T cell receptors and uses thereof

Abstract

The present disclosure provides T cell receptors (TCRs) that bind to COL6A3 and their use in medical treatment or prophylaxis, for example the treatment of COL6A3-expressing neoplasms or cancers. The present disclosure also provides nucleic acids and expression vectors that encode the TCRs.

Description

[0001] T CELL RECEPTORS AND USES THEREOF

[0002] Field of the Invention

[0003] The present invention relates to TCR sequences, and their use in TCR-based immunotherapies and in the treatment of COL6A3-expressing neoplasms and cancers.

[0004] Background

[0005] Immunotherapy has recently increased greatly in importance. This is particularly the case in relation to the treatment or prevention of cancers, though immunotherapies have application in relation to other medical conditions, such as allergies. Various immunotherapeutic techniques are known, including activation immunotherapies such as dendritic cell-based priming and T-cell adoptive transfer, and autologous immune enhancement therapy using T lymphocytes.

[0006] T cell receptor (TCR)-based therapies are based on the binding of TCRs to peptides presented in the context of MHC molecules (also referred to herein as “HLA molecules”). For a TCR-based therapy against cancer, the target antigens of the TCR must be expressed in tumor cells, and the patient must express the HLA allele to which the TCR is restricted. As part of immune presentation of antigens to CD8+ T cells, antigens are broken down into peptides by the proteasome or immunoproteasome, leading to the presentation of these peptides on MHC molecules. CD8+ T cells, via their TCR, bind to peptides presented on a given allele of MHC class I molecules. The specific binding of T cells to peptides presented by a given MHC class I molecule is called HLA restriction of the T cell response (Murphy & Weaver (2017) Janeway’s Immunobiology 9). Once a T cell has bound to the cancer cell via the TCR:MHC+peptide interaction and the cell is activated by additional stimuli, the T cell can kill the tumor cell.

[0007] There are different types of tumor antigens that can be targeted for TCR-based therapy. Ideally, the antigen should be expressed exclusively or predominantly on the tumor compared to normal healthy tissue. A key success factor for TCR-based therapies is the selection of the tumor antigen, such that as many patients as possible can benefit from a given therapy. Tumor antigens that are expressed in several tumor types and in a large proportion of patients (so-called shared tumor antigens) are therefore of high priority.

[0008] A problem that arises in development of immunotherapies (including TCR-based therapy) is the identification of functional target antigens and their cognate T cells and / or T cell receptor sequences. One commonly adopted approach in relation to cancer immunotherapies is to search for candidate neoantigens derived from somatic mutations in tumor cells, for example by deep sequencing of tumor DNA or RNA. One difficulty with this approach is that although cancer is a disease that is often driven by oncogenic mutation, the mutation pattern defining the genetic profile of individuals is unique and the oncogenicity of most somatic mutations is unknown, as is the antigenicity of most somatic mutations. A recent study of the antigenicity of cancer-associated somatic mutations found that fewer than 1 in 1 ,000 candidate antigenic peptides derived from missense mutations lead to a functional neoantigen, and furthermore this analysis did not result in the identification of a T cell or TCR pair from which to develop a therapy. Furthermore, the majority of somatic mutations are only observed in an individual subject with cancer, rather than being present in a population of patients. These mutations are also heterogeneously expressed within the tumor, typically being present in less than 0.5% of tumor cells. Accordingly, it can be difficult to identify functional cancer neoantigens that arise from somatic mutations.

[0009] It has previously been proposed that antigens could arise from dysregulated mRNA splicing events. However, development of cancer immunotherapies via this approach remains challenging. For example, there is difficulty in identifying mRNA splicing events that are tumor-specific, a step that is essential to identify cancer-associated splice variant proteins (SVP) that can be assessed as a source of splicing- derived antigens. There are also significant challenges in detecting protein variants derived from dysregulated mRNA splicing events, because many alternative splicing events are found in transcripts that exist in low abundance. Even when evidence is found that a splice variant is translated into protein, it is not guaranteed that peptides derived from the full-length protein will have immunogenic activity.

[0010] Accordingly, it is generally desirable to overcome or ameliorate one or more of the above-mentioned difficulties.

[0011] The present invention has been devised in light of the above considerations.

[0012] Summary of the Invention

[0013] The present invention is based on the realisation that dysregulated or aberrant messenger RNA (mRNA) splicing may lead to splice variants that are specific to disease. Such splice variants may be shared across multiple disease types (such as multiple cancer types), providing a target that could be exploited across different diseases.

[0014] The inventors have identified an antigen-binding molecule that binds to and recognises an antigen derived from the dysregulated or aberrant splicing of alpha 3 subunit of type VI collagen (COL6A3). This antigen is overexpressed in tumor cells compared with healthy cells and is cancer-specific; therefore, targeting this antigen with a therapeutic such as a TCR allows for the targeted killing of tumor cells.

[0015] The present invention relates to T cell receptors (TCRs) that are capable of binding to COL6A3, or a COL6A3 splice variant e.g. antigenic peptides derived from COL6A3 or a COL6A3 splice variant.

[0016] Provided is a T cell receptor, optionally isolated, wherein the amino acid sequence of CDR3a is SEQ ID NO: 8 or 16 and the amino acid sequence of CDR3p is SEQ ID NO: 12 or 20.

[0017] In some embodiments, the T cell receptor binds to COL6A3, a COL6A3-derived antigen, a COL6A3 splice variant, or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4. Also provided is a T cell receptor, optionally isolated, wherein the T cell receptor comprises the following CDRs:

[0018] (a)

[0019] CDR1a having the amino acid sequence of SEQ ID NO: 6

[0020] CDR2a having the amino acid sequence of SEQ ID NO: 7

[0021] CDR3a having the amino acid sequence of SEQ ID NO: 8

[0022] CDR1 p having the amino acid sequence of SEQ ID NO: 10

[0023] CDR2p having the amino acid sequence of SEQ ID NO: 11

[0024] CDR3p having the amino acid sequence of SEQ ID NO: 12; or

[0025] (b)

[0026] CDR1a having the amino acid sequence of SEQ ID NO: 14

[0027] CDR2a having the amino acid sequence of SEQ ID NO: 15

[0028] CDR3a having the amino acid sequence of SEQ ID NO: 16

[0029] CDR1 p having the amino acid sequence of SEQ ID NO: 18 CDR2p having the amino acid sequence of SEQ ID NO: 19 CDR3p having the amino acid sequence of SEQ ID NO: 20.

[0030] In some embodiments, the T cell receptor comprises: an alpha chain variable region comprising an amino acid sequence having at least 70% sequence identity to SEQ ID NO: 5 or 13; and a beta chain variable region comprising an amino acid sequence having at least 70% sequence identity to SEQ ID NO: 9 or 17.

[0031] In some embodiments, the T cell receptor comprises: (a) an alpha chain variable region comprising the amino acid sequence of SEQ ID NO: 5 and a beta chain variable region comprising the amino acid sequence of SEQ ID NO: 9; or (b) an alpha chain variable region comprising the amino acid sequence of SEQ ID NO: 13 and a beta chain variable region comprising the amino acid sequence of SEQ ID NO: 17. In some embodiments, the TOR has an MHC restriction of HLA-A*02.

[0032] In some embodiments, the TOR is a soluble TOR, a chimeric TOR or a TCR-CAR.

[0033] Also provided is a complex, optionally isolated, optionally in vitro, comprising a T cell receptor according to the present disclosure bound to: (a) a peptide having the amino acid sequence of SEQ ID NO: 3 or 4; or (b) a complex of a peptide having the amino acid sequence of SEQ ID NO: 3 or 4 and an HLA molecule.

[0034] Also provided is a nucleic acid, or a plurality of nucleic acids, optionally isolated, encoding a T cell receptor according to the present disclosure. In some embodiments, the nucleic acid or plurality of nucleic acids comprises one or more nucleotide sequences selected from SEQ ID NOs: 54-57.

[0035] In some embodiments, the nucleic acid or plurality of nucleic acids comprises the nucleotide sequence of

[0036] SEQ ID NO: 54. In some embodiments, the nucleic acid or plurality of nucleic acids comprises the nucleotide sequence of SEQ ID NO: 55. In some embodiments, the nucleic acid or plurality of nucleic acids comprises the nucleotide sequence of SEQ ID NO: 56. In some embodiments, the nucleic acid or plurality of nucleic acids comprises the nucleotide sequence of SEQ ID NO: 57.

[0037] In some embodiments, the nucleic acid or plurality of nucleic acids encodes one or more amino acid sequences selected from SEQ ID NOs: 50-53. In some embodiments, the nucleic acid or plurality of nucleic acids comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 50. In some embodiments, the nucleic acid or plurality of nucleic acid comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 51 . In some embodiments, the nucleic acid or plurality of nucleic acids comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 52. In some embodiments, the nucleic acid or plurality of nucleic acid comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 53.

[0038] In some embodiments, the nucleic acid or plurality of nucleic acids comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 25. In some embodiments, the nucleic acid or plurality of nucleic acid comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 26.

[0039] Also provided is an expression vector, or a plurality of expression vectors, comprising a nucleic acid or a plurality of nucleic acids according to the present disclosure. In some embodiments, the expression vector comprises the nucleotide sequence of SEQ ID NO: 77.

[0040] Also provided is a cell, optionally isolated, comprising a T cell receptor, nucleic acid, plurality of nucleic acids, an expression vector, or a plurality of expression vectors according to the present disclosure. In some embodiments, the cell is an immune cell. In some embodiments, the cell is a T cell or an activated cytotoxic T cell.

[0041] Also provided is a method comprising culturing a cell according to the present disclosure under conditions suitable for expression of a T cell receptor by the cell.

[0042] Also provided is a composition comprising (i) a T cell receptor, a nucleic acid, a plurality of nucleic acids, an expression vector, a plurality of expression vectors, or a cell according to the present disclosure, or a cell produced by a method according to the present disclosure, and (ii) a pharmaceutically acceptable carrier, diluent, excipient, or adjuvant.

[0043] Also provided is a composition comprising a cell or population of cells according to the present disclosure. In some embodiments, the composition is a pharmaceutical composition or medicament.

[0044] Also provided is a TCR, nucleic acid, expression vector, cell or composition according to the present disclosure for use in a method of medical treatment or prophylaxis.

[0045] Also provided is a TCR, nucleic acid, expression vector, cell or composition according to the present disclosure for use in a method of treating or preventing a disease or condition. In some embodiments, the condition is cancer. In some embodiments, the cancer is one of breast cancer, head and neck cancer, gastric cancer, or colorectal cancer.

[0046] In some embodiments, the cancer expresses or overexpresses COL6A3, a COL6A3 splice variant or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4. In some embodiments, the cancer has been determined to express or overexpress COL6A3, a COL6A3-derived antigen, a COL6A3 splice variant or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4.

[0047] In some embodiments, the cancer is in a subject that has been determined to have an increased level of T lymphocytes that bind specifically to COL6A3, a COL6A3-derived antigen, a COL6A3 splice variant, or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4.

[0048] Also provided is a method of killing target cells in a subject, wherein the target cells express or overexpress COL6A3, a COL6A3-derived antigen, a COL6A3 splice variant or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4, the method comprising administering to the subject an effective amount of a TOR, nucleic acid, expression vector, cell or composition according to the present disclosure.

[0049] Also provided is a method for eliciting an immune response in a subject, wherein the subject has a cancer that expresses or overexpresses COL6A3, a COL6A3-derived antigen, a COL6A3 splice variant or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4, the method comprising administering to the subject an effective amount of a TOR, nucleic acid, expression vector, cell or composition according to the present disclosure.

[0050] Also provided is a method of eliciting an immune response in a subject, the method comprising administering to a subject an effective amount of a TOR, nucleic acid, expression vector, cell or composition, wherein the subject has a cancerthat has previously been determined to express or overexpress COL6A3, a COL6A3-derived antigen, a COL6A3 splice variant or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4. In some embodiments, the method comprises administering to the subject an effective amount of a TCR, nucleic acid, expression vector, cell or composition according to the present disclosure.

[0051] Also provided is a method of identifying the suitability of a treatment for treating a subject with cancer, the method comprising determining whether the cancer expresses or overexpresses COL6A3, a COL6A3- derived antigen, a COL6A3 splice variant or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4, and administering to the subject an effective amount of a TCR, nucleic acid, expression vector, cell or composition. In some embodiments, the method comprises administering to the subject an effective amount of a TCR, nucleic acid, expression vector, cell or composition according to the present disclosure.

[0052] The invention includes the combination of the aspects and preferred features described except where such a combination is clearly impermissible or expressly avoided. Summary of the Figures

[0053] Embodiments and experiments illustrating the principles of the invention will now be discussed with reference to the accompanying figures in which:

[0054] Figure 1 shows RNAseq data for COL6A3 Exon4 splice variant expression in breast cancer, head and neck cancer, gastric cancer, and colorectal cancer tumor vs adjacent normal tissue. RNA sequencing reads mapping to the COL6A3 Exon4 splice junction (chr2:237381499-237387582;-) were counted and normalized based on library size. The median normalized read counts for adjacent samples (black bars) and the top 20% of tumor samples (grey bars) are shown for each tumor type indicated, and the values are plotted as histograms. As shown by this histogram, there are a significant number of patients (at least 20%) who show overexpression of the COL6A3 Exon4 in these tumor types. (CPM = counts per million).

[0055] Figures 2A and 2B show (A) a diagrammatic representation of COL6A3 splice variants, and the positions of primers (Primers for detecting the Exon4 and Exon6 splice variants are indicated by black and grey triangles, respectively) used for detecting the COL6A3 Exon4 and Exon6 splice variants. The alternatively spliced exons are Exon3, Exon4, and Exon6. (B) a photographic representation of the detection of the COL6A3 Exon4 and Exon6 splice variants in each of the different cell lines indicated above each lane. SW982, U87MG, U118MG, cells express high levels of both variants, PC3, and NCI- H196 express moderate levels, whereas MIA-PACA2 express low levels of the COL6A3 Exon4 and Exon6 splice variants. In contrast, HEK293T cells do not express COL6A3 Exon4 and Exon6 splice variants.

[0056] Figures 3A, 3B and 3C are representations showing TCR responses to the COL6A3 Exon4 splice variant 9-mer and 10-mer peptides for (A) H22-1 , (B) H22-2 and (C) A01 . Serum-starved T2 target cells, loaded with 10nM of either COL6A3 Exon4 splice variant 9-mer or COL6A3 Exon4 splice variant 10-mer peptide, were co-cultured with J76 reporter cells expressing H22-1 , H22-2, and A01 TCR to measure the TCR response to each of the COL6A3 Exon4 splice variant 9-mer and 10-mer peptides. All TCRs responded more strongly to the 9-mer peptide than to the 10-mer peptide.

[0057] Figure 4 is a graphical representation showing the response of H22-1 , H22-2, and A01 TCR to different concentrations of COL6A3 Exon4 splice variant 9-mer peptides. Serum-starved T2 target cells, loaded with different concentrations of COL6A3 Exon4 splice variant 9-mer peptide, were co-cultured with J76 reporter cells expressing H22-1 , H22-2, or A01 TCR to measure the TCR response to different concentrations of COL6A3 Exon4 splice variant 9-mer peptide. Both TCRs responded to nM concentrations of peptide / HLA complex. The EC50 for H22-1 , H22-2, and A01 was 8.680nM, 1 ,812nM, and 3.972nM respectively.

[0058] Figures 5A, 5B, and 5C are representations showing TCR responses to peptides (SEQ ID NO: 27-31) that are similar in sequence to the COL6A3 Exon4 splice variant 9-mer peptide as well as an unrelated peptide (SEQ ID NO: 32) for (A) H22-1 , (B) H22-2, and (C) A01 . These COL6A3 similar peptides differ from the COL6A3 Exon4 splice variant 9-mer peptide by 3 amino acids and were identified using NCBI Blast. Serum-starved T2 target cells were loaded with 10nM of the original COL6A3 Exon4 splice variant 9-mer peptide, COL6A3 similar peptide (SP1 - SP5, SEQ ID NO: 27-31 , respectively), or unrelated peptides (UP, SEQ ID NO: 32). These peptide-loaded target cells were co-cultured with J76 reporter cells expressing H22-1 , H22-2, and A01 TOR to measure the specificity of the TOR response to peptides that have similar sequences.

[0059] Figures 6A, 6B and 6C are representations showing the responses of (A) H22-1 , (B) H22-2, and (C) A01 TCRs to 9-mer alanine scanning library peptides. Serum-starved T2 target cells were loaded with either 10nM of the original COL6A3 Exon4 splice variant 9-mer or peptides with alanine mutation at each amino acid position. These peptide-loaded target cells were co-cultured with J76 reporter cells expressing H22- 1 , H22-2, or A01 TOR to measure the specificity of the TOR response to the alanine mutated COL6A3 peptides.

[0060] Figures 7A and 7B are representations showing TCR responses to 9-mer positional scanning library peptides. The library of peptides used to determine the specificity of the COL6A3 H22-1 TCRs consists of single amino acid substitutions at each position of the COL6A3 Exon4 splice variant 9-mer peptide, i.e.: all 20 amino acids were substituted singly at position one to nine of the COL6A3 Exon4 splice variant 9- mer peptide to make this library of peptides for testing COL6A3 TCR specificity. (A) shows the H22-1 TCR response to this peptide library loaded on T2 cells. The percentage response of H22-1 TCR is shown as a heatmap for each amino acid substitution (this has been normalized to the COL6A3 Exon4 splice variant 9-mer peptide, SEQ ID NO: 3). (B) shows a Logo plot of recognized single variant peptides for H22-1 ; the size of each letter at each position reflects how well that amino acid is recognized by the H22-1 TCR. Positions where the TCR tolerates few other amino acid substitutions have few amino acids and tall letters, whereas positions where the TCR can tolerate many amino acid changes will have many short letters. Specificity of the H22-1 TCR is highly dependent on amino acids in position 5-7.

[0061] Figures 8A and 8B show the response of CIK cells expressing H22-1 and H22-2 TCRs towards target cells expressing COL6A3 splice variant antigen. (A) is a FACs plot representation showing the expression of CD69 and CD137 on CIK cells expressing H22-1 and H22-2 after being co-cultured with COL6A3 splice variant-expressing cell lines. CIK cells expressing both TCRs were activated in target cells that are HLA-A02+ve (SW982 A2, U87 A2, U118 A2, and PC3 A2), and they are not activated in HLA-A02-ve target cells (U118 A11 and PC3 A11). (B) is a histogram showing the percentage of CD8+ CIK cells expressing CD69 and CD137. An increase in the expression of CD69 and CD137 is only observed on H22-1 and H22-2 TCR-CIK cells that were cocultured with HLA-A02+ve target cells.

[0062] Figure 9 is a graphical representation showing the results of T cell-mediated killing elicited by CIK cells expressing COL6A3 H22-1 and H22-2 TCRs. Control CIK cells and CIK cells electroporated with either H22-1 or H22-2 TCR mRNA were co-cultured with target cells at either 10:1 or 5:1 effector to target cell ratios (i.e.: CIK cells: target cell) for 48hrs. The degree of cell killing efficiency was depicted by the reduction of target cell density overtime. CIK cells expressing H22-1 or H22-2 show prominent specific killing of HLA-A02+ve target cells, and not HLA-A02-ve target cells, when compared to control CIK cells. Figures 10A and 10B show (A) a diagrammatic representation of the COL6A3 Exon4 splice variant, and the positions of primers used for detecting the COL6A3 Exon4 splice variant; and (B) a photographic representation of the detection of the COL6A3 Exon4 splice variant in matched tumor (T) and normal (N) tissue from three (3) colorectal cancer (CRC) patients.

[0063] Figure 11 is a graphical representation of a sashimi plot showing the RNA sequencing reads that map to the 5’ region of the COL6A3 gene. Density of RNA sequencing reads that align to different regions is shown and the arcs represent sequencing reads that span a splice junction. The number associated with each arc represents the number of reads that span a particular splice junction. The boundaries of Exons 2-5 in the 5’ region of COL6A3 are shown in the grey boxes. The number of splice junctions that lead to the inclusion of COL6A3 Exon4 is underlined, and the sequencing reads that map to COL6A3 Exon4 are indicated in the dotted line box.

[0064] Detailed Description of the Invention

[0065] Aspects and embodiments of the present invention will now be discussed with reference to the accompanying figures. Further aspects and embodiments will be apparent to those skilled in the art. All documents mentioned in this text are incorporated herein by reference.

[0066] The present invention relates to TCR sequences and their use in TCR-based immunotherapies against cells expressing COL6A3 or COL6A3 splice variants.

[0067] COL6A3 (alpha 3 subunit of type VI collagen)

[0068] COL6A3 is also known as “alpha 3 subunit of type VI collagen” or “collagen, type VI, alpha 3 chain”. The human COL6A3 gene sequence is represented by GenBank ID no. 1293. COL6A3 is also known as DYT27, UCMD1 , BTHLM1 , UCMD1C, or BTHLM1C.

[0069] In this specification “COL6A3” refers to COL6A3 from any species and includes COL6A3 isoforms, fragments, variants, or homologues from any species. In some embodiments, the COL6A3 is COL6A3 from a mammal (e.g. a therian, placental, epitherian, preptotheria, archontan, primate (rhesus, cynomolgous, non-human primate or human)). Isoforms, fragments, variants or homologues of COL6A3 may optionally be characterised as having at least 70% (e.g. one of >70%, >75%, >80%, >85%, >86%, >87%, >88%, >89%, >90%, >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99% or 100%) sequence identity to the amino acid sequence of an immature or mature COL6A3 isoform from a given species, e.g. human.

[0070] In some embodiments, the antigen-binding molecule (e.g. the TCR or fragment thereof) binds to COL6A3 (also known as alpha 3 subunit of type VI collagen; or collagen, type VI, alpha 3 chain). In some embodiments, the antigen-binding molecule (e.g. the TCR or fragment thereof) binds to a COL6A3- derived antigen. In some embodiments, the antigen-binding molecule (e.g. the TCR or fragment thereof) binds to a COL6A3 splice variant. In some embodiments, the antigen-binding molecule (e.g. the TCR or fragment thereof) binds to a COL6A3 Exon4 splice variant, e.g. to an amino acid sequence comprising SEQ ID NO: 3 or SEQ ID NO: 4. In some embodiments, the antigen-binding molecule (e.g. the TOR or fragment thereof) binds to an amino acid sequence with at least 70%, preferably one of 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity to SEQ ID NO: 3 or SEQ ID NO: 4. In some embodiments, the antigen-binding molecule (e.g. the TOR or fragment thereof) binds to an amino acid sequence consisting of SEQ ID NO: 3 or SEQ ID NO: 4. In some embodiments, the antigen-binding molecule (e.g. the TOR or fragment thereof) binds to a peptide encoded by the nucleotide sequence of SEQ ID NO: 74 or 75.

[0071] In some embodiments, the COL6A3, COL6A3-derived antigen or COL6A3 splice variant (such as the COL6A3 Exon4 splice variant) is expressed in a subject determined to have cancer. In some embodiments, the COL6A3, COL6A3-derived antigen or COL6A3 splice variant (such as the COL6A3 Exon 4 splice variant) is overexpressed or upregulated in a subject determined to have cancer compared with a subject determined not to have cancer.

[0072] The terms “splice variant” or “splice isoform” as used herein may refer to different mRNA molecules which are a result of differential splicing from the same initial pre-mRNA sequence transcribed from a locus, based upon the inclusion or exclusion of specific exon or intron sequences from the initial pre-mRNA transcript sequence. Each separate splice variant or isoform may correlate to a specific polypeptide, based on the amino acid sequence encoded by the processed mRNA. The terms “splice variant” or “splice isoform” may also refer to a polypeptide encoded by a splice variant of an mRNA transcribed from a locus (also known as an isoform). A single locus may therefore encode multiple protein (or polypeptide) splice variants or isoforms. A “splice variant” or “splice isoform” may be a nucleic acid (such as an RNA transcript or mRNA) or a polypeptide. The terms “splice variant” or “splice isoform” may also refer to a fragment of a splice variant nucleic acid or polypeptide.

[0073] As referred to herein, a “COL6A3 splice variant” or“COL6A3 splice isoform” may refer to different mRNA molecules which are the result of differential splicing from the same initial pre-mRNA transcribed from a COL6A3 locus or gene, based upon the inclusion or exclusion of specific exon or intron sequences from the initial pre-mRNA transcript sequence. Each separate splice variant or isoform may correlate to a specific polypeptide, based on the amino acid sequence encoded by the processed mRNA. The terms “COL6A3 splice variant” or “COL6A3 splice isoform” may also refer to a polypeptide encoded by a splice variant of an mRNA transcribed from a COL6A3 locus or gene. A single locus may therefore encode multiple protein (or polypeptide) splice variants or isoforms. A “splice variant” or “splice isoform” may be a nucleic acid (such as an RNA transcript or mRNA) or a polypeptide. The terms “splice variant” or “splice isoform” may also refer to a fragment of a splice variant nucleic acid or polypeptide.

[0074] As referred to herein, a “COL6A3 Exon4 splice variant” is a nucleic acid (such as an RNA transcript or mRNA) or a polypeptide which is the result of differential splicing of the pre-mRNA transcribed from a COL6A3 locus or gene, wherein Exon 4 of COL6A3 is included. Exemplary COL6A3 Exon 4 splice variants are represented by SEQ ID NOs: 47 and 48. The DNA sequence encoding Exon 4 of COL6A3 is shown in SEQ ID NO: 42. As referred to herein, a “COL6A3-derived antigen” may refer to a COL6A3 splice variant, a COL6A3 Exon4 splice variant, or a splice variant in which the Exon 4 of COL6A3 has been included (e.g. as a result of alternative splicing). A COL6A3-derived antigen may refer to an antigen derived from a COL6A3 splice variant, a COL6A3 Exon4 splice variant, or a splice variant in which the Exon4 of COL6A3 has been included (e.g. an antigen derived from all or part of a sequence defining a COL6A3 splice variant, a COL6A3 Exon4 splice variant, or a splice variant in which the Exon4 of COL6A3 has been included). For example, the COL6A3-derived antigen may be a peptide derived from a COL6A3 Exon4 splice variant transcript (e.g. the transcripts of SEQ ID NO: 47 or 48). A COL6A3-derived antigen may refer to a peptide having (e.g. comprising or consisting of) the amino acid sequence of SEQ ID NO: 3 or 4, or a peptide having at least 85%, 90%, or 95% sequence identity to SEQ ID NO: 3 or 4. A COL6A3-derived antigen may also refer to a peptide encoded by the nucleotide sequence of SEQ ID NO: 74 or 75, or a nucleotide sequence having at least 85%, 90%, or 95% sequence identity to SEQ ID NO: 74 or 75. A COL6A3- derived antigen may also refer to a peptide encoded by part or all of the nucleotide sequence of SEQ ID NO: 47 or 48. A COL6A3-derived antigen may also refer to a peptide encoded (e.g., in the appropriate translation frame) by the nucleotide sequence of SEQ ID NO: 42. A COL6A3-derived antigen may be referred to herein as a “COL6A3 antigen”.

[0075] The terms “peptide”, “polypeptide” and “protein” are used interchangeably and include any polymer of amino acids (dipeptide or greater) linked through peptide bonds or modified peptide bonds. The polypeptides of the invention may comprise non-peptidic components, such as carbohydrate groups. Carbohydrates and other non-peptidic substituents may be added to a polypeptide by the cell in which the polypeptide is produced and will vary with the type of cell. Polypeptides are defined herein, in terms of their amino acid backbone structures; substituents such as carbohydrate groups are generally not specified, but may be present, nonetheless.

[0076] References herein to antigens being “encoded” by a nucleotide sequence given in a SEQ ID NO. or transcript, mean that peptides binding to HLA, or the antigen, can be derived from the corresponding translated protein.

[0077] T-cell receptors (TCRs)

[0078] The present disclosure provides antigen-binding molecules and fragments, chains, polypeptides, and complexes thereof, e.g., T-cell receptors.

[0079] The term “T-cell receptor” (“TCR”) as used herein, refers to a heteromeric cell-surface receptor capable of specifically interacting with (or has a binding affinity for) a target antigen, antigen protein or fragment thereof bound to an HLA molecule and which may be presented on the surface of an antigen-presenting cell or the target cell.

[0080] As used herein, “TCR” includes, but is not limited to, naturally occurring and non-naturally occurring

[0081] TCRs; full-length TCRs and antigen binding portions thereof, chimeric TCRs; TCR fusion constructs; and synthetic TCRs. It will be understood that this term extends to heterodimers of TRA and TRB chains or heterodimers of TRG and TRD chains.

[0082] In humans, TCRs are expressed on the surface of T cells, and they are responsible for T cell recognition and targeting of antigen presenting cells. Antigen presenting cells (APC) display fragments of foreign or self-proteins (antigens) complexed with the major histocompatibility complex (MHC; also referred to herein as complexed with a HLA molecule, e.g., a HLA class I or class II molecule). A TCR recognizes and binds to the antigen:HLA complex and recruits CD3 (expressed by T cells), activating the TCR. The activated TCR initiates downstream signaling and an immune response, including the destruction of the APC.

[0083] In general, a TCR can comprise two chains, an alpha chain and a beta chain (or less commonly a gamma chain and a delta chain), interconnected by disulfide bonds to form a heterodimeric receptor. Each chain comprises a variable domain (e.g. alpha chain variable domain and beta chain variable domain) and a constant region (e.g. alpha chain constant region and beta chain constant region). The variable domain is located distal to the cell membrane, and the variable domain interacts with an antigen. A variable domain may also be referred to herein as a “variable region”. The constant region is located proximal to the cell membrane, acts to anchor the protein in the cell membrane, and associates with invariant subunits of the CD3 signaling apparatus. A TCR can further comprise a transmembrane region and a short cytoplasmic tail. As used herein, the term ‘constant region’ encompasses the transmembrane region and the cytoplasmic tail, when present, as well as the traditional “constant region”.

[0084] The variable domains can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FR). Each alpha chain variable domain and beta chain variable domain comprises three CDRs and four FRs: FR1 , CDR1 , FR2, CDR2, FR3, CDR3, FR4.

[0085] Each variable domain contains a binding domain that interacts with an antigen. This may be called an antigen-binding domain or antigen-binding fragment of a TCR. Together, the 6 CDRs form the majority of the antigen binding site of the TCR, thus conferring onto each TCR its specificity (Schroeder and Cavacini, J Allergy Clin Immunol 125(202):S41-S52 (2010); Bhati et al., Protein Science 23:260-272 (2014), which are hereby incorporated by reference in their entirety). The CDRs interact with a complex of an antigenic peptide bound to a protein encoded by the major histocompatibility complex (pepMHC) (Davis and Bjorkman (1988) Nature, 334, 395-402; Davis et al. (1998) Annu Rev Immunol, 16, 523-544; Murphy (2012), xix, 868 p., which are hereby incorporated by reference in their entirety). Although all three CDRs on each chain are involved in antigen binding, CDR3 is believed to be the primary antigenbinding region, interacting with the peptide in the HLA complex groove during TCR binding. CDR1 and CDR2 are believed to primarily recognize the HLA complex.

[0086] The term CDR3 used herein describes the CDR3 region optionally including the fixed C’-terminal amino acid C (cysteine) and N’-terminal amino acid F (phenylalanine) or W (Tryptophan), or the respective nucleotide sequences coding for these amino acids. The CDR3 including C’-terminal C and N’-terminal F / W, or the respective codons, is also termed ‘Junction’ in the field.

[0087] Where not expressly stated, and unless the context indicates otherwise, the term “TCR” also includes an antigen-binding fragment or an antigen-binding portion of any TCR disclosed herein and includes a monovalent and a divalent fragment or portion, and a single chain TCR or TCR fragment. An “antigen binding molecule”, “portion of a TCR” or “TCR fragment” may refer to a portion of a TCR less than the whole. An “antigen binding molecule”, “portion of a TCR”, or “TCR fragment” can include the antigenic complementarity determining regions (CDRs).

[0088] The term “TCR” is not limited to naturally occurring TCRs bound to the surface of a T cell. As used herein, the term “TCR” further refers to a TCR described herein that is expressed on the surface of a cell other than a T cell (e.g., a cell that naturally expresses or that is modified to express CD3, as described herein), or a TCR described herein that is free from a cell membrane (e.g., an isolated TCR or a soluble TCR). Thus, in some embodiments, an antigen-binding molecule, e.g. TCR or TCR chain / polypeptide, described herein is provided in isolated or purified form. For example, antigen-binding molecules according to the present disclosure may be isolated / purified from naturally occurring biological material. In some embodiments, an antigen-binding molecule described herein, e.g. TCR or TCR chain / polypeptide, is soluble. In some embodiments, an antigen-binding molecule described herein, e.g. TCR or TCR chain / polypeptide, (or a nucleotide sequence encoding the antigen-binding molecule) is comprised within and / or expressed by a cell, e.g. a cell as described herein.

[0089] TCRs are described using the International Immunogenetics (IMGT) TCR nomenclature, and links to the IMGT public database of TCR sequences. Native alpha-beta heterodimeric TCRs have an alpha chain and a beta chain. Broadly, each chain comprises variable, joining and constant regions, and the beta chain also usually contains a short diversity region between the variable and joining regions, but this diversity region is often considered as part of the joining region. Each variable region comprises three CDRs (Complementarity Determining Regions) embedded in a framework sequence, one being the hypervariable region named CDR3. There are several types of alpha chain variable (Va) regions and several types of beta chain variable (Vp) regions distinguished by their framework, CDR1 and CDR2 sequences, and by a partly defined CDR3 sequence. The Va types are referred to in IMGT nomenclature by a unique TRAV number. Thus “TRAV21” defines a TCR Va region having unique framework and CDR1 and CDR2 sequences, and a CDR3 sequence which is partly defined by an amino acid sequence which is preserved from TCR to TCR, but which also includes an amino acid sequence which varies from TCR to TCR. In the same way, “TRBV5-1 ” defines a TCR Vp region having unique framework and CDR1 and CDR2 sequences, but with only a partly defined CDR3 sequence.

[0090] The joining regions of the TCR are similarly defined by the unique IMGT TRAJ and TRBJ nomenclature, and the constant regions by the IMGT TRAC and TRBC nomenclature. The beta chain diversity region is referred to in IMGT nomenclature by the abbreviation TRBD, and, as mentioned, the concatenated TRBD / TRBJ regions are often considered together as the joining region. The a and p chains of ap TCRs are generally regarded as each having two “domains”, namely variable and constant domains. The variable domain consists of a concatenation of variable region and joining region.

[0091] In the present specification, the term “TCR alpha variable domain” therefore refers to the concatenation of TRAV and TRAJ regions, and the term TCR alpha constant domain refers to the extracellular TRAC region, or to a C-terminal truncated TRAC sequence.

[0092] Likewise, the term “TCR beta variable domain” refers to the concatenation of TRBV and TRBD / TRBJ regions, and the term TCR beta constant domain refers to the extracellular TRBC region, or to a C- terminal truncated TRBC sequence.

[0093] The unique sequences defined by the IMGT nomenclature are widely known and accessible to those working in the TCR field. For example, they can be found in the IMGT public database. The “T cell Receptor Factsbook”, (2001) LeFranc and LeFranc, Academic Press, ISBN 0-1 2-441 352-8 also discloses sequences defined by the IMGT nomenclature, but because of its publication date and consequent time-lag, the information therein sometimes needs to be confirmed by reference to the IMGT database.

[0094] As will be obvious to those skilled in the art, the mutation(s) in the TCRa chain sequence and / or TCRp chain sequence may be one or more of substitution(s), deletion(s), or insertion(s). These mutations can be carried out using any appropriate method including, but not limited to, those based on polymerase chain reaction (PCR), restriction enzyme-based cloning, or ligation independent cloning (LIC) procedures.

[0095] The TCRs of the invention may be ap heterodimers or may be in single chain format. Single chain formats include ap TCR polypeptides of the Va-L-Vp, Vp-L-Va, Va-Ca-L-Vp or Va-L-Vp-Cp types, wherein Va and Vp are TCRa and p variable regions respectively, Ca and Cp are TCR a and p constant regions respectively, and L is a linker sequence. For use as a targeting agent for delivering therapeutic agents to the antigen-presenting cell the TCR may be in soluble form ( / .e., having no transmembrane or cytoplasmic domains), For stability, soluble ap heterodimeric TCRs preferably have an introduced disulphide bond between residues of the respective constant domains, as described, for example, in WO 03 / 020763. One or both of the constant domains present in an ap heterodimer of the disclosure may be truncated at the C-terminus or C-termini, for example by up to 15, or up to 10, or up to 8 or fewer amino acids. For use in adoptive therapy, an ap heterodimeric TCR may, for example, be transfected as full- length chains having both cytoplasmic and transmembrane domains. TCRs for use in adoptive therapy may contain a disulphide bond corresponding to that found in nature between the respective alpha and beta constant domains; additionally or alternatively a non-native disulphide bond may be present.

[0096] As will be obvious to those skilled in the art, it may be possible to truncate the sequences provided at the C-terminus and / or N-terminus by 1 , 2, 3, 4, 5 or more residues, without substantially affecting the binding characteristics of the TCR. All such trivial variants are encompassed by the present invention. Alpha-beta heterodimeric TCRs of the invention usually comprise an alpha chain TRAC constant domain sequence and a beta chain TRBC1 or TRBC2 constant domain sequence. The alpha and beta chain constant domain sequences may be modified by truncation or substitution to delete the native disulphide bond between Cys2 of exon 2 of TRAC and Cys2 of exon 2 of TRBC1 or TRBC2. The alpha and beta chain constant domain sequences may also be modified by substitution of cysteine residues for Thr 48 of TRAC and Ser 57 of TRBC1 or TRBC2, the said cysteines forming a disulphide bond between the alpha and beta constant domains of the TCR.

[0097] The present invention provides an antigen-binding molecule, e.g. a TCR or fragment / chain thereof, that binds to a COL6A3-derived antigenic peptide, such as when presented by a major histocompatibility complex (MHC) molecule. In some embodiments, the antigen-binding molecule binds to COL6A3 or a COL6A3-derived antigen as described herein. In some embodiments, the antigen-binding molecule binds to COL6A3, a COL6A3 splice variant (e.g. a COL6A3 Exon4 splice variant), or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4. In some embodiments, the antigen-binding molecule binds to a peptide comprising or consisting of the amino acid sequence of SEQ ID NO: 3. In some embodiments, the antigen-binding molecule binds to a peptide comprising or consisting of the amino acid sequence of SEQ ID NO: 4. In some embodiments, the antigen-binding molecule binds to a peptide having at least 85%, 90%, or 95% sequence identity to SEQ ID NO: 3. In some embodiments, the antigen-binding molecule binds to a peptide having at least 85%, 90%, or 95% sequence identity to SEQ ID NO: 4. In some embodiments, the antigen-binding molecule binds to a peptide encoded by the nucleotide sequence of SEQ ID NO: 74 or 75.

[0098] In some embodiments the antigen-binding molecule comprises a TCRa chain, or a fragment thereof. In some embodiments, the TCRa chain comprises a TCRa variable domain. In some embodiments, the TCRa chain, e.g. TCRa chain variable domain, comprises a CDR3a having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 8. In some embodiments, the TCRa chain, e.g. TCRa chain variable domain, comprises a CDR3a having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 16.

[0099] In some embodiments the antigen-binding molecule comprises a TCRp chain, or a fragment thereof. In some embodiments, the TCRp chain comprises a TCRp variable domain. In some embodiments, the TCRp chain, e.g. TCRp chain variable domain, comprises a CDR3p having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 12. In some embodiments, the CDR3p has an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 20.

[0100] In some embodiments, the antigen-binding molecule comprises a TCRa chain having a TCRa variable domain comprising a CDR3a having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 8; in combination with a TCRp chain having a TCRp chain variable domain comprising a CDR3p having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 12.

[0101] In some embodiments, the antigen-binding molecule comprises a TCRa chain having a TCRa variable domain comprising a CDR3a having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 16; in combination with a TCRp chain having a TCRp chain variable domain comprising a CDR3p having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 20.

[0102] In some embodiments, the antigen-binding molecule comprises a TCRa chain having a TCRa variable domain comprising a CDR3a having the amino acid sequence of SEQ ID NO: 8; in combination with a TCRp chain having a TCRp chain variable domain comprising a CDR3p having the amino acid sequence of SEQ ID NO: 12.

[0103] In some embodiments, the antigen-binding molecule comprises a TCRa chain having a TCRa variable domain comprising a CDR3a having the amino acid sequence of SEQ ID NO: 16; in combination with a TCRp chain having a TCRp chain variable domain comprising a CDR3p having the amino acid sequence of SEQ ID NO: 20.

[0104] In some embodiments, the antigen-binding molecule, e.g. TCR or fragment thereof, comprises a TCRa chain having a TCRa variable domain comprising: a CDR1a having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 6; a CDR2a having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 7; and / or a CDR3a having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 8.

[0105] In some embodiments, the antigen-binding molecule, e.g. TOR or fragment thereof, comprises a TCRp chain having a TCRp variable domain comprising: a CDR1 having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 10; a CDR2p having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 11 ; and / or a CDR3p having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 12.

[0106] In some embodiments, the antigen-binding molecule e.g. TCR or fragment thereof, comprises:

[0107] (i) a TCRa chain variable domain incorporating the following CDRs: a CDR1a having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 6; a CDR2a having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 7; and / or a CDR3a having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 8; and

[0108] (ii) a TCRp chain variable domain incorporating the following CDRs: a CDR1 having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 10; a CDR2p having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 11 ; and / or a CDR3p having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 12.

[0109] In some embodiments, the antigen-binding molecule, e.g. TOR or fragment thereof, comprises a TCRa chain having a TCRa variable domain comprising: a CDR1a having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 14; a CDR2a having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 15; and / or a CDR3a having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 16.

[0110] In some embodiments, the antigen-binding molecule, e.g. TCR or fragment thereof, comprises a TCRp chain having a TCRp variable domain comprising: a CDR1 having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 18; a CDR2p having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 19; and / or a CDR3p having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 20.

[0111] In some embodiments, the antigen-binding molecule e.g. TCR or fragment thereof, comprises:

[0112] (i) a TCRa chain variable domain incorporating the following CDRs: a CDR1a having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 14; a CDR2a having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 15; and / or a CDR3a having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 16; and

[0113] (ii) a TCRp chain variable domain incorporating the following CDRs: a CDR1 p having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 18; a CDR2p having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 19; and / or a CDR3p having an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 20.

[0114] In some embodiments, the antigen-binding molecule e.g. TCR or fragment thereof, comprises:

[0115] (i) a TCRa chain variable domain incorporating the following CDRs: CDR1a having the amino acid sequence of SEQ ID NO: 6 CDR2a having the amino acid sequence of SEQ ID NO: 7, and CDR3a having the amino acid sequence of SEQ ID NO: 8, or a variant thereof in which 1 or 2 or 3 amino acids in CDR1 a, and / or in which 1 or 2 or 3 amino acids in CDR2a, and / or in which 1 or 2 or 3 amino acids in CDR3a are substituted with another amino acid.

[0116] In some embodiments, the antigen-binding molecule e.g. TCR or fragment thereof, comprises:

[0117] (i) a TCRp chain variable domain incorporating the following CDRs: CDR1 p having the amino acid sequence of SEQ ID NO: 10

[0118] CDR2p having the amino acid sequence of SEQ ID NO: 11 , and

[0119] CDR3p having the amino acid sequence of SEQ ID NO: 12, or a variant thereof in which 1 or 2 or 3 amino acids in CDR1 p, and / or in which 1 or 2 or 3 amino acids in CDR2p, and / or in which 1 or 2 or 3 amino acids in CDR3p are substituted with another amino acid.

[0120] In some embodiments, the antigen-binding molecule e.g. TCR or fragment thereof, comprises:

[0121] (i) a TCRa chain variable domain incorporating the following CDRs: CDR1a having the amino acid sequence of SEQ ID NO: 14

[0122] CDR2a having the amino acid sequence of SEQ ID NO: 15, and

[0123] CDR3a having the amino acid sequence of SEQ ID NO: 16, or a variant thereof in which 1 or 2 or 3 amino acids in CDR1a, and / or in which 1 or 2 or 3 amino acids in CDR2a, and / or in which 1 or 2 or 3 amino acids in CDR3a are substituted with another amino acid.

[0124] In some embodiments, the antigen-binding molecule e.g. TCR or fragment thereof, comprises:

[0125] (i) a TCRp chain variable domain incorporating the following CDRs:

[0126] CDR1 p having the amino acid sequence of SEQ ID NO: 18

[0127] CDR2p having the amino acid sequence of SEQ ID NO: 19, and

[0128] CDR3p having the amino acid sequence of SEQ ID NO: 20, or a variant thereof in which 1 or 2 or 3 amino acids in CDR1 p, and / or in which 1 or 2 or 3 amino acids in

[0129] CDR2p, and / or in which 1 or 2 or 3 amino acids in CDR3p are substituted with another amino acid.

[0130] In some embodiments, the antigen-binding molecule e.g. TCR or fragment thereof, comprises:

[0131] (i) a TCRa chain variable domain incorporating the following CDRs:

[0132] CDR1a having the amino acid sequence of SEQ ID NO: 6

[0133] CDR2a having the amino acid sequence of SEQ ID NO: 7, and

[0134] CDR3a having the amino acid sequence of SEQ ID NO: 8, or a variant thereof in which 1 or 2 or 3 amino acids in CDR1 a, and / or in which 1 or 2 or 3 amino acids in CDR2a, and / or in which 1 or 2 or 3 amino acids in CDR3a are substituted with another amino acid; and

[0135] (ii) a TCRp chain variable domain incorporating the following CDRs:

[0136] CDR1 p having the amino acid sequence of SEQ ID NO: 10 CDR2p having the amino acid sequence of SEQ ID NO: 11 , and CDR3p having the amino acid sequence of SEQ ID NO: 12, or a variant thereof in which 1 or 2 or 3 amino acids in CDR1 p, and / or in which 1 or 2 or 3 amino acids in CDR2p, and / or in which 1 or 2 or 3 amino acids in CDR3p are substituted with another amino acid.

[0137] In some embodiments, the antigen-binding molecule e.g. TOR or fragment thereof, comprises:

[0138] (i) a TCRa chain variable domain incorporating the following CDRs:

[0139] CDR1a having the amino acid sequence of SEQ ID NO: 14 CDR2a having the amino acid sequence of SEQ ID NO: 15, and CDR3a having the amino acid sequence of SEQ ID NO: 16, or a variant thereof in which 1 or 2 or 3 amino acids in CDR1 a, and / or in which 1 or 2 or 3 amino acids in CDR2a, and / or in which 1 or 2 or 3 amino acids in CDR3a are substituted with another amino acid; and

[0140] (ii) a TCRp chain variable domain incorporating the following CDRs:

[0141] CDR1 p having the amino acid sequence of SEQ ID NO: 18 CDR2p having the amino acid sequence of SEQ ID NO: 19, and CDR3p having the amino acid sequence of SEQ ID NO: 20, or a variant thereof in which 1 or 2 or 3 amino acids in CDR1 p, and / or in which 1 or 2 or 3 amino acids in CDR2p, and / or in which 1 or 2 or 3 amino acids in CDR3p are substituted with another amino acid.

[0142] In some embodiments, the antigen-binding molecule e.g. TCR or fragment thereof comprises a TCRa chain variable domain incorporating the following CDRs:

[0143] CDR1a having the amino acid sequence of SEQ ID NO: 6

[0144] CDR2a having the amino acid sequence of SEQ ID NO: 7, and CDR3a having the amino acid sequence of SEQ ID NO: 8.

[0145] In some embodiments, the antigen-binding molecule e.g. TCR or fragment thereof, comprises a TCRp chain variable domain incorporating the following CDRs:

[0146] CDR1 p having the amino acid sequence of SEQ ID NO: 10

[0147] CDR2p having the amino acid sequence of SEQ ID NO: 11 , and

[0148] CDR3p having the amino acid sequence of SEQ ID NO: 12. In some embodiments, the antigen-binding molecule e.g. TCR or fragment thereof comprises a TCRa chain variable domain incorporating the following CDRs:

[0149] CDR1a having the amino acid sequence of SEQ ID NO: 14

[0150] CDR2a having the amino acid sequence of SEQ ID NO: 15, and CDR3a having the amino acid sequence of SEQ ID NO: 16.

[0151] In some embodiments, the antigen-binding molecule e.g. TCR or fragment thereof, comprises:

[0152] (i) a TCRp chain variable domain incorporating the following CDRs: CDR1 p having the amino acid sequence of SEQ ID NO: 18 CDR2p having the amino acid sequence of SEQ ID NO: 19, and CDR3p having the amino acid sequence of SEQ ID NO: 20.

[0153] In some embodiments, the antigen-binding molecule e.g. TCR or fragment thereof, comprises:

[0154] (i) a TCRa chain variable domain incorporating the following CDRs:

[0155] CDR1a having the amino acid sequence of SEQ ID NO: 6 CDR2a having the amino acid sequence of SEQ ID NO: 7, and CDR3a having the amino acid sequence of SEQ ID NO: 8; and

[0156] (ii) a TCRp chain variable domain incorporating the following CDRs:

[0157] CDR1 p having the amino acid sequence of SEQ ID NO: 10 CDR2p having the amino acid sequence of SEQ ID NO: 11 , and CDR3p having the amino acid sequence of SEQ ID NO: 12.

[0158] In some embodiments, the antigen-binding molecule e.g. TCR or fragment thereof, comprises:

[0159] (i) a TCRa chain variable domain incorporating the following CDRs:

[0160] CDR1a having the amino acid sequence of SEQ ID NO: 14 CDR2a having the amino acid sequence of SEQ ID NO: 15, and CDR3a having the amino acid sequence of SEQ ID NO: 16; and

[0161] (ii) a TCRp chain variable domain incorporating the following CDRs:

[0162] CDR1 p having the amino acid sequence of SEQ ID NO: 18 CDR2p having the amino acid sequence of SEQ ID NO: 19, and CDR3p having the amino acid sequence of SEQ ID NO: 20.

[0163] In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRa chain variable domain comprising one or more framework regions selected from SEQ ID NOs: 58-61. In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRa chain variable domain comprising one or more framework regions selected from SEQ ID NOs: 66-69. In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRp chain variable domain comprising one or more framework regions selected from SEQ ID NOs: 62- 65. In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRp chain variable domain comprising one or more framework regions selected from SEQ ID NOs: 70-73.

[0164] In some embodiments, an antigen-binding molecule e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRa chain variable domain comprising the framework regions represented by SEQ ID NOs: 58-61. In some embodiments, an antigen-binding molecule e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRa chain variable domain comprising the framework regions represented by SEQ ID NOs: 66-69.

[0165] In some embodiments, an antigen-binding molecule e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRa chain variable domain comprising the framework regions represented by SEQ ID NOs: 58-61 or one or more sequences having at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with one or more of SEQ ID NOs: 58-61. In some embodiments, an antigen-binding molecule e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRa chain variable domain comprising the framework regions represented by SEQ ID NOs: 66-69 or one or more sequences having at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with one or more of SEQ ID NOs:66-69.

[0166] In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRp chain variable domain comprising the framework regions represented by SEQ ID NOs: 62-65. In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRp chain variable domain comprising the framework regions represented by SEQ ID NOs: 70-73.

[0167] In some embodiments, an antigen-binding molecule e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRp chain variable domain comprising the framework regions represented by SEQ ID NOs: 62-65 or one or more sequences having at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with one or more of SEQ ID NOs: 62-65. In some embodiments, an antigen-binding molecule e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRp chain variable domain comprising the framework regions represented by SEQ ID NOs: 70-73 or one or more sequences having at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with one or more of SEQ ID NOs: 70-73. In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRa chain variable domain comprising:

[0168] FR1 having the amino acid sequence of SEQ ID NO: 58,

[0169] FR2 having the amino acid sequence of SEQ ID NO: 59,

[0170] FR3 having the amino acid sequence of SEQ ID NO: 60, and

[0171] FR4 having the amino acid sequence of SEQ ID NO: 61 , or a variant thereof in which 1 or 2 or 3 amino acids in FR1 , and / or in which 1 or 2 or 3 amino acids in FR2, and / or in which 1 or 2 or 3 amino acids in FR3 are substituted with another amino acid, and / or in which 1 or 2 or 3 amino acids in FR4 are substituted with another amino acid.

[0172] In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRp chain variable domain comprising:

[0173] FR1 having the amino acid sequence of SEQ ID NO: 62,

[0174] FR2 having the amino acid sequence of SEQ ID NO: 63,

[0175] FR3 having the amino acid sequence of SEQ ID NO: 64, and

[0176] FR4 having the amino acid sequence of SEQ ID NO: 65, or a variant thereof in which 1 or 2 or 3 amino acids in FR1 , and / or in which 1 or 2 or 3 amino acids in FR2, and / or in which 1 or 2 or 3 amino acids in FR3 are substituted with another amino acid, and / or in which 1 or 2 or 3 amino acids in FR4 are substituted with another amino acid.

[0177] In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRa chain variable domain comprising:

[0178] FR1 having the amino acid sequence of SEQ ID NO: 66,

[0179] FR2 having the amino acid sequence of SEQ ID NO: 67,

[0180] FR3 having the amino acid sequence of SEQ ID NO: 68, and

[0181] FR4 having the amino acid sequence of SEQ ID NO: 69, or a variant thereof in which 1 or 2 or 3 amino acids in FR1 , and / or in which 1 or 2 or 3 amino acids in FR2, and / or in which 1 or 2 or 3 amino acids in FR3 are substituted with another amino acid, and / or in which 1 or 2 or 3 amino acids in FR4 are substituted with another amino acid.

[0182] In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRp chain variable domain comprising:

[0183] FR1 having the amino acid sequence of SEQ ID NO: 70,

[0184] FR2 having the amino acid sequence of SEQ ID NO: 71 ,

[0185] FR3 having the amino acid sequence of SEQ ID NO: 72, and

[0186] FR4 having the amino acid sequence of SEQ ID NO: 73, or a variant thereof in which 1 or 2 or 3 amino acids in FR1 , and / or in which 1 or 2 or 3 amino acids in FR2, and / or in which 1 or 2 or 3 amino acids in FR3 are substituted with another amino acid, and / or in which 1 or 2 or 3 amino acids in FR4 are substituted with another amino acid.

[0187] In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises:

[0188] (i) a TCRa chain variable domain comprising:

[0189] FR1 having the amino acid sequence of SEQ ID NO: 58,

[0190] FR2 having the amino acid sequence of SEQ ID NO: 59,

[0191] FR3 having the amino acid sequence of SEQ ID NO: 60, and

[0192] FR4 having the amino acid sequence of SEQ ID NO: 61 , or a variant thereof in which 1 or 2 or 3 amino acids in FR1 , and / or in which 1 or 2 or 3 amino acids in FR2, and / or in which 1 or 2 or 3 amino acids in FR3 are substituted with another amino acid, and / or in which 1 or 2 or 3 amino acids in FR4 are substituted with another amino acid, and

[0193] (ii) a TCRp chain variable domain comprising:

[0194] FR1 having the amino acid sequence of SEQ ID NO: 62,

[0195] FR2 having the amino acid sequence of SEQ ID NO: 63,

[0196] FR3 having the amino acid sequence of SEQ ID NO: 64, and

[0197] FR4 having the amino acid sequence of SEQ ID NO: 65, or a variant thereof in which 1 or 2 or 3 amino acids in FR1 , and / or in which 1 or 2 or 3 amino acids in FR2, and / or in which 1 or 2 or 3 amino acids in FR3 are substituted with another amino acid, and / or in which 1 or 2 or 3 amino acids in FR4 are substituted with another amino acid.

[0198] In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises:

[0199] (i) a TCRa chain variable domain comprising:

[0200] FR1 having the amino acid sequence of SEQ ID NO: 66,

[0201] FR2 having the amino acid sequence of SEQ ID NO: 67,

[0202] FR3 having the amino acid sequence of SEQ ID NO: 68, and

[0203] FR4 having the amino acid sequence of SEQ ID NO: 69, or a variant thereof in which 1 or 2 or 3 amino acids in FR1 , and / or in which 1 or 2 or 3 amino acids in FR2, and / or in which 1 or 2 or 3 amino acids in FR3 are substituted with another amino acid, and / or in which 1 or 2 or 3 amino acids in FR4 are substituted with another amino acid, and

[0204] (ii) a TCRp chain variable domain comprising:

[0205] FR1 having the amino acid sequence of SEQ ID NO: 70,

[0206] FR2 having the amino acid sequence of SEQ ID NO: 71 ,

[0207] FR3 having the amino acid sequence of SEQ ID NO: 72, and FR4 having the amino acid sequence of SEQ ID NO: 73, or a variant thereof in which 1 or 2 or 3 amino acids in FR1 , and / or in which 1 or 2 or 3 amino acids in FR2, and / or in which 1 or 2 or 3 amino acids in FR3 are substituted with another amino acid, and / or in which 1 or 2 or 3 amino acids in FR4 are substituted with another amino acid.

[0208] In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRa chain variable domain comprising:

[0209] CDR1a having the amino acid sequence of SEQ ID NO: 6

[0210] CDR2a having the amino acid sequence of SEQ ID NO: 7,

[0211] CDR3a having the amino acid sequence of SEQ ID NO: 8,

[0212] FR1 having the amino acid sequence of SEQ ID NO: 58,

[0213] FR2 having the amino acid sequence of SEQ ID NO: 59,

[0214] FR3 having the amino acid sequence of SEQ ID NO: 60, and

[0215] FR4 having the amino acid sequence of SEQ ID NO: 61 , or a variant thereof in which 1 or 2 or 3 amino acids in FR1 , and / or in which 1 or 2 or 3 amino acids in FR2, and / or in which 1 or 2 or 3 amino acids in FR3 are substituted with another amino acid, and / or in which 1 or 2 or 3 amino acids in FR4 are substituted with another amino acid.

[0216] In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRp chain variable domain comprising:

[0217] CDR1a having the amino acid sequence of SEQ ID NO: 10

[0218] CDR2a having the amino acid sequence of SEQ ID NO: 1 1 ,

[0219] CDR3a having the amino acid sequence of SEQ ID NO: 12,

[0220] FR1 having the amino acid sequence of SEQ ID NO: 62,

[0221] FR2 having the amino acid sequence of SEQ ID NO: 63,

[0222] FR3 having the amino acid sequence of SEQ ID NO: 64, and

[0223] FR4 having the amino acid sequence of SEQ ID NO: 65, or a variant thereof in which 1 or 2 or 3 amino acids in FR1 , and / or in which 1 or 2 or 3 amino acids in FR2, and / or in which 1 or 2 or 3 amino acids in FR3 are substituted with another amino acid, and / or in which 1 or 2 or 3 amino acids in FR4 are substituted with another amino acid.

[0224] In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRa chain variable domain comprising:

[0225] CDR1a having the amino acid sequence of SEQ ID NO: 14 CDR2a having the amino acid sequence of SEQ ID NO: 15, CDR3a having the amino acid sequence of SEQ ID NO: 16, FR1 having the amino acid sequence of SEQ ID NO: 66, FR2 having the amino acid sequence of SEQ ID NO: 67, FR3 having the amino acid sequence of SEQ ID NO: 68, and

[0226] FR4 having the amino acid sequence of SEQ ID NO: 69, or a variant thereof in which 1 or 2 or 3 amino acids in FR1 , and / or in which 1 or 2 or 3 amino acids in FR2, and / or in which 1 or 2 or 3 amino acids in FR3 are substituted with another amino acid, and / or in which 1 or 2 or 3 amino acids in FR4 are substituted with another amino acid.

[0227] In some embodiments, an antigen-binding molecule, e.g. TOR or fragment thereof, according to the present disclosure comprises a TCRp chain variable domain comprising:

[0228] CDR1a having the amino acid sequence of SEQ ID NO: 18 CDR2a having the amino acid sequence of SEQ ID NO: 19, CDR3a having the amino acid sequence of SEQ ID NO: 20, FR1 having the amino acid sequence of SEQ ID NO: 70,

[0229] FR2 having the amino acid sequence of SEQ ID NO: 71 ,

[0230] FR3 having the amino acid sequence of SEQ ID NO: 72, and

[0231] FR4 having the amino acid sequence of SEQ ID NO: 73, or a variant thereof in which 1 or 2 or 3 amino acids in FR1 , and / or in which 1 or 2 or 3 amino acids in FR2, and / or in which 1 or 2 or 3 amino acids in FR3 are substituted with another amino acid, and / or in which 1 or 2 or 3 amino acids in FR4 are substituted with another amino acid.

[0232] In some embodiments, an antigen-binding molecule, e.g. TOR or fragment thereof, according to the present disclosure comprises:

[0233] (i) a TCRa chain variable domain comprising:

[0234] CDR1a having the amino acid sequence of SEQ ID NO: 6 CDR2a having the amino acid sequence of SEQ ID NO: 7, CDR3a having the amino acid sequence of SEQ ID NO: 8, FR1 having the amino acid sequence of SEQ ID NO: 58,

[0235] FR2 having the amino acid sequence of SEQ ID NO: 59,

[0236] FR3 having the amino acid sequence of SEQ ID NO: 60, and

[0237] FR4 having the amino acid sequence of SEQ ID NO: 61 , or a variant thereof in which 1 or 2 or 3 amino acids in FR1 , and / or in which 1 or 2 or 3 amino acids in FR2, and / or in which 1 or 2 or 3 amino acids in FR3 are substituted with another amino acid, and / or in which 1 or 2 or 3 amino acids in FR4 are substituted with another amino acid, and

[0238] (ii) a TCRp chain variable domain comprising:

[0239] CDR1a having the amino acid sequence of SEQ ID NO: 10 CDR2a having the amino acid sequence of SEQ ID NO: 1 1 , CDR3a having the amino acid sequence of SEQ ID NO: 12, FR1 having the amino acid sequence of SEQ ID NO: 62, FR2 having the amino acid sequence of SEQ ID NO: 63, FR3 having the amino acid sequence of SEQ ID NO: 64, and

[0240] FR4 having the amino acid sequence of SEQ ID NO: 65, or a variant thereof in which 1 or 2 or 3 amino acids in FR1 , and / or in which 1 or 2 or 3 amino acids in FR2, and / or in which 1 or 2 or 3 amino acids in FR3 are substituted with another amino acid, and / or in which 1 or 2 or 3 amino acids in FR4 are substituted with another amino acid.

[0241] In some embodiments, an antigen-binding molecule, e.g. TOR or fragment thereof, according to the present disclosure comprises:

[0242] (i) a TCRa chain variable domain comprising:

[0243] CDR1a having the amino acid sequence of SEQ ID NO: 14

[0244] CDR2a having the amino acid sequence of SEQ ID NO: 15,

[0245] CDR3a having the amino acid sequence of SEQ ID NO: 16,

[0246] FR1 having the amino acid sequence of SEQ ID NO: 66,

[0247] FR2 having the amino acid sequence of SEQ ID NO: 67,

[0248] FR3 having the amino acid sequence of SEQ ID NO: 68, and

[0249] FR4 having the amino acid sequence of SEQ ID NO: 69, or a variant thereof in which 1 or 2 or 3 amino acids in FR1 , and / or in which 1 or 2 or 3 amino acids in FR2, and / or in which 1 or 2 or 3 amino acids in FR3 are substituted with another amino acid, and / or in which 1 or 2 or 3 amino acids in FR4 are substituted with another amino acid, and

[0250] (ii) a TCRp chain variable domain comprising:

[0251] CDR1a having the amino acid sequence of SEQ ID NO: 18 CDR2a having the amino acid sequence of SEQ ID NO: 19, CDR3a having the amino acid sequence of SEQ ID NO: 20, FR1 having the amino acid sequence of SEQ ID NO: 70,

[0252] FR2 having the amino acid sequence of SEQ ID NO: 71 ,

[0253] FR3 having the amino acid sequence of SEQ ID NO: 72, and

[0254] FR4 having the amino acid sequence of SEQ ID NO: 73, or a variant thereof in which 1 or 2 or 3 amino acids in FR1 , and / or in which 1 or 2 or 3 amino acids in FR2, and / or in which 1 or 2 or 3 amino acids in FR3 are substituted with another amino acid, and / or in which 1 or 2 or 3 amino acids in FR4 are substituted with another amino acid.

[0255] In some embodiments, an antigen-binding molecule, e.g., TOR or fragment thereof, according to the present disclosures comprises a TCRa chain variable domain comprising the amino acid sequence of SEQ ID NO: 5. In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRa chain variable domain comprising the amino acid sequence of SEQ ID NO: 13. In some embodiments, an antigen-binding molecule, e.g., TCR or fragment thereof, according to the present disclosures comprises a TCRp chain variable domain comprising the amino acid sequence of SEQ ID NO: 9. In some embodiments, an antigen-binding molecule, .e.g., TCR or fragment thereof, according to the present disclosures comprises a TCRp chain variable domain comprising the amino acid sequence of SEQ ID NO: 17.

[0256] In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRa chain variable domain comprising SEQ ID NOs: 5 and / or 13, or one or more sequences having at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with one or more of SEQ ID NOs: 5 and / or 13.

[0257] In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRp chain variable domain comprising SEQ ID NOs: 9 and / or 17, or one or more sequences having at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with one or more of SEQ ID NOs: 9 and / or 17.

[0258] In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises:

[0259] (i) a TCRa chain variable domain comprising SEQ ID NOs: 5 and / or 13, or one or more sequences having at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with one or more of SEQ ID NOs: 5 and / or 13; and

[0260] (ii) a TCRp chain variable domain comprising SEQ ID NOs: 9 and / or 17, or one or more sequences having at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with one or more of SEQ ID NOs: 9 and / or 17.

[0261] In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRa chain variable domain having an amino acid sequence as shown in SEQ ID NO: 5, or an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 5.

[0262] In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRp chain variable domain having an amino acid sequence as shown in SEQ ID NO: 9, or an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 9.

[0263] In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRa chain variable domain having an amino acid sequence as shown in SEQ ID NO: 13, or an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 13.

[0264] In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRp chain variable domain having an amino acid sequence as shown in SEQ ID NO: 17, or an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 17.

[0265] In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises:

[0266] (i) a TCRa chain variable domain having an amino acid sequence as shown in SEQ ID NO: 5, or an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 5; and

[0267] (ii) a TCRp chain variable domain having an amino acid sequence as shown in SEQ ID NO: 9, or an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 9.

[0268] In some embodiments, an antigen-binding molecule, e.g. TCR or fragment thereof, according to the present disclosure comprises:

[0269] (i) a TCRa chain variable domain having an amino acid sequence as shown in SEQ ID NO: 13, or an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 13; and

[0270] (ii) a TCRp chain variable domain having an amino acid sequence as shown in SEQ ID NO: 17, or an amino acid sequence sharing at least about 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO: 17.

[0271] In some embodiments, an antigen-binding molecule e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRa chain variable domain having an amino acid sequence as shown in SEQ ID NO: 5 and a TCRp chain variable domain having an amino acid sequence as shown in SEQ ID NO: 9.

[0272] In some embodiments, an antigen-binding molecule e.g. TCR or fragment thereof, according to the present disclosure comprises a TCRa chain variable domain having an amino acid sequence as shown in SEQ ID NO: 13 and a TCRp chain variable domain having an amino acid sequence as shown in SEQ ID NO: 17.

[0273] In some embodiments, an antigen-binding molecule according to the present disclosure, e.g. TCR or fragment thereof, comprises the CDRs, FRs and / or the alpha and / or beta chain variable domains of a TCR described herein, or CDRs, FRs and / or alpha and / or beta chain variable domains which are derived from those of a TCR described herein.

[0274] In some embodiments, an antigen-binding molecule according to the present disclosure, e.g. TCR or fragment thereof, comprises a TCRa chain comprising a TCRa constant region having at least 80%, 85%, 90%, or 95% sequence identity to an amino acid sequence of: SEQ ID NO: 22; and a TCRp chain comprising a TCRp constant region having at least 80%, 85%, 90%, or 95% sequence identity to an amino acid sequence of: SEQ ID NO: 23.

[0275] In some embodiments, an antigen-binding molecule according to the present disclosure, e.g. TCR or fragment thereof, comprises a TCRa chain comprising a TCRa constant region having at least 80%, 85%, 90%, or 95% sequence identity to an amino acid sequence of: SEQ ID NO: 78; and a TCRp chain comprising a TCRp constant region having at least 80%, 85%, 90%, or 95% sequence identity to an amino acid sequence of: SEQ ID NO: 79.

[0276] In some embodiments, any TCRa chain described herein may comprise a constant region comprising a mutated version of the human TCRa constant region as in SEQ ID NO: 78. In some embodiments, any TCRp chain described herein may comprise a constant region comprising a mutated version of the human TCRp constant region as in SEQ ID NO: 79. In some embodiments, any TCR described herein may comprise a human TCR constant region comprising a mutated version of the human TCRa constant region as in SEQ ID NO: 78 and a mutated version of human TCRp constant region as in SEQ ID NO: 79. The mutation comprises the introduction of a Cys in both the alpha and beta chains of the TCR to create a stabilizing disulfide bridge between the two chains. TCR chains can be modified by mutagenesis of residue 48 in the Ca region from Thr to Cys and residue 57 of the Cp region from Ser to Cys. The method has been described previously in Kuball et al, Blood. 2007 Mar 15; 109(6): 2331-2338., which is hereby incorporated by reference in its entirety. The mutation promotes stable expression and pairing of the transduced TCR in human T cells in which the endogenous TCR is not knocked out.

[0277] In some embodiments, the antigen-binding molecule (e.g. TCR of fragment thereof) comprises the amino acid sequence of SEQ ID NO: 50. In some embodiments, the antigen binding molecule (e.g. TCR or fragment thereof) comprises or consists of an amino acid sequence having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 50. In some embodiments, the antigen-binding molecule (e.g. TCR of fragment thereof) comprises the amino acid sequence of SEQ ID NO: 51. In some embodiments, the antigen-binding molecule (e.g. TCR or fragment thereof) comprises or consists of an amino acid sequence having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 51 . In some embodiments, the antigen-binding molecule (e.g. TCR of fragment thereof) comprises the amino acid sequence of SEQ ID NO: 52. In some embodiments, the antigen-binding molecule (e.g. TCR or fragment thereof) comprises or consists of an amino acid sequence having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 52. In some embodiments, the antigen-binding molecule (e.g. TCR or fragment thereof) comprises the amino acid sequence of SEQ ID NO: 53. In some embodiments, the antigen-binding molecule (e.g. TCR or fragment thereof) comprises or consists of an amino acid sequence having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 53.

[0278] In some embodiments, the antigen-binding molecule (e.g. TCR or fragment thereof) comprises the amino acid sequence of SEQ ID NO: 50 and the amino acid sequence of SEQ ID NO: 51. In some embodiments, the antigen-binding molecule (e.g. TCR or fragment thereof) comprises the amino acid sequence of SEQ ID NO: 52 and the amino acid sequence of SEQ ID NO: 52.

[0279] In some embodiments, the TCR comprises or consists of the amino acid sequence of SEQ ID NO: 25. In some embodiments, the TCR comprises or consists of an amino acid sequence having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 25. In some embodiments, the TCR comprises or consists of the amino acid sequence of SEQ ID NO: 26. In some embodiments, the TCR comprises or consists of an amino acid sequence having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 26. In some embodiments, the TCR is selected from H22-1 and H22-2.

[0280] In some embodiments, any antigen-binding molecule, e.g. TCR or fragment thereof, described herein may be capable of recognising and / or binding to a peptide or antigen derived from COL6A3 protein, i.e. a COL6A3-derived peptide or antigen, such as when presented by a major histocompatibility complex (MHC) molecule. In some embodiments, COL6A3 comprises or consists of the amino acid sequence of SEQ ID NO: 49. In some embodiments, any antigen-binding molecule e.g. TCR or fragment thereof, described herein, may be capable of recognising and / or binding to a peptide or antigen derived from a COL6A3 splice variant, such as when presented by a major histocompatibility complex (MHC) molecule. In some embodiments, the COL6A3 splice variant is a COL6A3 Exon4 splice variant. In some embodiments, the COL6A3 splice variant or COL6A3 Exon4 splice variant comprises or consists of the amino acid sequence of SEQ ID NO: 3. In some embodiments, the COL6A3 splice variant or COL6A3 Exon4 splice variant comprises or consists of the amino acid sequence of SEQ ID NO: 4. In some embodiments, any antigen-binding molecule e.g. TCR or fragment thereof, described herein may be capable of recognising and / or binding to a peptide or antigen encoded by SEQ ID NO: 74 or SEQ ID NO: 75. In some embodiments, the antigen-binding molecule (e.g. TCR or fragment thereof) is capable of recognising and / or binding to a peptide or antigen encoded by or derived from SEQ ID NO: 47 or SEQ ID NO: 48. In some embodiments, the antigen-binding molecule (e.g. TCR or fragment thereof) is capable of recognising and / or binding to a peptide or antigen encoded (e.g. in the appropriate translation frame) by SEQ ID NO: 42.

[0281] An “antigen” refers to any molecule, e.g., a peptide, that provokes an immune response or is capable of being bound by a TCR. An “epitope” as used herein, refers to a portion of a polypeptide that provokes an immune response or is capable of being bound by a TCR. The immune response may involve either antibody production, or the activation of specific immunologically competent cells, or both. A person of skill in the art would readily understand that any macromolecule, including virtually all proteins or peptides, can serve as an antigen. An antigen and / or an epitope can be endogenously expressed, i.e. expressed by genomic DNA, or can be recombinantly expressed. An antigen and / or epitope can be of exogenous origin. An antigen and / or epitope can possess modifications to the amino acids comprising the antigen and / or epitope if of polypeptide origin (e.g. phosphorylation, glycosylation, cysteinylation, deamidation, and / or other post-translational modifications to the amino acids within the antigen and / or epitope). An antigen and / or an epitope can be specific to a certain tissue, such as a cancer cell, or it can be broadly expressed. In addition, fragments of larger molecules can act as antigens. In some embodiments herein, antigens are tumor antigens. An epitope can be present in a longer polypeptide (e.g., in a protein), or an epitope can be present as a fragment of a longer polypeptide. In some embodiments, an epitope is complexed with a major histocompatibility complex (MHC; also referred to herein as a HLA molecule, e.g., a HLA class I or class II molecule). In some embodiments, the antigen is a COL6A3-derived antigen as disclosed herein. In some embodiments, the antigen is an amino acid sequence comprising SEQ ID NO: 3 or 4. In some embodiments, the antigen is encoded by SEQ ID NO: 74 or 75. In some embodiments, the antigen is encoded by part or all of SEQ ID NO: 47 or 48. In some embodiments, the antigen is encoded (e.g. in the appropriate translation frame) by SEQ ID NO: 42.

[0282] TCRs bind, via their CDR loops, to peptides presented by molecules of the major histocompatibility complex (MHC). This TCR-MHC interaction is crucially important in cell-mediated immunity, with the specificity in the cellular immune response being attributable to MHC polymorphism, an extensive TCR repertoire, and a variable peptide cargo. The conventional T-cell response is mediated by TCR recognition of short peptide fragments bound to MHC class I or MHC class II molecules. Generally, MHC- I molecules present peptides derived from endogenous protein that are recognized by cytotoxic T-cells, whereas MHC-II molecules present exogenously-derived peptides to T helper cells (see e.g. Bhati et al., Protein Science, 23:260-272 (2014), which is hereby incorporated by reference in its entirety).

[0283] The term “HLA” as used herein, refers to the human leukocyte antigen. In humans, MHCs are encoded by the human leukocyte antigen (HLA) locus on chromosome 6. Accordingly, the terms “HLA” and “MHC” may be used interchangeably herein. There are three major HLA gene loci (HLA-A, HLA-B and HLA-C) and three minor loci (HLA-E, HLA-F and HLA-G). The chromosome 6 HLA locus is highly polymorphic, spans over 5 mega bases and covers over 200 genes. Individual subjects normally express 6 different classical MHC-I and 6 MHC-II molecules that can differ from each other by a single amino acid, or by more than 30 amino acids. These polymorphisms mostly affect the MHC binding cleft, and thus dictate the diversity of peptides presented by each MHC molecule (Bhati et al., Protein Science, 23:260-272 (2014)). The frequency distribution of most common HLA alleles is publicly available (http: / / www.allelefrequencies.net / top10dist.asp).

[0284] The term “HLA binding peptide” as used herein refers to a peptide that is capable of forming peptide-HLA (pHLA) complexes for presentation to T lymphocytes.

[0285] MHC proteins are expressed on the surface of cells and are involved in activation of the immune response. HLA class I genes encode MHC class I molecules, which are expressed on the surface of cells in complex with peptide fragments (antigens) of self or non-self proteins. T cells expressing TCR and CD3 recognize the antigen:MHC class I complex and initiate an immune response to target and destroy antigen presenting cells displaying non-self proteins.

[0286] As used herein, an “HLA class I molecule” or “MHC class I molecule” refers to a protein product of a wildtype or variant HLA class I gene encoding an MHC class I molecule. Accordingly, “HLA class I molecule” and “MHC class I molecule” are used interchangeably herein.

[0287] MHC class I a-chains are polymorphic, and different a-chains are capable of binding and presenting different peptides. Genes encoding MHC class I a polypeptides are highly variable, with the result that cells from different subjects often express different MHC class I molecules.

[0288] The MHC Class I molecule comprises two protein chains: the alpha chain (a-chain) and the p2- microglobulin (p 2m) chain. Human p 2m is encoded by the B2M gene. The amino acid sequence of p2m is set forth in SEQ ID NO: 76. The alpha chain of the MHC Class I molecule is encoded by the HLA gene complex. The HLA complex is located within the 6p21 .3 region on the short arm of human chromosome 6 and contains more than 220 genes of diverse function. The HLA genes are highly variable, with over 36,000 HLA alleles and related alleles, including over 25,000 HLA Class I alleles, known in the art, encoding thousands of HLA proteins, including over 14,000 HLA Class I proteins (see, e.g., hla.alleles.org). There are at least three genes in the HLA complex that encode a MHC Class I alpha chain protein: HLA-A, HLA-B, and HLA-C. In addition, HLA-E, HLA-F, and HLA-G encode proteins that associate with p 2m chain to form the MHC Class I molecule.

[0289] The term “antigen-presenting cell”, as used herein, designates cells having the capability to present processed antigenic moiety fragments via MHC class I or MHC class II molecules. Most cell types including cancer cells can express MHC class I molecules and present fragments via MHC class I molecules, while MHC class II molecules are expressed on professional antigen presenting cells. Professional antigen-presenting cells may be a B-cell, a monocyte, or a dendritic cell. The antigen presenting cells may be synthetic, or be isolated from peripheral blood mononuclear cells (PBMCs). Artificial APCs are a type of cell line that expresses an HLA molecule of interest for testing TCR binding. The HLA protein can be endogenously expressed, or the artificial APCs can be engineered to express the HLA molecule of interest. Artificial APCs expressing the HLA allele of interest can be loaded with peptides such that the binding of a TCR to a peptide:HLA class I complex can be tested.

[0290] “Antigen-derived”, for example “COL6A3-derived” or “COL6A3 splice variant-derived”, refers to an immunogenic peptide / epitope, being a portion of the antigen / polypeptide from which it has been processed. For example, an antigen is processed in the cell by the proteasome or immunoproteasome and the resulting antigen-derived peptides are presented on the MHC class I or MHC class II complex. In some embodiments, an antigen-binding molecule as described herein, e.g. a TCR or fragment thereof, recognizes and / or binds to a COL6A3-derived peptide. In some embodiments, an antigen-binding molecule as described herein, e.g. a TCR or fragment thereof, recognizes and / or binds to a COL6A3 splice variant-derived peptide. In some embodiments, an antigen-binding molecule as described herein, e.g. a TCR or fragment thereof, recognizes and / or binds to a COL6A3 Exon4 splice variant-derived peptide.

[0291] In some embodiments, the COL6A3-derived or COL6A3 splice variant-derived peptide is SEQ ID NO: 3. In some embodiments, the COL6A3-derived or COL6A3 splice variant-derived peptide is SEQ ID NO: 4. These sequences are derived from a sequence resulting from the inclusion of Exon 4 of COL6A3, as a consequence of alternative splicing.

[0292] For conciseness, hereinbelow a peptide that is presented by an MHC class I molecule comprising an MHC class I a chain polypeptide encoded by a given HLA allele or a HLA allele within a given genus of HLA alleles may be referred to simply as being presented “through” or “on” the relevant allele. For example, a TCR that binds to a COL6A3-derived or COL6A3 splice variant-derived antigenic peptide (e.g. a COL6A3 Exon4 splice variant antigenic peptide) presented by an MHC class I molecule comprising an MHC class I a chain polypeptide encoded by a HLA-A*02 allele may be described as a TCR that binds to a COL6A3-derived or COL6A3 splice variant-derived antigenic peptide presented through / on a HLA-A*02 allele.

[0293] In some embodiments, an antigen-binding molecule as described herein, e.g. a TCR or fragment thereof, is capable of recognizing / binding to a COL6A3 peptide or COL6A3-derived antigen, e.g. when presented by a major histocompatibility complex (MHC) molecule comprising a MHC class I a chain polypeptide encoded by HLA-A*02 (also known as HLA-A2, HLA-A02, and HLA-A*2). That is, when presented on HLA-A*02.

[0294] In some embodiments, an antigen-binding molecule as described herein, e.g. a TCR or fragment thereof, is capable of recognizing / binding to a COL6A3 peptide or COL6A3-derived antigen, e.g. when presented by a major histocompatibility complex (MHC) molecule comprising a MHC class I a chain polypeptide encoded by a HLA-A*02:01 allele. That is, when presented on HLA-A*02:01. In some embodiments, an antigen-binding molecule as described herein, e.g. a TCR or fragment thereof, is capable of recognizing / binding to SEQ ID NO: 3 or 4, e.g. when presented by a major histocompatibility complex (MHC) molecule comprising a MHC class I a chain polypeptide encoded by HLA-A*02 (also known as HLA-A2, HLA-A02, HLA-A-02, and HLA-A*2). That is, when presented on HLA-A*02.

[0295] In some embodiments, an antigen-binding molecule as described herein, e.g. a TCR or fragment thereof, is capable of recognizing / binding to SEQ ID NO: 3 or 4, e.g. when presented by a major histocompatibility complex (MHC) molecule comprising a MHC class I a chain polypeptide encoded by a HLA-A*02:01 allele. That is, when presented on HLA-A*02:01 .

[0296] In some embodiments, an antigen-binding molecule as described herein, e.g. a TCR or fragment thereof, is capable of recognizing / binding to a KLLPYIVGV (SEQ ID NO: 3)-HLA-A*02 complex.

[0297] In some embodiments, an antigen-binding molecule as described herein, e.g. a TCR or fragment thereof, is capable of recognizing / binding to a KLLPYIVGVA (SEQ ID NO: 4)-HLA-A*02 complex.

[0298] In some embodiments, an antigen-binding molecule as described herein, e.g. a TCR or fragment thereof, is capable of recognizing / binding to a KLLPYIVGV (SEQ ID NO: 3)-HLA-A*02:01 complex.

[0299] In some embodiments, an antigen-binding molecule as described herein, e.g. a TCR or fragment thereof, is capable of recognizing / binding to a KLLPYIVGVA (SEQ ID NO: 4)-HLA-A*02:01 complex.

[0300] In some embodiments, an antigen-binding molecule as described herein, e.g. a TCR or fragment thereof, is capable of recognizing / binding to a peptide:MHC complex comprising a MHC class I a chain polypeptide encoded by a HLA-A*02 allele (e.g. HLA-A*02:01), and a peptide comprising or consisting of KLLPYIVGV (SEQ ID NO: 3).

[0301] In some embodiments, an antigen-binding molecule as described herein, e.g. a TCR or fragment thereof, is capable of recognizing / binding to a peptide:MHC complex comprising a MHC class I a chain polypeptide encoded by a HLA-A*02 allele (e.g. HLA-A*02:01), and a peptide comprising or consisting of KLLPYIVGVA (SEQ ID NO: 4).

[0302] The TCRs / antigen-binding molecules described herein may be comprised within multispecific molecules. That is, the present invention provides a multispecific antigen-binding molecule comprising an antigenbinding molecule e.g. TCR described herein. A multispecific antigen-binding molecule may be e.g. bispecific, trispecific, etc. Also provided is the use of a TCR / antigen-binding molecule described herein as part of a fusion construct, wherein said fusion construct comprises a TCR / antigen-binding molecule described herein and an antigen-binding molecule that is capable of binding to a molecule expressed (e.g. specifically expressed) by immune cells, e.g. T cells, including but not limited to CD3.

[0303] In some embodiments, a multispecific antigen-binding molecule according to the present disclosure comprises an antigen-binding molecule e.g. TCR described herein and at least one further antigen- binding molecule that is capable of binding to a molecule expressed by an immune cell. The two or more antigen-binding molecules may be expressed / presented as a fusion construct or fusion protein.

[0304] In some embodiments, a multispecific antigen-binding molecule according to the present disclosure comprises an antigen-binding molecule e.g. TCR described herein and at least one further antigenbinding molecule that is capable of binding to a molecule expressed by a T cell. The molecule expressed by an immune cell / a T cell may be CD3. The molecule expressed by an immune cell / a T cell may be CD4 or CD8. That is, the TCRs / antigen-binding molecules described herein may be used in bispecific T cell engagers (BiTEs) or T cell Engaging Receptors (TCER®). Such multispecific molecules can target immune cells, e.g. via a CD3-binding arm, to diseased cells that are recognised via the TCR moiety.

[0305] In some embodiments, the TCR / antigen-binding molecule described herein and / or the at least one further antigen-binding molecule that is capable of binding to a molecule expressed by an immune cell are single-chain molecules, e.g. in scFv form. The at least two antigen binding molecules may be connected via a linker.

[0306] In some embodiments, the antigen-binding molecule {e.g., the TCR) described herein is a TCR-based chimeric antigen receptor (TCR-CAR). A “TCR-CAR” as referred to herein is a molecule where the variable domains of a TCR recognizing a peptide in the major histocompatibility complex (pMHC) are linked to intracellular domains of chimeric antigen receptors (CARs). The TCR-CAR is capable of recognizing the neoepitope / MHC complex.

[0307] Functional properties of TCRs of the disclosure

[0308] The antigen-binding molecules / TCRs / TCR chains / TCR fragments described herein may be characterised by reference to certain functional properties. In some embodiments, an antigen-binding molecule described herein may possess one or more of the following properties: recognizes and / or binds {e.g. specifically binds) to COL6A3; recognizes and / or binds {e.g. specifically binds) to a COL6A3 splice variant; recognizes and / or binds {e.g. specifically binds) to a COL6A3 Exon4 splice variant; recognizes and / or binds {e.g. specifically binds) to a COL6A3 peptide or COL6A3-derived antigen

[0309] {e.g. antigenic peptide); recognizes and / or binds {e.g. specifically binds) to KLLPYIVGV (SEQ ID NO: 3); recognizes and / or binds {e.g. specifically binds) to KLLPYIVGVA (SEQ ID NO: 4); recognizes and / or binds {e.g. specifically binds) to a COL6A3 or COL6A3 splice variant-derived peptide or antigen {e.g. antigenic peptide) when presented by a major histocompatibility complex (MHC) molecule comprising an MHC class I a chain polypeptide, e.g. encoded by HLA-A*02, e.g. encoded by HLA-A*02:01 ; recognizes and / or binds {e.g. specifically binds) to KLLPYIVGV (SEQ ID NO: 3) when presented by a major histocompatibility complex (MHC) molecule comprising a MHC class I a chain polypeptide, e.g. encoded by HLA-A*02, e.g. encoded by HLA-A*02:01 ; recognizes and / or binds (e.g. specifically binds) to KLLPYIVGVA (SEQ ID NO: 4) when presented by a major histocompatibility complex (MHC) molecule comprising a MHC class I a chain polypeptide, e.g. encoded by HLA-A*02, e.g. encoded by HLA-A*02:01 ; recognizes and / or binds (e.g. specifically binds) to a cell expressing COL6A3, a COL6A3-derived antigen, a COL6A3 splice variant or a COL6A3 Exon4 splice variant; recognizes and / or binds (e.g. specifically binds) to a cell expressing a COL6A3 peptide, a COL6A3-derived antigen, a COL6A3 splice variant peptide or a COL6A3 Exon4 splice variant peptide; recognizes and / or binds (e.g. specifically binds) to a cell presenting KLLPYIVGV (SEQ ID NO: 3), e.g. when presented by a major histocompatibility complex (MHC) molecule comprising a MHC class I a chain polypeptide, e.g. encoded by HLA-A*02, e.g. encoded by HLA-A*02:01 ; recognizes and / or binds (e.g. specifically binds) to a cell presenting KLLPYIVGVA (SEQ ID NO: 4), e.g. when presented by a major histocompatibility complex (MHC) molecule comprising a MHC class I a chain polypeptide, e.g. encoded by HLA-A*02, e.g. encoded by HLA-A*02:01 ; activates a host cell, e.g. T cell, in which a COL6A3 peptide, COL6A3-derived antigen, COL6A3 splice variant peptide, or COL6A3 Exon4 splice variant peptide is comprised / expressed; promotes cell killing activity of a cell in which the COL6A3 peptide, COL6A3-derived antigen, COL6A3 splice variant peptide, or COL6A3 Exon4 splice variant peptide is comprised / expressed; has an ‘anti-cancer’ effect when comprised / expressed in a host cell, e.g. T cell; has an ‘anti-tumor effect when comprised / expressed in a host cell, e.g. T cell; confers cytotoxic activity when comprised / expressed in a host cell, e.g. T cell; and / or promotes IFNy secretion from a host cell, e.g. T cell, in which it is comprised / expressed.

[0310] In some embodiments, an antigen-binding molecule (e.g. TCR) described herein specifically binds to a COL6A3-derived antigen described herein (e.g. COL6A3, a COL6A3 splice variant, a COL6A3 Exon4 splice variant or a peptide represented by SEQ ID NO: 3 or 4). In some embodiments, the antigen-binding molecule specifically binds to a peptide represented by SEQ ID NO: 3 or 4. As used herein “specifically binds” means that the antigen-binding molecule (e.g. TCR) recognizes or binds to a specific peptide or antigen (such as a peptide represented by SEQ ID NO: 3 or 4) but does not substantially recognize or bind other peptides or antigens. In some embodiments, an antigen-binding molecule (e.g. TCR) described herein specifically binds to the peptide or antigen represented by SEQ ID NO: 3 but does not substantially recognize or bind to a peptide or antigen that differs from SEQ ID NO: 3 by at least 1 , 2, or 3 amino acids (e.g. any one of the peptides represented by SEQ ID NOs: 27-31). In some embodiments, an antigenbinding molecule (e.g. TCR) described herein specifically binds to the peptide or antigen represented by SEQ ID NO: 4 but does not substantially recognize or bind to a peptide or antigen that differs from SEQ ID NO: 4 by at least 1 , 2, or 3 amino acids.

[0311] It will be appreciated that a given antigen-binding molecule may display more than one of the properties recited in the preceding paragraphs. A given antigen-binding molecule may be evaluated for the properties recited in the preceding paragraph using suitable assays. For example, the assays may be e.g. in vitro assays, optionally cell-based assays or cell-free assays. In some embodiments, the assays may be e.g. in vivo assays, i.e. performed in non-human animals. In some embodiments, the assays may be e.g. ex vivo assays, i.e. performed using cells / tissue / an organ obtained from a subject. Where assays are cell-based assays, they may comprise treating cells with a given host cell comprising / expressing the antigen-binding molecule / TCR in order to determine whether the host cells / antigen-binding molecule / TCR displays one or more of the recited properties. Assays may employ species labelled with detectable entities in order to facilitate their detection. Assays may comprise evaluating the recited properties following treatment of cells separately with a range of quantities / concentrations of a given host cells / antigen-binding molecule / TCR (e.g. a dilution series). It will be appreciated that the cells preferably express the target antigen for the antigen-binding molecule / TCR ( / .e. a COL6A3, COL6A3 splice variant or COL6A3 Exon4 splice variant peptide, such as those described herein).

[0312] An “anti-tumor effect” as used herein, refers to a biological effect that can present as a decrease in tumor volume, a decrease in the number of tumor cells, a decrease in tumor cell proliferation, a decrease in the number of metastases, an increase in overall or progression-free survival, an increase in life expectancy, or amelioration of various physiological symptoms associated with the tumor. An anti-tumor effect can also referto the prevention of the occurrence of a tumor, e.g., by use of a vaccine.

[0313] In some embodiments, the functionality of TCRs can be assessed by quantification of cytokine secretion in the cell culture media.

[0314] It is well known that cytokines and their signaling pathways exert potent effects on T cell activation, differentiation, and function. Interferon gamma (IFNy) is crucial for Thl differentiation and induction of IFN-y release. In other subsets, IFN-y inhibits the differentiation of Th2 and Th17 cells but has been shown to promote tReg and antigen-specific memory T cell generation (Bishop et al. Front Immunol. 2021 Apr 13). IFNy is a key moderator of cell-mediated immunity with diverse, mainly pro-inflammatory actions on immunocytes and target tissue. Recent studies have shown it may enhance anti-tumor and antiviral effects of CD8 T cells. IFNy is released in large amounts by macrophages, activated CD8 T cells, natural killer T cells, and Th1 CD4 T cells (Bhat et al. Cell Death Dis. 2017 Jun 1 ;8(6):e2836). IFNy secreted by T cells into the culture medium during the cytotoxicity assay can be quantified by ELISA methodology.

[0315] The functionality of TCRs can be assessed using primary human T cells transduced with said TCRs. Peripheral blood mononuclear cells (PBMCs) from healthy donors can be used as a source of primary T cells for the preparation of effector cells, e.g. as described herein. Transduction efficiency can be verified by flow cytometry, e.g. using an anti-mouse TCR antibody to verify that at least 50% of T cells express the transduced TCR.

[0316] The functionality of TCRs can be assessed by quantification of cytotoxicity using a flow cytometry assay, e.g. as described herein. For example, TCR-expressing T cells can be used as effector cells and can be mixed with cells expressing the target peptide (target cells).

[0317] The functionality of TCRs can also be assessed by quantification of cytotoxicity, e.g. using xCelligence impedance readout or other methods known to the skilled person. Nucleic acids and vectors

[0318] Any antigen-binding molecule, e.g. TCR, multispecific antigen-binding molecule or fragment thereof, according to the present disclosure may be encoded by any nucleotide sequence that encodes the required amino acid sequence(s), taking into account codon degeneracy.

[0319] The present disclosure provides nucleic acids, and pluralities of nucleic acids, encoding the TCRs, antigen-binding molecules, polypeptides and polypeptide complexes according to the present disclosure. In some embodiments, the nucleic acid(s) comprise or consist of DNA and / or RNA. In some embodiments, the nucleic acid is a polynucleotide, e.g. a polydeoxyribonucleotide or a polyribonucleotide.

[0320] The present disclosure also provides vectors, plasmids, and pluralities of vectors and / or plasmids containing nucleic acids, and pluralities of nucleic acids, encoding the TCRs, antigen-binding molecules, polypeptides and polypeptide complexes according to the present disclosure.

[0321] Nucleic acids, nucleotide sequences, plasmids and vectors according to the present disclosure may be provided in purified or isolated form, i.e. from other nucleic acids, plasmids, vectors or naturally occurring biological material.

[0322] In some embodiments, the antigen-binding molecule (e.g. TCR or fragment thereof) of the present disclosure comprises a polypeptide or polypeptides encoded by a nucleic acid / nucleotide sequence described herein.

[0323] In some embodiments, the nucleic acid or plurality of nucleic acids comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 5 or an amino acid sequence sharing at least 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO: 5. In some embodiments, the nucleic acid or plurality of nucleic acids comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 9 or an amino acid sequence sharing at least 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO: 9.

[0324] In some embodiments, the nucleic acid or plurality of nucleic acids comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 13 or an amino acid sequence sharing at least 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO: 13. In some embodiments, the nucleic acid or plurality of nucleic acids comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 17 or an amino acid sequence sharing at least 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO: 17.

[0325] In some embodiments, the nucleic acid or plurality of nucleic acids encodes one or more amino acid sequences selected from SEQ ID NOs: 50-53. In some embodiments, the nucleic acid or plurality of nucleic acids comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 50 or an amino acid sequence sharing at least 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO: 50. In some embodiments, the nucleic acid or plurality of nucleic acid comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 51 or an amino acid sequence sharing at least 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO: 51 . In some embodiments, the nucleic acid or plurality of nucleic acids comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 52 or an amino acid sequence sharing at least 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO: 52. In some embodiments, the nucleic acid or plurality of nucleic acid comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 53 or an amino acid sequence sharing at least 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO: 53.

[0326] In some embodiments, the nucleic acid or plurality of nucleic acids comprises the nucleotide sequence of SEQ ID NO: 54 or a nucleotide sequence sharing at least 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO: 54. In some embodiments, the nucleic acid or plurality of nucleic acids comprises the nucleotide sequence of SEQ ID NO: 55 or a nucleotide sequence sharing at least 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO: 55. In some embodiments, the nucleic acid or plurality of nucleic acids comprises the nucleotide sequence of SEQ ID NO: 56 or a nucleotide sequence sharing at least 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO: 56. In some embodiments, the nucleic acid or plurality of nucleic acids comprises the nucleotide sequence of SEQ ID NO: 57 or a nucleotide sequence sharing at least 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO: 57.

[0327] In some embodiments, the nucleic acid or plurality of nucleic acids comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 25 or an amino acid sequence sharing at least 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO: 25. In some embodiments, the nucleic acid or plurality of nucleic acid comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 26 or an amino acid sequence sharing at least 70%, preferably one of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO: 26.

[0328] Any of the nucleotide sequences described herein may be replaced by a codon degenerate nucleotide sequence thereof encoding the amino acid sequence encoded by the reference sequence.

[0329] As used herein, the term “nucleic acid” refers to a polymer comprising multiple nucleotide monomers (e.g., ribonucleotide monomers or deoxyribonucleotide monomers). “Nucleic acid” includes, for example, genomic DNA, cDNA, RNA, mRNA, and DNA-RNA hybrid molecules. Nucleic acid molecules can be naturally occurring, recombinant, or synthetic. In addition, nucleic acid molecules can be single-stranded, double-stranded or triple-stranded. In some embodiments, nucleic acid molecules can be modified. In the case of a double-stranded polymer, “nucleic acid” can refer to either or both strands of the molecule.

[0330] The term “nucleotide sequence”, in reference to a nucleic acid, refers to a contiguous series of nucleotides that are joined by covalent linkages, such as phosphorus linkages (e.g., phosphodiester, alkyl and aryl-phosphonate, phosphorothioate, phosphotriester bonds), and / or non-phosphorus linkages (e.g., peptide and / or sulfamate bonds). In certain embodiments, the nucleotide sequence encoding, e.g., a target-binding molecule linked to a localizing domain is a heterologous sequence (e.g., a gene that is of a different species or cell type origin).

[0331] The terms “nucleotide” and “nucleotide monomer” refer to naturally occurring ribonucleotide or deoxyribonucleotide monomers, as well as non-naturally occurring derivatives and analogs thereof. Accordingly, nucleotides can include, for example, nucleotides comprising naturally occurring bases (e.g., adenosine, thymidine, guanosine, cytidine, uridine, inosine, deoxyadenosine, deoxythymidine, deoxyguanosine, or deoxycytidine) and nucleotides comprising modified bases known in the art.

[0332] Where a nucleotide sequence is disclosed herein, the reverse complement thereof is also expressly contemplated. Moreover, in each instance wherein a nucleotide sequence is disclosed herein, codon degenerate nucleotide sequences thereof encoding the same amino acid sequence are also expressly contemplated. A “codon degenerate nucleotide sequence” of a reference nucleotide sequence refers to a nucleotide sequence having a non-identical nucleotide sequence to the nucleotide sequence of the reference nucleotide sequence but encoding the same amino acid sequence as the amino acid sequence encoded by the reference nucleotide sequence, as a consequence of degeneracy of the genetic code.

[0333] “Encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides ( / .e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the noncoding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA. References herein to antigens being encoded by a nucleotide sequence given in a SEQ ID NO. or transcripts, mean that peptides binding to HLA, or the antigen, can be derived from the corresponding translated protein.

[0334] Unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase “nucleotide sequence that encodes a protein or an RNA” may also include introns to the extent that the nucleotide sequence encoding the protein may, in some version, contain an intron(s).

[0335] In various embodiments, a nucleotide sequence according to the present disclosure encoding one or more antigen binding molecules or polypeptides of the TCR is codon optimized, e.g. for expression in a chosen cell, such as a mammalian cell. The mammalian cell may be an immune cell, such as a T cell, e.g. a human T cell.

[0336] Codon optimization is a common method used to increase the expression of recombinant proteins, especially in the field of biotherapeutics. Its basis lies in the use of synonymous codon mutations in messenger RNA (mRNA) coding regions. Codon optimization is known to maximize protein expression by overcoming expression limitations associated with codon usage. This routine method has been reported to increase protein expression by up to >1000-fold. This method is often applied in order to fine-tune the expression of one of two light chain genes of a bispecific antibody (Mauro, BioDrugs 32;69-81 (2018)). Altering codon usage is possible since the 20 amino acids are encoded by 61 codons. Except for methionine and tryptophane, which are encoded by a single codon each, all other amino acids are specified by two to six redundant codons. Synonymous codon usage is not random, as it varies between different organisms, between different tissues of the same organism, and even between different parts of the same gene (Mauro, BioDrugs 32;69-81 (2018)).

[0337] In some embodiments, any TCR described herein may be expressed as a hybrid TCR construct comprising a nucleotide encoding a human TCRa variable region amino acid sequence and a nucleotide encoding a human TCRp variable region amino acid sequence, along with a nucleotide encoding a mouse TCR constant region comprising alpha constant region of SEQ ID NO: 22 and beta constant region of SEQ ID NO: 23.

[0338] In some embodiments, any TCR described herein may be expressed as a TCR construct comprising a nucleotide encoding a human TCRa variable region amino acid sequence and a nucleotide encoding a human TCRp variable region amino acid sequence, along with a nucleotide encoding a mouse TCR constant region comprising a mutated version of the TCRa constant region of SEQ ID NO: 22 and a mutated version of the TCRp constant region of SEQ ID NO: 23.

[0339] In some embodiments, any TOR described herein may be expressed as a TOR construct comprising a nucleotide encoding a human TCRa variable region amino acid sequence and a nucleotide encoding a human TCRp variable region amino acid sequence, along with a nucleotide encoding a human TCR constant region comprising TCRa constant region of SEQ ID NO: 78 and a TCRp constant region of SEQ ID NO: 79.

[0340] In some embodiments, any TCR described herein may be expressed as a TCR construct comprising a nucleotide encoding a human TCRa variable region amino acid sequence and a nucleotide encoding a human TCRp variable region amino acid sequence, along with a nucleotide encoding a human TCR constant region comprising a mutated version of the TCRa constant region of SEQ ID NO: 78 and a mutated version of the TCRp constant region of SEQ ID NO: 79.

[0341] A TCR, antigen-binding molecule or polypeptide according to the present disclosure may be produced within a cell by translation of RNA encoding the relevant polypeptide(s). A TCR, antigen-binding molecule or polypeptide according to the present disclosure may be produced within a cell by transcription from nucleic acid(s) encoding the relevant polypeptide(s), and subsequent translation of the transcribed RNA. Constituent polypeptides of a TCR or antigen-binding molecule according to the present disclosure may be encoded by different nucleic acids of the plurality of nucleic acids, or by different vectors of the plurality of vectors.

[0342] In some embodiments, a nucleotide sequence encoding an antigen-binding molecule according to the present disclosure, e.g. a TCR or fragment thereof, is comprised / contained within a vector or plasmid. That is, the present disclosure provides a vector or plasmid comprising a nucleotide sequence encoding an antigen-binding molecule according to the present disclosure, e.g. a TCR or fragment thereof.

[0343] As referred to herein, a “vector” may be a nucleic acid molecule used as a vehicle to transfer exogenous nucleic acid into a cell.

[0344] Accordingly, the present disclosure also provides a vector, or plurality of vectors, comprising the nucleic acid or plurality of nucleic acids according to the present disclosure. The vector may facilitate delivery of the nucleic acid(s) encoding a polypeptide according to the present disclosure to a cell. The vector may be an expression vector comprising elements required for expressing a polypeptide according to the present disclosure. The vector may comprise elements facilitating integration of the nucleic acid(s) into the genomic DNA of cell into which the vector is introduced.

[0345] A vector may be a vector for expression of the nucleic acid in a cell ( / .e. an expression vector). Vectors may include a promoter sequence operably linked to a nucleotide sequence encoding a TCR / antigen- binding molecule / polypeptide according to the present disclosure. A vector may also include a termination codon ( / .e. 3’ in the nucleotide sequence of the vector to the nucleotide sequence encoding the polypeptide(s)) and expression enhancers. Any suitable vectors, promoters, enhancers and termination codons known in the art may be used to express a peptide or polypeptide from a vector according to the present disclosure.

[0346] The term “operably linked” may include the situation where nucleic acid encoding a polypeptide according to the present disclosure and regulatory nucleotide sequence(s) (e.g. a promoter and / or enhancers) are covalently linked in such a way as to place the expression of the nucleic acid encoding a polypeptide under the influence or control of the regulatory nucleotide sequence(s) (thereby forming an expression cassette). Thus, a regulatory sequence is operably linked to the selected nucleotide sequence if the regulatory sequence is capable of effecting transcription of the nucleotide sequence. The resulting transcript(s) may then be translated into the desired polypeptide(s).

[0347] “Expression vector” refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operably linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., Sendai viruses, lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.

[0348] Vectors contemplated in connection with the present disclosure include DNA vectors, RNA vectors, plasmids (e.g. conjugative plasmids (e.g. F plasmids), non-conjugative plasmids, R plasmids, col plasmids, episomes), viral vectors (e.g. retroviral vectors, e.g. gammaretroviral vectors (e.g. murine Leukemia virus (MLV)-derived vectors, e.g. SFG vector), lentiviral vectors, adenovirus vectors, adeno- associated virus vectors, vaccinia virus vectors and herpesvirus vectors), transposon-based vectors, and artificial chromosomes (e.g. yeast artificial chromosomes), e.g. as described in Maus et al., Annu Rev Immunol (2014) 32:189-225 and Morgan and Boyerinas, Biomedicines (2016) 4:9, which are both hereby incorporated by reference in their entirety. In some embodiments, a vector according to the present disclosure is a lentiviral vector.

[0349] In some embodiments, a vector is selected based on tropism for a cell type / tissue / organ to which it is desired to deliver the nucleic acid. In some embodiments, a vector is selected based on tropism for a cell type in which it is desired to express the TCR / antigen-binding molecule / polypeptide(s). For example, it may be desired to deliver the nucleic acid / express the TCR / antigen-binding molecule / polypeptide(s) in an immune cell, e.g. a T cell.

[0350] In some embodiments, the nucleic acid is a vector suitable for delivering the nucleic acid encoding the antigen-binding-molecule / TCR as a gene therapy. In some embodiments, the vector is an adeno- associated virus (AAV) vector. Adeno-associated virus vectors and their use in vector gene therapy is reviewed e.g. in Wang et al., Nat. Rev. Drug Discov. (2019) 18: 358-378 and Li and Samulski, Nat. Rev. Genet. (2020) 12: 255-272, both of which are hereby incorporated by reference in their entirety. In some embodiments, a vector may be an adeno-associated virus vector described in Wang et al., Nat. Rev. Drug Discov. (2019) 18: 358-378. In some embodiments, a vector may be an adeno-associated virus vector described in Li and Samulski, Nat. Rev. Genet. (2020) 12: 255-272.

[0351] In some embodiments, a vector may be an adeno-associated viral vector of one of the following serotypes: AAV1 , AAV2, AAV2i8, AAV5, AAV6, AAV8, AAV9, AAV9.45, AAV10 or AAVrh74.

[0352] In some embodiments, a vector may be a lentiviral vector. A “lentivirus” as used herein refers to a genus of the Retroviridae family. Lentiviruses are unique among the retroviruses in being able to infect nondividing cells; they can deliver a significant amount of genetic information into the DNA of the host cell, so they are one of the most efficient methods of a gene delivery vector. HIV, SIV, and FIV are all examples of lentiviruses. Vectors derived from lentiviruses offer the means to achieve significant levels of gene transfer in vivo. pALD lentiviral vectors, for example, can be obtained from Aldevron / Oxgene.

[0353] In some embodiments, the vector may be a eukaryotic vector, i.e. a vector comprising the elements necessary for expression of protein from the vector in a eukaryotic cell. In some embodiments, the vector may be a mammalian vector, e.g. comprising a cytomegalovirus (CMV) or SV40 promoter to drive protein expression.

[0354] In some embodiments a vector comprises modification to increase binding to and / or transduction of a cell-type of interest (i.e. as compared to the level of binding / transduction by the unmodified vector). In some embodiments modification is to a capsid protein.

[0355] In some embodiments a vector comprises a capsid protein comprising a cell-targeting peptide. In some embodiments the cell-targeting peptide is a cell-targeting peptide described in Biining and Srivastava, Molecular Therapy: Methods & Clinical Development (2019) 12: 248-265, which is hereby incorporated by reference in its entirety, e.g. a cell-targeting peptide shown in Table 1 , 2, 3 or 4 thereof.

[0356] In some embodiments a vector comprises a capsid protein comprising substitution at one or more tyrosine residues, e.g. one or more surface-exposed tyrosine residues. In some embodiments, one or more tyrosine residues of the capsid protein are substituted with phenylalanine. In some embodiments a vector comprises a capsid protein in which one or more tyrosine residues are substituted with another amino acid as described in lida et al., Biomed Res Int. (2013) 2013: 974819, which is hereby incorporated by reference in its entirety.

[0357] In some embodiments, a vector may be an adeno-associated virus vector described in Biining and Srivastava, supra. In some embodiments, a vector may be an adeno-associated virus vector described in lida et al., supra.

[0358] SEQ ID NO: 77 herein provides an exemplary expression vector for the delivery and / or expression of TCRs. In some embodiments, a vector is based on SEQ ID NO: 77 herein. In some embodiments, any nucleic acid(s) / nucleotide sequence(s) encoding a TOR can be inserted into the backbone of SEQ ID NO: 77. SEQ ID NOs: 96 and 97 provide the expression vectors for two exemplary TCRs, H22-1 and H22-2. In some embodiments, the expression vector comprises or consists of the nucleotide sequence of SEQ ID NO: 96. In some embodiments, the expression vector comprises or consists of the nucleotide sequence of SEQ ID NO: 97.

[0359] In some embodiments the nucleic acid / vector comprises one or more sequences for controlling expression of the nucleic acid. Accordingly, in some embodiments the nucleic acid / vector comprises a control element for inducible expression of the nucleic acid.

[0360] A sequence for controlling expression of the nucleic acid may provide for expression of the nucleic acid by cells of a particular type or tissue. For example, expression may be under the control of a cell type- or tissue-specific promoter. The term “promoter” as used herein is defined as a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a polynucleotide sequence.

[0361] Promoters for cell type- or tissue-specific expression of a nucleic acid in accordance with the present invention can be selected in accordance with the disease to be treated / prevented. For example, the promoter may drive expression in an immune cell. The promoter may be a tissue-specific promoter, e.g. one which, when operably linked with a polynucleotide encoded or specified by a gene, causes the gene product to be produced in a cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.

[0362] Expression may be under the control of a constitutive promoter, e.g. a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell.

[0363] A sequence for controlling expression of the nucleic acid may provide for expression of the nucleic acid in response to e.g. a given agent / signal. For example, expression may be under the control of an inducible promoter. The agent may provide for inducible expression of the nucleic acid in vivo by administration of the agent to a subject having been administered with a modified cell according to the disclosure, or ex vivo / in vitro by administration of the agent to cells in culture ex vivo or in vitro.

[0364] In some embodiments a nucleic acid or vector according to the present disclosure may employ a conditional expression system for controlling expression of the nucleic acid encoding the antigen-binding- molecule / TCR by cells comprising the nucleic acid / vector. ‘Conditional expression’ may also be referred to herein as ‘inducible expression’, and refers to expression contingent on certain conditions, e.g. the presence of a particular agent. Conditional expression systems are well known in the art and are reviewed e.g. in Ryding et al. Journal of Endocrinology (2001) 171 , 1-14, which is hereby incorporated by reference in its entirety. Methods of producing TCRs

[0365] Disclosed herein is a method of producing a TCR; the method may comprise: 1) identifying and isolating T lymphocytes from a patient or donor, which bind specifically to the antigen or fragment thereof that is bound to the HLA molecule; and / or 2) further identifying the sequence of antigen-binding molecules expressed by these T lymphocytes.

[0366] Provided is a method of producing a TCR; the method may comprise: 1) isolation of PBMCs from patients or matched healthy donors; 2) isolation of antigen-presenting cells and T lymphocytes; 3) stimulation of T lymphocytes with an antigen identified according to a method as defined herein; 4) identifying and isolating T lymphocytes that bind specifically to the shared antigen or fragment thereof that is bound to the HLA molecule; 5) further identifying the sequence of the TCR expressed by these T lymphocytes.

[0367] The method for identifying TCR sequences that bind specifically to one or more antigens identified herein, may comprise one or more of the following steps: a) isolation of antigen-specific T lymphocytes; b) separation of antigen-specific T lymphocytes into individual cells; c) preparation of nucleic acid from antigen-specific T lymphocytes; and d) sequencing to obtain TCR sequences that are antigen-specific.

[0368] Isolation of antigen-specific T lymphocytes may be done by: 1) contacting one or more labelled biomolecules with one or more samples containing peripheral blood from respective patients having the medical condition or from donors, and 2) isolating, from the one or more samples, T lymphocytes that are bound to labelled biomolecules. In some embodiments, the labelled biomolecule may be an HLA multimer and binding would indicate antigen specificity. In some embodiments, the labelled biomolecule may be an antibody that indicates activation of T lymphocytes upon recognition of antigen. For example, when an EBV-specific T lymphocyte encounters an EBV-infected cell, it would be activated to induce surface expression of CDI107 or secrete IFN-y. In some embodiments, the labelled biomolecule may be combinations of single or multiple HLA multimers and antibodies. In some embodiments, there may involve expansion of these antigen-specific cells to facilitate obtaining more material for subsequent steps. The isolated antigen-specific T lymphocytes may consist of a polyclonal population of T lymphocytes that express multiple TCRs (each T lymphocyte expressing different versions of TRA and TRB).

[0369] Separation of antigen-specific T lymphocytes into individual cells, so that the sequences of individual TCRs can be identified, may be accomplished by a number of methods well known to those skilled in the art. These methods include, for example, sorting the population of antigen-specific T lymphocytes into individual cells using a FACs sorter; using microfluidics; using droplet emulsions; or separation may include the addition of barcode sequences to facilitate identification of individual T lymphocytes clones and subsequent pooling of antigen-specific T lymphocytes.

[0370] Preparation of nucleic acid from the antigen-specific T lymphocytes for the isolation of TCR sequences can likewise be accomplished by a number of methods well known to those skilled in the art. Either RNA or DNA may be used as the starting nucleic acid material. The nucleic acid is amplified by PCR to get enough material for isolating TCR sequences. TCR sequences may also be amplified directly from the nucleic acid from antigen-specific T lymphocytes. Amplification of TCR sequences may include generating a gene expression profile of the antigen-specific T lymphocytes to allow prioritization or ranking of TCR sequences.

[0371] Sequencing may be carried out by any number of sequencing modalities including but not limited to, for example, Sanger sequencing or next-generation sequencing to obtain TCR sequences. The sequencing of TCRs may be carried out following the identification of antigen-specific T lymphocytes.

[0372] Alternatively, TCR sequences may be identified through screening a library of yeast or bacteriophages expressing TCRs on their surface. This involves identifying which TCR sequence is able to bind to a shared antigen or fragment thereof that is bound to the HLA molecule.

[0373] Disclosed herein is a nucleic acid encoding a T-cell receptor, wherein the T-cell receptor encoded by the nucleic acid is capable of specifically binding to a shared antigen or fragment thereof, wherein the shared antigen or fragment thereof is bound to an HLA molecule.

[0374] Provided herein is also an isolated T-cell receptor encoded by the nucleic acid as defined herein. In some embodiments, there is provided a T-cell receptor (TCR) that specifically binds to a shared antigen, wherein the shared antigen is bound to an HLA molecule. The shared antigen may be presented on the surface of an antigen-presenting cell or cancer cell.

[0375] Once antigen-specific TCRs against the shared antigen as identified according to the method defined herein have been obtained, then these TCRs are engineered into immune cells, in accordance with methods well known to those of skill in the art, for use in the treatment of a medical condition.

[0376] Soluble TCR for immunotherapy

[0377] The identified TCR sequence can be solubilized by removal of the transmembrane region and cytoplasmic tail of the TCR chains. The interchain stability of the soluble TCR can be stabilized by modifications of the sequences of the TCR chains; for example, residues in TRA and TRB chains can be replaced with cysteine which allow disulphide bonds to be formed between the two chains. These soluble TCRs may be further modified to have additional functionalities that enhance treatment efficacy; for example, fusion to an anti-CD3 single chain variable fragment, which allows recruitment of CD3 T cells. Such methods are well known to persons of skill in the art and can be found, for example, in Walseng et a / Pios One 2015 and Damato et al Cancers (Basel) 2019. In some embodiments, there is provided a solubilised TCR that is fused to an antibody such as a single chain variable fragment. In some embodiments, the single chain variable fragment is an anti-CD3 single chain variable fragment.

[0378] Alternatively, identified TCR sequences may be produced recombinantly by expressing a nucleotide sequence encoding the variable regions of the TCR in a host cell (such as in mammalian Chinese Hamster Ovary cells). With the aid of an expression vector, a nucleic acid containing the nucleotide sequence may be transfected and expressed in a host cell suitable for the production of a soluble TCR.

[0379] The solubilised TCRs of the present invention can also be attached to a detectable label (such as fluorescent labels, radiolabels, enzymes, nucleic acid probes) or a therapeutic agent (such as an immunomodulatory, radioactive isotope, toxin, enzyme, or a cytotoxic agent).

[0380] The solubilised TCRs as defined herein may be glycosylated. The degree of glycosylation may be controlled in vivo, by using particular cell lines for example, or in vitro, by chemical modification. Such modifications are desirable, since glycosylation can improve pharmacokinetics, reduce immunogenicity, and more closely mimic a native human protein.

[0381] Cells comprisinq / expressinq TCRs

[0382] The present disclosure provides a cell, or pluralities / populations of cells, comprising / expressing antigenbinding molecules, e.g. T cell receptors (TCRs). The cell / cells may express or comprise an antigenbinding molecule, e.g. TCR or fragment / chain thereof, according to the present disclosure. The cell / cells may comprise or express nucleic acid encoding an antigen-binding molecule, e.g. TCR or fragment / chain thereof, according to the present disclosure. Such cells may be called TCR-expressing cells. It will be appreciated that a TCR-expressing cell comprises the TCR it expresses. It will also be appreciated that a cell expressing nucleic acid encoding a TCR also expresses and comprises the TCR encoded by the nucleic acid.

[0383] Aspects and embodiments of the present disclosure relate to host cells, and in particular immune cells. It will be appreciated that where cells are referred to herein in the singular ( / .e. ‘a / the cell’), pluralities / populations of such cells are also contemplated.

[0384] In aspects and embodiments of the present disclosure, the cells are primary cells. That is, in some embodiments, the cells are / were isolated directly from living tissue / a living subject. The cells may be from any animal or human. The cells may be mammalian, more preferably human. The cells may be from a human patient.

[0385] In preferred embodiments, the host cell is an immune cell. An “immune cell” may be a cell of hematopoietic origin, e.g. a neutrophil, eosinophil, basophil, dendritic cell, lymphocyte, or monocyte. A lymphocyte may be e.g. a T cell, B cell, NK cell, NKT cell or innate lymphoid cell (ILC), or a precursor thereof. The host cell / immune cell may express e.g. CD3 polypeptides (e.g. CD3y CD3s CD3 or CD36), TCR polypeptides (TCRa or TCRp), CD27, CD28, CD4 or CD8. In some embodiments, the host cell / immune cell is a T cell, e.g. a CD3+ T cell. In some embodiments, the T cell is a CD3+, CD4+ T cell. In some embodiments, the T cell is a CD3+, CD8+ T cell. In some embodiments, the T cell is a T helper cell (TH cell). In some embodiments, the T cell is a cytotoxic T cell (e.g. a cytotoxic T lymphocyte (CTL)). In some embodiments, the immune cell is a cytokine-induced killer (CIK) cell. An antigen-specific T cell may display certain functional properties of a T cell in response to the antigen / antigenic peptide for which the T cell is specific, or in response to a cell comprising / expressing the antigen / antigenic peptide. In some embodiments, the properties are functional properties associated with effector T cells, e.g. cytotoxic T lymphocytes (CTLs). An “activated cytotoxic T cell” referred to herein displays functional properties of an antigen-specific T cell in response to the antigen / antigenic peptide for which the T cell is specific. In some embodiments, the functional properties are associated with the production of inflammatory cytokines or killing of target cells that express the antigen / antigenic peptide.

[0386] In some embodiments, an antigen-specific T cell may display one or more of the following properties: cytotoxicity to a cell comprising / expressing the antigen / peptide thereof for which the T cell is specific; proliferation, IFNy expression, CD107a expression, IL-2 expression, TNFa expression, perforin expression, granzyme expression, granulysin expression, and / or FAS ligand (FASL) expression in response to stimulation with the antigen / peptide thereof for which the T cell is specific, or in response to exposure to a cell comprising / expressing the antigen / peptide thereof for which the T cell is specific.

[0387] Antigen-specific T cells according to the present disclosure express / comprise an antigen-binding molecule / TCR / fragment thereof that is capable of recognising a peptide of the antigen for which the T cell is specific when presented by the appropriate MHC molecule. In some embodiments, the antigen-specific immune cell is a T cell, e.g. a CD3+ T cell. In some embodiments, the T cell is a CD3+, CD4+ T cell. In some embodiments, the T cell is a CD3+, CD8+ T cell. In some embodiments, the T cell is a T helper cell (TH cell)). In some embodiments, the T cell is a cytotoxic T cell (e.g. a cytotoxic T lymphocyte (CTL)). In some embodiments, an antigen-specific immune cell (e.g. an antigen-specific T cell) is specific for an antigen of COL6A3. Such cells may be referred to as COL6A3-specific immune cells (or T cells). A COL6A3-specific immune cell expresses / comprises a receptor (preferably a T cell receptor) capable of recognising a peptide of an antigen of COL6A3 (e.g. when presented by an MHC molecule). In some embodiments, the COL6A3-specific immune cell expresses / comprises a TCR specific for a peptide of a COL6A3 antigen presented by MHC class I. In some embodiments, the COL6A3-specific immune cell expresses / comprises a TCR specific for a COL6A3 splice variant. In some embodiments, the COL6A3- specific immune cell expresses / comprises a TCR specific for a COL6A3 Exon4 splice variant. In some embodiments, the COL6A3-specific immune cell expresses / comprises a TCR specific for KLLPYIVGV (SEQ ID NO: 3) presented by MHC class I. In some embodiments, the COL6A3-specific immune cell expresses / comprises a TCR specific for KLLPYIVGVA (SEQ ID NO: 4) presented by MHC class I.

[0388] Host cells, e.g. immune cells or T cells according to the present disclosure, may be described as “engineered cells” or “genetically engineered cells”. As used herein, an “engineered cell” refers to a cell, e.g. immune cell / T cell, that has been genetically modified as compared to a naturally occurring cell. The term “genetically engineered” or “engineered” refers to a method of modifying the genome of a cell, including, but not limited to, deleting a coding or non-coding region or a portion thereof or inserting a coding region or a portion thereof. In some embodiments, the cell that is modified is a lymphocyte, e.g., a T cell or a modified cell that expresses CD3, which can be obtained from either a patient or a donor. The cell can be modified (e.g. as described herein) to express an exogenous construct, such as, e.g., an antigen-binding molecule / TCR disclosed herein, which can be incorporated into the cell's genome. In some embodiments, the cell is modified to express CD3.

[0389] In some embodiments, the engineered cells have an anti-cancer and / or anti-tumor effect.

[0390] Any host / immune / T cell provided herein may be provided in a “purified”, “substantially purified” or “isolated” form. As used herein, a “substantially purified” cell is a cell that is essentially free of other cell types. A substantially purified cell also refers to a cell which has been separated from other cell types with which it is normally associated in its naturally occurring state. In some instances, a population of substantially purified cells refers to a homogenous population of cells. In other instances, this term refers simply to cells that have been separated from the cells with which they are naturally associated in their natural state, or have been separated / isolated / purified from naturally occurring biological material. In some embodiments, the cells are cultured in vitro. In other embodiments, the cells are not cultured in vitro.

[0391] Cells described herein may comprise a combination of TCRs, e.g. one or more TCRs according to the present disclosure, and optionally one or more further TCRs. The TCRs may be introduced into the cells via the same or different vectors.

[0392] A plurality / population of cells described herein may comprise two or more TCRs, including TCR(s) from the present disclosure. For example, cells within the plurality / population of cells may each comprise two or more TCRs. As another example, different cells within the plurality / population of cells may each comprise at least one TCR, where the TCRs are different to one another. Different TCRs may be individually transduced into different host cells.

[0393] An immune cell comprising an antigen-binding molecule / TCR or a nucleic acid encoding an antigenbinding molecule / TCR according to the present disclosure may be characterised by reference to functional properties of the cells. In some embodiments an immune cell comprising an antigen-binding molecule / TCR or a nucleic acid encoding an antigen-binding molecule / TCR according to the present disclosure displays one or more of the following properties:

[0394] (a) expression of one or more cytotoxic / effector factors (e.g. IFNy, granzyme, perforin, granulysin, CD107a, TNFa, FASL) in response to cells presenting the MHC:peptide complex for which the TCR is specific;

[0395] (b) proliferation / population expansion, and / or growth factor (e.g. IL-2, GM-CSF) expression in response to cells presenting the MHC:peptide complex for which the TCR is specific;

[0396] (c) cytotoxicity to cells presenting the MHC:peptide complex for which the TCR is specific;

[0397] (d) no cytotoxicity ( / .e. same as or below baseline) to cells which do not present the MHC:peptide complex for which the TCR is specific; and (e) anti-cancer activity (e.g. cytotoxicity to cancer cells, tumor growth inhibition, reduction of metastasis, etc.) against cancer-comprising cells presenting the MHC:peptide complex for which the TCR is specific.

[0398] Cell proliferation / population expansion can be investigated by analysing cell division or the number of cells over a period of time. Cell division can be analysed, for example, by in vitro analysis of incorporation of3H-thymidine or by CFSE dilution assay, e.g. as described in Fulcher and Wong, Immunol Cell Biol (1999) 77(6): 559-564, hereby incorporated by reference in its entirety. Proliferating cells can also be identified by analysis of incorporation of 5-ethynyl-2'-deoxyuridine (EdU) by an appropriate assay, as described e.g. in Buck et al., Biotechniques. 2008 Jun; 44(7):927-9, and Sali and Mitchison, PNAS USA 2008 Feb 19; 105(7): 2415-2420, both hereby incorporated by reference in their entirety.

[0399] As used herein, “expression” may be gene or protein expression. Gene expression encompasses transcription of DNA to RNA, and can be measured by various means known to those skilled in the art, for example by measuring levels of mRNA by quantitative real-time PCR (qRT-PCR), or by reporter-based methods. Similarly, protein expression can be measured by various methods well known in the art, e.g. by antibody-based methods, for example by western blot, immunohistochemistry, immunocytochemistry, flow cytometry, ELISA, ELISPOT, or reporter-based methods.

[0400] Cytotoxicity and cell killing can be investigated, for example, using any of the methods reviewed in Zaritskaya et al., Expert Rev Vaccines (2011), 9(6):601-616, hereby incorporated by reference in its entirety. Examples of in vitro assays of cytotoxicity / cell killing assays include release assays such as the51Cr release assay, the lactate dehydrogenase (LDH) release assay, the 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyl tetrazolium bromide (MTT) release assay, and the calcein-acetoxymethyl (calcein-AM) release assay. These assays measure cell killing based on the detection of factors released from lysed cells. Cell killing by a given cell type can be analysed e.g. by co-culturing the test cells with the given cell type and measuring the number / proportion of cells viable / dead after a suitable period of time. Other suitable assays include the xCELLigence real-time cytolytic in vitro potency assay described in Cerignoli et al., PLoS One. (2018) 13(3): e0193498 (hereby incorporated by reference in its entirety).

[0401] Cells may be evaluated for anti-cancer activity by analysis in appropriate in vitro assays or in vivo models of the relevant cancer.

[0402] Methods for producing cells comprising / expressing an antigen-binding molecule / TCR of interest are well known to the skilled person, and generally comprise introducing nucleic acid(s) / vector(s) encoding constituent polypeptide(s) of the antigen-binding molecule / TCR into the cells.

[0403] Such methods may comprise nucleic acid transfer for permanent ( / .e. stable) or transient expression of the transferred nucleic acid. The transfer may involve methods of transfection, transformation or transduction. The term “transfected” or “transformed” or “transduced” as used herein refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell. A ‘transfected’ or ‘transformed’ or ‘transduced’ cell is one which has been transfected, transformed or transduced with exogenous nucleic acid. The cell includes the primary subject cell and its progeny. In some embodiments, following introduction into a cell, nucleic acid(s) encoding the polypeptide(s) of the TCR may be integrated into or form part of the genomic DNA of the cell. In some embodiments, following introduction into a cell nucleic acid(s) encoding the polypeptide(s) may be maintained extra-chromosomally. Suitable methods for introducing nucleic acid(s) / vector(s) into cells include transduction, transfection and electroporation.

[0404] Any suitable genetic engineering platform may be used, and include gammaretroviral vectors, lentiviral vectors, adenovirus vectors, DNA transfection, transposon-based gene delivery and RNA transfection, for example as described in Maus et al., Annu Rev Immunol (2014) 32:189-225, hereby incorporated by reference in its entirety. Methods also include those described e.g. in Wang and Riviere Mol Ther Oncolytics. (2016) 3:16015, which is hereby incorporated by reference in its entirety.

[0405] Methods for generating / expanding populations of cells comprising / expressing the TCR in vitro / ex vivo are well known to the skilled person. Suitable culture conditions ( / .e. cell culture media, additives, stimulations, temperature, gaseous atmosphere), cell numbers, culture periods and methods for introducing nucleic acid(s) / vector(s) encoding polypeptide(s) of interest into cells, etc. can be determined by reference e.g. to WO 2018 / 177966 A1. In some embodiments, a cell / population of cells according to the present disclosure is prepared under GMP (good manufacturing practice; e.g. as described in the guidelines for good manufacturing practice published by the European Commission (Volume 4 of ‘The rules governing medicinal products in the European Union’ contains guidance for the interpretation of the principles and guidelines of good manufacturing practices for medicinal products for human and veterinary use laid down in Commission Directives 91 / 356 / EEC, as amended by Directive 2003 / 94 / EC, and 91 / 412 / EEC, respectively)) conditions.

[0406] Conveniently, cultures of cells according to the present disclosure may be maintained at 37°C in a humidified atmosphere containing 5% CO2. The cells of cell cultures can be established and / or maintained at any suitable density, as can readily be determined by the skilled person. Cultures can be performed in any vessel suitable for the volume of the culture, e.g. in wells of a cell culture plate, cell culture flasks, a bioreactor, etc. In some embodiments cells are cultured in a bioreactor, e.g. a bioreactor described in Somerville and Dudley, Oncoimmunology (2012) 1 (8):1435-1437, which is hereby incorporated by reference in its entirety.

[0407] Introducing nucleic acid(s) into a cell may comprise transduction, e.g. lentiviral transduction. Transduction of immune cells with viral vectors is described e.g. in Simmons and Alberola-lla, Methods Mol Biol. (2016) 1323:99-108, which is hereby incorporated by reference in its entirety.

[0408] Agents may be employed to enhance the efficiency of transduction. Hexadimethrine bromide (polybrene) is a cationic polymer which is commonly used to improve transduction, through neutralising charge repulsion between virions and sialic acid residues expressed on the cell surface. Other agents commonly used to enhance transduction include e.g. the poloxamer-based agents such as LentiBOOST (Sirion Biotech), Retronectin (Takara), Vectofusin (Miltenyi Biotech) and also SureENTRY (Qiagen) and ViraDuctin (Cell Biolabs). In some embodiments the methods comprise centrifuging the cells into which it is desired to introduce nucleic acid encoding polypeptide(s) of the TCR in the presence of cell culture medium comprising viral vector comprising the nucleic acid (referred to in the art as ‘spinfection’). The methods generally comprise introducing a nucleic acid encoding polypeptide(s) of the TCR into a cell and culturing the cell under conditions suitable for expression of the polypeptide(s) by the cell. In some embodiments, the methods comprise culturing immune cells into which nucleic acid encoding the polypeptide(s) has been introduced, in order to expand their number.

[0409] In some embodiments, the methods comprise analysing the cells to confirm successful introduction of the nucleic acid into the cells. In some embodiments, the methods comprise analysing the cells to confirm expression of the polypeptide(s) by the cells (e.g. via evaluation of a detectable entity).

[0410] In some embodiments the methods further comprise separating / isolating / purifying / enriching cells expressing the TCR e.g. from other cells (e.g. cells which do not express the TCR). Methods for purifying / isolating immune cells from heterogeneous populations of cells are well known in the art and may employ e.g. FACS- or MACS-based methods for sorting populations of cells based on the expression of the TCR / constituent polypeptide(s) thereof. In some embodiments, the methods comprise separating / isolating / purifying / enriching cells of a particular type, e.g. CD8+ T cells or CTLs expressing the TCR of interest.

[0411] Methods for producing cells according to the present disclosure may comprise modifying the cells to reduce the expression of a CD3-TCR complex polypeptide. In some embodiments, the methods comprise modifying nucleic acid (e.g. endogenous nucleic acid) encoding the CD3-TCR complex polypeptide. Modification of a given target nucleic acid can be achieved in a variety of ways known to the skilled person, including modification of the target nucleic acid by homologous recombination, and target nucleic acid editing using site-specific nucleases (SSNs).

[0412] Suitable methods may employ targeting by homologous recombination, which is reviewed, for example, in Mortensen Curr Protoc Neurosci. (2007) Chapter 4:Unit 4.29 and Vasquez et al., PNAS 2001 , 98(15): 8403-8410 both of which are hereby incorporated by reference in their entirety. Targeting by homologous recombination involves the exchange of nucleotide sequence through crossover events guided by homologous sequences. Other suitable techniques include nucleic acid editing using SSNs. Gene editing using SSNs is reviewed e.g. in Eid and Mahfouz, Exp Mol Med. 2016 Oct; 48(10): e265, which is hereby incorporated by reference in its entirety. Enzymes capable of creating site-specific double strand breaks (DSBs) can be engineered to introduce DSBs to target nucleotide sequence(s) of interest. DSBs may be repaired by error-prone non-homologous end-joining (NHEJ), in which the two ends of the break are rejoined, often with insertion or deletion of nucleotides. Alternatively, DSBs may be repaired by homology- directed repair (HDR), a high-fidelity mechanism in which a DNA template with ends homologous to the break site is supplied and introduced at the site of the DSB.

[0413] SSNs capable of being engineered to generate target nucleotide sequence-specific DSBs include zinc- finger nucleases (ZFNs), transcription activator- 1 ike effector nucleases (TALENs) and clustered regularly interspaced palindromic repeats / CRISPR-associated-9 (CRISPR / Cas9) systems. ZFN systems are reviewed e.g. in Umov et al., Nat Rev Genet. (2010) 11 (9):636-46, which is hereby incorporated by reference in its entirety. ZFNs comprise a programmable Zinc Finger DNA-binding domain and a DNA- cleaving domain (e.g. a Fokl endonuclease domain). The DNA-binding domain may be identified by screening a Zinc Finger array capable of binding to the target nucleotide sequence. TALEN systems are reviewed e.g. in Mahfouz et al., Plant Biotechnol J. (2014) 12(8):1006-14, which is hereby incorporated by reference in its entirety. TALENs comprise a programmable DNA-binding TALE domain and a DNA- cleaving domain (e.g. a Fokl endonuclease domain). TALEs comprise repeat domains consisting of repeats of 33-39 amino acids, which are identical except for two residues at positions 12 and 13 of each repeat which are repeat variable di-residues (RVDs). Each RVD determines binding of the repeat to a nucleotide in the target DNA sequence according to the following relationship: ‘HD’ binds to C, ‘Nl’ binds to A, ‘NG’ binds to T and ‘NN’ or ‘NK’ binds to G (Moscou and Bogdanove, Science (2009) 326(5959):1501 .). CRISPR / Cas9 and related systems e.g. CRISPR / Cpf1 , CRISPR / C2c1 , CRISPR / C2c2 and CRISPR / C2c3 are reviewed e.g. in Nakade et al., Bioengineered (2017) 8(3):265-273, which is hereby incorporated by reference in its entirety. These systems comprise an endonuclease (e.g. Cas9, Cpf1 etc.) and the single-guide RNA (sgRNA) molecule. The sgRNA can be engineered to target endonuclease activity to nucleotide sequences of interest.

[0414] In some embodiments, modifying nucleic acid (e.g. endogenous nucleic acid) encoding the CD3-TCR complex polypeptide in accordance with the present disclosure employs a site-specific nuclease (SSN) system targeting nucleic acid encoding the CD3-TCR complex polypeptide. The SSN system may be a ZFN system, a TALEN system, CRISPR / Cas9 system, a CRISPR / Cpf1 system, a CRISPR / C2c1 system, a CRISPR / C2c2 system or a CRISPR / C2c3 system.

[0415] In some embodiments, a method for producing a cell according to the present disclosure comprises introducing nucleic acid(s) encoding CRISPR / Cas9 system(s) targeting TRAC, TRBC1 and / or TRBC2 (e.g. TRAC and TRBC1) into a cell. In some embodiments, the nucleic acid(s) encode a CRISPR RNA (crRNA) targeting TRAC, TRBC1 and / or TRBC2 (e.g. TRAC and TRBC1 ; e.g. an exon of TRAC, TRBC1 and / or TRBC2 (e.g. TRAC and TRBC1)) and a trans-activating crRNA (tracrRNA) for processing the crRNA to its mature form.

[0416] Therapeutic and prophylactic applications

[0417] The TCRs, antigen-binding molecules, polypeptides, nucleic acids, vectors, cells, and compositions described herein find use in therapeutic and prophylactic methods.

[0418] The present disclosure provides a TCR, antigen-binding molecule, polypeptide, nucleic acid (or plurality thereof), vector (or plurality thereof), cell (or plurality thereof), or composition described herein for use in a method of medical treatment or prophylaxis. Also provided is a TCR, antigen-binding molecule, polypeptide, nucleic acid (or plurality thereof), vector (or plurality thereof), cell (or plurality thereof), or composition described herein for use as a medicament. Also provided is a TCR, antigen-binding molecule, polypeptide, nucleic acid (or plurality thereof), vector (or plurality thereof), cell (or plurality thereof), or composition described herein for use in a method of treating or preventing a disease or condition described herein. Also provided is the use of a TCR, antigen-binding molecule, polypeptide, nucleic acid (or plurality thereof), vector (or plurality thereof), cell (or plurality thereof), or composition described herein in the manufacture of a medicament for treating or preventing a disease or condition described herein. Also provided is a method of treating or preventing a disease or condition described herein, comprising administering to a subject a therapeutically or prophylactically effective amount of a TCR, antigen-binding molecule, polypeptide, nucleic acid (or plurality thereof), vector (or plurality thereof), cell (or plurality thereof), or composition described herein.

[0419] The methods (of treatment) may be effective to reduce the development or progression of a disease / condition, alleviate the symptoms of a disease / condition or reduce the pathology of a disease / condition. The methods may be effective to prevent progression of the disease / condition, e.g. to prevent worsening of, or to slow the rate of development of, the disease / condition. In some embodiments, the methods may lead to an improvement in the disease / condition, e.g. a reduction in the symptoms of the disease / condition or reduction in some other correlate of the severity / activity of the disease / condition. In some embodiments, the methods may prevent development of the disease / condition to a later stage (e.g. a chronic stage or metastasis).

[0420] In accordance with various aspects of the present disclosure, treatment or prevention of a disease / condition may comprise one or more of the following: reducing the number and / or activity of cells presenting the MHC:peptide complex for which the TCR is specific; cell killing of / cytotoxicity to cells presenting the MHC:peptide complex for which the TCR is specific; and anti-cancer activity (e.g. cytotoxicity to cancer cells, tumor growth inhibition, reduction of metastasis, etc.) against cancer comprising cells presenting the MHC:peptide complex for which the TCR is specific.

[0421] It will be appreciated that antigen-binding molecules of the present disclosure find use in the treatment / prevention of diseases / conditions that would derive therapeutic or prophylactic benefit from a reduction in the number or activity of cells expressing COL6A3-derived antigenic peptides, e.g. cells of a COL6A3-associated cancer.

[0422] For example, the disease / condition may be associated with expression of COL6A3. The disease / condition may be described as a COL6A3-associated disease or condition.

[0423] For example, the disease / condition may be a disease / condition in which a cell comprising a COL6A3 antigen or a cell comprising a peptide of a COL6A3 antigen (e.g. a peptide of a COL6A3 antigen described herein, e.g. a COL6A3 splice variant, or SEQ ID NO: 3 or 4) is pathologically implicated. Such diseases / conditions include those in which a cell comprising a COL6A3 antigen or a cell comprising a peptide of a COL6A3 antigen (e.g. a peptide of a COL6A3 antigen described herein, e.g. a COL6A3 splice variant, or SEQ ID NO: 3 or 4) is positively-associated with the onset, development or progression of the disease / condition, and / or severity of one or more symptoms of the disease / condition, or in which such a cell is a risk factor for the onset, development or progression of the disease / condition. In some embodiments, the disease / condition to be treated / prevented in accordance with the present disclosure is a disease / condition characterized by the presence of a cell comprising a COL6A3 antigen or a cell comprising a peptide of a COL6A3 antigen (e.g. SEQ ID NO: 3 or 4). In some embodiments, the disease / condition is characterised by an increased number / proportion / activity of such cells as compared to the number / proportion / activity of such cells observed in the absence of the disease / condition (e.g. in a healthy subject, or in equivalent non-diseased tissue).

[0424] Disclosed herein is a method of treating or preventing a disease or condition in a subject, the method comprising administering a therapeutically or prophylactically effective amount of a TCR, peptide, nucleic acid, expression vector, cell, or composition described herein. In some embodiments, the method comprises administering a therapeutically or prophylactically effective amount of a TCR. In some embodiments, the TCR is a solubilised TCR. In some embodiments, the method comprises administering a therapeutically or prophylactically effective amount of an engineered immune cell expressing a TCR according to the present disclosure.

[0425] There is also provided a TCR (e.g. a solubilised TCR) or an engineered immune cell for use in treatment of the medical condition. Also provided is the use of a solubilised TCR or an engineered immune cell as defined herein in the manufacture of a medicament for the treatment of the medical condition.

[0426] The term “administering” refers to contacting, applying, or providing a suitable therapy to a subject suffering from a medical condition. The medical condition may be a cancer, and the suitable therapy may be any one of a number of anti-cancer immunotherapies.

[0427] The term “treating” as used herein may refer to (1) preventing or delaying the appearance of one or more symptoms of the disorder; (2) inhibiting the development of the disorder or one or more symptoms of the disorder; (3) relieving the disorder, i.e., causing regression of the disorder or at least one or more symptoms of the disorder; and / or (4) causing a decrease in the severity of one or more symptoms of the disorder.

[0428] Also provided herein is the use, optionally in vitro, of a TCR, peptide, nucleic acid, plurality of nucleic acids, expression vector, plurality of expression vectors, or cell according to the present disclosure to deplete, or increase killing of, cells expressing COL6A3 or a COL6A3-derived antigen. In some embodiments, the COL6A3-derived antigen is a COL6A3 splice variant (or COL6A3 splice variant-derived antigen), a COL6A3 Exon4 splice variant (or COL6A3 Exon4 splice variant-derived antigen) or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4.

[0429] Also provided herein is a method for detecting COL6A3 or a COL6A3-derived antigen in a sample, the method comprising contacting a sample containing, or suspected of containing COL6A3 or the COL6A3- derived antigen with a T cell receptor or a cell disclosed herein and detecting the formation of a complex of the T cell receptor or cell with COL6A3 or the COL6A3-derived antigen. In some embodiments, the COL6A3-derived antigen is a COL6A3 splice variant (or COL6A3 splice variant-derived antigen), a COL6A3 Exon4 splice variant (or COL6A3 Exon4 splice variant-derived antigen) or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4.

[0430] Also provided herein is a method for detecting immune cells that bind specifically to COL6A3 or a COL6A3-derived antigen in a sample, the method comprising contacting a sample containing, or suspected of containing, immune cells with the COL6A3 or COL6A3-derived antigen and detecting the formation of a complex of said cells and the COL6A3 or COL6A3-derived antigen. In some embodiments, the COL6A3-derived antigen is a COL6A3 splice variant (or COL6A3 splice variant-derived antigen), a COL6A3 Exon4 splice variant (or COL6A3 Exon4 splice variant-derived antigen) or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4.

[0431] Also provided herein is the use of a TCR, peptide, nucleic acid, plurality of nucleic acids, expression vector, plurality of expression vectors or cell according to the present disclosure as an in vitro or in vivo diagnostic or prognostic agent.

[0432] Also provided herein is a method of selecting or stratifying a subject for treatment with a COL6A3 (or COL6A3-derived antigen) targeted agent, the method comprising contacting, in vitro, a sample from the subject with a TCR or cell according to the present disclosure and detecting the formation of a complex of the T cell receptor or cell with COL6A3 or a COL6A3-derived antigen. In some embodiments, the COL6A3-derived antigen is a COL6A3 splice variant (or COL6A3 splice variant-derived antigen), a COL6A3 Exon4 splice variant (or COL6A3 Exon4 splice variant-derived antigen) or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4.

[0433] Also provided herein is a method of characterising a cancer in a subject, the method comprising determining the level of COL6A3 or a COL6A3-derived antigen in a sample obtained from the subject, wherein an increased level of COL6A3 or a COL6A3-derived antigen as compared to a reference characterises the cancer as one that is associated with the expression of the COL6A3 or COL6A3- derived antigen. In some embodiments, the COL6A3-derived antigen is a COL6A3 splice variant (or COL6A3 splice variant-derived antigen), a COL6A3 Exon4 splice variant (or COL6A3 Exon4 splice variant-derived antigen) or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4.

[0434] The term “sample” (or “test samples”) includes tissues, cells, body fluids and isolates thereof, etc., isolated from a subject, as well as tissues, cells, and fluids, etc. present within a subject ( / .e., the sample is in vivo). Examples of samples include whole blood, blood fluids (e.g., serum and plasm), lymph and cystic fluids, sputum, stool, tears, mucus, hair, skin, ascitic fluid, cystic fluid, urine, nipple exudates, nipple aspirates, sections of tissues such as biopsy and autopsy samples, frozen sections taken for histologic purposes, archival samples, explants and primary and / or transformed cell cultures derived from patient tissues etc. “reference” as referred to herein may be one or more samples taken from cell(s) or tissue(s) that are not affected by a medical condition (e.g.: non-cancerous cells or non-tumor cells) taken from the subject having the medical condition (for example, a matched sample), or one or more samples taken from another subject (e.g.: a healthy subject who does not suffer from the medical condition). The reference may also be a pre-determined value or an average value of more than one measurement of the sample, such as an expression level of a transcript in the sample.

[0435] Cancer

[0436] The medical condition as referred to herein can be a cancer. The terms “cancer” and “cancerous” refer to or describe the physiological condition in mammals that is typically characterized in part by unregulated cell growth. As used herein, the term “cancer” refers to non-metastatic and metastatic cancers, including early stage and late-stage cancers. By “non-metastatic” is meant a cancer that remains at the primary site and has not penetrated into the lymphatic or blood vessel system or to tissues other than the primary site. The term "metastatic cancer” refers to cancerthat has spread or is capable of spreading from one part of the body to another. Generally, a non-metastatic cancer is any cancerthat is a Stage 0, I, or II cancer, and occasionally a Stage III cancer. A metastatic cancer, on the other hand, is usually a stage IV cancer.

[0437] A cancer may be any unwanted cell proliferation (or any disease manifesting itself by unwanted cell proliferation), neoplasm or tumor or increased risk of or predisposition to the unwanted cell proliferation, neoplasm, or tumor. The cancer may be benign or malignant and may be primary or secondary (metastatic). A neoplasm or tumor may be any abnormal growth or proliferation of cells and may be located in any tissue. Examples of tissues include the adrenal gland, adrenal medulla, anus, appendix, bladder, blood, bone, bone marrow, brain, breast, cecum, central nervous system (including or excluding the brain) cerebellum, cervix, colon, duodenum, endometrium, epithelial cells (e.g. renal epithelia), gallbladder, oesophagus, glial cells, heart, ileum, jejunum, kidney, lacrimal glad, larynx, liver, lung, lymph, lymph node (including abdominal lymph node, axillary lymph node, cervical lymph node, inguinal lymph node, mediastinal lymph node, pelvic lymph node, periaortic lymph node), lymphoblast, maxilla, mediastinum, mesentery, myometrium, nasopharynx, omentume, oral cavity, ovary, pancreas, parotid gland, peripheral nervous system peritoneum, pleura, prostate, salivary gland, sigmoid colon, skin, small intestine, soft tissues, spleen, stomach, testis, thymus, thyroid gland, tongue, tonsil, trachea, uterus, vulva, white blood cells.

[0438] A “cancer” can comprise any one or more of the following or a combination thereof: acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), adrenocortical cancer, adrenal cancer, anal cancer, astrocytoma, bladder cancer, blood cancer, bone cancer, bone marrow tumor, brain tumor, brain stem nerve gliomas, breast cancer, cancer of the female genital system, cancer of the male genital system, central nervous system lymphoma, cervical cancer, childhood rhabdomyosarcoma, childhood sarcoma, chronic or acute leukemia, chronic lymphocytic leukemia (CLL), chronic myeloid leukemia (CML), CNS tumor, colon and rectal cancer, colon cancer, cutaneous or intraocular melanoma, endocrine cancer, endometrial cancer, endometrial sarcoma, esophageal cancer, eye cancer, fallopian tube carcinoma, gallbladder cancer, gastric (or stomach) cancer, gastrointestinal tract cancer, glioma, glioblastoma multiforme, hairy cell leukemia, head and / or neck cancer, hepatocellular cancer, Hodgkin's disease, hypopharyngeal cancer, Kaposi's sarcoma, kidney cancer, large intestinal cancer, laryngeal cancer, leukemia, liver cancer, lung cancer, lymphocytic lymphoma, malignant fibrous histiocytoma, malignant thymoma, melanoma, mesothelioma, multiple myeloma, myeloma, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, nervous system cancer, neuroblastoma, non-Hodgkin's lymphoma, oral cancer, oral cavity cancer, oropharyngeal cancer, osteosarcoma, ovarian cancer, pancreatic cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pituitary adenoma, pituitary tumor, plasma cell neoplasm, primary CNS lymphoma, prostate cancer, rectal or colorectal cancer, renal cell carcinoma, renal pelvic carcinoma, respiratory system, retinoblastoma, salivary gland cancer, skin cancer, small cell lung cancer, small intestine cancer, soft tissue sarcoma, stomach cancer, stomach cancer, squamous cell carcinoma, testicular cancer, thyroid cancer, urinary system cancer, ureter cancer, urethral cancer, uterine sarcoma, uveal melanoma (also known as intraocular melanoma), vaginal cancer, vascular system, vulval cancer, Waldenstrom's macroglobulinemia and Wilms' tumor.

[0439] In some embodiments, the cancer is breast cancer, head and neck cancer, gastric cancer, or colorectal cancer. In some embodiments, the cancer is breast cancer. In some embodiments, the cancer is gastric cancer. In some embodiments, the cancer is head and / or neck cancer (for example head and neck squamous carcinoma). In some embodiments, the cancer is colorectal cancer.

[0440] In some embodiments, the cancer is one that is characterized by the expression or overexpression of COL6A3 or a COL6A3-derived antigen. In some embodiments, the COL6A3-derived antigen is a COL6A3 splice variant (or COL6A3 splice variant-derived antigen), a COL6A3 Exon4 splice variant (or COL6A3 Exon4 splice variant-derived antigen) or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4.

[0441] In some embodiments, the cancer is one that is characterized by the expression or overexpression of a COL6A3 splice variant in which Exon4 of COL6A3 has been included (e.g., as a result of alternative splicing).

[0442] The cancer may be found in any location of the body but is defined by the expression or overexpression of COL6A3, a COL63 splice variant, a COL6A3 splice variant in which Exon4 of COL6A3 has been included, or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4.

[0443] The identification of COL6A3, a COL63 splice variant, a COL6A3 splice variant in which Exon4 of COL6A3 has been included, or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4. in a particular cancer type (e.g., gastric cancer) may help to characterise other cancer types (e.g., head and neck or colon cancer) that are associated with the expression of the same antigen. This may help development of diagnostic tests or treatments across the different cancer types that are associated with the expression of the antigen.

[0444] Thus, in some embodiments, the cancer has been determined to express or overexpress COL6A3, a COL63 splice variant, or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4. In some embodiments, the cancer has been determined to express or overexpress a COL6A3 splice variant in which Exon 4 of COL6A3 has been included. In some embodiments, the cancer is in a subject that has been determined to have an increased level of T lymphocytes that bind specifically to COL6A3, a COL6A3 splice variant, or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4. In some embodiments, the cancer is in a subject that has been determined to have an increased level of T lymphocytes that bind specifically to a COL6A3 splice variant in which Exon 4 has been included.

[0445] Disclosed herein is a method of treating a cancer associated with the expression of a COL6A3 splice variant, the method comprising administering a solubilised TCR or an engineered immune cell expressing a TCR as defined herein to a subject to treat the cancer in the subject.

[0446] Also disclosed herein is an antigen-binding molecule (e.g., a TCR) for use in a method of treating a cancer, wherein the antigen-binding molecule binds to COL6A3, a COL6A3-derived antigen, a COL6A3 splice variant (such as a COL6A3 Exon4 splice variant), or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4.

[0447] Also disclosed herein is a method of treating a medical condition, the method comprising administering an immunomodulatory composition as defined herein.

[0448] As used herein, the term "immunomodulatory composition" may refer to a composition that is capable of modulating the immune system of an animal. The immunomodulatory composition may comprise an antigen (e.g. a COL6A3-derived antigen) or one or more HLA binding peptides identified herein which are capable of stimulating the expansion of T lymphocytes and / or generating an antibody to one or more of the HLA binding peptide(s), wherein the HLA binding peptide is bound to an HLA molecule. The immunomodulatory composition may comprise either a single or a plurality of nucleic acid or peptide sequences. The immunomodulatory composition may have immunostimulatory properties that may be further enhanced through 1) modification of the protein / nucleic acid sequences and / or conjugation techniques; or 2) expression in a viral or bacterial host that are familiar to a person skilled in the art.

[0449] In some embodiments, the immunomodulatory composition as defined herein comprises an adjuvant. The adjuvant is a substance that increases the immunological response of the subject to the immunomodulatory composition. Suitable adjuvants include, but are not limited to, aluminium hydroxide (alum), immunostimulating complexes (ISCOMS), non-ionic block polymers or copolymers, cytokines (like IL-1 , IL-2, IL-7, IFN- a, IFN-p, IFN-y, etc.), saponins, monophosphoryl lipid A (MLA), muramyl dipeptides (MDP) and the like. Other suitable adjuvants include, for example, aluminium potassium sulphate, heat- labile or heat-stable enterotoxin isolated from Escherichia coli, cholera toxin or the p subunit thereof, diphtheria toxin, tetanus toxin, pertussis toxin, Freund's incomplete or complete adjuvant, etc. Toxinbased adjuvants, such as diphtheria toxin, tetanus toxin and pertussis toxin may be inactivated prior to use, for example, by treatment with formaldehyde.

[0450] In some embodiments, the immunomodulatory composition as defined herein comprises an antigen- presenting cell and one or more HLA binding peptides or antigens (e.g. a COL6A3-derived antigen) identified herein. For example, dendritic cells from a subject with cancer may be isolated and one or more antigens may be presented on the surface of dendritic cells ex vivo. These dendritic cells loaded with one or more HLA binding peptides identified herein may then be administered in the subject with the medical condition to induce an immune reaction. In some embodiments, the dendritic cells can be engineered to express the antigen identified herein.

[0451] In some embodiments, the immunomodulatory composition comprises one or more peptides comprising or consisting of the amino acid sequence of SEQ ID NO: 3 or 4. In some embodiments, the immunomodulatory composition comprises an antigen-presenting cell and one or more peptides comprising or consisting of the amino acid sequence of SEQ ID NO: 3 or 4. In some embodiments, the immunomodulatory composition comprises one or more peptides encoded by the nucleotide sequence of SEQ ID NO: 42, 47, 48, 74 or 75. In some embodiments, the immunomodulatory composition comprises an antigen-presenting cell and one or more peptides encoded by the nucleotide sequence of SEQ ID NO: 42, 47, 48, 74 or 75. In some embodiments, the immunomodulatory composition comprises one or more antigen-binding molecules (e.g. TCRs or fragments thereof) disclosed herein.

[0452] Also disclosed herein is a method of treating a cancer associated with the expression of a COL6A3 splice variant, the method comprising administering an immunomodulatory composition as defined herein to a subject to treat the cancer in the subject.

[0453] Also disclosed herein is a method of stimulating an immunomodulatory or immune response in a subject with cancer, wherein the method comprises administering to the subject an effective amount of an immunomodulatory composition disclosed herein, an antigen-binding molecule (e.g. TCR or fragment thereof) disclosed herein, or a pharmaceutical composition disclosed herein under conditions and for a sufficient time to stimulate the immunomodulatory response in the subject.

[0454] Also disclosed herein is a method of treating a subject with cancer, the method comprising administering an antigen-binding molecule (e.g. TCR or fragment thereof) disclosed herein, or an immunomodulatory composition disclosed herein.

[0455] In certain embodiments of the methods disclosed herein, the subject may have been determined to have cancer. In some embodiments, the subject may have been determined to express or overexpress COL6A3, a COL6A3-derived antigen, a COL6A3 splice variant (e.g., the COL6A3 Exon4 splice variant), or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4.

[0456] Determining whether a subject has a cancer which expresses or overexpresses COL6A3, a COL6A3- derived antigen, a COL6A3 splice variant (e.g., the COL6A3 Exon4 splice variant), or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4 may involve, for example, RNA sequencing.

[0457] Also provided herein is a method of killing target cells in a subject, the method comprising administering to the subject an effective amount of a TCR, nucleic acid, expression vector, cell, or composition described herein. The target cells (e.g. cancer cells) may express or overexpress COL6A3. In some embodiments, the target cells express or overexpress a COL6A3-derived antigen. In some embodiments, the target cells express or overexpress a COL6A3 splice variant. In some embodiments, the target cells express or overexpress a COL6A3 Exon4 splice variant. In some embodiments, the target cells express or overexpress a peptide having the amino acid sequence of SEQ ID NO: 3 or 4.

[0458] Also provided herein is a method of eliciting an immune response in a subject, the method comprising administering to the subject an effective amount of a TCR, nucleic acid, expression vector, cell, or composition described herein. In some embodiments, the subject has a cancerthat expresses or overexpresses COL6A3. In some embodiments, the cancer expresses or overexpresses a COL6A3- derived antigen. In some embodiments, the cancer expresses or overexpresses a COL6A3 splice variant. In some embodiments, the cancer expresses or overexpresses a COL6A3 Exon4 splice variant. In some embodiments, the cancer expresses or overexpresses a peptide having the amino acid sequence of SEQ ID NO: 3 or 4.

[0459] Patient / subject

[0460] The subject or patient to be treated may be any animal or human. The subject is preferably mammalian, more preferably human. The subject may be a non-human animal, but more preferably human. The subject may be male or female. The subject may be a patient. Therapeutic uses may be in humans or animals (veterinary use).

[0461] The terms “patient”, “subject”, “host” or “individual”, used interchangeably herein, refer to any subject, particularly a vertebrate subject, and even more particularly a mammalian subject, for whom therapy or prophylaxis is desired. Suitable vertebrate animals that fall within the scope of the invention include, but are not restricted to, any member of the phylum Chordata including primates (e.g., humans, monkeys and apes, and includes species of monkeys such as from the genus Macaca (e.g., cynomolgus monkeys such as Macaca fascicularis, and / or rhesus monkeys (Macaca mulatta)) and baboon (Papio ursinus), as well as marmosets (species from the genus Callith rix) , squirrel monkeys (species from the genus Saimiri) and tamarins (species from the genus Saguinus), as well as species of apes such as chimpanzees (Pan troglodytes)), rodents (e.g., mice rats, guinea pigs), lagomorphs (e.g., rabbits, hares), bovines (e.g., cattle), ovines (e.g., sheep), caprines (e.g., goats), porcines (e.g., pigs), equines (e.g., horses), canines (e.g., dogs), felines (e.g., cats), avians (e.g., chickens, turkeys, ducks, geese, companion birds such as canaries, budgerigars etc.), marine mammals (e.g., dolphins, whales), reptiles (e.g., snakes, frogs, lizards etc.), and fish. In some embodiments, the subject is human.

[0462] In certain embodiments of the methods disclosed herein, the subject may be selected in accordance with one or more clinical parameters. For example, the one or more clinical parameters may include parameters related to the medical condition (such as disease subtype, for example tumor type, or disease progression status), or HLA subtype.

[0463] Pharmaceutical compositions and therapeutic applications

[0464] The present disclosure also provides compositions comprising the TCRs, antigen-binding molecules, polypeptides, nucleic acids, vectors, and cells described herein. The polypeptides, polypeptide complexes, nucleic acids, expression vectors and cells described herein may be formulated as pharmaceutical compositions or medicaments for clinical use. Pharmaceutical compositions may be prepared using a pharmaceutically acceptable “carrier” composed of materials that are considered safe and effective. “Pharmaceutically acceptable” refers to molecular entities and compositions that are “generally regarded as safe” (GRAS), e.g., that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset and the like, when administered to a human. In some embodiments, this term refers to molecular entities and compositions approved by a regulatory agency of the US federal or a state government, such as the GRAS list under section 204(s) and 409 of the Federal Food, Drug and Cosmetic Act, that is subject to premarket review and approval by the FDA or similar lists, the U.S. Pharmacopeia or another generally recognized pharmacopeia for use in animals, and more particularly in humans.

[0465] The term “carrier” refers to diluents, binders, lubricants and disintegrants. Those with skill in the art are familiar with such pharmaceutical carriers and methods of compounding pharmaceutical compositions using such carriers.

[0466] The pharmaceutical compositions provided herein may include one or more excipients, e.g., solvents, solubility enhancers, suspending agents, buffering agents, isotonicity agents, antioxidants, or antimicrobial preservatives. When used, the excipients of the compositions will not adversely affect the stability, bioavailability, safety, and / or efficacy of the active ingredients (e.g., a TCR) used in the composition. Thus, the skilled person will appreciate that compositions are provided wherein there is no incompatibility between any of the components of the dosage form. Excipients may be selected from the group consisting of buffering agents, solubilizing agents, tonicity agents, chelating agents, antioxidants, antimicrobial agents, and preservatives.

[0467] Compounds of the invention may be formulated as pharmaceutical compositions for clinical use and may comprise a pharmaceutically acceptable carrier, diluent, or adjuvant. The composition may be formulated for topical, parenteral, intravenous, intramuscular, intrathecal, intraocular, subcutaneous, oral, inhalational, ortransdermal routes of administration which may include injection. Injectable formulations may comprise the selected compound in a sterile or isotonic medium.

[0468] Compounds of the present invention or identified by methods of the present invention may be used in the treatment of tumors and cancer in humans or animals in need of treatment thereof. Preferably, the subject undergoing treatment is a human patient in need of such treatment.

[0469] Kits

[0470] The present disclosure also provides kits of parts. Aspects and embodiments of the present disclosure relate to kits for producing a cell (e.g. an antigen-specific cell) according to the present disclosure. Aspects and embodiments of the present disclosure relate to kits for performing the methods according to the present disclosure. In some embodiments, the kit may have at least one container having a predetermined quantity of a TCR, antigen-binding molecule, polypeptide, nucleic acid, vector, cell or composition described herein. The kit may provide the relevant articles together with instructions (e.g. a protocol) as to how to employ them in accordance with a method described herein.

[0471] In some embodiments, a kit of parts comprises materials for producing a polypeptide according to the present disclosure. In some embodiments, a kit of parts comprises materials for producing a TCR / antigen-binding molecule according to the present disclosure. In some embodiments, a kit of parts comprises materials for producing a cell according to the present disclosure. In some embodiments, a kit of parts comprises materials for producing a composition according to the present disclosure. In some embodiments, the kit of parts may comprise a nucleic acid / plurality or an expression vector / plurality according to the present disclosure, and optionally materials for introducing the nucleic acid / plurality or an expression vector / plurality into a cell.

[0472] In some embodiments, the kit may comprise materials for producing a TCR, antigen-binding molecule, polypeptide, nucleic acid, vector, cell or composition described herein. In some embodiments, the kit of parts may comprise materials for formulating a TCR, antigen-binding molecule, polypeptide, nucleic acid, vector, cell or composition described herein to a pharmaceutical composition / medicament, e.g. in a composition further comprising a pharmaceutically acceptable carrier, diluent, excipient or adjuvant.

[0473] The kit may provide a TCR, antigen-binding molecule, polypeptide, nucleic acid, vector, cell or composition described herein together with instructions for administration to a patient in order to treat a specified disease / condition (e.g. a disease / condition described herein).

[0474] In some embodiments the kit may further comprise at least one container having a predetermined quantity of another therapeutic agent (e.g. as described herein). In such embodiments, the kit may also comprise a second medicament or pharmaceutical composition such that the two medicaments or pharmaceutical compositions may be administered simultaneously or separately such that they provide a combined treatment for the specific disease / condition.

[0475] Kits according to the present disclosure may include instructions for use, e.g. in the form of an instruction booklet or leaflet. The instructions may include a protocol for performing any one or more of the methods described herein.

[0476] Sequence identity

[0477] As used herein, “sequence identity” refers to the percent of nucleotides / amino acid residues in a subject sequence that are identical to nucleotides / amino acid residues in a reference sequence, after aligning the sequences and, if necessary, introducing gaps, to achieve the maximum percent sequence identity between the sequences. Pairwise and multiple sequence alignment for the purposes of determining percent sequence identity between two or more amino acid or nucleic acid sequences can be achieved in various ways known to a person of skill in the art, for instance, using publicly available computer software such as ClustalOmega (Soding, J. 2005, Bioinformatics 21 , 951-960), T-coffee (Notredame et al. 2000, J. Mol. Biol. (2000) 302, 205-217), Kalign (Lassmann and Sonnhammer 2005, BMC Bioinformatics, 6(298)), BLAST (Altschul et al, J. Mol. Biol. 215:403 (1990)), and MAFFT (Katoh and Standley 2013, Molecular

[0478] 5 Biology and Evolution, 30(4) 772-780) software. When using such software, the default parameters, e.g. for gap penalty and extension penalty, are preferably used.

[0479] Sequences

[0480] The features disclosed in the foregoing description, or in the following claims, or in the accompanying drawings, expressed in their specific forms or in terms of a means for performing the disclosed function, or a method or process for obtaining the disclosed results, as appropriate, may, separately, or in any combination of such features, be utilised for realising the invention in diverse forms thereof.

[0481] While the invention has been described in conjunction with the exemplary embodiments described above, many equivalent modifications and variations will be apparent to those skilled in the art when given this disclosure. Accordingly, the exemplary embodiments of the invention set forth above are considered to be illustrative and not limiting. Various changes to the described embodiments may be made without departing from the spirit and scope of the invention.

[0482] For the avoidance of any doubt, any theoretical explanations provided herein are provided for the purposes of improving the understanding of a reader. The inventors do not wish to be bound by any of these theoretical explanations.

[0483] Any section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0484] Throughout this specification, including the claims which follow, unless the context requires otherwise, the words “comprise” and “include”, and variations such as “comprises”, “comprising”, and “including” will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

[0485] It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Ranges may be expressed herein as from “about” one particular value, and / or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by the use of the antecedent “about,” it will be understood that the particular value forms another embodiment. The term “about” in relation to a numerical value is optional and means for example + / - 10%.

[0486] Examples

[0487] Example 1 : The COL6A3 Exon4 splice variant is tumor-specific and overexpressed in multiple cancer types

[0488] COL6A3 contains an alternatively spliced Exon4 that is overexpressed in multiple cancer types. Figure 1 shows the expression level of a splice junction (chr2:237381499-237387582;-) that leads to the inclusion of COL6A3 Exon4 (chr2:237387582-237388184;-) SEQ ID NO 42. Comparing the expression of this splice junction in tumor vs adjacent normal tissue, it is observed that breast cancer, head and neck cancer, gastric cancer and colorectal cancer all show expression of COL6A3 Exon4.

[0489] These results show that the COL6A3 Exon4 splice variant is overexpressed in multiple cancer types.

[0490] Example 2: Identification of cell models that express COL6A3 splice variants

[0491] Multiple COL6A3 splice variants are expressed, particularly in the N-terminal region. There are 3 alternatively splice exons (Exon3, Exon4 and Exon6) as shown in Figure 2A. Amongst these alternatively spliced exons, there have been multiple reports that look at COL6A3 splice variants that include Exon4 and Exon6. Cell lines that expressed COL6A3 splice variants with COL6A3 Exon4 and Exon6 were identified using RT-PCR. Primers were designed that amplified COL6A3 Exon4 (COL6A3_E4_F4: AACCGCCAACCATTGTCACAC (SEQ ID NO: 81), and COL6A3_E5_R1 :

[0492] GAAGTCTCGGATGGCATTGAAG (SEQ ID NO: 82)) and COL6A3 Exon6 (COL6A3_E6_F3: GAGATCGCTTTCGACTCCTCC (SEQ ID NO: 84), and COL6A3_E6_R4:

[0493] GTCGCGCACATAAGGGAAATTG (SEQ ID NO: 85)) splice variants. The positions where these primers bind are shown in Figure 2A. cDNA prepared from cell lines was used for RT-PCR. Figure 2A shows a representation of the COL6A3 Exon4 splice variant, and the positions of the primers used to detect this variant (indicated by triangles).

[0494] After PCR, the PCR products were separated by size on an agarose gel and visualized. The presence of the COL6A3 Exon4 and Exon6 splice variant (113bp and 201 bp, respectively) was confirmed in several cell lines (Figure 2B). Cell lines that express high levels of the COL6A3 Exon4 and Exon6 splice variant include SW982, U87MG and U119MG, whereas PC3 and NCI-H196 express moderate levels of COL6A3 Exon4 and Exon6 splice variant. In contrast MIA PACA2 cells express low levels of the COL6A3 Exon4 and Exon6 splice variant.

[0495] Four cell lines (U87-MG, U118-MG, PC3 and MIA-PACA2) expressing different levels of the COL6A3 Exon4 and Exon6 splice variant were used to determine whether there was presentation of the COL6A3 Exon4 splice variant 9-mer (KLLPYIVGV, SEQ ID NO: 3), 10-mer (KLLPYIVGVA, SEQ ID NO: 4) and Exon6 splice variant peptide (FLLDGSANV, SEQ ID NO: 32) peptides on HLA-A02. HLA alleles present in the cell lines were confirmed by HLA genotyping and are shown in Table 1 below.

[0496] Table 1

[0497] Table 1 shows the intrinsic HLA alleles detected in the cell lines and the engineered HLAs introduced to the cells. The second and third columns refer to HLA-alleles that are endogenously expressed by the cell lines. The final column indicates the HLA-alleles that have been engineered into the cell line using lentiviral transduction.

[0498] U87-MG cells endogenously express HLA-A02, whereas the other cell lines (U118-MG, PC3 and MIA- PACA2) do not endogenously express HLA-A02 and were genetically engineered to express HLA-A02 (Table 2).

[0499] Table 2

[0500] The table below shows the COL6A3 Exon4 splice variant 9-mer, 10-mer peptide and Exon6 splice variant peptide presented by these target cells. The first 3 columns indicate the sequence of the peptide, the HLA-allele that the peptides bind to, and the length of the peptide, respectively. The next 4 columns show the number of copies of the peptide that are presented by HLA molecules on the surface of the target cells, for each cell line. The final column summarizes whether the given peptide was detected in one of the cell lines tested in this screening assay.

[0501] All four cell lines (U87-MG and the HLA engineered cell lines U118-MG, PC3 and MIA-PACA2) were expanded in vitro and used for isolation of HLA-peptide complexes. The use of multiple cell lines with different HLA-alleles and expression level of the COL6A3 Exon4 splice variant allows a more accurate assessment of peptide presentation by HLA. Mass spectroscopy was then performed to detect peptides bound to HLA (Terai et al. (2022)). Briefly, HLA-peptide complexes were isolated from the cell lines using affinity purification with a pan-HLA antibody (W6 / 32), followed by elution of peptides bound to HLA and identification of eluted peptides using mass spectroscopy. Specificity and sensitivity of peptide identification was further increased using heavy isotope labelled peptides and quantification of peptides being investigated. Using this approach, two peptides (9-mer; KLLPYIVGV (SEQ ID NO: 3) and 10-mer; KLLPYIVGVA (SEQ ID NO: 4)) which differ by an additional alanine at the C-terminus for the 10mer peptide, were confirmed to be presented by HLA-A02 on all cell lines tested. The Exon6 splice variant peptide was not detected on any of these target cells even though the Exon6 splice variant was detected in these cell lines. Example 3: Identification of TCRs recognizing the COL6A3 Exon4 splice variant

[0502] TCRs were generated against the HLA-A02 binding 9-mer peptide (SEQ ID NO:3) derived from the COL6A3 Exon4 splice variant, as identified in Example 2. Antigen-specific T cells against COL6A3 Exon4 splice variant 9-mer peptide (SEQ ID NO:3) were generated from naive CD8+ T cells using artificial antigen-presenting cells that present the COL6A3 Exon4 splice variant 9-mer peptide. Briefly, K562 artificial antigen-presenting cells were first treated with mitomycin to inhibit the growth of these cells, before co-culturing with naive CD8+ T cells. Naive CD8+ T cells were isolated from healthy donor PBMCs using EasySep™ Human Naive CD8+ T Cell Isolation Kit II, from STEMCELL Technologies. During the co-culture, a cytokine cocktail was used as follows: Interleukin 21 (30 ng / mL) was added on the initial 3 days, followed by Interleukin 7 and Interleukin 15 (5 ng / mL each) for the remaining culture period. After co-culture, antigen-specific T cells against COL6A3 Exon4 splice variant 9-mer peptide were detected by staining the cells with HLA-A02 tetramers loaded with COL6A3 Exon4 splice variant 9-mer peptide. Single tetramer positive cells were sorted into 96 well plates for TCR sequencing (iRepertoire).

[0503] TCR sequences were then generated using procedures well known to those skilled in the art. Briefly, primers specific for the TCR alpha and beta chains were used for cloning TCR sequences from individual cells. Samples containing amplified TCR sequences were barcoded for TCR sequencing to determine TCR sequences (paired TCR alpha and beta chains from individual T cells). Sequencing data was analysed to identify paired TCR alpha and beta sequences that recognize the COL6A3 Exon4 splice variant 9-mer peptide. 79 TCRs were identified in total.

[0504] Example 4: Generation of COL6A3 TCR expression vectors

[0505] TCRs of Example 3, recognizing the COL6A3 Exon4 splice variant 9-mer peptide, were cloned into expression vectors that could be used for both lentiviral transduction and in vitro mRNA production. TCR expression was driven by an EF1 a promoter (SEQ ID NO: 21), and the human TCR constant regions were replaced with murine TCR constant regions (comprising nucleic acid sequences encoding the amino sequence msTRAC (SEQ ID NO:22) and msTRBC (SEQ ID NO: 23)). A F2A linker (nucleic acid sequences encoding the amino sequence SEQ ID NO: 24) was positioned between the TCR alpha and TCR beta chain for production of individual TCR polypeptides. The TCRs are expressed as a single protein sequence that is post-translationally processed into two separate proteins with the F2A linker.

[0506] Example 5: Generation of COL6A3 TCR expression J76 reporter cell lines

[0507] TCRs of Example 3 were expressed in a J76 reporter cell line that contained a NFAT reporter system to measure TCR activation (described in Rosskopf et al. (2018)). The NFAT reporter system serves as a sensor for TCR signalling, switching on GFP production when the TCRs recognize the peptide / HLA complex. Lentivirus generated from the TCR expression vectors in Example 4 were used to transduce J76 reporter cell lines. Briefly, lentivirus was produced by transfecting HEK293T cells with the TCR expression vector generated in Example 4 together with lentivirus packaging plasmids. Lentiviral supernatants were collected between 24hr and 48hr post-transfection and concentrated. The concentrated lentivirus was then used for cell transduction. Stable TCR-expressing J76 reporter cells were selected using puromycin-containing selection media. These TCR-expressing J76 reporter cells were used for TCR characterization and assessment of TCR function.

[0508] Similarly, cell therapy for cancer treatment can be produced by lentiviral transduction of human immune cells.

[0509] Example 6: Screening of COL6A3 TCRs

[0510] After generating J76 reporter cell lines that expressed TCRs identified in Example 3, an initial screening of these TCRs was done by testing specificity of the TCR response to the COL6A3 Exon4 splice variant 9-mer peptide. J76 reporter cells expressing TCRs identified in Example 3 were co-cultured with T2 cells that had been serum-starved for an hour and loaded with 1) 10 zM; or 2) 100nM COL6A3 Exon4 splice variant 9-mer peptide loaded T2 cells; or 3) T2 cells that were not loaded with peptide. Only TCRs that showed response to 100nM of the COL6A3 Exon4 splice variant 9-mer peptide loaded T2 cells, and no response to T2 cells, were kept.

[0511] Out of the 79 TCRs identified in Example 3, only 3 TCRs (H22-1 , H22-2 and A01) showed a specific response to 100nM loaded COL6A3 Exon4 splice variant 9-mer peptide loaded T2 cells. H22-1 comprises a TCR alpha variable domain (SEQ ID NO: 5) with CDR sequences SEQ ID NOs:6-8, and a TCR beta variable domain (SEQ ID NO: 9) with CDR sequences SEQ ID NOs: 10-12. H22-2 comprises a TCR alpha variable domain (SEQ ID NO: 13) with CDR sequences SEQ ID NOs: 14-16 and a TCR beta variable domain (SEQ ID NO: 17) with CDR sequences SEQ ID NOs: 18-20. A01 comprises a TCR alpha variable domain (SEQ ID NO: 87) with CDR sequences SEQ ID NOs: 88-90 and a TCR beta variable domain (SEQ ID NO: 91) with CDR sequences SEQ ID NOs: 92-94. Expressed TCR sequences for H22- 1 , H22-2 and A01 correspond to SEQ ID NO: 25, 26 and 95, respectively.

[0512] Example 7: Characterization of COL6A3 TCRs to COL6A3 Exon4 splice variant 9-mer and 10-mer peptide

[0513] Both the COL6A3 Exon4 splice variant 9-mer (SEQ ID NO: 3) and 10-mer (SEQ ID NO: 4) peptides were detected in all target cells (as shown in Example 2). TCRs identified in Example 6 were investigated for their ability to recognize both COL6A3 Exon4 splice variant 9-mer and 10-mer peptides using J76 reporter cells expressing these TCRs. T2 cells, which endogenously express HLA-A02, were serum-starved for an hour and loaded with 10nM of the COL6A3 Exon4 9-mer and 10-mer peptide. These peptide-loaded target cells were then co-cultured with the J76 reporter cells expressing the TCRs. After 24hrs, the percentage of GFP-expressing J76 cells was quantified using FACs analysis and TCR responses to COL6A3 Exon4 splice variant 9-mer and 10-mer peptides were evaluated. Figures 3 show the TCR responses of TCRs identified in Example 6 to the COL6A3 Exon4 splice variant 9-mer and 10-mer peptides. The H22-1 and H22-2 TCRs can respond to these two COL6A3 peptides. TCR A01 shows the strongest response to the COL6A3 Exon4 splice variant 10-mer peptide. Example 8: Characterization of COL6A3 TCR affinity

[0514] The affinity of TCRs identified in Example 6 towards the COL6A3 Exon4 splice variant 9-mer peptide (SEQ ID NO: 3) was tested by using the J76 reporter cells expressing the TCRs. T2 cells, which endogenously express HLA-A02, were serum-starved for an hour and loaded with different concentrations (1 pM to 10pM) of the COL6A3 Exon4 splice variant 9-mer peptide. These T2 cells were then co-cultured with the J76 reporter cells expressing the TCRs identified in Example 6 for 24hrs. The dose responses of these TCRs were determined based on the GFP response of J76 reporter cells, which was quantified by FACs analysis. Figure 4 shows the dose response of the TCRs towards the COL6A3 Exon4 splice variant 9-mer peptide. All TCRs were activated by the COL6A3 Exon4 splice variant 9-mer peptide at low nM concentration and the EC50 for H22-1 , H22-2 and A01 were 8.68nM, 1 ,812nM, and 3.972nM, respectively.

[0515] Example 9: Identification of COL6A3 similar peptides and determination of COL6A3 TCRs response

[0516] NCBI BLAST was used to identify similar peptides to the COL6A3 Exon4 splice variant 9-mer peptide. These similar peptides differed from the COL6A3 Exon4 splice variant 9-mer peptide by 3 amino acids (SEQ ID NOs: 27-31). TCR responses to these peptides were tested using the J76 reporter cells expressing TCRs identified in Example 6. T2 cells were serum-starved for an hour and loaded with 10nM of the original COL6A3 Exon4 splice variant 9-mer peptide (COL6A3), peptides similar to the COL6A3 Exon4 splice variant 9-mer peptide (SEQ ID NOs: 27-31), and an unrelated HLA-A02 binding peptide (SEQ ID NO: 32). Target cells were co-cultured with the J76 reporter cells expressing TCRs identified in Example 6 for 24hrs. The percentages of GFP-expressing J76 cells were quantified using FACs analysis to determine whether TCRs could respond to these peptides that were similar to the COL6A3 Exon4 splice variant 9-mer peptide. Both H22-1 and H22-2 TCRs show no response to these similar peptides (Figures 5A and 5B), whereas A01 TCR shows responses to two of these peptides (SP1 and SP2, Figure 5C). This indicates that there is potential for the A01 TCR to be activated by peptides similar to the COL6A3 Exon4 splice variant 9-mer peptide.

[0517] Example 10: Characterization of COL6A3 TCR specificity

[0518] The specificities of the TCRs identified in Example 6 were tested by using the TCR expressing J76 reporter cells. TCR specificity was determined by using 1) Alanine scanning library - a peptide library consisting of peptides with alanine substitution at each position of the COL6A3 Exon4 splice variant 9- mer peptide (position 1-9, SEQ ID NOs: 33-41) and 2) Positional scanning library - a peptide library consisting of peptides with single amino acid substitutions at each position of the COL6A3 Exon4 splice variant 9-mer peptide.

[0519] To understand which amino acids in the COL6A3 Exon4 splice variant 9-mer peptide are critical for recognition by the TCRs identified in Example 6, these TCRs were screened with alanine scanning library. J76 reporter cells expressing TCRs were co-cultured with target cells loaded with 10nM of peptides from the alanine scanning library (SEQ ID NOs: 33-41), as well as the original COL6A3 Exon4 splice variant 9-mer peptide (SEQ ID NO: 3), for 24hrs. The percentages of GFP responses were quantified using FACs analysis to determine the specificity of the TCRs. Figures 6A, 6B and 6C show the TCR responses to these peptides. The responses of TCRs were affected by alanine substitution at multiple amino acid positions in the peptide, demonstrating that they are specific for the COL6A3 Exon4 splice variant 9-mer peptide. The H22-1 response was greatly affected by alanine substitution at position 1 , 3, 4, 5, 6 and 7, H22-2 was affected by substitution at positions 3, 5, 7 and 8, whereas A01 was affected by substitution at positions 1 , 2, 3, 8 and 9. Based on the results from the alanine substitution experiment, the A01 TCR mainly recognizes the amino acids in the middle of the COL6A3 Exon4 splice variant 9-mer peptide (positions 4-7). The COL6A3 Exon4 splice variant 9-mer similar peptides (SEQ ID NO:27-31) share high sequence homology in this region. The results of Example 9, coupled with these results from the alanine scanning experiment, strongly suggest that A01 is unsuitable as a therapeutic due to the possibility of cross-reactivity to peptides similar to the COL6A3 Exon4 splice variant 9-mer peptide.

[0520] The specificity of the TCR H22-1 TCR was further investigated by testing TCR responses ( / .e. reactivity) to peptides in the positional scanning library. T2 cells were serum-starved for an hour, loaded with 10OnM of peptides in the positional scanning library and co-cultured with J76 cells that expressed the H22-1 TCR. The percentages of GFP responses were quantified using Incucyte SX5 after 48hrs of co-culture. The TCR response of H22-1 TCR to peptides in the positional scanning library is shown in Figure 7A. TCR responses to different peptides at each position were normalized to the original COL6A3 Exon4 splice variant 9-mer peptide; for example, the GFP response for the various amino acid substitutions (19 other amino acids not including Lysine (K) which is present in the original COL6A3 Exon4 9-mer peptide) at position one were normalized to the original COL6A3 Exon4 splice variant 9-mer peptide. The logo-plot (Figure 7B) shows that the H22-1 TCR response is highly dependent on the presence of particular amino acids in positions 5 to 7 ( / .e., the response is restricted to amino acids present at these positions in the logo-plot). For example, H22-1 TCR can respond to isoleucine or valine at position 6, whereas response is restricted to only tyrosine at position 5.

[0521] Example 11 : Production of CIK cells electroporated with COL6A3 TCR mRNA

[0522] Cytokine induced killer (CIK) cells are cytotoxic T cells that can be expanded ex vivo and further transduced with TCR for immunotherapy in oncology. TCRs can be introduced into CIK cell by mRNA electroporation.

[0523] Briefly, mRNA of the COL6A3 H22-1 and H22-2 TCRs were prepared by in vitro transcription and electroporated into cytokine-induced killer (CIK) cells. The mRNA electroporated CIK cells were tested for their ability to recognize and kill target cells that expressed the COL6A3 Exon4 splice variant.

[0524] The COL6A3 H22-1 and H22-2 TCR expression vectors of Example 4 were linearized with a restriction enzyme and used as templates for in vitro transcription (HiScribe T7 ARCA mRNA synthesis kit, NEB). An ARCA cap was incorporated during mRNA synthesis and the polyA tail was added after mRNA synthesis. After mRNA purification, the mRNA was used for electroporation of CIK cells. CIK cells were generated by stimulating PBMCs with interferon-gamma (1000 lU / mL) on Day 0;,and anti- CD3 antibodies (OKT3 100ng / mL) and interleukin-2 (500 lU / mL) on Day 1. After 4 days of culture, cells were diluted to 1x106cells / mL and interleukin-15 (500 lU / mL) was added. This was repeated on Day 8.

[0525] CIK cells were sub-cultured every 2-3 days and fresh media containing interleukin-2 (500 ILI / mL) was added. After 2 weeks of culture, 1x106CIK cells were electroporated with 2 pg of COL6A3 H22-1 and H22-2 TCR mRNA.

[0526] Similarly, mRNA encoding TCRs can be used to transduce immune cells for generating a therapeutic for treating cancer.

[0527] Example 12: Co-culture of COL6A3 TCR-CIK cells with target cells

[0528] The COL6A3 H22-1 and H22-2 TCRs were tested for their ability to recognize and kill target cells that endogenously express the COL6A3 Exon4 splice variant. CIK cells prepared in Example 10 were cocultured with target cells expressing COL6A3 splice variant, as identified in Example 2. Table 3 below shows the target cells that were used for determining the TCR responses of H22-1 and H22-2 TCR-CIK cells and shows the intrinsic HLA alleles in these cell lines.

[0529] Table 3

[0530] Some of the target cells (SW982 and U87-MG) endogenously express HLA-A02 whereas other target cells (U118-MG and PC3) do not. The target cells were engineered to express HLA (either HLA-A02 or HLA-A11 , an irrelevant HLA) as well as a red fluorescent protein to label the target cells. The red fluorescent protein in target cells allows identification / quantification of these cells when co-cultured with CIK cells.

[0531] TCR recognition of its target peptide / HLA triggers the expression of activation markers such as CD69 and CD137 on the surface of T-cells. COL6A3 H22-1 and H22-2 TCR-electroporated CIK cells were cocultured with target cells to determine whether target cells have sufficient amounts of the COL6A3 Exon4 splice variant 9-mer or 10-mer peptide / HLA-A02 complex on their cell surface to activate the CIK cells after co-culture. After 24hrs of co-culture, cells were stained with T-cell markers such as CD8 and CD3 as well as activation markers such as CD69 and CD137, to determine the activation state of CD8+ CIK cells. Figures 8A and 8B show the FACs results from this co-culture experiment. Only CIK cells electroporated with H22-1 and H22-2 TCRs respond to target cells that express the COL6A3 Exon4 splice variant and are HLA-A02 positive ( / .e.: SW982 A2, U87 A2, U118 A2, and PC3 A2). COL6A3 H22-1 TCR shows a stronger response to these target cells compared to H22-2 TCR, as shown by the greater amount of CD137 expressing CD8+ CIK cells.

[0532] TCR recognition of its target peptide / HLA can trigger cell killing of the target cell. However, a certain threshold of TCR signalling is required for effective cell killing. COL6A3 H22-1 and H22-2 TCR mRNA- electroporated CIK cells were co-cultured with target cells to determine whether these TCRs could mediate target cell killing. Figure 9 shows the results of target cell killing after co-culture of target cells with CIK cells. Target cell killing was determined by monitoring the number of target cells expressing red fluorescent protein. For this experiment, target cells listed in Table 3 were co-cultured with control CIK cells (no mRNA electroporation) or CIK cells that were electroporated with either COL6A3 H22-1 or H22-2 TCRs at different effector to target cells ratios (either 5:1 or 10:1 , CIK cells to target cells). The number of target cells was measured at different time points to monitor target cell killing. Specific killing of target cells by H22-1 and H22-2 TCRs can be observed in all HLA-A02+ target cells (SW982 A2, U87 A2, U118 A2 and PC3 A2) and not in HLA-A02- target cells (U118 A11 and PC3 A11 target cells), with varying killing efficiency that corresponds to the expression level of COL6A3 splice variant (SW982 > U87-MG > U118-MG > PC3) (see Figures 2A and 2B). The distinct reduction of target cells was due to the cell killing of H22-1 and H22-2 TCRs, as evidenced by the minimal killing of target cells observed in control CIK cells, which lacked these specific TCRs.

[0533] These results demonstrate that the COL6A3 H22-1 and H22-2 TCRs can be used to develop therapeutics for treating cancers that express the COL6A3 splice variant.

[0534] Example 13: Detection of the COL6A3 Exon4 splice variant for diagnostic purposes

[0535] RNA sequencing can be used for diagnostic purposes to enable identification and / or treatment of subjects that express the COL6A3 Exon4 splice variant.

[0536] The DNA sequence encoding COL6A3 Exon4 in the genome is denoted by SEQ ID NO: 42. Detection of this sequence in cDNA from tumor tissue can be used to identify subjects that express the COL6A3 Exon4 splice variant. cDNA was prepared using RNA extracted from tissue samples and RT-PCR of the COL6A3 Exon4 was performed using primers (COL6A3F: CGTCTTTTGCCTCTTTCTCTCAG (SEQ ID NO: 1) and COL6A3R2: CCATCCACCAGGAAGACTATGTC (SEQ ID NO: 43) that flanked the alternatively spliced Exon4 (Figures 10A and 1 B). The PCR products were resolved by DNA gel electrophoresis and the amplified sequence, which includes the COL6A3 Exon4 PCR product, was identified as a 705bp fragment (SEQ ID NO: 44).

[0537] RNA sequencing data can similarly be used for diagnosis purposes. After RNA sequencing, sequencing reads are mapped onto the reference genome. Sequencing reads that map onto COL6A3 Exon4 (SEQ ID NO: 42) or flanking regions (SEQ ID NO: 45 and SEQ ID NO: 46) can be used to determine expression of the COL6A3 Exon4 splice variant present in transcripts ENST00000392004 (SEQ ID NO: 47) or ENST00000353578 (SEQ ID NO: 48). Figure 11 shows a sashimi plot of sequencing reads that map onto the 3’ region of the COL6A3 gene and is a graphical representation of the density of sequencing reads that map to this region. The number of splice junctions (which indicates COL6A3 Exon4 inclusion), is underlined and sequencing reads that map to COL6A3 Exon 4 (SEQ ID NO: 42) are indicated by the dotted box.

[0538] These results demonstrate how splice variants identified according to the present method may be suitable for use in diagnosis.

[0539] Example 14: Treatment of subjects that express the COL6A3 Exon4 splice variant with a therapeutic TCR

[0540] CIK cells may either be produced from the subject who is being treated or from a donor with matched HLA. CIK cells expressing the COL6A3 H22-1 or H22-2 TCR are scaled up (~1x108cells / Kg) and produced according to Example 10. Lymphodepletion with Fludarabine and Cyclophosphamide is carried out prior to infusion of the CIK cells expressing the COL6A3 H22-1 or H22-2 TCR. Infusion of the CIK cells expressing the COL6A3 H22-1 or H22-2 TCR was used to treat the subject expressing the COL6A3 Exon4 splice variant who was diagnosed as described in Example 12.

[0541] References

[0542] A number of publications are cited above in order to more fully describe and disclose the invention and the state of the art to which the invention pertains. Full citations for these references are provided below. The entirety of each of these references is incorporated herein.

[0543] Altschul et al, J. Mol. Biol. (1990) 215:403

[0544] Bhat et al. Cell Death Dis. (2017) Jun 1 ;8(6):e2836

[0545] Bhati et al., Protein Science (2014) 23:260-272

[0546] Bishop et al. Front Immunol. (2021) Apr 13; vol. 12

[0547] Buck et al., Biotechniques. (2008) Jun; 44(7):927-9

[0548] Biining and Srivastava, Molecular Therapy: Methods & Clinical Development (2019) 12: 248-265

[0549] Cerignoli et al., PLoS One. (2018) 13(3): e0193498

[0550] Damato et al Cancers (Basel) (2019) 11 (7):971

[0551] Davis et al. Annu Rev Immunol. (1998) 16, 523-544

[0552] Davis and Bjorkman (1988) Nature, 334, 395-402

[0553] Eid and Mahfouz, Exp Mol Med. (2016) Oct; 48(10): e265

[0554] Fulcher and Wong, Immunol Cell Biol (1999) 77(6): 559-564 lida et al., Biomed Res Int. (2013) 2013: 974819 Katoh and Standley, Molecular Biology and Evolution (2013) 30(4) 772-780

[0555] Kuball et al, Blood. (2007) Mar 15; 109(6): 2331-2338

[0556] Lassmann and Sonnhammer (2005), BMC Bioinformatics, 6(298)

[0557] Li and Samulski, Nat. Rev. Genet. (2020) 12: 255-272

[0558] Maus et al., Annu Rev Immunol (2014) 32:189-225

[0559] Mauro, BioDrugs (2018) 32;69-81

[0560] Mahfouz et al., Plant Biotechnol J. (2014) 12(8):1006-14

[0561] Morgan and Boyerinas, Biomedicines (2016) 4:9

[0562] Mortensen Curr Protoc Neurosci. (2007) Chapter 4:Unit 4.29

[0563] Moscou and Bogdanove, Science (2009) 326(5959):1501.

[0564] Murphy & Weaver (2017) Janeway’s Immunobiology 9

[0565] Murphy (2012), Janeway’s Immunobiology 8 xix, 868 p.

[0566] Notredame et al. J. Mol. Biol. (2000) 302, 205-217

[0567] Rosskopf S, Leitner J, Paster W, et al. Oncotarget. 2018;9(25):17608-17619

[0568] Ryding et al. Journal of Endocrinology (2001) 171 , 1-14

[0569] Sali and Mitchison, PNAS USA (2008) Feb 19; 105(7): 2415-2420

[0570] Schroeder and Cavacini, J Allergy Clin Immunol (2010) 125(202):S41-S52

[0571] Simmons and Alberola-lla, Methods Mol Biol. (2016) 1323:99-108

[0572] Somerville and Dudley, Oncoimmunology (2012) 1 (8):1435-1437

[0573] Sbding, J. , Bioinformatics (2005) 21 , 951-960

[0574] T cell Receptor Factsbook”, (2001) LeFranc and LeFranc, Academic Press, ISBN 0-1 2-441 352-8

[0575] Terai YL, Huang C, Wang B, et al. Cancers (Basel) (2022);14(5):1243. Published 2022 Feb 28.

[0576] Umov et al., Nat Rev Genet. (2010) 11 (9):636-46

[0577] Vasquez et al., PNAS (2001), 98(15)

[0578] Walseng et al Pios One (2015) 10(4): e0119559

[0579] Wang et al., Nat. Rev. Drug Discov. (2019) 18: 358-378

[0580] Wang and Riviere Mol Ther Oncolytics. (2016) 3:16015

[0581] Zaritskaya et al., Expert Rev Vaccines (2011), 9(6):601-616

[0582] For standard molecular biology techniques, see Sambrook, J., Russel, D.W. Molecular Cloning, A

[0583] Laboratory Manual. 3 ed. 2001 , Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press

Claims

Claims:1 . A T cell receptor, optionally isolated, wherein the amino acid sequence of CDR3a is SEQ ID NO: 8 or 16 and the amino acid sequence of CDR3p is SEQ ID NO: 12 or 20.

2. The T cell receptor of claim 1 , that binds to COL6A3, a COL6A3-derived antigen, a COL6A3 splice variant, or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4.

3. A T cell receptor, optionally isolated, optionally according to claim 1 or 2, wherein the T cell receptor comprises the following CDRs:(a)CDR1a having the amino acid sequence of SEQ ID NO: 6CDR2a having the amino acid sequence of SEQ ID NO: 7CDR3a having the amino acid sequence of SEQ ID NO: 8CDR1 p having the amino acid sequence of SEQ ID NO: 10CDR2p having the amino acid sequence of SEQ ID NO: 11CDR3p having the amino acid sequence of SEQ ID NO: 12; or(b)CDR1a having the amino acid sequence of SEQ ID NO: 14CDR2a having the amino acid sequence of SEQ ID NO: 15CDR3a having the amino acid sequence of SEQ ID NO: 16CDR1 p having the amino acid sequence of SEQ ID NO: 18CDR2p having the amino acid sequence of SEQ ID NO: 19CDR3p having the amino acid sequence of SEQ ID NO: 20.

4. The T cell receptor of claim 3, wherein the T cell receptor comprises: an alpha chain variable region comprising an amino acid sequence having at least 70% sequence identity to SEQ ID NO: 5 or 13; and a beta chain variable region comprising an amino acid sequence having at least 70% sequence identity to SEQ ID NO: 9 or 17.

5. The T cell receptor of claim 4, wherein the T cell receptor comprises:(a) an alpha chain variable region comprising the amino acid sequence of SEQ ID NO: 5 and a beta chain variable region comprising the amino acid sequence of SEQ ID NO: 9; or(b) an alpha chain variable region comprising the amino acid sequence of SEQ ID NO: 13 and a beta chain variable region comprising the amino acid sequence of SEQ ID NO: 17.

6. The T cell receptor of any one of claims 1 to 5, wherein the TOR has an MHC restriction of HLA- A*02.

7. The T cell receptor of any one of claims 1 to 6, wherein the TOR is a soluble TOR, a chimeric TOR or a TCR-CAR.

8. A complex, optionally isolated, optionally in vitro, comprising a T cell receptor according to any one of claims 1 to 7 bound to:(a) a peptide having the amino acid sequence of SEQ ID NO: 3 or 4; or(b) a complex of a peptide having the amino acid sequence of SEQ ID NO: 3 or 4 and an HLA molecule.

9. A nucleic acid, or a plurality of nucleic acids, optionally isolated, encoding a T cell receptor according to any one of claims 1 to 7.

10. A nucleic acid according to claim 9 comprising one or more nucleotide sequences selected from SEQ ID NOs: 54-57 or comprising one or more nucleotide sequences encoding one or more of SEQ ID NOs: 25, 26 and 50-53.

11. An expression vector, or a plurality of expression vectors, comprising a nucleic acid or a plurality of nucleic acids according to claim 9 or 10.

12. A cell, optionally isolated, comprising a T cell receptor according to any one of claims 1 to 7, a nucleic acid or a plurality of nucleic acids according to claim 9 or 10, or an expression vector or a plurality of expression vectors according to claim 11.

13. The cell of claim 12, wherein the cell is an immune cell.

14. The cell of claim 12 or 13, wherein the cell is a T cell or an activated cytotoxic T cell.

15. A method comprising culturing a cell according to any one of claims 12 to 14 under conditions suitable for expression of a T cell receptor by the cell.

16. A composition comprising (i) a T cell receptor according to any one of claims 1 to 7, a nucleic acid or a plurality of nucleic acids according to claim 9 or 10, an expression vector or a plurality of expression vectors according to claim 11 , a cell according to any one of claims 12 to 14, or a cell produced by the method of claim 15, and (ii) a pharmaceutically acceptable carrier, diluent, excipient or adjuvant.

17. A composition comprising a cell or population of cells according to any one of claims 12 to 14.

18. A composition according to claim 16 or 17, wherein the composition is a pharmaceutical composition or medicament.

19. A TCR, nucleic acid, expression vector, cell or composition according to any one of claims 1 to 14, or 16 to 18 for use in a method of medical treatment or prophylaxis.

20. A TCR, nucleic acid, expression vector, cell or composition according to any one of claims 1 to 14, or 16 to 18 for use in a method of treating or preventing a disease or condition.21 . The TCR, nucleic acid, expression vector, cell or composition for use in a method of treating a disease or condition according to claim 20, wherein the disease or condition is cancer.

22. The TCR, nucleic acid, expression vector, cell or composition for use in a method of treating cancer according to claim 21 , wherein the cancer is one of breast cancer, head and neck cancer, gastric cancer, or colorectal cancer.

23. The TCR, nucleic acid, expression vector, cell or composition for use in a method of treating cancer according to claim 21 or 22, wherein the cancer expresses or overexpresses COL6A3, a COL6A3- derived antigen, a COL6A3 splice variant or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4.

24. The TCR, nucleic acid, expression vector, cell or composition for use in a method of treating cancer according to any one of claims 20 or 21 , wherein the cancer has been determined to express or overexpresses COL6A3, a COL6A3-derived antigen, a COL6A3 splice variant or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4.

25. The TCR, nucleic acid, expression vector, cell or composition for use in a method of treating cancer according to any one of claims 21 to 24, wherein the cancer is in a subject that has been determined to have an increased level of T lymphocytes that bind specifically to COL6A3, a COL6A3- derived antigen, a COL6A3 splice variant, or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4.

26. Use of a TCR, nucleic acid, expression vector, cell or composition according to any one of claims 1 to 14, or 16 to 18 in the manufacture of a medicament for use in a method of medical treatment or prophylaxis.

27. Use of a TCR, nucleic acid, expression vector, cell or composition according to any one of claims 1 to 14, or 16 to 18 in the manufacture of a medicament for use in a method of treating or preventing a disease or condition.

28. The use of claim 27 wherein the disease or condition is cancer.

29. The use of claim 28, wherein the cancer is one of breast cancer, head and neck cancer, gastric cancer, or colorectal cancer.

30. The use of claim 28 or 29, wherein the cancer expresses or overexpresses COL6A3, a COL6A3- derived antigen, a COL6A3 splice variant or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4.31 . The use of any one of claims 29 to 31 , wherein the cancer has been determined to express or overexpresses COL6A3, a COL6A3-derived antigen, a COL6A3 splice variant or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4.

32. The use of any one of claims 28 to 31 , wherein the cancer is in a subject that has been determined to have an increased level of T lymphocytes that bind specifically to COL6A3, a COL6A3- derived antigen, a COL6A3 splice variant, or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4.

33. A method of treating or preventing a disease or condition in a subject, the method comprising administering to the subject a therapeutically or prophylactically effective amount of a TOR, peptide, nucleic acid, expression vector, cell or composition according to any one of claims 1 to 14, or 16 to 18.

34. The method of claim 33, wherein the disease or condition is cancer.

35. The method of claim 34, wherein the cancer is one of breast cancer, head and neck cancer, gastric cancer, or colorectal cancer.

36. The method of claim 34 or 35, wherein the cancer expresses or overexpresses COL6A3, a COL6A3-derived antigen, a COL6A3 splice variant or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4.

37. The method of any one of claims 34 to 36, wherein the cancer has been determined to express or overexpresses COL6A3, a COL6A3-derived antigen, a COL6A3 splice variant or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4.

38. The method of any one of claims 34 to 37, wherein the subject has been determined to have an increased level of T lymphocytes that bind specifically to COL6A3, a COL6A3-derived antigen, a COL6A3 splice variant, or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4.

39. A method of killing target cells in a subject, wherein the target cells express or overexpress COL6A3, a COL6A3-derived antigen, a COL6A3 splice variant or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4, the method comprising administering to the subject an effective amount of a TOR, nucleic acid, expression vector, cell or composition according to any one of claims 1 to 14, or 16 to 18.

40. A method for eliciting an immune response in a subject, wherein the subject has a cancer that expresses or overexpresses COL6A3, a COL6A3-derived antigen, a COL6A3 splice variant or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4, the method comprising administering to the subject an effective amount of a TCR, nucleic acid, expression vector, cell or composition according to any one of claims 1 to 14, or 16 to 18.41 . A method of eliciting an immune response in a subject, the method comprising administering to a subject an effective amount of a TCR, nucleic acid, expression vector, cell or composition, wherein the subject has a cancerthat has previously been determined to express or overexpress COL6A3, a COL6A3-derived antigen, a COL6A3 splice variant or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4.

42. The method of claim 41 , wherein the method comprises administering to the subject an effective amount of a TCR, nucleic acid, expression vector, cell or composition according to any one of claims 1 to 14, or 16 to 18.

43. A method of identifying the suitability of a treatment for treating a subject with cancer, the method comprising determining whether the cancer expresses or overexpresses COL6A3, a COL6A3-derived antigen, a COL6A3 splice variant or a peptide having the amino acid sequence of SEQ ID NO: 3 or 4, and administering to the subject an effective amount of a TCR, nucleic acid, expression vector, cell or composition.

44. The method of claim 43, wherein the method comprises administering to the subject an effective amount of a TCR, nucleic acid, expression vector, cell or composition according to any one of claims 1 to 14, or 16 to 18.

Images