an Fc region paired with an anti-GPRC5D heavy and light chain (FIG.1), enhancing heterodimerization through the use of knobs-into-holes mutations. Heavy chain 1 includes the "knob" mutation T366W (EU numbering), while heavy chain 2 features the anti-GPRC5D Fab region and "hole" mutations T366S, L368A, Y407V, along with additional mutations H435R and Y436F to disrupt protein A binding. Both heavy chains incorporate K248E and T437R, or "RE", mutations in the constant region (Fc) designed to enhance antibody clustering on target cells, leading to improved complement-dependent cytotoxicity.

[0469] Antibodies were produced using either the CHO-Expi cell line, yielding a typical Fcglycan, or a Fut8 knockout cell line resulting in an Fc with fully afucosylated core glycan. Afucosylation enhances binding to Fcγ receptors, particularly FcgRIIIa (CD16), and to a lesser extent FcgRIIa, leading to enhanced effector functions, primarily antibody-dependent cell- mediated cytotoxicity (ADCC) and antibody-dependent cellular phagocytosis (ADCP).

[0470] FIG. 2 illustrates that generating a monoclonal antibody against GPRC5D alone isinsufficient for inducing CDC mechanisms to lyse tumor cells. While the bivalent antibody showed no CDC activity, the K248E and T437R, or "RE" mutations induced some CDC. However, a remarkable increase in CDC activity is observed when the molecular formatting combines the right binder, CDC-enhancing mutations, and monovalency. This molecularAttorney Docket No.: JBI6924WOPCT1 design is compatible with afucosylation, and molecules produced in both normal CHO cells and Fut8 knockout cells exhibit the same potent CDC activity. EXAMPLE 3. SCREENING FOR BINDING OF MONOVALENT HITS

[0471] A selection of 31 hits from various immunization campaigns underwent conversion tothe monovalent and CDC-enhancing format as detailed in Example 2. The selection was based on their sequence diversity, in silico liability analysis, target binding, and thermal stability. These monovalent binders, featuring CDC-enhancing Fc mutations, were subsequently reevaluated for binding to target cells to eliminate hits that may experience a loss of target binding due to reduced avidity as monovalent binders.

[0472] In brief, two endogenous GPRC5D-expressing cell lines, H929 and MM1.R, along withtheir corresponding GPRC5D knock-out lines, were cultured, harvested, and resuspended in PBS using standard cell culture procedures. The four cell lines were either stained with no fluorescent label, 0.02uM CSFE (BD Pharmingen, #C34554), or 0.2uM CTV (BD Pharmingen, #C34557), or both labels. Near-infrared live / dead stain (Thermo Fisher, #L10119) was added to all cells at a 1:10,000 dilution for 10-15 minutes at room temperature. Subsequently, cells were centrifuged for 5 minutes at 300g, and FBS (Gibco, #16000-036) was added to the tubes. After another centrifugation, cells were resuspended in R10 media, and all four lines were mixed in equal volumes.

[0473] Next, 50,000 cells (cell mixture) in a 50µL volume per well were placed in 96-well v-bottom polypropylene plates (Greiner Bio, #651261), and antibody dilutions were added to the cells. Following a 1-hour incubation at 37oC, cells were washed twice, and 50 µl of 2 µg / ml goat-anti-human Fc AF647 (Jackson IR , #109-606-098) was added to the appropriate wells of the plates, incubating for 30 minutes at 4oC. After two additional washes, cells were read on the Intellicyt iQue Screener Plus (Sartorius). Applying appropriate gating and compensation, the signal-to-background ratio (geometric mean of each population in each well / geometric mean of negative control wells) was plotted to generate cell binding dose-response curves for the GPRC5D monovalent hits No binding was observed of these monovalent hits to either of the GPRC5D knock-out cell lines. Binding parameters of wild type H929 and MM1.R are shown in Table 4. Table 4. Cell binding parameters of monovalent hitsAttorney Docket No.: JBI6924WOPCT1 H929 MM1.Rame EC50 To Botto Hill EC90( EC50 To Botto Hill EC90( 9 9 8 9 8 8 9 8 8 8 8 9 9 9 7 8 8 8 9 4 8 9Attorney Docket No.: JBI6924WOPCT1 EXAMPLE 4. SCREENING AND CHARACTERIZATION OF MONOVALENT HITS FOR CDC, ADCC, AND ADCP ACTIVITIES CDC Evaluation:

[0474] FIG. 3 illustrates the assessment of a panel of 16 monovalent human anti-GPRC5Dantibodies for their CDC-inducing activity against the MM.1R cell line using pooled human serum over a 24-hour period. The monovalent isotype control (B23B293.001), bivalent anti- GPRC5D (GC5B1231), and bivalent isotype control (B23B259) antibodies were included as controls, showing no CDC activity. Among the 16 monovalent anti-GPRC5D antibodies tested, only 5 exhibited varying levels of CDC activity.

[0475] In FIG. 4, a separate panel of 12 monovalent rat anti-GPRC5D antibodies underwentevaluation for CDC-inducing activity against the MM.1R cell line using pooled human serum. The monovalent isotype control (B23B293.001) showed no CDC activity. Out of the 12 monovalent rat anti-GPRC5D antibodies, 10 displayed varying levels of CDC activity. To explore the retention of CDC activity, two rat antibodies (GC5B1562 and GC5B1571) were humanized, resulting in a new panel of monovalent humanized anti-GPRC5D antibodies, as depicted in FIG.5. All antibodies retained CDC activity, similar to the monovalent anti- GPRC5D antibody GC5B1552.

[0476] FIG. 6 illustrates the evaluation of bivalent biparatopic anti-GPRC5D antibodies forCDC activity. None of the bivalent and biparatopic antibodies demonstrated substantial CDC activity, except GC5B1509 and GC5B1510. These antibodies were bivalent but contained only one anti-GPRC5D binding region, while the other binder was generated as a null that was not expressed on the surface of MM.1R cells. This confirmed that monovalent binding to GPRC5D was essential for substantial CDC activity against GPRC5D-expressing cells.

[0477] Finally, a comprehensive comparison of all bivalent and monospecific anti-GPRC5Dantibodies was conducted, testing them in combinations of CDC-enhancing mutations along with afucosylation against the MM.1R cell line. In all combinations, only the monospecific antibodies (GC5B1509 and GC5B1510) and CDC-enhancing antibodies demonstrated robust CDC activity, as illustrated in FIG.7. ADCC Evaluation:Attorney Docket No.: JBI6924WOPCT1

[0478] To verify ADCC activity, a set of four monovalent human anti-GPRC5D antibodiesunderwent assessment for ADCC-inducing activity against the MM.1R cell line. The evaluation, conducted after 48 hours using healthy donor NK cells at a 5:1 effector-to-target ratio in a flow cytometry-based assay, revealed that all four monovalent anti-GPRC5D antibodies retained varying levels of ADCC activity. This was compared to the bivalent positive control antibody, GC5B1231.AFU.002, and negative control isotypes, B23B259 (bivalent), and B23B293.001 (monovalent), as depicted in FIG.8. The digits after “AFU.” in GC5B1552.AFU numbers used herein this application represent protein batch numbers of GC5B1552.AFU. For example, in GC5B1231.AFU.002, ‘002’ is the batch number.

[0479] From the same panel of monovalent rat anti-human GPRC5D antibodies that hadpreviously demonstrated CDC activity, 10 antibodies were tested for ADCC activity against the MM.1R cell line. All 10 antibodies elicited ADCC activity, as illustrated in FIG.9. Subsequently, two of these rat anti-human GPRC5D antibodies (GC5B1571 and GC5B1562) were humanized and converted into a monovalent format, testing them for ADCC activity in comparison to the GC5B1552 antibody. The humanized anti-GPRC5D antibodies displayed increased potency in ADCC activity but demonstrated a lack of CDC and ADCC equipoise when compared to the GC5B1552 monovalent antibody, as shown in FIG.10.

[0480] Finally, the ADCC activity of bivalent, monospecific, and monovalent anti-GPRC5Dantibodies was assessed in the MM.1R cell line (FIGs.11 and 12). While the monospecific and monovalent antibodies were less potent than the bivalent antibodies, they demonstrated better equipoise between the CDC and ADCC mechanisms. ADCP Evaluation:

[0481] The ADCP activity of the monovalent anti-GPRC5D antibody, GC5B1552, wasassessed against various cell lines, including GPRC5D+ H929, H929 BCMA KO, and MM.1R, as well as the GPRC5D-, H929 GPRC5D KO cell line. GC5B1552 exhibited on-target ADCP activity against GPRC5D+ expressing cell lines, as depicted in FIG.13A, FIG.13B, FIG.13C, and FIG 13D. However, no ADCP activity was observed against the GPRC5D- cell line. EXAMPLE 5. EFFICACY OF GC5B1552.AFU.001 IN HUMAN MULTIPLE MYELOMA XENOGRAFTS WITH NK-92.CD16 CELL HUMANIZED NSG-IL15 MICEAttorney Docket No.: JBI6924WOPCT1

[0482] The efficacy of GC5B1552.AFU.001 was assessed in established luciferase-transfecteddisseminated MM.1S or OPM-2 human multiple myeloma (MM) xenografts in female NSG- IL15 mice humanized with 10e6 NK-92.CD16 cells weekly for 3 weeks. Animals were randomly assigned to groups (n=10) based on tumor burden, determined by live bioluminescence imaging (BLI) on day 3 or 13 post-intravenous tumor implantation for MM.1S and OPM-2 xenografts, respectively. GC5B1552.AFU.001 at doses of 10, 3, and 0.3 mg / kg, or the B23B293.001 isotype control antibody at 10 mg / kg, was administered intraperitoneally weekly for 3 weeks or q3-4 days for 6 weeks, respectively. Parallel treatment groups were established without human NK-92.CD16 cells to control for mouse effector cell contributions.

[0483] In the MM.1S xenograft model on day 28 post-tumor implantation, statisticallysignificant (p<0.05) antitumor efficacy was observed with GC5B1552.AFU.001 at all dose levels, resulting in 99-100% tumor growth inhibition (∆TGI) with and without NK-92.CD16 cells, compared to the respective B23B293.001 control (FIG.15) on day 28. Engraftment of animals with NK-92.CD16 cells led to more partial tumor responses with GC5B1552.AFU.001 treatment at 10 or 3 mg / kg, with 8 or 7 of 10 animals, respectively, compared to 2 of 10 animals with 3 mg / kg without NK engraftment on day 28 post-tumor implantation, demonstrating NK- mediated antitumor efficacy.

[0484] In the OPM-2 xenograft model on day 53 post-tumor implantation, statisticallysignificant antitumor efficacy was observed with GC5B1552.AFU.001 at all concentrations with and without NK-92.CD16 cells, compared to the B23B293.001 control (FIG.14). Treatment of animals that did not receive NK-92.CD16 cells with GC5B1552.AFU.001 at 10, 3, and 0.3 mg / kg resulted in 70%, 86%, and 65% ∆TGI, respectively, as compared to the respective B23B293.001 control on day 53. NK-92.CD16 engraftment enhanced antitumor activity, with treatment with GC5B1552.AFU.001 at 10, 3, and 0.3 mg / kg resulting in 100%, 100%, and 99% ∆TGI, respectively, as compared to the respective B23B293.001 control on day 53. In addition to enhancing TGI, NK.92.CD16 engraftment also increased the number of complete responses (CRs), with GC5B1552.AFU.001 at 10, 3, and 0.3 mg / kg resulting in 4, 3, and 4 of 10 animals, respectively, compared to no complete responses in treatment groups that did not receive NK-92.CD16 cells. Furthermore, treatment with GC5B1552.AFU.001 at 10 and 3 mg / kg in the presence of NK-92.CD16 cells resulted in significant 83% and 77% TR, respectively. Furthermore, treatment with GC5B1552.AFU.001 at 10, 3, and 0.3 mg / kg withoutAttorney Docket No.: JBI6924WOPCT1 NK-92.CD16 engraftment enhanced survival and resulted in 31%, >41%, and 32% ILS, respectfully, as compared to the respective B23B293.001 control.

[0485] Taken together with in vitro data showing that GC5B1552.AFU can induce antigen-specific NK-mediated cytotoxicity against multiple GPRC5D+hematological tumor cell lines, these studies provide support for clinical investigation of GC5B1552.AFU as a therapeutic for GPRC5D+MM. EXAMPLE 6: AFFINITY, ASSOCIATION CONSTANT, AND DISSOCIATION CONSTANT

[0486] Due to GPRC5D’s nature as a membrane G protein-coupled receptor, the measurementof antibody affinity by Surface Plasmon Resonance (SPR) with typical recombinant antigens is not feasible. Instead, nanodiscs, synthetic model membranes, were utilized to present GPRC5D proteins in a configuration resembling their native conformation.

[0487] The binding kinetics of GPRC5D-nanodiscs (Acro, #GPD-H52D4) to anti-GPRC5Dantibodies were analyzed through SPR using Biacore T200 or Biacore 8K instruments. A sensor chip surface was prepared with goat-anti-human-Fc reagent, and antibodies were captured on the sensor chip via the Fc region. GPRC5D-nanodiscs were subjected to a buffer change to running buffer using a desalting column (Thermo Fisher, #89890) following the manufacturer's recommendations. Various concentrations of GPRC5D-nanodiscs were injected onto the captured ligands, and the association (for 120 seconds) and dissociation (for 300 seconds) rates were monitored over time. The sensor chip surface was regenerated at the end of each cycle by short pulses of dilute 0.85% H3PO4 for 20 seconds (2x), followed by running buffer 1x HBSP (1x). A global fitting of all non-zero concentrations using a 1:1 Langmuir binding model was employed to determine kinetic rates (ka and kd) and binding affinity KD.

[0488] Double reference subtraction was achieved by including a zero concentration ofGPRC5D-nanodisc (e.g., running buffer only) and flow path correction from the reference flow cell where the capture of ligands was omitted. Table 5. Binding Affinity, Association Constant, and Dissociation Constant of GPCR5D Hits to Human GPRC5D Nanodisc Protein ID GPRC5D Binder Avg ka (1 / Ms) Avg kd (1 / s) Avg KD (nM)Attorney Docket No.: JBI6924WOPCT1 Protein ID GPRC5D Binder Avg ka (1 / Ms) Avg kd (1 / s) Avg KD (nM)GCDB334.001 GC5B596 1.18E+04 4.23E-03 359. , , Human and Cyno GPRC5D Nanodisc Protein ID GPRC5D Species Avg ka (1 / Ms) Avg kd (1 / s) Avg KD (nM)GC5B1552 AFU 003 Human 220E+04 169E-03 77:

[0489] A dozen GPRC5D binders underwent evaluation for kinetic cell binding on H929-WTand MM.1R-WT cell lines. The antibodies were initially diluted in complete RPMI at a 2X concentration with an adjusted blocking mix (1:20 dilution of peptide-based block (Innovex) + 125µg / mL rat gamma globulins (Jackson)) and incubated at 37℃ in a deep well plate. Subsequently, cells were harvested and counted using Vi-Cell XR (Beckman Coulter) and added to the master deep well plate to achieve ~1x105cells per timepoint. At each time point, cells were transferred to a round-bottom 96-well plate containing cold FACS buffer (Stain buffer containing 0.2% BSA (BD) + 2mM EDTA (ThermoFisher)), centrifuged (1200RPM, 5 min), and the supernatant was aspirated. After two additional washes with FACS buffer, cells were stained at 4℃ with Alexa Fluor® 647 AffiniPure F(ab')₂ Fragment Goat Anti-Human IgG, Fcγ fragment-specific diluted in Fc block (1:200, Jackson) for 30 minutes. Following incubation, cells were washed three more times with cold FACS buffer and then resuspended in FACS buffer containing Sytox Green to label all dead cells (ThermoFisher). Plates were run on the Intellicyt iQue Screener Plus (Sartorius) within three hours of staining.

[0490] Using the ForeCyt software, singlet-live populations were gated, and the medianfluorescent intensity (MFI) of the APC channel was calculated for each sample. Raw data were exported to Excel (Office 365, Microsoft), where duplicates were averaged and further analyzedAttorney Docket No.: JBI6924WOPCT1 in Prism software (v.9.0.0, GraphPad). Final graphs present the median fluorescent intensities of each molecule concentration at each time point.

[0491] Different GPRC5D binders exhibited varying levels of binding to H929 and MM1R cells(FIG.16A, FIG.16B, FIG.16C, FIG.16D, FIG16E, and FIG.16F ). Notably, GP5B82 and GP5B66 binders demonstrated the strongest cell binding signal, aligning with the SPR affinity data indicating their higher affinity. The binders exhibited stable and increasing cell binding over time, suggesting no significant internalization. The kinetic binding study was repeated for GC5B1552.AFU after the final formatting conversion, and similar stable cell binding was observed. EXAMPLE 8A: EXPRESSION AND PURIFICATION OF GC5B1552.AFU

[0492] GC5B1552.AFU (see amino acid and nucleic acid sequences in Tables 7 to 10) wasexpressed in a fucosyltransferase 8 (FUT8) knockout CHO host cell line, C3234B (Janssen R&D), to generate afucosylated antibodies. The purification process involved protein-A chromatography followed by mixed-mode column chromatography. Table 7A. Variable Regions and Heavy / Light Chain Sequences for GC5B1552.AFU VH VL HC1 Heavy Chain 1 HC2 Heavy Chain 2 LC2 Light Chain 2 VH Amino VL Amino Clone SEQ SEQ SEQ (HC1) Sequence SEQ (HC2) Sequence SEQ (LC2)Sequence A id A id SL IT DL K SS SG TIS YY TF RT PS S P V Q DS S VY LS GEAttorney Docket No.: JBI6924WOPCT1 YRQKSLSLSPG KVEPKSCDKT K HTCPPCPAPEL LGGPSVFLFPPunderlined. SEQ ID NO: 27 ATGGCTAGATCCGCACTGCTCATTCTGGCTCTGCTTCTGCTTGGACTGTTCTCTCCTGGAGCATGGGG AGACAAAACTCACACTTGTCCACCGTGCCCAGCACCTGAACTGCTGGGGGGACCGTCAGTCTTCCTC G G C C C A C C TTable 8B. Nucleotide sequence of GC5B1552.AFU Light Chain 2 gene with signal peptide underlined. SEQ ID NO: 28 ATGGCCAGGAAGTCCGCTCTGCTCGCTCTGGCACTTCTGCTTCTGGGATTTGGACCTGCTTGGGCTG A AT A AT A A T T AT T T T T A T A A A T A AT A TG A G AAttorney Docket No.: JBI6924WOPCT1 GCGGAACACCTATCCTCTGACCTTTGGCGGAGGCACCAAGGTGGAAATCAAGCGTACTGTGGCTGC ACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAACTGCCTCTGTTGTGTGCC TGCTGAATAACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTCCAATCGG C Cunderlined. SEQ ID NO: 29 ATGGCCAGGAAGTCCGCTCTGCTCGCTCTGGCACTTCTGCTTCTGGGATTTGGACCTGCTTGGGCTC AGGTGCAGCTGGTTGAATCTGGTGGCGGAGTGGTGCAGCCTGGCAGATCTCTGAGACTGTCTTGTGC CGCCTCCGGCTTCACCTTCTCCAACTACGGAATGCACTGGGTCCGACAGGCCCCTGGCAAAGGATTG A C C C C T C T A T C C C C A T. g . Numbering Chain CDR1 (SEQ ID NO) CDR2 (SEQ ID NO) CDR3 (SEQ ID NO) Format 8))Attorney Docket No.: JBI6924WOPCT1

[0493] In brief, C3234B cells were cultured in suspension in ExpiCHO™ Expression Medium(ThermoFisher; Cat # A2910001) at 37°C, 8% CO2, and 125 rpm. Cells were passaged into 12×2L sterile, vented, non-baffled Erlenmeyer flasks (Corning 431255) with a 400mL starting culture volume per flask.

[0494] On Culture Day 0, plasmid DNAs (HC1:HC2:LC chain ratio of 1:2:6) for transfectionwere diluted in OptiPRO medium (ThermoFisher Cat # 12309019), and ExpiFectamine™ CHO transfection reagent was diluted in another portion of OptiPRO medium. The plasmid DNA and ExpiFectamine™ CHO reagent mixtures were combined and distributed across the 12 flasks. After overnight incubation (Culture Day 1), additional components were added, and cells were further incubated according to the ExpiFectamine™ CHO transfection kit Max Titer protocol.

[0495] On Culture Day 5, cells were supplemented, and incubation continued until harvest(Culture Day 12). The clarified supernatant from the transiently transfected C3234B cells was subjected to centrifugation and filtration. GC5B1552.AFU was then purified from the clarified supernatant.

[0496] The filtered cell culture supernatant was loaded onto a pre-equilibrated MabSuRe ProteinA column (GE Healthcare, CV=167 mL, 4.4 cm diameter). After loading, the column was washed and eluted. The eluted protein was neutralized, pooled, and dialyzed.

[0497] Further purification was conducted by mixed-mode chromatography (MMC) using CaptoMMC ImpRes resin (GE Healthcare, CV=145 mL, 3.2 cm diameter). The eluted fractions containing monomeric protein were pooled, dialyzed, and filtered.

[0498] The concentration of purified protein was determined spectrophotometrically, and itsquality was assessed by SDS-PAGE and analytical SE-HPLC (Agilent HPLC system). Endotoxin levels were measured using a turbidimetric LAL assay (Pyrotell®-T, Associates of Cape Cod; Falmouth, MA). EXAMPLE 8B: Table 7B Variable Regions and Heavy / Light Chain Sequences for GC5B1552.AFU VH VL HC1 Heavy Chain 1 HC2 Heavy Chain 2 LC2 Light Chain 2 VH Amino VL Amino ceAttorney Docket No.: JBI6924WOPCT1 QVQLVES DIQMTQSP DKTHTCPPCPA QVQLVESGGG DIQMTQSPSSL GGGVVQP SSLSASVG PELLGGPSVFL VVQPGRSLRLS SASVGDRVTIT GRSLRLS DRVTITCR FPPKPEDTLMI CAASGFTFSNY CRASQGIRNDL K SS SG TIS YY TF RT PS S P V Q DS S VY LS GEEXAMPLE 9: BIOPHYSICAL PROPERTIES

[0499] GPRC5D antibodies underwent assessment for various biophysical properties using thefollowing methodologies:Attorney Docket No.: JBI6924WOPCT1

[0500] 1. Differential Scanning Calorimetry (DSC): DSC experiments were conducted with aMicroCal Auto VP-capillary DSC system (Malvern Instruments Ltd., Malvern, UK). Samples, approximately 1.0 mg / mL in 1× PBS buffer, were subjected to a temperature ramp from 25°C to 95°C at a rate of 10°C / min. Analysis of resulting data was performed using MicroCal Origin 7 software.

[0501] 2. NanoDSF (Differential Scanning Fluorimetry): The conformational stability ofproteins was measured using advanced nanoDSF technology. Intrinsic fluorescence of tryptophan during thermal unfolding was monitored using the Prometheus NT.48 instrument (NanoTemper Technologies GmbH). Samples at 0.5 mg / ml in phosphate buffer saline (PBS) were analyzed in duplicates. Thermal melting mid-point (Tm) values and onset of aggregation (Tagg) were identified and reported.

[0502] 3. CIC (Cross-Interaction Chromatography ): Antibody retention times in CIC weredetermined by injecting 0.1 mg / mL samples into an Agilent 1200 series HPLC system with PBS as the mobile phase. Retention times were measured at 214, 254, and 280 nm using a UV detector. Peaks were visualized, and methods were described as previously published.

[0503] 4. HIC (Hydrophobic Interaction Chromatography) : HIC analysis was performed on anAgilent 1200 series HPLC system using a TOSOH TSKgel Butyl NPR column. Samples were injected, and an isocratic elution with 80% 2 M ammonium sulfate in PBS was carried out. The column was washed and re-equilibrated between runs.

[0504] 5. SEC (Size Exclusion Chromatography): For each SEC experiment, the antibody wascoupled to Toyopearl AF-tresyl-650M chromatography resin. Peaks were visualized at 215 nm, and retention times were determined using HPLC Ettan LC system UNICORN software.

[0505] 6. Viscosity Measurement: Viscosity of the sample at 100 mg / mL was determined as afunction of shear rate using the NeoVisc Multiplexed Viscometer (Neofluidics LLC, California, USA). Measurements were conducted at 25°C, and viscosity values were reported as averages of duplicates. Table 11. Biophysical Assessments of GPRC5D BindersAttorney Docket No.: JBI6924WOPCT1 ID Binder Conformational Stability byHydrophobicity Nano-DSFby aHIC CIC)format of GC5B1552)exhibits the overall most favorable profile, indicating minimal manufacturing developability risks (Table 11). For instance, GC5B752 demonstrates a higher retention time and hydrophobicity index, while GC5B754 exhibits higher viscosity at 22.6 cP at 90 mg / mL in 10 mM Histidine pH 6.5, compared to 4.6 cP for GC5B1552 at 100 mg / mL in Acetate pH 5.5.

[0507] GC5B1552 was measured in duplicates to have Tonset = 57.60C, Tm1 = 65.20C and Tm2= 68.90C. Additionally, GC5B1552 displayed a retention time of 5.40 minutes and a peak width of 1.06 minutes. Comparative analysis revealed that GC5B1552 demonstrates lower hydrophobicity (Hydrophobicity index, HI=0.42) in contrast to a well-established control monoclonal antibody, CNTO5825 (HI=0.49). EXAMPLE 10: FCγR AFFINITY AND KINETICS

[0508] The assessment of FcγR-antibody interactions was conducted using Surface PlasmonResonance (SPR) on a four-channel Biacore T200 optical biosensor system at 25°C (GE Healthcare, Piscataway, NJ). To prepare the biosensor surface, anti-his antibody was coupled to a CM4 sensor chip using amine-coupling chemistry. Following activation and deactivation steps, the Fcγ receptors (FcgRI, FcgRIIa, FcgRIIb, FcgRIII) from human and cynomolgus sources were captured on separate flow cells, with flow cell 1 serving as a reference.

[0509] Optimal capture levels for each receptor were determined, and subsequent interactioncycles assessed the binding of antibodies (GC5B1552.AFU.003 and CNTO3930) to each FcγAttorney Docket No.: JBI6924WOPCT1 receptor. After injection, the dissociation phase was monitored, and the sensor chip surface was regenerated for subsequent cycles.

[0510] The antibody titration series for each Fcγ receptor included a range of concentrations, andinteraction parameters were set accordingly. Sensorgrams were processed and analyzed using Biacore T200 Evaluation software. Double-referenced sensorgrams were fitted to a 1:1 Langmuir binding model for CD64 and CD16 receptors or an Equilibrium Steady-State binding model for CD32 receptors to determine binding kinetics and affinities.

[0511] The results for FcγR-antibody interactions were reported as an average of triplicates,presenting kon (on-rate), koff (off-rate), and KD (equilibrium dissociation constant), or KD only for steady-state analysis.

[0512] GC5B1552.AFU exhibits binding to both human and cynomolgus FcγRs, as summarizedin Table 12. Notably, it demonstrates a 50.7- and 111.3-fold increase in binding affinities to human FcγRIIIa 158F and V alleles, respectively. This heightened binding to FcγRIIIa contributes significantly to the enhancement of ADCC mechanisms. Table 12. FcγR-Antibody Affinity And Kinetics 95% Avg 95% CI Avg Avg 95% Fold CI e ng 1 1 1 1 1 1 1 1 1 .5 .9 .8 .2Attorney Docket No.: JBI6924WOPCT1 6.67E+0 1.08E hu-RI 5.67E+05 7.38E-04 1.3 0.3 2.2 4 -04 hu-RIIa N / A N / A 3707 1133 2.5 .0 .7 .3

[0513] The pharmacokinetic (PK) characteristics of GC5B1552.AFU and GC5B1509.AFU wereevaluated in a single-dose, non-GLP PK study intravenously (IV) administered to female and male cynomolgus monkeys, with three animals per molecule. The IV administration was conducted at a dose of 0.5 mg / kg (in 10 mM histidine, pH 6.0). Total GC5B1552.AFU concentrations were quantified using a qualified electrochemiluminescence immunoassay (ECLIA) from Meso Scale Discovery (MSD).

[0514] Systemic drug exposure was assessed by determining the maximum serum drugconcentration (Cmax) and the area under the drug serum concentration-time curve (AUC) for one dose interval, as presented in Table 13. Serum concentrations over time are depicted in FIGs.17 and 18.

[0515] The heavy chains of GC5B1552.AFU incorporate mutations (K248E and T437R) in theconstant region (Fc), representing a novel and crucial design aimed at enhancing complement- dependent cytotoxicity. Notably, the PK properties and serum concentrations of GC5B1552.AFU closely resemble those of GC5B1509.AFU, which shares the same binder and monovalency but lacks the K248E and T437R mutations. Table 13. Individual and Mean (SD) Serum Pharmacokinetic Estimates Following a Single IV Dose of 0.5 mg / kg in Cynomolgus Monkeys Group Gender ID Cmax AUClast AUCinf Vz CL T1 / 2 y) 576646Attorney Docket No.: JBI6924WOPCT1 GC5B1509.AFU Male 1KR19 11.06 24.06 24.47 172.13 20.43 5.84Male 1YV19A 10.42 45.89 47.02 111.34 10.63 7.2651bivalent GPRC5D mAb) were evaluated in a distinct study involving 12 cynomolgus monkeys, each receiving a single dose of GC5B1231.AFU. The initial dosing occurred on Day 1, and the study design is outlined in Table 13. Quantification of GC5B1231.AFU concentrations was performed using a validated Electrochemiluminescence Immunoassay (ECLIA) method on the MSD platform. The summarized PK parameter estimates are presented in Table 15, with serum concentrations depicted in FIGs.19-22.

[0517] GC5B1231.AFU contains the GPRC5D binder GP5B66. Another antibody, GC5B754,containing the same binder, exhibited notably high viscosity at 22.6 cP when at 90 mg / mL. In contrast, GC5B1552.AFU displayed a significantly lower viscosity of 4.6 cP at 100 mg / mL, indicating superior biophysical characteristics compared to GC5B754. Given the known impact of suboptimal biophysical traits on the pharmacokinetic (PK) properties of therapeutic antibodies, GC5B1552.AFU was selected due to its superior biophysical attributes. This choice aims to potentially mitigate both the risks associated with chemistry, manufacturing, and control (CMC), as well as PK concerns in future developments. Table 14. PK study design of GC5B1231.AFU Group Test Article Dose (mg / kg) Route Number of AnimalsTable 15. Individual and Mean (SD) Serum GC5B1552.AFU PK Parameter Estimates Following a Single Dose of GC5B1552.AFU in Cynomolgus Monkeys Group ID CmaxTmax AUClast AUCinf CL Vz T1 / 2Attorney Docket No.: JBI6924WOPCT1 Group 2 2001 229.96 - 647.19 652.57 15.32 78.78 3.56IV 2002 214.93 - 557.73 567.10 17.63 117.95 4.6410 k 2501 209 22 597 78 610 42 16 38 11371 481

[0518] To evaluate non-specific binding, antibodies featuring diverse GPRC5D bindersunderwent scrutiny using Retrogenix cell microarray technology. The screening library encompassed over 5000 expression vectors, encoding full-length human plasma membrane proteins, secreted proteins, or cell surface-tethered secreted proteins. Each vector included ZsGreen1 for transfection confirmation and was arrayed in duplicate across multiple microarray slides. Quadruplicate spots of an expression vector (pIRES-hEGFR-IRES-ZsGreen1) were included on every slide to ensure a threshold of transfection efficiency. Reverse transfection / expression was performed in human HEK293 cells, followed by the addition of GPRC5D antibodies at a determined final concentration, typically 2 μg / mL, post-cell fixation. Binding detection utilized an AlexaFluor647-labeled anti-human IgG Fc detection antibody, validated in the pre-screen. Image analysis and quantification, including transfection efficiency, were conducted using ImageQuant software (GE Healthcare, Version 8.2). A protein 'hit' was identified when duplicate spots exhibited an elevated signal compared to background levels, categorized as 'strong, medium, weak, or very weak' based on intensity. All GPRC5D antibodies demonstrated strong binding to the primary target GPRC5D in this microarray. However, potential non-specific interactions were observed for certain binders. Further investigation of these hits was carried out using flow cytometry. Live HEK293 cells were transfected with vectors encoding the hits and ZsGreen1-only (negative control), followed by incubation with 1 or 2 μg / mL GPRC5D antibodies. Positive and negative assay controls were included, and assessments were made using flow cytometry. In the flow cytometry confirmation, some GPRC5D antibodies exhibited weak non-specific interactions, albeit significantly weaker than the primary interaction with GPRC5D. Conversely, GC5B1552.AFU exhibited robust bindingAttorney Docket No.: JBI6924WOPCT1 exclusively with GPRC5D, showcasing high specificity for its primary target. These results underscore the specificity of GC5B1552.AFU for GPRC5D. EXAMPLE 13: NONCLINICAL STUDIES TABLE 16. List Of Abbreviations And Definitions Of Terms Abbreviations ADA anti-drug antibodyADCC ntib d d nd nt ll l r t t xi itAttorney Docket No.: JBI6924WOPCT1 ISO International Organization for StandardizationIV intravenousKD dissociation constant. 13.1.1 Primary Pharmacodynamics 13.1.1.1 GPRC5D Expression in Normal Human Tissues

[0519] Analysis of GPRC5D normal tissue expression included a review of literature, publicdomain databases including the Human Protein Atlas , as well as application of tissue section- based protein (immunohistochemistry [IHC]) and gene expression (such as RT-PCR and in situ hybridization [ISH]) techniques.

[0520] Published literature and internally generated data demonstrated that GPRC5D has limitedexpression in normal tissues: 1) normal plasma cells (with little to no expression in B cells or B-cell precursors) with lower cell surface expression compared to on MM cells (Verkleij et al., Blood Adv.5(8):2196-2215(2021)); 2) hair follicles and eccrine sweat glands in skin; and 3) filiform papillae in tongue. Humans and monkeys have comparable patterns of GPRC5DAttorney Docket No.: JBI6924WOPCT1 expression with minor differences in RNA expression of a few tissues that are unlikely to impact clinical translation (see Section 13.1.1.4).

[0521] GPRC5D expression has been reported in human normal plasma cells (Venkateshaiah etal., Blood 122(21): Poster 651 (2013); Kodama et al., Mol Cancer Ther.18(9):1555-1564 (2019); Smith et al., Sci Transl Med.11(485):eaau7746 (2019); Verkleij et al., Blood Adv.5(8):2196- 2215 (2021)). Consistent with the literature, mRNA and protein expression of GPRC5D was confirmed by ISH and IHC in interstitial / tissue-resident plasma cells (by morphology) in human normal lymphoid organs (tonsil, lymph node, spleen, bone marrow), gastrointestinal tract (stomach, duodenum and colon) and salivary glands ( Pillarisetti et al., Blood 135(15):1232-1243 (2020) and Goldsmith et al., Clinical Lymphoma Myeloma and Leukemia.21(2):P91(2021)). Inoue et al first reported GPRC5D mRNA and protein expression in hair follicles in skin and keratinized structures called filiform papillae in the tongue (both in mice) (Inoue et al., J Invest Dermatol.122(3):565-573 (2004)), while Smith et al reported expression in hair follicles and apocrine sweat glands of skin in human and monkey (Smith et al., Sci Transl Med. 11(485):eaau7746 (2019)). GPRC5D expression (by ISH and IHC) was confirmed in hair bulb and shaft and epithelial cells of eccrine sweat glands of human skin, as well as in filiform papillae of the human tongue (Goldsmith et al., Clinical Lymphoma Myeloma and Leukemia. 21(2):P91 (2021)). GPRC5D expression in human nails has not been assessed; however, it has been reported in nail beds in mouse (mRNA; Inoue et al., J Invest Dermatol.122(3):565-573 (2004)), and a similar pattern of expression is likely in humans.

[0522] Low levels of GPRC5D mRNA were detected by RT-qPCR in cerebellum (Pillarisetti etal., Blood 135(15):1232-1243 (2020)). While ISH of cerebellum was negative, low expression of GPRC5D mRNA was detected (Goldsmith et al., Clinical Lymphoma Myeloma and Leukemia.21(2):P91(2021)) in a subset of motor neurons within the inferior olivary nucleus (ION) of the medulla oblongata with no corresponding IHC protein signal in adjacent tissue. These motor neurons extend axons into the cerebellum, and detection of RNA in these cells could explain very low levels of RNA detection by RT-qPCR in the cerebellum (Pillarisetti et al., Blood 135(15):1232-1243 (2020)). mRNA expression in the ION was subsequently confirmed by microarray (Mailankody et al., Engl J Med.387(13):1196-1206 (2022)). Smith et al did not report GPRC5D protein expression in human brain and GPRC5D protein was not detected by IHC in any of the normal human brain samples examined, including cerebrum, cerebellum,Attorney Docket No.: JBI6924WOPCT1 medulla, corpus callosum, striatum, thalamus, midbrain and meninges (Smith et al., Sci Transl Med.11(485):eaau7746 (2019)). In human male reproductive tract, low levels of GPRC5D RNA have been reported by RT-qPCR in testis and prostate (Brauner-Osborne et al., Biochim Biophys Acta.1518(3):237-248 (2001) and Pillarisetti et al., Blood 135(15):1232-1243 (2020)), and expression in testis was confirmed by ISH. However, ISH of normal human prostate, seminal vesicle and epididymis did not reveal expression of GPRC5D mRNA, and IHC did not detect any GPRC5D protein expression in normal human male reproductive tract. Human female reproductive tract was negative by both ISH and IHC. 13.1.1.2 In Vitro Studies13.1.1.2.1 Binding Characterization

[0523] The binding kinetics of GC5B1552.AFU to GPRC5D was measured by SPR utilizingnanodisc, a technology that enabled surface immobilization of membrane proteins for sensing and detection. Using this method, the binding affinity (KD) for GC5B1552.AFU to human GPRC5D was 84 nM. GC5B1552.AFU bound to cynomolgus GPRC5D with ≥23-fold weaker affinity (estimated KD≥1900 nM).

[0524] Cell binding of GC5B1552.AFU to endogenous GPRC5D+ MM cell lines was evaluatedby flow cytometry at 37℃ for 1 hour. Cell-based EC50 values were calculated as 6.4 and 5.6 nM for H929 and MM.1R, respectively. No binding was observed for H929 GPRC5D knockout (KO) and MM.1R GPRC5D KO cells. 13.1.1.2.2 GPRC5D Expression in MM BMMC Plasma Cells and MM Cell Lines

[0525] The expression of GPRC5D was evaluated by flow cytometry in CD138+ (plasma cells)population of primary MM BMMCs (n=30) bone marrow mononuclear cells (BMMCs) (Table 17) and MM cell lines (Table 18). The JIM-3 and AMO-1 cell lines showed similar GPRC5D receptor density as MM patient samples. Table 17. GPRC5D Percent Expression and Receptor Density Values in CD138+BMMC MM Samples. Antigen Percent CD138+Receptor density (ABC) GPRC5D 70.4 (± 3.6) 7,032 (± 812)Attorney Docket No.: JBI6924WOPCT1 ABC, antibody binding capacity; BMMC, bone marrow mononuclear cells; CD, cluster of differentiation; GPRC5D, G-protein-coupled receptor Family C Group 5 Member D; MM, multiple myeloma; SEM, standard error of the mean. Mean values±SEM (n=30) shown for GPRC5D in CD138+(plasma cells) BMMC MM samples. Receptor density counts (in ABC) were quantified on live cells using Bangs Quantum™ Simply Cellular®quantitative cellular antigen expression kit. TABLE 18. GPRC5D PERCENT EXPRESSION AND RECEPTOR DENSITY VALUES IN MM CELL LINES Cell line Receptor density (ABC) OPM-2 148,938 MM.1R 168,781 MM.1S 65,913 H929 47,351 JIM-3 36,692 AMO-1 29,017 ABC, antibody binding capacity; BMMC, bone marrow mononuclear cells; GPRC5D, G-protein-coupled receptor Family C Group 5 Member D; MM, multiple myeloma. ABC values of GPRC5D are shown for 6 hematologic tumor cell lines. Receptor density counts (in ABC) were quantified on live cells using Bangs Quantum™ Simply Cellular®quantitative cellular antigen expression kit. 13.1.1.2.3 GC5B1552.AFU-mediated Antibody-dependent Cellular Cytotoxicity (ADCC) of MM Cell Lines

[0526] An ADCC assay was used to evaluate the in vitro cytotoxicity of GC5B1552.AFU onMM.1R, H929, and AMO-1 MM cell lines using primary healthy donor human NK cells. An isotype control was used as a negative control. GC5B1552.AFU demonstrated concentration- dependent cytolytic activity of all the MM cells lines, with EC50 values of 0.005, 0.04, and 1.20 nM, for MM.1R, H929, and AMO-1 cells, respectively (FIG.24). GC5B1552.AFU showed no ADCC activity in a H929 GPRC5D KO cell line. NK cell activation was measured by CD137, which showed a similar pattern to MM cell cytotoxicity. Additionally, NK cells alone were treated with GC5B1552.AFU, isotype control, or anti-CD38 (positive control) evaluated NK cell fratricide. GC5B1552.AFU did not result in NK fratricide but the positive control anti- CD38 did, due to CD38 expression on NK cells. 13.1.1.2.4 GC5B1552.AFU-mediated Complement-dependent Cytotoxicity (CDC) of MM Cell LinesAttorney Docket No.: JBI6924WOPCT1

[0527] In vitro CDC activity of GC5B1552.AFU was evaluated in the MM.1R, JIM-3, andAMO-1 cell lines using a CellTiter-Glo®assay using 40% human serum. GC5B1552.AFU induced CDC on the cell lines tested, with EC50 values of 8.77, 13.1, and 35.3 nM for MM.1R, JIM-3, and AMO-1, cells, respectively (FIG.25). 13.1.1.2.5 GC5B1552.AFU-mediated Antibody-dependent Cellular Phagocytosis (ADCP)

[0528] The in vitro ADCP activity of GC5B1552.AFU in MM.1R and H929 cells was evaluatedin an ADCP assay, using healthy donor isolated human monocytes induced into a M1- macrophage phenotype. GC5B1552.AFU induced ADCP against MM.1R and H929 with the same EC50 value of 0.05 nM (FIG.26). The isotype control showed no ADCP activity in the cell lines tested. Additionally, GC5B1552.AFU did not induce any ADCP in a GPRC5D–H929 GPRC5D KO cell line. 13.1.1.2.6 GC5B1552.AFU ADCC and CDC Effect Against MM Plasma Cells

[0529] Bone marrow mononuclear cells from patients with MM were used in ADCC and CDCassays to evaluate the cytotoxic activity of GC5B1552.AFU on the CD138+plasma cell population. All the samples expressed GPRC5D, which ranged in receptor density of 10,189 to 90,210 antibody binding capacity (ABC), with MM sample 6 having the highest GPRC5D expression ( Table 19). Table 19. Expression of GPRC5D CD138+MM BMMCs Used in ADCC and CDC Assays MM patient GPRC5D ABC Sample 1 63,592 Sample 2 13,552 Sample 6 90,210 Sample 17 10,189 ABC, antibody binding capacity; ADCC, antibody-dependent cellular cytotoxicity; BMMC, bone marrow mononuclear cell; CD, cluster of differentiation; CDC, complement-dependent cytotoxicity; GPRC5D, G-protein- coupled receptor Family C Group 5 Member D; MM, multiple myeloma; NK, natural killer. Receptor density counts (in ABC) were quantified on live cells using Bangs Quantum™ Simply Cellular®quantitative cellular antigen expression kit.

[0530] The cytotoxic activity of GC5B1552.AFU on MM BMMC CD138+ plasma cells from4 donors was evaluated using primary human NK cells derived from healthy donors in an ADCC assay and 40% human serum in a CDC assay. GC5B1552.AFU induced varying levels ofAttorney Docket No.: JBI6924WOPCT1 ADCC with all 4 donors tested in a concentration-dependent manner and EC50values ranging between 0.007-0.64 nM and CDC activity in 2 of 4 MM samples tested, and EC50 values of 35.5- 40.5 nM (FIGs.27A and 27B, Table 20).

[0531] The same MM donor samples were also evaluated in a CDC assay with GC5B1552.AFUalong with 40% human serum. After 2 hours, cytotoxicity was evaluated like in the ADCC assay. Multiple myeloma patient sample 6 was the most sensitive and MM patient sample 17 showed minimal sensitivity to GC5B1552.AFU ( FIGs.27A and 27B, Table 19 ). Samples 1 and 2 were not sensitive to CDC-mediated cytotoxicity by GC5B1552.AFU. Table 20. EC50Values (nM) Observed for GC5B1552.AFU From MM CD138+cells in ADCC and CDC Assays MM Sample# Sample 1 Sample 2 Sample 6 Sample 17ADCC EC50 (nM) 0.007 0.09 0.04 0.64CDC EC50 (nM) ND ND 40.5 35.5ADCC, antibody-dependent cellular cytotoxicity; CD, cluster of differentiation; CDC, complement-dependent cytotoxicity; EC50, 50% effective concentration; MM, multiple myeloma; ND, not determined. GC5B1552.AFU viability EC50 values from CD138+MM patient samples (1, 2, 6, and 17) in ADCC and CDC assays are shown. EC50values were estimated using post-hoc estimation from the fitted model parameters. 13.1.1.3 In Vivo Studies Table 21. List Of AbbreviationsAttorney Docket No.: JBI6924WOPCT1ABC antibody bound per cellADCC antibody-dependent cellular cytotoxicityADCP antibody-dependent cellular phagocytosisBLI bioluminescent imagingCD cluster of differentiationCDC complement-dependent cytotoxicityCR complete responseDPBS Dulbecco’s phosphate-buffered salineFab fragment antigen-bindingFc fragment crystallizableFcγR Fc gamma receptorGPRC5D G-protein-coupled receptor Family C Group 5 Member DHu humanIg immunoglobulinIL interleukinILS increased life spanIVIS In vivo Imaging Systemluc luciferasemAb monoclonal antibodyMM multiple myelomaMSD Mesoscale DiagnosticMMRM mixed model for repeated measuresNK natural killerNOD non-obese diabeticNSG-Tg(Hu-IL15) non-obese diabetic (NOD) severe combined immunodeficiency (scid) gamma or NOD.Cg-PrkdcscidIl2rgtm1WjlTg(IL15)1Sz / SzJp photonsPK pharmacokinetic PR partial tumor regressionROI region of interestRPMI Roswell Park Memorial InstituteRT room temperaturescid severe combined immunodeficiencysr steradianTGI tumor growth inhibitionTR tumor regression

[0532] The goal of in vivo studies was to evaluate the antitumor activity of GC5B1552.AFU intwo disseminated, established GPRC5D+human MM xenograft models: MM.1S-luc and OPM- 2-luc. In these studies, antitumor activity of GC5B1552.AFU was assessed by its ability to elicit effector functionality on mouse cells or engrafted human NK-92.CD16 cells. While non- obese diabetic (NOD) severe combined immunodeficiency [scid] gamma or NOD.Cg‑PrkdcscidIl2rgtm1WjlTgIL151Sz / SzJ (NSG-Tg[human {Hu}-interleukin {IL}15]) mice do not have mouse NK cells, they do harbor mouse monocytes, macrophages and dendritic cells, which are effector cells capable of eliciting ADCC and / or ADCP. Replicating the dosing regimen in the presence and absence of NK-92.CD16 cell engraftment allowed for the assessment of human versus mouse effector cell contributions on tumor growth inhibition.Attorney Docket No.: JBI6924WOPCT1

[0533] The tolerability of GC5B1552.AFU could not be assessed with respect to GPRC5Dbinding to host tissues since the anti-GPRC5D fragment antigen-binding (fab) does not bind mouse GPRC5D. 13.1.1.3.1 Test agents and controls Error! Reference source not found.

[0534] The test agent of these studies, antibodycomprising a human IgG1-like Fc region an heavy and light chain. Heterodimerization is enhanced using the knobs-into-holes mutations in the IgG1-based Fc region. Both heavy chains feature mutations K248E and T437R in the constant region, which are designed to enhance antibody clustering when bound to a target cell, leading to enhanced CDC. The core glycan in the antibody is afucosylated, resulting in higher affinity binding to FcγRs, particularly FcγRIIIa (CD16) and to a lesser extent FcγRIIa, leading to enhanced effector function, primarily ADCC. A monovalent isotype control antibody was also used in all studies.

[0535] Antibodies were formulated in Ca2+-free and Mg2+-free Dulbecco’s phosphate-bufferedsaline (DPBS) to reach the desired concentration for dosing in a total volume of 10 mL / kg to deliver 0.25^mL per dose for a 25 g animal and were adjusted by individual body weights for all studies. Working concentrations of the antibodies were prepared fresh prior to each treatment from a stock supply stored at 4°C. Table 22. Antibody and Control used in the studies Lot #, drug concentration and Antibody Identity endotoxin concentration GC5B1552.AFU GC5B768-monovalent K248E and GC5B1552.AFU.003 T437R CDC enhancing mutations mAb PPB000120327, 3.20^mg / mL, <1^EU / mg Isotype control IgG1 isotype control monovalent, B23B293.AFU.001 K248E and T437R CDC enhancing PPB000121410, 5.42^mg / mL, mutations, afucosylated <1^EU / mg AFU, afucosylated; CDC, complement-dependent cytotoxicity; EU, endotoxin units; Ig, immunoglobulin; mAb, monoclonal antibody. Table 23. Reagents used in the studiesAttorney Docket No.: JBI6924WOPCT1 Reagent Catalog number Source Tissue and Cell Injection Reagents D-luciferin 122799 Perkin Elmer Diet Gel 76A 72-07-5022 Clear H2ODPBS, Ca2+, Mg2+ free 14190-144 Gibco by Life TechnologiesHeat-inactivated fetal bovine serum 16140-071 Gibco by Life TechnologiesIsofluorane NDC 11695-6777-2 CovetrusRPMI 1640 61870-036 Gibco by Life TechnologiesSodium Pyruvate 11360-070 Gibco by Life Technolgies NEAA 11140-050 Gibco by Life Technologies Hydrocortisone Stock Solution 07925 StemCell Technologies IL-2 130-097-746 Miltenyi Biotec MyeloCult H5100 05150 StemCell Technologies Puromycin A11138-02 Gibco by Life Technologies RPMI 1640 + Glutamax 61870036 Gibco by Life Technologies PK Analysis Reagents Btn-Goat anti-human IgG-heavy and light chain A80-319B Bethyl Labs Sulfo-tag-Goat anti-human IgG, polyclonal MOS00347144 Janssen Low Cross Buffer 100500 Candor Assay buffer (1x PBS + 1% BSA + 0.5% Tween-20) N / A Janssen Wash buffer (1X PBS + 0.05% Tween-20) N / A Janssen 4x Read buffer R92TC-1 Meso Scale Discovery MSD 96-Well Small Spot Streptavidin Plate L45SA-1 Meso Scale Discovery BSA, bovine serum albumin; btn, biotin; DPBS, Dulbecco’s phosphate-buffered saline; Ig, immunoglobulin; IL-2, interleukin-2; Meso Scale Discovery; N / A, not applicable; NEAA, nonessential amino acids; NSG, non-obese diabetic (NOD) severe combined immunodeficiency (scid) gamma or NOD.Cg-PrkdcscidIL2rgtmlWjl / SzJ gamma; RPMI, Roswell Park Memorial Institute. 13.1.1.3.2 Animals

[0536] For Studies ONC2022-032 and ONC2022-134 female NSG-Tg(Hu-IL15) mice were usedwhen they were approximately 8-10 weeks of age and weighed approximately 20 g. All animals were allowed to acclimate and recover from any shipping-related stress for a minimum of 5 days prior to experimental use. Autoclaved water and irradiated food were provided ad libitum, and the animals were maintained on a 12-hour light and dark cycle. All animals that received NK- 92.CD16 cells were provided diet gel 76A to assist with adverse effects of the cell injections. Cages, bedding, and water bottles were autoclaved before use and changed weekly. 13.1.1.3.3 Tumor Models, Human Immune Cells, and Cell Culture Methods

[0537] The human MM cell line MM.1S was obtained from American Type Culture Collection(ATCC) while the human MM OPM-2 cell line was obtained from Deutsche Sammlung von Mikroorganisimen und Zellkulturen.Attorney Docket No.: JBI6924WOPCT1

[0538] Surface GPRC5D was characterized for antigen levels (defined as anti...

Claims

Attorney Docket No.: JBI6924WOPCT1 CLAIMS We claim:

1. A method of treating a multiple myeloma in a subject in need thereof, the methodcomprising administering a therapeutically effective amount of an antibody or an antigen- binding fragment thereof specifically binding to G protein–coupled receptor class C group 5 member D (GPRC5D), wherein the antibody or antigen binding fragment thereof comprises: a. a heavy chain complementarity determining region 1 (CDR1), a heavy chaincomplementarity determining region 2 (CDR2), and a heavy chain complementarity determining region 3 (CDR3) comprising the amino acid sequences of SEQ ID NO: 6, 7, and 8, respectively; and a light chain complementarity determining region 1 (CDR1), a light chain complementarity determining region 2 (CDR2), and a light chain complementarity determining region 3 (CDR3) comprising the amino acid sequences of SEQ ID NO: 9, 10, and 11, respectively; b. a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprisingthe amino acid sequences of SEQ ID NO: 12, 13, and 8, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 9, 10, and 11, respectively; c. a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprisingthe amino acid sequences of SEQ ID NO: 14, 15, and 8, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 9, 10, and 11, respectively; d. a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprisingthe amino acid sequences of SEQ ID NO: 16, 17, and 18, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 19, 20, and 11, respectively; or e. a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprisingthe amino acid sequences of SEQ ID NO: 21, 22, and 23, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 24, 25, and 26, respectively.Attorney Docket No.: JBI6924WOPCT12. The method of claim 1, wherein the antibody or the antigen binding fragment thereofcomprises a heavy chain variable region (VH) comprising an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1.

3. The method of claim 1 or claim 2, wherein the antibody or the antigen binding fragmentthereof comprises a VH comprising SEQ ID NO: 1.

4. The method of any one of claims 1 to 3, wherein the antibody or the antigen bindingfragment thereof comprises a light chain variable region (VL) comprising an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2.

5. The method of any one of claims 1 to 4, wherein the antibody or the antigen bindingfragment thereof comprises a VL comprising SEQ ID NO: 2.

6. The method of any one of claims 1 to 5, wherein the antibody or the antigen bindingfragment thereof comprises a heavy chain variable region (VH) comprising SEQ ID NO: 1, and a light chain variable region (VL) comprising SEQ ID NO: 2.

7. The method of any one of claims 1 to 6, wherein the antibody or the antigen-bindingfragment thereof is an IgG.

8. The method of any one of claims 1 to 7, wherein the antibody or the antigen-bindingfragment thereof comprises an IgG1 isotype Fc region.

9. The method of any one of claims 1 to 8, wherein the IgG1 isotype Fc region comprisesK248E and T437R (RE) mutations as per the EU numbering system.Attorney Docket No.: JBI6924WOPCT110. The method of any one of claims 1 to 9, wherein the antibody or the antigen-bindingfragment thereof is afucosylated.

11. The method of any one of claims 1 to 10, wherein the antibody or the antigen-bindingfragment thereof has enhanced antibody-dependent cellular cytotoxicity (ADCC) activity as compared with a fucosylated antibody or an antigen-binding fragment thereof.

12. The method of any one of claims 1 to 11, wherein the antibody or the antigen-bindingfragment thereof has antibody-dependent cellular phagocytosis (ADCP) activity.

13. The method of any one of claims 1 to 12, wherein the antibody or the antigen-bindingfragment thereof comprises one or more mutations which promote heterodimerization.

14. The method of any one of claims 1 to 13, wherein the antibody or the antigen-bindingfragment thereof further comprises knob-into-hole (KiH) mutations.

15. The method of any one of claims 1 to 14, wherein the IgG1 isotype Fc region furthercomprises H435R and Y436F mutations per the EU numbering system.

16. The method of any one of claims 1 to 15, wherein the antibody or the antigen bindingfragment thereof is a monovalent antibody or an antigen binding fragment thereof.

17. The method of any one of claims 1 to 16, wherein the monovalent antibody or theantigen-binding fragment thereof has enhanced antibody-dependent cellular cytotoxicity (ADCC) activity and enhanced complement-dependent cytotoxicity (CDC) as compared with a fucosylated divalent antibody or an antigen-binding fragment thereof without K248E and T437R (RE) mutations.

18. The method of claim 17, wherein the monovalent antibody or the antigen-bindingfragment thereof comprises an Fc domain and a Fab.Attorney Docket No.: JBI6924WOPCT119. The method of claim 17 or claim 18, wherein the monovalent antibody or the antigenbinding fragment thereof comprises: a. a heavy chain complementarity determining region 1 (CDR1), a heavy chaincomplementarity determining region 2 (CDR2), and a heavy chain complementarity determining region 3 (CDR3) comprising the amino acid sequences of SEQ ID NO: 6, 7, and 8, respectively; and a light chain complementarity determining region 1 (CDR1), a light chain complementarity determining region 2 (CDR2), and a light chain complementarity determining region 3 (CDR3) comprising the amino acid sequences of SEQ ID NO: 9, 10, and 11, respectively; b. a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprisingthe amino acid sequences of SEQ ID NO: 12, 13, and 8, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 9, 10, and 11, respectively; c. a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprisingthe amino acid sequences of SEQ ID NO: 14, 15, and 8, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 9, 10, and 11, respectively; d. a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprisingthe amino acid sequences of SEQ ID NO: 16, 17, and 18, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 19, 20, and 11, respectively; or e. a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 comprisingthe amino acid sequences of SEQ ID NO: 21, 22, and 23, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 comprising the amino acid sequences of SEQ ID NO: 24, 25, and 26, respectively.

20. The method of any one of claims 17-19, wherein the monovalent antibody or the antigenbinding fragment thereof comprises a heavy chain variable region (VH) comprising an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1.Attorney Docket No.: JBI6924WOPCT121. The method of any one of claims 17-20, wherein the monovalent antibody or the antigenbinding fragment thereof comprises a VH comprising SEQ ID NO: 1.

22. The method of any one of claims 17-21, wherein the monovalent antibody or the antigenbinding fragment thereof comprises a light chain variable region (VL) comprising an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2.

23. The method of any one of claims 17-22, wherein the monovalent antibody or the antigenbinding fragment thereof comprises a VL comprising SEQ ID NO: 2.

24. The method of any one of claims 17-23, wherein the monovalent antibody or the antigenbinding fragment thereof comprises a heavy chain variable region (VH) comprising SEQ ID NO: 1, and a light chain variable region (VL) comprising SEQ ID NO: 2.

25. The method of any one of claims 17-24, wherein the monovalent antibody or the antigen-binding fragment thereof comprises a first heavy chain (HC1), a second heavy chain (HC2), and a second light chain (LC2).

26. The method of claim 25, wherein the HC1 of the monovalent antibody or the antigenbinding fragment thereof comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 3.

27. The method of claim 25 or 26, wherein the HC1 of the monovalent antibody or theantigen binding fragment thereof comprises SEQ ID NO: 3.

28. The method of any one of claims 25-27, wherein the HC2 of the monovalent antibody orthe antigen binding fragment thereof comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4.Attorney Docket No.: JBI6924WOPCT129. The method of any one of claims 25-28, wherein the HC2 of the monovalent antibody orthe antigen binding fragment thereof comprises SEQ ID NO: 4.

30. The method of claim 25 or 26, wherein the HC1 of the monovalent antibody or theantigen binding fragment thereof comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 30.

31. The method of claim 25, 26, or 30, wherein the HC1 of the monovalent antibody or theantigen binding fragment thereof comprises SEQ ID NO: 30.

32. The method of claim 25 or 28, wherein the HC2 of the monovalent antibody or theantigen binding fragment thereof comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 31.

33. The method of any one of claims 25, 28 or 32, wherein the HC2 of the monovalentantibody or the antigen binding fragment thereof comprises SEQ ID NO: 31.

34. The method of any one of claims 25-33, wherein the LC2 of the monovalent antibody orthe antigen binding fragment thereof comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5.

35. The method of any one of claims 25-34, wherein the LC2 of the monovalent antibody orthe antigen binding fragment thereof comprises SEQ ID NO: 5.

36. A method of treating a multiple myeloma in a subject in need thereof, the methodcomprising administering a therapeutically effective amount of a monovalent antibody or an antigen-binding fragment thereof specifically binding to GPRC5D, comprising a first heavy chain comprising SEQ ID NO: 3, a second heavy chain comprising SEQ ID NO: 4, and a second light chain comprising SEQ ID NO: 5.Attorney Docket No.: JBI6924WOPCT137. A method of treating a multiple myeloma in a subject in need thereof, the methodcomprising administering a therapeutically effective amount of a monovalent antibody or an antigen-binding fragment thereof specifically binding to GPRC5D, comprising a first heavy chain comprising SEQ ID NO: 30, a second heavy chain comprising SEQ ID NO: 31, and a second light chain comprising SEQ ID NO: 5.

38. A method of treating a multiple myeloma in a subject in need thereof, the methodcomprising administering a therapeutically effective amount of a pharmaceutical composition comprising the antibody, the monovalent antibody, or the antigen-binding fragment thereof of any one of claims 1 to 31, and a pharmaceutically acceptable carrier.

39. The method of any one of claims 1-38, wherein the multiple myeloma is characterized bythe expression of GPRC5D.

40. The method of any one of claims 1-39, wherein the multiple myeloma is relapsed.

41. The method of any one of claims 1-40, wherein the multiple myeloma is refractory.

42. The method of any one of claims 1-41, wherein the antibody, the monovalent antibody,or the antigen binding fragment thereof is administered to the subject as a monotherapy to treat the multiple myeloma.

43. The method of any one of claims 1-42, wherein the subject is eighteen years of age orolder.

44. The method of claim 42 or claim 43, wherein the subject has received at least one priortherapy for multiple myeloma.

45. The method of claim 44, wherein the at least one prior therapy for multiple myelomacomprises one or more of: a proteasome inhibitor, an immunomodulatory agent and an anti-CD38 monoclonal antibody.Attorney Docket No.: JBI6924WOPCT146. The method of any one of claims 42-45, wherein prior to the administration of theantibody or the antigen-binding fragment thereof specifically binding to GPRC5D, the subject has one or more of: a) a serum monoclonal paraprotein (M-protein) level >0.5 g / dL; b) a urine M-protein level >200 mg / 24 hours; c) a light chain multiple myeloma: serum immunoglobulin free light chain (FLC) >10 mg / dL and abnormal serum immunoglobulin kappa-lambda FLC ratio; d) hemoglobin ≥8 g / dL (≥5 mmol / L) without a red blood cell transfusion within 7 days of being tested; e) absolute neutrophil count ≥1×109 / L without use of granulocyte colony stimulating factor (G-CSF) within 7 days of being tested; or f) platelets ≥50×109 / L without transfusion support within 7 days of being tested.

47. The method of any one of claims 42-46, wherein prior to the administration of theantibody or the antigen-binding fragment thereof specifically binding to GPRC5D, the subject does not have: a) active plasma cell leukemia, Waldenström’s macroglobulinemia, polyneuropathy, organomegaly, endocrinopathy, M-protein, and skin changes syndrome (POEMS), or immunoglobulin light chain amyloidosis; b) non-hematologic toxicity from prior anticancer therapy that has not resolved to baseline level or to ≤Grade 1; c) known loss of expression of GPRC5D antigen; d) known allergies, hypersensitivity, or intolerance to excipients of the antibody, the monovalent antibody or the antigen-binding fragment thereof; or e) pulmonary compromise requiring supplemental oxygen used to maintain adequate oxygenation.

48. The method of any one of claims 1-47, wherein there is no or minimal natural killer (NK)cell fratricide.Attorney Docket No.: JBI6924WOPCT149. The method of any one of claims 1-48, wherein the therapeutically effective amount ofthe antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of at least about 20 mg per dose administration.

50. The method of any one of claims 1-49, wherein the therapeutically effective amount ofthe antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 20 mg to about 1700 mg per dose administration.

51. The method of any one of claims 1-50, wherein the therapeutically effective amount ofthe antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose ranging from about 20 mg to about 1620 mg per dose administration.

52. The method of any one of claims 1-51, wherein the therapeutically effective amount ofthe antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 50 mg to about 1700 mg per dose administration.

53. The method of any one of claims 1-52, wherein the therapeutically effective amount ofthe antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 100 mg to about 1700 mg per dose administration.

54. The method of any one of claims 1-53, wherein the therapeutically effective amount ofthe antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 105 mg to about 250 mg per dose administration.Attorney Docket No.: JBI6924WOPCT155. The method of any one of claims 1-54, wherein the therapeutically effective amount ofthe antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 250 mg to about 1700 mg per dose administration.

56. The method of any one of claims 1-55, wherein the therapeutically effective amount ofthe antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose ranging from about 350 mg to about 840 mg per dose administration.

57. The method of any one of claims 1-56, wherein the therapeutically effective amount ofthe antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 500 mg to about 1700 mg per dose administration.

58. The method of any one of claims 1-57, wherein the therapeutically effective amount ofthe antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 1000 mg to about 1700 mg per dose administration.

59. The method of any one of claims 1-51, wherein the therapeutically effective amount ofthe antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 20 mg per dose administration.

60. The method of any one of claims 1-52, wherein the therapeutically effective amount ofthe antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 60 mg per dose administration.

61. The method of any one of claims 1-54, wherein the therapeutically effective amount ofthe antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 180 mg per dose administration.Attorney Docket No.: JBI6924WOPCT162. The method of any one of claims 1-57, wherein the therapeutically effective amount ofthe antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 540 mg per dose administration.

63. The method of any one of claims 1-58, wherein the therapeutically effective amount ofthe antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose of about 1620 mg per dose administration.

64. The method of any one of claims 1-63, wherein the therapeutically effective amount ofthe antibody, the monovalent antibody, or the antigen-binding fragment thereof comprises or is a therapeutically effective dose ranging from about 5 mg / kg to about12 mg / kg per dose administration.

65. The method of any one of claims 1-64, wherein the antibody, the monovalent antibody,or the antigen-binding fragment thereof is administered subcutaneously, for example by subcutaneous injection or by subcutaneous infusion.

66. The method of any one of claims 1-65, wherein the antibody, the monovalent antibody,or the antigen-binding fragment thereof is administered at a frequency ranging from once every three to weeks to once every week.

67. The method of any one of claims 1-66, wherein the antibody, the monovalent antibody,or the antigen-binding fragment thereof is administered at a frequency of once every three weeks.

68. The method of any one of claims 1-67, wherein the antibody, the monovalent antibody,or the antigen-binding fragment thereof is administered at a frequency of once every two weeks.Attorney Docket No.: JBI6924WOPCT169. The method of any one of claims 1-68, wherein the antibody, the monovalent antibody,or the antigen-binding fragment thereof is administered at a frequency of once every week.

70. The method of any one of claims 1-69, wherein the antibody, the monovalent antibody,or the antigen-binding fragment thereof is administered until remission of multiple myeloma is achieved in a subject.

71. The method of any one of claims 1-70, wherein the method achieves a partial response(PR), very good partial response (VGPR), complete response (CR) or stringent complete response (sCR) in the subject, according to International Myeloma Working Group (IMWG) criteria.

72. The method of any one of claims 1-71, wherein the method achieves a very good partialresponse (VGPR), complete response (CR) or stringent complete response (sCR) in the subject, according to International Myeloma Working Group (IMWG) criteria.

73. The method of any one of claims 1-72, wherein the method achieves a complete response(CR) or stringent complete response (sCR) in the subject, according to International Myeloma Working Group (IMWG) criteria.

74. The method of any one of claims 1-73, wherein the method achieves a stringent completeresponse (sCR) in the subject, according to International Myeloma Working Group (IMWG) criteria.

75. The method of any one of claims 1-74, wherein the method does not induce a Treatment-Related toxicity in the subject.

76. The method of any one of claims 1-75, wherein the probability that the Dose LimitingToxicity (DLT) rate is of 28%, or exceeds 28% in a cohort of at least 20 subjects is lower than 95%.Attorney Docket No.: JBI6924WOPCT177. The method of any one of claims 1-76, wherein the cancer is significantly reduced in thesubject.

78. The method of any one of claims 1-77, wherein the method increases the OverallResponse Rate (ORR).

79. The method of claim 78, wherein the ORR includes the proportion of patients whosetumor is significantly reduced or is destroyed in a cohort of at least 20 patients, compared to a prior line of therapy.

80. The method of any one of claims 1-79, wherein the treatment increases the ProgressionFree Survival (PFS) in the subject, particularly compared to a prior line of therapy.

81. The method of any one of claims 1-79, wherein the treatment increases the Duration ofresponse (DoR).

82. The method of claim 81, wherein the DoR is the length of time that a tumor continues torespond to treatment without the cancer growing or spreading in the subject, particularly compared to a prior line of therapy.

83. The method of any one of claims 79-82, wherein the prior line of therapy comprises oneor more of an administration of a proteasome inhibitor, an immunomodulatory agent, and an anti-CD38 therapy.

84. The method of any one of claims 1-83, wherein the method comprises the administrationof a prior or concomitant therapy.

85. The method of claim 84, wherein the prior or concomitant therapy comprises aglucocorticoid, an antihistamine, an antipyretic, a H2-antagonist, and / or an anti-emetic.Attorney Docket No.: JBI6924WOPCT186. The method of any one of claims 1-85, wherein the multiple myeloma is a relapsedand / or refractory multiple myeloma.

87. The method of any one of claims 1-86, wherein the subject is a human subject.

88. An antibody or antigen-binding fragment thereof specifically binding to GPRC5D, asdefined in any one of claims 1-87, for use in the method of any one of claims 1-87.

Images