Composition for real-time PCR
Using a DNA polymerase without 5'→3' exonuclease activity and a labeled probe in real-time PCR, the method addresses probe degradation issues, ensuring accurate detection and diagnosis of tuberculosis and antibiotic-resistant strains through effective melting curve analysis.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-09-05
- Publication Date
- 2026-03-12
AI Technical Summary
Existing real-time PCR methods using Taqman probes suffer from probe degradation during amplification, leading to reduced accuracy in melting curve analysis for detecting antibiotic-resistant tuberculosis bacteria.
Employing a DNA polymerase lacking 5'→3' exonuclease activity to prevent probe degradation, combined with a probe labeled with a reporter and quencher, allowing for accurate melting curve analysis and detection of mutations.
Enables rapid, simple, and accurate detection and diagnosis of tuberculosis infection and antibiotic-resistant strains by maintaining probe integrity for effective melting curve analysis.
Smart Images

Figure KR2025013763_12032026_PF_FP_ABST
Abstract
Description
Composition for real-time PCR
[0001] The present invention relates to a composition for real-time polymerase chain reaction and a method for detecting antibiotic-resistant tuberculosis bacteria using the same.
[0002] Real-time polymerase chain reaction (Real-time PCR) is a PCR-based method that monitors the amplification reaction of a target nucleic acid sequence over time and measures parameters related to the level of amplification, enabling real-time PCR. Real-time PCR can simultaneously amplify a target nucleic acid sequence and measure its quantity, making it useful for DNA genotyping and mutation detection.
[0003] A typical melting curve assay using real-time PCR is a method for genotyping and detecting mutations in amplified DNA by analyzing the decrease in fluorescence value that occurs during the process in which an intercalating dye that fluoresces between double-stranded DNA amplification products after PCR is completed is unwound into single strands as the temperature increases (US 8364415 B2).
[0004] However, intercalating dyes do not react specifically to specific double-stranded DNA, but rather bind to all double-stranded DNA and fluoresce, potentially leading to false positives. To address this, probes that specifically react to a single target are required.
[0005] Taqman probes are used as such probes. These are probes with a specific sequence that have a reporter that emits fluorescence at the 5' end and a quencher that quenches the fluorescence at the 3' end. They hybridize specifically and sequence-wise with a single target (or an amplification product of the target) present in the reaction mixture below a specific temperature. By observing the fluorescence value of the reporter separated from the quencher during the extension process of DNA polymerase, the amplification of the target can be qualitatively and quantitatively confirmed.
[0006] That is, by using a Taqman probe that specifically binds to a specific sequence and fluoresces instead of an intercalating dye that nonspecifically binds to all nucleic acid sequences, it is possible to qualitatively and quantitatively confirm whether a single target is amplified.
[0007] However, Taqman probes typically degrade during the amplification process, resulting in a reduced absolute amount in the final amplified product, which is detrimental to melting curve analysis. Therefore, research into more accurate and efficient melting curve analysis is still needed.
[0008]
[0009] The present invention provides a composition for real-time polymerase chain reaction and a method for detecting antibiotic-resistant tuberculosis bacteria using the same.
[0010]
[0011] One object of the present invention is to provide a composition for real-time PCR.
[0012] Another object of the present invention is to provide a cartridge for real-time PCR comprising the composition.
[0013] Another object of the present invention is to provide a composition for detecting antibiotic-resistant tuberculosis bacteria.
[0014] Another object of the present invention is to provide a method for detecting antibiotic-resistant tuberculosis bacteria.
[0015] Another object of the present invention is to provide a method for providing information for diagnosing antibiotic-resistant tuberculosis infection.
[0016] Another object of the present invention is to provide a use of the composition for real-time PCR for detecting antibiotic-resistant tuberculosis bacteria.
[0017]
[0018] The present invention has the advantage of enabling rapid, simple, and accurate detection and diagnosis of tuberculosis infection and antibiotic-resistant tuberculosis using a composition for real-time PCR.
[0019] Figure 1 shows the results of analysis of amplification curves and melting curves for each enzyme using real-time PCR.
[0020] Figure 2 is about the optimal reaction composition for real-time PCR.
[0021] Figure 3 shows the results according to the distance between the reporter and quencher within the probe.
[0022] Figure 4 (4a-4f) shows the results of qualitative and quantitative analysis using MTB complex-specific genes.
[0023] Figure 5 is about primers of the rpoB gene for detection of antibiotic resistance mutations.
[0024] Figure 6 (6a-6b) relates to a probe of the rpoB gene for detecting antibiotic resistance mutations.
[0025] Figure 7 is about primers and probes of inhA and katG for detection of antibiotic resistance mutations.
[0026] Figure 8 shows the results of melting curve analysis for detecting antibiotic resistance mutations using real-time PCR.
[0027]
[0028] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in the present invention can also be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in the present invention fall within the scope of the present invention. Furthermore, the scope of the present invention should not be considered limited by the specific descriptions described below.
[0029] Furthermore, those skilled in the art will recognize or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific embodiments of the invention described herein. Furthermore, such equivalents are intended to be encompassed by the present invention.
[0030]
[0031] One aspect of the present invention provides a composition for real-time PCR.
[0032] In the present invention, "real-time PCR" refers to a PCR-based experimental method that monitors the amplification reaction of a target nucleic acid sequence to be detected over time and measures parameters related to the level of amplification, thereby enabling real-time polymerase chain reaction. Because real-time PCR allows for simultaneous confirmation of amplification of a target nucleic acid sequence and measurement of its amount, it is used for DNA genotyping and mutation detection.
[0033] In real-time PCR, the fluorescence (signal) generated according to the increase in the amplification product by PCR is monitored in real time, the number of cycles until the amplification product (signal) reaches a certain level is measured, and the copy number of the target gene in the original biological sample is estimated by referring to the calibration curve created using a standard sample. Specific examples of the real-time PCR method include a fluorescent probe method (e.g., TaqMan method, molecular beacon method, cycling probe method) that uses a fluorescently labeled probe, or an intercalator method that uses a reagent that fluoresces by binding to double-stranded DNA. The present invention is specifically characterized by using a probe that has a reporter at the 5' end and a quencher at the 3' end; a reporter at the 3' end and a quencher at the 5' end; or a reporter and a quencher present at the internal bases of the probe.
[0034] Currently, DNA polymerases commonly used in real-time PCR, such as Taq polymerase, degrade Taqman probes during the amplification process, so the probes are consumed during the synthesis process and their absolute amount decreases, making it disadvantageous for performing melting curve assays.
[0035] In order to solve this problem, in one specific example of the present invention, real-time PCR was performed using a DNA polymerase that does not have 5'→3' exonuclease activity, compared to the case where the existing Taq polymerase was used. As a result, when the DNA polymerase according to the present invention was used, the probe was not degraded during the amplification process, so the probe was present in the PCR product after the amplification was completed, showing a distinct melting peak, and it was confirmed that it is advantageous for Tm confirmation even in a relatively low concentration of template, and thus advantageous for melting curve analysis used for genotyping or mutation detection (Fig. 1).
[0036]
[0037] That is, in conventional real-time PCR, fluorescence occurs when the probe is degraded during the synthesis process by utilizing the 5'→3' exonuclease activity of DNA polymerase. On the other hand, when using DNA polymerase without 5'→3' exonuclease activity, the probe maintains a coiled conformation before hybridizing with the target sequence, so the reporter and quencher are close together, which suppresses fluorescence. However, when the probe hybridizes with the target sequence, the coiled structure is released, and when the reporter and quencher physically move away from each other, a difference in fluorescence values occurs. Through this, the presence of a nucleic acid target sequence and whether the nucleic acid target sequence has been amplified can be confirmed by analyzing the difference in fluorescence values without decomposing the probe.
[0038] In addition, by performing a melting curve analysis using a probe that has not been degraded even after amplification is complete, the presence or absence of a mutation in the nucleic acid target sequence can be determined by the denaturation temperature, or Tm (Melting temperature), depending on the binding force between the probe sequence and the nucleic acid target sequence. For example, using the Tm value, it is possible to determine whether a mutation that occurred within the nucleic acid target sequence is a genotype that causes antibiotic resistance.
[0039] The term "melting curve assay" of the present invention refers to a method for analyzing the melting temperature of a double-stranded nucleic acid formed by target DNA or RNA and a probe. This method is called melting curve analysis because it is performed by, for example, Tm (Melting temperature) analysis or analysis of the melting curve of the double strand.
[0040] This is a method for determining the presence or absence of a nucleic acid target sequence by forming a hybrid (double-stranded DNA) between a target single-stranded DNA of a detection sample and the probe using a probe complementary to a detection target sequence (nucleic acid target sequence) containing the nucleic acid for detection purposes, then performing a heat treatment on this hybrid formation, detecting dissociation (melting) of the hybrid due to an increase in temperature by a change in a signal such as absorbance, and then determining a melting temperature (Tm) value based on the detection result.
[0041] The Tm value is higher as the homology of the hybridization product increases, and it is lower as the homology decreases. Therefore, the Tm value (evaluation reference value) is obtained in advance for the hybridization product between the detection target sequence including the nucleic acid target sequence and the probe complementary thereto, and the Tm value (measured value) between the target single-stranded DNA of the detection sample and the probe is measured. If the measured value is the same as the evaluation reference value, it can be determined as a match, that is, the nucleic acid target sequence exists, and if the measured value is lower than the evaluation reference value, it can be determined as a mismatch, that is, the nucleic acid target sequence does not exist.
[0042] The melting curve analysis of the present invention can detect polymorphisms or mutations in genes by using the melting temperature (Tm) value that appears when a probe to which a reporter and a quencher are combined is attached to a complementary nucleic acid target sequence and then detaches from the nucleic acid target sequence as the temperature rises.
[0043]
[0044] As one embodiment of the present invention, a composition for real-time PCR comprises a DNA polymerase without 5'→3' exonuclease activity; a primer set; and a probe.
[0045] The probe is labeled with a reporter at the 5' end and a quencher at the 3' end; a reporter at the 3' end and a quencher at the 5' end; or a reporter and a quencher are labeled at the internal bases of the probe.
[0046] The composition may be a real-time PCR composition involving melting curve analysis, wherein the distance between the reporter and the quencher is 10 to 50 mer.
[0047]
[0048] The term "DNA polymerase lacking 5'→3' exonuclease activity" of the present invention means an enzyme lacking or having a 5'→3' exonuclease activity removed from among the activities of DNA polymerases, and as a specific example, it may be at least one selected from the group consisting of Klenow fragment, Klentaq, and aTaq™ DNA polymerase (Promega Corp.), but any DNA polymerase lacking 5'→3' exonuclease activity is sufficient and is not limited thereto. The "DNA polymerase lacking 5'→3' exonuclease activity" can be obtained synthetically, as a known protein, or commercially in various ways.
[0049]
[0050] The term "probe" in the present invention refers to a nucleic acid fragment, such as RNA or DNA, capable of forming a specific binding with a gene or mRNA. The probe may have a length ranging from a few bases to several hundred bases. It may be produced in the form of an oligonucleotide probe, a single-stranded DNA probe, a double-stranded DNA probe, an RNA probe, etc.
[0051] The probe may include labels used for detection at the 5' end and 3' end of the corresponding base sequence, or at the internal bases. For example, the probe of the present invention may have a reporter labeled at the 5' end and a quencher labeled at the 3' end. In another example, the probe of the present invention may have a reporter labeled at the 5' end and a quencher labeled at the 3' end, or may include the reporter and quencher within the sequence.
[0052] The above reporter can be used without limitation as long as it is a fluorescent substance commonly used in the field, for example, Cy3, Cy5, Cy5.5, Bodipy, Alexa 488, Alexa 532, Alexa 546, Alexa 568, Alexa 594, Alexa 660, fluorescein, 5-carboxyfluorescein (5'-FAM), 6-carboxyfluorescein (6-Carboxyfluorescein; FAM), hexachloro-6-carboxyfluorescein, tetrachloro-6-carboxyfluorescein, Orange green 488X, Orange green 514X, HEX (2',4',5',7',-tetrachloro-6-carboxy-4,7-dichlorofluorescein), TET, Oyster 556, Oyster 645, Bodipy 630 / 650, Bodipy 650 / 665, Quasar 670, VIC, JOE, 5-(2'-aminoethyl)amino naphthalene-1-sulfonic acid, coumarin and its derivatives, Cyanine-5, Lucifer Yellow, Texas Red, Rhodamine, Tetramethylrhodamine, 5-TAMRA, 6-TAMRA, Yakima Yellow, Calfluor Orange 546, CalRed610, etc. can be used.
[0053] The above quencher can be used without limitation as one commonly used in the relevant field, and for example, nonfluorescent quenchers such as minor groove binder (MGB), tetramethylrhodamine, carboxytetramethylrhodamine, Black Hole Quencher (BHQ)1, BHQ2, BHQ3, 4'-benzoic acid, 4-dimethylaminophenyl azophenyl-4'-maleimide, SFC Quencher (SFCQ), SFCQ1, SFCQ2, etc. can be used.
[0054] The above reporter and quencher can be used in a modified form (e.g., an internally modified form) that can be commonly used in the art at the internal and / or terminal bases of the probe sequence.
[0055] When real-time polymerase chain reaction is performed using a probe labeled as above, the amplified product can be monitored in real time, enabling accurate quantitative detection of DNA and RNA, and since electrophoresis is not required, rapid, simple, and accurate diagnosis is possible.
[0056]
[0057] In one specific example of the present invention, the probe may have a distance (length) of bases (nucleotides) between the reporter and the quencher of 10 to 50 mer, or 20 to 37 mer. For example, the number of bases between the reporter and the quencher labeled on the probe may be, but is not limited to, 10 to 50; 15 to 45; 12 to 40; 15 to 40; 17 to 40; 18 to 40; 20 to 40; 18 to 36; 20 to 37; 20 to 36; or 26 to 32.
[0058] At this time, the distance (length) of the base 'mer' can be used interchangeably with the number of bases.
[0059]
[0060] The term "primer" of the present invention means a short nucleic acid sequence having a short free 3' terminal hydroxyl group, which can form base pairs with a complementary template and functions as a starting point for copying the template strand.
[0061] The primer can initiate DNA synthesis in the presence of reagents for polymerization (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature. PCR conditions and the lengths of the forward (sense) and reverse (antisense) primers can be modified based on those known in the art. The primer can incorporate additional features that do not alter the basic properties of the primer that serve as the initiator of DNA synthesis. In addition, the primer can include a label that is detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical, or chemical means, if desired. Examples of labels include enzymes (alkaline phosphatase), radioisotopes (e.g., 32P), fluorescent molecules, and chemical groups (e.g., biotin).
[0062] In the present invention, a "primer set" refers to a combination of two or more primers capable of amplifying a target gene. A primer set comprising two primers, a forward primer and a reverse primer, each corresponding to a specific region may be referred to as a primer pair.
[0063] The primer of the present invention is composed of a nucleic acid, which may be a single-stranded nucleic acid. In the present invention, the nucleic acid refers to a molecule in which nucleotides and molecules having functions equivalent to the nucleotides are polymerized. Examples include DNA, RNA, and polymers of RNA and DNA. When RNA is included, "T (thymine)" in the DNA sequence is referred to as "U (uracil)" in the base sequence. The primer of the present invention can be prepared by any chemical synthesis method known to those skilled in the art. For example, the primer can be prepared using an enzyme such as a nuclease, or can be prepared using a commercially available DNA / RNA automated synthesizer (Applied Biosystems, Beckman Instruments, etc.). In such primers, the constituent nucleic acids can be further freely modified.
[0064] For example, in the primer of the present invention, the 5' end or the 3' end may include, but is not limited to, a labeling substance (e.g., a fluorescent molecule, a dye molecule, a radioactive isotope, an organic compound such as digoxigenin or biotin, etc.) and / or an additional sequence (a loop primer portion used in the LAMP method, etc.) to facilitate detection or amplification of the primer.
[0065]
[0066] In addition, the composition for real-time PCR of the present invention may further include a buffer solution containing at least one selected from the group consisting of dNTP, MgSO4, KCl, and betaine.
[0067] In one specific example, the buffer solution may contain dNTPs in a range of, but not limited to, 1 to 10 mM, 1 to 8 mM, 2 to 6 mM, or 2 to 4 mM.
[0068] Additionally, MgSO4 may be included in a range of, but is not limited to, 1 to 15 mM, 1.5 to 14 mM, 2 to 13 mM, 2.5 to 12.5 mM, 3 to 12 mM, 4 to 11 mM or 5 to 10 mM.
[0069] Additionally, KCl may be included in a range of, but is not limited to, 10 to 150 mM, 20 to 130 mM, 25 to 125 mM, 30 to 120 mM, 20 to 110 mM or 50 to 100 mM.
[0070] Additionally, betaine may be included in a concentration range of, but not limited to, 0.1 to 3 M, 0.15 to 2.5 M, 0.2 to 2 M, 0.25 to 1.25 M or 0.5 to 1 M.
[0071] The composition of the present invention may additionally include any component necessary for amplifying and detecting genes in addition to the above.
[0072] For example, the composition of the present invention may include a reverse transcriptase enzyme, a tube or other suitable container, a DNA polymerase cofactor (e.g., magnesium ion, etc.), DNase, RNase inhibitor, DEPC-water, sterile water, a buffer, etc.
[0073]
[0074] In one specific example of the present invention, the composition may be for detecting Mycobacterium tuberculosis complex and determining antibiotic resistance.
[0075] The term "Mycobacterium tuberculosis complex (MTBC)" of the present invention refers to a Mycobacteria genus that causes tuberculosis, and may include at least one selected from Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium africanum, Mycobacterium canettii, Mycobacterium caprae, Mycobacterium microti, and Mycobacterium pinnipedii.
[0076] Tuberculosis (TB) is one of the most incurable infectious diseases that threatens human life worldwide, along with AIDS and malaria. The rate of drug-resistant TB has been increasing recently. Treatment of drug-susceptible TB typically involves a combination of first-line anti-TB drugs: rifampin (RIF), isoniazid (INH), ethambutol (EMB), and pyrazinamide (PZA). Resistance to both rifampin and isoniazid is defined as multidrug-resistant tuberculosis (MDR-TB).
[0077] It is known that more than 95% of tuberculosis bacteria resistant to rifampicin have mutations in the rpoB gene region, known as the rifampicin resistance determinant region (Ramaswamy S, et al., Tuber Lung Dis. Vol.79. pp.3-29, 2015.), and resistance of tuberculosis bacteria to isoniazid is known to be caused by mutations in the katG and inhA genes (Seifert M, et al., PLoS ONE. Vol. 10(3), e0119628. 2015).
[0078]
[0079] The term "one or more" in the present invention may include 1, 2, 3,,, or any combination of the listed configurations.
[0080]
[0081] The composition according to the present invention can simultaneously detect tuberculosis bacteria and determine antibiotic resistance, enabling efficient detection of tuberculosis bacteria and diagnosis of infection. This is useful because it enables the correct and rapid selection of anti-tuberculosis drugs in the treatment of tuberculosis patients, thereby enabling early treatment and preventing the spread of infection.
[0082]
[0083] In one specific example of the present invention, the primers and probes of the composition for real-time PCR may be specific to the Mycobacterium tuberculosis IS6110 gene or IS1081 gene.
[0084] At this time, the IS6110 gene or IS1081 gene refers to a gene region specific to tuberculosis bacteria.
[0085] In one specific example of the present invention, the primer may be at least one selected from SEQ ID NOs: 48, 49, 51, and 52.
[0086] Additionally, the primers may include a primer set of SEQ ID NO: 48 and SEQ ID NO: 49; a primer set of SEQ ID NO: 51 and SEQ ID NO: 52; or all of the above.
[0087] In another specific embodiment of the present invention, the probe may be at least one selected from SEQ ID NOs: 50 and 53.
[0088] In another specific embodiment of the present invention, the primer and probe are
[0089] (1) A primer set consisting of SEQ ID NO: 48 and SEQ ID NO: 49; and a probe consisting of SEQ ID NO: 50;
[0090] (2) a primer set consisting of sequence numbers 51 and 52; and a probe consisting of sequence numbers 53; or
[0091] It may include both (1) and (2) above.
[0092]
[0093] In addition, as another specific example of the present invention, the primers and probes of the composition may be specific for one or more genes selected from the antibiotic-resistant tuberculosis genes rpoB, katG, and inhA.
[0094] In one specific example of the present invention, the primer and probe can enable detection of a mutation in any one or more bases selected from positions 511, 513, 515, 516, 526, 531, and 533 of the rpoB gene. In addition, the primer and probe according to the present invention can enable detection of a mutation in the 315th base position of katG, and can enable detection of a base mutation in any one or more positions selected from positions 8 and 15 of the inhA gene.
[0095]
[0096] In another specific embodiment of the present invention, the primer may be at least one selected from SEQ ID NOs: 19, 20, 22, 23, 28, 29, 37, and 41.
[0097] Specifically, it may be at least one primer set selected from the primer sets consisting of SEQ ID NO: 28 and SEQ ID NO: 29; SEQ ID NO: 37 and SEQ ID NO: 41; SEQ ID NO: 19 and SEQ ID NO: 20; and SEQ ID NO: 22 and SEQ ID NO: 23.
[0098] In another specific embodiment of the present invention, the probe may be one or more selected from SEQ ID NOs: 6, 16, 17, 18, 21, and 24.
[0099] In addition, the primers and probes may be at least one selected from (1) a primer set of SEQ ID NO: 28 and SEQ ID NO: 29; and a probe of SEQ ID NO: 6; (2) a primer set of SEQ ID NO: 28 and SEQ ID NO: 29; and a probe of SEQ ID NO: 16; (3) a primer set of SEQ ID NO: 37 and SEQ ID NO: 41; and a probe of SEQ ID NO: 17; (4) a primer set of SEQ ID NO: 37 and SEQ ID NO: 41; and a probe of SEQ ID NO: 18; (5) a primer set of SEQ ID NO: 19 and SEQ ID NO: 20; and a probe of SEQ ID NO: 21; and (6) a primer set of SEQ ID NO: 22 and SEQ ID NO: 23; and a probe of SEQ ID NO: 24.
[0100]
[0101] In another specific example of the present invention, the primers and probes of the composition for real-time PCR may be specific for at least one gene selected from the Mycobacterium tuberculosis IS6110 gene, the Mycobacterium tuberculosis IS1081 gene, the antibiotic-resistant Mycobacterium tuberculosis gene rpoB, the antibiotic-resistant Mycobacterium tuberculosis gene katG, and the antibiotic-resistant Mycobacterium tuberculosis gene inhA.
[0102] At this time, the primers and probes may be at least one selected from (1) a primer set of SEQ ID NO: 48 and SEQ ID NO: 49; and a probe of SEQ ID NO: 50; (2) a primer set of SEQ ID NO: 51 and SEQ ID NO: 52; and a probe of SEQ ID NO: 53; (3) a primer set of SEQ ID NO: 28 and SEQ ID NO: 29; and a probe of SEQ ID NO: 6; (4) a primer set of SEQ ID NO: 28 and SEQ ID NO: 29; and a probe of SEQ ID NO: 16; (5) a primer set of SEQ ID NO: 37 and SEQ ID NO: 41; and a probe of SEQ ID NO: 17; (6) a primer set of SEQ ID NO: 37 and SEQ ID NO: 41; and a probe of SEQ ID NO: 18; (7) a primer set of SEQ ID NO: 19 and SEQ ID NO: 20; and a probe of SEQ ID NO: 21; and (8) a primer set of SEQ ID NO: 22 and SEQ ID NO: 23; and a probe of SEQ ID NO: 24.
[0103]
[0104] Meanwhile, even if the present invention describes a 'polynucleotide of a specific sequence number', a 'polynucleotide represented by a specific sequence number', a 'polynucleotide having a nucleotide sequence described by a specific sequence number', or a 'polynucleotide comprising a nucleotide sequence described by a specific sequence number', it is obvious that a polynucleotide having a nucleotide sequence in which some sequences are deleted, modified, substituted, or added can also be used in the present invention if it has the same or corresponding activity as a polynucleotide composed of the nucleotide sequence of the corresponding sequence number.
[0105] For example, if it has the same or corresponding activity as the polynucleotide, it is obvious that a polynucleotide in which a part of the sequence is added to or at the end of the nucleotide sequence of the corresponding sequence number, or in which a part of the sequence is deleted from or at the end of the nucleotide sequence of the corresponding sequence number, also falls within the scope of the present invention.
[0106] Homology and identity refer to the degree to which two given base sequences are related and can be expressed as a percentage.
[0107] The terms homology and identity are often used interchangeably.
[0108] Sequence homology or identity of conserved polynucleotides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences are generally capable of hybridizing under moderate or high stringency conditions along at least about 50%, 60%, 70%, 80%, or 90% of the entire sequence or its full length.
[0109] Homology or identity of polynucleotide sequences can be determined, for example, using the algorithm BLAST by the literature [see Karlin and Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873 (1993)] or FASTA by Pearson (see Methods Enzymol., 183, 63, 1990). Based on the BLAST algorithm, programs called BLASTN and BLASTX have been developed (see http: / www.ncbi.nlm.nih.gov). Additionally, whether any amino acid or polynucleotide sequence has homology, similarity or identity can be determined by comparing the sequences by Southern hybridization experiments under defined stringent conditions, and appropriate hybridization conditions are within the skill of the art and can be determined by methods well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F. M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).
[0110] The primers and probes provided in the present invention are not limited to oligonucleotides composed of each of the above-mentioned sequence numbers, and variants thereof having a base sequence that hybridizes to a base sequence complementary to the base sequence shown in each sequence number under strict conditions and similarly functioning as a primer or probe are also included in the scope of the present invention. In addition, primers / probes that have the function of amplifying and detecting the sequences that can be amplified and detected by the primers / probes provided in the present invention are also included in the scope of the present invention.
[0111] The above primers or probes can incorporate additional features without altering their basic properties. That is, modifications to the oligonucleotide sequence can be made using conventional means known in the art, as long as they exhibit the effect of detecting the tuberculosis bacteria targeted by the present invention.
[0112] Non-limiting examples of such modifications include methylation, capping, substitution of one or more nucleotides with their homologues, and modifications between nucleotides, such as modification with uncharged linkers (e.g., methylphosphonate, phosphotriester, phosphoroamidate, carbamate, etc.) or charged linkers (e.g., phosphorothioate, phosphorodithioate, etc.). Furthermore, the nucleic acids may have one or more additional covalently linked moieties, such as nucleases, toxins, antibodies, signal peptides, proteins such as poly-L-lysine, intercalators such as acridine or psoralen, chelators of metals, radioactive metals, iron-oxidizing metals, and manganese-containing agents.
[0113]
[0114] The composition of the present invention may be used for qualitative or quantitative detection of a target gene using a real-time PCR method.
[0115]
[0116] Methods for monitoring the amplification reaction of real-time PCR include, but are not limited to, attaching a luminescent substance to a phagocytic gene complementary to the base sequence of the target gene and measuring the fluorescence released at the initial stage of gene amplification. For example, fluorescence sensitivity can be detected using a dsDNA-binding dye such as SYBR Green, a hydrolysis probe such as a TaqMan probe, Beacons, or Scorpions, or a hybridization probe such as a Light Cycler.
[0117] Methods for calculating experimental results in quantitative polymerase chain reaction can be broadly divided into absolute quantification and relative quantification.
[0118]
[0119] Absolute quantitation is a method of quantifying a target nucleic acid by comparing its Ct (Cycle Threshold) value with the Ct value of a standard nucleic acid of known concentration. In absolute quantitation, a standard curve is first created, and then the unknown amount is compared to the standard curve to extrapolate the value. A "standard curve" is a functional equation that represents the linear relationship between the Ct values for each concentration obtained by measuring the Ct values using the same primers from a standard material of known genome copy number and performing regression analysis on these values. For example, gDNA (genomic DNA) or plasmid can be used to create a standard curve.
[0120] Relative quantitative analysis is a method of quantifying the expression rate of a target gene relative to the expression rate of a control gene. It uses a method similar to creating a standard curve, but uses a different arithmetic formula, and the PCR efficiency of the control gene must be similar to that of the target gene.
[0121] In one specific embodiment of the present invention, the composition of the present invention may further include, but is not limited to, a reference gene of the Mycobacterium tuberculosis complex (MTBC). This gene may be used to create a standard curve. The sequence information of this reference gene may be obtained from a known database or obtained by analyzing tuberculosis bacteria provided by the International Institute for the Study of Tuberculosis.
[0122]
[0123] The composition of the present invention can perform not only quantitative detection of a target gene through a real-time PCR method but also melting curve analysis as a qualitative detection method.
[0124] In one specific example of the present invention, the melting curve analysis may be performed using, but is not limited to, the FMCA (Fluorescence Melting Curve Analysis) method.
[0125] The fluorescence melting curve analysis of the present invention is a method for analyzing a melting curve using a fluorescent substance. More specifically, the melting curve can be analyzed using a probe containing a fluorescent substance. The fluorescent substance may be a reporter or a quencher, or an intercalating fluorescent substance.
[0126] In the present invention, not only can amplification of a nucleic acid target sequence be performed through real-time PCR, but also a fluorescence melting curve can be analyzed through the amplified product and a selected probe to select and detect antibiotic-resistant tuberculosis bacteria.
[0127]
[0128] The composition of the present invention may further include any component necessary for amplifying and detecting a gene.
[0129] For example, the composition of the present invention may include a reverse transcriptase, a tube or other suitable container, a reaction buffer, a DNA polymerase cofactor (e.g., magnesium ion, etc.), deoxynucleotides (dNTPs), a polymerase, DNase, an RNase inhibitor, DEPC-water, sterile water, MgCl2, a buffer, etc. The enzyme may be an enzyme that is stable at the temperature at which the PCR reaction is performed.
[0130]
[0131] The real-time PCR composition of the present invention can be used for diagnosing tuberculosis infection.
[0132] In one specific example of the present invention, the composition may be used for quantitative determination of tuberculosis bacteria genes.
[0133] In one specific example of the present invention, the tuberculosis gene may be at least one selected from the IS6110 gene and the IS1081 gene.
[0134] The terms of the present invention are as described above.
[0135] As described above, tuberculosis infection can be diagnosed by amplifying, quantifying, and detecting tuberculosis bacteria genes using the composition for real-time PCR.
[0136]
[0137] The term "diagnosis" of the present invention includes determining the susceptibility of an individual to a particular disease or condition, determining whether an individual currently has a particular disease or condition, or monitoring the condition of an individual to provide information about the efficacy of a treatment.
[0138] For the purpose of the present invention, the diagnosis may be to confirm whether there is an infection with MTBC (Mycobacterium tuberculosis complex), specifically, whether there is an infection with tuberculosis bacteria, and / or to determine whether the infected tuberculosis bacteria are antibiotic-resistant bacteria.
[0139]
[0140] Another aspect of the present invention provides a cartridge for real-time PCR comprising the composition.
[0141] The above cartridge may contain, but is not limited to, a test tube or other suitable container, an enzyme such as reverse transcriptase, DNase, RNase inhibitor, DEPC-water, sterile water, etc., in addition to the composition for real-time PCR described above.
[0142]
[0143] Another aspect of the present invention provides a composition for detecting antibiotic-resistant tuberculosis bacteria.
[0144] In one specific example of the present invention, the composition for detecting antibiotic-resistant tuberculosis bacteria may include one or more primer sets and probes selected from the following (1) to (6).
[0145] (1) A primer set of SEQ ID NO: 28 and SEQ ID NO: 29; and a probe of SEQ ID NO: 6;
[0146] (2) Primer set of SEQ ID NO: 28 and SEQ ID NO: 29; and probe of SEQ ID NO: 16;
[0147] (3) Primer set of SEQ ID NO: 37 and SEQ ID NO: 41; and probe of SEQ ID NO: 17;
[0148] (4) Primer set of SEQ ID NO: 37 and SEQ ID NO: 41; and probe of SEQ ID NO: 18;
[0149] (5) a primer set of sequence numbers 19 and 20; and a probe of sequence number 21; and
[0150] (6) Primer set of SEQ ID NO: 22 and SEQ ID NO: 23; and probe of SEQ ID NO: 24.
[0151] The composition for detecting tuberculosis bacteria of the present invention may further include any component necessary for amplifying and detecting genes, as described above.
[0152]
[0153] Another aspect of the present invention provides a method for detecting antibiotic-resistant tuberculosis bacteria, comprising the steps of amplifying a nucleic acid target sequence isolated from a sample through real-time PCR using the composition, and obtaining and analyzing a melting curve using the amplified product.
[0154] The term "sample" in the present invention may include, without limitation, any biological sample derived from or isolated from an individual infected or suspected of being infected with tuberculosis bacteria. Examples thereof include, but are not limited to, blood, plasma, serum, bone marrow, tissue, cells, saliva, sputum, hair, urine, etc. Examples of such individuals include birds, mammals, and humans. Examples of such mammals include humans, mice, rats, cows, horses, pigs, dogs, sheep, ferrets, hamsters, monkeys, apes, goats, or cats. The process of isolating nucleic acids from a specimen may be performed using a known process.
[0155]
[0156] As a specific example of the present invention, the method for detecting antibiotic-resistant tuberculosis bacteria may be for performing qualitative detection, and the qualitative detection may be for determining the tuberculosis bacteria gene or determining the mutant genotype.
[0157] At this time, the tuberculosis gene may be at least one selected from the IS6110 gene and the IS1081 gene. In addition, the determination of the mutant genotype may be a determination of whether there is a mutation (mutation) in the rpoB, katG, and inhA genes.
[0158] In one specific example of the present invention, the mutation of the rpoB gene may refer to a mutation of any one or more bases selected from base positions 511, 513, 515, 516, 526, 531, and 533 in the base sequence of the rpoB gene, the mutation of the katG gene may refer to a mutation at the 315th base position in the base sequence of the katG gene, and the mutation of the inhA gene may refer to a base mutation at any one or more positions selected from base positions 8 and 15 in the base sequence of the inhA gene. By detecting base mutations at the above positions, it may be possible to determine whether or not there is antibiotic resistance.
[0159] In one specific example of the present invention, the non-mutant genes rpoB, katG and inhA may be, but are not limited to, the rpoB, katG and inhA genes of the Mycobacterium tuberculosis H37Rv (GenBank accession No. L05910) strain.
[0160]
[0161] Another aspect of the present invention is a method of using the composition, through real-time PCR,
[0162] (1) A quantitative step including a step of amplifying a nucleic acid target sequence isolated from a sample and obtaining an amplification curve;
[0163] (2) a qualitative step including a step of obtaining a melting curve analysis using the amplified product; and
[0164] (3) A method for detecting antibiotic-resistant tuberculosis bacteria is provided, including a step of separately analyzing the obtained amplification curve and melting curve or analyzing them sequentially or simultaneously.
[0165] The above terms are as described above.
[0166]
[0167] In the present invention, the step of obtaining the amplification curve or melting curve is performed through real-time PCR (polymerase chain reaction), and in one specific example, the analysis of the amplification curve can be analyzed by measuring the Ct (cycle threshold) value, and the analysis of the melting curve can determine the presence or absence of a nucleic acid target sequence or whether it is mutated through melting peak analysis.
[0168] In the present invention, the term "nucleic acid target sequence" refers to a nucleic acid sequence to be detected, which is annealed or hybridized with a primer or probe under hybridization, annealing, or amplification conditions. The term "nucleic acid target sequence" is not different from the terms "target nucleic acid," "target nucleic acid sequence," "target sequence," or "target nucleic acid sequence" used herein, and they are used interchangeably herein.
[0169] As used herein, the term "hybridization" refers to the formation of a double-stranded nucleic acid by complementary single-stranded nucleic acids. Hybridization can occur when the complementarity between the two nucleic acid strands is perfect (a perfect match), or even when some mismatched bases are present. The degree of complementarity required for hybridization can vary depending on the hybridization conditions, and can be particularly controlled by temperature.
[0170]
[0171] Another aspect of the present invention provides a method for providing information for diagnosing antibiotic-resistant tuberculosis infection, comprising the steps of amplifying a nucleic acid target sequence isolated from a sample through real-time PCR using the composition, and obtaining and analyzing a melting curve using the amplified product.
[0172] The above terms are as described above.
[0173]
[0174] Another aspect of the present invention provides a method for diagnosing tuberculosis infection, comprising the step of performing real-time PCR on a nucleic acid target sequence isolated from a sample using the composition.
[0175] In one specific example of the present invention, the diagnostic method may include a step of amplifying and analyzing a nucleic acid target sequence isolated from a sample through real-time PCR.
[0176] In one specific example of the present invention, the diagnostic method may include a step of obtaining and analyzing a melting curve using a product amplified through real-time PCR.
[0177] Analysis of the above amplification and / or melting curves can be used to diagnose tuberculosis infection and / or infection with antibiotic-resistant tuberculosis bacteria.
[0178] The above terms are as described above.
[0179]
[0180] Another aspect of the present invention is,
[0181] The present invention provides a composition for use in real-time PCR with melting curve analysis, comprising a DNA polymerase lacking 5'→3' exonuclease activity; a primer set; and a probe, wherein the probe comprises a reporter at the 5' end and a quencher at the 3' end; a reporter at the 3' end and a quencher at the 5' end; or a reporter and a quencher labeled at internal bases of the probe, wherein the distance between the reporter and the quencher is 10 to 50 mer.
[0182] Another aspect of the present invention provides a use of the composition for real-time PCR for detecting tuberculosis bacteria or determining antibiotic resistance thereof.
[0183] The above tubercle bacilli may be at least one selected from the Mycobacterium tuberculosis complex consisting of Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium africanum, Mycobacterium canettii, Mycobacterium caprae, Mycobacterium microti, and Mycobacterium pinnipedii.
[0184] Another aspect of the present invention provides a use of the composition for real-time PCR for detecting antibiotic-resistant tuberculosis bacteria.
[0185] Another aspect of the present invention provides a use of the composition for real-time PCR for diagnosing antibiotic-resistant tuberculosis infection.
[0186] The above terms are as described above.
[0187]
[0188]
[0189] Hereinafter, this application will be described in more detail through examples and experimental examples. However, these examples and experimental examples are intended to exemplify this application and the scope of this application is not limited to these examples and experimental examples.
[0190]
[0191] Example 1: Analysis of enzyme-specific amplification and melting curves using real-time PCR
[0192]
[0193] In order to compare the effects of melting curve analysis according to enzyme type using real-time PCR, the effects were compared using Klenow fragment as an example of a DNA polymerase without 5'→3' exonuclease activity of the present invention and Taq polymerase as an example of a conventional DNA polymerase having the 5'→3' exonuclease activity.
[0194] Specifically, a primer set (SEQ ID NO: 1 and 2) and a probe (SEQ ID NO: 3) were designed with a specific sequence of the rpoB gene of Mycobacterium tuberculosis, and when the same Oligo was used, the effect on melting curve analysis was compared and analyzed depending on the type of enzyme.
[0195] The forward primer and the reverse primer sequences were positioned 5' and 3' away from the 'hot spot region' (81 bp) where antibiotic-resistant mutations of Mycobacterium tuberculosis are concentrated, and a probe that can hybridize within the generated amplified product was designed to have a Tm around 68°C as the standard for a perfect match (100%). Using the primer set and probe, the melting peak height of the melting curve was compared according to the type of enzyme to compare the efficiency of melting curve analysis.
[0196] Specifically, in order to compare the height of the melting peak according to the enzyme type, a reaction mixture of 0.3 μM of the primer set and probe, 2 mM of dNTPs, 5 mM of MgSO4, 50 mM of KCl, and 0.5 M of Betaine was prepared, and 48 cycles were repeated at 95 °C (denaturation) for 20 seconds, 68 °C (annealing) for 20 seconds, and fluorescence measurement (scan), 72 °C (synthesis) for 20 seconds. After PCR, all double strands were denatured at 95 °C, and melting curve analysis was performed by increasing the temperature by 1 °C every second from 50 °C to 90 °C, and fluorescence measurement was performed for every 1 °C increase in temperature.
[0197] The template used in the reaction was the gDNA of Mycobacterium tuberculosis H37Rv donated from the International Institute of Tuberculosis in Masan, and 1x10 3 It was used as cp / test.
[0198] As a result, in the amplification graph as shown in Fig. 1, the fluorescent marker of the probe degraded by Taq polymerase showed an RFU value of 5,000 due to the accumulated fluorescence value, and a value below 0 was observed due to the probes whose melting peak heights that could be used for melting curve analysis were exhausted.
[0199] On the other hand, when using Klenow fragments, only the amount bound to the amplification product can be observed due to the probes that are not degraded, so it shows a Ct value similar to the RFU value of 4,000, but the melting peak height is 620, which is about three times higher than the melting peak height that can be confirmed when using Taq polymerase.
[0200] That is, when using the Klenow fragment, the melting peak height increases as the number of probes that can hybridize to the total amount of amplification products located within the corresponding probe sequence increases, which is advantageous for confirming Tm even with a relatively low concentration of template.
[0201]
[0202] Example 2. Exploration of optimal reaction mixture composition for real-time PCR using a DNA polymerase lacking 5'→ 3' exonuclease activity.
[0203]
[0204] The DNA polymerase of the present invention lacking 5'→ 3' exonuclease activity has some differences in protein structure from conventional DNA polymerases such as Taq Polymerase. Accordingly, the buffer solution used in the reaction can be suitably modified to suit the properties of the nucleic acid template to be detected, such as a conventional PCR or real-time polymerase chain reaction buffer solution containing dNTP, MgCl2, KCl, betaine, etc. Therefore, the following search was conducted to derive the optimal buffer solution composition and concentration that yields the highest melting peak height.
[0205] In order to derive the optimal reactant composition using sequences 1, 2, and 3 used in Example 1 to configure the optimal buffer solution concentration, the primer sets and probes of sequences 1, 2, and 3 in the composition of the reactants used in Example 1 were set to 0.3 μM, and 2 mM dNTPs, 50 mM KCl, 0.5 M Betaine, and 5 mM MgSO4 were used as controls, and the melting peak height was analyzed by lowering or increasing the composition of the buffer solution, respectively.
[0206] The concentration of each composition was analyzed for optimal reactant composition using the concentration of each buffer solution as an independent variable, as shown in Table 1: dNTP was 1 mM, 2 mM, 3 mM, 4 mM; KCl was 25 mM, 50 mM, 75 mM, 100 mM, 125 mM; Betaine was 0.25 M, 0.5 M, 0.75 M, 1 M, 1.25 M; and MgSO4 was 2.5 mM, 5 mM, 7.5 mM, 10 mM.
[0207] SaltRangedNTP1,2, 3,4,5KCl25,50, 75,100, 125Betaine0.25,0.5, 0.75,1,1.25MgSO42.5,5, 7.5,10, 12.5
[0208] The reaction conditions were 95°C (denaturation) for 20 seconds, 68°C (annealing) for 20 seconds, and fluorescence measurement (scan), 72°C (synthesis) for 20 seconds, repeated for 48 cycles. After PCR, all double strands were denatured at 95°C, and melting curve analysis was performed by increasing the temperature by 1°C per second from 50°C to 90°C, and fluorescence measurement was performed for every 1°C increase in temperature. The test concentration of the template was 1x10 3 It was used as cp / test.
[0209]
[0210] As a result, when analyzing the amplification graph and melting peak height as shown in Fig. 2, it was confirmed that the optimal concentrations were 2 mM to 4 mM for dNTP, 50 mM to 100 mM for KCl, 0.5 M to 1 M for Betaine, and 5 mM to 10 mM for MgSO4.
[0211]
[0212] Example 3. Searching for the optimal distance between the reporter and quencher of a probe.
[0213]
[0214] In order to search for the optimal distance between the reporter and the quencher of the probe of the present invention, the positions of the reporter and the quencher were manufactured differently as 12mer, 17mer, 20mer, 26mer, 32mer, and 37mer according to the nucleotide distance between the reporter and the quencher, and comparison was made after melting curve analysis.
[0215] At this time, depending on the wavelength of fluorescence, when the reporter was FAM or HEX, BHQ1 was used as a quencher, and when the reporter was Cy5, BHQ2 was used as a quencher. In order to compare the height of the melting curve according to the distance between the reporter and the quencher of the present invention, the primer sets of SEQ ID NO: 1 and SEQ ID NO: 2 and the reaction mixtures of each SEQ ID NO: 42, 43, 44, 45, 46, and 47 of Table 2 below were prepared and 48 cycles were repeated at 95°C (denaturation) for 20 seconds, 68°C (annealing) for 20 seconds, and fluorescence measurement (scan), 72°C (synthesis) for 20 seconds. After PCR was completed, all double strands were denatured at 95°C, and melting curve analysis was performed by increasing the temperature by 1°C every second from 50°C to 90°C, and fluorescence measurement was performed for every 1°C increase in temperature. The test concentration of the mold is 1x10 3 It was used as cp / test.
[0216]
[0217] Sequence number Name Sequence (5' → 3') Sequence 42F-Q 12mer 5'-CCCGCTGTCGGGGTTGACCCACAAG / iFAM_T / CGCCGACTGTCG-BHQ1-3' Sequence 43F-Q 17mer 5'-CCCGCTGTCGGGGTTGACCC / iFAM_T / ACAAGCGCCGACTGTCG-BHQ1-3' Sequence 44F-Q 20mer 5'-CCCGCTGTCGGGGTTGA / iFAM_T / CCCACAAGCGCCGACTGTCG-BHQ1-3' Sequence 45F-Q 26mer 5'-CCCGCTGTCGG / iFAM_T / GGTTGACCCACAAGCGCCGACTGTCG-BHQ1-3' Sequence 46F-Q 32mer5'-CCCGC / iFAM_T / TGTCGGGGTTGACCCACAAGCGCCGACTGTCG-BHQ1-3'Sequence 47F-Q 37mer5'-FAM-CCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCG-BHQ1-3'
[0218] The sequences selected through Example 3 showed the results shown in Fig. 3. According to Fig. 3, when the distance between the reporter and the quencher was 12 mer (corresponding to 'sequence 42' in Fig. 3), the melting peak was not formed because the distance between the reporter and the quencher was too close, and when the distance between the reporter and the quencher was 17 mer, it was confirmed that the z melting peak height was reduced even though the sequences were the same (corresponding to 'sequence 43' in Fig. 3). When the distance between the reporter and the quencher was 20 mer or more, a distinct peak height was observed that enabled melting peak height analysis, and in particular, the highest melting peak height was observed when the reporter and the quencher were located at a distance of 26 mer and 32 mer (corresponding to 'sequence 45' and 'sequence 46' in Fig. 3). On the other hand, when the reporter and quencher were located at a distance of 37 mer, it was confirmed that the melting peak height actually decreased (corresponding to 'Sequence 44' in Fig. 3). This confirmed that the probe can be effectively used for melting peak height analysis when the distance between the reporter and quencher is 20 mer to 37 mer, and that the effect is particularly excellent at a distance of about 26 mer to 32 mer.
[0219]
[0220] Example 4: Primer set and probe search for qualitative and quantitative analysis of IS1081 and IS6110.
[0221]
[0222] The optimal oligo set capable of performing qualitative and quantitative analysis of the MTB complex (M. tuberculosis, M. bovis, M. africanum, M. microti, M. canettii, M. pinnipedii) under the optimal reactant composition of the present invention was explored.
[0223] Since IS1081 and IS6110 are genes (SEQ ID NO: 54 and SEQ ID NO: 55) that exist specifically in the MTB Complex, they can be qualitatively detected and the amount of MTB Complex DNA present in the reactant can be inferred through the derivation of a Ct value proportional to the concentration, enabling qualitative and quantitative analysis.
[0224]
[0225] Using the optimal reaction composition set in Example 3 above, 48 cycles were performed at 95°C (denaturation) for 20 seconds, 68°C (annealing) for 20 seconds, and fluorescence measurement (scan), 72°C (synthesis) for 20 seconds. After PCR, all double strands were denatured at 95°C, and melting curve analysis was performed by increasing the temperature by 1°C per second from 50°C to 90°C, and fluorescence measurement was performed for every 1°C increase in temperature. The test concentration of the template for each strain was 1x10 3 , 1x10 2 , 1x10 1 , was used as cp / test.
[0226] As a result of performing PCR using sequence numbers 48, 49, and 50 targeting the IS1081 gene selected through the present invention and sequence numbers 51, 52, and 53 targeting the IS6110 gene, it was confirmed that all MTB complexes could be qualitatively detected (Table 3).
[0227] At this time, probe sequence numbers 50 and 53 were used with HEX conjugated to the 5' end as a reporter and BHQ1 conjugated to the 3' end as a quencher.
[0228] In addition, it was confirmed that quantitative analysis was also possible by confirming that the Ct values for each strain of the MTB Complex were located on a straight line with R2=0.999 (Fig. 4(4a~4f)).
[0229]
[0230] Sequence number Name Sequence (5' → 3') Sequence 48 IS1081_FGACGCCGAATCAGTTGTTGCCCAATATG Sequence 49 IS1081_RGGTGAACGCCAGCAGGTCGGT Sequence 50 IS1081_PTCTGACCGACAAACTCCCCGCGG Sequence 51 IS6110_FTTCGGACCACCAGCACCTAACCG Sequence 52 IS6110_RGCGTCGGTGACAAAGGCCACG Sequence 53 IS6110_PCACCTATGTGTCGACCTGGGCAGGGT
[0231]
[0232] Example 5: Optimal probe search for rpoB, inhA, and katG for detection of resistance mutations.
[0233] Under the optimal reactant composition of the present invention, an optimal oligo set was searched for the hot spot region of rpoB where mutations conferring resistance to rifampicin are concentrated, an oligo set detecting mutations occurring at positions -8 and -15 of inhA where mutations conferring resistance to isozide are located, and an optimal oligo set capable of detecting mutations occurring at codon position 315 of katG. The mutations that can be detected in each gene are shown in Table 4.
[0234]
[0235] RIF-resistanceINH-resistanceN=33rpoBkatGinhACTG511CCG--1CAA513GAA--1ATG515GTGAGC315ACC -1GAC516GGCAGC315ACC-2GAC516GTCAGC315ACC-3GAC516TAC--2CAC526AACAGC315ACC-1CAC526CGC--15 C > T1CAC526CTCAGC315ACC-15 C > T1CAC526GAC--1CAC526GGC--15 C > T1CAC526TACAGC315ACC-1TCG531TTGAGC315ACC-8TCG531TTG--8 T > C2TCG531TTG--1TCG531TTG--15 C > T1TCG531TTG--8 T > A1TCG531TTGAGC315ACC-15 C > T1CTG533CCGAGC315ACC-2-AGC315ACC-15 C > T1
[0236] Mutations in rpoB are concentrated in the 81mer hot spot region, so it is impossible to detect all 81mers with a single probe. Therefore, in the present invention, four probes of appropriate length were selected for the commonly used PCR process, and an oligo set capable of detecting each mutation was searched. In addition, since probes with long sequences (-20mer or longer) have a small effect on Tm changes due to mismatches at the 5' and 3' ends, they were designed to overlap with adjacent probes to increase accuracy, so that one mutation can be cross-validated with two probes, and the optimal combination was searched.
[0237] The rpoBHot spot region was divided into four large parts, and the Tm of the probe was set at 72°C. The Tm values were calculated based on the GC contents in the sequence of the antibiotic-susceptible strain (WT, Mycobacterium tuberculosis H37Rv (GenBank accession No. L05910; hereinafter, H37Rv) and then sequentially designed.
[0238] Additionally, palindromic sequences were intentionally mismatched to increase PCR efficiency in order to prevent mutations present at the location to be detected from forming self-dimers with high GC content or oligos themselves.
[0239] In particular, since the sequences near the 3' codon of the hot spot region are GC rich (more than 60%), self-dimers were excluded by inducing mismatches in relatively short or unreported mutation regions during oligo design.
[0240] That is, it was confirmed that the resistance mutation occurring within the hot spot region could be detected by using four probes (SEQ ID NO: 6, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18) selected from the rpoB gene (Fig. 5 and Fig. 6 (6a-6b)).
[0241] In addition, it was confirmed that the four selected probes had the optimal efficiency for selecting mutants of rpoB, as they had higher melting peak heights than the non-selected probes.
[0242]
[0243] In addition, probes for detecting isoniazid resistance mutations of inhA and katG exist at positions that can be detected with a single probe, and a probe (SEQ ID NO: 24, SEQ ID NO: 21) capable of detecting all of them was designed, and primers capable of amplifying them were designed.
[0244] The reaction composition set in Example 3 was repeated 48 cycles of 95°C (denaturation) for 20 seconds, 68°C (annealing) for 20 seconds, and fluorescence measurement (scan), 72°C (synthesis) for 20 seconds. After PCR, all double strands were denatured at 95°C, and melting curve analysis was performed by increasing the temperature by 1°C every second from 50°C to 90°C, and fluorescence measurement was performed for every 1°C increase in temperature. The test concentration of the template was 1x103 It was used as cp / test.
[0245] The results for the selected primers and probes of inhA, katG (primer sets of SEQ ID NO: 22 and SEQ ID NO: 23 and probe of SEQ ID NO: 24; primer sets of SEQ ID NO: 19 and SEQ ID NO: 20 and probe of SEQ ID NO: 21) are as disclosed in Fig. 7.
[0246]
[0247] Example 6: Search for the optimal primer set for the probe for detecting the resistant rpoB mutation.
[0248]
[0249] In the present invention, the probe for detecting rpoB was designed to be able to detect the entire hot spot region, but in this case, the 5' end probe and the 3' end probe have a distance difference of about 60 mer. In order to detect the entire hot spot region of rpoB, the sequence must be designed so that the probe amplifies the entire sequence of the corresponding region. However, if the probe is designed as described above, the length of the PCR amplification product becomes long, which causes problems such as a decrease in amplification efficiency due to the use of dNTPs used in PCR. Therefore, in order to prevent a decrease in PCR efficiency, the target region of rpoB was divided into two parts, SEQ ID NO: 6 and SEQ ID NO: 16, and SEQ ID NO: 17 and SEQ ID NO: 18, and each part was separated into a primer set to search for an optimal primer set.
[0250]
[0251] The positions of SEQ ID NO: 6 and SEQ ID NO: 16 are intended to detect mutations from codon 507 to codon 521, and thus applying the reverse primer designed at positions of SEQ ID NO: 17 and SEQ ID NO: 18 does not affect mutation detection. The positions of SEQ ID NO: 17 and SEQ ID NO: 18 are intended to detect mutations from codon 522 to codon 533, and thus applying the forward primer at position SEQ ID NO: 6 does not affect mutation detection. The optimal primers for the two-part primer set, SEQ ID NO: 6 and SEQ ID NO: 16, and SEQ ID NO: 17 and SEQ ID NO: 18, are designed to reduce the length of the PCR amplification product and to determine whether the PCR efficiency and the efficiency of melting peak height analysis can be increased.
[0252]
[0253] Sequence numbers 25 to 33 are sequences that can amplify positions 6 and 16 of SEQ ID NO. 6, and sequence numbers 34 to 41 are designed as sequences that can amplify positions 17 and 18 of SEQ ID NO. 1. The optimal reaction composition was 95°C (denaturation) for 20 seconds, 68°C (annealing) for 20 seconds, and fluorescence measurement (scan), 72°C (synthesis) for 20 seconds, repeated for 48 cycles. After PCR, all double strands were denatured at 95°C, and melting curve analysis was performed by increasing the temperature by 1°C every second from 50°C to 90°C, and fluorescence measurement was performed for every 1°C increase in temperature. The test concentration of the template was 1x10 3 It was used as cp / test.
[0254] Example 3 Sequence numbers 1, 2, and 3 were used as controls (Control). As a result, in Fig. 6 (6a-6b), it was confirmed that the melting peak heights of Sequence numbers 28 and 29 were 4 times more effective than the control groups Sequence numbers 1 and 2, and that the melting peak height of Sequence number 17 was 2 times more effective than the control groups Sequence numbers 1 and 2. Therefore, based on the above results, primer sets of Sequence numbers 28 and 29; and primer sets of Sequence numbers 37 and 41 were selected.
[0255] The sequences of the probes and primers used above are as shown in Table 5. Among the sequences below, probes SEQ ID NO. 3 to SEQ ID NO. 18 were used by conjugating FAM as a reporter at the 5' end and BHQ1 as a quencher at the 3' end. In addition, probes SEQ ID NO. 21 and SEQ ID NO. 24 were used by conjugating HEX as a reporter at the 5' end and BHQ1 as a quencher at the 3' end.
[0256]
[0257]
[0258] Example 7: Analysis of the effect of differentiating antibiotic-resistant strains containing mutant rpoB, inhA, and katG genes.
[0259]
[0260] Using the Oligos for detecting rpoB, inhA, and katG produced in Examples 5 and 6 above, melting curve analysis was performed using the Tm of the susceptible strain WT (H37Rv) and an antibiotic-resistant strain with a mutation in each probe sequence, and the tendency for the Tm value of the melting peak to change depending on the presence of the mutation was analyzed, confirming that it was different from the susceptible strain.
[0261]
[0262] Using the optimal composition of the present invention and the optimal primer set and probe for each position, all resistant strains were subjected to 48 cycles of 95°C (denaturation) for 20 seconds, 68°C (annealing) for 20 seconds, and fluorescence measurement (scan), 72°C (synthesis) for 20 seconds. After PCR, all double strands were denatured at 95°C, and melting curve analysis was performed by increasing the temperature by 1°C every second from 50°C to 90°C, and fluorescence measurement was performed for every 1°C increase in temperature.
[0263] To confirm the differentiation effect from antibiotic-resistant strains, the resistant strains used in the reaction were 34 antibiotic-resistant tuberculosis strains (Mycobacterium tuberculosis 0B014, 0B269, 0B234, 0B319, 1B027, 0B319, 0B234, 0B186, 0B216, 0B255, 0B012, 0B065, 0B135, 0B160, 0B180, 1B005, 4B252, 0A024, 0B085, 0B240, 0B266, 0B318, 0B328, 0B376, 0B409, 6A024, 0B342, 0B188, gDNA of strains 0B124, 4B359, 0B186, 0B129, 1B027 and 0B028 was donated and 1x10 3 It was used as cp / test.
[0264]
[0265] As a result, it was confirmed in Fig. 8 that the Tm of the resistant strain changed depending on the mutation type differently from the susceptible strain WT (H37Rv), and as a result of the above, it was confirmed that the distinction of antibiotic-resistant mutant tuberculosis bacteria was possible through the probe and primer set selected through Examples 5 and 6.
[0266]
[0267] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.
[0268]
[0269]
[0270]
[0271]
[0272]
[0273]
Claims
1. 5'→3' DNA polymerase without exonuclease activity; primer set; and probe, The probe is labeled with a reporter at the 5' end and a quencher at the 3' end; a reporter at the 3' end and a quencher at the 5' end; or a reporter and a quencher are labeled at the internal bases of the probe. A composition for real-time PCR involving melting curve analysis, wherein the distance between the reporter and the quencher is 10 to 50 mer.
2. A composition according to claim 1, wherein the DNA polymerase having no 5'→3' exonuclease activity is at least one selected from the group consisting of Klenow fragment, Klentaq, and aTaq™ DNA polymerase.
3. A composition according to claim 1, wherein the distance between the reporter and the quencher of the probe is 20 to 37 mer.
4. A composition according to claim 1, wherein the composition further comprises a buffer solution comprising at least one selected from the group consisting of dNTP, MgSO4, KCl, and betaine.
5. In the first paragraph, the composition is for detecting one or more bacteria selected from the Mycobacterium tuberculosis complex consisting of Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium africanum, Mycobacterium canettii, Mycobacterium caprae, Mycobacterium microti, and Mycobacterium pinnipedii and determining antibiotic resistance thereof.
6. A composition according to claim 1, wherein the primer and probe are specific for the Mycobacterium tuberculosis IS6110 gene or IS1081 gene.
7. A composition according to claim 1, wherein the primer and probe are specific for at least one gene selected from antibiotic-resistant Mycobacterium tuberculosis genes rpoB, katG, and inhA.
8. In the 6th paragraph, the composition (1) A primer set consisting of SEQ ID NO: 48 and SEQ ID NO: 49; and a probe consisting of SEQ ID NO: 50; (2) A primer set comprising sequence numbers 51 and 52; and a probe comprising sequence number 53; or a composition comprising both (1) and (2).
9. In paragraph 7, the primer and probe (1) at least one primer set selected from the primer sets consisting of SEQ ID NO: 28 and SEQ ID NO: 29; SEQ ID NO: 37 and SEQ ID NO: 41; SEQ ID NO: 19 and SEQ ID NO: 20; and SEQ ID NO: 22 and SEQ ID NO: 23; and (2) A composition comprising at least one probe selected from sequence number 6; sequence number 16; sequence number 17; sequence number 18; sequence number 21 and sequence number 24.
10. In the first paragraph, the primer and probe A composition specific for at least one gene selected from the Mycobacterium tuberculosis IS6110 gene, the Mycobacterium tuberculosis IS1081 gene, the antibiotic-resistant Mycobacterium tuberculosis gene rpoB, the antibiotic-resistant Mycobacterium tuberculosis gene katG, and the antibiotic-resistant Mycobacterium tuberculosis gene inhA.
11. In the 10th paragraph, the composition wherein the primer and probe are at least one primer set and probe selected from the following (1) to (8): (1) A primer set of SEQ ID NO: 48 and SEQ ID NO: 49; and a probe of SEQ ID NO: 50; (2) Primer set of SEQ ID NO: 51 and SEQ ID NO: 52; and probe of SEQ ID NO: 53; (3) Primer set of SEQ ID NO: 28 and SEQ ID NO: 29; and probe of SEQ ID NO: 6; (4) Primer set of SEQ ID NO: 28 and SEQ ID NO: 29; and probe of SEQ ID NO: 16; (5) Primer set of SEQ ID NO: 37 and SEQ ID NO: 41; and probe of SEQ ID NO: 17; (6) Primer set of SEQ ID NO: 37 and SEQ ID NO: 41; and probe of SEQ ID NO: 18; (7) a primer set of sequence numbers 19 and 20; and a probe of sequence number 21; and (8) Primer set of SEQ ID NO: 22 and SEQ ID NO: 23; and probe of SEQ ID NO:
24.
12. The composition of paragraph 1 is a composition for performing qualitative or quantitative detection using a real-time PCR method.
13. In the 12th paragraph, the composition is for diagnosing tuberculosis infection.
14. In the 12th paragraph, the composition is a composition for quantitative determination of tuberculosis bacteria genes.
15. A composition according to claim 14, wherein the tuberculosis gene is at least one selected from the IS6110 gene and the IS1081 gene.
16. A cartridge for real-time PCR comprising a composition of any one of claims 1 to 15.
17. A composition for detecting antibiotic-resistant tuberculosis bacteria, comprising one or more primer sets and probes selected from (1) to (6): (1) A primer set of SEQ ID NO: 28 and SEQ ID NO: 29; and a probe of SEQ ID NO: 6; (2) Primer set of SEQ ID NO: 28 and SEQ ID NO: 29; and probe of SEQ ID NO: 16; (3) Primer set of SEQ ID NO: 37 and SEQ ID NO: 41; and probe of SEQ ID NO: 17; (4) Primer set of SEQ ID NO: 37 and SEQ ID NO: 41; and probe of SEQ ID NO: 18; (5) a primer set of sequence numbers 19 and 20; and a probe of sequence number 21; and (6) Primer set of SEQ ID NO: 22 and SEQ ID NO: 23; and probe of SEQ ID NO:
24.
18. A method for detecting antibiotic-resistant tuberculosis bacteria, comprising the step of amplifying a nucleic acid target sequence isolated from a sample through real-time PCR using a composition of any one of claims 1 to 15, and obtaining and analyzing a melting curve using the amplified product.
19. A detection method according to claim 18, wherein the method is for performing qualitative detection.
20. A detection method according to claim 19, wherein the qualitative detection is for the identification of tuberculosis bacteria genes.
21. A detection method according to claim 20, wherein the tuberculosis gene is at least one selected from the IS6110 gene and the IS1081 gene.
22. A method for detecting antibiotic-resistant tuberculosis bacteria using real-time PCR using a composition of any one of claims 1 to 15, (1) A quantitative step including a step of amplifying a nucleic acid target sequence isolated from a sample to obtain an amplification curve; (2) a qualitative step including a step of obtaining a melting curve analysis using the amplified product; and (3) A method for detecting antibiotic-resistant tuberculosis bacteria, comprising a step of analyzing the obtained amplification curve and melting curve separately or sequentially or simultaneously. 23.제1항 내지 제15항 중 어느 한 항의 조성물을 이용하여 실시간 PCR을 통해 시료로부터 분리된 핵산 타겟 서열을 증폭하고, 상기 증폭된 산물로 융해곡선을 수득 및 분석을 수행하는 단계를 포함하는, 항생제 내성 결핵균 감염 진단을 위한 정보의 제공방법.
24. Use of the composition of any one of claims 1 to 15 for detecting antibiotic-resistant tuberculosis bacteria.
Citation Information
Patent Citations
Polymerase chain reaction primers and probes for mycobacterium tuberculosis
JP2020168007A
Bovine tuberculosis specific enzyme immuno assay kit comprising immune specific protein antigen and other immunogens and the method for diagnosing the bovine tuberculosis by using the same
KR1020090052175A
Methods for detection of a target nucleic acid by forming a cleavage structure with a cleavage resistant probe
KR1020090098971A
Novel thermostable DNA polymerase
KR1020100060283A
THD primer target detection
KR1020120084320A