Compositions and methods for treatment of hepatitis b

Abstract

The present invention is related to compositions and methods for modifying the hepatitis B virus (HB V) genome using CRISPR gene editing technology to treat a subject suffering from HBV. The present invention is also related to compositions of modified HB V genomes.

Description

[0001] COMPOSITIONS AND METHODS FOR TREATMENT OF HEPATITIS B

[0002] INCORPORATION BY REFERENCE OF A SEQUENCE LISTING XML

[0003] A Sequence Listing is provided herewith as a Sequence Listing XML, “Compositions and methods for treatment of hepatitis B.xml” created on September 1, 2025 and having a size of 55 KB. The contents of the Sequence Listing XML are incorporated by reference herein in their entirety.

[0004] FIELD OF THE INVENTION

[0005] The present invention is related to compositions and methods for modifying the hepatitis B virus (HBV) genome. The present invention is also related to compositions of modified HBV genomes.

[0006] BACKGROUND OF THE INVENTION

[0007] Chronic hepatitis B virus (HBV) infection often leads to adverse clinical outcomes, including cirrhosis and hepatocellular carcinoma (HCC).1Although current antiviral therapies have dramatically improved the outcomes of individuals with chronic hepatitis B (CHB), most patients experience rebound viremia after discontinuation of nucleos(t)ide analogs (NAs).2The major obstacle for eradicating HBV infection by NAs is the persistent covalently closed circular DNA (cccDNA), which is the episomal form of a virally replicative template.3Curative strategies for CHB need to either eliminate all of the infected hepatocytes or purge all of the replication-competent cccDNA.4,5So far, curing HBV remains extremely challenging because no drugs can specifically target and destroy cccDNA.

[0008] Integration of HBV DNA into host genomes is a common event occurring upon HBV infection.6,7Unlike retrovirus, HBV integration is not a requisite for the viral life cycle because integrated HBV DNA does not serve as a template for productive viral replication.8Nevertheless, integrated HBV DNA has recently been proven to be a crucial source for the continuous secretion of hepatitis B surface antigen (HBsAg).9An excessive amount of secreted HBsAg likely has the immunosuppressive effect and acts as a “decoy” for antibody responses in order to allow HBV to escape from host immunological control.10Recently, there has been emerging enthusiasm for the functional cure of HBV, which is defined as loss of HBsAg. However, disruption of cccDNA alone may not necessarily result in HBsAg loss. It is reasonably assumed that a functional HBV cure cannot be achieved without targeting integrated HBV genomes.11

[0009] Recent advance of genome-editing tools has provided a novel approach to treat viral infections by cutting and destroying viral genomes in a sequence-specific manner.12, 13, 14, 15Particularly, the CRISPR / Cas RNA-guided DNA endonuclease has gained the wide interest because it can be conveniently redirected to the desired DNA sequences by simply redesigning the sequences of guide RNAs (gRNAs) that are perfectly matched with the protospacer sequences of the target genomes. Cleavage of target genomes by Cas9 / gRNA causes double-strand breaks (DSBs) of DNA, which are often repaired by the non- homologous end joining (NHEJ) pathway.16,17The NHEJ pathway frequently leads to nucleotide insertions or deletions (indels) and thus disrupts the open reading frames (ORFs) of genes.

[0010] Previous studies, including ours, have examined the utility of CRISPR / Cas9 in disruption of HBV genomes.18, 19, 20, 21, 22Most studies have taken advantage of the wild-type (WT) CRISPR / Cas9 system and demonstrated its utility in specific cleavage of intrahepatic HBV templates, including cccDNA and integrated HBV genomes, for curing HBV infection.23,24However, the CRISPR-meditated cleavage of integrated HBV DNA also results in DSBs of the host genome, which may cause large deletions and chromosomal rearrangements, leading to pathological consequences.25Recently, a novel CRISPR-derived base-editing strategy has been shown to generate precise C-T / G-A conversion without DSBs at specific genome loci.26The initial “base editors” (BEs) utilized a catalytically impaired Cas9 endonuclease (dCas9) tethered with APOB EC deaminase. To enhance C-T / G-A conversion, the dCas9-deaminase construct was fused with a uracil glycosylase inhibitor (UGI) that suppresses uracil excision following deamination to prevent the reversion of the U:G pair to a C:G pair. A widely used third-generation BE (BE3) was thus designed with the combination of APOBEC1, Cas9-derived nickase, and UGI.27Since then, a growing number of modified BEs have been developed to improve various aspects of BE tools.28For example, the fourth-generation BE4 increases the efficiency of C-T / G-A conversion, while halving the frequency of undesired base changes compared to BE3. BE4Gam is generated by fusing BE4 to DSB-binding protein Gam from bacteriophage Mu to further reduce indel formation.29In addition, the efficacy of base editing can be significantly improved by optimizing codon usage (BERA), and further enhanced by including nuclear targeting motifs at the N terminus of BE enzymes (FNLS-BEs).30Theoretically, base editing the target nucleotides without DSBs of DNA should reduce the risk of genome rearrangement and carcinogenesis.26Although interesting, the effect of the Cas9-mediated BE on the episomal cccDNA remains unclear.

[0011] Although successful modification of HBV genome has been reported using Cas9- BE31, there still exist limitations in the use of a single gRNA for targeting multiple HBV genotypes. Limitations imposed by PAM sequence and editing window of deaminase prevents targeting of the various HBV genotiypes.32, 33Therefore, there is a need to provide a solution for overcoming these limitations.

[0012] BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 illustrates an embodiment of the composition of the present invention comprising a lipid nanoparticle encapsulating a Cas9-BE mRNA and a gRNA, and an embodiment of using such composition to modify the HBV genome comprising cccDNA in a subjected infected by HBV.

[0014] Figure 2 illustrates an embodiment of the composition of the present invention comprising a lipid nanoparticle encapsulating a Cas9-BE mRNA and a gRNA, and an embodiment of using such composition to modify the HBV genome comprising cccDNA in a subjected infected by HBV.|0015 | Figure 3 is a schematic illustration of the HBV genome with four ORFs, including core, polymerase, surface, and X, targeted by the gRNAs / SpRY base editors. The small rectangles above the HBV genome indicate individual gRNA-targeted sites.

[0016] Figure 4 illustrates the conservation frequency of specific guide RNAs in HBV genotypes A-E.

[0017] Figure 5 illustrates the base editing efficiency of specific guide RNAs in an HBV genome.

[0018] Figure 6 illustrates the base editing efficiency for guide RNA gN-C2, gN-S10-l and gN-S10-2 in HepG2.2.15 cells. The gN-S10-l and gN-S10-2 indicate the two nucleotides that are simultaneously edited by gN-S lO. The efficiency of C-T / G-A conversion in these gRNA targeting sites was evaluated by Sanger sequencing.

[0019] Figure 7 illustrates the conservation frequency of specific guide RNAs in different HBV genotypes.

[0020] Figure 8 is a schematic illustration of mutated amino acids in the three spCas9 variants VQR, VRER, and EQR: VQR (DI 135V, R1335Q and T1337R), VRER (DI 135V, G1218R, R1335E and T1337R), EQR (DI 135E, R1335Q and T1337R).

[0021] Figure 9 is a schematic illustration of the base-edited efficiency for individual sites within the HBV genome targeted by individual gRNAs with variants of spCas9 base editors.

[0022] Figure 10 illustrates the base-editing efficiency of SpCas9-BE variant VQR (V), VRER (VR), and EQR (E) with individual gRNAs.

[0023] Figure 11 illustrates the premature stop codon generated after base-editing using specific gRNAs.

[0024] Figure 12 illustrates the base editing efficiency of specific gRNAs using ScCas9-BE. The HBV plasmid and ScCas9-BE with individual gRNAs were co-transfected to 293T cells.

[0025] Figure 13 illustrates the base editing efficiency of specific gRNAs using SpRY-BE. The HBV plasmid and SpRY-BE with individual gRNAs were co-transfected to 293T cells.

[0026] Figure 14 illustrates the fold change of secreted HBsAg levels, measured by the quantitative HBsAg assay, in the supernatant of HepG2.2.15 cells at day 0 day 4 day 8 day 15 day 18 and day 23 after transduction with the lentiviral vectors carrying individual gRNAs gN-C2, and gN-SlO along with SpRY-BE in comparison to those transduced by the control glacZ along with SpRY-BE.

[0027] Figure 15 illustrates the fold change of secreted HBeAg levels, measured by the quantitative HBsAg assay, in the supernatant of HepG2.2.15 cells at day 0 day 4 day 8 day 15 day 18 and day 23 after transduction with the lentiviral vectors carrying individual gRNAs gN-C2, and gN-SlO along with SpRY-BE in comparison to those transduced by the control glacZ along with SpRY-BE.

[0028] Figure 16 illustrates fold change of supernatant HBV DNA in HepG2.2.15 cells transduced by the lentiviral vectors carrying individual gRNAs gN-C2, and gN-SlO along with SpRY-BE in comparison to those transduced by the control glacZ along with SpRY-BE.

[0029] Figure 17 illustrates the protein expression levels of BE-SpRY in HepG2.2.15 cells 24 h or 48 h after LNP transfection.

[0030] Figure 18 illustrates the fold change of HBsAg to mock in HepG2.2.15 cells (A) 3 days or (B) 6 days after transfection with LNP encapsulating SpRY-BE mRNA and gRNAs gN-C2 and gN-SlO.

[0031] Figure 19 illustrates the editing efficiency in the (A) core gene or (B) the surface gene through transfection with LNP encapsulating SpRY-BE mRNA and gRNAs gN-C2 and gN- S10.

[0032] DETAILED DESCRIPTION OF THE INVENTION

[0033] As used in this specification and in claims which follow, the singular forms “a”, “an” and “the” include plural referents unless the context clearly indicates otherwise. Thus, for example, reference to “an ingredient” includes mixtures of ingredients, reference to “anactive pharmaceutical agent” includes more than one active pharmaceutical agent, and the like.

[0034] As used herein, the term “about” as a modifier to a quantity is intended to mean + or - 20% , + or - 15% , + or - 10% or + or - 5% inclusive of the quantity being modified.

[0035] As used herein, the term “subject,” “individual” or “patient” is used interchangeably herein, which refers to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets.

[0036] As used herein, the term “effective amount” or “a therapeutically effective amount” of a drug or pharmacologically active agent comprises administering an amount necessary to achieve a desired result. The exact amount required will vary from subject to subject, depending on the species, age, general condition of the subject, the severity of the disease, the particular active agent, its mode of administration, the desired outcome, and the like. In certain embodiments of the present invention, a “therapeutically effective amount” of a compound or pharmaceutical composition is that amount effective for inhibiting progression or reversing of any disease disclosed herein in a subject or a biological sample (e.g., in cells). In certain embodiments, disease progression is inhibited by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 99%. In certain embodiments, the compound inhibits disease progression by at least about 25%, at least about 50%, at least about 75%, or at least about 90%. In certain embodiments of the present invention, a “therapeutically effective amount” refers to an amount of a compound or composition sufficient to reversal of disease. In certain embodiments, the disease is reversed by about 1%, about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99% or any numbers and number ranges falling within these values.

[0037] The present invention provides a composition comprising a base editor and one or more guide RNAs. In an embodiment, the nucleotide sequence of each of the one or more guide RNAs of the present invention is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to a nucleotide sequence selected from SEQ ID NO. 1 to SEQ ID NO. 62. In an embodiment, each of the one or more guide RNAs of the present invention comprises a nucleotide sequence, from 5' to 3', a 1, 2, 3, 4, or 5 nucleotide 5' truncation fragment thereof, selected from one or more of SEQ ID NO. 1 to SEQ ID NO. 62. (gN-C2-rc denotes a nucleotide sequence reverse complement to gN-C2)

[0038] SEQ ID NO. 1 (gN-C2): TCTCAATCGCCGCGTCGCAG

[0039] SEQ ID NO. 2 (gN-SlO): AGAAGTCCACCACGAGTCTA (minus strand)

[0040] SEQ ID NO. 3 (gN-S12): AGAGAAGTCCACCACGAGTC (minus strand)

[0041] SEQ ID NO. 4 (gN-Cl): TCAAGCCTCCAAGCTGTGCC

[0042] SEQ ID NO. 5 (gN-Pl): GTGGACTTCTCTCAATTTTC

[0043] SEQ ID NO. 6 (gN-P2): TGGACTTCTCTCAATTTTCT

[0044] SEQ ID NO. 7 (gN-P3): GGACTTCTCTCAATTTTCTA

[0045] SEQ ID NO. 8 (gN-P4): GACTTCTCTCAATTTTCTAG

[0046] SEQ ID NO. 9 (gN-P5): GCTCAGTTTACTAGTGCCAT

[0047] SEQ ID NO. 10 (gN-P6) CTCAGTTTACTAGTGCCATT

[0048] SEQ ID NO. 11 (gN-Sl) TGTTACAGGCGGGGTTTTTC

[0049] SEQ ID NO. 12 (gN-S2) GTTACAGGCGGGGTTTTTCT

[0050] SEQ ID NO. 13 (gN-S3) TACAGGCGGGGTTTTTCTTG

[0051] SEQ ID NO. 14 (gN-S4) ACAGGCGGGGTTTTTCTTGT

[0052] SEQ ID NO. 15 (gN-S5) ATACCACAGAGTCTAGACTC

[0053] SEQ ID NO. 16 (gN-S6) TACCACAGAGTCTAGACTCG |0054| SEQ ID NO. 17 (gN-S7) CCACAGAGTCTAGACTCGTG

[0055] SEQ ID NO. 18 (gN-S8) CCACCACGAGTCTAGACTCT (minus strand)

[0056] SEQ ID NO. 19 (gN-S9) GTCCACCACGAGTCTAGACT (minus strand)

[0057] SEQ ID NO. 20 (gN-Sll): GAGAAGTCCACCACGAGTCT (minus strand)

[0058] SEQ ID NO. 21 (gN-S13): ATTGAGAGAAGTCCACCACG (minus strand)

[0059] SEQ ID NO. 22 (gN-S14): ATTTTGGCCAAGACACACGG (minus strand)

[0060] SEQ ID NO. 23 (gN-S15): GGACTATCAAGGTATGTTGC

[0061] SEQ ID NO. 24 (gN-S16): TATCAAGGTATGTTGCCCGT

[0062] SEQ ID NO. 25 (gN-S17): CTCCCATAGGTATTTTGCGA (minus strand)

[0063] SEQ ID NO. 26 (gN-Sl 8): CCCACTCCCATAGGTATTTT (minus strand)

[0064] SEQ ID NO. 27 (gN-S19): ACCACTGAACAAATGGCACT (minus strand)

[0065] SEQ ID NO. 28 (gN-S20): AACCACTGAACAAATGGCAC (minus strand)

[0066] SEQ ID NO. 29 (gN-S21): ATACCACATCATCCATATAA (minus strand)

[0067] SEQ ID NO. 30 (gN-S22): ACCCAAAGACAAAAGAAAAT (minus strand)

[0068] SEQ ID NO. 31 (gN-S23): TACCCAAAGACAAAAGAAAA (minus strand)

[0069] SEQ ID NO. 32 (gN-C2-rc): CTGCGACGCGGCGATTGAGA

[0070] SEQ ID NO. 33 (gN-SlO-rc): TAGACTCGTGGTGGACTTCT

[0071] SEQ ID NO. 34 (gN-S12-rc): GACTCGTGGTGGACTTCTCT

[0072] SEQ ID NO. 35 (gN-Cl -rc): GGCACAGCTTGGAGGCTTGA

[0073] SEQ ID NO. 36 (gN-Pl-rc) GAAAATTGAGAGAAGTCCAC

[0074] SEQ ID NO. 37 (gN-P2-rc) AGAAAATTGAGAGAAGTCCA

[0075] SEQ ID NO. 38 (gN-P3-rc) TAGAAAATTGAGAGAAGTCC

[0076] SEQ ID NO. 39 (gN-P4-rc) CTAGAAAATTGAGAGAAGTC

[0077] SEQ ID NO. 40 (gN-P5-rc) ATGGCACTAGTAAACTGAGC

[0078] SEQ ID NO. 41 (gN-P6-rc) AATGGCACTAGTAAACTGAG

[0079] SEQ ID NO. 42 (gN-Sl-rc) GAAAAACCCCGCCTGTAACA

[0080] SEQ ID NO. 43 (gN-S2-rc) AGAAAAACCCCGCCTGTAAC

[0081] SEQ ID NO. 44 (gN-S3-rc) CAAGAAAAACCCCGCCTGTA

[0082] SEQ ID NO. 45 (gN-S4-rc) ACAAGAAAAACCCCGCCTGT

[0083] SEQ ID NO. 46 (gN-S5-rc) GAGTCTAGACTCTGTGGTAT

[0084] SEQ ID NO. 47 (gN-S6-rc) CGAGTCTAGACTCTGTGGTA

[0085] SEQ ID NO. 48 (gN-S7-rc) CACGAGTCTAGACTCTGTGG

[0086] SEQ ID NO. 49 (gN-S8-rc) AGAGTCTAGACTCGTGGTGG

[0087] SEQ ID NO. 50 (gN-S9-rc) AGTCTAGACTCGTGGTGGAC |OO88| SEQ ID NO. 51 (gN-SH-rc) : AGACTCGTGGTGGACTTCTC

[0089] SEQ ID NO. 52 (gN-S13-rc) : CGTGGTGGACTTCTCTCAAT

[0090] SEQ ID NO. 53 (gN-S14-rc) : CCGTGTGTCTTGGCCAAAAT

[0091] SEQ ID NO. 54 (gN-S15-rc) : GCAACATACCTTGATAGTCC

[0092] SEQ ID NO. 55 (gN-S16-rc) : ACGGGCAACATACCTTGATA

[0093] SEQ ID NO. 56 (gN-S17-rc) : TCGCAAAATACCTATGGGAG

[0094] SEQ ID NO. 57 (gN-S18-rc) : AAAATACCTATGGGAGTGGG

[0095] SEQ ID NO. 58 (gN-S19-rc): AGTGCCATTTGTTCAGTGGT

[0096] SEQ ID NO. 59 (gN-S20-rc): GTGCCATTTGTTCAGTGGTT

[0097] SEQ ID NO. 60 (gN-S21-rc): TTATATGGATGATGTGGTAT

[0098] SEQ ID NO. 61 (gN-S22-rc): ATTTTCTTTTGTCTTTGGGT

[0099] SEQ ID NO. 62 (gN-S23-rc): TTTTCTTTTGTCTTTGGGTA

[0100] In an embodiment, the guide RNA of the present invention comprises a CRISPR RNA (crRNA) and a trans-encoded small RNA (tracrRNA), wherein the crRNA comprises a nucleic acid sequence complementary to a target polynucleotide sequence. In an embodiment, the guide RNA of the present invention comprises a single guide RNA. In an embodiment, the guide RNAs of the present invention comprises a nucleotide sequence that is complementary to a target polynucleotide sequence. In an embodiment, the guide RNA of the present invention comprises a nucleotide sequence comprising at least 10, 12, 14, 16, 18, 20contiguous nucleotides that are complementary to the target polynucleotide sequence. In an embodiment, the target polynucleotide sequence of the present invention comprises at least a part of an HBV genome. In an embodiment, the target polynucleotide sequence of the present invention comprises at least a part of an HBV pre-C gene, C gene, X gene, P gene, pre-Sl gene, pre-S2 gene, S gene, or a combination thereof. In an embodiment, the target polynucleotide sequence of the present invention comprises at least a part of an HBV genome encoding an HBV polymerase, an HBV pre-core protein, an HBV core protein, an HBV surface protein (e.g., large surface protein (LHB), middle surface protein (MHB), small surface protein (SHB)), an HBV envelope protein, an HBV X protein, or a combination thereof. In an embodiment, the target polynucleotide sequence of the present invention is conserved among the at least 2, 3, 4, 5, 6, 7, 8, 9 or more of the HBV genotypes. In an embodiment, the target nucleotide sequence of the present invention comprises at least part of the HBV covalently closed circular DNA (cccDNA), relaxed circular double stranded DNA (rcDNA), or a combination thereof. In an embodiment, the target polynucleotide sequence comprises the positive strand of the at least part of the HBV genome, the negative strand of the at least part of the HBV genome, or a combination thereof. In an embodiment, the target polynucleotide sequence of the present invention comprising at least part of the HBV genome is flanked by the genome of a subject comprising a eukaryotic cell such as a human hepatocyte. In another embodiment, the target nucleotide sequence comprising at least part of the HBV genome is not flanked by the genome of a subject comprising a eukaryotic cell such as a human hepatocyte.

[0101] In an embodiment, the base editor of the present invention comprises a Cas9 protein or a variant thereof and a nucleotide deaminase. In an embodiment, the base editor is in the form of a polypeptide or a polynucleotide encoding thereof. In an embodiment, the base editor of the present invention comprises a fusion protein comprising a Cas9 protein or a variant thereof and a nucleotide deaminase. The present invention also comprises a polynucleotide encoding the amino acid sequences of said fusion protein. In an embodiment, the fusion protein further comprises a linker that joins the Cas9 protein or a variant thereof and the nucleotide deaminase. In an embodiment, the linker comprises an organic molecule, group, polymer, or chemical moiety. In an embodiment, the linker comprises a nucleic acid, a polynucleotide, a peptide, a protein, or an aptamer.

[0102] In some embodiment, the Cas9 protein or a variant thereof of the present invention comprises Streptococcus pyogenes Cas9 (SpCas9), Staphylococcus aureus Cas9 (SaCas9), Streptococcus thermophilus 1 Cas9 (StlCas9), Streptococcus canis Cas9(ScCas9), or variantthereof. In some embodiment, the Cas9 protein or a variant thereof comprises a nuclease inactivated variant or a nickase variant. In an embodiment, the Cas9 protein or a variant thereof comprises a SpCas9 variant, wherein the SpCas9 variant comprises one or more amino acid mutations at DIO, S55, A61, R221, G366, N394, M495, N497, Y515, K526, R661, R691, N692, M694, Q695, H698, E762, K810, D839, H840, K848, Q926, N963, H983, D986, K1003, R1060, G1104, Li l l i, D1135, SI 136, T1138, V1139, KI 151, G1218, E1219, E1243, L1245, E1253, A1285, K1289, T1314, N1317, A1322, D1332, R1333, R1335, or T1337. In an embodiment, the Cas9 protein or a variant thereof comprises a SpCas9 variant, wherein the SpCas9 variant comprises the mutations D10A, A61R, LI 111R, D1135L, S1136W, G1218K, E1219Q, N1317R, A1322R, R1333P, R1335Q, T1337R, or a combination thereof. In an embodiment, the Cas9 protein or a variant thereof comprises a SpCas9 variant, wherein the SpCas9 variant comprises the mutations D10A, A61R, LI 111R, D1135L, S1136W, G1218K, E1219Q, N1317R, A1322R, R1333P, R1335Q, and T1337R (SpRY). In an embodiment, the Cas9 protein or a variant thereof comprises a ScCas9 variant, wherein the ScCas9 variant comprises one or more amino acid mutations at DIO, 1367, G368, 1369, H371, T375, T376, Q381, R701, or T1227. In an embodiment, the Cas9 protein or a variant thereof comprises a ScCas9 variant, wherein the ScCas9 variant comprises the mutations D10A, I367A, G368D, I369K, H371L, T375S, T376G, Q381E, R701A, T1227K, or a combination thereof. In an embodiment, the Cas9 protein or a variant thereof comprises a ScCas9 variant, wherein the ScCas9 variant comprises the mutations D10A, 1367 A, G368D, I369K, H371L, T375S, T376G, Q381E, R701A, and T1227K (HiFi-ScCas9++). Various embodiments of modified Cas9 proteins or Cas9 variants were disclosed in PCT application no. PCT / US2021 / 014933 filed 25 January, 2021, the contents of which are incorporated by reference herein in their entireties. In an embodiment, the Cas9 protein or a variant thereof has a protospacer adjacent motif (PAM) specificity for a nucleotide sequence comprising 5'- NGG-3', 5'-NAG-3', 5'-NGA-3', 5'-NAA-3', 5'-NNAGGA-3', or 5'-NNACCA-3' wherein N is selected from A, T, C, or G. In an embodiment, the Cas9 protein or a variant thereof has a better PAM specificity for NRN over NYN wherein N is selected from A, T, C, or G, R is selected from A or G, and Y is selected from C or T. In an embodiment, the Cas9 protein or a variant thereof is not constrained with the recognition of specific PAM for the base editing activity.

[0103] In an embodiment, the nucleotide deaminase of the present invention converts a C*G base pair to a T / U»A base pair of a target polynucleotide sequence. In an embodiment, the nucleotide deaminase of the present invention converts a C*G base pair to a T / U»A base pairof a target polynucleotide sequence without introducing double stranded breaks in the target polynucleotide sequence. In an embodiment, the nucleotide deaminase converts a T / U»A base pair to a OG base pair of a target polynucleotide sequence. In an embodiment, the nucleotide deaminase converts a T / U»A base pair to a OG base pair of a target polynucleotide sequence without introducing double stranded breaks in the target polynucleotide sequence. In an embodiment, the nucleotide deaminase converts a target C to U of a polynucleotide sequence. In an embodiment, the nucleotide deaminase converts a target A to inosine (I), wherein I is treated as G by polymerase. In an embodiment, the nucleotide deaminase comprises an adenosine deaminase, a cytidine deaminase, or a combination thereof. In an embodiment, the adenosine deaminase comprises adenosine deaminase 1 (ADA1), ADA2; adenosine deaminase acting on RNA 1 (ADAR1), ADAR2, ADAR3; adenosine deaminase acting on tRNA 1 (ADAT1), ADAT2, ADAT3; and naturally occurring or engineered tRNA-specific adenosine deaminase (TadA) Tad A* 7.10, TadA*8.1 , TadA*8.2, TadA*8.3, TadA*8.4, TadA*8.5, Tad A* 8.6, TadA*8.7, TadA*8.8, TadA*8.9, TadA*8.10, TadA*8.11, TadA*8.12, TadA*8.13, TadA*8.14, TadA*8.15, TadA*8.16, TadA*8.17, TadA*8.18, TadA*8.19, TadA*8.20, TadA*8.21, TadA*8.22, TadA*8.23, or TadA*8.24. In an embodiment, the cytidine deaminase comprises apolipoprotein B mRNA-editing enzyme, catalytic polypeptide- like (APOBEC) family of deaminases, including APOBEC1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D / E, APOBEC3F, APOBEC3G, APOBEC3H, or APOBEC4; activation-induced cytidine deaminase (AID), e.g., activation induced cytidine deaminase (AICDA); cytosine deaminase 1 (CDA1) or CDA2; or cytosine deaminase acting on tRNA (CDAT).

[0104] In an embodiment, the base editor of the present invention introduces a premature stop codon, a nonsense mutation, a missense mutation, or a combination thereof to the target polynucleotide sequence. In an embodiment, the polynucleotide altered by any embodiment of the base editor of the present invention comprises a premature stop codon, a nonsense mutation, a missense mutation, or a combination thereof that is not present before the editing by the base editor. In an embodiment, the premature stop codon comprises a nucleotide sequence comprising 5'-TAA-3', 5 -TAG-3', or 5'-TGA-3'. In an embodiment, the premature stop codon replaces an amino acid residue comprising glutamine (Q) or tryptophan (W) originally presented in the HBV genome. In an embodiment, the premature stop codon comprises Q18X or Q198X in the pre-core protein, Q169X in the core protein, Q383X or Q517X in the polymerase protein, or Q179X, Q193X, W198X, W199X, Q214X, Q264X, W326X, W328X, W345X, W362X, or W386X in the surface protein, or a combinationthereof, wherein X represents a premature stop codon (e.g., Q18X indicates a replacement of QI 8 by a premature stop codon). In an embodiment, the polynucleotide altered by any embodiment of the base editor of the present invention comprises at least a part of an HBV genome. In an embodiment, the polynucleotide altered by any embodiment of the base editor of the present invention comprises HBV covalently closed circular DNA (cccDNA), relaxed circular double stranded DNA (rcDNA), or a combination thereof. In an embodiment, the polynucleotide altered by any embodiment of the base editor of the present invention comprises at least a part of an HBV pre-C gene, C gene, X gene, P gene, pre-Sl gene, pre-S2 gene, S gene, or a combination thereof. In an embodiment, the polynucleotide altered by any embodiment of the base editor of the present invention comprises a nucleotide sequence encoding an HBV polymerase, an HBV pre-core protein, an HBV core protein, an HBV surface protein (e.g., large surface protein (LHB), middle surface protein (MHB), small surface protein (SHB)), an HBV envelope protein, an HBV X protein, or a combination thereof. In an embodiment, the polynucleotide altered by the base editor is flanked by the genome of a subject comprising a eukaryotic cell. In another embodiment, the polynucleotide altered by any embodiment of the base editor of the present invention is not flanked by the genome of a subject comprising a eukaryotic cell. In an embodiment, the polynucleotide altered by any embodiment of the base editor of the present invention comprises at least a part of an HBV genome of genotype A, B, C, D, E, F, G, H, I, or other genotypes. In an embodiment, the polynucleotide altered by any embodiment of the base editor of the present invention comprises at least a part of an HBV genome conserved among the at least 2, 3, 4, 5, 6, 7, 8, 9 or more of the HBV genotypes.

[0105] In an embodiment, the base editor of the present invention further comprises an inhibitor of base excision repair. In an embodiment, the inhibitor of base excision repair comprises uracil glycolysis inhibitors (UGIs) or inosine base excision repair inhibitor.

[0106] The present invention further provides a composition comprising a nanoparticle encapsulating any embodiment of the base editor and one or more of the guide RNA of the present invention. In an embodiment, the nanoparticle comprises lipid nanoparticle (LNP), polymer particle, lipid-polymer hybrid particle, liposome, exosome, virus, or virus-like particle.

[0107] In an embodiment, the nanoparticle of the present invention comprises a first lipid comprising an ionizable lipid and a second lipid comprising a neutral lipid, an anionic lipid, a PEGylated lipid, or a combination thereof. In an embodiment, the ionizable lipid of the present invention comprises 8-[(2-hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino]-octanoic acid, 1 -octylnonyl ester (SM-102), DLin-MC3-DMA (MC3), 4- hydroxybutyl)azanediyl]di(hexane-6,l-diyl) bis(2-hexyldecanoate) (ALC-0315), 3,6-bis[4- [bis[(9Z,12Z)-2-hydroxy-9,12-octadecadien-l-yl]amino]butyl]-2,5-piperazinedione (OF-02), alkyne ionizable lipid: (di(dec-3-yn-l-yl) 9-((4-(dimethylamino) butanoyl)oxy) heptadecanedioate) (A6), alkylene ketone-derived lipid: 1H -Imidazole-2-carboxylic acid, 1- [3-(2-ethyl-l-piperidinyl)propyl]-5,5-di-(8Z )-8-heptadecen-l-yl-2,5-dihydro-, ethyl ester (ACI) A18-Iso5-2DC18, or a combination thereof. In an embodiment, the ionizable lipid of the present invention comprises multi -tail ionizable lipids such as N1 ,N16-didodecyl-4,7,13- tris[3-(dodecylamino)-3-oxopropyl]-4,7,10,13-tetraazahexadecanediamide (98N12-5), 1,1 ' - [[2-[4-[2-[[2-[bis(2-hydroxydodecyl)amino]ethyl](2-hydroxydodecyl)amino]ethyl]-l- piperazinyl]ethyl]imino]bis-2-dodecanol (Cl 2-200), 2-(dioctylamino)ethyl nonyl hydrogen phosphate (9A1P9) or 3,6-bis[4-[bis(2-hydroxydodecyl)amino]butyl]-2,5-piperazinedione (cKK-E12). In an embodiment, the ionizable lipid of the present invention comprises ionizable polymer-lipids. In an embodiment, the ionizable lipid of the present invention comprises biodegradable ionizable lipids 9-[4-(dimethylamino)-l-oxobutoxy]- heptadecanedioic acid, l ,17-di-(2Z)-2-nonen-l-yl ester (L-319), 9Z,12Z-octadecadienoic acid, l,r,l",r"-[(3,6-dioxo-2,5-piperazinediyl)bis(4,l-butanediylnitrilodi-2,l-ethanediyl)] ester (OF-Deg-Lin), tetrakis(2-(octyldisulfaneyl)ethyl) 3,3',3",3"'- (((methylazanediyl)bis(propane-3,l-diyl))bis(azanetriyl))tetrapropionate (306-O12B), tetrakis(8-methylnonyl) 3,3',3",3'"-(((methylazanediyl)bis(propane-3,l- diyl))bis(azanetriyl))tetrapropionate (306OH0).

[0108] In an embodiment, the second lipid of the present invention comprises phosphatidylserines (PSs), phosphatidylglycerols (PGs), phosphatidylinositols (Pls, not limited to a specific sugar), fatty acids, steroids such as corticosteroids, sterols containing a carboxylic acid group for example, cholesterol, phosphatidylethanolamines (PEs) such as 1 ,2- diacyl-sn-glycero- 3 -phosphoethanolamines including, but not limited to 1,2- dioleoylphosphoethanolamine (DOPE), 1,2-distearoylphosphoethanolamine (DSPE), or 1,2- dihexadecoylphosphoethanolamine (DHPE), phosphatidylcholines (PC) such as L-a- phosphatidylcholine, 1 ,2-diacyl-glycero-3 -phosphocholines including, but not limited to 1,2- distearoylphosphocholine (DSPC), 1 ,2-dipalmitoylphosphocholine (DPPC), 1,2- dimyristoylphosphocholine (DMPC), l,2-dioeoyl-sn-glycero-3-phosphocholine (DOPC), egg PC, soybean PC, hydrogenated soybean phosphatidylcholine (HSPC), and sphingomyelins. The fatty acids linked to the glycerol backbone are not limited to a specific length or numberof double bonds. Phospholipids may also have two different fatty acids. In an embodiment, PEGylated lipid comprises DMG-PEG, DSG-PEG, or a combination thereof. In an embodiment, the second lipid comprises corticosteroid drugs such as dexamethasone.

[0109] In an embodiment, the molar ratio between the first and the second lipid is from about 1:5 to about 5:1 such as about 1 :5, about 1:4, about 1:3, about 1:2, about 1 :1, about 2: 1, about 3:1, about 4: 1, about 5:1 including any ratios or ratio ranges falling within these values.

[0110] In an embodiment, the nanoparticle comprises phospholipids at a molar ratio from about 2% to about 20% over the total lipids of the nanoparticle such as about 2%, about 4%, about 6%, about 8%, about 10%, about 12%, about 14%, about 16%, about 18%, about 20% including any percentages or percentage ranges falling within these ranges.

[0111] In an embodiment, the nanoparticle comprises steroids at a molar ratio from about 15% to about 60% over the total lipids of the nanoparticle such as about 15%, 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60% including any percentages or percentage ranges falling within these ranges.

[0112] In an embodiment, the nanoparticle comprises PEGylated lipid at a molar ratio from about 0.2% to about 5% over the total lipids of the nanoparticle such as about 0.2%, about 0.4%, about 0.6%, about 0.8%, about 1.2%, about 1.5%, about 1.8%, about 2.1%, about 2.4%, about 3%, about 3.5%, about 4%, about 4.5%, about 5% including any percentages or percentage ranges falling within these ranges.

[0113] In an embodiment, the nanoparticle of the present invention comprises ionizable lipid, phospholipid, steroid, and PEGylated lipid at a molar ratio of 50:10:38.5: 1.5.

[0114] In an embodiment, the nanoparticle of the present invention comprises SM-102, DSPC, cholesterol, and DMG-PEG2000 at a molar ratio of 50:10:38.5: 1.5. In an embodiment, the nanoparticle of the present invention comprises MC3, DSPC, cholesterol, and DMG-PEG2000 at a molar ratio of 50:10:38.5:1.5. In an embodiment, the nanoparticle of the present invention comprises MC3, DSPC, cholesterol, dexamethasone, and DMG- PEG2000 at a molar ratio of 50:10:34.65:3.85:1.5.

[0115] The method of preparing the nanoparticle of the present invention comprises methods known in the art. In an embodiment, the method of preparation comprises the steps of: a. dissolving in an organic solution the lipids of the nanoparticle of the present invention, b. dissolving in an aqueous solution a composition comprising a base editor and one or more guide RNAs of the present invention,c. mixing the organic solution obtained from step a with the aqueous solution obtained from step b.

[0116] In an embodiment, the method of preparation further comprises a step of purifying the nanoparticle, a step of concentration the nanoparticle, or a combination thereof. In an embodiment, the method of preparation comprises the use of a microfluidic device.

[0117] The present invention also provides a method to modify the genome of a hepatitis B virus (HBV) comprising the steps of: a. contacting at least a part of the HBV genome with any embodiment of the composition comprising a base editor and one or more guide RNAs of the present invention, b. guiding the base editor and the one or more guide RNAs to a target site on the HBV genome based on the guide RNA, c. modifying the at least a part of the HBV genome at the target site using the base editor.

[0118] In an embodiment, the one or more guide RNAs comprise any embodiment of gRNA disclosed herein. In an embodiment, the one or more guide RNAs of the present invention comprises a nucleotide sequence at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to the nucleotide sequence selected from one or more of SEQ ID NO. 1 to SEQ ID NO. 62. In an embodiment, the one or more guide RNAs of the present invention comprises a nucleotide sequence, from 5' to 3’, or a 1, 2, 3, 4, or 5 nucleotide 5’ truncation fragment thereof, selected from one or more of SEQ ID NO. 1 to SEQ ID NO. 62.

[0119] In an embodiment, the guide RNA of the present invention comprises a CRISPR RNA (crRNA) and a trans-encoded small RNA (tracrRNA), wherein the crRNA comprises a nucleic acid sequence complementary to a target site on the HBV genome. In an embodiment, the guide RNA of the present invention comprises a single guide RNA. In an embodiment, the guide RNAs of the present invention comprises a nucleotide sequence that is complementary to a target site on the HBV genome. In an embodiment, the guide RNA of the present invention comprises a nucleotide sequence comprising at least 10, 12, 14, 16, 18, 20 contiguous nucleotides that are complementary to a target site on the HBV genome.

[0120] In an embodiment, the base editor of the present invention comprises a Cas9 protein or a variant thereof and a nucleotide deaminase. In an embodiment, the base editor is in the form of a polypeptide or a polynucleotide encoding thereof. In an embodiment, the base editor of the present invention comprises a fusion protein comprising a Cas9 protein or a variant thereof and a nucleotide deaminase. In an embodiment, the fusion protein is in a formcomprising a polynucleotide encoding the amino acid sequences of said fusion protein. In an embodiment, the fusion protein further comprises a linker that joins the Cas9 protein or a variant thereof and the nucleotide deaminase. In an embodiment, the linker comprises an organic molecule, group, polymer, or chemical moiety. In an embodiment, the linker comprises a nucleic acid, a polynucleotide, a peptide, a protein, or an aptamer.

[0121] In some embodiment, the Cas9 protein or a variant thereof of the present invention comprises Streptococcus pyogenes Cas9 (SpCas9), Staphylococcus aureus Cas9 (SaCas9), Streptococcus thermophilus 1 Cas9 (StlCas9), Streptococcus canis Cas9(ScCas9), or variant thereof. In some embodiment, the Cas9 protein or a variant thereof comprises a nuclease inactivated variant or a nickase variant. In an embodiment, the Cas9 protein or a variant thereof comprises a SpCas9 variant, wherein the SpCas9 variant comprises one or more amino acid mutations at DIO, S55, A61, R221, G366, N394, M495, N497, Y515, K526, R661, R691, N692, M694, Q695, H698, E762, K810, D839, H840, K848, Q926, N963, H983, D986, K1003, R1060, G1104, Lil 11, D1135, SI 136, T1138, V1139, K1151, G1218, E1219, E1243, L1245, E1253, A1285, K1289, T1314, N1317, A1322, D1332, R1333, R1335, or T1337. In an embodiment, the Cas9 protein or a variant thereof comprises a SpCas9 variant, wherein the SpCas9 variant comprises the mutations D10A, A61R, LI 111R, D1135L, S1136W, G1218K, E1219Q, N1317R, A1322R, R1333P, R1335Q, T1337R, or a combination thereof. In an embodiment, the Cas9 protein or a variant thereof comprises a SpCas9 variant, wherein the SpCas9 variant comprises the mutations D10A, A61R, LI 111R, D1135L, S1136W, G1218K, E1219Q, N1317R, A1322R, R1333P, R1335Q, and T1337R (SpRY). In an embodiment, the Cas9 protein or a variant thereof comprises a ScCas9 variant, wherein the ScCas9 variant comprises one or more amino acid mutations at DIO, 1367, G368, 1369, H371, T375, T376, Q381, R701, or T1227. In an embodiment, the Cas9 protein or a variant thereof comprises a ScCas9 variant, wherein the ScCas9 variant comprises the mutations D10A, I367A, G368D, I369K, H371L, T375S, T376G, Q381E, R701A, T1227K, or a combination thereof. In an embodiment, the Cas9 protein or a variant thereof comprises a ScCas9 variant, wherein the ScCas9 variant comprises the mutations D10A, I367A, G368D, I369K, H371L, T375S, T376G, Q381E, R701A, and T1227K (HiFi-ScCas9++). Various embodiments of modified Cas9 proteins or Cas9 variants were disclosed in PCT application no. PCT / US2021 / 014933 filed 25 lanuary, 2021, the contents of which are incorporated by reference herein in their entireties. In an embodiment, the Cas9 protein or a variant thereof has a protospacer adjacent motif (PAM) specificity for a nucleotide sequence comprising 5'- NGG-3', 5'-NAG-3', 5'-NGA-3', 5'-NAA-3', 5'-NNAGGA-3', or 5'-NNACCA-3' wherein N isselected from A, T, C, or G. In an embodiment, the Cas9 protein or a variant thereof has a better PAM specificity for NRN over NYN wherein N is selected from A, T, C, or G, R is selected from A or G, and Y is selected from C or T. In an embodiment, the Cas9 protein or a variant thereof is not constrained with the recognition of specific PAM for the base editing activity.

[0122] In an embodiment, the nucleotide deaminase comprises an adenosine deaminase, a cytidine deaminase, or a combination thereof. In an embodiment, the adenosine deaminase comprises adenosine deaminase 1 (ADA1 ), ADA2; adenosine deaminase acting on RNA 1 (AD ARI), ADAR2, ADAR3; adenosine deaminase acting on tRNA 1 (AD ATI), ADAT2, ADAT3; and naturally occurring or engineered tRNA-specific adenosine deaminase (TadA) Tad A* 7.10, TadA*8.1, TadA*8.2, TadA*8.3, TadA*8.4, TadA*8.5, Tad A* 8.6, TadA*8.7, TadA*8.8, TadA*8.9, TadA*8.10, TadA*8.11, TadA*8.12, TadA*8.13, TadA*8.14, TadA*8.15, TadA*8.16, TadA*8.17, TadA*8.18, TadA*8.19, TadA*8.20, TadA*8.21, TadA*8.22, TadA*8.23, or Tad A" 8.24. In an embodiment, the cytidine deaminase comprises apolipoprotein B mRNA-editing enzyme, catalytic polypeptide-like (APOBEC) family of deaminases, including APOBEC 1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D / E, APOBEC3F, APOBEC3G, APOBEC3H, or APOBEC4; activation-induced cytidine deaminase (AID), e.g., activation induced cytidine deaminase (AICDA); cytosine deaminase 1 (CDA1) or CDA2; or cytosine deaminase acting on tRNA (CDAT).

[0123] In an embodiment, the base editor of the present invention further comprises an inhibitor of base excision repair. In an embodiment, the inhibitor of base excision repair comprises uracil glycolysis inhibitors (UGIs) or inosine base excision repair inhibitor.

[0124] In an embodiment, the target site on the HBV genome of the present invention comprises at least a part of an HBV pre-C gene, C gene, X gene, P gene, pre-Sl gene, pre-S2 gene, S gene, or a combination thereof. In an embodiment, the target site on the HBV genome of the present invention comprises at least a part of an HBV genome encoding an HBV polymerase, an HBV pre-core protein, an HBV core protein, an HBV surface protein (e.g., large surface protein (LHB), middle surface protein (MHB), small surface protein (SHB)), an HBV envelope protein, an HBV X protein, or a combination thereof. In an embodiment, the target site on the HBV genome of the present invention is conserved among the at least 2, 3, 4, 5, 6, 7, 8, 9 or more of the HBV genotypes. In an embodiment, the target site of the HBV genome of the present invention comprises at least part of the HBV covalently closed circular DNA (cccDNA), relaxed circular double stranded DNA (rcDNA), or a combination thereof. In an embodiment, the target site on the HBV genome comprises the positive strand of the atleast part of the HBV genome, the negative strand of the at least part of the HBV genome, or a combination thereof. In an embodiment, the target site on the HBV genome is flanked by the genome of a subject comprising a eukaryotic cell such as a human hepatocyte. In another embodiment, the target site on the HBV genome is not flanked by the genome of a subject comprising a eukaryotic cell such as a human hepatocyte.

[0125] In an embodiment, the contact between at least a part of the HBV genome with the base editor and one or more guide RNAs of the step a of the method of the present invention is in a eukaryotic cell such as hut not limited to a human cell, a mouse cell, or a rat cell. In an embodiment, the contacting is in a cell in vivo or ex vivo.

[0126] In an embodiment, the guiding of the base editor and the one or more guide RNAs to the target site of the step b of the method of the present invention comprises the interaction between the one or more guide RNAs and their target sites on the HBV genome. In an embodiment, the interaction between the one or more guide RNAs and their target sites on the HBV genome comprises at least 10, 12, 14, 16, 18, 20 contiguous base pairing.

[0127] In an embodiment, the guiding of the base editor and the one or more guide RNAs to the target sites on the HBV genome of the step b of the method of the present invention further comprises the recognition of PAM sequence on the HBV genome by the base editor. In an embodiment, the recognition of PAM sequence on the HBV genome comprises the recognition by the Cas9 protein or a variant thereof of the base editor. In an embodiment, the PAM sequence on the HBV genome comprises a nucleotide sequence comprising 5'-NGG-3’, 5'-NAG-3', 5’-NGA-3', 5'-NAA-3', 5'-NNAGGA-3', or 5'-NNACCA-3' wherein N is selected from A, T, C, or G. In an embodiment, the Cas9 protein or a variant thereof has a better PAM specificity for NRN over NYN wherein N is selected from A, T, C, or G, R is selected from A or G, and Y is selected from C or T. In an embodiment, the guiding of the base editor and the one or more guide RNAs to the target site on the HBV genome of the step b of the method of the present invention is not constrained with the recognition of specific PAM for the base editing activity.

[0128] In an embodiment, the guiding of the base editor and the one or more guide RNAs to the target site on the HBV genome of step b of the method of the present invention comprises the interaction between the one or more guide RNAs and the base editor. In an embodiment, the interaction between the one or more guide RNAs and the base editor comprises the interaction between the one or more guide RNAs and the Cas9 protein or a variant thereof of the base editor.

[0129] In an embodiment, the modification at the target site on the at least a part of the HBV genome by the base editor comprises editing one or more nucleotides by the nucleotide deaminase. In an embodiment, the nucleotide deaminase of the present invention converts a OG base pair to a T / U»A base pair of a target polynucleotide sequence. In an embodiment, the nucleotide deaminase of the present invention converts a OG base pair to a T / U*A base pair of a target site on the HBV genome without introducing double stranded breaks in the target polynucleotide sequence. In an embodiment, the nucleotide deaminase converts a T / OA base pair to a C«G base pair of a target site on the HBV genome. In an embodiment, the nucleotide deaminase converts a T / U*A base pair to a C*G base pair of a target site on the HBV genome without introducing double stranded breaks in the target polynucleotide sequence. In an embodiment, the nucleotide deaminase converts a target C to U of a polynucleotide sequence. In an embodiment, the nucleotide deaminase converts a target A to inosine (I), wherein I is treated as G by polymerase.

[0130] In an embodiment, the base editor of the present invention introduces a premature stop codon, a nonsense mutation, a missense mutation, or a combination thereof to a target site on the HBV genome. In an embodiment, the part of HBV genome altered by any embodiment of the base editor of the present invention comprises a premature stop codon, a nonsense mutation, a missense mutation, or a combination thereof that is not present before the editing by the base editor. In an embodiment, the premature stop codon comprises a nucleotide sequence comprising 5'-TAA-3', 5’-TAG-3', or 5'-TGA-3'. In an embodiment, the premature stop codon replaces an amino acid residue comprising glutamine (Q) or tryptophan (W) originally presented in the HBV genome. In an embodiment, the premature stop codon comprises Q18X or Q198X in the pre-core protein, Q169X in the core protein, Q383X or Q517X in the polymerase protein, or Q179X, Q193X, W198X, W199X, Q214X, Q264X, W326X, W328X, W345X, W362X, or W386X in the surface protein, or a combination thereof, wherein X represents a premature stop codon (e.g., Q18X indicates a replacement of QI 8 by a premature stop codon).

[0131] The present invention also provides a method of treatment for HBV comprising the step of administering to a subject any embodiment of the composition comprising a base editor and one or more guide RNAs of the present invention. In an embodiment, the subject is infected with at least an HBV genotype. In an embodiment, the HBV infection results in the presence of at least a part of the HBV genome in the subject. In an embodiment, the at least a part of the HBV genome is integrated into the subject’s genome. In an embodiment, thesubject comprises an eukaryote. In an embodiment, the subject comprises a mammal such as but not limited to a human, a mouse, or a rat.

[0132] In an embodiment, the method of treatment for HBV comprises the modification of the at least a part of the HBV genome in a subject. In an embodiment, the modification comprises the conversion of a OG base pair to a T / U»A base pair of the at least a part of the HBV genome in a subject. In an embodiment, the modification comprises the conversion of a T / U»A base pair to a OG base pair of the at least a part of the HBV genome in a subject. In an embodiment, the modification comprises the conversion of a target C to U of at least a part of the HBV genome in a subject. In an embodiment, the modification comprises the conversion of a target A to I of at least a part of the HBV genome in a subject. In an embodiment, the modification does not comprise the introduction of a double strand break in the subject’s genome. In an embodiment, the modification comprises the introduction of a premature stop codon, a nonsense mutation, a missense mutation, a combination thereof to a target site on the at least a part of the HBV genome in a subject. In an embodiment, the target site on the at least a part of the HBV genome in a subject comprises at least a part of an HBV pre-C gene, C gene, X gene, P gene, pre-Sl gene, pre-S2 gene, S gene, or a combination thereof. In an embodiment, the target site on the at least a part of the HBV genome in a subject comprises a nucleotide sequence encoding an HBV polymerase, an HBV pre-core protein, an HBV core protein, an HBV surface protein (e.g., large surface protein (LHB), middle surface protein (MHB), small surface protein (SHB)), an HBV envelope protein, an HBV X protein, or a combination thereof. In an embodiment, the premature stop codon comprises a nucleotide sequence comprising 5'-TAA-3', 5'-TAG-3', or 5'-TGA-3'. In an embodiment, the modification comprises the conversion of an amino acid residue comprising glutamine (Q) or tryptophan (W) into a premature stop codon.

[0133] In an embodiment, the method of treatment for HBV of the present invention prevents the production of a polypeptide, a protein, or a combination thereof from the at least a part of the HBV genome in a subject. In an embodiment, the method of treatment for HBV of the present invention reduces the production of a polypeptide, a protein, or a combination thereof from the at least a part of the HBV genome in a subject by at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%. In an embodiment, the polypeptide, the protein, or a combination thereof produced from the at least a part of the HBV genome comprises at least a part of the HBV polymerase, the HBV pre-core protein, the HBV core protein, the HBVsurface protein (e.g., large surface protein (LHB), middle surface protein (MHB), small surface protein (SHB)), the HBV envelope protein, the HBV X protein, or a combination thereof. In an embodiment, the method of treatment for HBV of the present invention reduces the content of HBV DNA in the subject by at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%.

[0134] In an embodiment, the administration step of the present invention may be performed in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic, vaginal, rectal, intranasal, transdermal), oral, or parenteral. Parenteral administration includes intravenous drip, subcutaneous, intraperitoneal or intramuscular injection, intravitreal, or intrathecal or intraventricular administration. The route and site of administration may be chosen to enhance delivery or targeting of the disrupting agent comprising a site-specific targeting moiety to a particular location.|0135 | The present invention also provides a composition comprising a modified HBV genome using the method to modify the genome of an HBV of the present invention.

[0136] In an embodiment, the modified HBV genome comprises a premature stop codon, a nonsense mutation, a missense mutation, or a combination thereof. In an embodiment, the premature stop codon comprises a nucleotide sequence comprising 5’-TAA-3', 5'-TAG-3', or 5’-TGA-3'. In an embodiment, the premature stop codon replaces an amino acid residue comprising glutamine (Q) or tryptophan (W) originally presented in the HBV genome.

[0137] In an embodiment, the modified HBV genome comprises at least a part of an HBV genome. In an embodiment, the at least a part of an HBV genome comprises HBV covalently closed circular DNA (cccDNA), relaxed circular double stranded DNA (rcDNA), or a combination thereof. In an embodiment, the at least a part of an HBV genome comprises a positive strand of HBV genome, a negative strand of HBV genome, or a combination thereof. In an embodiment, the modified HBV genome comprises at least a part of an HBV pre-C gene, C gene, X gene, P gene, pre-Sl gene, pre-S2 gene, S gene, or a combination thereof. In an embodiment, the at least a part of an HBV genome is flanked by the genome of a subject comprising a eukaryotic cell such as a human hepatocyte. In another embodiment, the at least a part of an HBV genome is not flanked by the genome of a subject comprising a eukaryotic cell such as a human hepatocyte. In an embodiment, the at least a part of an HBV genome comprises HBV genome of genotype A, B, C, D, E, F, G, H, I, or other genotypes. In anembodiment, the at least a part of an HBV genome is conserved among the at least 2, 3, 4, 5, 6, 7, 8, 9 or more of the HBV genotypes.

[0138] In an embodiment, the modified HBV genome of the present invention, after being transcribed and / or translated in a subject, is not capable of producing one or more of an HBV protein comprising an HBV polymerase, an HBV pre-core protein, an HBV core protein, an HBV surface protein (e.g., large surface protein (LHB), middle surface protein (MHB), small surface protein (SHB)), an HBV envelope protein, or an HBV X protein. In an embodiment, the modified HBV genome of the present invention, after being transcribed and / or translated in a subject, is not capable of producing one or more functional HBV protein comprising an HBV polymerase, an HBV pre-core protein, an HBV core protein, an HBV surface protein (e.g., large surface protein (LHB), middle surface protein (MHB), small surface protein (SHB)), an HBV envelope protein, or an HBV X protein.

[0139] In an embodiment, the modified HBV genome comprises a nucleotide sequence at least about 5%, about 10, about 20%, about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% identical to a naturally occurred HBV genome.

[0140] It is to be understood that both the foregoing general description and detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. In general, the terms used in the disclosure should not be construed to limit the technology to the specific embodiments disclosed in the specification, unless the above detailed description explicitly defines such terms. Accordingly, the actual scope of the technology encompasses the disclosed embodiments and all equivalent ways of practicing or implementing the technology.

[0141] EXAMPLES

[0142] Materials and Methods

[0143] Plasmids

[0144] The human codon-optimized base editing vectors pLenti-FNLS-P2A-Puro (BE3) and pLenti-BE4Gam-P2A-Puro (BE4), as well as U6-gRNA, were obtained from Addgene (Cambridge, MA, USA). The variant VQR (DI 135V, R1335Q, and T1337R), VRER (DI 135V, G1218R, R1335E, and T1337R), EQR (DI 135E, R1335Q, and T1337R) were generated by site-directed mutagenesis of the pLenti-BE4Gam-P2A-Puro backbone based on a previous report. CBE4max-SpRY-P2A-EGFP and Sc-l— I- were purchased from Addgene. The HiFi-Sc++ was generated via site mutagenesis, and the different versions of SpRY-BEs and HiFi-Sc++-BEs were generated via Gibson assembly. The pLenti-U6-gRNA-BSD wasgenerated through Gibson assembly, by combing the U6-BsmBI-sgRNA scaffold and the blasticidin-resistant gene, which was derived from the pLVX.AcGFP.Nl (catalog no. 632154, Clontech) backbone. The resultant gRNAs were subsequently cloned into the plasmid pLenti-U6-gRNA-BSD. The non-vector helper plasmids for lentiviral production, p8.91 and pMD.G, were obtained from the RNAi Core of Academia Sinica, Taiwan. BE- Designer-CRISPR RGEN tools were used to identify the 20-bp protospacer sequences of gRNAs targeting the HBV core, polymerase, surface, and X (http: / / www.rgenome.net / be- designer / ). 1.3x HBV-WT was derived from the pCMV-HBV backbone using Gibson assembly. 1.3x HBV-W156X-S and 1.3x HBV-W414X-P were generated by site-directed mutagenesis of the 1.3x HBV-WT backbone.

[0145] Cell Lines and Culture

[0146] HEK293T-C, -Pol, and -S cells were generated by transduction of HEK293T cells with lentiviral vector containing the harboring part or the entire ORFs of core, polymerase, and surface genes, respectively, from genotype D HBV. HEK293T, HEK293T-C, HEK293T- Pol, HEK293T-S, HepG2.2.15, and HepAD38 cells were all maintained in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS), 100 U / mL penicillin, and 100 pg / mL streptomycin (Gibco) at 37°C and 5% CO2. Additionally, 1.5 pg / mL puromycin was added to HEK293T-C, -Pol, and -S. cells, 400 pg / mL G418 was added to HepG2.2.15 cells, and 400 pg / mL G418 and tetracycline were added to HepAD38 cells. HepG2-NTCP-C4 cells were maintained in DMEM / F12, GlutaMAX (Gibco) containing 10% FBS, 100 U / mL penicillin, and 100 [i g / mL streptomycin (Gibco), 5 [ g / mL human insulin (ProSpec), 10 mM HEPES (N-2- hydroxyethylpiperazine-N ' -2-ethanesulfonic acid) (Gibco), and 1 mg / mL G418.

[0147] Transfection of Cell Lines

[0148] DNA transfection was performed using Lipofectamine 3000 according to the manufacturer’s protocol with some modifications. For transfection-based editing experiments, HEK293T, HEK293T-C, HEK293T-P, and HEK293T-S cells were seeded to 70%-80% confluence and cotransfected by the expression vectors containing the BE (pLenti- FNLS-P2A-Puro; BE3) and the sgRNA at the ratio of 4:1. For the experiments comparing the viral expression of 1.3x HBV-WT and the derived HBV with site-directed mutagenesis, Huh7 cells were transfected by the indicated plasmids, 1.3x HBV-WT, W414X-P, orW156X-S, and were then harvested at 3 days or 5 days post-transfection. Subsequently, genomic DNAs were extracted by a blood and tissue kit (QIAGEN) and subjected to Sanger sequencing, or Hirt’s DNA was extracted for a Southern blotting assay.

[0149] Lentiviral Production and Transduction

[0150] For the production of lentivirus of BEs pLenti-FNLS-P2A-Puro (BE3) and pLenti- BE4Gam-P2A-Puro (BE4), HEK293T cells were seeded in 10-cm dishes containing 5 pg / mL poly-d-lysine (Sigma, St. Louis, MO, USA). Cells were seeded 1 day before transfection, and, the next day, cells at 95% confluence were transfected with a prepared mix in Opti- MEM (Gibco) containing 6 pg of lentiviral backbone, 4 pg of p8.91, and 2 pg of pMD.G. The media were replaced with Opti-MEM containing 5% FBS, and the culture media were collected after 48 and 72 h. The supernatant was filtered with a 0.4-pm filter (Millipore, Billerica, MA, USA) and subsequently ultracentrifuged with a 20% sucrose cushion in the bottom of the tube and incubated at 26,000 rpm (4°C) for 2 h. The precipitated viral pellet was resuspended in Opti-MEM overnight and then stored at -80°C. For the production of the lentivirus of sgRNAs, HEK293T cells were seeded in a six-well plate containing 5 pg / mL poly-d-lysine (Sigma, St. Louis, MO, USA) 1 day before transfection. On the next day, cells at 95% confluence were transfected with a prepared mix in Opti-MEM containing 1.5 pg of lentiviral backbone, 1 pg of p8.91, and 0.5 pg of pMD.G. The procedures for collection, purification, and storage of lentiviruses are the same as those described above.

[0151] Transduction with BE Lentiviruses

[0152] For transduction of HepG2.2.15 and HepG2-NTCP-C4 cells, 5 x 105individual cells were seeded in a 12- well plate. After 24 h, cells were transduced with viral supernatants in the presence of Polybrene (8 pg / pL), and the plates were centrifuged for 1 h at 1,250 x g, 32°C. Three days after transduction, cells were treated with puromycin (2.5 pg / mL) and blasticidin S (5 pg / mL) for 7 days of selection. The transduced cells were trypsinized and reseeded at the same number, and subsequently transduced by the same lentivirus again as the above procedures. For the transduced HepG2.2.15 cells, the supernatants were collected at 3 and 5 days after transducing twice with pLenti-BE4Gam-P2A-Puro (BE4), and the cell lysates were collected at 5 days post-transduction. For the HepG2-NTCP-C4 transduction, cells were transduced twice with pLenti-FNLS-P2A-Puro (BE3) and gRNAs.

[0153] Preparation and Infection of HBV

[0154] Infectious HBV was produced from HepAD38 cells as described in Ladner et al. Agents Chemother. 1997;41:1715-1720. The supernatant was harvested and concentrated by 20% sucrose cushion. For the HBV infection experiment, HepG2-NTCP-C4 cells were seeded in a 12- well plate and transduced by pLenti-FNLS-P2A-Puro (BE3) and gRNA lentiviruses. After repeated lentiviral transduction for two times, HBV was infected at 5,000 genome equivalents (GE) / cell. All infections were performed as described in Yan et al. eLife. 2012;l:e00049 and. Iwamolo et al. Biochem. Biophys. Res. Commun. 2014;443:808-813. In addition, HBV was infected into HepG2-NTCP-C4 cells in a 12-well plate at 50,000 GE / cell for cccDNA detection by Southern blot. Briefly, cells were mixed with HBV in the presence of 8% PEG8000 and 5% DMSO at 37°C for 16 h in suspension. To suppress the formation of newly synthesized RC-DNA, infected HepG2-NTCP-C4 cells were treated with 20 pM 3TC (lamivudine) from 3 days after infection.

[0155] Sanger and MiSeq Sequencing of Base-Edited Genomic DNA and cccDNA

[0156] Genomic DNAs of harvested cells were extracted using a DNase blood and tissue kit (QIAGEN) according to the manufacturer’s instructions. The genomic regions of interest were amplified by PCR with the site-specific primers and PfuUltra II fusion HS DNA polymerase (Agilent Technologies) according to the manufacturer’s protocol. The PCR products were purified by the Illustra GFX PCR DNA and gel band purification kits (GE Healthcare), and were subjected to Sanger sequencing.To remove linear and RC-form HBV DNAs for Sanger and MiSeq sequencing of cccDNA, genomic DNAs were extracted and digested with T5 exonuclease (New England Biolabs) in the reaction mixture of 50 pL containing 500 ng of DNA, 5 pL of ,10x reaction buffer and 1 pL of T5 Exo at 37°C for 1 h, and afterward 11 mM EDTA was added to stop reaction.

[0157] Sanger and MiSeq Sequencing of Base-Edited Genomic DNA and cccDNA

[0158] Genomic DNAs of harvested cells were extracted using a DNase blood and tissue kit (QIAGEN) according to the manufacturer’s instructions. The genomic regions of interest were amplified by PCR with the site-specific primers (Table S3) and PfuUltra II fusion HS DNA polymerase (Agilent Technologies) according to the manufacturer’s protocol. The PCR products were purified by the Illustra GFX PCR DNA and gel band purification kits (GE Healthcare), and were subjected to Sanger sequencing.To remove linear and RC-form HBV DNAs for Sanger and MiSeq sequencing of cccDNA, genomic DNAs were extracted and digested with T5 exonuclease (New England Biolabs) inthe reaction mixture of 50 (1L containing 500 ng of DNA, 5 pL of , I Ox reaction buffer and 1 pL of T5 Exo at 37°C for 1 h, and afterward 11 mM EDTA was added to stop reaction.

[0159] Immunoblotting Assay

[0160] Cells were washed with phosphate-buffered saline (PBS) and lysed with radioimmunoprecipitation assay (RIP A) buffer (50 mM Tris-HCl [pH 7.5], 150 mM NaCl, 1 mM EDTA, 1% Nonidet P-40 [NP-40], 0.5% sodium deoxycholate, 0.1% SDS, protease inhibitor cocktail [Roche]). Whole-cell extracts were subjected to 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), followed by western blot analysis using primary antibodies (anti- -actin [Merck], anti-HBs [Ad / Ay] antibody [ab9193; Abeam, Cambridge, MA, USA]) and secondary antibody and detected by Immobilon Western Chemiluminescent HRP (horseradish peroxidase) substrate (Millipore, Billerica, MA, USA).

[0161] ELISA of HBsAg and HBeAg

[0162] Elecsys HBsAg II (Roche Diagnostics) was used for HBsAg and HBeAg qualitative determination in the culture supernatant of G2.2.15. Samples with a signal / cutoff ratio (S / CO) of >1 are considered positive, and the values are considered as a semiquantitative level of HBsAg and HBeAg respectively. The quantitative levels of HBsAg in the culture supernatant of HepG2-NTCP-C4 were measured using an Architect HBsAg kit (Abbott Laboratories). The calibration range recommended by the manufacturer was from 0 to 250 lU / mL. The positivity criterion of HBsAg was >0.05 lU / mL.

[0163] Analysis of Viral Polymerase Activity

[0164] For the experiments comparing the viral polymerase function in HBV replication of 1.3x-HBV (D)-WT, CMV-HBV and the derived HBV with site-directed mutagenesis, HepG2-NTCP-C4 and Huh7 cells were transfected by indicated plasmids (1.3xHBV (D)_WT, 1.3xHBV-pol_L33F, 1.3xHBV-pol_R35C or 1.3xHBV-pol_D380N) and were then harvested at 3 days post transfection. Subsequently, genomic DNAs was extracted by Blood and Tissue kit (Qiagen, Hilden, Germany) and subjected to Sanger sequencing, or Hirt’s DNA was extracted for Southern blotting assay.

[0165] Quantitative Real-Time PCR

[0166] The viral DNAs were purified from the supernatant of G2.2. 15 using a DNase blood and tissue kit (QIAGEN) according to the manufacturer’s instructions. The PCR reaction wasperformed in a total volume of 10 pL, which contains 4 pL of DNA template, 0.25 pM for each primer, a 0.1 pM probe, and 5 pL of TaqMan master mix. The program was 2 min at 50°C, 10 min at 95°C, and 40 cycles of 95°C for 15 s and 60°C for 1 min.

[0167] HBV DNA Extraction and Southern Blotting

[0168] HBV DNA was extracted by the modified Hirt method as previously described.18 Infected HepG2-NTCP-C4 was lysed in Hirt’s buffer (0.7% SDS, 10 mM Tris-HCl [pH 8.0], and 10 mM EDTA [pH 8.0]). The lysates were treated with 5 M NaCl and incubated at 4°C overnight and then centrifuged at 10,000 rpm for 30 min at 4°C. For extraction of DNA, the supernatant was treated by saturated phenol twice and phenol / chloroform (1 : 1) once. DNA was precipitated with 2x vol of 100% ethanol at room temperature overnight and subsequently precipitated at 10,000 rpm centrifugation at 4°C for 30 min. 30 pg of Hirt DNA was analyzed by the modified Southern blot method as described in Lin et al., Mol. Ther. Nucleic Acids. 2014;3:el86.

[0169] DNA Library Preparation and MiSeq Sequencing

[0170] A Thermo Scientific Phusion high-fidelity DNA polymerases kit was used according to the manufacturer’ s recommendations (Illumina) for DNA library preparation. Adaptor- ligated DNA was indexed and enriched through limited-cycle PCR. The DNA library was quantified with NanoDrop and through real-time PCR. The DNA library was loaded on an Illumina MiSeq instrument according to the manufacturer’s instructions and sequenced with 600 cycles by the Medical Microbiota Center of the First Core Laboratory, National Taiwan University College of Medicine.The quality of raw reads was evaluated by FastQC. Base editing efficiency and indel rates of each sample were calculated using a Python script. Briefly, the sequence of gRNA target regions in each read was identified by splitting the reads by 10-bp flanking sequences with exact matches on both sides of the target regions. Indels were calculated as the number of reads with target regions that contain insertions or deletions divided by the total read number. Base editing efficiency was measured by counting the number of A, T, C, and G bases at each position on the target sequences and then the numbers were divided by the number of total reads. The ratios of induced premature stop codons in each sample were determined by dividing the number of reads containing induced premature stop codons with the number of total reads.

[0171] Statistical Analysis

[0172] An unpaired, two-sided Student’s t test was used to compare the difference between two independent groups.

[0173] Example 1 Designing and Screening HBV-Specific gRNAs for Inducing Missense Mutations by Cas9 Base Editors (BE)

[0174] To construct the HBV-specific gRNAs that are suitable for an Cas9 base editor (Cas9- BE) or a variant thereof, we first searched for the candidate protospacer sequences across the four ORFs of the HBV genome by using the website software BE-Designer.8We identified candidate target sequences in the core, in the surface, in the polymerase, and in X ORFs (Figure 3-5). HBV-specific gRNAs were then constructed and co-transfected with codon- optimized FNLS-P2A-Puro (puromycin), hereafter named BE3 for the sake of simplicity, into integrated HBV genome-containing HEK293T cells (HBV-HEK293T cells), including HEK293T-core, HEK293Tpolymerase (pol), and HEK293T-surface cells. HEK293T were seeded 65-75% confluence in 12-well plate and co-transfected by the expression plasmids containing the HBV genome, base editor and the sgRNA at the ratio of 3:2: 1, and then the cells were harvested at 3 days post-transfection. To analyze the editing efficiency, genomic DNAs of the edited cells were extracted using the DNase Blood & Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The interest genomic regions were amplified by PCR with the site-specific primers and PfuUltra II Fusion HS DNA Polymerase (Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s protocol. The PCR products were purified by the Illustra GFX PCR DNA and Gel band Purification Kits (GE Healthcare, Chicago, IL, USA), and subjected to Sanger sequencing. The sequencing data was quantified by the online software Synthego. The efficiency of C- T / G-A conversion in these gRNA targeting sites was shown in Figure 5-6. The ratio of C- T / G-A conversion at each target site was roughly categorized as approximately 0%, less than 50%, approximately 50%, and greater than 50%. The extent of sequence conservation for the protospacer sequence and protospacer adjacent motif (PAM) of each gRNA is summarized in Figure 4 and 7. Overall, among all of the screened HBV-specific gRNAs, we discovered gRNAs targeting the core and surface ORFs with base-editing efficiency of approximately or greater than 80%.

[0175] We also performed the screening for candidate gRNAs using SpCas9- BE variants, including VQR, VRER, and EQR, which recognize altered PAMs NGAN, NGCG, and NGAG, respectively (Figure 8).31The results are summarized in Figure 9-10, which showthat the overall editing efficiency of SpCas9-BE variants was lower than that of the natural SpCas9-BE (Figure 5).

[0176] We also performed the screening for candidate gRNAs using Cas9-BE variants including ScCas9 and SpRY, which recognized altered PAMs NNG and NRN (R: A / G) respectively (Figure 11). The premature stop codon generated after base-editing and the target sequence conserveness among different genotypes are summarized in Figure 11. The editing efficiency results are summarized in Figure 12 (ScCas9-BE) and Figure 13 (SpRY- BE).

[0177] Example 2 Suppression of HBV Viral Load, HBsAg, and HBeAg by Base Editing- Specific Loci of the HBV Genome

[0178] We demonstrate that the secreted HBsAg levels were significantly decreased in Hepg2.2.15 cells ( the cell line with integrated HBV DNA) treated with gN-SlO with a decrease of over 95% (Figure 14). In addition, secreted HBeAg levels were significantly decreased in HBV-infected cells treated with gN-C2 with a decrease of over 20% (Figure 15). Finally, viral DNAs were also significantly reduced in cells treated by all these three gRNAs (Figures 16). Collectively, our results prove that cccDNA could be base edited to reduce the expression of viral proteins.

[0179] Example 3 Suppression of HBV viral load, HBsAg, and HBeAg by LNP encapsulating SpRY-BE-mRNA and guide RNAs of the present invention

[0180] Three LNP formulations encapsulating guide RNAs gN-C2 and gN-SlO were prepared (SM102, MC3, MC3-Dex). The molar ratio among the lipid compositions of each LNP formulation is shown below:SM102: SM-102: DSPC: Cholesterol: DMG-PEG2000 = 50: 10:38.5:1.5,MC3: Dlin-MC3-DMA: DSPC: Cholesterol: DMG-PEG2000 = 50: 10:38.5:1.5,MC3-Dex: Dlin-MC3-DMA: DSPC: Cholesterol: Dexamethasone: DMG-PEG2000 = 50:10:34.65:3.85:1.5.HepG2.2.15 cells were transfected with the LNPs, and the LNP-containing media was then replaced with fresh media one day after transfection. To analyze the expression of base editor in the transfected HepG2.2.15 cells, HepG2.2.15 cells transfected with 1000 ng LNP were collected at 1 and 2 days post LNP transfection. Expressions of BE-SpRY using western blotting were observed (Figure 17). To analyze the level of HBV antigens, the cell culture media was harvested at 3 and 6 days post transfection. Levels of HBV surface antigen (HBsAg) were significantly reduced via LNP transfection (Figure 18). To analyze the editingefficiency of the LNPs, transfected HepG2.2.15 cells were harvested, and the genomic DNA was extracted. Figure 19 shows the editing efficiency of the LNPs on the core gene and the surface gene. Editing on HBV surface gene by the LNPs was more efficient than editing on the core gene. In addition, editing through SM102-containing LNPs was the most efficient compared to other LNP formulations.

[0181] DISCUSSION

[0182] In this study, we demonstrate that CRISPR / Cas9-mediated BEs could successfully introduce nonsense mutations to specific loci of HBV genomes. The BEs derived from SpCas9 variants VQR, VRER, and EQR, ScCas9 and SpRY were also able to generate nonsense mutations in HBV genomes, further expanding the candidate protospacer sequences. With appropriate gRNAs and BEs, both integrated HBV genomes and cccDNAs could be base edited with high efficacy. More importantly, generation of premature stop codons in the viral surface and polymerase genes of integrated HBV genomes and cccDNAs led to significant reduction of HBsAg secretion and viral replication, a critical step toward HBV cure.|0183 | Although Cas9-mediated BEs have been shown to effectively edit a variety of host genomes, their efficacy in episomal forms of viral DNA remains questionable. The core component of the base-editing enzyme is APOBEC, which has been shown to mutate cccDNA.33. However, little is known about the effects of the subsequent DNA repair mechanisms and the uracil DNA glycosylase inhibitor on the episomal cccDNA. By using the in vitro HBV infection system, we proved the nucleotide C to T conversion of cccDNA, which was accompanied by the significant reduction of HBsAg secretion and HBV replication. This is a proof of concept that Cas9-mediated Bes can be utilized to target and silence cccDNA.

[0184] Integration of HBV genomes into host chromosomes occurs in the early stage of HBV infection.7Although the integrated HBV genome is not a source for productive HBV infection, it often causes continuous secretion of HBsAg, which has long been suggested to suppress the antiviral immunity and allows for establishment of persistent HBV infection. As a result, targeting integrated HBV genomes or silencing surface gene expression to prevent persistent HBsAg secretion is considered a critical step toward the functional cure of HBV.11 34Nevertheless, prior attempts to cleave integrated HBV genomes byWTSpCas9 endonuclease may result in host genome large deletions and complex rearrangements, which can cause pathologic consequences.25In contrast, Cas9-mediated BEs change the target base in genomic DNA without making DSBs of DNA, and they may reduce the risk of genomicdamage. Recently, inactivation of HBV genes by siRNA-based strategies has gained wide interest for silencing the expression of HBs Ag, but the effect is transient unless restoration of antiviral immunity can be achieved.9Unlike siRNA-based strategies, Cas9-mediated BEs can silence HBV gene expression permanently by introducing nonsense mutations to viral genes. As we show herein, Cas9-mediated BEs effectively generated premature stop codons of the surface gene in both integrated HBV genomes and cccDNAs and reduced HBsAg secretion. Therefore, Cas9-mediated BEs are advantageous for its transient expression to achieve longterm suppression of HBsAg expression, demonstrating its potential for functional HBV cure.

[0185] Despite the promising potential of the Cas9-mediated BE as an HBV cure, there remain several daunting challenges, including off-target effects and the difficulty for in vivo delivery of Cas9, the same as those faced by WT Cas9 endonuclease.24Moreover, mutagenesis with premature stop codons will generate truncated viral proteins and may carry potentially pathogenic or carcinogenic effects, which should be cautiously evaluated.Although we showed that the off-target mutations caused by base editing were quite low, this risk still cannot be ignored.37In addition, in vivo delivery is particularly challenging for Cas9 BEs because they are larger than WT Cas9 for the appended base-editing domains.Nevertheless, several strategies have been adopted to minimize the off-target effects of Cas9- mediated genome editing.38 39Recently, the intein-mediated split-Cas9 systems have also been developed to reduce the insert size to fit the cargo capacity of the AAV system.40,41Alternatively, the advance of non- viral delivery systems with lipid nanoparticle may improve their in vivo delivery efficiency.42,43Future study in a disease-relevant animal model is required to prove the in vivo efficacy of Cas9 BEs for inactivation of HBV.

[0186] In conclusion, Cas9-mediated BEs provide an opportunity for permanent inactivation of both cccDNA and integrated HBV DNA without DSBs of DNA. Combined with NAs, which effectively inhibit ongoing viral replication, Cas9-mediated BEs may eventually achieve the ultimate cure of HBV by suppressing both HBV replication and HBsAg production.

[0187] It can be appreciated by those skilled in the art that changes could be made to the examples described above without departing from the broad inventive concept thereof. It is understood, therefore, that this invention is not limited to the particular examples disclosed, but it is intended to cover modifications within the spirit and scope of the present invention as defined by the appended claims.

[0188] References which are each hereby incorporated in its entirety1. Yang H.C., et al. Revisiting the natural history of chronic HBV infection. Curr. Hepatol. Rep. 2016;15: 141-149.2. Papatheodoridis G., et al. Discontinuation of oral antivirals in chronic hepatitis B: A systematic review. Hepatology. 2016;63: 1481-1492.3. Nassal M. HBV cccDNA: viral persistence reservoir and key obstacle for a cure of chronic hepatitis B. Gut. 2015;64:1972-1984.4. Lok A.S., et al. Hepatitis B cure: from discovery to regulatory approval. Hepatology. 2017;66:1296-1313.5. Revill P.A., et al. A global scientific strategy to cure hepatitis B. Lancet Gastroenterol. Hepatol. 2019;4:545-558.6. Mason W.S., et al. HBV DNA integration and clonal hepatocyte expansion in chronic hepatitis B patients considered immune tolerant. Gastroenterology. 2016; 151:986-998. e4.7. Tu T., et al. HBV DNA integration: molecular mechanisms and clinical implications. Viruses. 2017;9:E75.8. Seeger C., et al. Molecular biology of hepatitis B virus infection. Virology. 2015;479- 480:672-686.9. Wooddell C.I., et al. RNAi-based treatment of chronically infected patients and chimpanzees reveals that integrated hepatitis B virus DNA is a source of HBsAg. Sci. Transl. Med. 2017;9:eaan0241. [PMC free article] [PubMed] [Google Scholar]10. Bertoletti A., et al. Adaptive immunity in HBV infection. J. Hepatol. 2016;64(1 , Suppl):S71-S83.11. Cornberg M., et al. Hepatitis: no cure for hepatitis B and D without targeting integrated viral DNA? Nat. Rev. Gastroenterol. Hepatol. 2018;15:195-196.12. Stone D., et al. Genome editing and the next generation of antiviral therapy. Hum. Genet. 2016;135: 1071-1082.13. Kennedy E.M., et al. Gene editing: a new tool for viral disease. Annu. Rev. Med. 2017;68:401-411.14. Bloom K., et al. Inactivation of hepatitis B virus replication in cultured cells and in vivo with engineered transcription activator-like effector nucleases. Mol. Ther. 2013;21 : 1889— 1897.15. Chen J., et al. An efficient antiviral strategy for targeting hepatitis B virus genome using transcription activator-like effector nucleases. Mol. Ther. 2014;22:303-311.16. Jinek M., et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 2012;337:816-821.17. Jiang W., et al. Annu. Rev. Microbiol. 2015;69:209-228.18. Lin S.R., et al. The CRISPR / Cas9 system facilitates clearance of the intrahepatic HBV templates in vivo. Mol. Ther. Nucleic Acids. 2014;3:el86.19. Seeger C., et al. Targeting hepatitis B virus with CRISPR / Cas9. Mol. Ther. Nucleic Acids. 2014;3:e216.20. Karimova M., et al. CRISPR / Cas9 nickase-mediated disruption of hepatitis B virus open reading frame S and X. Sci. Rep. 2015;5:13734.21 . Liu X., et al. Inhibition of hepatitis B virus by the CRISPR / Cas9 system via targeting the conserved regions of the viral genome. J. Gen. Virol. 2015;96:2252-2261.22. Ramanan V., et al. CRISPR / Cas9 cleavage of viral DNA efficiently suppresses hepatitis B virus. Sci. Rep. 2015;5: 10833.23. Ely A., et al. Progress with developing use of gene editing to cure chronic infection with hepatitis B virus. Mol. Ther. 2016;24:671-677.24. Yang H.C., et al. The potential and challenges of CRISPR-Cas in eradication of hepatitis B virus covalently closed circular DNA. Virus Res. 2018;244:304-310.25. Kosicki M., et al. Repair of double-strand breaks induced by CR1SPR-Cas9 leads to large deletions and complex rearrangements. Nat. Biotechnol. 2018;36:765-771.26. Rees H.A., et al. Base editing: precision chemistry on the genome and transcriptome of living cells. Nat. Rev. Genet. 2018;19:770-788.27. Komor A.C., et al. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature. 2016;533:420-424.28. Schatoff E.M., et al. Base editing the mammalian genome. Methods. 2019; 164-165 GOO- IOS.29. Komor A.C., et al. Improved base excision repair inhibition and bacteriophage Mu Gam protein yields C:G-to-T:A base editors with higher efficiency and product purity. Sci. Adv. 2017;3:eaao4774.30. Zafra M.P., et al. Optimized base editors enable efficient editing in cells, organoids and mice. Nat. Biotechnol. 2018;36:888-893.31. Yang Y.C., et al. Permanent inactivation of HBV genomes by CRISPR / Cas9-mediated non-cleavage base editing. Mol Ther Nucleic Acids. 2020;20:480-490.32. Rajoriya N., et al. How viral genetic variants and genotypes influence disease and treatment outcome of chronic hepatitis B. Time for an individualized approach? J Hepatol. 2017;67: 1281-1297.33. Velkov S., et al. The global hepatitis B virus genotype distribution approximated from available genotyping data. Genes (Basal). 2018;9:495.

Claims

CLAIMS1. A composition comprising a base editor and one or more guide RNAs wherein each of the nucleotide sequence of the one or more guide RNAs is at least about 80% identical to a nucleotide sequence selected from SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO. 3 to SEQ ID NO. 62.

2. The composition of claim 1 , wherein the one or more guide RNAs each comprises a nucleotide sequence of SEQ ID NO. 1 or SEQ ID NO. 2.

3. The composition of claim 1 , wherein the base editor comprises a Cas9 protein or a variant thereof and a nucleotide deaminase.

4. The composition of claim 3, wherein the Cas9 protein or a variant thereof comprises a nuclease inactivated variant or a nickase variant.

5. The composition of claim 3, wherein the Cas9 protein or a variant thereof comprises a SpCas9 variant comprising one or more amino acid mutations at DIO, S55, A61, R221, G366, N394, M495, N497, Y515, K526, R661, R691, N692, M694, Q695, H698, E762, K810, D839, H840, K848, Q926, N963, H983, D986, K1003, R1060, G1104, Lil l i, D1135, S1136, T1138, V1139, K1151, G1218, E1219, E1243, L1245, E1253, A1285, K1289, T1314, N1317, A1322, D1332, R1333, R1335, or T1337.

6. The composition of claim 5, wherein the SpCas9 variant comprises the mutations D10A, A61R, L1111R, D1135L, S1136W, G1218K, E1219Q, N1317R, A1322R, R1333P, R1335Q, T1337R, or a combination thereof.

7. The composition of claim 3, wherein the Cas9 protein or a variant thereof comprises a ScCas9 variant comprising one or more amino acid mutations at DIO, 1367, G368, 1369, H371, T375, T376, Q381, R701, or T1227.

8. The composition of claim 7, wherein the ScCas9 variant comprises the mutations D10A, 1367 A, G368D, I369K, H371L, T375S, T376G, Q381E, R701A, T1227K, or a combination thereof.

9. The composition of claim 3, wherein the Cas9 protein or a variant thereof is not constrained with the recognition of specific PAM for the base editing activity.

10. The composition of claim 3, wherein the nucleotide deaminase comprises an adenosine deaminase, a cytidine deaminase, or a combination thereof.

11. The composition of claim 3, wherein the base editor further comprises an inhibitor of base excision repair.

12. The composition of claim 11, wherein the inhibitor of base excision repair comprises uracil glycolysis inhibitors (UGIs), or inosine base excision repair inhibitor.

13. The composition of claim 1, further comprises a nanoparticle encapsulating the base editor and the one or more guide RNAs.

14. The composition of claim 13, wherein the nanoparticle comprises ionizable lipid, phospholipid, steroid, and PEGylated lipid at a molar ratio of 50:10:38.5: 1.5.

15. A method for modifying an HBV genome using the composition of claim 1 comprising the steps of: a. contacting at least a part of the HBV genome with a base editor and one or more guide RNAs, b. guiding the base editor and the one or more guide RNAs to a target site on the HBV genome based on the guide RNA, c. modifying the at least a part of the HBV genome at the target site using the base editor.

16. The method of claim 15, wherein the base editor comprises a Cas9 protein or a variant thereof and a nucleotide deaminase.

17. The method of claim 16, wherein the Cas9 protein or a variant thereof comprises a nuclease inactivated variant or a nickase variant.

18. The method of claim 16, wherein the Cas9 protein or a variant thereof comprises a SpCas9 variant comprising one or more amino acid mutations at DIO, S55, A61, R221, G366, N394, M495, N497, Y515, K526, R661, R691, N692, M694, Q695, H698, E762, K810, D839, H840, K848, Q926, N963, H983, D986, K1003, R1060, G1104, El l 11, DI 135, SI 136, T1138, VI 139, KI 151, G1218, E1219, E1243, L1245, E1253, A1285, K1289, T1314, N1317, A1322, D1332, R1333, R1335, or T1337.

19. The method of claim 18, wherein the SpCas9 variant comprises the mutations D10A, A61R, L1111R, D1135L, S1136W, G1218K, E1219Q, N1317R, A1322R, R1333P, R1335Q, T1337R, or a combination thereof.

20. The method of claim 15, wherein the Cas9 protein or a variant thereof comprises a ScCas9 variant comprising one or more amino acid mutations at DIO, 1367, G368, 1369, H371, T375, T376, Q381, R701, or T1227.

21. The method of claim 20, wherein the ScCas9 variant comprises the mutations D10A, 1367 A, G368D, I369K, H371L, T375S, T376G, Q381E, R701 A, T1227K, or a combination thereof.

22. The method of claim 15, wherein the Cas9 protein or a variant thereof is not constrained with the recognition of specific PAM for the base editing activity.

23. The method of claim 15, wherein the nucleotide deaminase comprises an adenosine deaminase, a cytidine deaminase, or a combination thereof.

24. The method of claim 15, wherein the base editor further comprises an inhibitor of base excision repair.

25. The method of claim 24, wherein the inhibitor of base excision repair comprises uracil glycolysis inhibitors (UGIs), or inosine base excision repair inhibitor.

26. The method of claim 16, wherein the target site on the HBV genome comprises at least a part of an HBV pre-C gene, C gene, X gene, P gene, pre-Sl gene, pre-S2 gene, S gene, or a combination thereof.

27. The method of claim 16, wherein the modification comprises the conversion of a C*G base pair to a T / U»A base pair or a T / U»A base pair to a C*G base pair of at least a part of the HBV genome at the target site.

28. The method of claim 15, wherein the modification comprises the introduction of a premature stop codon, a nonsense mutation, a missense mutation, or a combination thereof to the target site on the HBV genome.

29. The method of claim 15, wherein the modification does not comprise the introduction of a DNA double strand break.

30. A method of treatment of HBV or chronic HBV comprising the step of administering the composition of claim 1 to a subject whose cells produces a polypeptide, a protein, or a combination thereof from at least a part of the HBV genome.

31. The method of claim 30, wherein the administration prevents the production of a polypeptide, a protein, or a combination thereof from at least a part of the HBV genome in the subject.

32. The method of claim 30, wherein the administration reduces the production of a polypeptide, a protein, or a combination thereof from the at least a part of the HBV genome in the subject.

33. The method of claim 30, wherein the administration reduces the content of HBV DNA in the subject.

Images