COMPOSITIONS COMPRISING sTIGIT AND PD-1 / PD-L1 AXIS INHIBITORS AND USES THEREOF
Soluble TIGIT and PD-1/PD-L1 axis inhibitors restore immune function in T-cells, addressing T cell exhaustion and enhancing immune effectiveness in chronic infections and cancer.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-09-19
- Publication Date
- 2026-03-26
AI Technical Summary
Existing treatments fail to effectively address T cell exhaustion, a state of dysfunction characterized by marked changes in metabolic function, transcriptional programming, and loss of effector function in patients with chronic infections or cancer, leading to reduced immune effectiveness.
Compositions comprising soluble forms of TIGIT and inhibitors of the PD-1/PD-L1 axis are developed to activate the immune system, specifically targeting dendritic and T-cells to restore immune function lost due to exhaustion.
These compositions enhance immune effectiveness by reducing T cell exhaustion, potentially treating and delaying immune-related diseases.
Smart Images

Figure IMGF000041_0001 
Figure IMGF000047_0001 
Figure 00000072_0000
Abstract
Description
[0001] COMPOSITIONS COMPRISING sTIGIT AND PD-1 / PD-L1 AXIS INHIBITORS ANDUSES THEREOF FIELD OF THE INVENTION The invention relates to the field of immunotherapeutics, concretely to the field of immunity restoration. BACKGROUND ART T cells are immune cells that become activated via T cell receptor (TCR) signaling following engagement with antigen. Physiologic activation through the T cell receptor renders T cells capable of mediating potent antitumor or anti-infective effects. During resolution of an acute inflammatory response, a subset of activated effector T cells differentiate into long-lived memory cells. By contrast, in patients with chronic infections or cancer, T cells not infrequently undergo pathologic differentiation toward a state of dysfunction, which has been termed immune exhaustion. Immune exhaustion, particularly T cell exhaustion, which is an acquired state of T cell dysfunction, is a hallmark of cancer and chronic viral infection. T cell exhaustion is characterized by marked changes in metabolic function, transcriptional programming, loss of effector function (e.g., cytokine secretion, killing capacity), and co-expression ofmultiple surface inhibitory receptors. The root cause of T cell exhaustion is persistentantigen exposure leading to continuous TCR signaling. Accordingly, there is a need in the art to provide means to reduce T cell exhaustion as means to enhance immune effectiveness in patients with cancer or chronic infections. SUMMARY OF THE INVENTIONThe authors of the present invention have developed compositions comprising solubleforms of TIGIT and an inhibitor of the PD-1 / PD-L1 axis that may activate the immunesystem in the context of dendritic and T-cells and restore immune function lost by theimmune exhaustion. Thus, these compositions may be useful in treating and delayingimmune-related diseases.Thus, in a first aspect, the present invention relates to a composition, hereinafter “thecomposition of the invention” comprising:a) a first component selected from the group consisting of:i) A polypeptide comprising a TIGIT variant that comprises the TIGIT Ig-like V-type domain and wherein said polypeptide lacks the TIGIT transmembrane and cytoplasmic domains and, ii) a polynucleotide encoding the polypeptide defined in i),andb) a second component, which is an inhibitor of the PD-1 / PD-L1 axis.In a second aspect, the present invention relates to a pharmaceutical composition,hereinafter “the pharmaceutical composition of the invention” comprising apharmaceutically effective amount of the composition of the invention and a pharmaceutically acceptable excipient.In a third aspect, the present invention relates to the composition of the invention or thepharmaceutical composition of the invention for use in medicine.In a fourth aspect, the present invention relates to the composition of the invention of thepharmaceutical composition of the invention for use in a method for treating or delaying an immune-related disease.In a fifth aspect, the present invention relates to a polypeptide comprising a TIGIT variantthat comprises the TIGIT Ig-like V-type domain and wherein said polypeptide lacks the TIGIT transmembrane and cytoplasmic domains or a polynucleotide encoding said polypeptide for use in a method for reducing immune toxicity in a patient that is being treated with an inhibitor of the PD-1 / PD-L1 axis. DESCRIPTION OF THE FIGURESFigure 1: sIR1 protein structure, in silico modelling and protein production. A.Structure of human TIGIT pre-protein containing the native signal peptide (SP Nat) (cleaved during intracellular processing), the extracellular, the transmembrane and thecytoplasmatic region. B. Structure of sIR1 Nat contains the SP Nat and the extracellularregion of TIGIT. The Ig-like V-Type domain includes the regions for homodimerization and interaction with CD155 / PVR (VTQ, AX6G, and TYP). For solubilization, the transmembrane sequences of TIGIT were removed, and sequences for cloning (BamHI),detection (His-tag) and protein termination (STOP) were included. C. Signal peptideoptimization was performed on sIR1 Nat by incorporating the SP from human CD5 preproprotein (SP CD5) or Azurocidin preproprotein (SP Azu) in sIR1 CD5 and Azu, respectively. Moreover, the tail sequence following the Ig-like V-Type was shortened toavoid retention in the membrane. D. Supernatants from transfection were collected after7 days and analysed by SDS-PAGE with Coomassie staining (left) or WB (right) toperform a protein production screening. E. Time course analysis performed by Coomassie staining (top) or WB (bottom) in supernatants collected 3-6 days post- transfection. Supernatant (SNT), Empty vector (EV), western blot (WB). Figure 2: sIR protein structure of human, murine and hybrid stable dimers prototypes. A. Human sIR prototypes. Structure of dimeric sIR2 containing human effector IgG1 Fc domain and sIR10 containing human no effector IgG4 Fc domain with S228P mutation. Human stable dimers contain Myc-tag and His-tag B. Murine sIRprototypes. Structure of monomeric sIR5 containing murine the TIGIT Ig-like V- typedomain, dimeric sIR6 containing murine effector IgG2c Fc domain, dimeric sIR7containing murine effector IgG2c Fc domain with a ΔPCPP (SEQ ID NO: 45) deletion,and dimeric sIR8 containing murine no effector IgG1 Fc domain with a ΔPCPP. Murinestable dimers contain Flag-tag and His-tag. C. Hybrid sIR prototypes. Structure of dimericsIR6 containing murine effector IgG2c Fc domain, dimeric sIR7 containing murine effector IgG2c Fc domain with a ΔPCPP deletion, and dimeric sIR8 containing murine no effector IgG1 Fc domain with a ΔPCPP. D. Control recombinant protein generatedwith the deletion of Ig-like V-type domain form sIR2. Signal peptides depicted as SP inthe different prototypes are cleaved during intracellular processing and are not present in the final mature secreted products.Figure 3: Body weight variation during LCMV infection. A. Schematic representationof study design to characterize chronic LCMVDOC infection in C57BL / 6 mice. The study included weight monitoring for 28 days and necropsy at three endpoints (14, 21 and 28days) in Mock (n=12) and LCMV-infected mice (n=12). B. Median body weight variationfrom baseline (t=13 days) after IP administration of LCMV. C. Box Plots represent themedian percentage of body weight variation from baseline ± IQR at -6, 2, 8, 15, 21 and28-days post-infection. Each point represents a mouse. D. Median percentage of bodyweight variation from baseline (t=13 days) disaggregated by sex. E. Box Plots representthe median percentage of body weight variation from baseline Figure 4: LCMV chronic infection in C57BL / 6 mice efficacy study of TIGIT / CD155blockade in combination with αPD-L1. A. Schematic representation of study design.The study included weight monitoring and blood sampling for 34 days with two necropsyendpoints on days 28 and 34. B. Median body weight variation from baseline (t=0 days)after IP administration of LCMV. C. Box Plots represent the median percentage of bodyweight variation from baseline ± IQR at 27-days and 33-days post-infection. Each pointrepresents a mouse. D. Representative LCMV viral load determination by FFU assay inMC57 cell lines from spleen samples. E. LCMV viral load (FFU / g). Undetectable samplesare indicated with black dots in the limit of quantification. White symbols represent αPD-L1 blockade alone or in combination. Intraperitoneal (IP). F. Representative images from histopathology of kidney under the different treatments. Kidneys were stained embebed in OCT, cut and sections stained with hematoxilin-eosin. Magnification: . Error bars: .G. Scores of kidney damage at day 28 based on histopathology. Scores ranges from 0-4.Bars represent median and each point the value for one mouse. p-value<0.05(*), p-value<0.005(**).Figure 5: Protein characterisation and quality control. A. Coomassie blue staining wasperformed on purified human sIR1, sIR2 and sIR10, and hybrid sIR4 and sIR9 prototypes. The Coomassie blue was conducted under reducing (R) and non-reducing (NR) conditions. Marker 1 (M1) was used as a reference. B. Western blot analysis was performed on the purified human sIR1, sIR2, sIR10 prototypes, and hybrid sIR4 and sIR9 prototypes, detecting the His-tag located in the C-terminal domain. The analysis was conducted under reducing (R) and non-reducing (NR) conditions. Marker 2 (M2) was used as a reference.Figure 6: Binding of sIRs to CD155 by functional ELISA and Bw5147 cell-basedassay. Functional ELISA to determine the IC50 values of human sIR1, sIR2, and sIR10and hybrid sIR4 and sIR9 was conducted on plates coated with hCD155 (A.) and mCD155 (B.). Data represent mean OD450-540 values from experimental duplicates. C. Bw hCD155 or Bw Ctrol cells were incubated with serial dilutions of sIR1, sIR2 and sIR10 for 1 hour at 4ºC. The binding of sIRs to hCD155 was assessed by flow cytometry using an anti-His-tag PE antibody (left panel). The percentage of binding of sIRs to hCD155 was determined in Bw cells by normalised log transform of PE MFI intensity. IC50 wasdetermined using a sigmoidal 4PL regression model. D Frequency of NFAT::eGFP,NFkB::CFP and co-expression of NFkB::CFP and NFAT::eGFP in Jk TIGIT cells upon coculture in the presence of sIR1, sIR2, and anti-TIGIT antibody; paired frequencies of Jk TIGIT cells (right) expressing NFkB::CFP; D. NFAT::eGFP; and NFAT::eGFP- NFkB::CFP after 6 hours co-culture with the Bw hCD155 in the presence of sIR, sIR2, and anti-TIGIT at 25 μg / mL, along with the controls (PBS / Isotype condition). Data represent mean frequencies of eGFP and CFP from experimental triplicates. P value<0.05 (*), p value<0.005 (**). Figure 8: Viral persistence in spleen and serum after LCMV chronic infection. A. LCMV viral load was determined by FFU assay in MC57 cell lines from spleen and serum samples on days 14, 21 and 28 post-infection. B. LCMV viral load disaggregated by sex. Undetectable samples are indicated with a black dot in the limit of quantification per sample.Figure 9: Lymphocytic cell populations are altered by LCMV chronic infection A.Representative dot plots of CD8⁺, CD4⁺ T-cell gated on CD3+ splenocytes and NK cellsgated on CD3- splenocytes B. Frequency of total CD8⁺ T-cells, CD4⁺ T-cells, and NK cells during LMCV chronic infection on day 14, 21, and 28 compared to uninfected mice (Mock).Figure 10: Expression of PD-1 and TIGIT in CD8⁺ T-cells during chronic LCMVinfection. A. Frequency of PD-1+CD8⁺ T-cells during LCMV chronic infection on day 14,21, and 28 post-infection compared to uninfected (Mock) mice. Unstimulated (Left),αCD3 stimulation (right). B. Frequency of total TIGIT+CD8⁺ T-cells during LMCV chronicinfection on day 14, 21, and 28 post-infection compared to uninfected (Mock) mice.Unstimulated (Left), αCD3 stimulation (right). C. Frequency of PD-1+TIGIT+ CD8⁺ T-cells during LMCV infection in response to gp33-specific stimulation on day 14, 21, and 28 post-infection compared to uninfected (Mock) mice.Figure 11: Expression of PD-1 and TIGIT in CD4⁺ T-cell during chronic LCMVinfection. A. Frequency of total PD- 1+CD4⁺ T-cells during LMCV chronic infection onday 14, 21, and 28 compared to uninfected (Mock) mice. Unstimulated (Left), αCD3stimulation (right). B. Frequency of TIGIT+CD4⁺ T-cells during LMCV chronic infectionon day 14, 21, and 28 compared to uninfected (Mock) mice. Unstimulated (Left), αCD3stimulation (right). C. Frequency of PD-1+TIGIT+ CD4⁺ T-cells during LMCV infection inresponse to gp33-specific stimulation on day 14, 21, and 28 post-infection compared to uninfected (Mock) mice.Figure 12: CD8⁺ T-cell responses during chronic LCMV infection. A. Frequency ofCD107a, IFNγ and TNF production in CD8⁺ T-cell in αCD3 stimulation. B. Frequency ofCD107a, IFNγ and TNF gp33-specific CD8⁺ T-cells.Figure 13: DCs are altered by chronic LCMV infection. A. Frequency of DCs on day28 and 34 post-infection. Figure 14: Frequency of PD-L1 in DCs is decreased in single and combined αPD-L1 increasing the levels of DCs activation. A-C. Frequency of total PD-L1+ and,CD155+ DCs on day 28 and 34 after LMCV infection across study arms. Figure 15: Lymphocytic and NK populations are altered by LCMV chronic infectionand not normalized by immune interventions. A-B. Frequency of total CD8+ T-cells,CD4+ T-cells, and NK cells at days 28 and 34 after infection.Figure 16: Expression levels of PD-1 and TIGIT in CD8⁺ and CD4⁺ T cells in LCMVchronic infection. A-B. Frequency of PD-1 and TIGIT expression in CD8⁺ T-cells, CD4⁺T-cells on day 28 and 34.Figure 17: CD8⁺ T-cell function in αCD3 stimulated condition. A-C. Frequency ofIFNγ, CD107a, and TNF in CD8⁺ T-cells.Figure 18: A. Activation patterns in DCs and CD8 T-cells measured as % positive cellsfor CD40, in the case of DCs and CD11b, in the case of CD8 T-cells, evaluated by flow cytometry. Left, representative examples of gating of CD40 and CD11b for each group.Right, box plots representing % positive cells in each group 28- and 34-days post-infection. Horizontal bars represent median and, each point, values from an individual mouse. *p<0.05**p<0.01. Comparisons were performed using One Way ANOVA andUncorrected Fisher's LSD for multiple comparisons.** B. Pro and anti- inflammatorymarkers in serum of mice detected at day 28 and 34 by ELISA Luminex. Heatmap (upper) using hierarchical clustering to compare detected cytokine values between day 28-day 21 / day 34-day 21 with clustering based on Euclidean distance measurements. Box plots representing the fold change (value of pg / mL of cytokine at d28 (left) or day 34 (right) divided by value at d21) for representative cytokines. Horizontal bars represent median and, each point, values from an individual mouse. *p<0.05**p<0.01. Comparisons were performed using One Way ANOVA and Uncorrected Fisher's LSD for multiple comparisons. C. Focus forming assay determining viral load in spleen. Box and whiskers graph representing the FFUs per gram of spleen of the different groups. Horizontal bars represent median and, each point, an individual mouse. *p<0.05**p<0.01. Comparisons were performed using One Way ANOVA and Uncorrected Fisher's LSD for multiple comparisons.Figure 19: Gatting strategy in PBMCs from PWHFigure 20: Fluorescence minus one controls (FMO) A. Paired frequencies of T-cells,TIGIT+ T-cells and functionality markers (IL-2, IL-10, TNF, IFN, CD107a), unstimulated and stimulated with HIV peptides for CD4 (C.) and CD8 (D.) T-cells, comparing controls(PBS, Fc-ctrl) with sIRs treatment (sIR1, sIR2) in PBMCs from PWH. p value<0.05(*), pvalue<0.005(**), p value<0.0005(***), p value<0.00005 (****).Figure 21: A. Schematic representation of chronogram of sIRs toxicity / PK in a murinemodel. At day 0, N=2 (saline control); N=4 (sIR1); N=6 (sIR4 and sIR9) wereintraperitoneally injected (10mg / kg). At day 7, N=2 (sIR4 and sIR9) and day 21 (N=2 (saline control); N=4 (sIR1); N=6 (sIR4 and sIR9) mice were euthanized and organs andblood were harvested. Weight, wellness scores, and sIR concentrations in serum werelongitudinally assessed during the experiment. B. Longitudinal body weight variationafter IP administration of sIR prototypes, points represent median percentage of variationfrom baseline (t=0h). C. Cross-sectional analysis of body weight variation at day 21 (504h, end of the experiment); box plots represent median percentage of body weightvariation from baseline ± IQR, and each dot, the value from each mouse.Figure 22: Toxicity and pharmacokinetics of sIRs in vivo.A. A. Representative imagesfrom histopathology of kidney under the different treatments. Kidneys were stained, embedded in OCT, cut and sections stained with haematoxylin-eosin. B. Longitudinal analysis of the median concentration of sIR1, sIR4 and sIR9 in serum after IPadministration. The follow- up of sIR concentration for each mouse is connected by thinlines and mean concentration of sIR1, sIR4 and sIR9 is connected for each sIR prototypeby solid lines. For each sIRs half-life (t1 / 2) and area under the curve are indicated. Cross-sectional analysis of median concentration of sIR1, sIR4 and sIR9 in serum ± IQR at 504 hours. Each point represented in the box plots indicates sIR concentration per mouse. P value<0.05(*). DETAILED DESCRIPTION OF THE INVENTION Composition of the inventionThe authors of the present invention have found that compositions comprising a TIGITvariant, which contains part or of the extracellular region and an inhibitor of the PD-1 / PD-L1 axis are capable of restoring the immune function of T-cells in patients suffering fromT cell exhaustion and improving activation of dendritic cells, as well as inducing a pro-inflammatory hallmark in serum. Surprisingly, these compositions are comparativelymore efficient in activating the immune system to revert immune exhaustion than similarcompositions in which TIGIT inhibition is achieved by anti-TIGIT antibodies. Accordingly, the invention relates to a composition comprising TIGIT variant which lacks the transmembrane and cytoplasmic domains and an inhibitor of the PD-1 / PD-L1 axis. The composition may be used for treating or delaying an immune-related disease.In a first aspect, the present invention relates to a composition, hereinafter “thecomposition of the invention” comprising:a) a first component selected from the group consisting of:i) A polypeptide comprising a TIGIT variant that comprises the TIGITIg-like V-type domain and wherein said polypeptide lacks the TIGIT transmembrane and cytoplasmic domains and, ii) a polynucleotide encoding the polypeptide defined in i),and b) a second component, which is an inhibitor of the PD-1 / PD-L1 axis. The term “comprising” or “comprises”, as used herein, discloses also “consisting of” according to the generally accepted patent practice. The terms “polypeptide” “peptide” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer. The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogues and amino acid mimetics that function in a manner similar to thenaturally occurring amino acids. Furthermore, the term "amino acid" includes both D- andL-amino acids (stereoisomers). The term "natural amino acids" or “naturally occurring amino acids” comprises the 20 naturally occurring amino acids; those amino acids often modified post-translationally in vivo, including, for example, hydroxyproline, phosphoserine and phosphothreonine; and other unusual amino acids including, but not limited to, 2-aminoadipic acid,hydroxylysine, isodesmosine, nor-valine, nor-leucine and ornithine.As used herein, the term "non-natural amino acid" or “synthetic amino acid” refers to a carboxylic acid, or a derivative thereof, substituted at position “a” with an amine groupand being structurally related to a natural amino acid. Illustrative non- limiting examplesof modified or uncommon amino acids include 2-aminoadipic acid, 3-aminoadipic acid, beta-alanine, 2-aminobutyric acid, 4-aminobutyric acid, 6-aminocaproic acid, 2- aminoheptanoic acid, 2-aminoisobutyric acid, 3-aminoisobutyric acid, 2-aminopimelic acid, 2,4-diaminobutyric acid, desmosine, 2,2'-diaminopimelic acid, 2,3- diaminopropionic acid, N-ethylglycine, N-ethylasparagine, hydroxy lysine, alio hydroxy lysine, 3-hydroxyproline, 4-hydroxyproline, isodesmosine, alloisoleucine, N- methylglycine, N-methylisoleucine, 6-N-methyl-lysine, N-methylvaline, norvaline, norleucine, ornithine, etc.The polypeptide of the present invention may also comprise non-amino acid moieties,such as for example, hydrophobic moieties (various linear, branched, cyclic, polycyclic or heterocyclic hydrocarbons and hydrocarbon derivatives) attached to the peptides; various protecting groups which are attached to the compound’s terminals to decrease degradation. Suitable protecting functional groups are described in Green and Wuts, "Protecting Groups in Organic Synthesis", John Wiley and Sons, Chapters 5 and 7, 1991. Chemical (non-amino acid) groups present in the polypeptide may be included in order to improve various physiological properties such as decreased degradation or clearance; decreased repulsion by various cellular pumps, improve various modes of administration, increased specificity, increased affinity, increased stability, bioavailability, solubility, decreased toxicity and the like. "Mimetic" includes molecules that mimic the chemical structure of a peptidic structure and retain the functional properties of the peptidic structure. Approaches to designing peptide analogous, derivatives and mimetics are known in the art.As used interchangeably herein, the terms “nucleic acid”, “polynucleotide” and“nucleotide sequence” relate to any polymeric form of nucleotides of any length andcomposed of ribonucleotides or deoxyribonucleotides. The terms include both single- stranded and double-stranded polynucleotides, as well as modified polynucleotides (e.g., methylated, protected). Typically, the nucleic acid is a “coding sequence” which, as used herein, refers to a DNA sequence that is transcribed and translated into a polypeptide in a host cell when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus. A coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences. A transcription termination sequence will usually be located 3' to the coding sequence.The first component of the composition of the invention is selected from a groupconsisting of: a polypeptide comprising a TIGIT variant that comprises the TIGIT Ig-like V-type domain and wherein said polypeptide lacks the TIGIT transmembrane and cytoplasmic domains, and a polynucleotide encoding the previously defined polypeptide. The term “TIGIT”, as used herein, refers to the T cell immunoreceptor with Ig and ITIM domains), an inhibitory receptor expressed mainly in natural killer (NK), CD8+ T, CD4+ T and T regulatory (Treg) cells. The protein is defined in the NCBI database (release of10 March 2024) with accession number NP_776160 for the human orthologue and withaccession number NP_001139797 for the mouse orthologue.The term “TIGIT variant” is to be understood as a polypeptide that comprises the TIGIT Ig-like V-type domain of a TIGIT polypeptide but that lacks the TIGIT transmembraneand cytoplasmic domains. The term includes any variant of the Ig-like V-type domain thatresults from the modification of one or more amino acid positions by deletion, insertionor substitution provided that the domain substantially maintains the ability to specificallybind CD155. In some embodiments, the TIGIT variant comprises the homodimerizationdomain, which facilitates the interaction of two TIGIT subunits in cis. In some embodiments, the TIGIT variant lacks the homodimerization domain, which facilitates the interaction of two TIGIT subunits in cis. In some embodiments, the TIGIT variant containsthe three amino acidic sequences (VTQ, AX6G, and TYP) within the Ig-like V-typedomain that allow the heterotetrameric interaction with CD155 in trans.By way of illustration, variants of the polypeptide of the invention include sequencescomprising the addition of 1 amino acid, 2 amino acids, 3 amino acids, 4 amino acids, 5 amino acids, 10 amino acids, 15 amino acids, 20 amino acids, 25 amino acids, 30 amino acids, 35 amino acids, 40 amino acids, 45 amino acids, 50 amino acids, 60 amino acids, 70 amino acids, 80 amino acids, 90 amino acids, 100 amino acids, 150 amino acids, 200 amino acids, at least 500 amino acids, at least 1000 amino acids or more at the aminoterminus of the polypeptide according to the invention and / or comprising the addition of1 amino acid, 2 amino acids, 3 amino acids, 4 amino acids, 5 amino acids, 10 aminoacids, 11 amino acids, 12 amino acids, 13 amino acids, 14 amino acids, 15 amino acids, 20 amino acids, 25 amino acids, 30 amino acids, 35 amino acids, 40 amino acids, 45 amino acids, 50 amino acids, 60 amino acids, 70 amino acids, 80 amino acids, 90 amino acids, 100 amino acids, 150 amino acids, 200 amino acids, at least 500 amino acids, atleast 1000 amino acids or more at the carboxy terminus of the polypeptide according tothe invention, and maintaining at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% of the activity of the sequence of the polypeptide according to the invention.The variant of the polypeptide of the invention may also include post-translationalmodifications, such as glycosylation, acetylation, isoprenylation, myristoylation, proteolytic processing, etc. In another embodiment, suitable variants of the polypeptide of the invention are those wherein one or more positions within the polypeptide of the invention contain an amino acid which is a conservative substitution of the amino acid present in the protein mentioned above. "Conservative amino acid substitutions" result from replacing one amino acid with another having similar structural and / or chemical properties. For example, the following six groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Serine (S), Threonine (T); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W). Selection of such conservative amino acid substitutions is within the skill of one of ordinary skill in the art and is described, for example, by Dordo et al.,(J. Mol. Biol, 1999, 217; 721-739) and Taylor et al., (J. Theor. Biol., 1986, 119:205-218).TIGIT variants according to the present invention are those which substantially preservethe binding capability of native TIGIT to CD155 or which show increased affinity forCD155 binding with respect to native TIGIT. The binding capacity is usually measured by the binding affinity, which is a parameter that measures the strength of the sum total of non-covalent interactions between a single binding site of a molecule (e.g., a TIGT variant) and its binding partner (e.g.,CD155). Unless indicated otherwise, as used herein, “binding affinity” refers to intrinsic binding affinity which reflects a 1:1 interaction between members of a binding pair. The affinity of a molecule X for its partner Y can generally be represented by the dissociation constant (KD). Affinity can be measured and / or expressed in a number of ways known in the art, including, but not limited to, equilibrium dissociation constant (KD), and equilibrium association constant (KA). The KD is calculated from the quotient of koff / kon, whereas KA is calculated from the quotient of kon / koff. kon refers to the association rate constant of, e.g., an antibody or antigen-bindingfragment thereof to an antigen, and koff refers to the dissociation of the two members ofthe binding pair (e.g. the TIGIT variant and the CD155). The affinity of the binding of the TIGIT variant to the CD155 may be measured by the dissociation constant or KD. KD values are measured by techniques known by the skilled in the art such as, for example ELISA, surface plasmon resonance (SPR), fluorescence anisotropy, Bio-Layer Interferometry, typically using OCTET(R) technology (Octet QKesystem, ForteBio) or KinExA(R) (Kinetic Exclusion Assay) assay.Considering that the binding affinity of native human TIGIT to human CD155 is of 1.3 nM,the suitable TIGIT variants for use according to the present invention include variants having a binding affinity of 10 nM or less, 9 nM or less, 8 nM or less, 7 nM or less, 6 nMor less, 5 nM or less, 4 nM or less.3 nM or less, 2 nm or less, 1 nM or less or lower.In a particular embodiment, the TIGIT variant essentially consists of amino acids 22 to124 of the human TIGIT, wherein the numbering is as defined in the NCBI database entry (Release of 10 March 2024) under accession number NP_776160. In a more particularembodiment, the TIGIT variant is a polypeptide as defined in SEQ ID NO: 1 or SEQ IDNO: 39.The term “essentially consisting”, as used herein is used to define polypeptides thatcomprise the specifically defined region (amino acids 22 to 124 of the human TIGIT Ig-like V-type domain, wherein the numbering is as defined in the NCBI database entryNP_776160 and corresponding positions in other orthologues).In some embodiments, the TIGIT variant contains amino acids 43 to 124 of human TIGITas well as part or all of the region spanning from position 22 (the start of the mature TIGIT) to position 42 (the start of the Ig-like V-type domain) and / or part or all of the region spanning from position 125 (the end of the Ig-like V-type domain) to position 141 (theend of the extracellular region). Therefore, the TIGIT variant according to the inventionmay contain amino acids 22 to 124 of human TIGIT.In an embodiment, the TIGIT variant essentially consists of amino acids 22 to 124 ofhuman TIGIT. In an embodiment, the TIGIT variant essentially consists of amino acids22 to 141 of human TIGIT. In an embodiment, the TIGIT variant essentially consists ofamino acids 22 to 144 of human TIGIT.In a particular embodiment, the TIGIT variant essentially consists of amino acids 20 to119 of the mouse TIGIT, wherein the numbering is as defined in the NCBI database entry (Release of 24 May 2024) under accession number NP_001139797. In a particular embodiment, the first component is a fusion protein comprising the TIGIT variant and a non-TIGIT polypeptide region. In another embodiment, the first component of the composition according to the invention is a polynucleotide encoding said fusion protein. As used herein, the term “fusion protein” relates to proteins which consist of two or more functional domains derived from different proteins. A fusion protein may be obtained by conventional means, e.g., by means of gene expression of the nucleotide sequence encoding for said fusion protein in a suitable cell. The fusion protein, per definition, is never found in nature as such. In some embodiments, wherein the first component of the composition according to theinvention is a fusion protein comprising a non-TIGIT protein, i.e. a functional domain froma different protein, it is the functional domain of the fusion protein that confers the abilityto form dimers, in which case the TIGIT variant contains the Ig-like V-type domain butdoes not contain the TIGIT homodimerization domain. Accordingly, in a preferred embodiment, the first component of the compositions according to the invention contains a fusion protein in which the TIGIT variant contains, essentially contains or consists of amino acids 41 to 122 of human TIGIT, wherein the numbering is as defined in the NCBI database entry (Release of 10 March 2024) under accession number NP_776160 or of amino acids 38 to 119 of the mouse TIGIT wherein the numbering is as defined in the NCBI database entry (Release of 24 May 2024) under accession number NP_001139797In an embodiment, the non-TIGIT polypeptide region is a Fc monomer which is formedby the hinge region and the CH2 and CH3 domains of the heavy chain of an IgG heavychain molecule.The term “Fc monomer”, as used herein refers to one of the two polypeptides that formthe immunoglobulin Fc region and which comprise the comprising the hinge domain andthe CH2 / CH3 domains of the IgG heavy chain. The term “fragment crystallizable region” or “Fc region”, as used herein, refers to the tail region of an antibody that interacts with cell surface receptors called Fc receptors and some proteins of the complement system. The Fc is a dimer formed by two polypeptides, each one. In a particular embodiment, when the first component of the composition according to the invention is a polypeptide comprising a TIGIT variant that comprises the TIGIT Ig- like V-type domain and wherein said polypeptide lacks the TIGIT transmembrane and cytoplasmic domains, the invention further relates to a homodimer that is formed by twomonomers of the TIGIT variant. The homodimers are stabilized by the homodimerizationdomain in the TIGIT variant polypeptide which is found in amino acids 32 to 42 of human TIGIT wherein the wherein the numbering is as defined in the NCBI database entry(Release of 10 March 2024) under accession number NP_776160 or in amino acids 26to 39 of murine TIGIT wherein the wherein the numbering is as defined in the NCBI database entry (Release of 10 March 2024) under accession number NP_001139797. In a particular embodiment, the first component of the composition according to theinvention is a homodimer of two fusion proteins wherein each of the fusion proteincomprises a TIGIT variant as defined above and an Fc monomer. In this case, the TIGITvariant that forms part of the fusion protein does not contain the homodimerization domains that appear in TIGIT. The term “homodimer” refers to a structure comprising to identical monomers, for example, two identical monomer polypeptides. The term the “homodimerization domain” refers to a domain of the human TIGIT Ig-likeV-type domain or mouse TIGIT Ig-like V-type domain that facilities the interaction of twoTIGIT subunits in cis. The homodimerization domain of the human TIGIT Ig-like V-typedomain consists in: NISAEKGGSII (SEQ ID NO: 40). The homodimerization domain ofthe mouse TIGIT Ig-like V-type domain consists in: NISAEEGGSVI (SEQ ID NO: 41). As used herein, the term “hinge”, “hinge domain” or “antibody hinge region” refers to the domain of heavy chain constant region that joins the CH1 domain to the CH2 domain and includes the upper, middle, and lower portions of the hinge. The hinge provides varying levels of flexibility between the binding and effector regions of an antibody and also provides sites for intermolecular disulfide bonding between the two heavy chain constant regions. The term "CH1 domain" refers to the heavy chain constant region linking the variabledomain to the hinge in a heavy chain constant domain. The term "CH1 domain" includeswildtype CH1 domains as well as variants thereof (e.g., non-naturally-occurring CH1 domains or modified CH1 domains). For example, the term "CH1 domain" includes wildtype CH1 domains and variants having 1, 2, 3, 4, 5, 1-3, 1-5, 3-5 and / or at most 5, 4, 3, 2, or 1 mutations, e.g., substitutions, deletions or additions. Exemplary CH1 domains include CH1 domains with mutations that modify a biological activity of an antibody, such as ADCC, CDC or half-life. The term "CH2 domain" refers to the heavy chain constant region linking the hinge to theCH3 domain in a heavy chain constant domain. The term "CH2 domain" includeswildtype CH2 domains, as well as variants thereof (e.g., non-naturally-occurring CH2 domains or modified CH2 domains). For example, the term "CH2 domain" includes wildtype CH2 domains and variants having 1, 2, 3, 4, 5, 1-3, 1-5, 3-5 and / or at most 5, 4, 3, 2, or 1 mutations, e.g., substitutions, deletions or additions. Exemplary CH2 domains include CH2 domains with mutations that modify a biological activity of an antibody, such as ADCC, CDC or half-life. The term "CH3 domain" refers to the heavy chain constant region that is C-terminal tothe CH2 domain in a heavy chain constant domain. The term "CH3 domain" includeswildtype CH3 domains, as well as variants thereof (e.g., non-naturally-occurring CH3 domains or modified CH3 domains). For example, the term "CH3 domain" includes wildtype CH3 domains and variants having 1, 2, 3, 4, 5, 1-3, 1-5, 3-5 and / or at most 5,4, 3, 2, or 1 mutations, e.g., substitutions, deletions or additions. Exemplary CH3domains include CH3 domains with mutations that modify a biological activity of an antibody, such as ADCC, CDC or half-life.In a particular embodiment, the Fc monomer is selected from the group consisting of thehuman IgG1 Fc monomer, the human IgG1 Fc monomer carrying a S228P mutation, themouse IgG2c Fc monomer, the mouse IgG2c Fc monomer carrying the ΔPCPP mutationand the mouse IgG1 Fc monomer.In another embodiment, the Fc monomer is selected from the group consisting of SEQID NO: 3 (human IgG1 Fc monomer), SEQ ID NO: 4 (human S228P IgG1 Fc monomer),SEQ ID NO: 5 (mouse IgG2c Fc monomer), SEQ ID NO: 6 (mouse ΔPCPP IgG2c Fcmonomer) or SEQ ID NO: 7 (mouse IgG1 Fc monomer). In some embodiments, the Fcmonomer comprises a sequence at least 75%, at least 80%, at least 85%, at least 90%,at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7. The terms “identical” or percent “identity” in the context of two or more nucleic acids or polypeptides refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same when compared and aligned (introducing gaps, if necessary) for maximum correspondence, not considering any conservative amino acid substitutions as part of the sequence identity. The percent identity can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software are known in the art which can be used to obtain alignments of amino acid or nucleotide sequences. Examples of algorithms suitable for determining sequence similarity include, but are not limited to, the BLAST, Gapped BLAST, and BLAST 2.0, WU-BLAST-2, ALIGN, and ALIGN-2 algorithms (Altschul S, et al., Nuc. Acids Res.1977; 25:3389-3402, Altschul S, et al., J. Mol. Biol.1990; 215:403-410, Altschul S, et al., Meth. Enzymol.1996; 266:460-480, Karlin S, et al., Proc. Natl. Acad. Sci. USA 1990; 87:2264-2268, Karlin S, et al.,Proc. Natl. Acad. Sci. USA 1993; 90:5873-5877, Genentech Corp, South San Francisco, CA, US, https: / / blast.ncbi.nlm.nih.gov / Blast.cgi, November 2021). Methods of alignment of sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can be conducted, for instance, by the Smith-Waterman local homology algorithm, by the Needleman-Wunsch homology alignment algorithm, by the Pearson- Lipman similarity search method, by computerized implementations of these algorithms or by manual alignment and visual inspection (Smith T, et al., Adv. Appl. Math. 1981; 2:482-489, Needleman S, et al., J. Mol. Biol. 1970; 48:443-453, Pearson W, et al., Lipman D, Proc. Natl. Acad. Sci. USA 1988; 85:2444-2448, the GAP, BESTFIT, FASTA and TFASTA programs, Wisconsin Genetics Software Package, Genetics Computer Group, Madison, WI, USA; Ausubel F, et al., Eds., Short Protocols in Molecular Biology, 5th Ed. (John Wiley and Sons, Inc., New York, NY, USA, 2002)). In a particular embodiment, the TIGIT variant is a fusion protein comprising the humanTIGIT Ig-like V-type domain and a human IgG1 Fc monomer region. In a more particularembodiment the fusion protein consists of SEQ ID NO: 8.In another particular embodiment, the TIGIT variant is a fusion protein comprising thehuman TIGIT Ig-like V-type domain and a human IgG4 Fc monomer region carrying aS228P mutation. In a more particular embodiment the fusion protein consists of SEQ IDNO: 9.In a particular embodiment, the TIGIT variant is a fusion protein comprising the mouseTIGIT Ig-like V-type domain and a mouse IgG2c Fc monomer region. In a more particularembodiment the fusion protein consists of SEQ ID NO: 10. In another particular embodiment, the TIGIT variant is a fusion protein comprising the mouse TIGIT Ig-like V-type domain and a mouse IgG2c Fc monomer region carrying aΔPCPP mutation. In a more particular embodiment the fusion protein consists of SEQ IDNO: 11.In a particular embodiment, the TIGIT variant is a fusion protein comprising the mouseTIGIT Ig-like V-type domain and a mouse IgG1 Fc monomer region. In a more particularembodiment the fusion protein consists of SEQ ID NO: 12.In a another particular embodiment, the TIGIT variant is a fusion protein comprising thehuman TIGIT Ig-like V-type domain and a mouse IgG2c Fc monomer region. In a moreparticular embodiment the fusion protein consists of SEQ ID NO: 13.In a particular embodiment, the TIGIT variant is a fusion protein comprising the humanTIGIT Ig-like V-type domain and a mouse IgG2c Fc monomer region carrying a ΔPCPPmutation. In a more particular embodiment the fusion protein consists of SEQ ID NO: 14.In a particular embodiment, the TIGIT variant is a fusion protein comprising the humanTIGIT Ig-like V-type domain and a mouse IgG1 Fc monomer region. In a more particularembodiment the fusion protein consists of SEQ ID NO: 15. In a particular embodiment, the first component is a polynucleotide selected from the group consisting of SEQ ID NO: 16 to 25. In another embodiment, if the first component is a polynucleotide, then the polynucleotide further comprises a region that encodes a signal sequence which is fused in frame to the polypeptide that comprises the TIGIT variant. As it is used herein, the term “signal sequence” or “signal peptide” refers to a peptide of a relatively short length, generally between 5 and 30 amino acid residues, directing proteins synthesized in the cell towards the secretory pathway. The signal peptide usually contains a series of hydrophobic amino acids adopting a secondary alpha helix structure. Additionally, many peptides include a series of positively-charged amino acids that can contribute to the protein adopting the suitable topology for its translocation. The signal peptide tends to have at its carboxyl end a motif for recognition by a peptidase, which is capable of hydrolyzing the signal peptide giving rise to a free signal peptide and a mature protein. The signal peptide can be cleaved once the protein of interest has reached the appropriate location. Any signal peptide may be used in the presentinvention. In a preferred embodiment, the signal sequence is the TIGIT native signalsequence, the azurocidin signal sequence or the CD5 signal sequence. In a morepreferred embodiment, the signal sequence is as defined in SEQ ID NO: 26 (TIGIT nativesignal sequence), SEQ ID NO: 27 (CD5 signal sequence) or SEQ ID NO: 28 (azurocidinsignal sequence). In another embodiment, the composition of the invention wherein the polynucleotide is selected from the group consisting of SEQ ID NO: 29 to 38.The second component of the composition of the invention consists of an inhibitor of thePD-1 / PD-L1 axis. The term “inhibitor of the PD-1 / PD-L1 axis”, as used herein, refers to a molecule that inhibits the interaction of a PD-L1 axis binding partner with either one or more of its binding partner, so as to remove T-cell dysfunction resulting from signaling on the PD-1signaling axis - with a result being to restore or enhance T-cell function. As used herein,a PD-L1 axis binding antagonist includes a PD-L1 binding antagonist and a PD-1 binding antagonist as well as molecules that interfere with the interaction between PD-L1 and PD-1 (e.g., PD-L2-Fc fusion). The term "PD-L1 binding antagonists" is a molecule that decreases, blocks, inhibits, abrogates or interferes with signal transduction resulting from the interaction of PD-L1 with either one or more of its binding partners, such as PD-1, B7-1. In some embodiments, a PD-L1 binding antagonist is a molecule that inhibits the binding of PD- L1 to its binding partners. In a specific aspect, the PD-L1 binding antagonist inhibits binding of PD-L1 to PD-1 and / or B7-1. In some embodiments, the PD-L1 bindingantagonists include anti-PD-L1 antibodies, antigen binding fragments thereof,immunoadhesins, fusion proteins, oligopeptides and other molecules that decrease, block, inhibit, abrogate or interfere with signal transduction resulting from the interactionof PD-L1 with one or more of its binding partners, such as PD-1, B7-1. In oneembodiment, a PD-L1 binding antagonist reduces the negative signal mediated by or through cell surface proteins expressed on T lymphocytes, and other cells, mediatedsignaling through PD-L1 or PD-1 so as render a dysfunctional T-cell less non-dysfunctional. In some embodiments of the method, the PD-1 / PD-L1 signaling inhibitoris an anti-PD-L1 antibody or an antigen binding fragment thereof. In some embodiments of the method, the anti-PD-L1 antibody or the antigen binding fragment thereof is selected from the group consisting of polyclonal antibody, monoclonal antibody, Fab, scFv, diabody, triabody, minibody, VHH and sdAb.In some embodiments of the method, the PD-L1 binding antagonist is an anti-PD-L1antibody or the antigen binding fragment thereof is selected from the group consistingofmanelimab, atezolizumab, avelumab, cosibelimab, durvalumab, envafolimab, socazolimab, BGB-A333, CK-301, CS-1001, FAZ-053, APL-502, MDX-1105, IMC-001, KD-005, Gensci-047, LY-3300054, SHR-1316, MSB-2311, AVA-004, CBT-502, JS-003, B12 and KY-1003. In some embodiments of the method, the anti-PD-L1 antibody or the antigen binding fragment thereof is B12.In some embodiments of the method, the PD-L2 binding antagonist is an anti-PD-L2antibody or an antigen binding fragment thereof. In a preferred embodiment, the anti-PD-L2 antibody is the mAb produced by clone 366C.9E5 (Merck catalog MABC1120). The term "PD-1 binding antagonist" is a molecule that decreases, blocks, inhibits, abrogates or interferes with signal transduction resulting from the interaction of PD-1 with one or more of its binding partners, such as PD-L1, PD-L2. In some embodiments, the PD-1 binding antagonist is a molecule that inhibits the binding of PD-1 to its binding partners. In a specific aspect, the PD-1 binding antagonist inhibits the binding of PD-1 toPD-L1 and / or PD-L2. For example, PD-1 binding antagonists include anti-PD-1antibodies, antigen binding fragments thereof, immunoadhesins, fusion proteins,oligopeptides and other molecules that decrease, block, inhibit, abrogate or interfere withsignal transduction resulting from the interaction of PD-1 with PD-L1 and / or PD-L2. Inone embodiment, a PD-1 binding antagonist reduces the negative signal mediated by or through cell surface proteins expressed on T lymphocytes, and other cells, mediatedsignaling through PD-1 or PD-L1 so as render a dysfunctional T-cell less non-dysfunctional. In some embodiments of the method, the PD-1 binding antagonist is ananti-PD-1 antibody or the antigen binding fragment thereof is selected from the group consisting ofpidilizumab, cemiplimab, sintilimab, cetrelimab, spartalizumab, camrelizumab, tislelizumab, balstilimab, toripalimab, dostarlimab, ABBV-181, penpulimab, pembrolizumab, genolimzumab, retifanlimab, sasanlimab, AMP-224, AB122, F-520, MEDI-3387, MEDI-5771, MEDI-0680, SG-001, nivolumab, BCD-100, BAT-1306, BI-754091, CBT-501, GLS-010, LZM-009, Sym-021, CS-1003, HLX-10, AK- 103, AM-0001, ENUM-244C8, ENUM-388D4, JTX-4014, RXI-762, STI-A1110, HLX-20, SSI-361, APL-501, TJ0141H, and SNA-01. In some embodiments of the method, the anti-PD-1 antibody or the antigen binding fragment thereof is toripalimab.The terms “anti-PD1 antibody” or “anti-PD-1 neutralizing antibody” refer to an antibodythat specifically binds to cell death protein 1 (PD-1) and inhibits the binding of PD-1 to its ligand PD-L1 and optionally inhibits the binding of PD-1 to its ligands PD-L1 and PD-L2. The anti-PD1 antibody thereby abolishes the suppressive effect of the PD-1 / PD-L1and / or PD-1 / PD-L2 interaction on T cells.The terms “anti-PD-L1 antibody” or “anti-PD-L1 neutralizing antibody” refer to anantibody that specifically binds to cell death protein 1 ligand (PD-L1) and inhibits thebinding of PD-L1 to PD-1. The anti-PD-L1 antibody thereby abolishes the suppressiveeffect of the PD-L1 / PD-1 interaction on T cells.In another embodiment, the composition of the invention wherein the first component is the polypeptide as defined in SEQ ID NO: 14 and the second component is an anti-PD- L1 antibody or wherein the first component is the polypeptide as defined in SEQ ID NO:15 and the second component is an anti-PD-L1 antibody. The anti-PD-L1 antibody usedis an InVivoMAb anti-mouse PD-L1 (B7-H1) with a catalog number of BE0101 and aclone number of 10F.9G2™.In a more particular embodiment, the first component and the second component of the composition of the invention wherein the first component is a polypeptide are present at a ratio of from about 10,000:1 to about 1:10,000.For example, the ratio of first component to second component may be from about 1:1to about 1:500. In other embodiments, the ratio of first component to second componentmay be from about 1:1 to about 1:100, from about 1:1 to about 1:50, from about 1:10 to about 1:10,000, from about 1:10 to about 1:1,000, from about 1:10 to about 1:100, from about 1:10 to about 1:50, from about 1:30 to about 1:10,000, from about 1:30 to about 1:1,000, from about 1:30 to about 1:100, from bout 1:30 to about 1:50, from about 1:50 to about 1:10,000, from about 1:50 to about 1:1,000, from about 1:50 to about 1:100 orof about 1:50 or of about 1:10.In another particular embodiment, the ratio of first component: to the second componentis from about 1:1 to about 500:1, from about 1:1 to about 100:1, from about 1:1 to about50:1, from about 10:1 to about 10,000:1, from about 10:1 to about 1,000:1, from about10:1 to about 100:1, from about 10:1 to about 50:1. In particular embodiments, the ratioof first component: second component may be from about 30:1 to about 10,000:1, from about 30:1 to about 1,000:1, from about 30:1 to about 100:1, from about 30:1 to about 50:1, from about 50:1 to about 10,000:1, from about 50:1 to about 1,000:1, from about50:1 to about 100:1. In a preferred embodiment, the ratio of first component to secondcomponent is of about 50:1. In another preferred embodiment the ratio of firstcomponent: second component is of about 10:1.Pharmaceutical composition of the inventionIn as second aspect, the invention relates to a pharmaceutical composition, hereinafterthe pharmaceutical composition of the invention, comprising a pharmaceutically effectiveamount of the composition of the invention and a pharmaceutically acceptable excipient.As used herein, the term “pharmaceutical composition” refers to a form that allows thebiological activity of the active ingredient contained to be effective and has an acceptable toxicity for the subject to which the composition is administered. The term “pharmaceutically effective amount”, as used herein, relates to the sufficient amount of a compound (i.e. of the combination of the invention) to provide the desired effect and it will generally be determined, by among other causes, the characteristics of the compound itself and the therapeutic effect to be achieved. It will also depend on the subject to be treated, the severity of the disease suffered by said subject, the chosen dosage form, administration route, etc. The term "excipient" refers to a substance that aids the absorption of any of the components or compounds of the pharmaceutical composition of the invention, or stabilises the components or compounds and / or aids the preparation of the pharmaceutical composition in the sense of giving it consistency or flavours to make it more palatable. Thus, excipients may have the function, by way of example, but not limited to, binding the components (e.g. starches, sugars or cellulose), sweetening, colouring, protecting the active substance (e.g. to insulate it from air and / or moisture), filling a pill, capsule or any other presentation or a disintegrating function to facilitate the dissolution of the components, not excluding other excipients not listed in this paragraph. The term 'excipient' is therefore defined as a material which, included in the dosage forms, is added to the active substances or their associations to enable their preparation and stability, to modify their organoleptic properties or to determine the physical and chemical properties of the pharmaceutical composition and their bioavailability. The expression “pharmaceutically acceptable excipient”, as used herein, includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents that are physiologically compatible with the composition of the invention. The “dosage form” is the configuration to which the active ingredients and excipients are adapted to provide a pharmaceutical composition or medicinal product. It is defined by the combination of the form in which the pharmaceutical composition is presented by the manufacturer and the form in which it is administered. All the terms and embodiments previously describes are equally applicable to this aspect of the invention.Medical uses of the compositions of the invention in the treatment of immune-relateddiseaseIn a third aspect, the present invention relates to the composition of the invention or thepharmaceutical composition of the invention for use in medicine, hereinafter first medicaluse of the invention. Alternatively, the invention relates to the use of the composition ofthe invention or the pharmaceutical composition of the invention for the manufacture ofa medicament. In a fourth aspect, the present invention relates to the composition of the invention or thepharmaceutical composition of the invention for use in a method for treating or delayingan immune-related disease, hereinafter second medical use of the invention.Alternatively, the invention relates to the use of the composition of the invention or thepharmaceutical composition of the invention for the manufacture of a medicament fortreating or delaying an immune-related disease. Alternatively, the invention relates to amethod for treating or delaying an immune-related disease, the method comprising administering to the subject an effective amount of the composition of the invention orthe pharmaceutical composition of the invention.The terms “treatment”, “treat” or “treating” as used herein refer to the administration ofthe composition of the invention or the pharmaceutical composition for controlling theprogression of a disease after its clinical signs have appeared. Control of the disease progression is understood to mean the beneficial or desired clinical results that include, but are not limited to, reduction of the symptoms, reduction of the duration of the disease, stabilization of pathological states (specifically to avoid additional deterioration), delaying the progression of the disease, improving the pathological state and remission (bothpartial and total). The control of progression of the disease also involves an extension ofsurvival compared with the expected survival if treatment was not applied. Within the context of the present invention, the terms “treat” and “treatment” refer specifically to stopping or slowing the infection and destruction of healthy CD4+ T cells by HumanImmunodeficiency Virus (HIV) together with the immune exhaustion derived from chronicHIV, chronic hepatitis, Hepatitis C Virus (HCV), retrovirus, Herpes Simplex virus, suchCytomegalovirus (CMV), Epstein Bar Virus (EBV), Varicella Zoster Virus (VZV) andTuberculosis infected subject. It also refers to the stopping and slowing of the onset ofsymptoms of the acquired immunodeficiency disease (AIDS), such as extremely lowCD4+ T cell count and repeated infections by opportunistic pathogens. Beneficial or desired clinical results include, but are not limited to, an increase in absolute naïve CD4+T cell count (range 10-3520), an increase in the percentage of CD4+ T cell over totalcirculating immune cells (range 1-50%), or an increase in CD4+ T cell count as a percentage of normal CD4+ T cell count in an uninfected subject (range 1-161%). “Treatment” can also mean prolonging survival of the infected subject as compared to expected survival if the subject does not receive any chronic hepatitis, Hepatitis C Virus (HCV), retrovirus, Human Immunodeficiency Virus (HIV), Herpes Simplex virus, suchCytomegalovirus (CMV), Epstein Bar Virus (EBV), Varicella Zoster Virus (VZV) and / orTuberculosis targeted treatment.The terms “delay” or “delaying”, as used herein refers to a cessation or slowing in the decline of one or more parameters of the immune-related disease in a subject or a maintenance of a level of one or more parameters of the immune-related disease. The term “subject”, as used herein, refers to an individual, plant or animal, such as a human, a nonhuman primate (e.g., chimpanzees and other apes and monkey species); farm animals, such as birds, fish, cattle, sheep, pigs, goats and horses; domesticmammals, such as dogs and cats; laboratory animals including rodents, such as mice,rats and guinea pigs. The term does not denote a particular age or sex. In a preferredembodiment of the invention, the subject is a human.As used herein, the term “immune related disease” relates to a disease in which theimmune system is involved in the pathogenesis of the disease, or in which cell proliferation occurs. Examples of immune-related diseases object of this invention are inflammatory diseases, in particular autoimmune diseases, and cancers. In another embodiment, the immune related disease is a chronic viral infection, a chronic bacterial infection, and a tumor. As used herein, the term “chronic viral infection” refers to a subject afflicted or infectedwith a chronic virus. In one embodiment, the chronic viral infection is selected, but notlimited, from the group consisting of: HCV, HIV, CMV, EBV and VZV.The term “HCV” or “Hepatitis C virus”, as used herein, refers to a single-stranded, positive-sense RNA virus member of the genus Hepacivirus in the family Flaviviridae (Rosen H, et al., NEJM 2011; 364(25):2429-2438). HCV may lead to liver disease and cirrhosis. In some cases, those with cirrhosis may develop serious complications such as liver failure, liver cancer, or dilated blood vessels in the esophagus and stomach. The term “HIV”, as used herein, include HIV-1 and HIV-2, SHIV and SIV. “HIV-1” means the human immunodeficiency virus type-1. HIV-1 includes, but is not limited to, extracellular virus particles and the forms of HIV-1 associated with HIV-1 infected cells. The HIV-1 virus may represent any of the known major subtypes (Classes A, B, C, D E, F, G and H) or outlying subtype (Group O) including laboratory strains and primary isolates. “HIV-2” means the human immunodeficiency virus type-2. HIV-2 includes, but is not limited to, extracellular virus particles and the forms of HIV-2 associated with HIV- 2 infected cells. The term “SIV” refers to simian immunodeficiency virus which is an HIV- like virus that infects monkeys, chimpanzees, and other nonhuman primates. SIV includes, but is not limited to, extracellular virus particles and the forms of SIV associated with SIV infected cells. The term “HIV exposure”, as used herein, refers to the contact of an uninfected subject with a subject having an HIV infection or AIDS, or the contact with body fluids from suchHIV-infected subject, in which such fluids from the infected subject contact a mucousmembrane, a cut or abrasion in the tissue (e.g., needle stick, unprotected sexual intercourse), or other surface of the uninfected subject in such a way that the virus could be transmitted from the infected subject or infected subject's body fluids to the uninfected subject. The term “HIV infection”, as used herein, refers to indications of the presence of the HIV virus in an individual including asymptomatic seropositivity, AIDS-related complex (ARC), and acquired immunodeficiency syndrome (AIDS). In a particular embodiment, the composition or the pharmaceutical composition for use according to the invention is applied to a patient suffering from a chronic HIV infection and which is receiving antiretroviral therapy.The term “antiretroviral therapy” or “ART”, as used herein, refers to the administration ofone or more antiretroviral drugs (i.e., HIV antiretrovirals) to inhibit the replication of HIV. Typically, ART involves the administration of at least one antiretroviral agent (or, commonly, a cocktail of antiretrovirals) such as nucleoside reverse transcriptase inhibitor (e.g., zidovudine (AZT, lamivudine (3TC) and abacavir), non-nucleoside reverse transcriptase inhibitor (e.g., nevirapine and efavirenz) and protease inhibitor (e.g., indinavir, ritonavir and lopinavir). The terms “CMV” or “Cytomegalovirus”, as used herein, refers to a genus of viruses in the order Herpesvirales, family Herpesviridae, subfamily Betaherpesvirinae. The CMV genus comprises 11 species including human betaherpesvirus 5 (HCMV, human cytomegalovirus, HHV-5), which is the species that infects humans. Diseases associated with HHV-5 include mononucleosis and pneumonia (ENA accession number GU980198). The term “CMV therapy”, as used herein, refers to any therapies, including blood products, immune therapies and drug therapies, approved or currently under evaluation for the prevention, inhibition of the progression or treatment of CMV or its related diseases. Examples of CMV therapies include antivirals such as Ganciclovir (CAS [82410-32-0]). The term “EBV” or “Epstein-Barr virus”, as used herein, refers to a double-stranded DNA virus member of the herpes virus family (Zanella M, et al., Clinical Microbiol Rev 2020; 33(4):e00027-20.0). EBV spreads most commonly through bodily fluids, primarily saliva. EBV can cause infectious mononucleosis, also called mono, and other illnesses.The term “VZV” or “Varicella-Zoster virus”, as used herein, refers to a human herpesvirus3 (HHV-3, HHV3) or human alphaherpesvirus 3 (taxonomically), is one of nine known herpes viruses that can infect humans. It causes chickenpox (varicella) commonly affecting children and young adults, and shingles (herpes zoster) in adults but rarely in children. VZV infections are species-specific to humans. The term “VZV infection”, as used herein, refers to indications of the presence of the VZV in an individual.The term "chronic bacterial infection" is a bacterial infection that is of a long duration orfrequent recurrence. For example, a chronic middle ear infection, or otitis media, can occur when the Eustachian tube becomes blocked repeatedly due to allergies, multiple infections, ear trauma, or swelling of the adenoids. The definition of "long duration" will depend upon the particular infection. For example, in the case of a chronic middle ear infection, it may last for weeks to months. Other known chronic bacterial infectionsinclude urinary tract infection (most commonly caused by Escherichia coli and / orStaphylococcus saprophyticus), gastritis (most commonly caused by Helicobacter pylori), respiratory infection (such as those commonly afflicting patents with cystic fibrosis, most commonly caused by Pseudomonas aeruginosa), pyelonephritis (mostcommonly caused by Proteus species, Escherichia coli and / or Pseudomonas species),osteomyelitis (most commonly caused by Staphylococcus aureus, but also by Escherichia coli), bacteremia, skin infection, rosacea, acne, chronic wound infection, infectious kidney stones (can be caused by Proteus mirabilis), bacterial endocarditis, and sinus infection. As used herein, the term “cancer” or “tumor” or “tumor disease” refers to a disease characterized by uncontrolled cell division (or by an increase of survival or apoptosis resistance) and by the ability of said cells to invade other neighboring tissues (invasion) and spread to other areas of the body where the cells are not normally located (metastasis) through the lymphatic and blood vessels, circulate through the bloodstream, and then invade normal tissues elsewhere in the body. Depending on whether or not they can spread by invasion and metastasis, tumors are classified as being either benign or malignant: benign tumors are tumors that cannot spread by invasion or metastasis, i.e., they only grow locally; whereas malignant tumors are tumors that are capable of spreading by invasion and metastasis. As used herein, the term cancer includes, but isnot limited to breast cancer, ovarian cancer, pancreatic cancer, prostate cancer, lungcancer, colorectal cancer, stomach / gastric cancer, endometrial / uterine / cervical cancer, bladder cancer, head and neck cancer, leukemia, cancer of the heart, of the small intestine, spleen, kidney, brain, skin, bone, bone marrow, blood, thymus, womb, testicles, hepatobiliary system and liver, sarcoma, cholangiocarcinoma, glioblastoma, multiple myeloma, lymphoma, adenoma, angiosarcoma, astrocytoma, epithelial carcinoma, germinoma, glioma, hemangioendothelioma, hemangiosarcoma, hematoma, hepatoblastoma, medulloblastoma, melanoma, neuroblastoma, hepatobiliary cancer, osteosarcoma, retinoblastoma, rhabdomyosarcoma, sarcoma and teratoma. Furthermore, this term includes acrolentiginous melanoma, actinic keratosisadenocarcinoma, adenoid cystic carcinoma, adenomas, adenosarcoma, adenosquamuscarcinoma, astrocytic tumors, Bartholin gland carcinoma, basal cell carcinoma, bronchial gland carcinoma, capillary carcinoid, carcinoma, carcinosarcoma, cystadenoma, endodermal sinus tumor, endometrial hyperplasia, endometrial stromal sarcoma, endometrioid adenocarcinoma, ependymal sarcoma, Ewing sarcoma, focal nodular hyperplasia, germ cell tumors, glucagonoma, hemangioblastoma, hemagioendothelioma, hemagioma, hepatic adenoma, hepatic adenomastosis,hepatocellular carcinoma, hepatobiliary cancer, insulinoma, intraepithelial neoplasia,squamous cell intraepithelial neoplasia, invasive squamous-cell carcinoma, large cell carcinoma, leiomyosarcoma, melanoma, malignant melonoma, malignant mesothelial tumor, medulloblastoma, medulloepithelioma, mucoepidermoid carcinoma, neuroblastoma, neuroepithelial adenocarcinoma, nodular melanoma, osteosarcoma, papillary serous adenocarcinoma, pituitary tumors, plasmacytoma, pseudosarcoma, pulmonary blastoma, renal cell carcinoma, retinoblastoma, rhabdomyosarcoma, serous carcinoma, microcytic carcinoma, soft tissue carcinoma, somatostatin secreting tumor, squamous carcinoma, squamous cell carcinoma, undifferentiated carcinoma, uveal melanoma, verrucous carcinoma, vipoma, Wilm tumor, intracerebral cancer, rectal cancer, astrocytoma, microcytic cancer and non-microcytic cancer, metastatic melanoma, androgen-independent metastatic prostate cancer, androgen-dependent metastatic prostate cancer. The term cancer includes both primary tumors as well as metastatic tumors.In a more particular embodiment, the first component and the second component of thecomposition of the invention are administered simultaneously or sequentially.Previous research has shown an association between increased expression of CD155in macrophages and poor antiviral immunity in coronary artery disease (CAD) (Zhao TV,Nat Cardiov Res 2022). Also, CAD is a risk factor for severe viral disease complicatedby high morbidity and mortality rates, particularly in the HIV-aged population and those with cardiovascular diseases. Thus, in another embodiment, the composition or the pharmaceutical composition according to the invention is used in a subject having a cardiovascular disease. As used herein, the term “cardiovascular disease” is intended to refer to all pathological states leading to a narrowing and / or occlusion of blood vessels throughout the body. In particular, the term “cardiovascular disease” refers to conditions including atherosclerosis, thrombosis, and other related pathological states, especially within arteries of the heart and brain. In a particular embodiment of the use I of the invention the cardiovascular disease is selected from a group consisting of: atherosclerosis, thrombosis, coronary artery disease, arrhythmia, congenital heart disease, hypertension, peripheral heart disease, cardiomyopathy, angina, pericarditis, rheumatic heart disease, aortic disease, cerebrovascular disease, and abnormal heart rhythms, preferably atherosclerosis. All previous definitions and embodiments related to previous aspects are also applicableto the third and fourth aspects and their embodiments.Methods for reducing immune toxicity in a patient that is being treated with an inhibitorof the PD-1 / PD-L1 axis using soluble TIGIT variantsIn a fifth aspect, the present invention relates to a polypeptide comprising a TIGIT variantthat comprises the TIGIT Ig-like V-type domain and wherein said polypeptide lacks the TIGIT transmembrane and cytoplasmic domains or a polynucleotide encoding saidpolypeptide for use in a method for reducing immune toxicity in a patient that is beingtreated with an inhibitor of the PD-1 / PD-L1 axis, hereinafter second medical use of the invention. The term “inhibitor of the PD-1 / PD-L1 axis”, as used herein, refers to a molecule that inhibits the interaction of a PD-L1 axis binding partner with either one or more of its binding partner, so as to remove T-cell dysfunction resulting from signaling on the PD-1signaling axis - with a result being to restore or enhance T-cell function. As used herein,a PD-L1 axis binding antagonist includes a PD-L1 binding antagonist and a PD-1 binding antagonist as well as molecules that interfere with the interaction between PD-L1 and PD-1 (e.g., PD-L2-Fc fusion). The term "PD-L1 binding antagonists" is a molecule that decreases, blocks, inhibits, abrogates or interferes with signal transduction resulting from the interaction of PD-L1 with either one or more of its binding partners, such as PD-1, B7-1. In some embodiments, a PD-L1 binding antagonist is a molecule that inhibits the binding of PD- L1 to its binding partners. In a specific aspect, the PD-L1 binding antagonist inhibits binding of PD-L1 to PD-1 and / or B7-1. In some embodiments, the PD-L1 bindingantagonists include anti-PD-L1 antibodies, antigen binding fragments thereof,immunoadhesins, fusion proteins, oligopeptides and other molecules that decrease, block, inhibit, abrogate or interfere with signal transduction resulting from the interactionof PD-L1 with one or more of its binding partners, such as PD-1, B7-1. In oneembodiment, a PD-L1 binding antagonist reduces the negative signal mediated by or through cell surface proteins expressed on T lymphocytes, and other cells, mediatedsignaling through PD-L1 or PD-1 so as render a dysfunctional T-cell less non-dysfunctional. In some embodiments of the method, the PD-1 / PD-L1 signaling inhibitoris an anti-PD-L1 antibodyor an antigen binding fragment thereof. In some embodiments of the method, the anti-PD-L1 antibody or the antigen binding fragment thereof is selected from the group consisting of polyclonal antibody, monoclonal antibody, Fab, scFv, diabody, triabody, minibody, VHH and sdAb.In some embodiments of the method, the PD-L1 binding antagonist is an anti-PD-L1antibody or the antigen binding fragment thereof is selected from the group consisting ofmanelimab, atezolizumab, avelumab, cosibelimab, durvalumab, envafolimab, socazolimab, BGB-A333, CK-301, CS-1001, FAZ-053, APL-502, MDX-1105, IMC-001, KD-005, Gensci-047, LY-3300054, SHR-1316, MSB-2311, AVA-004, CBT-502, JS-003, B12 and KY-1003. In some embodiments of the method, the anti-PD-L1 antibody or the antigen binding fragment thereof is B12. The term "PD-1 binding antagonist" is a molecule that decreases, blocks, inhibits, abrogates or interferes with signal transduction resulting from the interaction of PD-1 with one or more of its binding partners, such as PD-L1, PD-L2. In some embodiments, the PD-1 binding antagonist is a molecule that inhibits the binding of PD-1 to its binding partners. In a specific aspect, the PD-1 binding antagonist inhibits the binding of PD-1 toPD-L1 and / or PD-L2. For example, PD-1 binding antagonists include anti-PD-1antibodies, antigen binding fragments thereof, immunoadhesins, fusion proteins, oligopeptides and other molecules that decrease, block, inhibit, abrogate or interfere withsignal transduction resulting from the interaction of PD-1 with PD-L1 and / or PD-L2. Inone embodiment, a PD-1 binding antagonist reduces the negative signal mediated by or through cell surface proteins expressed on T lymphocytes, and other cells, mediatedsignaling through PD-1 or PD-L1 so as render a dysfunctional T-cell less non-dysfunctional. In some embodiments of the method, the PD-1 binding antagonist is ananti-PD-1 antibody or the antigen binding fragment thereof is selected from the group consisting ofpidilizumab, cemiplimab, sintilimab, cetrelimab, spartalizumab, camrelizumab, tislelizumab, balstilimab, toripalimab, dostarlimab, ABBV-181, penpulimab, pembrolizumab, genolimzumab, retifanlimab, sasanlimab, AMP-224, AB122, F-520, MEDI-3387, MEDI-5771, MEDI-0680, SG-001, nivolumab, BCD-100, BAT-1306, BI-754091, CBT-501, GLS-010, LZM-009, Sym-021, CS-1003, HLX-10, AK- 103, AM-0001, ENUM-244C8, ENUM-388D4, JTX-4014, RXI-762, STI-A1110, HLX-20, SSI-361, APL-501, TJ0141H, and SNA-01. In some embodiments of the method, the anti-PD-1 antibody or the antigen binding fragment thereof is toripalimab.In a particular embodiment, the polypeptide or polynucleotide for use according to thefifth aspect of the invention contains a TIGIT variant that contains both thehomodimerization domain and the Ig-like V-type domain. Preferably, the TIGIT variantcomprises, consists or essentially consists of amino acids 22 to 124 of human TIGITwherein the numbering is as defined in the NCBI database entry (Release of 10 March2024) under accession number NP_776160 or amino acids 20 to 119 of the mouse TIGITwherein the numbering is as defined in the NCBI database entry (Release of 24 May2024) under accession number NP_001139797. In another more particular embodiment,the TIGIT variant is a polypeptide as defined in SEQ ID NO: 1 or SEQ ID NO: 39.In a preferred embodiment, the polypeptide or polynucleotide for use according to thefifth aspect of the invention, which is a fusion protein comprising the TIGIT variant and a non-TIGIT polypeptide region or a polynucleotide encoding said fusion protein. In a particular embodiment, the non-TIGIT polypeptide region is a Fc monomer region which is formed by the hinge region and the CH2 and CH3 domains of an IgG molecule. In another embodiment, the Fc monomer region is selected from the group consisting ofthe human IgG1 Fc monomer, the human IgG1 Fc monomer carrying a S228P mutation,the mouse IgG2c Fc monomer, the mouse IgG2c Fc monomer carrying the ΔPCPPmutation and the mouse IgG1 Fc monomer.In a more particular embodiment, the Fc monomer region is selected from the groupconsisting of SEQ ID NO: 3 (human IgG1 Fc monomer), SEQ ID NO: 4 (human IgG1 Fcmonomer carrying a S228P mutation), SEQ ID NO: 5 (mouse IgG2c Fc monomer), SEQID NO: 6 (mouse IgG2c Fc monomer carrying the ΔPCPP mutation) or SEQ ID NO: 7(mouse IgG1 Fc monomer).In particular embodiment, the TIGIT variant is a fusion protein comprising the humanTIGIT Ig-like V-type domain and a human IgG1 Fc monomer region. In a more particularembodiment the fusion protein consists of SEQ ID NO: 8.In particular embodiment, the TIGIT variant is a fusion protein comprising the humanTIGIT Ig-like V-type domain and a human IgG4 Fc monomer region carrying a S228Pmutation. In a more particular embodiment the fusion protein consists of SEQ ID NO: 9.In particular embodiment, the TIGIT variant is a fusion protein comprising the mouseTIGIT Ig-like V-type domain and a mouse IgG2c Fc monomer region. In a more particularembodiment the fusion protein consists of SEQ ID NO: 10.In particular embodiment, the TIGIT variant is a fusion protein comprising the mouseTIGIT Ig-like V-type domain and a mouse IgG2c Fc monomer region carrying a ΔPCPPmutation. In a more particular embodiment the fusion protein consists of SEQ ID NO: 11.In particular embodiment, the TIGIT variant is a fusion protein comprising the mouseTIGIT Ig-like V-type domain and a mouse IgG1 Fc monomer region. In a more particularembodiment the fusion protein consists of SEQ ID NO: 12.In particular embodiment, the TIGIT variant is a fusion protein comprising the humanTIGIT Ig-like V-type domain and a mouse IgG2c Fc monomer region. In a more particularembodiment the fusion protein consists of SEQ ID NO: 13.In particular embodiment, the TIGIT variant is a fusion protein comprising the humanTIGIT Ig-like V-type domain and a mouse IgG2c Fc monomer region carrying a ΔPCPPmutation. In a more particular embodiment the fusion protein consists of SEQ ID NO: 14.In particular embodiment, the TIGIT variant is a fusion protein comprising the humanTIGIT Ig-like V-type domain and a mouse IgG1 Fc monomer region. In a more particularembodiment the fusion protein consists of SEQ ID NO: 15. In another embodiment, the polypeptide or polynucleotide for use according to the fifthaspect of the invention which is selected from the group consisting of SEQ ID NO: 16 to25. In a more particular embodiment, the polypeptide or polynucleotide for use according tothe fifth aspect of the invention wherein, if the first component is a polynucleotide, thenthe polynucleotide further comprises a region that encodes a signal sequence which is fused in frame to the polypeptide that comprises the TIGIT variant. In a preferred embodiment, the polypeptide or polynucleotide for use according to thefifth aspect of the invention wherein the signal sequence is as defined in SEQ ID NO: 26(TIGIT native signal sequence), SEQ ID NO: 27 (CD5 signal sequence) or SEQ ID NO:28 (azurocidin signal sequence).In a particular embodiment, the polypeptide or polynucleotide for use according to thefifth aspect of the invention wherein the polynucleotide is selected from the groupconsisting of SEQ ID NO: 29 to 38. In an embodiment, the polypeptide or polynucleotide for use according to the fifth aspect of the invention is used in a patient that suffers from a chronic bacterial or viral infectiousdisease. In an embodiment, the chronic bacterial infectious disease is selected from thegroup consisting of an ear infection, a urinary tract infection caused by Escherichia coli and / or by Staphylococcus saprophyticus, a gastritis caused by Helicobacter pylori, a respiratory infection caused by Pseudomonas aeruginosa, pyelonephritis caused byProteus species, Escherichia coli and / or Pseudomonas species, osteomyelitis, causedby Staphylococcus aureus or by Escherichia coli, bacteremia, skin infection, rosacea,acne, chronic wound infection, infectious kidney stones caused by Proteus mirabilis, bacterial endocarditis, and sinus infection. In yet another embodiment, the chronic viral infectious disease is selected from the group consisting of an infection caused by HCV, by HIV, by CMV, by EBV and by VZV. In a particular embodiment, the polypeptide or polynucleotide for use according to the fifth aspect of the invention is used in a patient suffering from a chronic HIV infection and which is receiving antiretroviral therapy. In another particular embodiment, the composition or the pharmaceutical composition according to the invention is used in a subject having a cardiovascular disease. All the terms and embodiments previously described are equally applicable to this aspect of the invention. *** The invention is defined below by means of the following examples which are to be construed as purely illustrative and not limitative of the scope of the invention. EXAMPLES Materials In silico modelling by I-TASSERThe Iterative Threading ASSEmbly Refinement (I-TASSER) modelling tool was used topredict the 3D structures of the sIRs. The sIR amino acid sequences were submitted for in silico modelling, and 3D models were obtained. From the top 5 final models, the highest C-score model was selected for visualization and analysis using Pymol software. The secondary and tertiary structures were aligned to the X-ray diffraction proteinstructure of TIGIT (PDB - 3Q0H). Finally, predicted solvent accessibility was analysed todetermine buried and highly exposed residues in the homodimerization domains and the VTQ, AX6G, and TYP sequences. Plasmids design and production All DNA sequences encoding sIR proteins (Fig.1-2) were synthesised using the Gene Synthesis service (Genscript). The DNA sequence was optimised for best codon usageand GC content in human cells using the Optimum™ Codon Tool. The final DNAsequence was cloned into pcDNA3.1 / Hygro (+) or pcDNA3.4- TOPO vectors. The OneShot™ OmniMAX™ 2 T1R Chemically Competent E. coli cells (Ref. C854003,Invitrogen) were used following the manufacturer's instructions. Briefly, the plasmidsencoding sIR were resuspended in nuclease- free H2O to obtain a stock concentrationof 100 ng / μL. Then, the sIRs' plasmid DNA (100 ng) was added to the One-Shotcompetent E. coli cells, which were incubated on ice for 30 min. Then, cells were heat-shocked at 42°C for 30 seconds without shaking, followed by a 2-minute incubation on ice. To recover the culture, pre-warmed S.O.C. medium (250 μL) was added to each vial, and the cell culture was incubated at 37°C for 1 hour in a shaking incubator at 225 rpm. Finally, an aliquot of the recovered transformation culture (25-100 μL) was spread onto a pre-warmed selective LB agar plate containing 10 μg / mL ampicillin, followed by overnight incubation at 37°C and 225 rpm. The next day, the colonies were selected from the plate and grown in 3mL of ampicillin-LB selective media at 37°C for 4 h in a shaking incubator at 225 rpm. After that, the volume was escalated to 200 mL, and the cultureswere grown overnight at 37°C in a shaking incubator at 225 rpm for plasmid DNApurification. Then, cell cultures were pelleted by centrifugation for 30 min at 3000 g to obtain cell pellets. According to the manufacturer's instructions, plasmid DNA waspurified with ZymoPURE™ II Plasmid Maxiprep Kit (Zymo Research) and DNA wassterilised with 0,22 μm filter. DNA concentration was determined by measuring absorbance at 260 nm using a NanoDrop One / One (ThermoFisher Scientific). Plasmid digestion was analysed with FastDigest restriction enzymes in an electrophoretic gel of 1% agarose for the release of the expected insert. Moreover, the purified plasmid was sequenced using universal primers, CMV-F (CGCAAATGGGCGGTAGGCGTG) and WRPE-R (CATAGCGTAAAA GGAGCAACA) (Macrogen, Madrid, Spain) for sequence confirmation. Protein production and purificationExpiFectamine™ 293 Transfection Kit (Ref. A14524, ThermoFisher) was used accordingto the manufacturer´s instructions for plasmid transfection and protein production. Briefly,Expi293F™ (ThermoFisher) cells at high density (4,5-5,5x106 cells / mL) and with cellviability >95% were diluted to a final density of 3.0x106cells / mL with pre-warmedExpi293F™ Expression Medium (ThermoFisher). Plasmid DNA of sIRs was diluted withOpti-MEM medium (1.0 μg / mL). Then, the ExpiFectamine™ reagent was diluted withOpti-MEM medium and was mixed by swirling or inversion. The diluted ExpiFectamine™ 293 reagent was added to the plasmid DNA and mixed by swirling or inversion. TheExpiFectamine™ and plasmid DNA complexes were incubated at room temperature for10–20 min. The complexes were slowly transferred to the Expi293F™ culture flask gentlyduring addition. Then, the cells were incubated in a 37°C incubator with ≥80% relative humidity and 8% CO2 on an orbital shaker for 22 hours at 125 rpm. After that,ExpiFectamine™ Enhancer#1 and Enhancer#2 were added to the transfection flask andgently swirled during addition. The culture supernatant with the protein of interest was harvested five days post-transfection unless otherwise specified. First, the supernatantwas harvested by centrifugation for 5 min at 300 g and then at 1000 g for 10 min. Finally,clarified supernatant was filtered using disposable sterile 0.22 μm filter units. Metalaffinity chromatography using HisTrap™ Excel columns (Merck) was used to purify thesoluble protein following the manufacturer's instructions. The column was equilibratedwith at least 5 column volumes (CV) of 500 mM NaCl-PBS (Ref.10010056, Gibco). The sample was loaded at a flow rate of 5 mL / min. The sample was washed with 20 CV of 500mM NaCl-10mM imidazole-PBS at 5 mL / min. Then, the sample was eluted applying a linear elution gradient (10 to 20 CV) from 10 to 500mM imidazole in 500mM NaCl-PBS at a flow rate of 5 mL / min. Imidazole was removed from the fractions using an Amicon® Ultra-15 Centrifugal Filter Unit (Merck). Protein quantification and quality control Protein concentration was determined by measuring absorbance at 280 nm using a NanoDrop One / One (ThermoFisher Scientific). The purity and integrity of sIR proteins were verified in a 4-20% SDS-PAGE dyed with Imperial Stain (Imperial Protein Stain, Ref. A1435101, Thermo Scientific). Alternatively, the protein specificity was verified via Western Blot using Immun-Blot® Low Fluorescence PVDF / Filter (Ref. 162-0261, Bio- Rad) and 1 / 1000 purified anti-6-His epitope Tag antibody (clone 6-His, Ref. 906101, Biolegend) with 1 / 20,000 IRDye® 800CW goat anti-mouse IgG secondary antibody (Ref. 926-32210, Li-Cor) or with 1 / 10000 HRP-AffiniPure Goat anti-mouse IgG secondaryantibody (ref 115-036- 071, Jackson). To perform the SEC-MALS analysis and determinethe oligomeric state of different sIR, 100μL of thoroughly purified protein samples at1mg / mL were loaded on a KW-803 column (Shodex) equilibrated with PBS at 0.9 mL / minflow rate (Shimadzu HPLC system). Detection was performed using a DAWN 8+multi- angle light scattering detector and an Optilab T-rEX differential refractometer (Wyatt Technology) (Protein Technologies Core Facility, CRG). Molar mass was calculated withthe Astra 6.1.17 software using a differential index of refraction (dn / dc) value of 0.183mL / g. Protein binding to human and murine CD155. To investigate the binding of sIR prototypes to CD155, the inventors employed complementary technologies, including surface plasmon resonance (SPR), functional ELISA and a cell-based assay. Protein binding by Surface Plasmon Resonance. Binding kinetics and affinity for sIR proteins were evaluated by surface plasmon resonance on a BIACORE T100 instrument (GE Healthcare). The assay involved hCD155 and mCD155 Fc chimeras captured on a Series S CM5 chip. Briefly, amine coupling was used to capture a mCD155 Fc chimera (9670-CD, Biotechne) or to create a human IgG surface (anti-human Fc mAb) followed by the capture of hCD155 Fc chimera (9174-CD, Biotechne) according to instructions from the GE Healthcare human IgG capture kit. Each antibody was captured on flow cell 4, leaving flow cell three as a subtractive reference. Capture levels of hCD155 or mCD155 were targeted between 100 and 200 resonance units, after which serial dilutions of sIR proteins were flowed over immobilised hCD155 or mCD155 (30 μL / min for 2 min) and allowed to dissociate for 3 min. The capture surface was regenerated witha 60- s injection of 3M MgCl2 between each injection. A 5-fold concentration series ofeach sIR variant ranging from 50 to 0.08 nm was used to analyse binding to hCD155 and mCD155. All sensorgrams were analysed using a 1:1 Langmuir binding model with software supplied by the manufacturer to calculate the kinetics and binding constants. To determine sIR2 KD containing a human IgG fragment, direct amine coupling was used to coat the CD155 Fc chimera in the S CM5 chip. Protein binding by functional ELISA. To determine the binding of sIRs to CD155 by ELISA, a 96-well plate was coated overnight with recombinant human and murine CD155 / PVR Fc Chimera (9174-CD or 9670-CD; R&D Systems) at a concentration of 2.5 μg / mL in 1x ELISA Coating Buffer (421701, Biolegend). The plate was washed with washbuffer (0.05 PBS / Tween, 5x300µL) and blocked with 300μL of blocking buffer (PBS 3%FBS) for 2 hours. Then, the excess blocking buffer was removed, and the plate waswashed three times with 300μL of wash buffer. Subsequently, 100μL of 3-fold serialdilutions of each sIR starting at 200μg / mL were added and incubated at 2-8°C overnight.The following day, the plate was washed, and 100μL of biotinylated 6-His antibody(1:1000, Cat.906103, Biolegend) were added and incubated at room temperature for 2hours. Then, the plate was washed, and 100μL of Avidin-HRP conjugate (1:2000, Cat.405103, Biolegend) were added and incubated at room temperature for 30 min. Afteranother wash, 100μL of chromogenic substrate 1-Step™ Ultra TMB-ELISA (Cat.34028,ThermoFisher) were added, and the plate was incubated at room temperature for 5-10min. The reaction was stopped by adding 100μL of stop solution (2M H2SO4, SigmaAldrich). The absorbance was read at 450 nm with background subtraction at 540 nm in an Ensight Multimode Plate Reader (Perkin Elmer).Protein binding to Bw5147 cell lines. The T-cell stimulator Bw5147 cell line expressinghuman CD155 (Bw hCD155) was cultured using previously described methods The cells were harvested with cell viability >95%, and 2×105live cells were transferred into each well in a 96-well plate with U-bottom. Cells were washed once with PBS after centrifugation at 400g. Then, sIRs were diluted in PBS to generate a 3-fold serial dilution starting at 200μg / mL. After that, cells were pelleted and thoroughly resuspended in100μL of the sIR serial dilutions. Bw hCD155 cells were incubated at 4°C for 1 hour withthe sIRs. After the incubation, the cells were washed once with FACS buffer andincubated in 100μL of PE-anti His antibody solution (5μL per test, Biolegend, Cat.362603). The staining was incubated at 4°C for 60 min, protected from light and thencells were washed three times with PBS and resuspended in 200μL of PBS. Sampleswere acquired in a FACSCanto cytometer (BD). The binding of sIRs to CD155 was determined by measuring the MFI of PE in the live cells gated by FSS / SSC. The binding of sIRs to CD155 was assessed by measuring the mean fluorescence intensity (MFI) of PE in the cells gated on FSS / SSC. The IC50 was determined using a sigmoidal, four- parameter logistic (4PL) regression model applied to the normalised log-transformed MFI intensity. Functional assays: coculture of BwCD155+JurkatThe inventors used Bw hCD155 cells and the triple parameter reporter Jurkat cell lineexpressing human TIGIT (Jk TIGIT). Before the coculture, Bw hCD155 cells were incubated at RT with a blocking solution of 100 μg / mL of human IgGs for 20 min. For the coculture assay, 5×104 Jk TIGIT cells were cocultured with or without 2x104 Bw hCD155 cells in the presence of sIR1, sIR2, TIGIT blockade antibody (Biolegend, Cat.372720) and IgG2a control isotype (Biolegend, Cat.400281) at 25 μg / mL for 6h at 37ºC in a 96 well U-bottom plate. Subsequently, cells were harvested and stained with mCD45.2- APC antibody (clone 104, Biolegend). Samples were acquired in FACSCanto (BD). The frequency expression of NFAT::eGFP and NFkB::CFP was measured in triplicates by flow cytometry in the entire population of viable Jk TIGIT cells and analyzed with FlowJo v10.6 (Tree Star Inc). The average mean frequency of each reporter fluorescent protein was obtained for each experimental condition. To determine the recovery of NFAT and NFkB transcription factors, subtraction of the background frequency of NFAT::eGFP and NFkB::CFP in the absence of Bw CD155 cells and the presence of sIR1, sIR2 and αTIGIT molecules was performed. LCMV chronic infection model and ethicsFor the study design, in vivo experiments were performed using C57BL / 6J- OlaHsd(C56BL / 6, 6-7 weeks of age) maintained under Specific-Pathogen Free (SPF) conditions during the experiment in the bio-contention environment (BSL3) at the Center ofComparative Medicine and Bioimaging (CMCiB-IGTP, Spain). The experimental designof the animal study included 50% sex representation (male, female) to address potential sex-based differences across all the analyses. The C57BL / 6 mice were purchased from Envigo Laboratories (Barcelona, Spain). To induce chronic infection in C56BL / 6 mice, a high dose of focus-forming units (FFU) 1×106of LCMVDOC was administered by intraperitoneal (IP) injection. The LCMVDOC was grown, stored, and quantified according to previously published methods. The PBS saline injection generated uninfected mice (Mock) as a control study group. All the experimental procedures were approved by the ethical committee for animal experimentation (CEEA-CMCiB, 22-001- MML) and by the local authorities of the Generalitat de Catalunya(Project 11676). The procedure was conducted according to the Guide for the Care and Use of Laboratory Animals provided by the Generalitat de Catalunya, the Principles of Laboratory Animal Care outlined by the National Institute of Health (NIH Bethesda, MA, USA) and the Declaration of Helsinki for animal experimental investigation. Study design of LCMV chronic infection To establish an LCMV model of chronic infection, a group of uninfected (Mock; n=10)and infected mice (LCMV; n=10) were monitored over 28 days after high- dose infectionwith LCMVDOCstrain. The inventors recorded weight measurements over 28 days to evaluate acute and chronic stages of LCMV infection. After euthanasia, on days 14, 21, and 28 (n=4 per group / per time point), necropsies were performed to obtain total blood by cardiac puncture, and the spleen was harvested to evaluate FFU and perform T-cell immunophenotype (Fig.3A). Study design of LCMV chronic infection to test sIRs prototypes efficacy A proof-of-concept study was carried out using the LCMV mice model of chronic infection to assess the efficacy of the sIR prototypes. Briefly, uninfected (Mock; n=10) and LCMVDOCinfected (LCMV; n=80) CL57BL / 6 mice were monitored for 21 days. On day 21, LCMVDOCmice were randomly allocated to each treatment arm, including LCMVSaline, sIR4, sIR9, αTIGIT, αPD-L1, sIR4+PD-1, sIR9+PD- L1, and αTIGIT+αPD-L1(n=10 for each group). All IP administrations were conducted using a 29G needle (BD,Spain) and repeated every three days until day 34 post-infection (Fig. 4A). Detailedinformation regarding the reagents used can be found in Table 1. Blood samples were collected 24 hours before and 24 hours after each IP administration. For this purpose, mice were punctured at the facial vein using a 4-5mm lancet (Novico Medica, Spain) to obtain approximately 20-30 μL of blood, which was then collected in a clotting activator 1.5 mL Microvette® tube (SARSTEDT). Additionally, longitudinal weight measurements were recorded at 2-4 days intervals. Upon euthanasia on days 28 (n=5, for each group) and 34 (n=5, for each group), necropsies were performed, total blood by cardiac puncture was obtained, and spleen and kidneys were harvested for further analysis. Table 1. Description of molecules Molecule Clone / IgG SuppliersIR4 - / MouseGenscript IgG2csIR9 - / Δ MP oC usP eP IgG1 GenscriptαTIGIT 10A7 / Mouse InvivoGen derived IgG2a αPD-L1 10F.9G2 / Rat IgG2b BioXCell Quantification of LCMV by Focus-Forming Assay The viral titers from the spleens or serum of LCMV-infected mice were assessed using a focus-forming assay (FFA) in MC57 cells. Upon necropsy, half of the spleen was collected in cryotubes and stored at -80°C until required. For serum determination, blood was allowed to be clotted in the Microvette® tube for 1 hour, and serum was recovered by centrifugation at 4,000g for 10 min; samples were subsequently stored at -80°C. To determine the FFU, frozen spleens and serum samples were homogenised, resuspended in DMEM (Invitrogen), and subjected to serial dilutions. Subsequently, 100 μL of each dilution was plated in a 24-well plate (Sigma-Aldrich) containing 2×106 cells / well and incubated for 6 hours at 37°C. Following the formation of a cell monolayer, a 1:1 mixture of 3% Methocel (Sigma-Aldrich) and 2X DMEM 12,5% FBS (Invitrogen) was added to each well and incubated for 48 hours at 37°C. For LCMV antigen stainingto determine FFUs, the cells were fixed with 37% formaldehyde (Sigma-Aldrich), washedtwice with PBS (Gibco), and incubated for 20min with a 1% TritonX solution (Sigma- Aldrich) for permeabilisation. To minimise nonspecific binding, the cells were incubated for 1 hour at room temperature with PBS containing 10% FBS. Subsequently, the cells were incubated for 1 hour with a rat anti-LCMV mouse antibody (clone VL4, Abyntek) and an additional hour with an anti-rat polyclonal IgG HRP secondary antibody (Jackson ImmunoResearch). The plaques were visualised using the Metal Enhanced DAB Substrate KIT (ThermoScientific). After drying, the spots were counted using an automated ELISpot reader unit (Cellular Technology Limited, Shaker Heights, OH). FFUresults from the spleen were normalised by the spleen weight or the serum volumebefore homogenisation. Splenocyte isolation The protocol for isolating splenocytes from mice spleen involves enzymatic disruption of the extracellular matrix to obtain a single-cell suspension suitable for immunophenotypeand ex vivo T-cell stimulation. Briefly, half of the spleen was collected in complete RPMImedia on ice to maintain cell viability and integrity. The spleens were then aseptically transferred onto a 6-well plate and washed with cold PBS to remove any external debris. Subsequently, 0.5mL of an enzymatic mix containing 20μL / mL DNase (Benzonase,Merck) and 64μL / mL Liberase™ TL (Collagenase I / II and Thermolysin, Sigma-Aldrich)was gently injected into the tissue using a pipette tip, ensuring complete perfusion of the spleen with the enzymatic solution. Following this, the organs were carefully disrupted into small pieces and incubated for 20-30 min at 37°C and 5% CO2 to facilitate tissue digestion and release of cells from the extracellular matrix. After the enzymatic digestion, the disrupted spleen was resuspended in 1mL of RPMI supplemented with 5% FBS and passed through a 70 μm cell strainer to obtain a single-cell suspension of splenocytes.The splenocyte suspension was washed by centrifugation at 400g for 6 min at 4°C.Subsequently, the cell pellet was treated with ACK Lysis buffer (Lonza) for 5 min following the manufacturer's instructions to remove red blood cells. Then, cells werewashed by centrifugation at 400g for 6 min at 4°C to discard any remaining tissue debrisand resuspended in 10 mL of R10 medium. Cell counting was performed using a NucleoCounter NC-3000 (ChemoMetec), and the cell suspension was diluted to a final concentration of 107live cells / mL. Characterisation of LCMV-specific CD8 T-cells responses in splenocytes Splenocytes were allowed to rest at 37°C with 5% CO2for 1 hour. After resting, cell density and viability were determined, and media was replaced by centrifugation with fresh R10 medium supplemented with 5 μg / mL anti-CD28 (clone 37.51, ThermoFisher) and 20 μL / mL anti-CD107a BV421 (clone 1D4B, Biolegend). Subsequently, cells were cultured in the absence or presence of the immunodominant gp33 CD8 T-cell peptide at1 μg / mL (GP133–41, Genscript) at a density of 5x106 cells / mL in a 48-well plate. Forgeneral TCR stimulation, splenocytes were stimulated with αCD3 (Clone 17A2, FG,ThermoFisher) pre- coated well at 1 μg / mL for TCR stimulation. Then, cells wereincubated at 37ºC with 5% CO2overnight. The next day, protein transport inhibitors, Brefeldin A (BD Biosciences) and Monensin (BD Biosciences) solutions, were added to the cell culture and incubated for 3 hours at 37ºC with 5% CO2 before harvest for immunophenotype by flow cytometry. Immunophenotype by flow cytometry For the immunophenotype of lymphoid and myeloid cells, 2x106splenocytes were rested in R10 for 1 hour at 37ºC and 5% CO2. Then, splenocytes were harvested after overnight incubation in the absence or presence of gp33 peptide before staining. Briefly,splenocytes were labelled with a Live / Dead probe (LIVE / DEAD™ Near-IR Dead CellStain, Invitrogen) and washed twice with Flow Buffer (PBS, 5% FBS). Following the manufacturer's indications, the Fc-receptors were blocked with CD16 / CD32 (Mouse BD Fc Block™). Splenocytes were then stained for T-cell immunophenotype with the surface markers CD3 (BV570 clone 17A2, Biolegend), CD4 (A647 clone GK1.5, Biolegend), CD8b (A700 clone 53-6.7, Biolegend), Nk1.1 (BV605 clone PK136, Biolegend), CD19 (PE / Dazzle clone 6D5, Biolegend), CD27 (BV785 clone LG.3A10, Biolegend), CD11b(BV510 clone M1 / 70, Biolegend), PD-1 (PE clone 29F.1A12, Biolegend) and TIGIT(PECy7 clone 1G9, Biolegend). For myeloid immunophenotyping, B220 (APC-Fire750 clone RA3-6B2, Biolegend), Ly6G (APC-Fire750 clone 1A8, Biolegend), SiglecF (APC Cy7 clone S17007L, Biolegend), CD3 (APC-Fire750 clone KT3.1.1, Biolegend), NK1.1 156516 (APC-Fire750 clone S17016D, Biolegend), MHCII (BV421 clone M5 / 114.15.2, Biolegend), CD11b (BV510 clone M1 / 70, Biolegend), CD11c (A700 clone N418, Biolegend), CD86 (A647 clone GL-1, Biolegend), CD40 (PE Dazzle 594 clone 3 / 23, Biolegend), hTIGIT (PE-Cy7, clone MBSA43 ThermoFisher), Ly6c (BV570 clone HK1.4, Biolegend), CD155 (BV605 clone TX56, Biolegend), PD-L1 (BV786 clone 10F.9G2, Biolegend) were employed. Subsequently, cells were washed, fixed and permeabilisedwith a Fix&Perm kit (ThermoFisher) for intracellular cytokine staining with IFNγ (BV711clone XMG1.2, Biolegend), TNF (BB700 clone MP6-XT22, BD), IL6 (FITC clone MP5- 20F3, ThermoFisher), IL10 (BV650 clone JES5-16E3, BD) antibodies. Then, sampleswere fixed in 1% formaldehyde and acquired on BD LSRFortessa ™ (Beckmann Coulter)using the FACS DiVa software (BD, Biosciences). Data were analysed by FlowJo v10.6 (Tree Star Inc). To determine the frequency of the different populations and functional markers, the inventors employed Fluorescence Minus One (FMO) control. The frequency of αCD3 and gp33-specific T-cell responses was determined by subtracting the percentage of cytokine production from the unstimulated control to the αCD3 or gp33 stimulation. The inventors considered a positive gp33-specific T-cell response afterbackground subtraction used as a cut- off value and a minimum of 400 events in the gateof cytokines. Multiplex cytokine assay The LXSAMSM-17 Mouse Luminex® Discovery Bead panel (Bio-Techne) was used toquantify the following analytes: BAFF, IFNγ, TNF, IL-2, IL-4, IL-5, IL-6, IL- 10, IL-13, IL-27, IL-33, TNFRI, MIP-1a, CCL2, CCL4, Granzyme B and RANTES, in serum samplescollected before administration of immune intervention at day 21 post-infection and after3 (day 28) and 5 (day 34) doses, following the manufacturer’s instructions. Plates were then read by Luminex 200, Austin Luminex, USA. Data were analysed using MILLIPLEX Analyst 5.1 software (Merck Millipore Darmstadt, Germany). Values of analytes after 3 and 5 doses were transformed in Fold Change (FCh) using day 21 as a baseline. Kidney pathology Once mice were euthanized, at the two end-points (day 28 and day 34), kidney were harvested, embedded in optimal cutting temperature compound (in Tissue- Tek® O.C.T.™) and stored at -80ºC until fixation. Then, kidneys were unfrozen, washed with PBS, fixed using neutral buffered formalin, included in paraffin and cut in 3 µm slices using a Leica 2255 microtome. Slices were stained with hematoxylin-eosin, observed with an Olympus BX45 microscope, and inflammation scores, ranking from 1 (not damage) to 4 (most inflammation), wereautomatically determined by the PathData System V6.2e1 software. Both kidneys from3 animals per group were analyzed and the higher score for each mice was used forcomparison (Fig.19).Statistics One-way ANOVA analyses were performed with Fisher's LSD test employed for multiple comparisons or among study groups. Two-way ANOVA comparison was performed with Fisher's LSD test for multiple comparisons among study groups at different time points. The analysis was conducted using GraphPad Prism (v10) software. The p-values (p) below 0.05 were considered significant and were indicated by asterisks as follows: *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001; ****p ≤ 0.0001. Non-significant differences were indicated as “ns”. PBMCs Samples. For experiments with PBMCs, cryopreserved samples from PWH on ART with more than 10 years of viral suppression were retrospectively selected. Characteristics of the study group are summarized in Table 2. All subjects provided their written informed consent for research. The project was approved by the institutional review board of Germans Trias i Pujol Hospital (PI-17-039). The study was conducted under the principles expressed in the Declaration of Helsinki. Median C MDe4dicaonu angte(c (e±lIlQs / RµL)) (±IQR) 91541( (84248 –– 5958)9)Median time o VniraAlR loTa(dyears) (±IQR) 16 U.9n(d1e4te.6ct–ab2l0eMedian time on ART (years) (±IQR) 13.0 (7.9 – 14.3.3))Table 2. Clinical and epidemiological characteristics of the study groupFunctional experiment. The inventors selected cryopreserved PBMCs from the studygroup. PBMCs were thawed and resuspended in R20 media (RPMI media containing 20% FCS, 100U / mL Penicillin and 0.1mg / mL Streptomycin) and rested at 37°C with 5% CO2 between 2 to 4 hours. After that, cell density and viability were determined, and the media was replaced with R10 medium supplemented in the presence of 1 µg / mL anti-CD28 (Clone L293, BD) and anti-CD107a PE-Cy5 (Clone H4A3, BD). Subsequently, 106cells / mL cells were cultured in a 48-well plate in the following conditions: 1) unstimulated, 3) HIV-1-Gag 15-mer pool peptide (2μg pool peptide / m) and 3) SEB (1μg / ml, Sigma- Aldrich). Unstimulated and HIV-1 stimulated conditions were tested in the absence or presence of sIR1, sIR2, and FC-control (all at 10 µg / mL). Then, cells were incubated at 37ºC with 5% CO2 for 2 h, and protein transport inhibitors, Brefeldin A (GolgiPlug, BD) and Monensin (GolgiSTOP, BD) solutions were added to the cell culture for overnight incubation. Immunophenotyping. After overnight incubation, PBMCs were harvested, washed twicewith 1x PBS, and labelled with a Live / Dead probe (LIVE / DEAD™ Near-IR Dead CellStain, Invitrogen) for 25 min. Then, cells were washed twice with Flow Buffer (PBS, 5% FBS), and the Fc-receptors were blocked with human TruStain FcX (Biolegend) following the manufacturer´s instructions. Subsequently, cells were washed with Flow Buffer andwere stained with a cocktail of surface antibodies for CD3 (APC- H7, clone SK7, BD),CD4 (AF647, clone RPA-T4, DB), CD8 (V500, clone RPA- T8 BD), CD16 (FITC, clone3G8, Biolegend), CD56 (BV421, Clone B159 BD), CD45RA (BV786, clone HI100 BD),CCR7(PE-CF594, clone 150503, BD), CD27 (BV605, clone L128, BD), TIGIT (PE-Cy7,clone MBSA43, ThermoFisher) and PVR / CD155 (BB700, clone SKII.4, BD) in Brilliant Stain Buffer (563794, BD) at RT for 20 min. Subsequently, cells were washed, fixed and permeabilized with a Fix&Perm kit (ThermoFisher) for intracellular cytokine staining TNF (AF700, clone MAb11, Biolegend), IL-10 (PE, clone JES3-9D7, Biolegend) IL-2 (BV650, clone MQ1-17H12 BD) and IFNγ (BV711, clone B27, BD). Stained samples were fixedin 1% formaldehyde and acquired on BD LSRFortessa™ Cell Analyzer (BeckmannCoulter) using the FACS DiVa software (BD, Biosciences). Data were analysed using FlowJo v10.6 (Tree Star Inc). To determine the frequency of the different populationsand functional markers, the inventors employed Fluorescence Minus One (FMO) control.Safety, toxicity and pharmacokinetics Mice, strain, ethics. For the study design, in vivo experiments were performed usingC57BL / 6J- OlaHsd (C57BL / 6, 6-7 weeks of age) maintained under controlled conditionsduring the experiment at the Center of Comparative Medicine and Bioimaging (CMCiB- IGTP, Spain). The experimental design includes 4 animal study groups with an equal distribution of males and females, ensuring a 50% sex representation to address potential sex-based differences. The C57BL / 6 mice were purchased from Envigo Laboratories (Barcelona, Spain). All the experimental procedures were approved by theethical committee for animal experimentation (CEEA- CMCiB, 22-001-MML) and by thelocal authorities of the Generalitat de Catalunya (Project 11676) and conducted according to the Guide for the Care and Use of Laboratory Animals provided by the Generalitat de Catalunya, the Principles of Laboratory Animal Care outlined by the National Institute of Health (NIH Bethesda, MA, USA) and the Declaration of Helsinki for animal experimental investigation. sIRs administration, sampling and euthanasia. For the safety, toxicity and PK study, saline solution (PBS) or sIR1, sIR4 and sIR9 prototypes (10 mg / kg in 200μl of PBS) were injected intraperitoneally (IP) using a syringe with a 25G needle (Novico Medica, Spain). Blood sampling was obtained at 0 h, 1 h, 6, 24 hours, 48 h, 72 h, 5 d, 7 d, 14 d and 21 dby punction with a 4-5mm lancet (Novico Medica, Spain) at the facial vein to collectapproximately 20-30 μl of blood in a clotting activator 1,5 mL Microvette® tube(SARSTEDT). In addition, the inventors recorded longitudinal weight measurement, handling and appearance score at the same time points. Upon euthanasia, at days 7 (n=2, for sIR4 and sIR9) and 21 (n=2, for Saline; n=4, for sIR1, sIR4 and sIR9), a necropsy was performed to harvest whole blood, the spleen, kidneys, and Mesenteric lymph node (MLN) that were OCT-embedded for pathology studies.Determination of sIR concentration in blood. Serum was recovered from clotted blood inthe Microvette® tube by centrifugation at 4,000g for 10 min. Serum samples were stored at -80°C until quantification by functional ELISA. Before sIR quantification, a secondcentrifugation at 10,000 g for 5 min was performed to maximise the removal of cell debris.Functional ELISA was performed to determine the concentration of sIR prototypes as previously described for binding. For each time point, the concentration of sIR prototypes was quantified to determine the half-life (t1 / 2) and the area under the drug concentration- time curve (AUC) in serum samples.Histopathological examination. Histopathological examination of the spleen, kidneys andMLN from OCT- embedded tissue was performed by H&E staining in the PathologicalAnatomy Department (HGTP, Badalona, Spain). The OCT-embedded tissue blocks were sliced into 5 μm slices with a microtome-cryostat (LEICA CM3050S) and mounted onto adhesion slides (SuperFrost® Plus, Epredia). After thawing, tissues were stained using the automated slide Stainer&Film coverslipper (SAKURA Tissue, Tek FilmMicroscopy analysis and visualization were performed using a light microscope Nikon Eclipse TS2R equipped with NIS-Elements software (Nikon, Japan). After image acquisition, d tissue integrity and vascularization, organ morphology and tissue morphologic indicators of necrosis, interstitial inflammation, and immune cellular infiltration in the cryosections was analyzed. ResultsExample 1 - In silico design and modelling of sIR prototypesTo design sIR recombinant proteins targeting CD155, the inventors identified the relevant domains of the human TIGIT inhibitory receptor using the information recapitulated in theUniversal Protein Resource (UniProt) database (TIGIT - Q495A1). In the UniProt server,the more basic classification of the TIGIT membrane protein is described with the extracellular, transmembrane and intracellular regions (Fig.1A). To generate soluble inhibitory receptors (sIRs) capable of interacting with CD155, the inventors preserved the extracellular domains of the TIGIT inhibitory receptor, which include the native signal peptide (SP Nat), the Ig-like V-type domain and the 17 aminoacids tail located prior to the transmembrane domain (Fig. 1B). In the Ig-like V-typedomain of TIGIT, the inventors can identify two critical functional sequences: 1) the homodimerization domain, which facilitates the interaction of two TIGIT subunits in cis and 2) the three aminoacidic sequences (VTQ, AX6G, and TYP) that allow the heterotetrameric interaction with CD155 in trans (Fig.1A). Next, to obtain the first solubleprototype, sIR1 Nat, the sequences of a BamHI spacer (GS), a His- tag sequence(HHHHHH) (SEQ ID NO: 44) and the stop codon (STOP) were added to the construct(Fig. 1B). In addition to the sIR1 Nat prototype, the inventors designed two additional prototypes to enhance soluble protein production. These prototypes incorporated different signal peptides (SP) to improve protein secretion. Specifically, the inventors utilised the signal peptide from the T cell surface glycoprotein CD5 (SP CD5) and the signal peptide from the azurocidin preprotein (SP Azu), resulting in sIR1 CD5 and sIR1 Azu, respectively. In both sIR1 CD5 and sIR1 Azu, the inventors shortened the 17-amino acid tail by removing the hydrophobic residues that could potentially hinder secretion and promote membrane retention (Fig.1C). Then, the different monomeric sIR prototypes were modelled using the iterative I- TASSER tool to study the folding and confirm the preservation of human TIGIT secondary and tertiary structures (Fig. 1D). The inventors confirmed that the homodimerization domains of sIR proteins were conformationally accessible to allow homodimerization and that the VTQ, AX6G, and TYP sequences were exposed to allow interaction with CD155. In addition, the heterotetrameric blockade between two sIR1 molecules and two surface molecules of CD155 was modelled to suggest the mode ofaction of CD155 blockade by the sIR1 homodimer. To identify the most efficientmonomeric sIR1 prototype for transient protein production using the Expi293F system, the inventors transfected plasmids encoding sIR1 Nat, sIR1 CD5, and sIR1 Azu. Seven days after transfection, the inventors observed that sIR1 Nat did not result in the production or secretion of soluble protein into the cell culture supernatant. However, the inventors obtained high protein yields of sIR1 CD5 and sIR1 Azu after transfection (Fig. 1D). These results suggest a suboptimal soluble production using the native signal peptide in the Expi293F system or a significant impairment in the secretion of sIR1 prototypes due to the 17-amino acid tail. Moreover, a time course analysis revealed that sIR1 Azu transfection produced more protein at 4-5 days post-transfection than sIR1 CD5 (Fig.1E). Based on these results, the inventors decided to maintain the design of sIR1 containing the SP Azu to produce the monomeric sIR1 prototype and as a scaffold for the subsequent sIR prototypes (Table 3). Table 3. Summary sIR prototypes design Human Ig-like V-sIR1t hy up me a d nomain -- --sIR2 human hIgG1 Effector sIR10 human hIgG4 No Effector S228P Hybrid sIR3 human mIgG2c Effector sIR4 human mIgG2c Effector ΔPCPP sIR9 human mIgG1 No Effector M sIRur 5ine murine -- --sIR6 murine mIgG2c Effector sIR7 murine mIgG2c Effector ΔPCPP sIR8 murine mIgG1 No Effector Next, the inventors aimed to increase sIR1 binding affinity for the CD155 ligand by developing stable sIR dimers that facilitate the homodimerization and heterotetrameric interaction between the sIR prototype and the CD155 ligand. To accomplish this, the inventors introduced Fc-immunoglobulin regions at the C-terminal of the sIR1 prototype. Specifically, the inventors used sequences from the effector human IgG1 Fc region to generate sIR2 and the non-effector human IgG4 Fc region with the S228P mutation to generate sIR10 (Fig. 2A). Additionally, the inventors developed three equivalent sIR constructs to target the mouse CD155 receptor by using the murine TIGIT Ig-like V-type domain, resulting in the monomeric murine sIR5, dimeric sIR6 (murine effector IgG2c), and dimeric sIR8 (murine non-effector IgG1) prototypes (Fig.2B). However, the in-silicocomparison of sIR2 and sIR6 revealed a potential impairment in protein folding of themurine Ig-like V-type domain due to the presence of a PCPP sequence in the murine IgG2c hinge region. To compensate for the potential incorrect folding, the inventors designed the sIR7 prototype with a deletion of the PCPP amino acids (ΔPCPP). Moreover, based on studies that support the binding of the human Ig-like V-type TIGIT domain to both human and murine CD155, the inventors designed hybrid sIR prototypes incorporating the human Ig-like V-type domain and murine Fc IgG regions, resulting in sIR3, sIR4 and sIR9 (Fig.2C). Finally, the inventors designed a human Fc-Control (Fc- Ctrl) protein, deleting the Ig-like V-type domain as a control molecule (Fig.2D.Example 2 - Production, purification and quality control of sIR proteins Next, the inventors transfected the encoding plasmids into the Expi293F cell culture system and obtained recombinant soluble proteins. Following supernatant harvest and protein purification by metal affinity chromatography, the inventors assessed the purity and molecular weight (MW) of all the sIR prototypes using SDS-PAGE and Western blot (WB) analysis. The inventors confirmed purity <95% and expected theoretical MW by SDS-PAGE and confirmed the presence of the His-tag in the C-terminal region by WB for all prototypes (Fig.5 A-B). In addition, the inventors employed SEC-MALS to evaluate the protein oligomerization state of sIR prototypes. Despite the potential of sIR1 and sIR5 to form homodimers in solution, due to the presence of the homodimerization domains, the inventors only detect monomeric forms by SEC-MALS. Moreover, SEC-MALS confirmed the stable dimeric state of the dimeric sIR prototypes and suggested potential glycosylation during proteinproduction due to the difference between theoretical MW and SEC- MALS MWdetermination (Table 4).Table 4. Theoretical and empirical molecular weight of sIRsTheoretical Theoretical Prototype MonomerDimer SEC-Structure MWMW (KDa)M MA WLS Human sIR1(K 12D .a 8) -- (K 17D .a 9) MonomersIR2 40.4 80.8 94.7 DimersIR10 40.6 81.2 95.2 DimerHybrid sIR3 40.6 81.2 94.5 DimersIR4 40.2 80.5 91.4 DimersIR9 40.5 81.0 107.8 DimerMurine sIR5 12.7 -- 17.6 MonomersIR6 40.5 81.0 92.7 DimersIR7 40.0 80.0 91.3 DimersIR8 39.1 78.2 97.2 DimerExample 3 - Dimeric sIRs bind with high affinity to hCD155 and mCD155 ligandsAfter confirming the purity and conformational state of the sIRs, the inventors assessed binding and affinity for the CD155 ligand, including both human and murine CD155 variants using BIACORE Surface Plasmon Resonance (SPR) analysis, functional ELISA and a cell-based assay. First, the inventors observed a low affinity of sIR1 and sIR5 for mCD155 by BIACORE assay. The low affinity of the monomeric sIRs was attributed to the rapid association and dissociation rate from mCD155, which hindered the experimental determination of the KDaffinity value (Fig. 6A-C and Table 5). However, the stable dimeric prototypes exhibited significantly slower dissociation rates from mCD155, resulting in a KDvalue in the nM range (Fig.6A-C and Table 5). When comparing the KDof dimeric prototypes, the inventors observed similar KDranges for mCD155, with median KDvalues of 45.4 nM, 46.5 nM, and 76.1 nM for the human, hybrid, and murine prototypes, respectively,indicating a good cross- species recognition between the human and murine Ig-like V-type domains for murine CD155 (Table 5).Table 5. Affinity constant for sIRs to hCD155 and mCD155mCD155 hCD155 KD(nM) KD(nM) Human ssIIR6 77.1 UNDsIRR78 5955..83 UUNNDDKD: Affinity constant; UND: Undetermined; * Determined by direct amine coupling of hCD155 On the other hand, the BIACORE assay conducted to determine the affinity of sIR for hCD155 indicated a similar rapid dissociation rate of the monomeric sIR1 and sIR5 from hCD155. For dimeric sIRs, the inventors detected a high binding affinity of human and hybrid sIRs for hCD155, with a KD of 8.64 nM for sIR2 and a median KD of 1.7 nM for the hybrid sIRs (Table 5). However, the inventors observed weak affinity of dimeric murine sIR6, sIR7, and sIR8 prototypes for hCD155, consistent with previous studies, indicating scarce recognition of hCD155 by the murine Ig-like V-type domain. Moreover, a comparison of BIACORE results for mCD155 and hCD155 ligands revealed consistently higher KD values in human and hybrid sIRs for mCD155 (ranging from 55.4nM to 42.2nM) compared to hCD155 (ranging from 8.64nM to 0.63nM). Furthermore, when investigating the impact of the ΔPCPP mutation in the murine IgG2c hinge region, the inventors obtained inconclusive results. In the BIACORE assay with mCD155, the deletion increased the KDin the hybrid sIR3 from 33.9 to 50.2 nM in the modified sIR4, while it decreased the KDin the murine sIR6 from 77.1 to 55.8 nM in the modified sIR7. However, in the BIACORE assay with hCD155, the ΔPCPP deletion decreased the KDin the hybrid sIR3 from 1.65 to 0.63 nM in the modified sIR4 (Table 5). These results indicate a limited impact of the isotype Fc fraction employed on the KDvalues.Additionally, the inventors investigated the binding affinity of the sIR prototypes to humanand murine CD155 by functional ELISA. In the functional ELISA for hCD155 across prototypes, the inventors did not obtain a binding curve for monomeric sIR1 due to the low signal within the same concentration range (Fig.7A). In the case of dimeric human and hybrid sIRs, the inventors observed similar binding curves for hCD155 with a median IC50of 24.8 ng / mL (Table 6). Similar findings were obtained in the functional ELISA for mCD155 across prototypes with dimeric prototypes binding with higher affinity than sIR1 (Fig. 7B). Overall, the IC50 values obtained from functional ELISA were higher for mCD155 (median 220 ng / mL) compared to hCD155 (median 24.8 ng / mL) (Table 6). These findings are consistent with the results obtained from the SPR study, which demonstrated higher KD values for the human and hybrid sIRs when binding to mCD155 compared to hCD155. These higher KD and IC50 values indicate a weaker binding affinity of the human and hybrid sIRs for mCD155.Table 6. IC50 for sIRs binding to mCD155 and hCD155 determined by functional ELISA.mCD 51 055 hCD m n nC IC51 a055 Hu (Ig / mL) (ng / mL) sIR1 UND UNDsIR2 204.5 33.65sIR10 66.13 11.96Hybrid sIR4 235.5 16.04sIR9 304.1 57.25UND; undeterminedFinally, the inventors assessed the binding of human sIR to hCD155 using a cell-based assay in Bw5147 cell lines (Bw hCD155 and Bw Ctrol). As shown in Fig.7C, the inventors confirmed the specific binding of sIR2 and sIR10 to Bw hCD155 compared to Bw Ctrol cells. In addition, the IC50values obtained in the cell-based assay for sIR2 and sIR10 (19.15ng / mL and 26.87 ng / mL, respectively) were consistent with the values obtained in the functional ELISA further confirming the binding of the human dimeric sIRs to hCD155 within the range of 10-30 ng / mL. After confirming the ability sIRs to bind CD155 on both immobilized physical surfaces and cellular membranes, the inventors next evaluated the capability of sIR1 and sIR2 to functionally block the TIGIT-CD155 inhibitory axis. The inventors employed a co-culture assay using the previously described Bw-hCD155 cells and Jurkat T-cells, engineered to overexpress human TIGIT and to express eGFP and CFP as fluorescent reporters of of NFAT and NFκB transcription factors (NFAT::GFP; NFκB::CFP), two critical regulators of T cell effector function. This system mimics CD155-TIGIT mediated immunosuppression and enables quantification of T-cell activation via flow cytometry based on reporter fluorescence. Jurkat T cells were incubated with Bw-hCD155 cells, in the presence of PBS (negative control), sIR1, sIR2, α-TIGIT or its correspondent isotype control (each at 25 µg / mL). Among the tested constructs, sIR2 significantly enhanced T cell activation, as evidenced by increased percentage of NF-κB+, NFAT+and double positive NF-κB+-NFAT+populations, compared with the control (PBS) Fig. 7D). In comparison, α-TIGITincreased the frequency of double positive NF-κB+-NFAT+cells, without significanteffects on single NF-κB+, NFAT+ cells, relative to its isotype control. (Fig.7D).Taking the results from this section, the inventors confirmed: 1) the limited binding ofmonomeric sIR1 and sIR5 prototypes to CD155 ligands; 2) the suitable cross- speciesrecognition with similar KD values of human, hybrid and murine sIRs to mCD155, but limited recognition of murine sIRs to hCD155; 3) the consistent higher affinity of human and hybrid sIR prototypes for hCD155 in comparison to mCD155, and 4) the limitedimpact of the different Fc regions included in the design of dimeric sIR prototypes in theKD or IC50 values. Moreover, these results demonstrate that Fc-containing sIR constructs, particularly sIR2, can bind functionally relevant CD155 on cell surfaces and reverse CD155-TIGIT mediated immune suppression, thereby promoting T cell activation. Under the tested conditions, sIR2 induced a stronger activation profile than α-TIGIT, supporting the potential of sIRs as immunomodulatory interventions.Example 4 - LCMV infection at high doses induces chronic infection and viralpersistence.First, the inventors conducted an in vivo study in the LCMV mice model to evaluate theexpression of IRs (TIGIT and PD-1) and functional changes in T-cell immune responses during the chronic infection stage. Briefly, C57BL / 6 mice received a high dose (106FFU) of LCMVDOCstrain to induce chronic infection (LCMV, n=12) and compared with uninfected control mice (Mock, n=12). The inventors performed necropsies (n=4, per group) on days 14, 21, and 28 to collect total blood and harvest spleen for FFU assayand immunophenotyping of CD8+ and CD4⁺ T cells and NK cells (Fig. 3A). During thefollow-up, the inventors assessed weight variation to indirectly characterise acute and chronic phases of LCMV infection. The inventors observed a significant weight loss in the LCMV-infected mice 7 days post- infection, which gradually recovered from day 9 onwards (Fig. 3B). Cross-sectional analysis showed significant weight loss differences by day 8 between Mock and LCMV- infected mice (Fig. 3C). After the acute infection phase, the inventors observed a progressive weight increase from 8 to 15 days. Despite this progressive weight increase, significant differences in weight between chronically LCMV-infected mice and Mock mice persisted until day 28 (Fig.3C), indicating chronically LCMV-infected mice cannot fully recover weight within three weeks from the onset of infection. Furthermore, the inventors evaluated weight variation stratified by sex with similar findings (Fig.3D). Females tend to gain less weight than males in Mock and LCMV-infected groups. Interestingly, on day 28, no differences were found in female Mock and LCMV-infected groups. The reduced number of mice after stratification by sex can be a limitation in assessing weight variation over the study period. Next, the inventors analysed FFUs in the spleen and serum samples collected afternecropsies (Fig. 8). This analysis revealed viral persistence in both spleen and serum atall three evaluated endpoints. However, the FFU / g values in the spleen were higher compared to the FFU / mL in serum samples, as expected (Fig.8A). The viral persistence in the spleen ranged from 104to 105FFU / g on day 14 and 21 post-infection and decreased to 103-104FFU / g on day 28 post-infection. On the other hand, the viral loadin serum started at 104 FFU / mL on day 14 and decreased to 102 - 103 FFU / mL on day28 post-infection. Due to the assay detection limits, the inventors could not quantify FFUs in two spleen and three serum samples. The inventors did not find differences by sex regarding FFU levels, and undetectable samples were distributed across male and female mice (Fig.8B). These results suggest that sex is not a variable relevant to viral persistence levels in this model. These findings indicate that LCMV infection persists for at least 28 days after the acute infection phase, as evidenced by detecting LCMV FFU in both serum and spleen. The significant decrease in weight observed at 7 days post-infection indicates the severity of the acute phase of infection. Remarkably, the weight in LCMV-infected mice was gradually recovered over the 28 days assessed, although it did not reach the levels of uninfected mice. Notably, the partial weight recovery after the acute phase, accompanied by LCMV persistence in serum and spleen, indicated a chronic infection phase established from day 21-28.Example 5 - LCMV chronic infection induces irreversible PD-1 and TIGIT expression inT-cells and loss of T-cell functionality Then, to comprehensively evaluate the cellular immune responses during chronic LCMV infection, the inventors monitored changes in CD4+, CD8+ T-cells and NK cells in splenocytes over time. The inventors performed immunophenotype in splenocytes 18 hours after spleen processing and stimulation. In unstimulated conditions, the inventors observed changes regarding cell dynamics with a significant decrease in CD8+T cellsand an increase in CD4⁺ T cells comparing infected and uninfected mice (Fig. 9 A-B).Intriguingly, this alteration persisted for at least 28 days post-infection. In contrast, no significant changes were observed in the NK cell population frequencies on days 21 and 28, maintaining a frequency of around 1% in splenocytes. Next, to assess CD8 T-cell exhaustion during chronic LCMV infection, the inventors examined the expression of PD-1 and TIGIT in T-cells after stimulation under two conditions: 1) αCD3 (TCR stimuli) and 2) gp33 peptide (LCMV antigen) and compared to unstimulated Mock and LCMV-infected splenocytes. The results indicate that LCMVinfection upregulated the expression of PD-1 in CD8⁺ T-cells compared to Mock, with thehighest expression on day 14 and significantly decreasing on 21- and 28-days post-infection (Fig. 10A). Notably, PD-1 upregulation in unstimulated CD8⁺ T-cells frominfected mice persisted at a median of 26% compared to Mock at 28 days (Fig. 10A).Similar results were found in αCD3 stimulation. Remarkably, roughly 91% of CD8⁺ T-cells in LCMV- infected mice expressed PD-1 during αCD3 stimulation on day 14,decreasing to 65% on days 21 and 28, corroborating the irreversible induction andmaintenance of PD-1 expression in CD8⁺ T-cells during chronic infection (Fig.10A).On the other hand, LCMV infection induced TIGIT expression in CD8⁺ T-cells, with apeak expression of 9.5% TIGIT+CD8⁺ T-cells on day 14 and an irreversible increase forup to 28 days compared to uninfected Mock mice (Fig. 10B). Upon αCD3 stimulation, TIGIT+CD8+T-cells were significantly increased by up to 40% on days 21 and 28 in LCMV-infected mice. Interestingly, TIGIT+CD8+T-cells were barely detectable upon stimulation in Mock mice (Fig.10B).Notably, most TIGIT+CD8⁺ T-cells co-expressed PD-1 in unstimulated and stimulatedexperimental conditions. Moreover, when stimulated with gp33 peptides, there was anincreased frequency of double-positive PD-1+TIGIT+ CD8⁺ T-cells compared tounstimulated conditions (median 6.2% and 2.4%, respectively), indicating that the expression of TIGIT is motivated by antigenic stimulation in this context (Fig. 10C).Remarkably, the absence of double-positive PD-1+TIGIT+ CD8⁺ T-cells in Mock mice,independent of any stimulation, indicates the relevant role of PD-1 and TIGIT co- expression in LCMV chronic viral infection.Then, the inventors evaluated changes in the expression of PD-1 and TIGIT in CD4⁺ T-cells. LCMV infection significantly increased PD-1 expression in unstimulated CD4⁺ T-cells compared to Mock at 14, 21, and 28 days. Interestingly, in the absence ofstimulation, the levels of PD-1 expression were higher in CD4⁺ T-cells than in CD8⁺ T-cells (Fig.10A-11A). Moreover, during LCMV infection, the inventors noted a decreasein PD-1+CD4⁺ T-cells between days 14 and 21, followed by an increase in PD-1+CD4⁺T-cells between 21 and 28 (Fig. 11A). Similar results were obtained during αCD3stimulation of CD4⁺ T-cells from LCMV-infected mice compared with Mock mice, with ahigh frequency of PD-1+CD4⁺ T-cells remaining elevated at 86% (Fig.11A). On the otherhand, the expression of TIGIT was induced by chronic LCMV infection in unstimulatedCD4⁺ T-cells, as compared to Mock mice (Fig. 11B). Similar to CD8⁺ T-cells, TIGITexpression remained elevated in unstimulated CD4⁺ T-cells even 28 days post- infection(Fig. 11B). Notably, upon αCD3 stimulation, the frequency of TIGIT+CD4⁺ T-cellsincreased up to 27% on days 21 and 28, whereas in Mock mice, it remained at 10% (Fig.11B). Similarly, to CD8⁺ T-cells, the vast majority of TIGIT+CD4⁺ T-cells co-expressedPD-1. However, contrary to CD8⁺ T-cells, the stimulation with gp33 peptides did not alterthe frequency of double-positive PD-1+TIGIT+ CD4⁺ T-cells compared to unstimulatedconditions (Fig. 11C). Interestingly, after αCD3 stimulation, PD-1+TIGIT+ CD4⁺ T-cellswere also present in uninfected mice, indicating that TIGIT expression may be involvedin other biological aspects unrelated to LCMV chronic infection in CD4⁺ T-cells.In summary, CD4⁺ T-cells exhibited elevated PD-1 and TIGIT co-expression frequencyin unstimulated and αCD3 conditions compared to CD8⁺ T-cells. Conversely, the co-expression of TIGIT and PD-1 was specifically displayed in CD8⁺ T-cells upon αCD3 andgp33 stimulation. These results indicate an irreversible expression of PD-1 and TIGIT in T-cells motivated by chronic LCMV infection with certain differences in the expressionprofiles between CD8⁺ and CD4⁺ T-cells.Then, the inventors evaluated CD8⁺ T cell function in the presence of αCD3 and gp33based on the CD107a, IFNγ and TNF markers. Remarkably, after αCD3 stimulation, theinventors observed a decline in the production of IFNγ and TNF in CD8⁺ T- cells fromday 14. In addition, the inventors noticed a decrease in the degranulation marker in CD8⁺ T-cells between days 14 and 21, followed by a recovery between days 21 and 28 (Fig. 12A). Then, the inventors evaluated the LCMV-specific CD8+ T-cell responses directed to the immunodominant gp33 peptide; the inventors observed a decrease in the expression of the CD107a degranulation marker and the production of TNF from day 14 to 21 in gp33- specific CD8+ T cells, which persist until day 28. The decrease in CD107a degranulation marker and TNF production indicates a potential impairment in the cytotoxic activity ofgp33-specific CD8+ T cell responses in chronic infection. However, no changes in theproduction of IFNγ were detected (Fig.12B). These findings align with previous reportsindicating early exhaustion of IFNγ+ gp33- specific CD8⁺ T-cell responses compared toTNF and CD107a. As previously reported, the gp33-specific IFNγ+CD8⁺ T-cells peak at7-8 days after LCMVDOC infection, accounting for up to 10% of total CD8+ T-cells.However, IFNγ+ gp33- specific CD8⁺ T-cell responses decrease to 3% from day 10 dueto T-cell exhaustion in this animal model. Thus, the observed low levels of IFNγ+ gp33-specific CD8⁺ T-cell responses from 14 (~4%) represent cells already impaired due toearly T-cell exhaustion. Overall, these results provide further evidence of T-cell exhaustion in the LCMV mice model, as shown by the irreversible coexpression of PD-1 and TIGIT, viral persistence in tissue, and decreased T-cell function. These findings indicate that the model of chronic LCMV infection can recapitulate the immune features of chronic infection and immune exhaustion, being well-suited for evaluating the effectiveness of sIRs prototypes targeting CD155. Additionally, there is potential to explore the combined use of sIR prototypes with αPD-L1, which has been previously shown to recover exhausted T-cell responses in this model, supporting the combinatorial targeting of CD155 and PD-L1 for immunotherapeutics to restore immunity in chronic viral infections.Example 6 - sIR4 reduces αPD-L1 immune-related toxicity and decreases viralpersistence in combinatorial treatment After characterising the LCMV chronic infection model, the inventors conducted a proof-of- concept safety and efficacy study to evaluate the immunotherapeutic effect of sIRprototypes in blocking the TIGIT / CD155 axis alone or in combination with αPD- L1. Thestudy design involved infected mice receiving a high dose of LCMVDOC strain to induce chronic LCMV infection (LCMV, n=80) and uninfected control mice (Mock, n=10), described in the previous section. On day 21, LCMV-infected mice were separated into the following study arms: single treatment (sIR4, sIR9, αTIGIT and αPD-L1) or combined treatments (sIR4+αPD-L1, sIR9+αPD-L1, αTIGIT+αPD-L1) every three days for two weeks (n=10 for each group). The Mock and LMCV control groups received saline administration at the same time points (n=10 for each group). The study design is represented in Fig. 4A. Briefly, the inventors monitored weight and collected blood samples during treatment administration. Moreover, the inventors evaluated viral persistence and characterised immune responses in the spleen after necropsies on mice receiving 3 (day 28) or 5 doses (day 34), respectively. During the 34-day follow-up, the inventors monitored weight variation to assess safety and toxicity by determining the effect of the immune intervention on weight loss. The inventors observed that LCMV-infected mice experienced significant weight loss 9 days post-infection compared to Mock but gradually recovered from day 10 onwards,consistent with the inventors’ previous data (Fig. 4B and 3B). Moreover, the inventorsconducted a cross-sectional analysis on days 27 and 33 in mice after 3 and 5 treatment doses, respectively. On day 27, the inventors observed a significant weight loss in LCMV-infected mice compared to Mock. No differences were observed between LCMV- infected mice and those treated with sIR4, sIR9, αTIGIT, sIR4+αPD-L1 andαTIGIT+αPD- L1 at day 27. However, the inventors noticed a significant weight loss inanimal groups that received single αPD-L1 treatment or combinatorial sIR9+αPD-L1 compared to LMCV-infected mice at day 27 (Fig.4C). On day 33, single αPD-L1 and all combinations of αPD-L1, except sIR4+αPD-L1, demonstrated a significant weight loss compared with LCMV-infected mice (Fig.4C). These results suggest that the inclusion of αPD-L1, either as a standalone or in combinatorial therapy, may lead to significant weight loss as a potential measure of immune-related toxicity. Nonetheless, using sIR4 in combination with αPD-L1 improved the tolerability of αPD-L1 treatment. Next, the inventors conducted a viral persistence study to determine FFUs in the spleen collected after necropsies (Fig.4D). Our findings indicate a significant decrease in FFU in the spleen for sIR4+αPD-L1 on day 28 compared to sIR4 or αTIGIT single treatments (Fig.4E). However, the inventors did not observe significant differences in FFU between any other arm. Notable, FFUs were below the limit of detection (LOD range, 328-1336 FFUs / g) in 3 spleens from αTIGIT treated mice. On day 34, the inventors only found a trend for sIR4+αPD-L1 and a significant reduction of FFUs for sIR9+αPD-L1 treatment compared to the LCMV-infected group Fig. 4E. Remarkably, these results indicate a consistent reduction of LCVM persistence in the spleen for sIR4+αPD-L1 treatment, indicating a potential better immune control of chronic LCMV infection with improved tolerability of this combination. In addition, the inventors evaluated toxicity on day 28 by determination of kidney damage scores in a histopathological study of renal tissue sections (Fig.4F), in which the most frequently observed lesion was inflammation of varying severity. Consistent with the weigh data, the α-PD-L1 group showed a damage score of 3, the maximum recorded in this experiment (Fig.4G). All the dual treatments (combining α-PD-L1 with sIR4, sIR9 or α-TIGIT) showed a damage score of 2, indicating decreased α-PD-L1 induced cytotoxicity. Together, these findings highlight a potential protective role for the toxicity of sIR4 when used alongside the α-PD-L1 in chronic viral infection. Next, the inventors evaluated the ability of the immunotherapies to activate the immune system in the context of chronic viral infection. The inventors assessed activation markers expression on DCs and T-cells isolated from splenocytes. Dual immunotherapies sIR4+α-PD-L1 and α-TIGIT + α-PD-L1 led to a significant increase indendritic cell (DC) activation, as indicated by an elevated percentage of CD40⁺ DCs atcomparable levels on day 28 (Fig.1820A). By day 34, α-PD-L1 monotherapy induced asignificant increase on CD40⁺ DCs, reaching similar percentages to those observed withα-TIGIT + α-PD-L1. On the other hand, activation caused by sIR4+α-PD-L1 at this endpoint, although still statistically significant compared with LCMV control, decreased from 4% to 2.5%. Additionally, treatments containing α-PD-L1, either alone or in combination, resulted inenhanced CD8⁺ T cell activation at both endpoints, without differences between them,supporting its role in promoting cytotoxic T cell responses (Fig.1820B). On day 28, both sIR4 + α-PD-L1 and α-TIGIT + α-PD-L1 induced a pro-inflammatory cytokine signature, characterized by a significant upregulation of TNF and TNFRI (Fig. 18C). This increase correlated with the observed activation state of DCs, suggesting an ongoing inflammatory response. In contrast, only the sIR4 + α-PD-L1 combination uniquely induced an anti- inflammatory / Th2-associated cytokine profile, with elevated levels of Th2-relatedcytokines (Fig. 18D). This may reflect a regulatory mechanism modulating theinflammatory response at this time point. The immune activation profile observed in the sIR4 + α-PD-L1 group was associated with a significant reduction in splenic viral load, as measured by focus-forming assay, at both endpoints. This suggests that the immunological effects of this combination are translated into effective viral control.Example 7 - αPD-L1 treatment induces immune activation of DCs in single andcombinatorial treatment with αTIGIT and sIR4. In addition, the inventors performed immunophenotype of myeloid and lymphoid compartments in splenocytes obtained after enzymatic tissue processing on days 28 and 34, shown in Fig.4A. This allowed us to characterise the expression of TIGIT, PD-1 andtheir ligands, CD155 and PD-L1 and determine the levels of immune activation in themyeloid compartment based on CD40 and CD86. In the myeloid compartment, the inventors did not observe any changes in the frequency of dendritic cells (DCs) among uninfected mice, LCMV-infected mice, or LCMV-infected and treated mice on day 28. However, the inventors observed a reduction in the frequency of DCs on day 34 between Mock and LCMV-infected mice, which was recovered by αTIGIT treatment (Fig.13A). Additionally, the inventors observed a significant decrease in the frequency of PD-L1+ DCs in single or combinatorial treatments containing αPD-L1 compared with LCMV-infected mice on days 28 and 34 (Fig. 14A). Nonetheless, the reduction in PD- L1+expression in DCs is consistent with antibody blockade and competition, as the inventors used the same clone (10F.9G2) for blocking and PD-L1 staining. On the other hand, the inventors did not observe a reduction in CD155+ expression in DCs across groups containing sIRs. Nevertheless, the inventors found an increase in CD155+ DCs following the administration of αPD-L1 on day 28 and in αPD-L1 and αTIGIT+αPD-L1 on days 28 and 34 (Fig.14B). Additionally, the inventors did not observe any hTIGIT+ DCs. These findings suggest that PD-L1 blockade was effectively accomplished in DCs. Additionally, the upregulation of CD155 expression in DCs following αPD-L1 and αTIGIT+αPD-L1 treatment supports the rationale for targeting the PD-L1 and TIGIT / CD155 axis in combination.Example 8 - Increased frequency of CD4+ T-cells and reduction of NK cells in chronicLCMV are not reversed by targeting the PD-L1 and TIGIT / CD155 axis. Then, the inventors analysed the lymphocytic compartment, including CD4+ and CD8+T- cells and NK cells. Consistent with our prior study, the inventors observed an increasein the frequency of CD4⁺ T-cells and a decrease in CD8⁺ T-cells in LCMV-infected micecompared to uninfected mice on days 28 and 34 (Fig. 15A). Remarkably, no immunotherapeutic interventions tested could reverse these alterations. Furthermore, the inventors observed a general decline in the frequency of NK cells with LCMV infection on days 28 and 34. This reduction in NK cells was increased in the presence of αPD-L1 treatment by day 34 (Fig.15A-B).Example 9 - Increased levels of PD-1 and TIGIT expression in CD8⁺ and CD4⁺ T cells inchronic LCMV are not reversed by targeting the PD-L1 and TIGIT / CD155 axis.Then, the inventors characterised the expression of PD1 and TIGIT in CD8⁺ and CD4⁺T-cells across study arms. Our findings indicate that chronic LCMV infection significantlyincreased PD-1 and TIGIT expression in CD8⁺ T-cells on days 28 and 34. In addition,the frequency of TIGIT in CD8⁺ T-cells was significantly reduced in mice treated withαTIGIT monoclonal antibodies, consistently with receptor blockade (Fig. 16A). Interestingly, treatments containing αPD-L1 tended to increase the frequency of PD-1expression in CD8⁺ T-cells, with statistical significance on day 28 for sIR9+αPD-L1 andαTIGIT+αPD-L1 and on day 34 for αPD-L1 and αTIGIT+αPD-L1 (Fig.16A). Additionally,αPD-L1 treatment significantly increased TIGIT expression in CD8⁺ T-cells on day 34compared to LCMV-infected mice (Fig. 16A). Similar results were observed in CD4⁺ T-cells (Fig.16A-B). Overall, TIGIT was exclusively present in T-cells expressing PD-1, consistent with our previous experiment. Furthermore, immune interventions containing αPD-L1 appear tohave a greater impact on the expression of PD-1 and TIGIT in CD8⁺ than CD4⁺ T-cells,as no changes in TIGIT or PD-1 expression were observed in CD4⁺ T-cells. Moreover,the significant reduction in TIGIT+ T-cells in αTIGIT may indicate epitope competition reflecting effective blockade rather than modulation of TIGIT expression. However, different clones were used for the TIGIT blockade (10A7 derivate) and flow cytometry (1G9) experiments.Example 10 - sIR4+αPD-L1 treatment enhanced degranulation in αCD3 stimulated CD8+T cells Then, the inventors characterised the functional CD8+ T cell responses after overnight stimulation of splenocytes in the presence of TCR stimulation (αCD3) and gp33 peptide. The inventors analysed CD8+ T-cell function based on the production of IFNγ, CD107a and TNF after receiving 3 and 5 treatment doses on days 28 and 34, respectively.During αCD3 stimulation, an increase in IFNγ production was observed in CD8⁺ T cellswith chronic LCMV infection compared to Mock, irrespective of the immune interventiongiven. Nonetheless, a rising trend in IFNγ CD8⁺ T-cells was observed in the presence ofαTIGIT and sIR4+αPD-L1 compared to αPD-L1 treated infected mice on day 34 (Fig. 17A). In addition, the inventors detected a significant increase in degranulation in CD8⁺ T-cells in sIR4+αPD-L1 and αTIGIT+αPD-L1 treatment compared with LCMV-infected mice and αPD-L1 treatment on day 34 (Fig. 17A-B). Notably, after background subtraction, the inventors observed a decreased production of TNF in LCMV-infected mice compared to Mock mice on day 28. Additionally, the inventors observed increasedTNF production after αCD3 stimulation in CD8⁺ T-cells from single sIR4, sIR9 and αTIGIT on day 28. However, the production of TNF was generally lower on day 34 (Fig.17A-C). Importantly, the inventors did not detect IL-10 and IL-6 in our experimental setting (data not shown). In summary, the results suggest that the combination of sIR4+αPD-L1 and αTIGITtreatments tend to increase IFNγ production in CD8⁺ T-cells after five doses, ascompared to single αPD-L1 treatment. This effect was not observed in the control group of LMCV-infected mice, indicating that the combined sIR4+αPD-L1 treatment was not inferior to the single αPD-L1 treatment. Additionally, mice receiving five doses ofsIR4+αPD-L1 and αTIGIT+αPD-L1 showed enhanced degranulation of CD8⁺ T-cells,which suggests an increased functionality of CD8 T-cells of combinatorial treatments.Example 13 - sIR2 Restores Immune Activation and Functionality in CD8⁺ T Cells fromPWH on ART To evaluate the immunomodulatory potential of sIRs in a clinically relevant setting, the inventors assessed their effects on peripheral blood mononuclear cells (PBMCs) isolated from people with HIV (PWH) receiving antiretroviral therapy (ART). The inventors investigated the ability of sIRs to reverse T-cell dysfunction and restore immune competence in two conditions: unstimulated and incubated with HIV-1-Gag 15-mer pool peptide. Unstimulated and HIV-1 stimulated conditions were tested in the absence or presence of sIR1, sIR2, and Fc-ctrl for 14-16 h and evaluated changes in the immune phenotype of CD8+ and CD4+ T-cells by flow cytometry (Fig.1921). Then, to assess functional activation mediated by sIRs, the inventors evaluated the expression on these cells of TIGIT, cytokines (IL-2, IL-10, TNF and IFN), and the degranulation marker CD107a (Fig. 22). The threshold for expression of functional markers was determined by fluorescence minus one (FMOs) control (Fig.2022A).Treatment with sIR2 significantly increased the frequency of total CD8⁺ T cells withinPBMCs, decreasing CD4+, indicating a global enhancement of CD8 T cell homeostasisand / or survival. Moreover, sIR2 treatment selectively enriched TIGIT⁺ CD8⁺ T-cells andCD4⁺ T-cells, consistent with its proposed mechanism of action via blockade of theTIGIT–CD155 inhibitory axis.Functionally, in the absence of exogenous stimulation, sIR2-treated CD8⁺ T cellsexhibited enhanced production of key effector cytokines, including interleukin-2 (IL-2), interleukin-10 (IL-10), tumor necrosis factor (TNF) and interferon-γ (IFN). These findingsindicate that sIR2 restores baseline effector function in CD8⁺ T cells from PWH on ART.However, this enhancement in cytokine production was not observed in response to HIV- specific antigen stimulation, suggesting that while sIR2 can reinvigorate general T cellresponsiveness, HIV-specific CD8⁺ T cell responses remain limited, potentially due toepigenetic or transcriptional constraints. Fig. 20B.Importantly, degranulation capacity, a surrogate marker for cytolytic activity, wassignificantly increased in both unstimulated and HIV-stimulated TIGIT⁺ CD8⁺ T cellsfollowing sIR2 treatment, supporting the notion that sIR2 can restore functional cytotoxicpotential. Fig.20B).In contrast, CD4⁺ T cell responses were more modest. sIR2 treatment led to a selectiveincrease in IL-2 and IL-10 production, without significant changes in other cytokines. Fig. 20B). These results suggest that sIR2 exerts cell type-specific effects, with a more pronouncedfunctional restoration observed in the CD8⁺ compartment, characterized by an increaseon production of effector cytokines by these cells, which is critical for viral control.Example 14 - Evaluation in vivo of safety and Pharmacokinetics of sIRsTo assess the in vivo safety and pharmacokinetic (PK) profiles of the sIR constructs, the inventors intraperitoneally injected sIR1 (n=4), sIR4 (n=6), and sIR9 (n=6) and a saline solution as control group (n=2) into C57BL / 6 mice and monitored safety and sIR concentrations in serum over 21 days. A summary of the experimental design is detailed in Fig.21A. No signs of toxicity were observed, including no weight loss or changes in general appearance or handling behavior, across treatment and control groups. Furthermore, no significant differences in body weight trajectories were detected between groups injectedwith sIRs and control animals (Fig. 21B) Histological examination revealed noabnormalities in major organs following sIR administration (Fig. 22A), supporting the safety of the constructs. The inventors analyzed pharmacokinetics by determination of sIR concentration in serum using an indirect ELISA. This study showed a favorable serum persistence of sIR4 and sIR9 (half-life of 32.54 h and 41.85 h respectively), with detectable levels maintained for up to 21 days following a single ip injection. In contrast, sIR1 exhibited poor pharmacokinetics, with serum concentrations falling below the limit of detection of theinventors’ assay within 48 h post-injection (Fig 22B). These findings are consistent within vitro binding data and likely reflect reduced stability and bioavailability due to the lack of an Fc region in sIR1. Based on these data, the inventors decided to move forward with sIR4 and sIR9 for further in vivo efficacy studies. FASTA The nucleotide and amino acid sequence for all sIR prototypes in FASTA format are provided in the following table (Table 7).
[0002] Table 7. Amino acid sequences of sIR prototypes
[0003]
Claims
CLAIMS1. A composition comprising:a) a first component selected from the group consisting of:i) a polypeptide comprising a TIGIT variant that comprises the TIGITIg-like V-type domain and wherein said polypeptide lacks the TIGIT transmembrane and cytoplasmic domains and, ii) a polynucleotide encoding the polypeptide defined in i),and b) a second component, which is an inhibitor of the PD-1 / PD-L1 axisfor use in the treatment of an immune related disease selected from a chronic viral infection and a chronic bacterial infection.
2. The composition for use according to claim 1 wherein the TIGIT variantessentially consists of amino acids 22 to 124 of human TIGIT, wherein the numbering is as defined in the NCBI database entry (Release of 10 March 2024) under accession number NP_776160 or of amino acids 20 to 119 of the mouse TIGIT wherein the numbering is as defined in the NCBI database entry (Release of 24 May 2024) under accession number NP_001139797.
3. The composition for use according to claim 2 wherein the TIGIT variant is apolypeptide as defined in SEQ ID NO: 1 or SEQ ID NO: 39 or SEQ ID NO: 2.
4. The composition according to claim 1 wherein the first component is a fusionprotein comprising the TIGIT variant and a non-TIGIT polypeptide region or a polynucleotide encoding said fusion protein.
5. The composition for use according to claim 4 wherein the TIGIT variantessentially consists of amino acids 41 to 122 of human TIGIT, wherein the numbering is as defined in the NCBI database entry (Release of 10 March 2024) under accession number NP_776160 or of amino acids 38 to 119 of the mouse TIGIT wherein the numbering is as defined in the NCBI database entry (Release of 24 May 2024) under accession number NP_001139797.
6. The composition for use according to claims 4 or 5 wherein the non-TIGITpolypeptide region is a Fc monomer which is formed by the hinge region and the CH2 and CH3 domains of an IgG molecule.
7. The composition for use according to claim 6 wherein the Fc monomer is selectedfrom the group consisting of the human IgG1 Fc monomer, the human IgG1 Fc monomer carrying a S228P mutation, the mouse IgG2c Fc monomer, the mouse IgG2c Fc monomer carrying the ΔPCPP mutation and the mouse IgG1 Fc monomer.
8. The composition for use according to claim 7 wherein the Fc monomer is selectedfrom the group consisting of SEQ ID NO: 3, 4, 5, 6 or 7.
9. The composition for use according to claim 8 wherein the TIGIT variant isselected from the group consisting of: a) A fusion protein comprising the human TIGIT Ig-like V-type domain and ahuman IgG1 Fc monomer, b) A fusion protein comprising the human TIGIT Ig-like V-type domain and ahuman IgG4 Fc monomer carrying a S228P mutation, c) A fusion protein comprising the mouse TIGIT Ig-like V-type domain and amouse IgG2c Fc monomer, d) A fusion protein comprising the mouse TIGIT Ig-like V-type domain and amouse IgG2c Fc monomer carrying a ΔPCPP mutation, e) A fusion protein comprising the mouse TIGIT Ig-like V-type domain and amouse IgG1 Fc monomer, f) A fusion protein comprising the human TIGIT Ig-like V-type domain and amouse IgG2c Fc monomer, g) A fusion protein comprising the human TIGIT Ig-like V-type domain and amouse IgG2c Fc monomer carrying a ΔPCPP mutation and h) A fusion protein comprising the human TIGIT Ig-like V-type domain and amouse IgG1 Fc monomer.
10. The composition for use according to claim 9 wherein the fusion protein isselected from the group consisting of SEQ ID NO: 8 to 15.
11. The composition for use according to any of claims 1 to 4 wherein the firstcomponent is provided as a homodimer of polypeptides comprising the TIGIT variant or according to any of claims 5 to 10 wherein the first component is provided as a homodimer of two fusion proteins.
12. The composition for use according to any of claims 1 to 11 wherein the firstcomponent is a polynucleotide selected from the group consisting of SEQ ID NO: 16 to 25.
13. The composition for use according to any of claims 1 to 12 wherein, if the firstcomponent is a polynucleotide, then the polynucleotide further comprises a region that encodes a signal sequence which is fused in frame to the polypeptide that comprises the TIGIT variant.
14. The composition for use according to claim 13 wherein the signal sequence is asdefined in SEQ ID NO: 26, 27 or 28.
15. The composition for use according to claims 13 wherein the polynucleotide isselected from the group consisting of SEQ ID NO: 29 to 38.
16. The composition for use according to any of claims 1 to 15, wherein the inhibitorof the PD-1 / PD-L1 axis is selected from the group consisting of a PD-1 binding antagonist, a PD-L 1 binding antagonist and a PD-L2 binding antagonist.
17. The composition for use according to claim 16 wherein the PD-1 bindingantagonist is anti-PD-1 antibody or an antigen-binding fragment thereof, the PD-L 1 binding antagonist is an anti-PD-L1 antibody or an antigen-binding fragmentthereof or the PD-L2 binding antagonist is an anti-PD-L2 antibody or an antigen-binding fragment thereof.
18. The composition for use according to claim 17 whereina) the PD-1 binding antagonist is selected from nivolumab, pembrolizumab,lambrolizumab pidilizumab, Cemiplimab, dostarlimab, toripalimab, tislelizumab camrelizumab, sintilimab and spartalizumab, b) the PD-L1 binding antagonist is selected from the group consisting ofatezolizumab, durvalumab and avelumab, the BMS-936559 antibody, durvalumab and the 10F.9G 2 antibody,c) the PD-L2 binding antagonist is anti-PD-L2 mAb, preferably the mAbproduced by clone 366C.9E5.
19. The composition for use according to claim 18 wherein the first component is thepolypeptide as defined in SEQ ID NO: 14 and the second component is an anti- PD-L1 antibody or wherein the first component is the polypeptide as defined in SEQ ID NO: 15 and the second component is an anti-PD-L1 antibody.
20. The composition for use according to any of claims 1 to 19 wherein the firstcomponent and the second component are administered simultaneously or sequentially.
21. The polypeptide for use according to any of claims 1 to 20 wherein the chronicviral infectious disease is selected from the group consisting of an infection by HCV, by HIV, by CMV, by EBV and by VZV.
22. The polypeptide for use according to claim 21 wherein the chronic viral infectiousdisease is an infection by HIV and wherein the patient to be treated is receivingantiretroviral therapy23. The composition for use according to any of claims 1 to 20 wherein the chronicbacterial infectious disease is selected from the group consisting of an ear infection, a urinary tract infection caused by Escherichia coli and / or byStaphylococcus saprophyticus, a gastritis caused by Helicobacter pylori, a respiratory infection caused by Pseudomonas aeruginosa, pyelonephritis causedby Proteus species, Escherichia coli and / or Pseudomonas species,osteomyelitis, caused by Staphylococcus aureus or by Escherichia coli,bacteremia, skin infection, rosacea, acne, chronic wound infection, infectious kidney stones caused by Proteus mirabilis, bacterial endocarditis, and sinus infection.
24. The polypeptide for use according to any of claims 1 to 23 wherein the patientsuffers from a cardiovascular disease..
25. A polypeptide comprising a TIGIT variant that comprises the TIGIT Ig-like V-typedomain and wherein said polypeptide lacks the TIGIT transmembrane and cytoplasmic domains or a polynucleotide encoding said polypeptide for use in a method for reducing immune toxicity in a patient that is being treated with an inhibitor of the PD-1 / PD-L-1 axis.
26. The polypeptide or polynucleotide for use according to claim 25 wherein theTIGIT variant essentially consists of amino acids 22 to 124 of the human TIGITwherein the numbering is as defined in the NCBI database entry (Release of 10 March 2024) under accession number NP_776160 or of amino acids 20 to 119of the mouse TIGIT wherein the numbering is as defined in the NCBI database entry (Release of 24 May 2024) under accession number NP_001139797.
27. The polypeptide or polynucleotide for use according to claim 26 wherein theTIGIT variant is a polypeptide as defined in SEQ ID NO: 1 or SEQ ID NO: 39 orSEQ ID NO: 2.
28. The polypeptide or polynucleotide for use according to claim 27 which is a fusionprotein comprising the TIGIT variant and a non-TIGIT polypeptide region or a polynucleotide encoding said fusion protein.
29. The polypeptide or polynucleotide for use according to claim 28 wherein theTIGIT variant essentially consists of amino acids 41 to 122 of human TIGIT,wherein the numbering is as defined in the NCBI database entry (Release of 10 March 2024) under accession number NP_776160 or of amino acids 38 to 119of the mouse TIGIT wherein the numbering is as defined in the NCBI database entry (Release of 24 May 2024) under accession number NP_001139797.
30. The polypeptide or polynucleotide for use according to claims 28 or 29 whereinthe non-TIGIT polypeptide region is a Fc monomer region which is formed by thehinge region and the CH2 and CH3 domains of an IgG molecule.
31. The polypeptide or polynucleotide for use according to claim 30 wherein the Fcmonomer region is selected from the group consisting of the human IgG1 Fcmonomer, the human IgG1 Fc monomer carrying a S228P mutation, the mouseIgG2c Fc monomer, the mouse IgG2c Fc carrying the ΔPCPP mutation and themouse IgG1 Fc monomer.
32. The polypeptide or polynucleotide for use according to claim 31 wherein the Fcmonomer region is selected from the group consisting of SEQ ID NO:3, 4, 5, 6 or7.
33. The polypeptide or polynucleotide for use according to claim 32 wherein theTIGIT variant is selected from the group consisting of: a) A fusion protein comprising the human TIGIT Ig-like V-type domain and ahuman IgG1 Fc monomer region,b) A fusion protein comprising the human TIGIT Ig-like V-type domain and ahuman IgG4 Fc monomer region carrying a S228P mutation,c) A fusion protein comprising the mouse TIGIT Ig-like V-type domain and amouse IgG2c Fc monomer region,d) A fusion protein comprising the mouse TIGIT Ig-like V-type domain and amouse IgG2c Fc monomer region carrying a ΔPCPP mutation,e) A fusion protein comprising the mouse TIGIT Ig-like V-type domain and amouse IgG1 Fc monomer region,f) A fusion protein comprising the human TIGIT Ig-like V-type domain and amouse IgG2c Fc monomer region,g) A fusion protein comprising the human TIGIT Ig-like V-type domain and amouse IgG2c Fc monomer region carrying a ΔPCPP mutation andh) A fusion protein comprising the human TIGIT Ig-like V-type domain and amouse IgG1 Fc monomer region.
34. The polypeptide or polynucleotide for use according to claim 33 wherein thefusion protein is selected from the group consisting of SEQ ID NO: 8 to 15.
35. The polypeptide or polynucleotide for use according to any of claims 25 to 34which is selected from the group consisting of SEQ ID NO: 16 to 25.
36. The polypeptide or polynucleotide for use according to any of claims 25 to 34wherein, if the first component is a polynucleotide, then the polynucleotide further comprises a region that encodes a signal sequence which is fused in frame to the polypeptide that comprises the TIGIT variant.
37. The polypeptide or polynucleotide for use according to claim 36 wherein thesignal sequence is as defined in SEQ ID NO: 26, 27 or 28.
38. The polypeptide or polynucleotide for use according to claim 37 wherein thepolynucleotide is selected from the group consisting of SEQ ID NO: 29 to 38.
39. The polypeptide or polynucleotide for use according to any of claims 25 to 38wherein the patient suffers from a chronic viral or bacterial infectious disease.
40. The polypeptide for use according to claim 39 wherein the chronic viral infectiousdisease is selected from the group consisting of an infection caused by HCV, by HIV, by CMV, by EBV and by VZV.
41. The polypeptide for use according to claim 40 wherein the chronic viral infectiousdisease is an infection by HIV and wherein the patient to be treated is receiving antiretroviral therapy42. The polypeptide for use according to claim 39 wherein the chronic bacterialinfectious disease is selected from the group consisting of an ear infection, aurinary tract infection caused by Escherichia coli and / or by Staphylococcussaprophyticus, a gastritis caused by Helicobacter pylori, a respiratory infection caused by Pseudomonas aeruginosa, pyelonephritis caused by Proteus species,Escherichia coli and / or Pseudomonas species, osteomyelitis, caused byStaphylococcus aureus or by Escherichia coli, bacteremia, skin infection,rosacea, acne, chronic wound infection, infectious kidney stones caused by Proteus mirabilis, bacterial endocarditis, and sinus infection.
43. The polypeptide for use according to any of claims 25 to 42 wherein the patientsuffers from a cardiovascular disease.
44. A composition comprising:a) a first component selected from the group consisting of:i) a polypeptide comprising a TIGIT variant that comprises the TIGITIg-like V-type domain and wherein said polypeptide lacks the TIGIT transmembrane and cytoplasmic domains and, ii) a polynucleotide encoding the polypeptide defined in i),and b) a second component, which is an inhibitor of the PD-1 / PD-L1 axis45. The composition according to claim 1 wherein the TIGIT variant essentiallyconsists of amino acids 22 to 124 of human TIGIT, wherein the numbering is as defined in the NCBI database entry (Release of 10 March 2024) under accession number NP_776160 or of amino acids 20 to 119 of the mouse TIGIT wherein the numbering is as defined in the NCBI database entry (Release of 24 May 2024) under accession number NP_001139797.
46. The composition according to claim 2 wherein the TIGIT variant is a polypeptideas defined in SEQ ID NO: 1 or SEQ ID NO: 39 or SEQ ID NO: 2.
47. The composition according to claim 1 wherein the first component is a fusionprotein comprising the TIGIT variant and a non-TIGIT polypeptide region or a polynucleotide encoding said fusion protein.
48. The composition according to claim 4 wherein the TIGIT variant essentiallyconsists of amino acids 41 to 122 of human TIGIT, wherein the numbering is as defined in the NCBI database entry (Release of 10 March 2024) under accession number NP_776160 or of amino acids 38 to 119 of the mouse TIGIT wherein the numbering is as defined in the NCBI database entry (Release of 24 May 2024) under accession number NP_001139797.
49. The composition according to claims 4 or 5 wherein the non-TIGIT polypeptideregion is a Fc monomer which is formed by the hinge region and the CH2 and CH3 domains of an IgG molecule.
50. The composition according to claim 6 wherein the Fc monomer is selected fromthe group consisting of the human IgG1 Fc monomer, the human IgG1 Fc monomer carrying a S228P mutation, the mouse IgG2c Fc monomer, the mouse IgG2c Fc monomer carrying the ΔPCPP mutation and the mouse IgG1 Fc monomer.
51. The composition according to claim 7 wherein the Fc monomer is selected fromthe group consisting of SEQ ID NO: 3, 4, 5, 6 or 7.
52. The composition according to claim 8 wherein the TIGIT variant is selected fromthe group consisting of: a) A fusion protein comprising the human TIGIT Ig-like V-type domain and ahuman IgG1 Fc monomer, b) A fusion protein comprising the human TIGIT Ig-like V-type domain and ahuman IgG4 Fc monomer carrying a S228P mutation, c) A fusion protein comprising the mouse TIGIT Ig-like V-type domain and amouse IgG2c Fc monomer, d) A fusion protein comprising the mouse TIGIT Ig-like V-type domain and amouse IgG2c Fc monomer carrying a ΔPCPP mutation, e) A fusion protein comprising the mouse TIGIT Ig-like V-type domain and amouse IgG1 Fc monomer, f) A fusion protein comprising the human TIGIT Ig-like V-type domain and amouse IgG2c Fc monomer, g) A fusion protein comprising the human TIGIT Ig-like V-type domain and amouse IgG2c Fc monomer carrying a ΔPCPP mutation and h) A fusion protein comprising the human TIGIT Ig-like V-type domain and amouse IgG1 Fc monomer.
53. The composition according to claim 9 wherein the fusion protein is selected fromthe group consisting of SEQ ID NO: 8 to 15.
54. The composition according to any of claims 1 to 4 wherein the first component isprovided as a homodimer of polypeptides comprising the TIGIT variant or according to any of claims 5 to 10 wherein the first component is provided as a homodimer of two fusion proteins.
55. The composition according to any of claims 1 to 11 wherein the first componentis a polynucleotide selected from the group consisting of SEQ ID NO: 16 to 25.
56. The composition according to any of claims 1 to 12 wherein, if the first componentis a polynucleotide, then the polynucleotide further comprises a region that encodes a signal sequence which is fused in frame to the polypeptide that comprises the TIGIT variant.
57. The composition according to claim 13 wherein the signal sequence is as definedin SEQ ID NO: 26, 27 or 28.
58. The composition according to claims 13 wherein the polynucleotide is selectedfrom the group consisting of SEQ ID NO: 29 to 38.
59. The composition according to any of claims 1 to 15, wherein the inhibitor of thePD-1 / PD-L1 axis is selected from the group consisting of a PD-1 binding antagonist, a PD-L 1 binding antagonist and a PD-L2 binding antagonist.
60. The composition according to claim 16 wherein the PD-1 binding antagonist isanti-PD-1 antibody or an antigen-binding fragment thereof, the PD-L 1 binding antagonist is an anti-PD-L1 antibody or an antigen-binding fragment thereof or the PD-L2 binding antagonist is an anti-PD-L2 antibody or an antigen-binding fragment thereof.
61. The composition according to claim 17 whereina) the PD-1 binding antagonist is selected from nivolumab, pembrolizumab,lambrolizumab pidilizumab, Cemiplimab, dostarlimab, toripalimab, tislelizumab camrelizumab, sintilimab and spartalizumab, b) the PD-L1 binding antagonist is selected from the group consisting ofatezolizumab, durvalumab and avelumab, the BMS-936559 antibody, durvalumab and the 10F.9G 2 antibody, c) the PD-L2 binding antagonist is anti-PD-L2 mAb, preferably the mAbproduced by clone 366C.9E5.
62. The composition according to claim 18 wherein the first component is thepolypeptide as defined in SEQ ID NO: 14 and the second component is an anti- PD-L1 antibody or wherein the first component is the polypeptide as defined in SEQ ID NO: 15 and the second component is an anti-PD-L1 antibody.
63. A pharmaceutical composition comprising a pharmaceutically effective amountof the composition according to any one of claims 1 to 19 and a pharmaceutically acceptable excipient.
64. The composition according to any one of claims 1 to 19 or the pharmaceuticalcomposition according to claim 20 for use in medicine.
65. The composition according to any one of claims 1 to 19 or the pharmaceuticalcomposition according to claim 20 for use in a method for treating or delaying an immune-related disease.
66. The composition or pharmaceutical composition for use according to claim 22wherein the immune related disease is a tumor.
67. The composition or pharmaceutical composition for use according to claims 22or 23 wherein the first component and the second component are administered simultaneously or sequentially.
Citation Information
Patent Citations
Methods of cancer treatment using Anti-tigit antibodies in combination with Anti-PD1 antibodies
CA3205839A1
Combination therapies
US20220185863A1
Anti-PD-1 / LAG3 / tigit trispecific antibodies and Anti-PD-1 / LAG3 bicpecific antibodies
US20220251194A1
Soluble tigit recombinant proteins
WO2023105281A1