SRSF1 antagonist

Abstract

This disclosure relates to an isolated nucleic acid molecule comprising a double stranded siRNA molecule comprising sense and antisense strands that silence SRSF1 expression, and the use of said double stranded siRNA molecules to treat neurodegenerative diseases.

Description

[0001] SRSF1 ANTAGONIST

[0002] Field of the Disclosure

[0003] This disclosure relates to an isolated nucleic acid molecule comprising a double stranded siRNA molecule comprising sense and antisense strands that silence SRSF1 expression, and the use of said double stranded siRNA molecules to treat neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS), C9ORF72-linked frontotemporal dementia (FTD) or fragile X-associated tremor / ataxia syndrome (FXTAS).

[0004] SEQUENCE LISTING

[0005] The instant application contains a Sequence Listing which has been submitted herewith and is hereby incorporated by reference in its entirety. Said .xml copy, created on August 07, 2025, and is 764,196 bytes in size.

[0006] Background to the Disclosure

[0007] Small interfering RNA (siRNA) is known to regulate gene expression and can be used to specifically ablate gene function. siRNAs can be used in therapy and are therefore an important therapeutic tool. The siRNA mediated RNA interference pathway starts with the cleavage of a longer double stranded RNA molecules by an RNase 11 l-like enzyme into smaller segments which are then bound into a ribonucleoprotein complex. Within the complex the strands are separated and the antisense is aligned with the target mRNA which is subsequently cleaved.

[0008] Neurodegenerative diseases are typically caused by neuronal dysfunction or neuronal loss and affects millions of people worldwide. Neurodegenerative diseases are more prevalent in the aging populations and include but are not limited to ALS, multiple sclerosis, Parkinson’s disease, Alzheimer disease, motor neuron and Huntington’s disease. ALS, FTD and FXTAS, are adult-onset neurodegenerative diseases with no effective treatment. ALS is the most common form motor neuron disease (MND), a collective term for a group of neurological disorders characterised by degeneration and loss of motor neurons. ALS is characterised by selective degeneration of the upper and lower motor neurons, leading to muscle wasting and premature death usually due to respiratory failure and paralysis. Around 90% of ALS cases are classified as sporadic, with approximately 10% showing a genetic component and familial inheritance. FTD is the second most-common form of early-onset dementia characterised by a progressive loss of neuronal cells in frontal and temporal lobe leading to alterations in cognitive function and personality.

[0009] Some causes of ALS and FTD are known. The most common genetic cause of ALS and FTD is a hexanucleotide repeat expansion of GGGGCC in the first intron of the chromosome 9 open reading frame 72 (C9orf72) gene, termed C9ALS / FTD and antisense oligonucleotide therapies targeting C9ORF72 are aimed at reducing the expression of the repeat expansion, thus reducing RNA-and dipeptide repeat (DPR) protein-mediated toxicity. The serine / arginine- rich splicing factor 1 (SRSF1) is known to inhibit the nuclear export of the pathologically expanded C9ORF72 transcripts without interfering with biogenesis / processing of the wild-type C9ORF72 transcripts and therefore is a suitable target for selectively reducing pathological C9ORF72 without impacting the expression of wild type C9ORF72 mRNA and protein levels. Interestingly, depletion of SRSF1 also confers neuroprotection in sporadic ALS cases which are not caused by a pathological C9ORF72 hexanucleotide repeat expansion. Other causes of ALS are associated with mutations in the SOD1 gene. The SOD1 gene encodes a superoxide dismutase that catalyses the dismutation of superoxide anion radicals to hydrogen peroxide and therefore reduces oxidative stresses.

[0010] Therapeutic approaches targeting faulty genes are known. PCT / EP2023 / 071868 discloses a viral vector comprising a transcription cassette comprising a nucleic acid molecule encoding an antagonist such as polypeptides or shRNA molecules that targets SRSF1. siRNA molecules targeting SRSF1 are also disclosed. US10,801 ,027 demonstrates that depletion of the export adaptor serine / arginine-rich splicing factor 1 (SRSF1) inhibits the nuclear export of pathological C9ORF72 repeat transcripts retaining hexanucleotide repeat expansions and is hereby incorporated by reference in its entirety. US10 / 385341 discloses a composition for decreasing SOD-1 mRNA and protein expression using antisense compounds. The compounds are formulated for intrathecal administration. The FDA approved an antisense oligonucleotide under the name Tofersen for the treatment of SOD1-ALS.

[0011] The present disclosure relates to siRNAs that silence the expression of SRSF1 and their use in the treatment of neurodegenerative diseases associated with SRSF1 such as ALS, FTD and FXTAS.

[0012] Statements of the Invention

[0013] According to an aspect of the invention there is provided a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand and an antisense strand wherein said antisense strand has a nucleotide sequence which is at least partially complementary to a nucleotide sequence with SEQ ID NO:1 (SRSF1), or polymorphic sequence variant thereof, and wherein said double stranded inhibitory RNA is between 15 and 30 nucleotides in length and silences expression of SRSF1.

[0014] In a preferred embodiment of the invention said antisense strand has a nucleotide sequence which is at least partially complementary to the nucleotide sequence in SEQ ID NO 1.

[0015] In a preferred embodiment of the invention said antisense strand has a nucleotide sequence which is at least partially complementary to the nucleotide sequence in the 3’ untranslated region.

[0016] In a further preferred embodiment of the invention said 3’ untranslated region comprises or consist of nucleic acid 857 to 5341 of SEQ ID NO 1 .

[0017] A polymorphic sequence variant varies from a reference sequence by 1 , 2, 3, 4, 5 or more nucleotides. Preferably said double stranded inhibitory RNA is a small interfering RNA (siRNA).

[0018] In a preferred embodiment of the invention said double stranded inhibitory RNA molecule comprises at least 19 contiguous nucleotides in length.

[0019] In a preferred embodiment of the invention said double stranded inhibitory RNA molecule comprises between 19 to 25 contiguous nucleotides in length.

[0020] In a preferred embodiment of the invention said double stranded inhibitory RNA molecule comprises between 21 to 23 contiguous nucleotides in length.

[0021] The double stranded inhibitory RNA molecules comprise or consist of natural nucleotide bases that do not require chemical modification or modified nucleotide bases and / or sugars.

[0022] In a preferred embodiment of the invention said double stranded inhibitory RNA molecule comprises or consist of an antisense nucleotide sequence selected from the group consisting of SEQ ID NO 99, 125, 101 , 113, 118, 100, 106, 103, 107, 137, 114, 110, 102, 116, 105, 108, 127, 104, 112 and 111. In a further preferred embodiment of the invention said double stranded inhibitory RNA molecule comprises or consist of an antisense nucleotide sequence selected from the group consisting of SEQ ID NO 109, 115, 117, 119, 120, 121 , 122, 123, 124, 126, 128, 129, 130, 131 , 132, 133, 134, 135, 136, 138, 139, 140, 141 ,142, 143, 144, 145,146, 147, 148, 149, 150,151 , 152, 153, 154, 155, 156, 157, 158, 159, 160, 161 , 162, 163, 164, 165, 166, 167, 168, 169, 170, 171 , 172, 173, 174, 175, 176, 177,178, 179, 180, 181 , 182,183,184, 185, 186,187, 188, 189, 190,191 , 192, 193 and 194.

[0023] In a preferred embodiment of the invention said double stranded inhibitory RNA molecule comprises or consist of an antisense nucleotide sequence selected from the group consisting of:

[0024] UGUUAUCCAGUUUUCGAACUGCA (SEQ ID NO 386), UAACUUAGUGUUAUCCAGUUUUC (SEQ ID NO 387) UAUCAUCUUAUGUACGAGAGCGA (SEQ ID NO 388), UCACCAAUCAUCUUAUGUACGAG (SEQ ID NO 389), UCUACAAAAAGUGUCACCAAUCA (SEQ ID NO 390), UAAACUGUAUACAACAUGGGUUC (SEQ ID NO 391), UAACUAAGCACUGUGACAAAUUA (SEQ ID NO 392), and UUAGAAGUGACUUACUGAUUUAC (SEQ ID NO 393).

[0025] In a preferred embodiment of the invention said double stranded inhibitory RNA molecule comprises or consist of a sense nucleotide sequence selected from the group consisting of SEQ ID NO 3, 29, 5, 17, 22, 4, 10, 7, 11 , 41 , 18, 14, 6, 20, 9, 12, 31 , 8, 16 and 15.

[0026] In a preferred embodiment of the invention said double stranded inhibitory RNA molecule comprises or consist of a sense nucleotide sequence selected from the group consisting of SEQ ID NO 13, 19, 21 , 23, 24, 25, 26, 27, 28, 30, 32, 33, 34, 35, 36, 37, 38, 39, 40, 42, 43, 44, 45,46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77,78, 79, 80, 81 ,82, 83,84, 85, 86, 87, 88, 89, 90, 91 , 92,93, 94, 95, 96, 97 and 98.

[0027] In a preferred embodiment of the invention said double stranded inhibitory RNA molecule comprises or consist of a sense nucleotide sequence selected from the group consisting of:

[0028] CAGUUCGAAAACUGGAUAACA (SEQ ID NO 394), AAACUGGAUAACACUAAGUUA (SEQ ID NO 395), GCUCUCGUACAUAAGAUGAUA (SEQ ID NO 396), CGUACAUAAGAUGAUUGGUGA (SEQ ID NO 397), AUUGGUGACACUUUUUGUAGA (SEQ ID NO 398), ACCCAUGUUGUAUACAGUUUA (SEQ ID NO 399), AUUUGUCACAGUGCUUAGUUA (SEQ ID NO 400), and AAAUCAGUAAGUCACUUCUAA (SEQ ID NO 401).

[0029] In a preferred embodiment of the invention said sense strand or antisense strand comprises a nucleotide sequence comprising one or more modified nucleotides and / or sugars.

[0030] In a preferred embodiment of the invention said modified nucleotides are selected from the group consisting of: a 3 '-terminal deoxy- thymine (dT) nucleotide, a 2'-0-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-0-allyl-modified nucleotide, 2'-C-alkyl-modified nucleotide, 2' -hydroxyl- modified nucleotide, a 2'-methoxyethyl modified nucleotide, a 2'-0- alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural base comprising nucleotide, a tetrahydropyran modified nucleotide, a 1 ,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a phosphorothioate group, a nucleotide comprising phosphorodithioate (PS2), a nucleotide comprising a methylphosphonate group, a nucleotide comprising a 5’- phosphate, and a nucleotide comprising a 5 ‘-phosphate mimic, for example a 5’-vinyl phosphate, a nucleotide comprising a 2’-deoxy-2’-fluro and a 2’ methyl sugar base.

[0031] In a preferred embodiment of the invention said sense strand or antisense strand comprises a nucleotide sequence comprising at least one modified nucleotide wherein said modification is 2'-deoxy-2'-fluoro.

[0032] In a preferred embodiment of the invention said sense strand or antisense strand comprises a nucleotide sequence comprising at least one modified nucleotide wherein said modification is 2'-fluoro.

[0033] In a preferred embodiment of the invention said sense strand or antisense strand comprises a nucleotide sequence comprising at least one modified nucleotide wherein said modification is 2'-O-methyl.

[0034] In an embodiment of the invention said sense strand or antisense strand comprises a nucleotide sequence comprising at least one modified sugar. A sugar modification includes a modified version of the ribosyl moiety, such as -O- modified RNA such as 2'-O-alkyl or 2'-O-(substituted)alkyl e.g. 2'-0-methyl, T-0-(2- cyanoethyl), 2'-0-(2- methoxy)ethyl (2'-MOE), 2'-0-(2-thiomethyl)ethyl, 2'-O-butyryl, -O- propargyl, 2'-O-allyl, 2'-O- (2-amino)propyl, 2'-O-(2-(dimethylamino)propyl), 2'-O-(2- amino)ethyl, 2'-O-(2- (dimethylamino)ethyl); 2'-deoxy (DNA); 2'-O-(haloalkoxy)methyl, e.g. 2'-0-(2- chloroethoxy)methyl (MCEM), -O- (2,2-dichloroethoxy)methyl (DCEM); 2'-<3-alkoxycarbonyl e.g. T-0-[2- (methoxycarbonyl)ethyl] (MOCE), 2'-O-[2-(N-methylcarbamoyl)ethyl] (MCE), T-0- [2-(N,N- dimethylcarbamoyl)ethyl] (DCME); 2'-halo e.g. 2'-F, FANA (2'-F arabinosyl nucleic acid); carbasugar and azasugar modifications; 3 '-O-alkyl e.g. 3'-0-methyl, 3 '-O-butyryl, V-O- propargyl and their derivatives.

[0035] In a preferred embodiment of the invention said sense and / or said antisense strands comprises internucleotide phosphorothioate linkages.

[0036] In a preferred embodiment of the invention said sense strand comprises internucleotide phosphorothioate linkages.

[0037] In a further preferred embodiment of the invention said double stranded inhibitory RNA molecule comprises or consist of an antisense nucleotide sequence selected from the group consisting of SEQ ID NO 291 , 317, 293, 305, 310, 292, 298, 295, 299, 329, 306, 302, 294, 308, 297, 300, 319, 296, 304 and 303.

[0038] In a preferred embodiment of the invention said double stranded inhibitory RNA molecule comprises or consist of an antisense nucleotide sequence selected from the group consisting of SEQ ID NO 301 , 307, 309, 311 , 312, 313, 314, 315, 316, 318, 320, 321 , 322, 323, 324,

[0039] 325, 326, 327, 328, 330, 331 , 332, 333, 334, 335, 336, 337, 338, 339, 340, 341 , 342, 343,

[0040] 344, 345, 346, 347, 348, 349, 350, 351 , 352, 353, 354, 355, 356, 357, 358, 359, 360, 361 ,

[0041] 362, 363, 364, 365, 366, 367, 368, 369, 370, 371 , 372, 373, 374, 375, 376, 377, 378, 379,

[0042] 380, 382, 382, 383, 384, 385 and 2.

[0043] In a further preferred embodiment of the invention said double stranded inhibitory RNA molecule comprises or consist of a sense nucleotide sequence selected from the group consisting of SEQ ID NO 195, 221 , 197, 209, 214, 196, 202, 199, 203, 233, 210, 206, 198, 212, 201 , 204, 223, 200, 208 and 207. In a preferred embodiment of the invention said double stranded inhibitory RNA molecule comprises or consist of an sense nucleotide sequence selected from the group consisting of SEQ ID NO 205, 211 , 213, 215, 216, 217, 218, 219, 220, 222, 224, 225, 226, 227, 228, 229, 230, 231 , 232, 234, 235, 236, 237, 238, 239, 240, 241 , 242, 243, 244, 245, 246, 247,248, 249, 250, 251 , 252, 253, 254, 255, 256, 257, 258, 259, 260, 261 , 262,263, 264, 265, 266, 267, 268, 269, 270, 271 , 272, 273, 274, 275, 276, 277, 278, 279, 280, 281 , 282, 283, 284, 285,286, 287, 288, 289 and 290.

[0044] In a preferred embodiment of the invention said nucleic acid molecule comprises a RNA strand comprising or consisting of a nucleotide sequence, or a polymorphic sequence variant set forth in Table 2.

[0045] In a preferred embodiment of the invention said nucleic acid molecule comprises a RNA strand comprising or consisting of a nucleotide sequence, or a polymorphic sequence variant set forth in Table 3.

[0046] In a preferred embodiment of the invention said nucleic acid molecule comprises a RNA strand comprising or consisting of a nucleotide sequence, or a polymorphic sequence variant set forth in Table 5.

[0047] In a preferred embodiment of the invention said nucleic acid molecule comprises a RNA strand comprising or consisting of a nucleotide sequence, or a polymorphic sequence variant set forth in Table 6.

[0048] In a preferred embodiment of the invention said nucleic acid molecule comprises a RNA strand comprising or consisting of a nucleotide sequence, or a polymorphic sequence variant set forth in Table 7.

[0049] Moreover, in some embodiments of the invention the antisense strand is optionally provided with at least a two-nucleotide base overhang sequence. Alternatively, the sense strand is provided with at least a two-nucleotide base overhang sequence. The two-nucleotide overhang sequence can correspond to nucleotides encoded by the target or are non-encoding and can be positioned at the 3’ or 5’ end of the sense or antisense strand.

[0050] In a preferred embodiment of the invention said inhibitory RNA molecule comprises a two- nucleotide overhang comprising or consisting of deoxythymidine dinucleotide (dTdT). In a preferred embodiment of the invention said dTdT overhang is positioned at the 5’ end of said antisense strand.

[0051] In an alternative preferred embodiment of the invention said dTdT overhang is positioned at the 3’ end of said antisense strand.

[0052] In a preferred embodiment of the invention said dTdT overhang is positioned at the 5’ end of said sense strand.

[0053] In an alternative preferred embodiment of the invention said dTdT overhang is positioned at the 3’ end of said sense strand.

[0054] The two-nucleotide overhang can be two nucleotides of any sequence and in any order, for example UU, AA, UA, AU, GG, CC, GC, CG, UG, GU, UC, CU and TT.

[0055] In a preferred embodiment of the invention said sense and / or said antisense strands comprises internucleotide phosphorothioate linkages.

[0056] In a preferred embodiment of the invention said sense strand comprises internucleotide phosphorothioate linkages.

[0057] Preferably, at the 5’ and / or 3’ end two nucleotides of said sense strand comprise two internucleotide phosphorothioate linkage.

[0058] In a preferred embodiment of the invention said antisense strand comprises internucleotide phosphorothioate linkages.

[0059] Preferably, at the 5’ and / or 3’ end two nucleotides of said antisense strand comprise two internucleotide phosphorothioate linkage.

[0060] In a preferred embodiment of the invention said double stranded inhibitory RNA molecule comprises or consist of an antisense nucleotide sequence selected from the group consisting of: usGfsuuaUfcCfAfguuuUfcGfaacugscsa (SEQ ID NO 291), usAfsacuUfaGfUfguuaUfcCfaguuususc (SEQ ID NO 295), usAfsucaUfcUfUfauguAfcGfagagcsgsa, (SEQ ID NO 298), usCfsaccAfaUfCfaucuUfaUfguacgsasg (SEQ ID NO 292), usCfsuacAfaAfAfagugllfcAfccaauscsa (SEQ ID NO 293), usAfsaacUfgUfAfuacaAfcAfugggususc (SEQ ID NO 305), usAfsacuAfaGfCfacugllfgAfcaaaususa (SEQ ID NO 310), and usUfsagaAfgUfGfacuuAfclIfgauuusasc (SEQ ID NO 317), wherein n is 2'-O-methyl ribonucleotide, Nf is 2'-fluoro ribonucleotide and s is phosphorothioate.

[0061] In the context of this application the abbreviation “n” represents any base selected from a, u, g and c, and wherein said base is modified with a 2’-O-methylation. “Nf” represents any base selected from A, II, G and C and wherein said base is modified with 2’-fluoro.

[0062] In a preferred embodiment of the invention said double stranded inhibitory RNA molecule comprises or consists of sense nucleotide sequence selected from the group consisting of: csasguucGfaAfAfAfcuggauaascsa (SEQ ID NO 195), asasacugGfallfAfAfcacuaagususa (SEQ ID NO 199), gscsucucGfuAfCfAfuaagaugasusa (SEQ ID NO 202), csgsuacallfaAfGfAfugauuggusgsa (SEQ ID NO 196), asusugguGfaCfAfCfuuuuuguasgsa (SEQ ID NO 197), ascsccauGfullfGfllfauacaguususa (SEQ ID NO 209), asusuuguCfaCfAfGfugcuuagususa (SEQ ID NO 214). and asasaucaGfuAfAfGfucacuucusasa (SEQ ID NO 221), wherein n is 2'-O-methyl ribonucleotide, Nf is 2'-fluoro ribonucleotide and s is phosphorothioate.

[0063] In a preferred embodiment of the invention said nucleic acid molecule comprises a vinylphosphonate modification.

[0064] In a preferred embodiment of the invention said vinylphosphonate modification is to the 5’ end phosphate of said sense RNA strand.

[0065] In a preferred embodiment of the invention said vinylphosphonate modification is to the 5’ end phosphate of said antisense RNA strand.

[0066] In a further preferred embodiment of the invention said double stranded inhibitory RNA molecule comprises one or more targeting ligands. In a further alternative embodiment of the invention said one or more targeting ligand(s) is linked to the either antisense strand or sense strand of said inhibitory RNA.

[0067] In a further preferred embodiment of the invention said targeting ligand is a lipophilic moiety.

[0068] In a preferred embodiment of the invention said double stranded inhibitory ribonucleic acid (RNA) molecule Is combined with a delivery vehicle.

[0069] The delivery of inhibitory RNA such as siRNA is achieved using delivery vehicles known in the art. For example, siRNA can be chemically modified and conjugated to a lipophilic moiety. Cationic delivery systems can also be employed in the delivery of siRNA. These include cationic lipids and liposomes, cationic polymers, cationic dendrimers and cationic cell penetrating peptides. The cationic delivery vehicles have a common positive charge which facilitates complex formation with negatively charged siRNA. Other liposome-based delivery vehicle includes solid nucleic acid lipid particles [SNALPs] which are also conjugated with polyethylene glycol. A yet further example of a siRNA delivery vehicle are self-assembled LPD nanoparticles. LPD nanoparticles comprise cationic lipids combined with protamine which interacts with negatively charged siRNA. Lipid nanoparticles (LNPs) are known to improve the delivery of siRNA to a target site. LNP enhance the stability of siRNAs and have a low level of toxicity, thus minimizing the requirement of using modified nucleotides reducing costs. LNP are internalised in the cell through endocytosis allowing the intracellular release of the siRNA molecules. Different types of LNPs exists such as liposomes, solid lipid NPs, nanostructured lipid carriers and nanoemulsions and LNPs can be modified by pegylation to improve pharmacokinetics or using surface ligands to target for example cancer cells or compounds the liver or spleen. LNPs are disclosed in patent application WO2010080724, WO2023092218A1 or US10576155, the contents are hereby incorporated by reference in its entirety.

[0070] The delivery of inhibitory RNAs such as siRNAs can be achieved using delivery vehicles known in the art. For example, the antisense oligonucleotide can be chemically modified and conjugated to a lipophilic moiety. An example of lipophilic moieties are disclosed in WO2019 / 217459 which is incorporated by reference in its entirety. WO2019 / 217459 discloses lipophilic moieties conjugated to double stranded inhibitory RNAs linked to either or both the sense or antisense strand of the inhibitory RNA, optionally including a linker or direct linkage to the sugar backbone, to deliver siRNA to extrahepatic tissue. The length of the hydrocarbon chain is between C4 to C18. In addition, specific internal regions of the sense and / or antisense sequences are selected. C16 is disclosed as a preferred hydrocarbon chain. Furthermore, W02 020 / 257194, the content of which is incorporated by reference in its entirety, discloses lipophilic conjugated inhibitory RNA to either or both the sense or antisense strand of an inhibitory RNA, optionally including a linker moiety or direct linkage to the sugar backbone, to deliver inhibitory RNA to tissues of the central nervous system (CNS) in particular the striatum. The length of the hydrocarbon chain is between C4 to C18 with a preferred hydrocarbon chain length of C16. Cationic delivery systems can also be employed in the delivery of ASOs. These include cationic lipids and liposomes, cationic polymers, cationic dendrimers and cationic cell penetrating peptides. The cationic delivery vehicles have a common positive charge which facilitates complex formation with negatively charged ASOs. Other liposome-based delivery vehicle includes solid nucleic acid lipid particles [SNALPs] which are also conjugated with polyethylene glycol. A yet further example of a ASO delivery vehicle is self-assembled LPD nanoparticles. LPD nanoparticles comprise cationic lipids combined with protamine.

[0071] In a preferred embodiment of the invention said lipophilic moiety is selected from a saturated or unsaturated C4-C30 hydrocarbon chain such for example a C4-C30 alkyl or alkenyl.

[0072] In a further preferred embodiment of the invention said lipophilic moiety comprises further a functional group selected from the group consisting of hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide, and alkyne.

[0073] In a preferred embodiment, the lipophilic group contains a saturated or unsaturated C16 hydrocarbon chain such as for example a linear C alkyl or C alkenyl.

[0074] In a further preferred embodiment of the invention said targeting ligand is 2'-O-hexadecyl.

[0075] In a preferred embodiment said double stranded inhibitory RNA molecule comprises or consist of an antisense nucleotide sequence selected from the group consisting of:

[0076] (vinu)sGfsuuauccaguuullfcGfaacugscsa (SEQ ID NO 402), (vinu)sAfsucaucuuauguAfcGfagagcsgsa (SEQ ID NO 403), (vinu)sAfsacuaagcacugllfgAfcaaaususa (SEQ ID NO 404), and (vinu)sUfsagaagugacuuAfcllfgauuusasc, (SEQ ID NO 405), wherein n is 2'-O-methyl ribonucleotide, Nf is 2'-fluoro ribonucleotide, (vinu) is 5'- vinylphosphonate-2'-OMe-U, s is phosphorothioate.

[0077] In a preferred embodiment said double stranded inhibitory RNA molecule comprises or consist of a sense nucleotide sequence selected from the group consisting of (Palm-C6)csasguucGfaAfAfAfcuggauaascsa (SEQ ID NO 406), csasguu(C16-C)GfaAfAfAfcuggauaascsa (SEQ ID NO 407), csasguucGfaAfAfAfcuggauaascsa(NHC6)(Palm) (SEQ ID NO 408), (Palm-C6)gscsucucGfuAfCfAfuaagaugasusa (SEQ ID NO 409), gscsucu(C16-C)GfuAfCfAfuaagaugasusa (SEQ ID NO 410), gscsucucGfuAfCfAfuaagaugasusa(NHC6)(Palm) (SEQ ID NO 411), (Palm-C6)asusuuguCfaCfAfGfugcuuagususa (SEQ ID NO 412), asusuug(C16-U)CfaCfAfGfugcuuagususa (SEQ ID NO 413), asusuuguCfaCfAfGfugcuuagususa(NHC6)(Palm) (SEQ ID NO 414), (Palm-C6)asasaucaGfuAfAfGfucacuucusasa (SEQ ID NO 415), asasauc(C16-A)GfuAfAfGfucacuucusasa (SEQ ID NO 416) and asasaucaGfuAfAfGfucacuucusasa(NHC6)(Palm) (SEQ ID NO 417), wherein n is 2'-O-methyl ribonucleotide, Nf is 2'-fluoro ribonucleotide, (C16-N) is 2'-O-C16 ribonucleotide wherein N is selected from A, G, II and T, s is phosphorothioate and (Palm-C6) / / (NHC6) (Palm) is Palmitate-C6.

[0078] Palmitate-C6 (Palm-C6) or (NHC6)(Palm) refers in the context of this invention to a palmitoyl (C16) group attached via an aminohexyl linker, for conjugation at the 5’ (position 1) or 3’ (position 21) termini; and (C16-N) or (2’-O-C16-ribonucleotide) refers to a palmitoyl group attached via a direct amide linkage, for conjugation at internal nucleotide positions (2-20).

[0079] In an alternative preferred embodiment said double stranded inhibitory RNA molecule comprises or consist of a sense nucleotide sequence selected from the group consisting of csasg(C16-U)ucGfaAfAfAfcuggauaascsa (SEQ ID NO 420) asasa(C16-U)caGfuAfAfGfucacuucusasa (SEq ID NO 421) csasguucGfaAfAfAfcugg(C16-A)uaascsa (SEQ ID NO 422) asasaucaGfuAfAfGfucac(C16-U)ucusasa (SEQ ID NO 423) (Palm)(NHC6)csasguucGfaAfAfAfcuggauaascsa (SEQ ID NO 424), wherein n is 2'-O-methyl ribonucleotide, Nf is 2'-fluoro ribonucleotide, (C16-N) is 2'-O-C16- ribonucleotide wherein N is selected from A, G, II and T, s is phosphorothioate and (Palm-C6) / / (NHC6) (Palm) is Palmitate-C6.

[0080] In a preferred embodiment said double stranded inhibitory RNA molecule comprises or consists of a sense nucleotide sequence selected from the group consisting of: 5'-csasguu(C16-C)GfaAfAfAfcuggauaascsa-3' (SEQ ID NO 407) and 5'-asasauc(C16-A)GfuAfAfGfucacuucusasa-3' (SEQ ID NO 416), wherein n is 2’-0-methyl ribonucleotide, Nf is 2'-fluoro ribonucleotide and s is phosphorothioate and (C16-N) is 2 -O-C16 ribonucleotide wherein N is selected from A, G, II and T.

[0081] In a preferred embodiment said double stranded inhibitory RNA molecule comprises or consists of an antisense nucleotide sequence selected from the group consisting of 5'-(vinu)sGfsuuaUfcCfAfguuullfcGfaacugscsa-3' (SEQ ID NO 418) and 5'-(vinu)sUfsagaAfgUfGfacuuAfcllfgauuusasc-3' (SEQ ID NO 419), wherein n is 2’-O-methyl ribonucleotide, Nf is 2'-fluoro ribonucleotide, s is phosphorothioate, and (vinu) is 5'-vinylphosphonate-2'-OMe-U.

[0082] In a preferred embodiment said double stranded inhibitory RNA molecule comprises or consists of a sense nucleotide sequence selected from the group consisting of GCUCUCGUACAUAAGAUGAUA (SEQ ID NO 396) and AAAUCAGUAAGUCACUUCUAA (SEQ ID NO 401).

[0083] In a preferred embodiment said double stranded inhibitory RNA molecule comprises or consists of an antisense nucleotide sequence selected from the group consisting of Aucaucuuauguacgagagcga (SEQ ID NO 388) and UUAGAAGUGACUUACUGAUUUAC (SEQ ID NO 393).

[0084] In a preferred embodiment said double stranded inhibitory RNA molecule comprises or consists of a sense nucleotide sequence

[0085] GCUCUCGUACAUAAGAUGAUA (SEQ ID NO 396) and an antisense nucleotide sequence Aucaucuuauguacgagagcga (SEQ ID NO 388)

[0086] In an alternative preferred embodiment said double stranded inhibitory RNA molecule comprises or consists of a sense nucleotide sequence AAAUCAGUAAGUCACUUCUAA (SEQ ID NO 401) and an antisense nucleotide sequence UUAGAAGUGACUUACUGAUUUAC (SEQ ID NO 393).

[0087] In a preferred embodiment said double stranded inhibitory RNA molecule comprises or consists of a sense nucleotide sequence selected from the group consisting of gscsucucGfuAfCfAfuaagaugasusa (SEQ ID NO 202) and asasaucaGfuAfAfGfucacuucusasa (SEQ ID NO 221), wherein n is 2'-O-methyl ribonucleotide, Nf is 2'-fluoro ribonucleotide and s is phosphorothioate. In an alternative preferred embodiment said double stranded inhibitory RNA molecule comprises or consists of an antisense nucleotide sequence selected from the group consisting of usAfsucallfcUfllfauguAfcGfagagcsgsa (SEQ ID NO 298) and usUfsagaAfgllfGfacuuAfcUfgauuusasc (SEQ ID NO 317), wherein n is 2'-O-methyl ribonucleotide, Nf is 2'-fluoro ribonucleotide and s is phosphorothioate.

[0088] In an alternative preferred embodiment said double stranded inhibitory RNA molecule comprises or consists of a sense nucleotide sequence gscsucucGfuAfCfAfuaagaugasusa (SEQ ID NO 202) and an antisense nucleotide sequence usAfsucallfcUfllfauguAfcGfagagcsgsa (SEQ ID NO 298), wherein n is 2'-O-methyl ribonucleotide, Nf is 2'-fluoro ribonucleotide and s is phosphorothioate.

[0089] In an alternative preferred embodiment said double stranded inhibitory RNA molecule comprises or consists of a sense nucleotide sequence asasaucaGfuAfAfGfucacuucusasa (SEQ ID NO 221) and an antisense nucleotide sequence usUfsagaAfgllfGfacuuAfcUfgauuusasc (SEQ ID NO 317), wherein n is 2'-O-methyl ribonucleotide, Nf is 2'-fluoro ribonucleotide and s is phosphorothioate.

[0090] In a preferred embodiment said double stranded inhibitory RNA molecule comprises or consists of a sense nucleotide sequence selected from the group consisting of gscsucucGfuAfCfAfuaagaugasusa(NHC6)(Palm) (SEQ ID NO 411) and asasaucaGfuAfAfGfucacuucusasa(NHC6)(Palm) (SEQ ID NO 417), wherein Nf is 2'-fluoro ribonucleotide, n is 2'-O-methyl ribonucleotide, s is phosphorothioate, (NHC6)(Palm) is Palmitate-C6.

[0091] In a preferred embodiment said double stranded inhibitory RNA molecule comprises or consists of an antisense nucleotide sequence selected from the group consisting of (vinu)sAfsucaucuuauguAfcGfagagcsgsa (SEQ ID 403) and (vinu)sUfsagaagugacuuAfcllfgauuusasc (SEQ ID NO 405), wherein (vinu) is 5'-vinylphosphonate-2'-O-methyl-uridine, Nf is 2'-fluoro ribonucleotide, n is 2'-O-methyl ribonucleotide, s is phosphorothioate.

[0092] In a preferred embodiment said double stranded inhibitory RNA molecule comprises or consists of a sense nucleotide sequence selected from the group consisting of gscsucucGfuAfCfAfuaagaugasusa(NHC6)(Palm) (SEQ ID NO 411) and antisense nucleotide sequence (vinu)sAfsucaucuuauguAfcGfagagcsgsa (SEQ ID 403) wherein (vinu) is 5'-vinylphosphonate-2'-O-methyl-uridine, Nf is 2'-fluoro ribonucleotide, n is 2'-O-methyl ribonucleotide, s is phosphorothioate backbone modification, (NHC6) (Palm) is Palmitate-C6.

[0093] In a preferred embodiment said double stranded inhibitory RNA molecule comprises or consists of an sense nucleotide sequence asasaucaGfuAfAfGfucacuucusasa(NHC6)(Palm) (SEQ ID NO 417) and an antisense nucleotide sequence (vinu)sUfsagaagugacuuAfcllfgauuusasc (SEQ ID NO 405) wherein (vinu) is 5'-vinylphosphonate-2'-O-methyl-uridine, Nf is 2'-fluoro ribonucleotide, n is 2'-O-methyl ribonucleotide, s is phosphorothioate backbone modification, (NHC6) (Palm) is Palmitate-C6.

[0094] According to an aspect of the invention there is provided a composition comprising the double stranded inhibitory ribonucleic acid molecule according to the invention and a pharmaceutically acceptable carrier or diluent.

[0095] In a preferred embodiment of the invention said composition further includes a pharmaceutical carrier and / or excipient.

[0096] When administered the compositions of the present invention are administered in pharmaceutically acceptable preparations. Such preparations may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers and optionally other therapeutic agents, which can be administered separately from the nucleic acid molecule according to the invention or in a combined preparation if a combination is compatible. Preferably the pharmaceutical acceptable preparations comprise artificial cerebrospinal fluids suitable for the administration of agents to the central nervous system.

[0097] The combination of a nucleic acid according to the invention and the other, different therapeutic agent is administered as simultaneous, sequential, or temporally separate dosages.

[0098] The compositions of the invention are administered in effective amounts. An “effective amount” is that amount of a composition that alone, or together with further doses, produces the desired response. In the case of treating a disease, such as ALS, the desired response is inhibiting or reversing the progression of the disease. This may involve only slowing the progression of the disease temporarily, although more preferably, it involves halting the progression of the disease permanently. This can be monitored by routine methods.

[0099] Such amounts will depend, of course, on the condition being treated, the severity of the condition, the individual patient parameters including age, physical condition, size and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. It is generally preferred that a maximum dose of the individual components or combinations thereof be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art, however, that a patient may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons or for virtually any other reasons.

[0100] The pharmaceutical compositions used in the foregoing methods preferably are sterile and contain an effective amount of a nucleic acid molecule according to the invention for producing the desired response in a unit of weight or volume suitable for administration to a patient. The response can, for example, be measured by determining regression of the neurodegenerative disease and decrease of disease symptoms or, by determining changes in patient biomarker levels that are related to neurodegeneration.

[0101] The doses of the nucleic acid molecule according to the invention administered to a subject can be chosen in accordance with different parameters, in particular in accordance with the mode of administration used and the state of the subject. Other factors include the desired period of treatment. If a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits. It will be apparent that the method of detection of the nucleic acid according to the invention facilitates the determination of an appropriate dosage for a subject in need of treatment.

[0102] Other protocols for the administration of compositions will be known to one of ordinary skill in the art, in which the dose amount, schedule of injections, sites of injections, mode of administration and the like vary from the foregoing. The administration of compositions to mammals other than humans, (e.g., for testing purposes or veterinary therapeutic purposes), is carried out under substantially the same conditions as described above. A subject, as used herein, is a mammal, preferably a human, and including a nonhuman primate. When administered, the pharmaceutical preparations of the invention are applied in pharmaceutically acceptable amounts and in pharmaceutically acceptable compositions. The term “pharmaceutically acceptable” means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients. Such preparations may routinely contain salts, buffering agents, preservatives, compatible carriers, and optionally other therapeutic agents. When used in medicine, the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof and are not excluded from the scope of the invention. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic, and the like. Also, pharmaceutically acceptable salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts.

[0103] Compositions may be combined, if desired, with a pharmaceutically acceptable carrier. The term “pharmaceutically acceptable carrier” as used herein means one or more compatible solid or liquid fillers, diluents or encapsulating substances which are suitable for administration into a human. The term “pharmaceutically acceptable carrier” in this context denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate, for example, solubility and / or stability. The components of the pharmaceutical compositions also are capable of being co-mingled with the molecules of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficacy.

[0104] The pharmaceutical compositions may contain suitable buffering agents, including acetic acid in a salt; citric acid in a salt; boric acid in a salt; and phosphoric acid in a salt. The pharmaceutical compositions also may contain, optionally, suitable preservatives.

[0105] The pharmaceutical compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well-known in the art of pharmacy. All methods include the step of bringing the active agent into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the active compound into association with a liquid carrier.

[0106] Compositions comprise a sterile aqueous or non-aqueous preparation of nucleic acid, which is preferably isotonic with cerebrospinal fluid. This preparation may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation also may be a sterile injectable solution or suspension in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1 , 3-butane diol. Among the acceptable solvents that may be employed are water, Ringer’s solution, and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono-or di-glycerides. In addition, fatty acids such as oleic acid may be used in the preparation of injectables. Carrier formulation suitable for oral, subcutaneous, intravenous, intramuscular, etc. administrations can be found in Remington’s Pharmaceutical Sciences, Mack Publishing Co., Easton, PA.

[0107] According to a further aspect of the invention there is provided a double stranded inhibitory RNA molecule according to the invention for use as a medicament.

[0108] According to a further aspect of the invention there is provided an inhibitory RNA molecule or composition according to the invention for use in the treatment of a neurodegenerative disease.

[0109] In a preferred embodiment said neurodegenerative disease is caused by dipeptide repeat proteins (DPR).

[0110] In a preferred embodiment of the invention said neurodegenerative disease is selected from the group consisting of: amyotrophic lateral sclerosis (ALS), sporadic amyotrophic lateral sclerosis, familial ALS caused by a mutation other than a pathological C9ORF72-r&peat expansion, frontotemporal dementia (FTD), motor neurone disease, frontotemporal lobar dementia (FTLD), Alzheimer’s Disease, Parkinson’s Disease, neurodegenerative disease with TDP43 pathology, Huntington’s Disease, Huntington's like disorder, and Fragile X-associated tremor / ataxia syndrome (FXTAS).

[0111] As known by the skilled person only approximately 10% ALS cases are caused by C9ORF72- repeat expansions, and 90% of all ALS (sporadic ALS) do not have these repeat expansions. In the case of FTD, approximately 40% of cases are caused by the C9ORF72 repeat expansions.

[0112] In an alternative preferred embodiment said neurodegenerative disease is selected from the group consisting of: Dentatorubropallidoluysian Atrophy (DRPLA), Schizophrenia / migraines, Prostate / breast cancer, Huntington’s Disease (HD), Spinal and Bulbar Muscular Atrophy (SBMA), Spinocerebellar Ataxia Type 1 (SCA1), Spinocerebellar Ataxia Type 2 (SCA2), Spinocerebellar Ataxia Type 3 (SCA3) or Machado-Joseph Disease (MJD), Spinocerebellar Ataxia Type 6 (SCA6), Spinocerebellar Ataxia Type 7 (SCA7), Spinocerebellar Ataxia Type 17 (SCA17), Amyotrophic lateral sclerosis (ALS) / Frontotemporal Dementia (FTD), Baratela- Scott Syndrome, Blepharophimosis-Ptosis-Epicanthus Inversus Syndactylyl, Cerebellar Ataxia, Neuropathy, Vestibular Areflexia Syndrome (CANVAS), Cleidocranial Dysplasia, Congenital Central Hypoventilation / Haddad Syndrome, Familial adult myoclonic epilepsy (FAME1 / BAFME1), Fragile X syndrome (FRAXA / FXS), Fragile X-associated tremor / ataxia syndrome (FXTAS), Fragile X-associated Primary Ovary Insufficiency (FXPOI), Fragile XE mental retardation (FRAXE), Fragile XF syndrome (FRAXF), FRA2A-associated mental retardation, FRA7A-associated autism spectrum disorder, FRAIOA-associated mental retardation, FRA11A-associated mental retardation, FRA12A-associated mental retardation, FRA16A-associated mental retardation, Friedreich’s ataxia (FRDA), Fuchs’ Endothelial Corneal Dystrophy (FECD), Hand-Foot-Genital Syndrome, Holoprosencephaly, Huntington Disease-Like 2 (HDL2), Jacobsen Syndrome, Myoclonus Epilepsy of the Unverricht-Lundborg Type, Congenital Myotonic Dystrophy, (CDM) / Steinert’s Disease, Myotonic dystrophy (DM1), Myotonic dystrophy type 2 (DM2), Neuronal Intranuclear Inclusion Disease (NIID) & Amyotrophic lateral Sclerosis (ALS), Oculopharyngeal Muscular Dystrophy, Pseudoachondroplasia and Multiple Epiphyseal Dysplasia (PSACH / MED), Spinocerebellar Ataxia Type 8 (SCA8), Spinocerebellar ataxia Type 10 (SCA10), Spinocerebellar ataxia Type 12 (SCA12), Spinocerebellar ataxia Type 31 (SCA31), Spinocerebellar ataxia Type 36 (SCA36), Spinocerebellar ataxia Type 37 (SCA37), Synpolydactylyl Type II (SPD), X-Linked Dystonia-Parkinsonism (XPD), X-Linked Mental Retardation and Abnormal Genitalia (XLAG), X-Linked Mental Retardation (XMLR) and X-linked Mental Retardation with Growth Hormone Deficiency (XLMRGHD)

[0113] In a preferred embodiment of the invention said neurodegenerative disease is amyotrophic lateral sclerosis (ALS).

[0114] In the context of this application ALS can be caused by pathological C9ORF72-repeat expansions.

[0115] In a preferred embodiment of the invention said neurodegenerative disease is sporadic and / or familial amyotrophic lateral sclerosis.

[0116] In a preferred embodiment of the invention said neurodegenerative disease is a sporadic ALS and is not caused by pathological C9ORF72-repeat expansions In a preferred embodiment of the invention said neurodegenerative disease is Fragile X- associated tremor / ataxia syndrome (FXTAS).

[0117] In a preferred embodiment of the invention said FTD is sporadic frontotemporal dementia (FTD).

[0118] In a preferred embodiment of the invention said FTD is genetic or familial FTD.

[0119] In a preferred embodiment said FTD is caused by C9ORF72- repeat expansions.

[0120] In an alternative preferred embodiment said FTD is not caused by C9ORF72-repeat expansions.

[0121] In a preferred embodiment of the invention said neurodegenerative disease is a disease with TDP43 proteinopathy.

[0122] In a preferred embodiment of the invention said neurodegenerative disease is Alzheimer’s disease.

[0123] In a preferred embodiment of the invention said neurodegenerative disease is Parkinson’s disease.

[0124] In a preferred embodiment of the invention said composition is formulated for intrathecal or intracerebroventricular administration.

[0125] Intrathecal administration is the direct injection into the spinal canal so that it reaches the cerebrospinal fluid (CSF) and circumvents therefore the blood-brain barrier. Intracerebroventricularly administration is the direct injection into the cerebral ventricles so that it reaches the CSF.

[0126] According to a further aspect of the invention there is provided a method to treat or prevent a neurodegenerative disease comprising administering a therapeutically effective amount of an inhibitory RNA molecule according to the invention to prevent and / or treat said neurodegenerative disease.

[0127] In a preferred method of the invention said neurodegenerative disease is caused by dipeptide repeat proteins (DPR). In a preferred method of the invention said neurodegenerative disease is selected from the group consisting of: amyotrophic lateral sclerosis (ALS) sporadic amyotrophic lateral sclerosis, familial ALS caused by a mutation other than a pathological C9ORF72-r&peat expansion, frontotemporal dementia (FTD) motor neurone disease, frontotemporal lobar dementia (FTLD), Alzheimer’s Disease, Parkinson’s Disease, neurodegenerative disease with TDP43 proteinopathy Huntington's Disease, Huntington's like disorder, and Fragile X-associated tremor / ataxia syndrome (FXTAS).

[0128] In an alternative method said neurodegenerative disease is selected from the group consisting of: Dentatorubropallidoluysian Atrophy (DRPLA), Schizophrenia / migraines, Prostate / breast cancer, Huntington’s Disease (HD), Spinal and Bulbar Muscular Atrophy (SBMA), Spinocerebellar Ataxia Type 1 (SCA1), Spinocerebellar Ataxia Type 2 (SCA2), Spinocerebellar Ataxia Type 3 (SCA3) or Machado-Joseph Disease (MJD), Spinocerebellar Ataxia Type 6 (SCA6), Spinocerebellar Ataxia Type 7 (SCA7), Spinocerebellar Ataxia Type 17 (SCA17), Amyotrophic lateral sclerosis (ALS) / Frontotemporal Dementia (FTD), Baratela- Scott Syndrome, Blepharophimosis-Ptosis-Epicanthus Inversus Syndactylyl, Cerebellar Ataxia, Neuropathy, Vestibular Areflexia Syndrome (CANVAS), Cleidocranial Dysplasia, Congenital Central Hypoventilation / Haddad Syndrome, Familial adult myoclonic epilepsy (FAME1 / BAFME1), Fragile X syndrome (FRAXA / FXS), Fragile X-associated tremor / ataxia syndrome (FXTAS), Fragile X-associated Primary Ovary Insufficiency (FXPOI), Fragile XE mental retardation (FRAXE), Fragile XF syndrome (FRAXF), FRA2A-associated mental retardation, FRA7A-associated autism spectrum disorder, FRAIOA-associated mental retardation, FRA11A-associated mental retardation, FRA12A-associated mental retardation, FRA16A-associated mental retardation, Friedreich’s ataxia (FRDA), Fuchs’ Endothelial Corneal Dystrophy (FECD), Hand-Foot-Genital Syndrome, Holoprosencephaly, Huntington Disease-Like 2 (HDL2), Jacobsen Syndrome, Myoclonus Epilepsy of the Unverricht-Lundborg Type, Congenital Myotonic Dystrophy, (CDM) / Steinert’s Disease, Myotonic dystrophy (DM1), Myotonic dystrophy type 2 (DM2), Neuronal Intranuclear Inclusion Disease (NIID) & Amyotrophic lateral Sclerosis (ALS), Oculopharyngeal Muscular Dystrophy, Pseudoachondroplasia and Multiple Epiphyseal Dysplasia (PSACH / MED), Spinocerebellar Ataxia Type 8 (SCA8), Spinocerebellar ataxia Type 10 (SCA10), Spinocerebellar ataxia Type 12 (SCA12), Spinocerebellar ataxia Type 31 (SCA31), Spinocerebellar ataxia Type 36 (SCA36), Spinocerebellar ataxia Type 37 (SCA37), Synpolydactylyl Type II (SPD), X-Linked Dystonia-Parkinsonism (XPD), X-Linked Mental Retardation and Abnormal Genitalia (XLAG), X-Linked Mental Retardation (XMLR) and X-linked Mental Retardation with Growth Hormone Deficiency (XLMRGHD) In a preferred embodiment of the invention said neurodegenerative disease is amyotrophic lateral sclerosis (ALS).

[0129] In a preferred method of the invention said neurodegenerative disease is sporadic amyotrophic lateral sclerosis and familial amyotrophic lateral sclerosis.

[0130] In a preferred embodiment of the invention said sporadic ALS is ALS not caused by pathological C9ORF72-repeat expansions.

[0131] In a preferred method of the invention said FTD is sporadic frontotemporal dementia (FTD).

[0132] In a preferred embodiment of the invention said FTD is genetic or familial FTD.

[0133] In a preferred embodiment said FTD is caused by C9ORF72- repeat expansions.

[0134] In an alternative preferred embodiment said FTD is not caused by C9ORF72-repeat expansions.

[0135] In a preferred method of the invention said neurodegenerative disease is Fragile X-associated tremor / ataxia syndrome (FXTAS).

[0136] In a preferred embodiment of the invention said neurodegenerative disease is a disease with TDP43 proteinopathy.

[0137] In a preferred embodiment of the invention said neurodegenerative disease is Alzheimer’s disease.

[0138] In a preferred embodiment of the invention said neurodegenerative disease is Parkinson’s disease.

[0139] Throughout the description and claims of this specification, the words “comprise” and “contain” and variations of the words, for example “comprising” and “comprises”, means “including but not limited to” and is not intended to (and does not) exclude other moieties, additives, components, integers or steps.

[0140] Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. Where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.

[0141] Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with an aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith.

[0142] Figure 1 : SEQ ID NO 1 ; DNA sequence corresponding to the mature mRNA sequence including 5’ and 3’ untranslated regions (Homo sapiens SRSF1 transcript variant 1 with NCBI reference sequence NM_006924.5);

[0143] Figure 2: Candidate XD-74289 demonstrated superior elimination of toxic DPR proteins and the rescue of cell proliferation in human reporter cell models of C9ORF72-ALS / FTD. Doseresponse curves were generated by transfecting HEK293 cells with various concentrations of indicated SRSF1 siRNAs (A, B). Data were fit with a 4-PL regression model to determine IC50 and IC80 values. In C9ORF72-ALS / FTD HEK293T cell models expressing 43 antisense hexanucleotide repeats in a repeat-associated non-AUG (RAN) translation manner (C-F), toxic dipeptide repeat proteins (DPRs) were dose-dependent reduced by siRNAs targeting SRSF1 (C, D) and cell proliferation was also improved as SRSF1-tareting siRNA concentrations increased (E, F). The siRNAs used in these experiments include XD-74289 (SEQ ID NO 416 and SEQ ID NO 419 (Figure 2A, C, E) and XD-74204 (SEQ ID NO 418 and SEQ ID NO 407) (Figure B, D, F);

[0144] Figure 3: siRNA-mediated depletion of SRSF1 in a human reporter cell model of C9ORF72- ALS / FTD and C9ORF72-ALS / FTD mice. (A) Dose-response of a potent lead siRNA XD-74289 (SEQ ID NO 416 and 419) in transfected in HEK293 cells (IC50 = 0.03 nM). (B-D) SRSF1 protein (B), poly-GP DPRs (C) and cell proliferation were quantified in HEK cells transfected for 72h with control (Ctrl) or G2C4x43 DPRs-expressing plasmids and increasing concentrations of siRNA XD-74289 (0 - 1 pM). Bar charts represent mean (%) ± SEM; 1-way ANOVA; ** p<0.01 ,*** p<0.001 ,**** p<0.0001 ; n=3 biological replicates). (E-F) SRSF1 protein (E) and poly-GP DPRs (F) were quantified in the brains of non-transgenic (NTg) and C9ORF72-ALS / FTD (C9-Tg) mice 7 days post cisterna magna injections of siRNA XD-74289 (SEQ ID NO 416 and 419) (0 - 30 pg). Bar charts represent mean (%) ± SEM; 1-way ANOVA; * p<0.05; n = 4-6 mice); Figure 4: RNA-seq investigation. Number of differentially-expressed genes (DEGs) after transfection of HEK293 cells with various siRNAs at 10nM for 24 h. Log2FC (Fold Change) with cut-offs of 0.5 / -0.5 and 1 / -1 are shown in panels A and B, respectively. 75-90% SRSF1 mRNA depletion was achieved in these studies;

[0145] Figure 5: Biodistribution and quantification of candidate siRNAs in CNS and peripheral tissues of Sprague Dawley rats. Rats were injected with 62.5 ug each of siRNA candidates as indicated in each figure title (A-G) and their respective siRNA levels quantified by PNA-HPLC assay in each of nine tissues (as shown in the Legend in (H)). Each figure (A-G) shows the biodistribution pattern and levels of respective siRNA on a per rat basis (e.g. C0119002 in (A), etc are individual rats).

[0146] Figure 6. Pharmacodynamic effect of candidate siRNAs on SRSF1 expression. Rats were injected with 62.5 ug each of siRNA candidates as indicated on the x-axis of each figure and the relative levels of SRSF1 mRNA in each of nine tissues (as indicated in the figure title) were determined after correction for GAPDH mRNA levels. SRSF1 mRNA levels in rats treated with the control (vehicle) were normalised to 1.0 and SRSF1 mRNA in rats treated with candidate siRNAs are reported as a fraction of the untreated group. SRSF1 mRNA reduction was greatest in XD-93792 (SEQ ID 411 , 403) followed by XD-93789 (SEQ ID 408, 402) = XD- 93787 (SEQ ID 406, 402) > XD-93798 (SEQ ID 417, 405) > XD-93796 (SEQ ID 415, 405) = XD101137 (SEQ ID 425, 415) = Control. For each figure (A-l), data are presented as mean + / -SD, n=6.

[0147] Figures 7: Protective effect of siRNA candidates on C9ORF72-ALS Patient Derived Motor Neurons (iMN) compared to a Comparator (Comp) antisense oligonucleotide (ASO). iMN were incubated with 1-10 pM siRNAs (as indicated), n=2. Approximately 15,000 (A-D) or 10,000 iMNs (E-F) were assessed for Caspase3 / 7 positivity per condition. In total, 14 siRNA candidate were assessed and most caused a pronounced, and dose-dependent reduction of C9-ALS iMNs (line 78) death as measured by a reduction in Caspase levels. A Comparator ASO was included in most experiments; candidate siRNAs rescued a larger proportion of iMN than the Comparator ASO when present at equimolar concentrations (10 pM).

[0148] Figure 8. siRNA candidates protect sporadic (no known ALS genetic mutation) ALS Patient Derived Motor Neurons (iMN) from death. iMN were cultured according to the methods described elsewhere in the document. Briefly, 1-10 pM siRNAs (SEQ ID as indicated) were incubated with iMNs for 78- (A) or 96-hours (B) and were then assessed for Caspase3 / 7 positivity. Both candidates tested caused a pronounced, and dose (A and B)- and time (A vs B)-dependent reduction of sporadic ALS iMNs death as measured by a reduction in Caspase levels.

[0149] Figure 9. siRNAs screening in a 7-day in vivo C9orf72-ALS / FTD mouse study. C9orf72- ALS / FTD mice were injected via cisterna magna at P2-3 with 30 ug each of 6 siRNA candidates or a negative control that lacked vinylphosphonate (SEQ ID 415, 425). Animals were sacrificed after 7 days and SRSF1 mRNA was quantified in the brain by qRT-PCR. SRSF1 siRNA-XD-93787 (SEQ ID 406, 402), XD-93789 (SEQ ID 408, 402), XD-93792 (SEQ ID 411 , 403), XD-93796 (SEQ ID 415, 405) and XD-93798 (SEQ ID 417, 405) showed SRSF1 mRNA reductions of 20-40% in C9ORF72-ALS / FTD mice compared to untreated transgenic C9ORF72-ALS / FTD mice (UT Tg) or no vinu control siRNA (data presented as means of n=4- 5 mice per group).

[0150] An embodiment of the invention will be described by reference to the following materials, methods and tables.

[0151] Materials and Methods

[0152] SYNTHESIS METHODS

[0153] 2’-Modified Oligoribonucleotide Synthesis

[0154] Candidate SRSF1 siRNAs were synthesized according to the phosphoramidite technology on solid phase employing a Mermade 96E synthesizer (LGC Bioautomation) 96 well format. Syntheses were performed on a solid support made of controlled pore glass (CPG). The siRNAs, specifically, sense or guide strands were assembled on 2‘-OMe-A loaded CPG solid support, available from LGC Biosearch Technologies (Petaluma, CA, USA), with a porosity of 513 A (85 pmol / g loading) and at a 500 nmol synthesis scale. Both standard 2'-modified RNA phosphoramidites and C16-modified phosphoramidites [(NHC6)(Palm) or (C16-N)] were employed, with the majority of ancillary reagents were purchased from Merck (Hamburg, Germany).

[0155] Specifically, the following 2‘-O-methyl (or similar C16-modified) phosphoramidites were used: (5‘-O-dimethoxytrityl-N6-(benzoyl)-2‘-O-methyl-adenosine-3‘-O-(2-cyanoethyl-N,N- diisopropylamino) phosphoramidite, 5‘-O-dimethoxytrityl-N4-(acetyl)-2‘-O-methyl-cytidine-3‘- O-(2-cyanoethyl-N,N[1]diisopropylamino) phosphoramidite, (5‘-O-dimethoxytrityl-N2- (isobutyryl)-2‘-O-methyl-guanosine-3‘-O-(2- cyanoethyl-N,N-diisopropylamino) phosphoramidite and 5‘-O-dimethoxytrityl-2‘-O-methyl-uridine-3‘-O-(2- cyanoethyl-N,N- diisopropylamino) phosphoramidite. The 2‘-deoxy-2‘-fluoro phosphoramidites carried the same protecting groups as the 2‘-O-methyl RNA amidites. For the MOE-DNA gapmer ASOs, the following 2‘-deoxy phosphoramidites were used: (5‘-O-dimethoxytrityl-N6-(benzoyl)-2‘- deoxy-adenosine-3‘-O-(2-cyanoethyl-N,N[1]diisopropylamino) phosphoramidite, 5‘-O- dimethoxytrityl-N4-(benzoyl)-2‘-deoxy-5-methylcytidine-3‘-O-(2- cyanoethyl-N,N- diisopropylamino) phosphoramidite, (5‘-O-dimethoxytrityl-N2-(isobutyryl)-2‘-deoxy- guanosine[1]3‘-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite and 5‘-O- dimethoxytrityl-2‘-deoxy-thymidine-3‘-O- (2-cyanoethyl-N,N-diisopropylamino) phosphoramidite. The 2‘-O-methoxyethyl phosphoramidites carried the same protecting groups as the 2‘-deoxy-units. All amidites were dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3 A) were added. 5-Ethylthiotetrazole (ETT, 500 mM in acetonitrile) was used as activator solution. Coupling times were 6-10 minutes. In order to introduce phosphorothioate linkages a 100 mM solution of 3-Amino-1 ,2,4-dithiazole-5-thione (or Xanthane hydride, obtained from TCI Chemicals, Germany) dissolved in ACN-pyridine (2:3 v / v) was employed as sulfurizing agent. TCA (3% in dichloromethane) was used as deblocking or detritylating agent for the siRNAs. The other ancillary reagents used were as follows: lodine- oxidizer (50 mM I2 in Pyridine-H2O (9:1)), Cap A (acetic anhydride in THF (9.1 :90.9 v / v)) and Cap B (THF, N-methylimidazole and pyridine (8:1 :1 v / v / v)) as capping agents. Oligonucleotides were all synthesized with removal of the final DMT protecting group (“DMT- Off’). C16-modified siRNAs were synthesized on solid support using phosphoramidite chemistry, as described above, with incorporation of specialized lipid-modified building blocks. C16-modified phosphoramidites were incorporated at the indicated positions using the defined building blocks: (NHC6)(Palm), corresponding to a palmitoyl (C16) group attached via an aminohexyl linker, for conjugation at the 5’ (position 1) or 3’ (position 21) termini; and (C16- N), corresponding to a palmitoyl group attached via a direct amide linkage, for conjugation at internal positions (2-20).

[0156] Cleavage and Deprotection of Support Bound Oligomer

[0157] After finalization of the solid phase synthesis, siRNA single strands were cleaved from the solid support by addition of 400 pL AMA (1 :1 (v / v) mixture of concentrated aqueous ammonia and 40% aqueous methylamine, both available from Sigma Aldrich) and collected in a 2 mL 96 well plate. To achieve quantitative removal of all the protecting groups the solutions were incubated with shaking at 33 °C for 3 hours. Samples were thereafter dried under reduced pressure and reconstituted in 250 mM tris(hydroxymethyl)aminomethane (TRIS) pH 7 to yield crude sample solutions for subsequent purification.

[0158] Purification of Oligoribonucleotides Crude preparations of the siRNA single strands were thereafter purified by Anion Exchange Chromatography using a Dionex DNA Pad 00 (9 x 250 mm)-column (ThermoFisher, Dreieich, Germany) on an AKTA Purifier system (GE Healthcare, Freiburg, Germany). Buffer A was 20 mM TRIS pH 7.4 and contained 20% acetonitrile and buffer B contained 500 mM sodium perchlorate in buffer A. Buffer A was 10 mM NaOH in H2O with 20% ACN, pH 12 and buffer B contained 500 mM sodium perchlorate in buffer A. Pooled fractions were precipitated overnight in the freezer using 3M NaOAc, pH=5.2 and a mixture of ethanol and isopropanol. Subsequently, the materials were assessed with respect to fulfillment of MS-identity (+ / -0.05% of calculated mass (by ESI-MS)) and purity (single strand purity > 85%, as per integration of the UV signal of the analytical AEX or IP-RP-HPLC trace).

[0159] Annealing of Purified Sense and Antisense Strands to Generate siRNA

[0160] Complementary strands were mixed in an equimolar ratio to yield the requisite amount of the siRNA duplexes. The mixtures were dried in a SpeedVac concentrator. Subsequently, 240 pL annealing buffer (200 mM NaH2PO4'H2O + Na2HPO4 buffer, pH 6.8, 1 M NaCI, diluted 5 times) were added to achieve a final duplex concentration of 50 pM. The duplex solutions were placed into a water bath at 70 °C, which was cooled to room temperature within 3 h. The resultant siRNA-duplexes were characterized by non-denaturing size-exclusion chromatography (SEC) HPLC towards fulfillment of duplex purity > 90%, as per integration of the UV signal of native HPLC trace at 260 nm.

[0161] Final Sample Solution Preparation

[0162] Finally, for the 96 siRNAs, 200 pL and 50 pM of annealed duplexes in annealing buffer were therefore submitted for the further in vitro experiments.

[0163] Cell culture and SRSF1 depletion using siRNAs siRNA screening studies: HEK293 cells were obtained from ATCC (ATCC in partnership with LGC Standards, Wesel, Germany, cat.# CRL-1573) and cultured in EMEM medium (#ATCC #30-2003), supplemented to contain 10% fetal calf serum, and 100 U / ml Penicillin / 100 pg / ml Streptomycin at 37 °C in an atmosphere with 5% CO2 in a humidified incubator. For transfection of HEK293 cells with siRNAs, cells were seeded at a density of 15,000 (for doseresponse) or 30,000 (for dual-dose) cells / well into 96-well tissue culture plates. Transfection of siRNAs was carried out with Lipofectamine 2000 (Life Technologies / Thermo) according to manufacturer’s instructions for reverse transfection, using 0.5 pl transfection reagent per well. Screens were performed with siRNAs in quadruplicates at concentrations indicated in Figure legends, including siRNAs targeting Ahsal , Firefly-Luciferase and FVII as controls and a mock transfection. After 24h of incubation with siRNAs, medium was removed and cells were lysed in 150 l Medium-Lysis Mixture (1 volume lysis buffer, 2 volumes cell culture medium) and then incubated at 53 °C for 30 minutes. In cases where siRNAs were delivered to cells by direct uptake, siRNAs were incubated with cells for 48 hours before being lysed / processed and analysed for SRSF1 reduction by the bDNA assay.

[0164] C9ORF72-ALS / FTD HEK cell model: HEK293T cells (ATCC CRL-3216) were maintained in a 37°C incubator with 5% CO2. HEK293T cells were cultured in Dulbecco’s Modified Eagle Medium (Lonza) supplemented with 10% fetal bovine serum (FBS) (Biosera) and 5 U / ml Penstrep (Lonza). For experiments, cells were plated on either 24-well plates (50,000 cells I well for western blot analysis or 25,000 cells / well for MTT analysis). To express C9ORF72 hexanucleotide repeats transcripts and associated dipeptide repeat proteins, cells were transfected with 700 ng plasmid(s) / well of 24-well plates using 3.5 pg PEI / ml media and one tenth medium volume OptiMEM for 72 h. Plasmids used in these studies that contain C9ORF72 hexanucleotide repeats are detailed in Castelli et al. Sci Transl Med 2023; 15: eabo3823. Certain C9ORF72-ALS / FTD HEK cell model experiments involved co-transfection of siRNA candidates as described above.

[0165] Primary C9ORF72-ALS / FTD mouse cortical neurons’. Cerebral cortices were isolated from embryonic day 14 (E14) embryos whilst submersed in cold HBSS- / -. Meninges were removed manually using dissecting forceps and tissue was washed once in 10 ml HBSS- / - prior to resuspension in 5 ml HBSS. Trypsin was added to a final concentration of 0.05% and incubated for 15 minutes at 37°C to allow tissue dissociation. 5 ml DNAse solution (0.001% DNAse I in HBSS magnesium / calcium) was added for 2 minutes and supernatant aspirated. Tissue was resuspended in 1 ml triturating solution (1% albumax, 0.05% trypsin inhibitor, 0.001% DNAse I) and triturated through flame-polished glass Pasteur pipettes with progressively smaller openings to obtain a single cell suspension. Cells were counted and plated on poly-D-lysine coated 12-well plates at a density of 4.5 million / plate in supplemented neurobasal media (1x B27 supplement stock, Ix GlutaMax, 50 U / mL penicillin-streptomycin) and maintained at 37°C and 5% CO2. At 4 days in vitro (4 DIV), a half media change was conducted and siRNA added directly to the well to a final concentration of 10 pM. Neurons of each well were lysed in a total of 130uL 1X reporter lysis buffer 7 days post addition of siRNAs to the medium (11 DIV) prior to quantification of poly-GP DPR expression levels by in-house developed Mesoscale Discovery (MSD) ELISA (Castelli et al. Science Translational Medicine 2023; 15: eabo3823).

[0166] Differentiation of patient-derived motor neurons Differentiation of iMotor Neurons (iMNs). Human patient (C9ORF72 and sporadic / no known ALS mutations) and healthy control-derived motor neurons (iMN) were differentiated from induced neural progenitor cells (iNPCs) using a modified version of the protocol described in Castelli et al. Science Translational Medicine 2023; 15: eabo3823. 50,000 iNPCs per well were plated in a 6-well plate coated with fibronectin (5 pg / ml, Millipore) in NPC medium (DMEM / F-12 Glutamax, 1x N2 stock, 0.5x B27 stock, Gibco). The differentiation was initiated when cells reach 70% confluence around 2-3 days. The NPC medium was changed to neuron differentiation medium (DMEM / F-12 Glutamax, 1x N2 stock, 1x B27 stock, Gibco) supplemented with 2.5 pM of DAPT (Tocris) for 2 days to determine differentiation towards neuronal lineage. On day 3 post DAPT treatment, the neuron differentiation medium is supplemented with 1 pM retinoic acid (Sigma), 1 pM Smoothened Agonist (SAG) (Millipore) and 2.5 pM Forskolin (Sigma) for another 7 days. On Day 10 post DAPT treatment cells were replated on a 96-well plate (10,000 cells / well). Next day, medium was changed to motor neuron medium, which consisted of neuron differentiation medium supplemented with each 10 ng / ml of BDNF, GDNF and CNTF (PepronTech), and was changed every 2 days. On Day 21 , cells were treated with 1 , 3 and 10 pM SRSF1-siRNAs or a comparator ASO (MedChem Express: HY-132581A) and monitored every 6 hours using high-content automated live-cell imaging on the Incucyte® S3 platform. Cell death / apoptosis was quantified by adding Caspase 3 / 7 Red dye (Sartorius) on Day 24 and monitored by live imaging for another 2 days. Cells were fixed on Day 26. The total cell number and caspase positive cells were quantified using “Adherent Cell-by-Cell Classification” analysis method embedded in the Incucyte® S3 live-cell imaging and analysis system.

[0167] Mice

[0168] BAC transgenic C9ORF72-ALS / FTD mice expressing approximately 500 G4C2 repeats from a human C9O F72-linked ALS gene (FVB / NJ-Tg(C9orf72)500Lpwr / J) were created by Prof Laura Ranum’s group (Liu et al. Neuron 2016; 90:521-34) and obtained from the Jackson Laboratory (Stock No: 029099, also known as C9-500). Mice were housed in groups of 2 to 5 with access to food and water ad libitum (Envigo, standard rodent diet 2018). The temperature was maintained at 21 °C with a 12-hour light / dark cycle. A plastic house was provided in each cage with sawdust (Datesand) to cover the floor of the cages and nesting material provided (Datesand paper wool). 5 pl siRNA dissolved in PBS Calcium / Magnesium (up to 30 pg per dose) were injected via cisterna magna in P1-3 pups under anaesthesia. Animals were sacrificed 7 days post-injection. mRNA quantification mRNA quantification was performed using the branched DNA assay (Quantigene Singleplex, Thermo) according to manufacturer’s instructions with a probeset directed to human SRSF1 (custom designed by Thermo). Luminescence was read using 1420 Luminescence Counter (WALLAC VICTOR Light, Perkin Elmer, Rodgau-Jugesheim, Germany) following 30 minutes incubation at RT in the dark. For each well, the target mRNA level was normalized to the respective GapDH mRNA level. The Ahsal siRNA served as an unspecific control for UHRF1 target mRNA expression and as positive control for transfection efficiency with regard to Ahsal mRNA level. By hybridization with an Ahsal probeset, mock-transfection served as controls for Ahsal mRNA level, and transfection efficiency for each 96-well plate was calculated by relating the Ahsal -level in cells treated with Ahsal siRNA (normalized to GapDH) to Ahsal levels in mock-treated cells. The activity of a given siRNA was expressed as percent of mRNA concentration of the respective target (normalized to GapDH mRNA) in treated cells, relative to the target mRNA concentration (normalized to GapDH mRNA) averaged across control wells.

[0169] Next generation RNA sequencing (RNA-seq) and bioinformatic analysis

[0170] HEK cells were maintained and transfected with 10 nM siRNAs according to the methods described above in siRNA screening studies. RNA was isolated and mRNA purified used standard methods. Total RNA samples with RNA integrity numbers (RIN) comprised between 9.2 and 9.9 were submitted for RNA-seq analysis. RNA-seq libraries were prepared and subjected to single-end illumina TruSeq stranded mRNA sequencing. RNA-seq reads were quality-checked, processed and aligned to the Human Genome GRCh38 using standard methods and software including FastQC vO.11.9, STAR v2.7.3a to identify differentially- expressed genes (DEGs) after HEK cell treatment with siRNAs. For each siRNA, read counts were extracted and compared against the mock treatment. P-values were determined for each gene and statistical significance determined after adjusting for multiple comparisons. Log2 fold change (Log2FC; the ratio of Iog2 -transformed read counts between treatment and control) plots were generated for each candidate after normalising to the mock.

[0171] Table 1 : Dual-dose screen of SRSF1 siRNAs (n=4) as displayed in Table 3 showing percent reduction in SRSF1 mRNA levels.

[0172] Table 2: Unmodified siRNA sequence Table 3: siRNA nucleic acid sequences (modified) where ‘n’ is 2'0-methyl ribonucleotide, ‘Nf’ is 2'-fluoro ribonucleotide and ‘s’ is a phosphorothioate. ‘N’ or ‘n’ are meant to represent any of the RNA bases: a, u, g or c.

[0173] Table 4: IC50, IC80 and maximum inhibition values interpolated from dose-response curve data using sequences as described in Table 3.

[0174]

[0175] Table 5: Dose-response analysis for SRSF1 siRNAs - lipid conjugates - direct uptake.

[0176] Candidates 621 and 2654 were modified with C16 at different positions at P6, P4, P16, P1 or

[0177] P21. C16 at P1 shows best uptake on HEKs; C16 at P21 also among best identified.

[0178]

[0179] Table 6 shows the dose-response analysis (IC50 values) for SRSF1 siRNA-conjugates in HEK293 cells. 12 candidates were tested. None of these candidates showed in vitro toxicity in an MTT assay.

[0180] Table 7: siRNA nucleic acid sequences (modified) where ‘n’ is 2'0-methyl ribonucleotide, ‘Nf’ is 2'-fluoro ribonucleotide, (C16-N) is 2’-O-C16-ribonucleotide, (Palm-C6) / / (NHC6)(Palm) is Palmitate-C6 and ‘s’ is a phosphorothioate and (vinu) is vinylphosphate 2-

[0181] O-methyl II. ‘N’ or ‘n’ are meant to represent any of the ribonucleotide bases: a, u, g or c. Table 8: XD identification Table and corresponding sequence ID numbers

[0182] Table 9. The objective of the study is to assess biodistribution and target engagement to select the best candidate siRNA molecules in the Sprague Dawley rat after a single intrathecal administration in the lumbar area.

[0183] Administration of Vehicle Control and Candidate SRSF1 siRNA to Sprague Dawley rats

[0184] Route: Intrathecal route Dose: selected based on previous studies and the presumed effective pharmacological dose. Frequency: Each test item will be administered as a single bolus.

[0185] Method: Laminectomy at the level of the fifth lumbar vertebra under anesthesia.

[0186] Volume: A fixed volume of 30 pL / animal will be administered intrathecally.

[0187] Duration of treatment: 4 weeks Treatment: On the day of allocation, all animals will be weighed and randomised in groups using Pristima version 7.5.1.

[0188] Table 10: Biodistribution and pharmacodynamic study design for rat study assessing SRSF1 siRNA candidates. terms of tot item as supplied

[0189] Table 11 : DPR Reduction in C9PRF72-ALS Mouse Cortical Neuron. Percent (%) DPR reduction’ is defined as % reduction of DPR (polyGP) after incubation of mouse cortical neurons with 10uM siRNA candidate compared to buffer control. Results from a single representative experiment are shown; results are consistent across n = 3 independent cortical neuron preps / experiments. XD-93798 (2654, P21) 47.0

[0190] Biodistribution / bioexpression in relevant organs of SRSF1 siRNA candidates

[0191] A piece of organs from brain regions from the right hemisphere (brainstem / cerebellum / frontal cortex / temporal cortex) I spinal cord regions (cervical / thoracic / lumbar) I kidneys cortex I liver will be collected and transferred into a 1.5 mL Protein LoBind® tube. Piece of these organs will be weighed (intended weight will be at least 15 mg if possible,), then stored frozen at < - 65°C siRNA levels measured using a PNA-HPLC Assay

[0192] The rat tissue samples are analyzed using a Peptide Nucleic Acid Anion-Exchange High- Performance Liquid Chromatography (PNA-AEX-HPLC) assay. The assay is based on the hybridization of a fluorescently labeled PNA probe with the antisense strand of the siRNA molecule. The duplex between the PNA probe and the antisense strand of the siRNA molecule is analyzed by AEX-HPLC coupled to a fluorescence detector.

[0193] SRSF1 mRNA expression analysis using a branched DNA assay

[0194] Relative SRSF1 mRNA levels in rat tissue lysates will be quantified using the QuantiGene Singleplex branched DNA (bDNA) assay (Thermo Fisher Scientific) and normalized to the mRNA expression levels of the housekeeping gene GAP-DH. All analyses are carried out as singlets.

[0195] Examples

[0196] Example 1

[0197] High (20nM) and low (0.3nM) concentrations of each siRNA candidate were transfected into HEK 293 cells and the impact on SRSF1 mRNA levels was quantified using the bDNA assay. Table 1 shows the relative reduction of SRSF1 mRNA levels as a percentage (%) of the negative control (set at 100%).

[0198] Example 2

[0199] Dose-response curves were generated by transfecting HEK293 cells with various concentrations (30nM - 1.52pM) of indicated SRSF1 siRNAs. The percent inhibition for each condition was calculated as describing in the methods. The data was fit to a 4-parameter logistic regression curve and IC50, IC80 and maximum inhibition levels (relative to negative control) were interpolated from the curves; these data are presented in Table 4. Example 3

[0200] Dose-response curves were generated by transfecting HEK293 cells with various concentrations (30nM - 1.52pM) of indicated SRSF1 siRNAs. The percent inhibition for each condition was calculated as describing in the methods. The data was fit to a 4-parameter logistic regression curve and IC50, IC80 and maximum inhibition levels (relative to negative control) were interpolated from the curves; these data are presented in Table 5.

[0201] Example 4

[0202] Dose-response curves were generated by incubating various concentrations (20uM - 2nM) of indicated SRSF1 siRNAs with HEK293 cells for a period of 48 hours. The impact on SRSF1 mRNA levels was quantified using the bDNA assay. The percent inhibition for each condition was calculated as describing in the methods. The data was fit to a 4-parameter logistic regression curve and IC50, IC80 and maximum inhibition levels (relative to negative control) were interpolated from the curves; these data are presented in Table 5.

[0203] Example 5

[0204] Dose-response curves were generated by incubating various concentrations (20uM - 2nM) of indicated SRSF1 siRNAs with HEK293 cells for a period of 48 hours. The impact on SRSF1 mRNA levels was quantified using the bDNA assay. The percent inhibition for each condition was calculated as describing in the methods. The data was fit to a 4-parameter logistic regression curve and IC50, IC80 and maximum inhibition levels (relative to negative control) were interpolated from the curves; these data are presented in Table 6.

[0205] Example 6

[0206] Figure 4 shows the number of differentially-expressed genes (DEGs) after treatment with various siRNAs. As shown, 75-90% SRSF1 mRNA depletion was achieved in these studies;

[0207] Example 7

[0208] Wild type Sprague Dawley rats were anesthetised, subjected to laminectomy at the level of the fifth lumbar and implanted with a short catheter extending to the thoracic spinal cord area. Each rat received one of six siRNA candidates via the catheter before its removal and postoperative care. Rats were monitored for one-month before being sacrificed and tissue harvested for determination of siRNA levels and biodistribution pattern (by PNA-HPLC assay; Figure 5) and SRSF1 knockdown (by branched DNA assay; Figure 6). The amount of each siRNA detected varied across candidates, but in general, the biodistribution pattern was similar in most rats regardless of group (candidate). siRNA levels were typically higher in the lumbar and thoracic spinal cord area and decreased as the distance from the injection site increased (i.e. typically lowest in the frontal cortex among CNS tissues). siRNA levels where measured in the kidney and liver to assess siRNA targeting to peripheral organs; no detectable siRNA in the liver and limited or no siRNA was present in the kidneys suggesting that biodistribution was limited to the CNS at the dose tested. The highest levels of siRNA candidates were detected in the group administered XD-93789 (SEQ ID 408, 402), followed by XD-93792 (SEQ ID 411 , 403) > XD-93798 (SEQ ID 417, 405) > XD-93787 (SEQ ID 406, 402) « XD-93796 (SEQ ID 415, 405) > XD-101137 (SEQ ID 415, 425) = Control (vehicle). Head-to-head comparison of sequence identical candidates with different conjugation patterns (i.e. XD-93787 vs XD-93789 and XD-93796 vs XD-93798) showed that the conjugate at position 21 (P21) always yielded a superior biodistribution profile. Results are plotted on an individual rat basis.

[0209] Pharmacokinetic effects on SRSF1 gene expression at the mRNA level were determined for each of six candidates (Figure 6): XD-93792 > XD-93789 = XD-93787 > XD-93798 > XD- 93796 = XD101137 = Control. Consistent with the biodistribution results, candidates XD- 93789 and XD-93792 were the most potent in reducing SRSF1 mRNA levels and as with siRNA drug levels the greatest reduction in SRSF1 occurred near the injection site in the lumbar and thoracic spinal cord region. Also consistent with the biodistribution results: no reduction of SRSF1 mRNA was observed in the kidney or liver. Results in Figure 6 are plotted as mean ± SD, n=6.

[0210] Example 8

[0211] Cortical neurons were harvested from C9ORF72-ALS embryos, plated and cultured as described elsewhere. Various siRNA candidates at 0 or 10 pM were added to the conditioned media of cortical neurons and their ability to reduced DPR levels examined by MSD ELISA. As shown in Table 11 , The 621 (XD-93787, XD-93788, XD-93789) and 2654 (XD-93796, XD- 93797, XD-93798) series of candidates showed the greatest reduction in DPRs (10 pM vs 0 pM control), followed by the 843 (XD-93790, XD-93791 , XD-93792 series of candidates. The 1599 (XD-93793, XD-93794, XD-93795) series of candidates had an apparently high efficacy in reducing DPRs levels, however, this was likely due to toxicity and cell death (i.e. morphological changes and increased protein levels - not shown) causing DPRs to be lost. This result is consistent with the higher off-target (RNAseq) results observed in Figure 4.

[0212] Example 9 14 siRNA candidates (as indicated by SEQ ID in Figure 7) were evaluated in C9orf72-ALS patient-derived motor neurons (iMN) experiments for their ability to protect the neurons against death (as measured by Caspase3 / 7 positivity). The neuroprotective potential of SRSF1- siRNAs was investigated in dose-response studies at 1 , 3 and 10 pM. In the first series of experiments (Figure 7A-D), a Comparator ASO was included at a concentration of 10 pM. SRSF1 siRNA XD-93787 (SEQ ID 406, 402) and siRNA XD-93798 (SEQ ID 417, 405) reduce C9-ALS iMNs death in a dose-dependent manner. The iMN survival is not significantly improved while treated with the comparator ASO at the same concentration (10 pM). In the second series of experiments (Figure 7E-F), SRSF1 siRNAs XD-93790 (SEQ ID 409, 403), XD-93791 (SEQ ID 410, 403), XD-93792 (SEQ ID 411 , 403) reduced iMNs death at a lower dose compared to SRSF1 siRNAs XD-93793 (SEQ ID 412, 404), XD-93794 (SEQ ID 413, 404), XD-93795 (SEQ ID 414, 404) with XD-93792 (SEQ ID 411 , 403) promoting the highest MNs survival in this series.

[0213] Example 10

[0214] Select siRNA candidates (as indicated by SEQ ID in Figure 8) were evaluated in sporadic (with no known genetic mutation) ALS patient-derived motor neurons (iMN) experiments for their ability to protect the neurons against death (as measured by Caspase3 / 7 positivity). The neuroprotective potential of SRSF1-siRNAs was investigated in dose-response studies at 1 , 3 and 10 pM. Both candidates tested dose-dependently protected sporadic-ALS iMN against death in a time dependent manner. Comparison of Figures 8A (78h incubation with siRNAs) vs 8B (96h incubation with siRNAs) shows that longer exposure to SRSF1 siRNA candidates results in a greater protective effect than shorter exposure times.

[0215] Example 11

[0216] In vivo screening of siRNA candidates (as indicated by SED ID NO in Figure 9) in C9orf72- ALS / FTD mice demonstrated that candidate siRNAs effectively reduced SRSF1 mRNA expression levels by 20 - 40% in the brains of C9ORF72-ALS mice compared to untreated transgenic C9ORF72-ALS / FTD mice or transgenic animal injected with no vinylphosphonate control siRNA (SEQ ID 415, 425).

Claims

Claims1. A double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand and an antisense strand wherein said antisense strand has a nucleotide sequence which is at least partially complementary to a nucleotide sequence with SEQ ID NO:1 (SRSF1), or polymorphic sequence variant thereof, wherein said double stranded inhibitory RNA is between 15 and 30 nucleotides in length and silences expression of SRSF1 and further wherein said double stranded inhibitory RNA is covalent linked to a lipophilic targeting moiety.

2. The double stranded inhibitory RNA according to claim 1 wherein said lipophilic moiety is selected from a saturated or unsaturated C4-C30 hydrocarbon chain.

3. The double stranded inhibitory RNA according to claim 2 wherein said lipophilic moiety is a C4 -C30 alkyl or alkenyl.

4. The double stranded inhibitory RNA according to any one of claims 1 to 3 wherein said lipophilic group contains a saturated or unsaturated C16 hydrocarbon chain such as for example a linear C alkyl or C alkenyl.

5. The double stranded inhibitory RNA according to claim 4 wherein said lipophilic targeting moiety is 2'-O-hexadecyl.

6. The double stranded inhibitory RNA molecule according to any one of claims 1 to 5 wherein said antisense strand has a nucleotide sequence which is at least partially complementary to the nucleotide sequence in SEQ ID NO 1.

7. The double stranded inhibitory RNA molecule according to any one of claims 1 to 6 wherein said antisense strand has a nucleotide sequence which is at least partially complementary to the nucleotide sequence in the 3’ untranslated region.

8. The double stranded inhibitory RNA molecule according to claim 7 wherein said 3’ untranslated region comprises or consist of nucleic acid 857 to 5341 of SEQ ID NO 1.

9. The double stranded inhibitory RNA molecule according to any one of claims 1 to 8 wherein said double stranded inhibitory RNA molecule comprises between 21 to 23 contiguous nucleotides in length.

10. The double stranded inhibitory RNA molecule according to any one of claims 1 to 9 wherein said double stranded inhibitory RNA molecule comprises or consist of an antisense nucleotide sequence selected from the group consisting of SEQ ID NO 99, 125, 101 , 113, 118, 100, 106, 103, 107, 137, 114, 110, 102, 116, 105, 108, 127, 104, 112, 111 , 109, 115, 117, 119, 120, 121 , 122, 123, 124, 126, 128, 129, 130, 131 , 132, 133, 134, 135, 136, 138, 139, 140, 141 ,142, 143, 144, 145,146, 147, 148, 149, 150,151 , 152, 153, 154, 155, 156, 157, 158, 159, 160, 161 , 162, 163, 164, 165, 166, 167, 168, 169, 170, 171 , 172, 173, 174, 175, 176, 177,178, 179, 180, 181 ,182, 183,184, 185, 186,187, 188, 189, 190,191 , 192, 193 and 194.

11. The double stranded inhibitory RNA molecule according to any one of claims 1 to 10 wherein said double stranded inhibitory RNA molecule comprises or consist of a sense nucleotide sequence selected from the group consisting of SEQ ID NO 3, 29, 5, 17, 22, 4, 10, 7, 11 , 41 , 18, 14, 6, 20, 9, 12, 31 , 8, 16, 15, 13, 19, 21 , 23, 24, 25, 26, 27, 28, 30, 32, 33, 34, 35, 36, 37, 38, 39, 40, 42, 43, 44, 45,46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77,78, 79, 80, 81 ,82, 83,84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97 and 98.

12. The double stranded inhibitory RNA molecule according to any one of claims 1 to 11 wherein said sense strand or antisense strand comprises a nucleotide sequence comprising one or more modified nucleotides.

13. The double stranded inhibitory RNA molecule according to claim 12 wherein said sense strand or antisense strand comprises a nucleotide sequence comprising at least one modified nucleotide wherein said modification is 2'-deoxy-2'-fluoro.

14. The double stranded inhibitory RNA molecule according to claims 12 or 13 wherein said sense strand or antisense strand comprises a nucleotide sequence comprising at least one modified nucleotide wherein said modification is 2'-O-methyl.

15. The double stranded inhibitory RNA molecule according to any one of claims 1 to 14 wherein said sense and / or said antisense strands comprises internucleotide phosphorothioate linkages.

16. The double stranded inhibitory RNA molecule according to any one of claims 1 to 15 wherein said nucleic acid molecule comprises a vinylphosphonate modification to the 5’ end phosphate of said antisense RNA strand.

17. The double stranded inhibitory RNA molecule according to any one of claims 1 to 16 wherein said sense strand or antisense strand comprises a nucleotide sequence comprising at least one modified sugar.

18. The double stranded inhibitory RNA molecule according to any one of claims 1 to 17 wherein said double stranded inhibitory RNA molecule comprises or consist of an antisense nucleotide sequence selected from the group consisting of SEQ ID NO 291 , 317, 293, 305, 310, 292, 298, 295, 299, 329, 306, 302, 294, 308, 297, 300, 319, 296, 304, 303, 301 , 307, 309, 311 , 312, 313, 314, 315, 316, 318, 320, 321 , 322, 323, 324, 325, 326, 327, 328, 330,331 , 332, 333, 334, 335, 336, 337, 339, 338, 340, 341 , 342, 343, 344, 345, 346, 347, 348,349, 350, 351 , 352, 353, 354, 355, 356, 357, 358, 359, 360, 361 , 362, 363, 364, 365, 366,367, 368, 369, 370, 371 , 372, 373, 374, 375, 276, 377, 378, 379, 380, 382, 382, 383, 384,385 and 2.

19. The double stranded inhibitory RNA molecule according to any one of claims 1 to 18 wherein said double stranded inhibitory RNA molecule comprises or consist of a sense nucleotide sequence selected from the group consisting of SEQ ID NO 195, 221 , 197, 209, 214, 196, 202, 199, 203, 233, 210, 206, 198, 212, 201 , 204, 223, 200, 208, 207, 205, 211 , 213, 215, 216, 217, 218, 219, 220, 222, 224, 225, 226, 227, 228, 229, 230, 231 232, 234, 235, 236, 237, 238, 239, 240, 241 , 242, 243, 244, 245, 246, 247,248, 249, 250, 251 , 252, 253, 254, 255, 256, 257, 258, 259, 260, 261 , 262,263, 264, 265, 266, 267, 268, 269, 270, 271 , 272, 273, 274, 275, 276, 277, 278, 279, 280, 281 , 282, 283, 284, 285,286, 287, 288, 289 and 290.

20. The double stranded inhibitory RNA molecule according to any one of claims 1 to 17 wherein said double stranded inhibitory RNA molecule comprises or consist of a sense nucleotide sequence selected from the group consisting of: CAGUUCGAAAACUGGAUAACA (SEQ ID NO 394), AAACUGGAUAACACUAAGUUA (SEQ ID NO 395), GCUCUCGUACAUAAGAUGAUA (SEQ ID NO 396), CGUACAUAAGAUGAUUGGUGA (SEQ ID NO 397), AUUGGUGACACUUUUUGUAGA (SEQ ID NO 398), ACCCAUGUUGUAUACAGUUUA (SEQ ID NO 399),AUUUGUCACAGUGCUUAGUUA (SEQ ID NO 400) and AAAUCAGUAAGUCACUUCUAA (SEQ ID NO 401).

21. The double stranded inhibitory RNA molecule according to any one of claims 1 to 17 and 20 wherein said double stranded inhibitory RNA molecule comprises or consist of an antisense nucleotide sequence selected from the group consisting of: UGUUAUCCAGUUUUCGAACUGCA (SEQ ID NO 386), UAACUUAGUGUUAUCCAGUUUUC (SEQ ID NO 387), UAUCAUCUUAUGUACGAGAGCGA (SEQ ID NO 388), UCACCAAUCAUCUUAUGUACGAG (SEQ ID NO 389), UCUACAAAAAGUGUCACCAAUCA (SEQ ID NO 390), UAAACUGUAUACAACAUGGGUUC (SEQ ID NO 391), UAACUAAGCACUGUGACAAAUUA (SEQ ID NO 392) and UUAGAAGUGACUUACUGAUUUAC (SEQ ID NO 393).

22. The double stranded inhibitory RNA molecule according to any one of claims 1 to 17 wherein said double stranded inhibitory RNA molecule comprises or consist of a sense nucleotide sequence selected from the group consisting of: csasguucGfaAfAfAfcuggauaascsa (SEQ ID NO 195), asasacugGfallfAfAfcacuaagususa (SEQ ID NO 199), gscsucucGfuAfCfAfuaagaugasusa (SEQ ID NO 202), csgsuacallfaAfGfAfugauuggusgsa (SEQ ID NO 196), asusugguGfaCfAfCfuuuuuguasgsa (SEQ ID NO 197), ascsccauGfullfGfllfauacaguususa (SEQ ID NO 209), asusuuguCfaCfAfGfugcuuagususa (SEQ ID NO 214) and asasaucaGfuAfAfGfucacuucusasa (SEQ ID NO 221), wherein n is 2'-O-methyl ribonucleotide, Nf is 2'-fluoro ribonucleotide and s is phosphorothioate.

23. The double stranded inhibitory RNA molecule according to any one of claims 1 to 17 and 22 wherein said double stranded inhibitory RNA molecule comprises or consist of an antisense nucleotide sequence selected from the group consisting of: usGfsuuaUfcCfAfguuullfcGfaacugscsa (SEQ ID NO 291), usAfsacuUfaGfUfguuallfcCfaguuususc (SEQ ID NO 295), usAfsucallfcUfllfauguAfcGfagagcsgsa (SEQ ID NO 298), usCfsaccAfallfCfaucullfallfguacgsasg (SEQ ID NO 292), usCfsuacAfaAfAfagugllfcAfccaauscsa (SEQ ID NO 293),usAfsaacUfgUfAfuacaAfcAfugggususc (SEQ ID NO 305), usAfsacuAfaGfCfacugllfgAfcaaaususa (SEQ ID NO 310) and usUfsagaAfgUfGfacuuAfclIfgauuusasc (SEQ ID NO 317), wherein n is 2'-O-methyl ribonucleotide, Nf is 2'-fluoro ribonucleotide and s is phosphorothioate.

24. The double stranded inhibitory RNA molecule according to any one of claims 1-17 wherein said double stranded inhibitory RNA molecule comprises or consist of a sense nucleotide sequence selected from the group consisting of(Palm-C6)csasguucGfaAfAfAfcuggauaascsa (SEQ ID NO 406) csasguu(C16-C)GfaAfAfAfcuggauaascsa (SEQ ID NO 407) csasguucGfaAfAfAfcuggauaascsa(NHC6)(Palm) (SEQ ID NO 408) (Palm-C6)gscsucucGfuAfCfAfuaagaugasusa (SEQ ID NO 409) gscsucu(C16-C)GfuAfCfAfuaagaugasusa (SEQ ID NO 410) gscsucucGfuAfCfAfuaagaugasusa(NHC6)(Palm) (SEQ ID NO 411) (Palm-C6)asusuuguCfaCfAfGfugcuuagususa (SEQ ID NO 412) asusuug(C16-U)CfaCfAfGfugcuuagususa (SEQ ID NO 413) asusuuguCfaCfAfGfugcuuagususa(NHC6)(Palm) (SEQ ID NO 414) (Palm-C6)asasaucaGfuAfAfGfucacuucusasa (SEQ ID NO 415) asasauc(C16-A)GfuAfAfGfucacuucusasa (SEQ ID NO 416) asasaucaGfuAfAfGfucacuucusasa(NHC6)(Palm) (SEQ ID NO 417), wherein n is 2'-O-methyl ribonucleotide, Nf is 2'-fluoro ribonucleotide, (C16-N) is 2'-O-C16- ribonucleotide, s is phosphorothioate and (Palm-C6) / / (NHC6) (Palm) is Palmitate-C6.

25. The double stranded inhibitory RNA molecule according to any one of claims 1-17 and 24 wherein said double stranded inhibitory RNA molecule comprises or consist of an antisense nucleotide sequence selected from the group consisting of: (vinu)sGfsuuauccaguuullfcGfaacugscsa (SEQ ID NO 402), (vinu)sAfsucaucuuauguAfcGfagagcsgsa (SEQ ID NO 403), (vinu)sAfsacuaagcacugllfgAfcaaaususa (SEQ ID NO 404), and (vinu)sUfsagaagugacuuAfcllfgauuusasc (SEQ ID NO 405), wherein n is 2'-O-methyl ribonucleotide, Nf is 2'-fluoro ribonucleotide, (vinu) is 5'- vinylphosphonate-2'-OMe-U, s is phosphorothioate.

26. The double stranded inhibitory RNA molecule according to any one of claims 1-17 wherein said double stranded inhibitory RNA molecule comprises or consist of a sense nucleotide sequence selected from the group consisting of: 5'-csasguu(C16-C)GfaAfAfAfcuggauaascsa-3' (SEQ ID NO 407) and 5'-asasauc(C16-A)GfuAfAfGfucacuucusasa-3' (SEQ ID NO 416) wherein n is 2’-O-methyl ribonucleotide, Nf is 2'-Fluoro ribonucleotide, s is phosphorothioate, (C16-N) is 2 -O-C16 ribonucleotide wherein N is selected from A, G, II and T.

27. The double stranded inhibitory RNA molecule according to any one of claims 1-17 and 26 wherein said double stranded inhibitory RNA molecule comprises or consist of an antisense nucleotide sequence selected from the group consisting of 5'-(vinu)sGfsuuaUfcCfAfguuullfcGfaacugscsa-3' (SEQ ID NO 418) and 5'-(vinu)sUfsagaAfgUfGfacuuAfcllfgauuusasc-3'(SEQ ID NO 419) wherein n is 2’-O-methyl ribonucleotide, Nf is 2'-Fluoro ribonucleotide, s is phosphorothioate, and (vinu) is vinylphosphonate 2'-O-Methyl II.

28. The double stranded inhibitory RNA molecule according to any one of claims 1-17 wherein said double stranded inhibitory RNA molecule comprises or consists of a sense nucleotide sequence selected from the group consisting ofGCUCUCGUACAUAAGAUGAUA (SEQ ID NO 396) and AAAUCAGUAAGUCACUUCUAA (SEQ ID NO 401).

29. The double stranded inhibitory RNA molecule according to any one of claims 1-17 and 28 wherein said double stranded inhibitory RNA molecule comprises or consists of an antisense nucleotide sequence selected from the group consisting of Aucaucuuauguacgagagcga (SEQ ID NO 388) and UUAGAAGUGACUUACUGAUUUAC (SEQ ID NO 393).

30. The double stranded inhibitory RNA molecule according to any one of claims 1-17 wherein said double stranded inhibitory RNA molecule comprises or consists of a sense nucleotide sequence selected from the group consisting of gscsucucGfuAfCfAfuaagaugasusa(NHC6)(Palm) (SEQ ID NO 411) and asasaucaGfuAfAfGfucacuucusasa(NHC6)(Palm) (SEQ ID NO 417) wherein Nf is 2'-fluoro ribonucleotide, n is 2'-O-methyl ribonucleotide, s is phosphorothioate, (Palm-C6) / / (NHC6) (Palm) is Palmitate-C6.31 . The double stranded inhibitory RNA molecule according to any one of claims 1-17 and 30 wherein said double stranded inhibitory RNA molecule comprises or consists of an antisense nucleotide sequence selected from the group consisting of (vinu)sAfsucaucuuauguAfcGfagagcsgsa (SEQ ID 403) and (vinu)sUfsagaagugacuuAfcllfgauuusasc (SEQ ID NO 405) wherein (vinu) is 5'-vinylphosphonate-2'-O-methyl-uridine, Nf is 2'-fluoro ribonucleotide, n is 2'-O-methyl ribonucleotide, s is phosphorothioate.

32. A pharmaceutical composition comprising the double stranded inhibitory ribonucleic acid molecule according to any one of claims 1 to 31 and a pharmaceutically acceptable carrier or diluent.

33. A double stranded inhibitory RNA molecule according to any one of claims 1 to 31 for use in the treatment of a neurodegenerative disease.

34. The double stranded inhibitory RNA molecule according to claim 33 wherein said neurodegenerative disease is selected from the group consisting of: amyotrophic lateral sclerosis (ALS), sporadic amyotrophic lateral sclerosis, familial ALS caused by a mutation other than a pathological C9ORF72-repeat expansion, frontotemporal dementia (FTD) motor neurone disease for example sporadic, genetic or familial FTD, frontotemporal lobar dementia (FTLD), Alzheimer’s Disease, Parkinson’s Disease, neurodegenerative disease with TDP43 proteinopathy, Huntington's like disorder, Huntington’s disease, Alzheimer disease, Parkinson’s disease and Fragile X-associated tremor / ataxia syndrome (FXTAS).

Images