Methods for detection of proteins and nucleic acids

Abstract

This disclosure relates to systems and methods for detection and measurement of proteins and nucleic acids in individual cells.

Description

PCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCTMETHODS FOR DETECTION OF PROTEINS AND NUCLEIC ACIDSCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority of US Provisional Application No. 63 / 697,400, filed September 20, 2024, which is incorporated by reference herein in its entirety for any purpose.FIELD

[0002] This disclosure relates to systems and methods for detection of target proteins and nucleic acids in biological samples.INTRODUCTION AND SUMMARY OF INVENTION

[0003] Conventionally, various attempts to evaluate genetic activity and / or decode biological processes, including disease processes or biological processes of pharmacological effect, have been focused on genomics. However, proteomics can provide further information about the biological function of cells and organisms. Proteomics includes qualitative and quantitative measurement of gene activity by detecting and quantifying the expression on a protein level rather than the genetic level.

[0004] At present, there is an increasing demand for high throughput proteomics. However, detecting and quantitating proteins can be difficult, while detecting and quantitating nucleic acids is relatively easy, at least in part because proteins are more complicated and more variable in biological functions than DNA. This has motivated many efforts to measure mRNA (messenger RNA) concentrations as a proxy for protein concentrations. However, attempts to simultaneously measure transcripts and proteins in single cells are limited in scale or can only profile a few genes and proteins in parallel. There remains a need for improved methods of detecting proteins and transcripts in a sample, e.g., in single cells or tissue samples.

[0005] Aptamers have a hydrodynamic diameter of ~2 nm compared to ~15 nm for antibodies and can be more effective for internalization and staining of intracellular compartments than with antibodies. This provides advantages for combining intracellular proteomic and transcriptom ic readouts.

[0006] Accordingly, the present disclosure relates to systems and methods for detection of proteins and nucleic acids. This disclosure also relates to systems and methods for spatial profiling of surface and intracellular proteins as well as nucleic acids across the cell or tissue sample.PCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT

[0007] In some embodiments, the present disclosure provides for a method of detection of a protein and an RNA in a cell. In some embodiments, the method comprises (a) contacting a cell suspended in a first fluid with a polynucleotide, wherein the polynucleotide comprises an aptamer and a capture probe, wherein the aptamer is capable of binding to a protein, and wherein the capture probe comprises an aptamer barcode sequence that identifies the aptamer and an anchor sequence; (b) contacting the first fluid with a microparticle, wherein the microparticle comprises: (i) a plurality of protein detection probes, each protein detection probe comprising a cell barcode sequence that identifies the cell, and a sequence that hybridizes to the anchor sequence of the capture probe; and (ii) a plurality of RNA detection probes, each RNA detection probe comprising the cell barcode sequence, and an RNA binding sequence; (c) conducting reverse transcription to provide: (i) a first analyte sequence comprising the cell barcode sequence, and the sequence that hybridizes to the anchor sequence from the protein detection probe; and a sequence that is complementary to the aptamer barcode sequence from the capture probe; and (ii) a second analyte sequence comprising the cell barcode sequence, and RNA binding sequence in the RNA detection probe; and cDNA of the RNA; (d) amplifying the first and second analyte sequences; and (e) identifying the first and second analyte sequences, wherein the analyte sequences are distinguishable for the protein and RNA.BRIEF DESCRIPTION OF THE DRAWINGS

[0008] Fig. 1 is a schematic diagram depicting an illustrative polynucleotide comprising an aptamer and capture probe in accordance with aspects of the present disclosure. The polynucleotide comprises, from 5’ to 3’, an aptamer (1) capable of binding to a protein, a binding site for a primer for nucleic acid amplification (2), an aptamer barcode (3), and an anchor sequence (4).

[0009] Fig. 2 is a flowchart depicting steps of an illustrative method for detecting a plurality of target proteins and RNAs in a sample, in accordance with aspects of the present disclosure.DETAILED DESCRIPTION

[0010] Various aspects and examples of systems and methods for protein and nucleic acid measurements are described below and illustrated in the associated drawings. Unless otherwise specified, a system for protein measurement in accordance with the present teachings, and / or its various components, may contain at least one of the structures, components, functionalities, and / or variations described, illustrated,PCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT and / or incorporated herein. Furthermore, unless specifically excluded, the process steps, structures, components, functionalities, and / or variations described, illustrated, and / or incorporated herein in connection with the present teachings may be included in other similar devices and methods, including being interchangeable between disclosed embodiments. The following description of various examples is merely illustrative in nature and is in no way intended to limit the disclosure, its application, or uses. Additionally, the advantages provided by the examples and embodiments described below are illustrative in nature and not all examples and embodiments provide the same advantages or the same degree of advantages.

[0011] The following definitions are used herein unless otherwise indicated.

[0012] “Comprising,” “including,” and “having” (and conjugations thereof) are used interchangeably to mean including but not necessarily limited to, and are open-ended terms not intended to exclude additional, unrecited elements or method steps.

[0013] Terms such as “first”, “second”, and “third” are used to distinguish or identify various members of a group, or the like, and are not intended to show serial or numerical limitation.

[0014] The term “or” is used in an inclusive sense, i.e. , equivalent to “and / or,” unless the context clearly indicates otherwise.

[0015] In this disclosure, one or more publications, patents, and / or patent applications may be incorporated by reference. However, such material is only incorporated to the extent that no conflict exists between the incorporated material and the statements and drawings set forth herein. In the event of any such conflict, including any conflict in terminology, the present disclosure is controlling.Examples, Components, and Alternatives

[0016] The following sections describe selected aspects of illustrative systems and methods involving polynucleotides including an aptamer for binding a target protein. The examples in these sections are intended for illustration and should not be interpreted as limiting the scope of the present disclosure. Each section may include one or more distinct embodiments or examples, and / or contextual or related information, function, and / or structure.A. Illustrative polynucleotide for binding target proteinsPCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT

[0017] This section describes an illustrative polynucleotide for binding a protein in a cell. Fig. 1 schematically depicts an illustrative polynucleotide in accordance with aspects of the present teachings. Unless otherwise specified, the drawings of the present disclosure are schematic and not necessarily to scale with respect to, e.g., polynucleotide length.

[0018] The illustrative polynucleotide comprises, from 5’ to 3’, an aptamer (1 ) capable of binding to a protein, a binding site for a primer for nucleic acid amplification (2), an aptamer barcode (3), and an anchor sequence (4). Regions (2)-(4) of the polynucleotide may collectively be referred to as a capture probe.

[0019] In some embodiments, the aptamer (for example, element 1 as shown in FIG. 1 ) comprises 20-100, 20-90, 20-80, 20-70, 20-60, 20-50, 20-40, 20-30, 30-100, 30-90, 30-80, 30-70, 30-60, 30-50, 30-40, 40-100, 40-90, 40-80, 40-70, or 40-60, 40-50, 50- 100, 50-90, 50-80, 50-70, 50-60, 60-100, 60-80, 60-70, 70-100, 70-90, 70-80, 80-100, 80-90, or 90-100 nucleotides. In some embodiments, the aptamer comprises 30-90 nucleotides. In some embodiments, the aptamer comprises 32-84 nucleotides. In some embodiments, the aptamer comprises 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 ,41 , 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, or 90 nucleotides.

[0020] In some embodiments, the aptamer comprises one or more chemically modified nucleotides. In some embodiments, the aptamer comprises at least one, at least two, at least three, at least four, or at least five C-5 modified nucleotides. In some embodiments, the aptamer comprises at least one C-5 modified nucleotide. In some embodiments, the aptamer comprises at least two C-5 modified nucleotides. In some embodiments, the aptamer comprises at least three C-5 modified nucleotides. In some embodiments, the aptamer comprises at least four C-5 modified nucleotides. In some embodiments, the aptamer comprises at least five C-5 modified nucleotides. In some embodiments, the modified nucleobase is selected from 5-(N-benzylcarboxamide) (“Bn”)-cytosine, 5-(N-2-phenylethylcarboxamide) (“PE”)-cytosine, 5-(N-3- phenylpropylcarboxamide (“PP”)-cytosine, 5-(N-1 -naphthylmethylcarboxamide) (“Nap”)- cytosine, 5-(N-2-naphthylmethylcarboxamide) (“2Nap”)-cytosine, 5-(N-1 -naphthyl-2- ethylcarboxamide) (“NE”)-cytosine, 5-(N- tyrosylcarboxamide) (”Tyr”)-cytosine, Bn- uracil, Nap-uracil, PE-uracil, 5-(N-isobutylcarboxamide) (“lb”)-uracil, 5-(N-4-fluoro- benzylcarboxamide) (“FBn”)-uracil, 2Nap-uracil, NE-uracil, 5-(N-3,4- methylenedioxybenzylcarboxamide) (“MBn”)-uracil, 5-(N-3-PCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT benzofuranylethylcarboxamide) (“BF”)-uracil, 5-(N-3-benzothiophenylethylcarboxamide) (“BT”)-uracil, 5-(N-3-phenylpropylcarboxamide) (“PP”)-uracil, 5-(N- morpholinoethylcarboxamide) (“MOE”)-uracil, Tyr-uracil, 5-(N-3-indole-2- ethylcarboxamide) (“Trp”)-uracil, 5-(n-(R)-2-hydrozypropylcarboxamide) (“Thr”)-uracil, 5-(N-((1 ,1’-biphenyl)-4-yl)ethylcarboxamide) “BPE”-uracil, 5-(N-4- phenylbenzylcarboxamide) (“PBn”)-uracil, 5-(N-4-phenoxybenzylcarboxamide) (“POP”)- uracil, 5-(N-3,3-diphenylpropylcarboxamide) (“DPP”)-uracil, 5-(N-3- phenylbenzylcarboxamide) (“DBM”)-uracil, 5-(N-benzylhydrylcarboxamide) (“BH”)- uracil, BPE-cytosine, PBn-cytosine, POP-cytosine, DPP-cytosine, DBM-cytosine, and BH-cytosine.

[0021] In some embodiments, the binding site for a primer for nucleic acid amplification (for example, element 2 as shown in FIG. 1 ) comprises a common sequence to enable PCR amplification. In some embodiments, the binding site for a primer for nucleic acid amplification is a binding site for an Illumina Read 2 sequence. In some embodiments, the binding site for a primer for nucleic acid amplification is a partial binding site for an Illumina Read 2 sequence.

[0022] In some embodiments, the aptamer barcode (for example, element 3 as shown in FIG. 1 ) comprises a sequence for identifying the aptamer. In some embodiments, the aptamer barcode sequence has a length of about 5-20 nucleotides. In some embodiments, the aptamer barcode sequence has a length of 5, 6, 7, 8, 9, 10,11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides. In some embodiments, the aptamer barcode sequence has a length of 5-20, 5-19, 5-18, 5-17, 5-16, 5-15, 5-14, 5- 13, 5-12, 5-11 , 5-10, 5-9, 5-8, 5-7, 5-6, 6-20, 6-19, 6-18, 6-17, 6-16, 6-15, 6-14, 6-13, 6-12, 6-11 , 6-10, 6-9, 6-8, 6-7, 7-20, 7-19, 7-18, 7-17, 7-16, 7-15, 7-14, 7-13, 7-12, 7-11 , 7-10, 7-9, 7-8, 8-20, 8-19, 8-18, 8-17, 8-16, 8-15, 8-14, 8-13, 8-12, 8-11 , 8-10, 8-9, 9- 20, 9-19, 9-18, 9-17, 9-16, 9-15, 9-14, 9-13, 9-12, 9-11 , 9-10, 10-20, 10-19, 10-18, I Q- 17, 10-16, 10-15, 10-14, 10-13, 10-12, 10-11 , 11 -20, 11 -19, 11 -18, 11 -17, 11 -16, 11-15, 11 -14, 11-13, 11 -12, 12-20, 12-19, 12-18, 12-17, 12-16, 12-15, 12-14, 12-13, 13-20, 13- 19, 13-18, 13-17, 13-16, 13-15, 13-14, 14-20, 14-19, 14-18, 14-17, 14-16, 14-15, 15-20, 15-19, 15-18, 15-17, 15-16, 16-20, 16-19, 16-18, 16-17, 17-20, 17-19, 17-18, 18-20, 18- 19, or 19-20 nucleotides. In some embodiments, the aptamer barcode sequence is 3’ of the binding site for a primer for PCR amplification.

[0023] In some embodiments, the anchor sequence (for example, element 4 as shown in FIG. 1 ) is the sequence of the polynucleotide that is capable of hybridizing to a sequence of a protein detection probe. In some embodiments, the anchor sequencePCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT that hybridizes to the protein detection probe is universal for the capture probe. In some embodiments, the anchor sequence comprises a poly-A oligonucleotide. In some embodiments, the anchor sequences of the plurality of polynucleotides are substantially identical, and optionally comprise a poly-A sequence of at least 10 nucleotides in length. In some embodiments, the anchor sequences of the plurality of polynucleotides comprise a poly-A sequence of at least 10 nucleotides in length. In some embodiments, the anchor sequence is located 3’ of the aptamer barcode sequence (for example, element 3 as shown in FIG. 1 ).Illustrative Aptamers

[0024] Any nucleic acid based aptamer that binds a protein target may be used in the present methods.

[0025] One way to detect and quantify the presence of specific proteins in a biological sample is through the use of protein-binding nucleic acid aptamers, such as SOMAmer® (Slow Off-rate Modified Aptamer) reagents. In some embodiments, an aptamer may comprise one or more chemically modified nucleotides that improve the stability and / or binding affinity of the aptamer for the protein target.

[0026] Aptamers are typically single stranded DNA-based protein affinity reagents that may include chemically modified nucleotides. In some embodiments, an aptamer comprises one or more chemically modified nucleotides, expanding the chemical diversity of standard DNA aptamers and enhancing the specificity and affinity of protein- nucleic acid interactions. These modified nucleotides are incorporated into nucleic acid libraries used for iterative selection and amplification of aptamers to a target, using for example, a process called SELEX (Systematic Evolution of Ligands by Exponential enrichment). In some embodiments, the inclusion of certain chemically modified nucleotides allows for the generation of aptamers capable of binding proteins that had been resistant to selection with nucleic acids lacking similar chemical modifications. Aptamers can be selected according to the desirable properties of specificity and slow off-rate, under the assay conditions in which the reagents will be used.

[0027] In some embodiments, an aptamer that binds a desired target is developed using “Systematic Evolution of Ligands by Exponential enrichment,” or SELEX. The SELEX process is a method for the in vitro evolution of nucleic acid molecules for a certain desired activity, such as specific binding to target molecules, such as proteins. In some embodiments, a SELEX-identified nucleic acid capture reagent is a specificPCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT ligand of a given target molecule, such as a protein. Molecules of any size or composition can serve as targets.

[0028] The SELEX method applied to the application of high affinity binding involves selection from a mixture of candidate oligonucleotides and stepwise iterations of binding, partitioning and amplification, using the same general selection scheme, to achieve virtually any desired criterion of binding affinity and selectivity. Starting from a mixture of nucleic acids, preferably comprising a segment of randomized sequence, the SELEX method includes steps of contacting the mixture with the target under conditions favorable for binding, partitioning unbound nucleic acids from those nucleic acids which have bound specifically to target molecules, dissociating the nucleic acid-target complexes, amplifying the nucleic acids dissociated from the nucleic acid-target complexes to yield a ligand-enriched mixture of nucleic acids, and then reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired to yield highly specific high affinity nucleic acid ligands to the target molecule. In this manner, aptamers suitable for binding to virtually any target protein can be discovered.

[0029] SOMAmers are protein-binding aptamers that have a rate of dissociation (ti / 2) generally between 5 and 240 minutes, this being the average time it takes for half of the protein-aptamer complexes to dissociate. SOMAmers generally comprise modified nucleosides that improve protein binding, affinity, and / or off rate. In some embodiments, the modifications comprise chemical groups that are attached to the 5-position of the pyrimidine bases. By functionalizing the 5-position with amino acid-like moieties (e.g., benzyl, 2-napthyl, etc.), the chemical diversity of oligonucleotides is expanded, allowing high affinity binding with a wider range of target molecules. Nonlimiting exemplary 5- position modified pyridine nucleobases include 5-(N-benzylcarboxamide) (“Bn”)- cytosine, 5-(N-2-phenylethylcarboxamide) (“PE”)-cytosine, 5-(N-3- phenylpropylcarboxamide (“PP”)-cytosine, 5-(N-1 -naphthylmethylcarboxamide) (“Nap”)- cytosine, 5-(N-2-naphthylmethylcarboxamide) (“2Nap”)-cytosine, 5-(N-1-naphthyl-2- ethylcarboxamide) (“NE”)-cytosine, 5-(N- tyrosylcarboxamide) (”Tyr”)-cytosine, Bn- uracil, Nap-uracil, PE-uracil, 5-(N-isobutylcarboxamide) (“lb”)-uracil, 5-(N-4-fluoro- benzylcarboxamide) (“FBn”)-uracil, 2Nap-uracil, NE-uracil, 5-(N-3,4- methylenedioxybenzylcarboxamide) (“MBn”)-uracil, 5-(N-3- benzofuranylethylcarboxamide) (“BF”)-uracil, 5-(N-3-benzothiophenylethylcarboxamide) (“BT”)-uracil, 5-(N-3-phenylpropylcarboxamide) (“PP”)-uracil, 5-(N- morpholinoethylcarboxamide) (“MOE”)-uracil, Tyr-uracil, 5-(N-3-indole-2-PCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT ethylcarboxamide) (“Trp”)-uracil, 5-(n-(R)-2-hydrozypropylcarboxamide) (“Thr”)-uracil, 5-(N-((1 ,1’-biphenyl)-4-yl)ethylcarboxamide) “BPE”-uracil, 5-(N-4- phenylbenzylcarboxamide) (“PBn”)-uracil, 5-(N-4-phenoxybenzylcarboxamide) (“POP”)- uracil, 5-(N-3,3-diphenylpropylcarboxamide) (“DPP”)-uracil, 5-(N-3- phenylbenzylcarboxamide) (“DBM”)-uracil, 5-(N-benzylhydrylcarboxamide) (“BH”)- uracil, BPE-cytosine, PBn-cytosine, POP-cytosine, DPP-cytosine, DBM-cytosine, and BH-cytosine. Nonlimiting exemplary modified nucleosides that may be included in aptamers, such as SOMAmers, include 5-position modified pyridine nucleosides. Exemplary 5-position modified pyridine nucleosides that may be used in aptamers, such as SOMAmers, include, but are not limited to, BndC, 2’-OMe-Bn-C, PEdC, 2’- OMe-PE-C, PPdC, 2’-OMe-PP-C, NapdC, 2’-OMe-Nap-C, 2NapdC, 2’-OMe-2Nap-C, NEdC, 2’-OMe-NE-C, 2NEdC, 2’-OMe-2NE-C, TyrdC, 2’-OMe-Tyr-C, BndU, 2’-OMe- Bn-U, NapdU, 2’-OMe-Nap-U, PEdll, 2’-OMe-PE-U, IbdU, 2’-OMe-lb-U, FBndll, 2’- OMe-FBn-U, 2Napdll, 2’-OMe-2Nap-U, NEdll, 2’-OMe-NE-U, MBndll, 2’-OMe-MBn-U, BFdll, 2’-OMe-BF-U, BTdll, 2’-OMe-BT-U, PPdU, 2’-OMe-PP-U, MOEdll, 2’-OMe- MOE-U, Tyrdll, 2’-OMe-Tyr-U, Trpdll, 2’-OMe-Trp-U, Thrdll, and 2’-OMe-Thr-U, BPEdU, 2’-OMe-BPE-U, 2’-F-BPE-U, PBndU, 2’-OMe-PBn-U, 2’-F-PBn-U, POPdU, 2’- OMe-POP-U, 2’-F-POP-U, DPPdU, 2’-OMe-DPP-U, 2’-F-DPP-U, DBMdll, 2’-OMe- DBM-U, 2’-F-DBM-U, BHdll, 2’-OMe-BH-U, 2’-F-BH-U, BPEdC, 2’-OMe-BPE-C, 2’-F- BPE-C, PBndC, 2’-OMe-PBn-C, 2’-F-PBn-C, POPdC, 2’-OMe-POP-C, 2’-F-POP-C, DPPdC, 2’-OMe-DPP-C, 2’-F-DPP-C, DBMdC, 2’-OMe-DBM-C, 2’-F-DBM-C, BHdC, 2’- OMe-BH-C, and 2’-F-BH-C. See, e.g., PCT Publication Nos. WO 2022 / 0221241 and WO 2018 / 0005974.

[0030] Assays directed to the detection and quantification of physiologically significant molecules in biological samples and other samples are important tools in scientific research and in the health care field. Aptamers are capable of binding to a target molecule in the sample in a highly specific manner and with very high affinity. After appropriate washing and partitioning steps to first remove unbound proteins and then to remove unbound aptamers, aptamers are eluted from the resultant aptamerprotein complexes. The eluted aptamers may then be detected, qualitatively or quantitatively, using the methods provided herein, thereby enabling a determination of the absence, presence, amount, and / or concentration of the target molecules in the sample.PCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT Illustrative Capture Probes

[0031] In certain embodiments of the present disclosure, the aptamer is linked to a capture probe comprising, from 5’ to 3’, a binding site for a primer for nucleic acid amplification, an aptamer barcode, and an anchor sequence.

[0032] In general, the capture probe can be any length that accommodates the lengths of its functional components. In one embodiment, the capture probe is from 20 and 100 nucleotides in length. In some embodiments, the capture probe is at least 20, 30, 40, 50, 60, 70, 80, 90 or over 100 nucleotides in length. In other embodiments, the capture probe is 200 to about 400 nucleotides in length. In one embodiment, the capture probe is generally made up of deoxyribonucleic acids (DNA). In one embodiment, the capture probe is a DNA sequence. In other embodiments, the capture probe comprises modified DNA bases. Modifications of DNA bases are known in the art, and can include chemically modified bases including labels. In other embodiments, the capture probe comprises ribonucleic acid (RNA) sequences or modified ribonucleotide bases. Modifications of RNA bases are known in the art, and can include chemically modified bases including labels. In still other embodiments, different portions of the capture probe can comprise DNA and RNA, modified bases, or modified polymer connections (including but not limited to PNAs and LNAs). For a description of modifications to oligonucleotides, see commercial suppliers, e.g., Integrated DNA Technologies, USA website; Custom Oligonucleotide Modifications Guide, Sigma- Aldrich, www.sigmaaldrich.com / technical- documents / articles / biology / custom-dna- oligos-modifications.html, and Modified Oligonucleotides, TriLink, www.trilinkbiotech.com / oligo / modifiedoligos.asp. As described above, in still other embodiments, the polymer construct is composed of polyamides, PNA, etc.

[0033] In some embodiments, the capture probe comprises a binding site for a primer for nucleic acid amplification. In some embodiments, the binding site for a primer for nucleic acid amplification is located 3’ of the aptamer. In some embodiments, the binding site for a primer for nucleic acid amplification comprises a common sequence to enable PCR amplification. In some embodiments, the binding site for a primer for nucleic acid amplification is a binding site for an Illumina Read 2 sequence (AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC). In some embodiments, the binding site for a primer for nucleic acid amplification is a partial binding site for an Illumina Read 2 sequence.

[0034] In some embodiments, the capture probe comprises an aptamer barcode.PCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT

[0035] An aptamer barcode domain may comprise any domain suitable for facilitating identification (e.g., sequenced or hybridization to a known sequence). An aptamer barcode may have any suitable length. In general, an aptamer barcode domain length of n nucleotides allows a library of 4nunique barcodes. For example, in embodiments where the aptamer barcode domain has a length of 15 nucleotides, a corresponding library may have up to 415= 1 ,073,741 ,824 barcodes.

[0036] In some embodiments, the aptamer barcode sequence has a length of about 5-20 nucleotides. In some embodiments, the aptamer barcode sequence has a length of 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides. In some embodiments, the aptamer barcode sequence has a length of 5-20, 5-19, 5-18, 5-17, 5-16, 5-15, 5-14, 5-13, 5-12, 5-11 , 5-10, 5-9, 5-8, 5-7, 5-6, 6-20, 6-19, 6-18, 6-17, 6-16, 6-15, 6-14, 6-13, 6-12, 6-11 , 6-10, 6-9, 6-8, 6-7, 7-20, 7-19, 7-18, 7-17, 7-16, 7-15, 7-14, 7-13, 7-12, 7-11 , 7-10, 7-9, 7-8, 8-20, 8-19, 8-18, 8-17, 8-16, 8-15, 8-14, 8-13, 8-12, 8- 11 , 8-10, 8-9, 9-20, 9-19, 9-18, 9-17, 9-16, 9-15, 9-14, 9-13, 9-12, 9-11 , 9-10, 10-20, 10-19, 10-18, 10-17, 10-16, 10-15, 10-14, 10-13, 10-12, 10-11 , 11 -20, 11-19, 11 -18, 11 -17, 11 -16, 11 -15, 11-14, 11 -13, 11 -12, 12-20, 12-19, 12-18, 12-17, 12-16, 12-15, 12-14, 12-13, 13-20, 13-19, 13-18, 13-17, 13-16, 13-15, 13-14, 14-20, 14-19, 14-18, 14-17, 14-16, 14-15, 15-20, 15-19, 15-18, 15-17, 15-16, 16-20, 16-19, 16-18, 16-17, 17-20, 17-19, 17-18, 18-20, 18-19, or 19-20 nucleotides.

[0037] In some embodiments, the aptamer barcode sequence is located 3’ of the binding site for a primer for PCR amplification.

[0038] In some embodiments, the capture probe comprises an anchor sequence. In some embodiments, the anchor sequence (for example, element 4 as shown in FIG. 1 ) is the sequence of the polynucleotide that is capable of hybridizing to a sequence of a protein detection probe. In some embodiments, the anchor sequence that hybridizes to the protein detection probe is universal for the capture probe. In some embodiments, the anchor sequence comprises a poly-A oligonucleotide. In some embodiments, the anchor sequences of the plurality of polynucleotides are substantially identical, and optionally comprise a poly-A sequence of at least 10 nucleotides in length. In some embodiments, the anchor sequences of the plurality of polynucleotides comprise a poly- A sequence of at least 10 nucleotides in length. In some embodiments, the anchor sequence is located 3’ of the aptamer barcode sequenceB. Illustrative MicroparticlesPCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT

[0039] This section describes an illustrative microparticle for detection of a protein and an RNA from a single cell. In some embodiments, a plurality of microparticles are provided for detection of a plurality of different proteins and a plurality of different RNAs from individual cells in a sample. In some embodiments, the microparticle comprises a plurality of protein detection probes, each protein detection probe comprising a binding site for a primer for a polymerase chain reaction (PCR), a cell barcode sequence that identifies the cell, a unique molecular identifier (UMI), and a sequence that hybridizes to the anchor sequence in the aptamer. In some embodiments, the microparticle comprises a plurality of RNA detection probes, each RNA detection probe comprising a binding site for a primer for a polymerase chain reaction (PCR), a cell barcode sequence that identifies the cell, a unique molecular identifier (UMI), and an RNA binding sequence.Solid Support

[0040] In some embodiments, the microparticle comprises a solid support. In some embodiments, the solid support is a bead.

[0041] In some embodiments, the solid support may be microgel particles that are micron-scale spheres of gel matrix. In some embodiments, the microgels are composed of a hydrophilic polymer that is soluble in water, including alginate or agarose. In other embodiments, the microgels are composed of a lipophilic microgel. In other embodiments, the solid support may be a hydrogel. In certain embodiments, the hydrogel is selected from naturally derived materials, synthetically derived materials and combinations thereof. Examples of hydrogels include, but are not limited to, collagen, hyaluronan, chitosan, fibrin, gelatin, alginate, agarose, chondroitin sulfate, polyacrylamide, polyethylene glycol (PEG), polyvinyl alcohol (PVA), acrylamide / bisacrylamide copolymer matrix, polyacrylamide / poly(acrylic acid) (PAA), hydroxyethyl methacrylate (HEMA), poly N-isopropylacrylamide (NIPAM), and polyanhydrides, polypropylene fumarate) (PPF).

[0042] In some embodiments, the plurality of protein detection probes and the plurality of RNA detection probes are attached to the solid support. In some embodiments, the plurality of protein detection probes and the plurality of RNA detection probes are attached to the solid support via covalent acrylic linkage. In some embodiments, the protein and RNA detection probes are acrydite-modified on their 5' end (linker region). Generally, acrydite-modified oligonucleotides can be incorporated, stoichiometrically, into hydrogels such as polyacrylamide, using standard free radical polymerization chemistry, where the double bond in the acrydite group reacts with otherPCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT activated double bond containing compounds such as acrylamide. Specifically, copolymerization of the acrydite-modified capture probes with acrylamide including a crosslinker, e.g. N,N'-methylenebis, will result in a crosslinked gel material comprising covalently attached protein and RNA detection probes. In some other embodiments, the protein and RNA detection probes comprise acrylate terminated hydrocarbon linker and combining the said protein and RNA detection probes with a solid support will cause their attachment to the solid support.

[0043] In some embodiments, one or more of the plurality of protein detection probes, the plurality of RNA detection probes, or the plurality of DNA detection probes are linked to the solid support by a cleavable linker. In some embodiments, the cleavable linker is a UV-cleavable linker.Binding Site for a Primer for a Polymerase Chain Reaction (PCR)

[0044] In some embodiments, the protein or RNA detection probe comprises a binding site for a primer for a polymerase chain reaction (PCR). In some embodiments, the binding site is for a universal primer sequence. One of ordinary skill in the art would understand that this generally refers to a primer binding site for a primer that would be expected to hybridize (base-pair) to, and prime, one or more loci of complementary sequence, if present, on any nucleic acid fragment. In some embodiments, the binding site for a primer may bind to a P5 or P7 primer.Cell Barcode

[0045] In some embodiments, the protein or RNA detection probe comprises a cell barcode sequence. A cell barcode sequence may comprise any domain suitable for facilitating identification (e.g., when sequenced). A cell barcode sequence may have any suitable length. In general, a cell barcode length of n nucleotides allows a library of 4nunique barcodes. For example, in embodiments where the cell barcode domain has a length of 15 nucleotides, a corresponding library may have up to 415= 1 ,073,741 ,824 barcodes.Unique Molecular Identifier (UM I)

[0046] In some embodiments, the protein or RNA detection probe comprises a unique molecular identifier (UMI). In some embodiments, the UMI comprises a unique or practically unique domain that facilitates identification and correction of errors associated with sequencing and / or other processing of first and second analyte sequences of the present disclosure. A UMI sequence may have any suitable length. In some examples, a UMI region may be five nucleotides long, which is a length of some commonly available commercial products. However, other lengths may be used wherePCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT appropriate; for example, lengths longer than five nucleotides do not compromise performance in at least some examples.Sequence that Hybridizes to an Anchor Sequence

[0047] In some embodiments, the protein detection probe disclosed herein comprises a sequence that hybridizes to the anchor sequence of a capture probe. In some embodiments, the sequence that hybridizes to the anchor sequence of the capture probe is universal for the anchor probe. In some embodiments, the sequence that hybridizes to the anchor sequence of the capture probe comprises a poly-T oligonucleotide. In some embodiments, the sequences that hybridize to the anchor sequence of the capture probe are substantially identical, and optionally comprise a poly-T sequence of at least 10 nucleotides in length. In some embodiments, the sequence that hybridizes to the anchor sequence of the capture probe comprises a poly-T sequence of at least 10 nucleotides in length.RNA Binding Sequence

[0048] In some embodiments, the RNA detection probe comprises an RNA binding sequence that binds RNAs. In some embodiments, the RNA binding sequence is a gene-specific sequence, i.e., a sequence that is complementary to a sequence that is unique to a particular RNA species. In some embodiments, the RNA binding sequence is a random sequence. In some embodiments, the RNA-binding sequence is a universal sequence. In some embodiments, the RNA binding sequence comprises a poly-T oligonucleotide. In some embodiments, the RNA binding sequences are substantially identical, and optionally comprise a poly-T sequence of at least 10 nucleotides in length. In some embodiments, the RNA binding sequence comprises a poly-T sequence of at least 10 nucleotides in length.C. Illustrative Nucleic Acid Amplification and Sequencing

[0049] In some embodiments, the methods of the present disclosure provide for identifying the first and second analyte sequences. In some embodiments, identification comprises sequencing, which may be performed by methods known in the art. For example, see, generally, Quail, et al., 2012, A tale of three next generation sequencing (NGS) platforms: comparison of Ion Torrent, Pacific Biosciences and Illumina MiSeq sequencers, BMC Genomics 13:341. Nucleic acid sequencing techniques include classic dideoxy sequencing reactions (Sanger method) using labeled terminators or primers and gel separation in slab or capillary, or preferably, next generationPCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT sequencing methods. For example, sequencing may be performed according to technologies described in U.S. Pub. 2011 / 0009278, U.S. Pub. 2007 / 0114362, U.S. Pub. 2006 / 0024681 , U.S. Pub. 2006 / 0292611 , U.S. Pat. Nos. 7,960,120, 7,835,871 , 7,232,656, 7,598,035, 6,306,597, 6,210,891 , 6,828,100, 6,833,246, and 6,911 ,345, each incorporated by reference.

[0050] The conventional pipeline for processing sequencing data includes generating FASTQ-format files that contain reads sequenced from a next generation sequencing platform, aligning these reads to an annotated reference genome, and quantifying expression of genes. These steps are routinely performed using known computer algorithms, which a person skilled in the art will recognize can be used for executing steps of the methods according to the present disclosure. For example, see Kukurba, Cold Spring Harb Protoc, 2015 (11 ):951-969, incorporated by reference.

[0051] After obtaining expression profiles from single cells, the expression profiles can be analyzed by, for example, comparing the profiles with reference or control profiles to ascertain information about the single target cells. For example, see generally, Efroni, Genome Biology, 2015; and Stahlberg, Nucleic Acids Research, 2011 , 39(4)e24, each of which incorporated by reference.D. Illustrative Biomolecules for Detection

[0052] In some embodiments, the methods of the present disclosure provide for detecting a plurality of proteins and a plurality of RNAs. In some embodiments, the methods of the present disclosure provide for detecting a plurality of proteins and a plurality of DNA sequences. Exemplary proteins, RNAs, and DNA sequences are disclosed below.

[0053] In some embodiments, the methods of the present disclosure provide for detecting a plurality of proteins. In some instances, one or more of the proteins in the plurality of proteins is a peptide, a glycoproteins (N-linked or O-linked), a lipoprotein, a phosphoprotein, a specific phosphorylated or acetylated variants of a protein, a amidation variant of a protein, a hydroxylation variants of a protein, a methylation variant of a protein, a ubiquitylation variant of a proteins, a sulfation variant of a protein, a viral coat protein, an extracellular protein, an intracellular protein, an antibody, an antigen binding fragment, or any combination thereof.

[0054] In some embodiments, the method of the present disclosure provides for detecting a plurality of nucleic acids. In some embodiments, the plurality of nucleicPCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT acids including DNA. In some embodiments, the plurality of nucleic acids including RNA. In some embodiments, the plurality of nucleic acids including DNA and RNA.

[0055] Examples of nucleic acid analytes include DNA analytes such as genomic DNA, methylated DNA, specific methylated DNA sequences, fragmented DNA, mitochondrial DNA, in situ synthesized PCR products, and RNA / DNA hybrids.

[0056] Examples of nucleic acid analytes also include RNA analytes such as various types of coding and non-coding RNA. Examples of the different types of RNA analytes include messenger RNA (mRNA), ribosomal RNA (rRNA), transfer RNA (tRNA), microRNA (miRNA), and viral RNA. The RNA can be a transcript (e.g., present in a tissue section). The RNA can be small (e.g., less than 200 nucleic acid bases in length) or large (e.g., RNA greater than 200 nucleic acid bases in length). Small RNAs mainly include 5.8S ribosomal RNA (rRNA), 5S rRNA, transfer RNA (tRNA), microRNA (miRNA), small interfering RNA (siRNA), small nucleolar RNA (snoRNAs), Piwi- interacting RNA (piRNA), tRNA-derived small RNA (tsRNA), and small rDNA-derived RNA (srRNA). The RNA can be double-stranded RNA or single-stranded RNA. The RNA can be circular RNA. The RNA can be a bacterial rRNA (e.g., 16s rRNA or 23s rRNA).

[0057] Additional examples of analytes include mRNA and cell surface features (e.g., using the labelling agents described herein), mRNA and intracellular proteins (e.g., transcription factors), mRNA and cell methylation status, mRNA and accessible chromatin (e.g., ATAC-seq, DNase-seq, and / or MNase-seq), mRNA and metabolites (e.g., using the labelling agents described herein), a barcoded labelling agent (e.g., the oligonucleotide tagged antibodies described herein) and a V(D)J sequence of an immune cell receptor (e.g., T-cell receptor), mRNA and a perturbation agent (e.g., a CRISPR crRNA / sgRNA, TALEN, zinc finger nuclease, and / or antisense oligonucleotide as described herein). In some embodiments, a perturbation agent can be a small molecule, an antibody, a drug, an aptamer, a miRNA, a physical environmental (e.g., temperature change), or any other known perturbation agents.

[0058] In some embodiments, the method of the present disclosure provides for detecting a plurality of RNAs. In some embodiments, the RNA is an endogenous RNA. In some embodiments, the RNA is an exogenous RNA. In some embodiments, the RNA is a messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), long noncoding RNA (IncRNA), microRNA (miRNA), small interfering RNA (siRNA), short nucleolar RNA (snoRNA), Piwi-interacting RNA (piRNA), small nuclear RNA (snRNA).PCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT

[0059] In some embodiments, the RNA comprises a poly-A tail. In some embodiments, the RNA does not comprise a poly-A tail.

[0060] In some embodiments, the method of the present disclosure provides for detecting a plurality of DNAs. In some embodiments, the target DNA comprises one or more of a single nucleotide polymorphism (SNP), an insertion or deletion (indel), a copy number variant (CNV), or a tandem repeat. In some embodiments, the target DNA comprises a marker of open chromatin. In some embodiments, the target DNA comprises one or more methylated nucleotides.F. Illustrative Methods

[0061] With reference to Fig. 2, this section describes an illustrative method for obtaining qualitative and / or quantitative information about proteins and RNAs in a sample. In general, a method for obtaining qualitative and / or quantitative information includes (1) contacting a target cell suspended in a first fluid with a plurality of polynucleotides comprising an aptamer and a capture probe, (2) contacting the first fluid with a microparticle comprising a plurality of protein detection probes and a plurality of RNA detection probes, (3) lysing the cell to facilitate binding of the polynucleotides and RNAs to the protein detection probes and RNA detection probes on the microparticle, (4) performing reverse transcription to provide a first and second analyte sequence, (5) amplifying the first and second analyte sequences, and (6) identifying the analyte sequences.

[0062] At step (1), the method includes contacting a target cell suspended in a first fluid with a plurality of polynucleotides comprising an aptamer and a capture probe. In some embodiments, each aptamer is capable of binding to a different protein. In some embodiments, each capture probe comprises an aptamer barcode sequence that identifies the aptamer and an anchor sequence. Exposing the cell to a library of many polynucleotides allows for detecting a large number of target protein species in a single assay. In some embodiments, the polynucleotides comprise aptamers that bind to cell surface epitopes such as proteins expressed on the surface of a cell. In some embodiments, the polynucleotides comprise aptamers that bind to intracellular epitopes such as proteins expressed within the cell. In embodiments in which the polynucleotides comprise aptamers that bind to intracellular epitopes, the cells may be fixed and permeabilized prior to polynucleotide exposure. In some examples, thePCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT aptamers are SOMAmers. SOMAmers have slower off-rates than typical aptamers, which in some embodiments allows the SOMAmer reagents to remain bound to the corresponding proteins during execution of additional assay steps such as multiple washes, improving assay performance.

[0063] At step (2), the method includes contacting the first fluid with a microparticle comprising a plurality of protein detection probes and a plurality of RNA detection probes. In some embodiments, each protein detection probe comprises a cell barcode sequence that identifies the cell, and a sequence that hybridizes to the anchor sequence of the capture probe. In some embodiments, each RNA detection probe comprises a cell barcode sequence and an RNA binding sequence. In some embodiments, the microparticle is a DNA-barcoded bead. In some embodiments, the method comprises contacting the first fluid with a microparticle, and a heat-activated cell lysis reagent. In some embodiments, the method further comprises contacting the first fluid, microparticle, and heat-activated cell lysis reagent with oil. This mixture is then vortexed for 1-2 minutes, yielding a plurality of emulsion droplets. In some embodiments, the emulsion droplets are monodispersed water-in-oil droplets encapsulating a single microparticle and a single cell, as well as heat-inactivated lysis reagent.

[0064] At step (3), the method includes lysing the cells to facilitate binding of the polynucleotides and RNAs to the protein detection probes and RNA detection probes on the microparticle. In some embodiments, the heat-activated lysis reagent comprises a protease that has minimal activity at 4°C but that can be activated at higher temperatures (e.g., proteinase K). In some embodiments, the heat-activated lysis reagent comprises proteinase K. In some embodiments, thermal activation of the heat- activated lysis reagent triggers cell lysis, resulting in the release of polynucleotides and RNAs from the polynucleotide-stained cell and subsequent binding to protein detection probes and RNA detection probes on the surface of the microparticle. In some embodiments, the anchor sequence of the polynucleotide hybridizes to the sequence of the protein detection probe that hybridizes to the anchor sequence of the capture probe of the polynucleotide. In some embodiments, the anchor sequence of the capture probe of the polynucleotide hybridizes to a poly-dT sequence on the protein detection probe. In some embodiments, the RNA hybridizes to an RNA-binding sequence on the RNA detection probe. In some embodiments, the RNA hybridizes to a poly-dT sequence on the RNA detection probe.PCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT

[0065] At step (4), the method includes performing reverse transcription to provide a first and second analyte sequence. In some embodiments, the method first comprises demulsifying the sample and removing the oil, leaving behind an aqueous solution of polynucleotide- and RNA-bound microparticles. In some embodiments, the method further comprises adding reverse transcriptase or polymerase and performing bulk reverse transcription or polymerase extension on the polynucleotides or RNAs. In some embodiments, a sequence at the 3’ end of the protein detection probe or RNA detection probe serves as a primer for the reverse transcriptase or polymerase. In some embodiments, a sequence that hybridizes to the anchor sequence of the capture probe at the 3’ end of the protein detection probe serves as a primer for the reverse transcriptase. In some embodiments, an RNA binding sequence at the 3’ end of the RNA detection probe serves as a primer for the reverse transcriptase. In some embodiments, reverse transcription provides a first and second analyte sequence. In some embodiments, the first analyte sequence comprises the cell barcode sequence, the sequence that hybridizes to the anchor sequence from the protein detection probe; and a sequence that is complementary to the aptamer barcode sequence from the capture probe. In some embodiments, the first analyte comprises a sequence that is complementary to SomalD sequence and a partial binding site for an Illumina Read 2 sequence. In some embodiments, the second analyte sequence comprises the cell barcode sequence, the RNA binding sequence in the RNA detection probe, and a sequence that is complementary to the RNA. In some embodiments, the second analyte sequence comprises the cell barcode sequence, the poly-dT sequence in the RNA detection probe, and a sequence that is complementary to the RNA. In some embodiments the first and second analytes are cDNAs. In some embodiments, the method further comprises appending a template switch oligonucleotide (TSO) to the 3’ end of the first and second analytes.

[0066] At step (5), the method includes amplifying the first and second analyte sequences. In some embodiments, amplification of the first and second analyte sequences can be used to prepare a sequencing library. In some embodiments, whole transcriptome amplification is first performed directly on the first and second analytes. In some embodiments, the microparticles are separated from the amplified analytes using spin columns. In some embodiments, the amplified analytes are further purified using magnetic bead-based size selection. In some embodiments, the amplified analytes are subjected to a second round of amplification using sequencing primers.PCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT

[0067] At step (6), the method includes identifying the first and second analyte sequences In some embodiments, the method includes identifying the analyte sequences based on nucleic acid amplification and sequencing. In some embodiments, the method comprises reading out the amplified analytes, e.g., by sequencing the amplified analytes, using next-generation sequencing and / or any other suitable techniques. The data obtained by reading out the analytes may be used to determine qualitative and / or quantitative information about the proteins and RNAs of the original sample, such as protein and RNA abundances.

[0068] The disclosure set forth above may encompass multiple distinct examples with independent utility. Although each of these examples has been disclosed in its preferred form(s), the specific embodiments thereof as disclosed and illustrated herein are not to be considered in a limiting sense, because numerous variations are possible. The subject matter of the example(s) includes all novel and nonobvious combinations and subcombinations of the various elements, features, functions, and / or properties disclosed herein.

[0069] Certain combinations and subcombinations regarded as novel and nonobvious are particularly pointed out throughout this disclosure. Other combinations and subcombinations of features, functions, elements, and / or properties may be claimed, with or without variation in scope, in applications claiming priority from this or a related application.

[0070] Explicit reference is hereby made to all examples, embodiments, inventions, labels, terms, descriptions, and illustrative measurements shown in the drawings and / or in any included appendices, whether or not described further herein. To the extent that section headings are used within this disclosure, such headings are for organizational purposes only.

Claims

PCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCTWHAT IS CLAIMED IS:1 . A method of detection of a protein and an RNA in a cell, comprising: a) contacting a cell suspended in a first fluid with a polynucleotide, wherein the polynucleotide comprises an aptamer and a capture probe, wherein the aptamer is capable of binding to a protein, and wherein the capture probe comprises an aptamer barcode sequence that identifies the aptamer and an anchor sequence; b) contacting the first fluid with a microparticle, wherein the microparticle comprises: i) a plurality of protein detection probes, each protein detection probe comprising a cell barcode sequence that identifies the cell, and a sequence that hybridizes to the anchor sequence of the capture probe; and ii) a plurality of RNA detection probes, each RNA detection probe comprising the cell barcode sequence, and an RNA binding sequence; c) conducting reverse transcription to provide: i) a first analyte sequence comprising the cell barcode sequence, and the sequence that hybridizes to the anchor sequence from the protein detection probe; and a sequence that is complementary to the aptamer barcode sequence from the capture probe; and ii) a second analyte sequence comprising the cell barcode sequence, and RNA binding sequence in the RNA detection probe; and cDNA of the RNA; d) amplifying the first and second analyte sequences; and e) identifying the first and second analyte sequences, wherein the analyte sequences are distinguishable for the protein and RNA.

2. A method of multiplexed detection of a plurality of different proteins and a plurality of different RNAs in a cell, comprising: a) contacting a cell suspended in a first fluid with a plurality of polynucleotides, wherein each polynucleotide comprises an aptamer and a capture probe, wherein each aptamer is capable of binding to a differentPCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT protein, wherein each capture probe comprises an aptamer barcode sequence that identifies the aptamer and an anchor sequence; b) contacting the first fluid with a microparticle comprising: i) a plurality of protein detection probes, each protein detection probe comprising a cell barcode sequence that identifies the cell, and a sequence that hybridizes to the anchor sequence of the capture probe; and ii) a plurality of RNA detection probes, each RNA detection probe comprising the cell barcode sequence , and an RNA binding sequence; c) conducting reverse transcription to provide: i) a first analyte sequence comprising the cell barcode sequence, and the sequence that hybridizes to the anchor sequence from the protein detection probe; and a sequence that is complementary to the aptamer barcode sequence from the capture probe; and ii) a second analyte sequence comprising the cell barcode sequence, and the RNA binding sequence in the RNA detection probe; and cDNA of the RNA; d) amplifying the first and second analyte sequences; and e) identifying the first and second analyte sequences, wherein the analyte sequences are distinguishable for each protein and RNA.

3. The method of claim 1 or 2, wherein the protein detection probes and RNA detection probes each comprise a unique molecular identifier (UMI).

4. The method of any one of claims 1 -3, wherein the first and second analyte sequences are identified based on nucleic acid amplification and sequencing.

5. The method of any one of claims 1 -4, wherein the protein detection probes and RNA detection probes each comprise a binding site for a universal primer for a nucleic acid amplification.

6. The method of any one of claims 1 -5, wherein the first and second analyte sequences are identified based polymerase chain reaction (PCR) amplification and sequencing.

7. The method of any one of claims 1 -6, wherein the protein detection probes and RNA detection probes each comprise a binding site for a universal primer for a polymerase chain reaction (PCR) amplification.PCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT8. The method of any one of claims 1-7, wherein the RNA binding sequence comprises a poly-dT nucleotide sequence.

9. A method of detecting a protein and an RNA in a cell, comprising: a) contacting a cell suspended in a first fluid with a polynucleotide, wherein the polynucleotide comprises an aptamer and a capture probe, wherein the aptamer is capable of binding to a protein, wherein the protein comprises a cell surface epitope or intracellular protein, wherein the capture probe comprises a aptamer barcode sequence that identifies the aptamer and an anchor sequence, and permeabilizing the cell to allow the polynucleotide to bind to the intracellular protein; b) contacting the first fluid with a microparticle, wherein the microparticle comprises: i) a plurality of protein detection probes, each protein detection probe comprising a cell barcode sequence that identifies the cell, and a sequence that hybridizes to the anchor sequence of the capture probe; and ii) a plurality of RNA detection probes, each RNA detection probe comprising the cell barcode sequence and an RNA-binding sequence; c) adding a second fluid to the first fluid; d) forming an emulsion droplet that contains the microparticle and the cell; e) conducting reverse transcription to provide: i) a first analyte sequence comprising the cell barcode sequence, and the sequence that hybridizes to the anchor sequence from the protein detection probe; and a sequence that is complementary to the aptamer barcode sequence from the capture probe; and ii) a second analyte sequence comprising the cell barcode sequence, and the RNA binding sequence in the RNA detection probe; and cDNA of the RNA; and f) identifying the first and second analyte sequences, wherein the analyte sequences are distinguishable for each protein and RNA.PCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT10. A method of detecting a plurality of different proteins and a plurality of different RNAs in a cell, comprising: a) contacting a cell suspended in a first fluid with a plurality of polynucleotides, wherein each polynucleotide comprises an aptamer and a capture probe, wherein each aptamer is capable of binding to a different protein, wherein the proteins comprise cell surface epitopes or intracellular proteins, wherein each capture probe comprises a aptamer barcode sequence that identifies the aptamer and an anchor sequence, and permeabilizing the cell to allow at least a portion of the plurality of polynucleotides to bind to intracellular proteins; b) contacting the first fluid with a microparticle comprising: i) a plurality of protein detection probes, each protein detection probe comprising a cell barcode sequence that identifies the cell, and a sequence that hybridizes to the anchor sequence of the capture probe; and ii) a plurality of RNA detection probes, each RNA detection probe comprising the cell barcode sequence and an RNA binding sequence; c) adding a second fluid to the first fluid; d) forming a plurality of emulsion droplets that each contain a single one of the microparticles and a single cell; e) conducting reverse transcription to provide: i) a first analyte sequence comprising the cell barcode sequence, and the sequence that hybridizes to the anchor sequence from the protein detection probe; and a sequence that is complementary to the aptamer barcode sequence from the capture probe; and ii) a second analyte sequence comprising the cell barcode sequence, and the RNA binding sequence in the RNA detection probe; and cDNA of the RNA; and f) identifying the first and second analyte sequences, wherein the analyte sequences are distinguishable for each protein and RNA.

11. The method of claim 9 or 10, wherein the protein detection probes and the RNA detection probes comprise a unique molecular identifier (UMI).

12. The method of any one of claim 9-11 , wherein the first and second analyte sequences are identified based on nucleic acid amplification and sequencing.PCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT13. The method of any one of claims 9-12, wherein the protein detection probes and RNA detection probes each comprise a binding site for a universal primer for a nucleic acid amplification.

14. The method of any one of claims 9-13, wherein the first and second analyte sequences are identified based polymerase chain reaction (PCR) amplification and sequencing.

15. The method of any one of claims 9-14, wherein the protein detection probes and the RNA detection probes comprise a binding site for a universal primer for a polymerase chain reaction (PCR) amplification.

16. The method of any one of claims 9-15, wherein the RNA binding sequence comprises a poly-dT nucleotide sequence.

17. The method of any one of claims 9-16, wherein the emulsion droplets contain a lytic reagent.

18. The method of any one of claims 9-17, wherein the first fluid is an aqueous fluid.

19. The method of any one of claims 9-18, wherein the second fluid comprises an oil.

20. The method of any one of claims 9-19, further comprising, in step (d), lysing the single cell thereby providing a cell lysate encapsulated in the emulsion droplet.

21. The method of claim 20, further comprising, after step (d), removing the second fluid.

22. The method of claim 20 or 21 , further comprising, in step (e), contacting the cell lysate with a polymerase or reverse transcriptase.

23. The method of any one of claims 4-22, further, after step (e), comprising amplifying the first and second analyte sequences.

24. The method of any one of claims 4-23, wherein the step (f) of identifying is based on nucleic acid amplification and sequencing.

25. The method of any one of claims 4-24, wherein the step (f) of identifying is based on PCR amplification and sequencing.

26. The method of any one of claims 4-25, wherein the method comprises contacting a plurality of cells, with a plurality of polynucleotides and a plurality of microparticles, configured to independently detect the presence, amount, or absence of proteins and RNAs in the plurality of cells.

27. A method of detecting a plurality of different proteins and a plurality of different RNAs in a cell suspended in a first fluid, comprising:PCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT a) contacting the first fluid with a plurality of polynucleotides, wherein each polynucleotide comprises an aptamer and a capture probe, wherein each aptamer is capable of binding to a different protein, wherein the plurality of different proteins comprise cell surface epitopes or intracellular proteins, wherein each capture probe comprises a binding site for a primer for nucleic acid amplification, an aptamer barcode sequence that identifies the aptamer, and an anchor sequence; b) allowing the cell to be permeabilized, wherein at least a portion of the plurality of polynucleotides each bind to a different intracellular protein; c) providing to the first fluid a cell lysis agent, and a microparticle comprising: i) a plurality of protein detection probes, each comprising a binding site for a primer for a polymerase chain reaction (PCR), a cell barcode sequence that identifies the cell, a unique molecular identifier (UMI), and a sequence that hybridizes to the anchor sequence in the capture probe; or ii) a plurality of RNA detection probes, each comprising a binding site for a primer for a polymerase chain reaction (PCR), the cell barcode sequence, the UMI, and an RNA binding sequence; d) adding a second fluid to the first fluid; e) vortexing the fluid and performing cell lysis, forming a plurality of emulsion droplets, each emulsion droplet comprising a single cell and a single microparticle and allowing the capture probe of the polynucleotide to bind to the protein detection probe and the RNA to hybridize to the RNA detection probe of the microparticle; f) removing the second fluid and adding an agent for reverse transcription; g) conducting reverse transcription to generate i) a first analyte sequence comprising the binding site for a primer, cell barcode sequence, UMI, and the sequence that hybridizes to the anchor sequence in the capture probe; and a sequence that is complementary to the aptamer barcode sequence and the binding site for a primer from the capture probe of the polynucleotide; ii) a second analyte sequence comprising the binding site for a primer, cell barcode sequence, UMI, and the RNA binding sequence; and cDNA of the RNA; h) amplifying the first and second analyte sequences in the sample; andPCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT i) identifying the first and second analyte sequences, wherein the analyte sequences are distinguishable for each protein and RNA.

28. The method of claim 27, further comprising, after step (g), separating the first analyte sequences and the second analyte sequences.

29. The method of claim 27 or claim 28, wherein the anchor sequence that hybridizes to the protein detection probe is universal for the capture probe.

30. The method of any one of claims 27-29, wherein the anchor sequence comprises a poly-A oligonucleotide.31 . The method of any one of claims 27-30, wherein the RNA binding sequence comprises a poly-dT nucleotide sequence.

32. The method of any one of claims 27-31 , wherein the first and second analyte sequences are identified based on polymerase chain reaction (PCR) amplification and sequencing.

33. A method of detecting a plurality of different proteins and a plurality of different DNA sequences in a cell suspended in a first fluid, comprising: a) contacting the first fluid with a plurality of polynucleotides, wherein each polynucleotide comprises an aptamer and a capture probe, wherein each aptamer is capable of binding to a different protein, optionally wherein the plurality of different proteins comprise cell surface epitopes or intracellular proteins, wherein each capture probe comprises a binding site for a primer for nucleic acid amplification, an aptamer barcode sequence that identifies the aptamer, and an anchor sequence; b) allowing the cell to be permeabilized, wherein at least a portion of the plurality of polynucleotides each bind to a different intracellular protein; c) providing to the first fluid a cell lysis agent, a set of PCR reagents, a first and second set of primers, and a microparticle comprising: a) a plurality of protein detection probes, each comprising a binding site for a primer for a polymerase chain reaction (PCR), a cell barcode sequence that identifies the cell, and a first common sequence; b) a plurality of DNA detection probes, each comprising a binding site for a primer for a polymerase chain reaction (PCR), a cell barcode that identifies the cell, and a second common sequence;PCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT wherein the plurality of protein detection probes and the plurality of DNA detection probes are cleavably linked to the microparticle, optionally by a cleavable linker; d) adding a second fluid to the to the first fluid; e) vortexing the fluid and performing cell lysis, forming a plurality of emulsion droplets, each emulsion droplet comprising a single cell and a single microparticle; f) performing a first round of PCR using the first and second set of PCR primers, wherein: i) the first set of PCR primers comprises (1 ) a plurality of first primers comprising a sequence that hybridizes to the anchor sequence and a sequence that is complementary to the first common sequence; and (2) a plurality of second primers comprising a sequence that hybridizes to the region that is a binding site for a primer for nucleic acid amplification; ii) the second set of PCR primers comprises (1 ) a plurality of first primers comprising a sequence that hybridizes to a first gene-specific sequence of a target DNA sequence and a sequence that is complementary to the second common sequence; and (2) a plurality of second primers comprising a sequence that hybridizes to a second gene-specific sequence of a target DNA sequence and a sequence that is a binding site for a primer for nucleic acid amplification; g) releasing the plurality of protein detection probes and the plurality of DNA detection probes from the microparticle, optionally by cleaving the cleavable linker; h) performing a second round of PCR to generate i) a first analyte sequence comprising a binding site for a primer, cell barcode sequence, a first common sequence, a sequence that hybridizes to the anchor sequence, an aptamer barcode, and a sequence that is a binding site for a primer for nucleic acid amplification; and ii) a second analyte sequence comprising a binding site for a primer, cell barcode sequence, a second common sequence, the target DNA sequence, and a sequence that is a binding site for a primer for nucleic acid amplification; and i) identifying the first and second analyte sequences in the sample, wherein the analyte sequences are distinguishable for each protein and DNA.PCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT34. The method of claim 33, further comprising, after step (j), separating the first analyte sequences and the second analyte sequences.

35. The method of claim 33 or 34, wherein the anchor sequence that hybridizes to the protein detection probe is universal for the capture probe.

36. The method of any one of claims 33-35, wherein the anchor sequence comprises a poly-A oligonucleotide.

37. The method of any one of claims 33-36, wherein the first and second analyte sequences are identified based on polymerase chain reaction (PCR) amplification and sequencing.

38. The method of any one of claims 33-37, wherein the target DNA comprises one or more of a single nucleotide polymorphism (SNP), an insertion or deletion (indel), a copy number variant (CNV), or a tandem repeat.

39. The method of any one of claims 33-38, wherein the target DNA comprises a marker of open chromatin.

40. The method of any one of claims 33-39, wherein the target DNA comprises one or more methylated nucleotides.41 .A kit for multiplexed detection of a plurality of different proteins and a plurality of different RNAs from a sample comprising a) a plurality of polynucleotides, wherein each polynucleotide comprises an aptamer and a capture probe, wherein each aptamer is capable of binding to a different protein, wherein each capture probe comprises an aptamer barcode sequence that identifies the aptamer and an anchor sequence; and b) a plurality of microparticles, each microparticle comprising: i) a plurality of protein detection probes, each probe comprising a cell barcode sequence that identifies the cell, and a sequence that hybridizes to the anchor sequence in the capture probe; and ii) a plurality of RNA detection probes, each probe comprising the cell barcode sequence, and an RNA binding sequence.

42. The kit of claim 41 , wherein the plurality of protein detection probes each further comprise a binding site for a primer for a polymerase chain reaction (PCR) and a unique molecular identifier (UMI).

43. The kit of claim 42 or 43, wherein the plurality of RNA detection probes each further comprise a binding site for a primer for a polymerase chain reaction (PCR) and a unique molecular identifier (UMI).PCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT44. The method or kit of any one of claims 41-43, wherein the binding site for a primer comprises a common sequence to enable PCR amplification.

45. The method or kit of any one of claims 1-44, wherein the aptamer barcode sequences have a length of about 5-20 nucleotides.

46. The method or kit of any one of claims 1-45, wherein the cell barcode sequences have a length of about 5-20 nucleotides or about 10-15 nucleotides.

47. The method or kit of any one of claims 1-46, wherein the cell barcode sequences have a length of about 10-15 nucleotides.

48. The method or kit of any one of claims 1-47, wherein the anchor sequences are substantially identical, and optionally comprise a poly A sequence of at least 10 nucleotides in length.

49. The method or kit of any one of claims 1-48, wherein the anchor sequence is located 3 ' of the aptamer barcode sequence.

50. The method or kit of any one of claims 1-49, wherein the aptamer barcode sequence is located 3' of the binding site for a primer for PCR amplification.51 . The method or kit of any one of claims 1 -50, wherein the RNA is a messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), long noncoding RNA (IncRNA), microRNA (miRNA), small interfering RNA (siRNA), short nucleolar RNA (snoRNA), Piwi-interacting RNA (piRNA), small nuclear RNA (snRNA).

52. The method or kit of any one of claims 1 -51 , wherein each of the aptamer in the plurality of polynucleotides independently comprises 20-100, 20-90, 20-80, 20-70, 20-60, 20-50, 30-100, 30-90, 30-80, 30-70, 30-60, 40-100, 40-90, 40-80, 40-70, or 40-60 nucleotides.

53. The method or kit of any one of claims 1-52, wherein each of the aptamer in the plurality of polynucleotides independently comprises 30-90 nucleotides.

54. The method or kit of any one of claims 1-53, wherein each of the aptamer in the plurality of polynucleotides independently comprise at least one, at least two, at least three, at least four, or at least five C-5 modified nucleobases.

55. The composition of claim 54, wherein the modified nucleobase is selected from 5- (N-benzylcarboxamide) (“Bn”)-cytosine, 5-(N-2-phenylethylcarboxamide) (“PE”)- cytosine, 5-(N-3-phenylpropylcarboxamide (“PP”)-cytosine, 5-(N-1- naphthylmethylcarboxamide) (“Nap”)-cytosine, 5-(N-2-naphthylmethylcarboxamide) (“2Nap”)-cytosine, 5-(N-1-naphthyl-2 -ethylcarboxamide) (“NE”)-cytosine, 5-(N- tyrosylcarboxamide) (”Tyr”)-cytosine, Bn-uracil, Nap-uracil, PE-uracil, 5-(N- isobutylcarboxamide) (“lb”)-uracil, 5-(N-4-fluoro-benzylcarboxamide) (“FBn”)-uracil,PCT / US25 / 46509 16 September 2025 (16.09.2025)Attorney Docket No. 01137-0100-00PCT 2Nap-uracil, NE-uracil, 5-(N-3,4-methylenedioxybenzylcarboxamide) (“MBn”)-uracil, 5-(N-3-benzofuranylethylcarboxamide) (“BF”)-uracil, 5-(N-3- benzothiophenylethylcarboxamide) (“BT”)-uracil, 5-(N-3-phenylpropylcarboxamide) (“PP”)-uracil, 5-(N-morpholinoethylcarboxamide) (“MOE”)-uracil, Tyr-uracil, 5-(N-3- indole-2-ethylcarboxamide) (“Trp”)-uracil, 5-(n-(R)-2-hydrozypropylcarboxamide) (“Thr”)-uracil, 5-(N-((1 ,1’-biphenyl)-4-yl)ethylcarboxamide) “BPE”-uracil, 5-(N-4- phenylbenzylcarboxamide) (“PBn”)-uracil, 5-(N-4-phenoxybenzylcarboxamide) (“POP”)-uracil, 5-(N-3,3-diphenylpropylcarboxamide) (“DPP”)-uracil, 5-(N-3- phenylbenzylcarboxamide) (“DBM”)-uracil, 5-(N-benzylhydrylcarboxamide) (“BH”)- uracil, BPE-cytosine, PBn-cytosine, POP-cytosine, DPP-cytosine, DBM-cytosine, and BH-cytosine.

Images