Anti-CLL-1 nanobody and use thereof

Abstract

Provided are an antibody or an antigen-binding fragment thereof that specifically binds to CLL-1, a multispecific antigen-binding molecule, a chimeric antigen receptor, an immune effector cell, a nucleic acid fragment, a vector, a host cell, a pharmaceutical composition, a kit, a preparation method, and the use thereof in treating diseases and detecting CLL-1.

Description

Anti-cll-1 nanobodies and uses thereof TECHNICAL FIELD

[0001] The present application relates to the field of biological medicine, in particular, it relates to an anti-CLL-1 nanobody and uses thereof. BACKGROUND

[0002] CLL-1 belongs to the V group of C-type lectin receptor family, also known as CLEC12A, MICL, DCAL-2 or CD371. The human gene encoding CLL-1 is mapped to 12p13, located in the NK gene complex containing NKG2R, low density lipoprotein receptor-1 (LOX-1) and beta-glucan receptor (BGR), CLL-1 is highly homologous to LOX-1 and BGR. The size of CLL-1 gene is about 31 kDa, encoding a polypeptide containing 265 amino acids. CLL-1 is a type II transmembrane glycoprotein, consisting of a single extracellular carbohydrate recognition domain with 6 N-glycosylation sites, a transmembrane region and an intracellular NH2 terminal with I / VXYXXL and YXXM sequences. I / VXYXXL has the function of ITIM, which plays a negative role in cell activation by recruiting Src homology domain phosphatase (SHP)-1 and SHP-2 with inhibitory effect.

[0003] Acute myeloid leukemia (AML) is the most common and most deadly hematological malignancy in adult patients, and the prognosis of most patients is poor. Although immunotherapy plays an important role in the field of hematological tumors and solid tumors at this stage, due to the lack of high specificity target antigen and the heterogeneity of AML, the progress of immunotherapy in AML is very slow, and the current treatment of AML is still mainly chemotherapy and hematopoietic stem cell transplantation, and it is urgent to develop new methods to improve the prognosis of AML.

[0004] CLL-1 is mainly expressed in myeloid cells such as granulocytes and monocytes, and is almost not expressed in T, B, NK cells and red blood cells and their precursors. CLL-1 is highly expressed in most AML leukemia cells, and is expressed in 90% of AML cells, but is not expressed in CD34 + CD38 - CD34 + CD38 -CD33 and CD34 are classic biomarkers of AML, and CLL-1 expression is significantly higher than CD34 and comparable to CD33 in AML patients. CLL-1 expression on leukemic stem cells (LSCs) is significantly higher than that on normal hematopoietic stem cells (HSCs). Larsen et al. found that the expression of CLL-1 is limited to myeloid cells compared to other stem cell antigens, which indicates that CLL-1 can be used as a marker for AML diagnosis. In addition, the expression of CLL-1 is stable throughout the course of the disease, and there is no difference in expression between the diagnosis sample and the relapse sample of the same patient. Therefore, CLL-1 can be one of the important molecular markers for detecting minimal residual disease (MRD) of AML stem cells. CLL-1 expression can also be associated with other myeloid leukemias, such as acute myelomonocytic leukemia, acute monocytic leukemia, acute primary myeloblasts leukemia, chronic myelogenous leukemia (CML), and myelodysplastic syndrome (MDS).

[0005] Despite the increasing understanding of the molecular genetics of related diseases in the prior art, relatively few new therapies have been approved for AML. Therefore, there is still a need for new therapeutic agents for AML, such as therapeutic agents targeting CLL-1. The special expression pattern of CLL-1 makes it one of the potential targets for immunotherapy of AML. However, there is still a lack of antibodies targeting CLL-1 with high specificity and high affinity on the market. Currently, five CLL-1xCD3 bispecific antibodies are in development, and the fastest one is QLF32101 (Qilu Pharmaceutical Co., Ltd.) in clinical phase I. Another product, Tepoditamab, has terminated development because its clinical phase I study did not achieve the expected efficacy, and the other three have not yet entered the clinical research stage. Among the above five bispecific antibodies, the types of CLL-1 targeting antibodies are all Fab, and there is currently no llama single-domain antibody (nanobody) drug targeting human CLL-1 that has entered the clinical research stage.

[0006] Nanobody (Nb) is a genetically engineered antibody containing only a single domain. In 1993, Belgian scientist Hamers-Casterman C discovered a natural heavy chain antibody containing only heavy chains without light chains in the blood of camels (Hamers Casterman C, Atarhouch T, Muyldermans S, Robinson G, Hamers C, Songa EB, et al. Naturally occurring antibodies devoid of light chains. Nature. 363(6428):446-8 (1993)). Compared with ordinary antibodies, heavy chain antibodies lack light chains, but still retain the ability to bind antigens. After cloning the variable region of heavy chain antibodies in camels, a single domain antibody (sdAb) consisting of only one heavy chain variable region, called nanobody or VHH antibody (variable heavy chain domain of a heavy chain antibody), is obtained. Nanobody not only has a molecular weight of only 1 / 10 of ordinary antibodies, but also has more flexible chemical properties, good stability, high solubility, high expression, high tumor tissue penetration, and easy coupling with other molecules. Therefore, nanobody technology has broad prospects for the development of therapeutic antibodies for CLL-1. SUMMARY

[0007] The present application provides an antibody or antigen-binding fragment thereof, multispecific antigen-binding molecule, chimeric antigen receptor, immune effector cell, nucleic acid fragment, vector, host cell, pharmaceutical composition, kit, preparation method and application thereof in treating diseases and detecting CLL-1, which specifically binds to CLL-1.

[0008] In some embodiments, the nanobody or antigen-binding fragment thereof that specifically binds to CLL-1 comprises a combination of complementarity-determining regions (CDRs), which comprises: CDR1, CDR2 and CDR3; the CDR1 comprises HCDR1 of the VHH domain as shown in any one of SEQ ID NOs: 1-20, the CDR2 comprises HCDR2 of the VHH domain as shown in any one of SEQ ID NOs: 21-44, and the CDR3 comprises HCDR3 of the VHH domain as shown in any one of SEQ ID NOs: 45-73, each of the CDR1, CDR2 and CDR3 is encoded by the IMGT analysis method.

[0009] In some embodiments, the Nanobodies or antigen-binding fragments thereof specifically binding to CLL-1 comprise a combination of CDRs comprising: a CDR1, a CDR2 and a CDR3; said CDR1, CDR2 and CDR3 having any sequence combination selected from the group consisting of:

[0010] Table 1. CDR sequence coding according to IMGT analysis method

[0011] Each CDR1, CDR2 and CDR3 is coded according to the IMGT consensus analysis method, preferably said substitution is a substitution of a conserved amino acid.

[0012] In particular, the Nanobodies or antigen-binding fragments of the application are, for example, coded according to the IMGT analysis method, wherein:

[0013] (1) said CDR1, CDR2 and CDR3 are respectively as shown in SEQ ID NO: 1, 21, 45;

[0014] (2) said CDR1, CDR2 and CDR3 are respectively as shown in SEQ ID NO: 2, 22, 46;

[0015] (3) said CDR1, CDR2 and CDR3 are respectively as shown in SEQ ID NO: 2, 23, 47;

[0016] (4) said CDR1, CDR2 and CDR3 are respectively as shown in SEQ ID NO: 3, 24, 48;

[0017] (5) said CDR1, CDR2 and CDR3 are respectively as shown in SEQ ID NO: 2, 25, 49;

[0018] (6) said CDR1, CDR2 and CDR3 are respectively as shown in SEQ ID NO: 4, 26, 50;

[0019] (7) said CDR1, CDR2 and CDR3 are respectively as shown in SEQ ID NO: 5, 27, 51;

[0020] (8) said CDR1, CDR2 and CDR3 are respectively as shown in SEQ ID NO: 2, 25, 47;

[0021] (9) the CDR1, CDR2 and CDR3 are respectively as shown in the sequences of SEQ ID NO: 3, 28, 52;

[0022] (10) the CDR1, CDR2 and CDR3 are respectively as shown in the sequences of SEQ ID NO: 6, 27, 53;

[0023] (11) the CDR1, CDR2 and CDR3 are respectively as shown in the sequences of SEQ ID NO: 7, 29, 54;

[0024] (12) the CDR1, CDR2 and CDR3 are respectively as shown in the sequences of SEQ ID NO: 2, 25, 55;

[0025] (13) the CDR1, CDR2 and CDR3 are respectively as shown in the sequences of SEQ ID NO: 8, 30, 56;

[0026] (14) the CDR1, CDR2 and CDR3 are respectively as shown in the sequences of SEQ ID NO: 9, 31, 57;

[0027] (15) the CDR1, CDR2 and CDR3 are respectively as shown in the sequences of SEQ ID NO: 2, 25, 47;

[0028] (16) the CDR1, CDR2 and CDR3 are respectively as shown in the sequences of SEQ ID NO: 1, 32, 58;

[0029] (17) the CDR1, CDR2 and CDR3 are respectively as shown in the sequences of SEQ ID NO: 3, 33, 59;

[0030] (18) the CDR1, CDR2 and CDR3 are respectively as shown in the sequences of SEQ ID NO: 2, 25, 55;

[0031] (19) the CDR1, CDR2 and CDR3 are respectively as shown in the sequences of SEQ ID NO: 2, 25, 60;

[0032] (20) the CDR1, CDR2 and CDR3 are respectively as shown in the sequences of SEQ ID NO: 10, 34, 61;

[0033] (21) the CDR1, CDR2 and CDR3 are respectively as shown in the sequences of SEQ ID NO: 11, 35, 62;

[0034] (22) the CDR1, CDR2 and CDR3 are respectively as shown in the sequences of SEQ ID NO: 10, 36, 63;

[0035] (23) the CDR1, CDR2 and CDR3 are respectively as set forth in SEQ ID NO: 12, 25, 64;

[0036] (24) the CDR1, CDR2 and CDR3 are respectively as set forth in SEQ ID NO: 13, 37, 65;

[0037] (25) the CDR1, CDR2 and CDR3 are respectively as set forth in SEQ ID NO: 14, 38, 66;

[0038] (26) the CDR1, CDR2 and CDR3 are respectively as set forth in SEQ ID NO: 3, 39, 67;

[0039] (27) the CDR1, CDR2 and CDR3 are respectively as set forth in SEQ ID NO: 15, 40, 68;

[0040] (28) the CDR1, CDR2 and CDR3 are respectively as set forth in SEQ ID NO: 16, 27, 51;

[0041] (29) the CDR1, CDR2 and CDR3 are respectively as set forth in SEQ ID NO: 17, 41, 69;

[0042] (30) the CDR1, CDR2 and CDR3 are respectively as set forth in SEQ ID NO: 18, 42, 70;

[0043] (31) the CDR1, CDR2 and CDR3 are respectively as set forth in SEQ ID NO: 1, 32, 71;

[0044] (32) the CDR1, CDR2 and CDR3 are respectively as set forth in SEQ ID NO: 19, 43, 72;

[0045] (33) the CDR1, CDR2 and CDR3 are respectively as set forth in SEQ ID NO: 20, 44, 73; or,

[0046] (34) the CDR1, CDR2 and CDR3 are a sequence combination having 1, 2, 3 or more amino acid insertions, deletions and / or substitutions compared to the sequence combinations of (1)-(33) above; preferably substitutions, more preferably substitutions of conserved amino acid residues.

[0047] In another specific embodiment, the present application provides an antibody or antigen binding fragment comprising:

[0048] (1) the variable region has the sequence set forth in SEQ ID NOs: 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, or 106;

[0049] (2) an amino acid sequence having at least 90% identity, preferably at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the sequence set forth in (1) above; or,

[0050] (3) the framework regions of the Nanobody or antigen binding fragment have at least 90% identity, preferably at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the framework regions of the amino acid sequence set forth in SEQ ID NOs: 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, or 106.

[0051] In a preferred embodiment, the antibody or antigen binding fragment thereof of the present application binds to human CLL-1 with a dissociation constant (K D ) of no more than 10 -7 nM, and binds to cynomolgus monkey CLL-1 with a dissociation constant (K D ) of no more than 10 -8 nM.

[0052] Optionally, the Nanobody or antigen binding fragment binds to or does not bind to monkey CLL-1 protein.

[0053] Optionally, the Nanobody or antigen binding fragment binds to or does not bind to murine CLL-1 protein.

[0054] In a preferred embodiment, the antibody or antigen binding fragment thereof of the present application comprises the sequence of the constant region of any one of human or murine antibody IgGl, IgG2, IgG3, IgG4, IgA, IgM, IgE, or IgD; preferably the constant region of human or murine antibody IgGl, IgG2, IgG3, or IgG4.

[0055] In a preferred embodiment, the antibody or antigen binding fragment thereof of the present application further comprises a heavy chain constant region sequence without a CH1 fragment.

[0056] In a preferred embodiment, the antibody or antigen-binding fragment thereof of the present application further comprises a heavy chain constant region sequence having a CH2 and CH3 fragment, or, the antibody or antigen-binding fragment further comprises an antibody Fc region;

[0057] the antibody constant region or antibody Fc region is linked to the antibody or antigen-binding fragment with or without a linker peptide;

[0058] optionally, the antibody constant region or antibody Fc region is from a Camelid, a mouse, a rat, a rabbit, a sheep or a human;

[0059] optionally, the antibody constant region or antibody Fc region is from an IgG, IgA, IgM, IgD or IgE.

[0060] In a preferred embodiment, the antibody or antigen-binding fragment thereof of the present application is chimeric or humanized or fully human; preferably, the antibody or antigen-binding fragment is selected from a monoclonal antibody, a polyclonal antibody, a natural antibody, an engineered antibody, a monospecific antibody, a multispecific antibody (e.g. a bispecific antibody), a monovalent antibody, a multivalent antibody, a full-length antibody, an antibody fragment, a naked antibody, a conjugated antibody, a humanized antibody, a fully human antibody, a Fab, a Fab’, a F(ab’)2, a Fd, a Fv, a scFv, a diabody or a single domain antibody.

[0061] In a preferred embodiment, the antibody or antigen-binding fragment thereof of the present application is further coupled to a therapeutic agent or a tracer; preferably, the therapeutic agent is selected from a radioisotope, a chemotherapeutic drug or an immunomodulatory agent, and the tracer is selected from a radiological contrast agent, a paramagnetic ion, a metal, a fluorescent label, a chemiluminescent label, an ultrasound contrast agent or a photosensitizer.

[0062] In a preferred embodiment, the present application further provides a multispecific antigen binding molecule; preferably, the multispecific antigen binding molecule comprises a first antigen binding module and a second antigen binding module, the first antigen binding module comprising the antibody or antigen-binding fragment of any one of the above, and the second antigen binding module specifically binds to an antigen other than CLL-1 or binds to a different CLL-1 epitope than the first antigen binding module;

[0063] Preferably, the other antigen is selected from CD3, PD-1, PD-L1, Her2, EpCAM, CD16, CD20, CD30, CD33, CD47, CD52, CD64, CD133, CEA, gpA33, Mucins, TAG-72, CIX, PSMA, folate-binding protein, GD2, GD3, GM2, VEGF, VEGFR, Integrin, aVb3, a5b1, ERBB2, ERBB3, MET, IGF1R, EPHA3, TRAILR1, TRAILR2, RANKL, or FAP.

[0064] Preferably, the multispecific antibody is a "bispecific", "trispecific", or "quadrspecific".

[0065] In some embodiments, the antibody or antigen-binding fragment thereof of the present application can induce target cell death through antibody-dependent cellular cytotoxicity (ADCC).

[0066] In a preferred embodiment, the present application provides a chimeric antigen receptor (CAR); preferably, the chimeric antigen receptor comprises at least an extracellular antigen binding domain, a transmembrane domain, and an intracellular signaling domain, the extracellular antigen binding domain comprising the CLL-1 antibody or antigen-binding fragment of any of the above.

[0067] In a preferred embodiment, the present application provides an immune effector cell; preferably, the immune effector cell comprises the chimeric antigen receptor of any of the above or a nucleic acid fragment comprising the chimeric antigen receptor of any of the above.

[0068] Preferably, the immune effector cell is selected from a T cell, a NK cell, a NKT cell, a monocyte, a macrophage, a dendritic cell, or a mast cell; the T cell can be selected from an inflammatory T cell, a cytotoxic T cell, a regulatory T cell (Treg), or a helper T cell.

[0069] Preferably, the immune effector cell is an allogeneic immune effector cell or an autologous immune cell.

[0070] In a preferred embodiment, the present application provides an isolated nucleic acid molecule encoding the Nanobody, antigen-binding fragment, or any combination thereof of any of the above, the multispecific antigen-binding molecule of any of the above, or the chimeric antigen receptor of any of the above.

[0071] In some embodiments, the present application provides an expression vector comprising the above-described isolated nucleic acid molecule of the present application.

[0072] In some embodiments, the present application provides a host cell comprising the above-described isolated nucleic acid molecule or expression vector of the present application.

[0073] In a preferred embodiment, the host cell is a eukaryotic cell or a prokaryotic cell; more preferably, the host cell is derived from a mammalian cell, a yeast cell, an insect cell, E. coli, and / or B. subtilis; more preferably, the host cell is selected from HEK293E or Chinese hamster ovary (CHO) cells.

[0074] In some embodiments, the present application provides a method of producing an antibody or antigen-binding fragment or a multispecific antigen-binding molecule, culturing the above-described host cell of the present application under appropriate conditions, and isolating the antibody or antigen-binding fragment or the multispecific antigen-binding molecule.

[0075] In some embodiments, the present application provides a method of producing an immune effector cell, introducing the above-described nucleic acid fragment of the CAR into the immune effector cell, preferably, the method further comprises initiating the expression of the above-described CAR by the immune effector cell.

[0076] In some embodiments, the present application provides a pharmaceutical composition, the composition comprising the above-described antibody or antigen-binding fragment of the present application, the above-described multispecific antigen-binding molecule of the present application, the above-described chimeric antigen receptor of the present application, the above-described immune effector cell of the present application, the above-described isolated nucleic acid molecule of the present application, the above-described expression vector of the present application, the above-described cell of the present application, or the product produced by the above-described method of the present application (e.g., antibody and antigen-binding fragment), and a pharmaceutically acceptable carrier.

[0077] In a preferred embodiment, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier, diluent, or adjuvant; more preferably, the pharmaceutical composition further comprises an additional anti-tumor agent.

[0078] In some embodiments, the present application provides a method of preventing and / or treating a CLL-1 mediated disease, comprising administering to a patient in need thereof an antibody or antigen binding fragment described above, a multispecific antigen binding molecule described above, a chimeric antigen receptor described above, an immune effector cell described above, an isolated nucleic acid molecule described above, an expression vector described above, a cell described above, a product of a method described above, or a pharmaceutical composition described above; the CLL-1 mediated disease is a myeloid leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute primary myelocytic leukemia, chronic myelogenous leukemia (CML), or a disease associated with myelodysplastic syndrome (MDS).

[0079] In some embodiments, the present application provides the use of an antibody or antigen binding fragment described above, a multispecific antigen binding molecule described above, a chimeric antigen receptor described above, an immune effector cell described above, an isolated nucleic acid molecule described above, an expression vector described above, a cell described above, a product of a method described above (e.g., antibodies and antigen binding fragments), or a pharmaceutical composition described above for the preparation of a medicament for preventing and / or treating a CLL-1 mediated disease, preferably a myeloid leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute primary myelocytic leukemia, chronic myelogenous leukemia (CML), or a disease associated with myelodysplastic syndrome (MDS).

[0080] In some embodiments, the present application provides the use of an antibody or antigen binding fragment described above, a multispecific antigen binding molecule described above, a chimeric antigen receptor described above, an immune effector cell described above, an isolated nucleic acid molecule described above, an expression vector described above, a cell described above, a product of a method described above (e.g., antibodies and antigen binding fragments), or a pharmaceutical composition described above for the preparation of a medicament for preventing and / or treating a CLL-1 mediated disease, preferably a myeloid leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute primary myelocytic leukemia, chronic myelogenous leukemia (CML), or a disease associated with myelodysplastic syndrome (MDS).

[0081] In some embodiments, the present application provides a kit comprising an antibody or antigen binding fragment described above, a multispecific antigen binding molecule described above, a chimeric antigen receptor described above, an immune effector cell described above, an isolated nucleic acid molecule described above, an expression vector described above, a cell described above, or a product of a method described above (e.g., antibodies and antigen binding fragments), or a pharmaceutical composition described above, and instructions for use.

[0082] The present application provides a nanobody with high binding affinity to CLL-1 protein, which can specifically bind to human CLL-1 positive cells, can be used not only for detecting the expression of CLL-1 in patients with diseases related to CLL-1 as a target, such as myeloid leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute primary myelocytic leukemia, chronic myeloid leukemia (CML) and myelodysplastic syndrome (MDS), but also can mediate the killing and phagocytosis of immune cells to CLL-1 positive cells, and can be used as a therapeutic agent targeting CLL-1. Meanwhile, the nanobody of the present application can also be made into an immune complex or a pharmaceutical composition for preventing or treating diseases related to CLL-1 as a target, or a detection reagent or kit for CLL-1 protein, which has important significance and broad application prospects in the fields of clinical diagnosis, prevention and treatment, and can fill the treatment gap of the above-mentioned related diseases.

[0083] Definitions and explanations of terms

[0084] Unless otherwise defined, all terms used herein have the meanings commonly understood by those of ordinary skill in the art. For terms specifically defined herein, the definitions shall control over any dictionary or other commonly understood meanings.

[0085] As used herein, the term "antibody" (Ab) refers to an immunoglobulin molecule that specifically binds to or is immunoreactive with a target antigen, including polyclonal, monoclonal, genetically engineered, and other modified forms of antibodies (including, but not limited to, chimeric antibodies, humanized antibodies, fully human antibodies, heteroconjugate antibodies (e.g., bispecific, trispecific, and tetraspecific antibodies, diabodies, triabodies, and tetrabodies), antibody conjugates, and antigen binding fragments of antibodies (including, for example, Fab', F(ab')2, Fab, Fv, rlgG, and scFv fragments). In addition, unless otherwise specified, the term "monoclonal antibody" (mAb) is intended to include both intact antibody molecules as well as non-intact antibody fragments (such as Fab and F(ab')2 fragments, which lack the Fc fragment of intact antibodies (clear more rapidly from animal circulation), and thus lack Fc-mediated effector functions (see, e.g., Wahl et al., J. Nucl. Med. 24:316, 1983; the contents of which are incorporated herein by reference).

[0086] An "antibody" herein can be derived from any animal, including but not limited to human and non-human animals, which can be selected from primates, mammals, rodents, and vertebrates, such as a camelid, a llama, an ostrich, an alpaca, a sheep, a rabbit, a mouse, a rat, or a cartilaginous fish (e.g., a shark).

[0087] The term "native antibody" herein refers to an antibody manufactured and paired by an immune system of a multicellular organism. The term "engineered antibody" herein refers to a non-native antibody obtained by genetic engineering, antibody engineering, and the like. Exemplarily, an "engineered antibody" includes a humanized antibody, a small molecule antibody (e.g., scFv, etc.), a bispecific antibody, and the like.

[0088] The term "monospecific" herein refers to having one or more binding sites, wherein each binding site binds to the same epitope of the same antigen.

[0089] The term "multispecific" herein refers to having at least two antigen binding sites, each of which binds to a different epitope of the same antigen or to different epitopes of different antigens. Thus, terms such as "bispecific," "trispecific," "tetraspecific," and the like refer to the number of different epitopes to which an antibody / antigen binding molecule can bind.

[0090] The term "valency" herein denotes the presence of a specified number of binding sites in an antibody / antigen binding molecule. Thus, the terms "monovalent", "bivalent", "tetravalent" and "hexavalent" denote the presence of one binding site, two binding sites, four binding sites and six binding sites, respectively, in the antibody / antigen binding molecule.

[0091] "Full-length antibody", "intact antibody" and "whole antibody" are used interchangeably herein to refer to an antibody having a structure substantially similar to a native antibody structure.

[0092] As used herein, the term "antigen binding fragment" refers to one or more fragments of an antibody that retain the ability to specifically bind to a target antigen. The antigen binding function of an antibody can be performed by fragments of a full-length antibody. Antibody fragments can be Fab, F(ab')2, scFv, SMIP, diabody, triabody, affibody, nanobody, aptamer, or domain antibody. Examples of binding fragments encompassed by the term "antigen binding fragment" of an antibody include, but are not limited to: (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL, and CH1 domains; (ii) a F(ab)2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CH1 domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody; (v) a dAb comprising a VH and VL domain; (vi) a dAb fragment that consists of a VH domain (Ward et al., Nature 341 :544-546, 1989); (vii) a dAb consisting of a VH or VL domain; (viii) an isolated complementarity determining region (CDR); and (ix) a combination of two or more isolated CDRs, which can optionally be linked by a synthetic linker. Moreover, although the two domains of the Fv fragment, VL and VH, are coded for by separate genes, they can be joined, using recombinant methods, by a linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see e.g., Bird et al., Science 242:423-426, 1988 and Huston et al., Proc. Natl. Acad. Sci. USA 85:5879-5883, 1988). These antibody fragments are obtained using conventional techniques known to those with skill in the art, and the fragments are screened for utility in the same manner as are intact antibodies. Antigen binding fragments can be produced by recombinant DNA techniques, enzymatic or chemical cleavage of intact immunoglobulins, or in some embodiments, by chemical peptide synthesis procedures known in the art.

[0093] As used herein, the term "CLL-1" refers to C-type lectin-like molecule-1, which is a detectable antigenic determinant on leukemic precursor cells and normal immune cells. C-type lectin-like-1 (CLL-1) is also known as MICL, CLEC12A, CLEC-1, dendritic cell-associated lectin 1, and DCAL-2. Human and murine amino acid and nucleic acid sequences can be found in public databases, such as GenBank, UniProt, and Swiss-Prot. For example, the amino acid sequence of human CLL-1 can be found at UniProt / Swiss-Prot Accession No. Q5QGZ9, and the nucleotide sequence encoding human CLL-1 can be found at Accession Nos. NM_001207010.1, NM_138337.5, NM_201623.3, and NM_201625.1. In one embodiment, the antigen binding moiety of the CAR recognizes and binds to an epitope within the extracellular domain of a CLL-1 protein or fragment thereof. In one embodiment, the CLL-1 protein is expressed on a cancer cell.

[0094] As used herein, the term "bispecific antibody" refers to an antibody, which is typically a human or humanized antibody, having monoclonal binding specificity for at least two different antigens. In the present application, one of the binding specificities can be detected against an antigenic epitope of CLL-1 and the other can be detected against another antigenic epitope of CLL-1 or any other antigen than CLL-1, such as against a cell surface protein, receptor, receptor subunit, tissue specific antigen, virus-derived protein, virus-encoded envelope protein, bacteria-derived protein, or bacterial surface protein, etc.

[0095] As used herein, the term "chimeric" antibody refers to an antibody having variable sequences derived from an immunoglobulin of one source organism, such as a rat or mouse, and constant regions derived from an immunoglobulin of a different organism, such as a human. Methods for producing chimeric antibodies are known in the art. See, e.g., Morrison, 1985, Science 229(4719): 1202-7; Oi et al., 1986, Bio Techniques 4:214-221; Gillies et al., 1985 J Immunol Methods 125: 191-202; all incorporated herein by reference.

[0096] As used herein, the term "heavy chain antibody" refers to an antibody that lacks a light chain of a conventional antibody. The term specifically includes, but is not limited to, a homodimeric antibody comprising a VH antigen binding domain in the absence of a CH1 domain, as well as CH2 and CH3 constant domains.

[0097] As used herein, the term "nanobody" refers to naturally occurring heavy chain antibodies devoid of light chains in camels, cloning of the variable region of which can result in single domain antibodies consisting of only a heavy chain variable region, also called VHH (Variable domain of heavy chain of heavy chain antibody), which is the smallest functional antigen binding fragment. For further description of VHHs and nanobodies, reference is made to the review article by Muyldermans (2001, Reviews in Molecular Biotechnology 74:277-302), and to the following patent applications mentioned as general background art: WO 94 / 04678, WO 95 / 04079 and WO 96 / 34103 to Free University of Brussels; WO 94 / 25591, WO 99 / 37681, WO 00 / 40968, WO 00 / 43507, WO 00 / 65057, WO 01 / 40310, WO 01 / 44301, EP 1 134 231 and WO 02 / 48193 to Unilever; WO 97 / 49805, WO 01 / 21817, WO 03 / 035694, WO 03 / 054016 and WO 03 / 055527 to Vlaams Instituut voor Biotechnologie (VIB); WO 03 / 050531 to Algonomics N.V. and Ablynx N.V.; WO 01 / 90190 to National Research Council of Canada; WO 03 / 025020 (= EP 1 433 793) to Institute of Antibodies; and WO 04 / 041867, WO 04 / 041862, WO 04 / 041865, WO 04 / 041863, WO 04 / 062551, WO 05 / 044858, WO 06 / 40153, WO 06 / 079372, WO 06 / 122786, WO 06 / 122787 and WO 06 / 122825 to Ablynx N.V., and further published patent applications by Ablynx N.V. Reference is also made to additional prior art mentioned in these applications, in particular to the list of references mentioned on pages 41-43 of international application WO 06 / 040153, which list and references are incorporated herein by reference. As described in these references, nanobodies, in particular VHH sequences and partially humanized nanobodies, can be characterized inter alia by the presence of one or more "signature residues" in one or more framework sequences.Further descriptions of Nanobodies can be found, for example, in WO 08 / 101985 and WO 08 / 142164, including humanization and / or camelization of Nanobodies, as well as other modifications, portions or fragments, derivatives or “Nanobody fusions”, multivalent constructs (including some non-limiting examples of linker sequences) and different modifications to increase the half-life of Nanobodies and their formulations. For further general descriptions of Nanobodies, reference is made to the prior art cited herein, for example as described in WO 08 / 020079 (page 16).

[0098] As used herein, the term “complementarity determining region” (CDR) refers to the hypervariable regions found in both light and heavy chain variable domains. The more conserved portions of variable domains are referred to as framework regions (FR). As understood in the art, the amino acid positions that represent the hypervariable regions of an antibody can vary depending on the context and the various definitions known in the art. Some positions within the variable domains can be considered hybrid hypervariable positions, as these positions can be considered to be within a hypervariable region under one set of criteria (such as IMGT or KABAT), while being considered outside of a hypervariable region under a different set of criteria (such as KABAT or IMGT). One or more of these positions can also be found in extended hypervariable regions. The present invention includes antibodies comprising modifications in these hybrid hypervariable positions. The variable domains of the naturally occurring heavy and light chains each comprise four framework regions joined by three CDRs (CDR1, CDR2, and CDR3), which form loops connecting, and in some cases forming part of, the framework structure. The CDRs in each chain are held together in close proximity by the FR regions and with CDRs from other antibody chains contribute to the formation of the antigen binding site of antibodies (see Kabat et al. Sequences of Protein of Immunological Interest, National Institute of Health, Bethesda, Md. 1987; which is incorporated herein by reference). For example, herein, CDR1-VH, CDR2-VH, and CDR3-VH refer to the first, second, and third CDRs, respectively, of the heavy chain variable region (VH), which three CDRs make up the CDR combination of the heavy chain (or variable region thereof) (VH CDR combination); CDR1-VL, CDR2-VL, and CDR3-VL refer to the first, second, and third CDRs, respectively, of the light chain variable region (VL), which three CDRs make up the CDR combination of the light chain (or variable region thereof) (VL CDR combination).

[0099] As used herein, the term "monoclonal antibody" refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and is not limited to the manner in which the antibody is made.

[0100] As used herein, the term "VH" refers to the variable region of an immunoglobulin heavy chain of an antibody (including the heavy chain of an Fv, scFv, or Fab). The term "VL" refers to the variable region of an immunoglobulin light chain (including the light chain of an Fv, scFv, dsFv, or Fab).

[0101] The term "heavy chain constant region" herein refers to the carboxy-terminal portion of an antibody heavy chain that is not directly involved in binding of the antibody to an antigen, but exhibits effector functions, such as interaction with Fc receptors, which has a more conserved amino acid sequence relative to the variable domains of the antibody. The "heavy chain constant region" comprises at least one of the following: a CH1 domain, a hinge region, a CH2 domain, a CH3 domain, or a variant or fragment thereof. The "heavy chain constant region" includes both "full length heavy chain constant region" and "heavy chain constant region fragment", the former having substantially similar structure as the native antibody constant region, while the latter includes only "a portion of the full length heavy chain constant region". Exemplarily, a typical "full length antibody heavy chain constant region" consists of a CH1 domain-hinge region-CH2 domain-CH3 domain; when the antibody is IgE, it further includes a CH4 domain; when the antibody is a heavy chain antibody, it does not include a CH1 domain. Exemplarily, a typical "heavy chain constant region fragment" can be selected from a CH1, Fc, or CH3 domain.

[0102] The term "light chain constant region" herein refers to the carboxy-terminal portion of an antibody light chain that is not directly involved in binding of the antibody to an antigen, which can be selected from a constant kappa domain or a constant lambda domain.

[0103] The term "Fc" herein refers to the carboxy-terminal portion of an intact antibody that results from proteolytic digestion with papain, which typically includes the CH3 and CH2 domains of an antibody. The Fc region includes, e.g., native sequence Fc regions, recombinant Fc regions, and variant Fc regions. Although the boundaries of the Fc region of an immunoglobulin heavy chain might vary slightly, the Fc region of a human IgG heavy chain typically extends from the amino acid residue of Cys226 or from Pro230 to the carboxy-terminus thereof. The C-terminal lysine (residue 447 according to EU numbering system) of the Fc region can be removed, e.g., during production or purification of the antibody, or by recombinantly engineering the nucleic acid encoding the antibody heavy chain, and therefore, the Fc region can or can not include Lys447.

[0104] The term "humanized antibody" herein refers to a non-human antibody that has been genetically engineered to have an amino acid sequence that is modified to increase homology to the sequence of a human antibody. Typically, a humanized antibody has all or a portion of the CDR regions from a non-human antibody (donor antibody) and all or a portion of the non-CDR regions (e.g., variable region FR and / or constant region) from a human immunoglobulin (acceptor antibody). A humanized antibody typically retains or partially retains the desired properties of the donor antibody, including but not limited to, antigen specificity, affinity, reactivity, ability to enhance immune cell activity, ability to enhance immune response, etc.

[0105] The term "fully human antibody" herein refers to an antibody having a variable region in which both the FR and CDR are derived from human germline immunoglobulin sequences. Furthermore, if the antibody comprises a constant region, the constant region is also derived from human germline immunoglobulin sequences. A fully human antibody herein can include amino acid residues that are not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by in vitro random or site-specific mutagenesis or by in vivo somatic mutation). However, a "fully human antibody" herein is not intended to include antibodies in which CDR sequences derived from the germline of another mammalian species (e.g., mouse) have been grafted onto human framework sequences.

[0106] The term "naked antibody" herein refers to an antibody that is not linked, fused, or conjugated to another agent or molecule (e.g., a label or drug), peptide, or polypeptide. In particular embodiments, a naked antibody expressed by a mammalian host cell can be glycosylated by the glycosylation machinery (e.g., glycosylation enzymes) of the host cell. In certain embodiments, a naked antibody is not glycosylated when expressed by a host cell that does not have its own glycosylation machinery (e.g., glycosylation enzymes). In certain embodiments, a naked antibody is a whole antibody, while in other embodiments, a naked antibody is an antigen-binding fragment of a whole antibody, such as a Fab antibody.

[0107] The term "conjugated antibody" refers to an antibody that can be associated with a pharmaceutically acceptable carrier or diluent, which can be a monoclonal, chimeric, humanized, or human antibody.

[0108] The term "diabody" herein refers to a bivalent, bispecific antibody that can bind to different epitopes on the same or different antigens.

[0109] As used herein, the term "percent (%) sequence identity" means the percentage of amino acid (or nucleotide) residues in a candidate sequence that are identical with the amino acid (or nucleotide) residues in a reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity (e.g., gaps can be introduced in one or both of a candidate and reference sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). Alignment for purposes of determining percent sequence identity can be achieved using a variety of methods known to those skilled in the art, for instance, using publically available computer software such as BLAST, ALIGN, or Megalign (DNASTAR® software). Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For example, a reference sequence can be compared to a candidate sequence to determine the sequence identity over a stretch of amino acid (or nucleotide) residues that is at least 30% (e.g., 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) of the length of the reference sequence. When a position in the candidate sequence is occupied by the same amino acid (or nucleotide) residue as the corresponding position in the reference sequence, then the molecules are identical at that position.

[0110] The term "conservative amino acid" is used herein to refer generally to amino acids that belong to the same class or have similar characteristics (e.g., charge, side chain size, hydrophobicity, hydrophilicity, backbone conformation, and rigidity). Illustratively, amino acids within each of the following groups belong to conservative amino acid residues with each other, and substitution of amino acid residues within a group is a substitution of conservative amino acid:

[0111] (1) Acidic amino acids: Asp (D) and Glu (E);

[0112] (2) Basic amino acids: Lys (K), Arg (R), and His (H);

[0113] (3) Hydrophilic uncharged amino acids: Ser (S), Thr (T), Asn (N), and Gin (Q);

[0114] (4) Aliphatic uncharged amino acids: Gly (G), Ala (A), Val (V), Leu (L), and He (I);

[0115] (5) Nonpolar uncharged amino acids: Cys (C), Met (M), and Pro (P);

[0116] (6) Aromatic amino acids: Phe (F), Tyr (Y), and Trp (W).

[0117] The term "Kabat numbering system" herein generally refers to the immunoglobulin alignment and numbering system set forth by Elvin A. Kabat (see, e.g., Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md., 1991).

[0118] The term "Chothia numbering system" herein generally refers to the immunoglobulin numbering system set forth by Chothia et al. that is based on the location of structural loop regions to identify the boundaries of CDR regions (see, e.g., Chothia & Lesk (1987) J. Mol. Biol. 196:901-917; Chothia et al. (1989) Nature 342:878-883).

[0119] The term "IMGT numbering system" herein generally refers to the immunoglobulin numbering system set forth by Chothia et al. that is based on the location of structural loop regions to identify the boundaries of CDR regions (see, e.g., Chothia & Lesk (1987) J. Mol. Biol. 196:901-917; Chothia et al. (1989) Nature 342:878-883).

[0120] As used herein, the term "specifically binds" refers to a binding reaction that is determinative of the presence of an antigen in a heterogeneous population of proteins and other biologica! molecules, e.g., specifically recognized by an antibody or antigen-binding fragment thereof. An antibody or antigen-binding fragment thereof that specifically binds to an antigen will bind to the antigen with a KD of less than 100 nM. For example, an antibody or antigen-binding fragment thereof that specifically binds to an antigen will bind to the antigen with a KD of up to 100 nM (e.g., between 1 pM and 100 nM). An antibody or antigen-binding fragment thereof that does not show specific binding to a particular antigen or epitope thereof will show a KD of greater than 100 nM (e.g., greater than 500 nM, 1 mM, 100 mM, 500 mM, or 1 mM) for that particular antigen or epitope. A variety of immunoassay formats can be used to select antibodies specifically immunoreactive with a particular protein or carbohydrate. For example, solid-phase ELISA immunoassay formats are routinely used to select antibodies specifically immunoreactive with a protein or carbohydrate. See, Harlow & Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Press, New York (1988) and Harlow & Lane, Using Antibodies, A Laboratory Manual, Cold Spring Harbor Press, New York (1999), which describe immunoassay formats and conditions that can be used to determine specific immunoreactivity.

[0121] As used herein, the term "antibody conjugate" refers to a conjugate formed by the chemical linkage of an antibody molecule either directly or through a linking linker to another molecule. For example, an antibody-drug conjugate (ADC), where the drug molecule is the other molecule.

[0122] The term "chimeric antigen receptor (CAR)" herein refers to a recombinant protein comprising at least (1) an extracellular antigen binding domain, such as a variable heavy or light chain of an antibody, (2) a transmembrane domain anchoring the CAR into an immune effector cell, and (3) an intracellular signaling domain. In certain embodiments, the extracellular antigen binding domain of the CAR comprises a scFv. The scFv can be derived from the variable heavy and light regions of a fusion antibody. Alternatively or additionally, the scFv can be derived from Fab's (rather than antibodies, e.g., obtained from a Fab library). In certain embodiments, the scFv is fused to a transmembrane domain, which is then fused to an intracellular signaling domain.

[0123] The term "nucleic acid" herein includes any compound and / or substance comprising a polymer of nucleotides. Each nucleotide consists of a base, in particular a purine or pyrimidine base (i.e. cytosine (C), guanine (G), adenine (A), thymine (T) or uracil (U)), a sugar (i.e. deoxyribose or ribose) and a phosphate group. Typically, a nucleic acid molecule is described by the sequence of bases, whereby the bases represent the primary structure (linear structure) of the nucleic acid molecule. The sequence of bases is usually denoted 5' to 3'. In the present context, the term nucleic acid molecule encompasses deoxyribonucleic acid (DNA), including for example complementary DNA (cDNA) and genomic DNA, ribonucleic acid (messenger RNA, RNA), in particular messenger RNA (mRNA), synthetic forms of DNA or RNA, and polymers comprising a mixture of two or more of these molecules. A nucleic acid molecule can be linear or circular. Furthermore, the term nucleic acid molecule includes both the sense and the antisense strand, as well as single- and double-stranded forms. Also, the nucleic acid molecules described herein can contain naturally occurring or non-naturally occurring nucleotides. Examples of non-naturally occurring nucleotides include modified nucleotide bases with derivatized sugar or phosphate backbone linkages or chemically modified residues. Nucleic acid molecules also encompass DNA and RNA molecules which are suitable as vectors for the direct expression of the antibodies of the present application in vitro and / or in vivo, e.g. in a host or patient. Such DNA (e.g. cDNA) or RNA (e.g. mRNA) vectors can be unmodified or modified. For example, the mRNA can be chemically modified to enhance the stability of the RNA vector and / or the expression of the encoded molecule, so that the mRNA can be injected into a subject to produce the antibody in vivo (see e.g. Stadler et al., Nature Medicine 2017, published online 12 June 2017, doi: 10.1038 / nm.4356 or EP2101823B1).

[0124] As used herein, the term "vector" includes nucleic acid vectors, such as DNA vectors (e.g., plasmids), RNA vectors, viruses, or other suitable replicons (e.g., viral vectors). A variety of vectors have been developed for delivery of polynucleotides encoding foreign proteins into prokaryotic or eukaryotic cells. The expression vectors of the present application contain polynucleotide sequences as well as additional sequence elements, e.g., for expressing proteins and / or for integrating these polynucleotide sequences into the genome of a mammalian cell. Certain vectors that can be used to express the antibodies and antibody fragments of the present application include plasmids containing regulatory sequences that direct transcription of the gene (e.g., promoter and enhancer regions). Other useful vectors for expressing antibodies and antibody fragments contain polynucleotide sequences that enhance the rate of translation of these genes or improve the stability or nuclear export of mRNA produced from transcription of the genes. These sequence elements include, e.g., 5' and 3' untranslated regions, internal ribosome entry sites (IRES), and polyadenylation signal sites in order to direct efficient transcription of the genes carried on the expression vectors. The expression vectors of the present application can also contain a polynucleotide that encodes a marker for selection of cells containing such vectors. Examples of suitable markers include genes that encode antibiotic (e.g., ampicillin, chloramphenicol, kanamycin, or neomycin) resistance.

[0125] The term "host cell" herein refers to a cell into which foreign nucleic acid has been introduced, including the progeny of such a cell. Host cells include "transformants" and "transformed cells," which include both the primary transformed cell and progeny of the primary transformed cell that have a non-identical genotype, regardless of the number of passages. Progeny can not be identical to the parental cell as a result of, e.g., mutation, but are still included in the definition of "transformants" and "transformed cells."

[0126] The term "pharmaceutical composition" herein refers to a preparation which is in a form suitable for administration into a subject and which is safe and efficacious for the intended use.

[0127] As used herein, the terms "subject," "object," and "patient" refer to an organism that receives treatment for a particular disease or condition, such as a cancer or infectious disease, as described herein. Examples of subjects and patients include mammals, such as humans, primates, pigs, goats, rabbits, hamsters, cats, dogs, guinea pigs, members of the bovine family (e.g., cattle, bison, water buffalo, elk, and yaks, etc.), sheep, and horses, etc., that receive treatment for a disease or condition, e.g., a cell proliferative disorder, such as a cancer or infectious disease.

[0128] As used herein, the term "treatment" refers to a surgical or therapeutic treatment whose purpose is to prevent, slow (lessen), arrest, or stop the progression of an undesired physiological change or pathological condition, such as the progression of a cell proliferative disorder (e.g., cancer or infectious disease) in a subject. Beneficial or desired results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. A subject in need of treatment includes a subject who has a disorder or disease, a subject who is predisposed to having a disorder or disease, or a subject who desires prophylaxis against a disorder or disease. When referring to terms such as slowing, lessening, diminishing, palliating, alleviating, and the like, the meaning also includes elimination, disappearance, nonoccurrence, and the like.

[0129] The term "effective amount" as used herein refers to that amount of a therapeutic agent, alone or in combination with another therapeutic agent, which is effective to prevent or alleviate a disease condition or the progression of the disease in a cell, tissue or subject. An "effective amount" also refers to the amount of a compound which is sufficient to result in amelioration of symptoms, e.g., to treat, cure, prevent or slow the progression of an associated medical condition, or to increase the rate of treatment, cure, prevention or slowing of these conditions. When the active ingredients are administered individually, a therapeutically effective dose is understood to refer to a dose of the ingredient. When a combination is administered, a therapeutically effective dose refers to the combined amounts of the active ingredients that give the therapeutic effect.

[0130] The term "appropriate conditions" as used herein refers to conditions suitable for the cultivation of a variety of host cells, including eukaryotic and prokaryotic cells.

[0131] The term "cancer" as used herein refers to a physiological condition, typically characterized by unregulated cell growth, in a mammal. Included in this definition is benign and malignant cancer.

[0132] The term "tumor" as used herein refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues. The terms "cancer" and "tumor" are not mutually exclusive when referred to herein.

[0133] The term "anti-neoplastic agent" as used herein refers to an anti-neoplastic drug, which is a class of drugs used to treat neoplastic diseases, including chemotherapeutic drugs, biological agents, etc.

[0134] The term "EC 50 " as used herein refers to the half maximal effective concentration, which includes the concentration of antibody that induces a response halfway between the baseline and maximum after a specified exposure time. EC 50The term "EC50" refers to the concentration of an antibody that results in 50% of its maximal effect. EC50 can be measured by methods known in the art.

[0135] The term "epitope" herein refers to a specific region on an antigen-antibody molecule that is capable of binding to an antigen, while an antigen epitope refers to a specific region on an antigen molecule that is capable of binding to an antibody or T cell receptor. Antibodies exert their immune functions, such as neutralizing pathogens, precipitating toxins, or promoting phagocytosis and clearance of pathogens, through binding to antigen epitopes.

[0136] The term "ADCC" herein refers to antibody-dependent cell-mediated cytotoxicity, which occurs when the Fab end of an antibody binds to an antigen epitope on the surface of a target cell, and the Fc end recruits effector cells (NK cells, macrophages) and binds to their surface Fc receptors (FcγR), mediating direct killing of the target cell by the effector cells. The "reporter gene method" described herein uses transfected cells stably expressing Fcy Rla receptors and firefly luciferase expressed by NFAT response elements as effector cells, and the expression level of luciferase as a detection index to detect ADCC effects in vitro.

[0137] The term "ADCP" herein refers to antibody-dependent cellular phagocytosis, which is also an important mechanism for identifying and mediating the action of therapeutic antibodies on tumor cells. The mechanism of action is based on the process of phagocytosis of target cells (such as tumor cells) by effector cells (macrophages, monocytes) with phagocytic potential. Antibodies bind to target cells through antigen recognition, and then phagocytic cells bind to target cells through their Fc segments. Once the FcR of the phagocytic cell is bound, the target cell is phagocytosed, and the phagosome fuses with the lysosome and is degraded. This process also leads to the production of soluble factors by effector cells, which help to initiate and drive the immune response. BRIEF DESCRIPTION OF DRAWINGS

[0138] Figure 1 is a reduced SDS-PAGE protein electrophoretogram of VHH-Fc antibodies (wherein M: Marker; 1-33: VHH1-VHH33).

[0139] Figure 2 is a non-reduced SDS-PAGE protein electrophoretogram of VHH-Fc antibodies (wherein M: Marker; 1-33: VHH1-VHH33).

[0140] Figure 3 is a concentration-absorbance curve of VHH-Fc (CCAB003-CCAB019) binding to human CLL-1.

[0141] Figure 4 is a concentration-absorbance curve of VHH-Fc (CCAB020-CCAB044) binding to human CLL-1.

[0142] Figure 5 is a concentration-absorbance curve of VHH-Fc (CCAB050-CCAB060) binding to human CLL-1.

[0143] Figure 6 is a concentration-absorbance curve of VHH-Fc (CCAB061-CCAB069) binding to human CLL-1.

[0144] Figure 7 is a concentration-absorbance curve of VHH-Fc (CCAB003-CCAB019) binding to cynomolgus monkey CLL-1.

[0145] Figure 8 is a concentration-absorbance curve of VHH-Fc (CCAB020-CCAB044) binding to cynomolgus monkey CLL-1.

[0146] Figure 9 is a concentration-absorbance curve of VHH-Fc (CCAB050-CCAB060) binding to cynomolgus monkey CLL-1.

[0147] Figure 10 is a concentration-absorbance curve of VHH-Fc (CCAB061-CCAB069) binding to cynomolgus monkey CLL-1.

[0148] Figure 11 is a concentration-absorbance curve of VHH-Fc (CCAB003-CCAB044) binding to mouse CLL-1.

[0149] Figure 12 is a concentration-absorbance curve of VHH-Fc (CCAB052-CCAB067) binding to mouse CLL-1.

[0150] Figure 13 is a time-displacement signal curve of VHH-Fc binding to mouse CLL-1.

[0151] Figure 14 is a concentration-mean fluorescence intensity curve of VHH-Fc (CCAB003-CCAB044) binding to U937 cells.

[0152] Figure 15 is a concentration-mean fluorescence intensity curve of VHH-Fc (CCAB052-CCAB067) binding to U937 cells.

[0153] Figure 16 is a concentration-mean fluorescence intensity curve of VHH-Fc (CCAB003-CCAB044) binding to hCLL1-293 cells.

[0154] Figure 17 is a concentration-mean fluorescence intensity curve of VHH-Fc (CCAB052-CCAB067) binding to hCLL1-293 cells.

[0155] Figure 18 is a graph showing the mean fluorescence intensity values of VHH-Fc binding to cynomolgus CLL1-293 cells.

[0156] Figure 19 is a graph showing the antibody-dependent cellular cytotoxicity (ADCC) effect curve mediated by VHH-Fc antibody.

[0157] Figure 20 is a graph showing the antibody-dependent cellular phagocytosis (ADCP) effect curve mediated by VHH-Fc antibody. DETAILED DESCRIPTION

[0158] The present application is described in detail below with reference to Examples and drawings, which are provided to illustrate some preferred embodiments of the present application, however, it is to be understood that the present application is not limited to the specific embodiments disclosed or as construed to be the scope of the present application. The specific conditions not specified in the examples are carried out according to the conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments not specified by the manufacturer are all conventional products that can be obtained by commercial purchase.

[0159] Example 1 Construction of human, cynomolgus CLL-1 overexpressing 293 monoclonal stable cell lines

[0160] The amino acid sequences of human CLL-1 (Q5QGZ9, 1-265aa) and cynomolgus CLL-1 (A0A2K5WXQ6, 1-232aa) proteins were queried using Uniprot, and were commissioned to Genewiz for gene synthesis and recombination into pIRES2-EGFP vector. The plasmid was prepared using an endotoxin-free plasmid miniprep kit (Tiangen, Catalog No. DP118-03), and was filtered to remove bacteria using a 0.22 μM filter membrane (NEST, Catalog No. 331011).

[0161] HEK 293 cells were cultured to the logarithmic growth phase, and the target gene plasmid was transfected into HEK 293 cells using PEI (Yoxin Biotech (Shanghai) Co., Ltd., 40816ES03). Two days after transfection, G418 (Yoxin Biotech (Shanghai) Co., Ltd., 60220ES08) solution was added to a final concentration of 1800 ug / mL for pressure screening culture. The expression of green fluorescent protein (GFP) was observed using a fluorescence microscope (OLYMPUS, Model: CKX53), and when the green cells reached 70-90%, the cells were collected and single-cell sorted using a flow cytometer (Beckman, Model: CytoFLEX SRT) 488 (FITC) fluorescence channel.

[0162] The sorted monoclonal cells were expanded in the order of 96-well plate→ 24-well plate→ 6-well plate, and the human CLL-1 expression of the cell strain was analyzed by flow cytometry (Beckman, model: CytoFLEX S) using a positive control antibody (Biolegend, item number: 353621), obtaining a human CLL-1 overexpressing 293 monoclonal cell strain (hCLL1-293), and the GFP expression of the cell strain was analyzed by flow cytometry, obtaining a cynomolgus monkey CLL-1 overexpressing 293 monoclonal cell strain (cynoCLL1-293). Expansion to a 10 cm culture dish and freezing.

[0163] Example 2 Screening of llama single-domain antibodies against human CLL-1

[0164] 2.1 Immunization of llama and detection of serum titer

[0165] Two llamas A and B were selected for immunization: 10 mL of blood was taken before immunization as a negative serum control. 0.2 mg of human CLL-1 mRNA (customized by Suzhou Jinan Protein Technology Co., Ltd.) was injected into the muscle of the llama. Two weeks after the first immunization, 0.2 mg of human CLL-1 mRNA was injected into the muscle of the llama for the second immunization, and 10 mL of blood was collected one week later for titer detection. Two weeks after the second immunization, 0.25 mg of human CLL-1 Fc antigen was mixed with an equal volume of Adjuvant Camelid and injected subcutaneously, and 50 mL of peripheral blood lymphocytes were collected one week later for titer detection. Two weeks after the third immunization, 0.25 mg of human CLL-1 Fc antigen was mixed with an equal volume of Adjuvant Camelid and injected subcutaneously, and 50 mL of peripheral blood lymphocytes were collected one week later for titer detection.

[0166] Enzyme-linked immunosorbent assay (ELISA) and fluorescence-activated cell sorting (FACS) were used to detect the antibody titer and specificity against human CLL-1 in llama serum (Tables 2-3).

[0167] The results showed that after the fourth immunization:

[0168] The serum titer of llama A against human CLL-1 antigen was 1:128000 (OD 450 >0.2), and the serum titer against Cyno CLL-1 was 1:128000 (OD 450 >0.2), which was at a high level (Table 2).

[0169] B llama serum titer against human CLL-1 antigen was 1:128000 (OD 450 >0.2), and against Cyno CLL-1 was 1:128000 (OD 450 >0.2), which was at a high level (Table 2).

[0170] The binding signal of llama A and B serum to hCLL1-293 cells was significantly higher than that to 293 cells (Table 3), indicating that the immunization titer of llama A and B reached the expectation, and phage library construction could be carried out.

[0171] Table 2. Llama serum ELISA titer detection after the fourth immunization

[0172] Table 3. Llama serum FACS titer detection after the fourth immunization

[0173] 2.2 Construction of phage library

[0174] A total of 50 mL of peripheral blood was collected from the llama after four immunizations, PBMC was separated using lymphocyte separation medium, and total RNA was extracted using an RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., Catalog No.: DP451). The extracted RNA was reverse transcribed into cDNA using a reverse transcription kit (Tiangen, Catalog No.: KR118-02). The nucleic acid fragments encoding VHH antibody and vector were amplified by PCR:

[0175] VHH antibody PCR primers:

[0176] Upstream primer (SEQ ID NO: 140):

[0177] Downstream primer-1 (SEQ ID NO: 141):

[0178] Downstream primer-2 (SEQ ID NO: 142):

[0179] pComb3XTT vector PCR primers:

[0180] Upstream primer (SEQ ID NO: 143): CACCAAGGTGGACAAGAAAGTTGAGCCCAAATC

[0181] Downstream primer (SEQ ID NO: 144): CCCCTGGAGACAAAGACAGGGTGC

[0182] The target nanobodies and pComb3XTT vector nucleic acid fragments were recovered and cloned into the phage display vector pComb3XTT (Fenghui Biotechnology Co., Ltd., Catalog No. QT078) using the restriction endonuclease Sfil (NEB, Catalog No. R0123L). The product was then electroporated into E. coli electrocompetent cells TG1 (Bi Yun Tian Biotechnology Co., Ltd., Catalog No. D0389) to construct a nanobody phage display library against human CLL-1 and the library was tested. The size of the library was calculated to be 1.18 x 1011 by gradient dilution plating. 9 To detect the insertion rate of the library, 32 clones were randomly selected for colony PCR, and the results showed that the insertion rate reached 72%.

[0183] 2.3 Screening of phage nanobodies

[0184] The plates were coated with 10 μg / well of human CLL-1 hlgG1 Fc protein (ACRO, Catalog No. CLA-H5266) and human IgG1 Fc protein (ACRO, Catalog No. FCC-H5214), respectively, and incubated at 4°C overnight. The next day, the phage display library was pre-mixed with PBS containing 6% BSA (Beijing Solabio Technology Co., Ltd., Catalog No. 128K058) at the same volume (final concentration of 3% BSA) and blocked at room temperature for 2 h. The pre-mixed solution was first incubated with the enzyme-labeled plate coated with Fc protein at 37°C for 1 h, and then incubated with the enzyme-labeled plate coated with human CLL-1 Fc protein at 37°C for 1 h. After that, the unbound phage was washed off with PBST for 6 times and PBS for 2 times. Finally, 100 μL of 0.1 M Gly-HCl eluent was added to elute the phage specifically binding to human CLL-1, thereby enriching the positive clones.

[0185] Using the same method, the phage enriched with human CLL-1 Fc protein was further enriched with cynomolgus monkey CLL-1 Fc (human IgG1) protein (Beijing Yiqiao Shenzhou Technology Co., Ltd., Catalog No. 90146-H01H) and human IgG1 Fc protein to obtain phage clones with binding ability to human and cynomolgus monkey CLL-1 proteins.

[0186] 2.4 Verification of phage positive clones

[0187] After panning, the obtained phage positive for binding to human and cynomolgus monkey CLL-1 were used to infect blank E. coli and plated. Then 384 single colonies were picked and expanded respectively. Human CLL-1-His (Kangyiteke (Shanghai) Co., Ltd., Cat. No. CLE-HM12A) and cynomolgus monkey CLL-1-His (Kangyiteke (Shanghai) Co., Ltd., Cat. No. CLE-CM12A) proteins were used to coat ELISA assay plates (Corning, Cat. No. 9018) at 4°C overnight. After 3% BSA blocking at room temperature for 1 hour, phage-E. coli culture supernatant was added and incubated at 37°C for 1 hour. After repeated washing for 3 times, 1:10000 diluted anti-M13-HRP (Beijing Yiqioshenzhou Technology Co., Ltd., Cat. No. 11973-MM05T-H) was added and incubated at room temperature for 1 hour. After repeated washing for 3 times, TMB color developing solution was added for color development, and the absorbance was detected by a microplate reader at 450 nm. Phage clones positive for binding to human and cynomolgus monkey CLL-1 were selected, and their supernatant was incubated with human CLL-1 overexpressing 293 cells at 4°C for 1 hour. After repeated washing for 3 times, anti-M13-PE (Beijing Yiqioshenzhou Technology Co., Ltd., Cat. No. 11973-MM05T-P) was added, and after repeated washing for 3 times, the mean fluorescence intensity (MFI) of the sample in the PE channel was detected by flow cytometry.

[0188] Fifty positive clones were selected for sequencing, and the sequencing results were analyzed using MOE software. According to the VHH encoded protein amino acid sequence, a phylogenetic tree was constructed, and after removing the sequences with close distances on the phylogenetic tree according to sequence similarity, 33 unique llama single domain antibody (VHH) sequences were obtained. The CDRs region sequences were analyzed by IMGT method, as shown in Tables 4-6 below. Table 4 shows the 33 llama single domain antibody variable region amino acid sequences, Table 5 shows the 33 llama single domain antibody variable region nucleotide sequences, and Table 6 shows the CDRs region sequences analyzed by IMGT method.

[0189] Table 4. Amino acid sequence information of human CLL-1 llama single domain antibody variable region

[0190] Table 5. Nucleotide sequence information of human CLL-1 llama single domain antibody variable region

[0191] Table 6. CDRs amino acid sequence information of human CLL-1 llama single domain antibody

[0192] Example 3: Preparation and quality inspection of VHH-Fc antibody

[0193] 3.1 Molecular construction of VHH-Fc antibody expression vector

[0194] In order to obtain recombinant VHH-Fc antibody for subsequent evaluation, the VHH variable region sequence was amplified using a PCR kit (Nanjing Novizen Biotech Co., Ltd., Catalog No.: P510-01), and the VHH variable region sequence was recombined into a pcDNA3.4 expression vector (from Suzhou Jinweizhi Biotechnology Co., Ltd.) containing a signal peptide and human IgG1 Fc using a homologous recombination kit (Yixing Biosciences Co., Ltd., Catalog No.: 10923ES50), and transformed into DH5a competent cells (ApexBio, Catalog No.: BC2001) for amplification culture. Suzhou Jinweizhi Biotechnology Co., Ltd. was commissioned to perform gene sequencing, and after the sequence was correct, the expression vector was prepared using an endotoxin-free plasmid miniprep kit (Tiangen Biotech (Beijing) Co., Ltd., Catalog No.: DP118-03), and filtered with a 0.22 μΜ filter membrane (NEST Biotech Co., Ltd., Catalog No.: 331011) to remove bacteria. The 33 llama single domain antibody expression vectors were numbered as shown in Table 7 below:

[0195] Table 7. Antibody number and antibody name correspondence table

[0196] 3.2 Expression and purification of VHH-Fc antibody

[0197] The expression vector was transiently transfected into Expi-293F cells (Thermo, Catalog No.: A29127) using ExpiFectamine TM 293 Transfection Kit (Themro, Catalog No.: A14524), and Expi293 TM Expression Medium (Thermo, Catalog No.: A1435101) was used. The cells were cultured continuously for 5 days at 8% CO2, 37°C, relative humidity 85%, and rotation speed 1000 rpm / min using a cell culture shaker (IKA, Model: MS3 digital). The cell components were removed by centrifugation to obtain the culture supernatant containing VHH-Fc antibody.

[0198] Protein A purification magnetic beads (Kangshen Biotech Co., Ltd., Catalog No. L00695) were added to the supernatant culture solution, and the mixture was incubated at 4°C with rotation at 30 rpm / min overnight. The magnetic beads were adsorbed using a magnetic separation rack (Kangshen Biotech Co., Ltd., Catalog No. L00722), and the supernatant was discarded. After washing with an equal volume of PBST four times, the antibody was eluted using 0.1M glycine-hydrochloric acid buffer (pH 3.0±0.1), and neutralized with 1 / 10 volume of 1M Tris-HCl (pH 8.5±0.1). The antibody was ultrafiltrated to PBS at 4°C using a 3kDa ultrafiltration tube (Kobiot Filtration Material Co., Ltd., Catalog No. ULRC0030150P), and then sterile filtered through a 0.22μM filter membrane before being stored at -80°C.

[0199] 3.3 Molecular weight and purity analysis of VHH-Fc antibody

[0200] To evaluate the molecular weight and purity of the VHH-Fc antibody, the antibody was mixed with 5x reducing loading buffer (Bi Yun Tian Biotechnology Co., Ltd., Catalog No. P0286) and 5x non-reducing loading buffer (Shenguo Biotechnology (Shanghai) Co., Ltd., Catalog No. 1927DA0001), respectively. SDS-PAGE electrophoresis (120V, 45min) was performed using high-resolution gradient gel (Yixing Biosciences (Shanghai) Co., Ltd., Catalog No. P7311040). After staining with Coomassie Brilliant Blue R-250 staining solution and destaining, gel imaging was performed using a chemiluminescence imager (Hangzhou Shenghua Technology Co., Ltd., Catalog No. SH-523).

[0201] The results showed that the molecular weight of the VHH-Fc antibody was in the range of 35kDa-45kDa after reducing SDS-PAGE protein electrophoresis (Figure 1), which was consistent with the theoretical molecular weight. The purity was high after non-reducing SDS-PAGE protein electrophoresis (Figure 2).

[0202] 4.1 Binding affinity of VHH-Fc antibody to human CLL-1 antigen

[0203] To evaluate the binding affinity of VHH-Fc antibody to human CLL-1 antigen, the concentration of human CLL-1 antigen (Kangyue Biotech (Shanghai) Co., Ltd., Cat No: CLE-HM12A) was diluted to 0.5 pg / mL with PBS; and added to a 96-well enzyme-labeled plate, 100 pL per well; the enzyme-labeled plate was sealed with sealing film and placed in a 4°C refrigerator for overnight incubation in the dark. The next day, the enzyme-labeled plate was washed 3 times with a plate washer, and blocking solution (PBS containing 5% skim milk) was added to the enzyme-labeled plate, 200 pL per well; the enzyme-labeled plate was sealed with sealing film and placed in a 37°C constant temperature oscillator, and incubated for 1 hour at room temperature in the dark. The concentration of VHH-Fc antibody was first diluted to 66.7 nM, 4-fold concentration gradient dilution, a total of 7 concentration gradient and corresponding added to the blocked enzyme-labeled plate, 100 pL per well; the enzyme-labeled plate was sealed with sealing film and placed in a 37°C constant temperature oscillator, and incubated for 1 hour at room temperature in the dark. The VHH-Fc antibody in the enzyme-labeled plate was discarded, and the enzyme-labeled plate was washed 3 times with a plate washer. Goat anti-human IgG Fc-HRP (Thermo, 31413) was diluted according to a ratio of 1:2000 and added to the enzyme-labeled plate, 100 pL per well; the enzyme-labeled plate was sealed with sealing film and placed in a 37°C constant temperature oscillator, and incubated for 1 hour at room temperature in the dark. The secondary antibody in the enzyme-labeled plate was discarded, the enzyme-labeled plate was washed 3 times with a plate washer, and TMB solution was added, 100 pL per well; after color development for 4 min, 100 pL of stop solution (1 M H2SO4 solution) was added per well, and the color development reaction was terminated. The enzyme-labeled plate was placed in an enzyme-labeled instrument, and the OD 450 values were read.

[0204] The results showed that the binding affinity of VHH-Fc antibodies CCAB043 and CCAB016 to human CLL-1 antigen was slightly weaker, 1.5 nM > EC 50 > 1 nM; the binding affinity of the remaining VHH-Fc antibodies to human CLL-1 antigen was stronger, EC 50 < 1 nM (Table 8, Figures 3-6).

[0205] Table 8. OD absorbance and EC values of VHH-Fc binding to human CLL-1 450 absorbance and EC 50 values

[0206] 4.2 Binding affinity of VHH-Fc antibody to cynomolgus monkey CLL-1 antigen

[0207] The binding affinity of VHH-Fc antibody to cynomolgus monkey CLL-1 antigen (Kangyue Biotech (Shanghai) Co., Ltd., Cat No: CLE-CM12A) was evaluated according to the method in Example 4.1.

[0208] Results show that CCAB015, CCAB020, CCAB054, CCAB062, CCAB065 do not bind to cynomolgus CLL-1 antigen, EC 50 Not calculated; CCAB003, CCAB005, CCAB007, CCAB016, CCAB041 bind very weakly to cynomolgus CLL-1 antigen, EC 50 >10 nM; CCAB019, CCAB025, CCAB034, CCAB035, CCAB043, CCAB053, CCAB063, CCAB069 bind moderately to cynomolgus CLL-1, 1 nM < EC 50 <10 nM, the rest of the VHH-Fc antibodies bind strongly to cynomolgus CLL-1 antigen, EC 50 <1 nM (Table 9, Figures 7-10).

[0209] Table 9. OD of VHH-Fc binding to cynomolgus CLL-1 450 Absorbance and EC 50 values N / A: data not available

[0210] 4.3 Binding affinity of VHH-Fc antibodies to mouse CLL-1 antigen

[0211] The binding affinity of VHH-Fc antibodies to mouse CLL-1 (Kangtai Biotech (Shanghai) Co., Ltd., Cat. No: CLE-MM12A) antigen was evaluated according to the method in Example 4.1. Results show that VHH-Fc antibodies do not bind to mouse CLL-1 antigen, EC 50 Not calculated (Table 10, Figures 11-12).

[0212] Table 10. OD of VHH-Fc binding to mouse CLL-1 450 Absorbance and EC 50 values N / A: data not available

[0213] Example 5 Evaluation of binding affinity of VHH-Fc antibodies to human CLL-1 antigen by biolayer interferometry (BLI) method

[0214] 5.1 Binding affinity of VHH-Fc antibodies to human CLL-1 antigen

[0215] The binding affinity of VHH-Fc antibody to human CLL-1 antigen was detected and analyzed using a biofilm interference molecular interaction instrument (GatorBio, model: Gator Prime). The detection buffer was a PBS (10 mM, pH 7.4) solution containing 0.02% Tween (Beijing Solabio Technology Co., Ltd., catalog number: T8220) and 0.2% BSA IgG Free (Jackson ImmunoResearch, catalog number: 001-000-061). The VHH-Fc antibody was diluted to 5 μg / mL with the detection buffer, and the concentration of human CLL-1 (Keao Biological Technology (Shanghai) Co., Ltd., catalog number: CLE-HM12A) antigen was diluted to 200 nM, 100 nM, 50 nM, 25 nM, 12.5 nM, and 0 nM. The antibody diluent, antigen diluent, and detection buffer were added to the corresponding wells of the detection plate. The detection plate temperature was set to 30°C, the light signal acquisition rate was 5.0 HZ, and the probe rotation speed was 1000 rpm / min. In each detection cycle, the Protein A probe (GatorBio, catalog number: 160001) was equilibrated in the detection buffer for 1 min, the VHH-Fc antibody solution was loaded for 2 min, the detection buffer was equilibrated for 1 min, and the human CLL-1 antigen was combined at different concentrations for 5 min, and the detection buffer was dissociated for 5 min. The light signal value of the 0 nM well was used as the blank reference value, and the light signal values of the other concentrations were subtracted from the reference value. The Global mode (common fitting of different concentration detection values) was used to fit the binding-dissociation kinetic curve, and the dissociation rate constant Koff, the association rate constant Kon, and the binding affinity Kd were calculated. off D .

[0216] The results showed that the binding affinity of antibodies CCAB016, CCAB056, CCAB061, CCAB062, CCAB063, and CCAB065 to human CLL-1 was medium to strong, with K D 10 -8 nM, and the binding affinity of the remaining antibodies to human CLL-1 antigen was strong, with K D 10 -9 nM (Table 11). The Full R 2 of the fitted curve was greater than 0.95.

[0217] Table 11. Binding affinity (K D ) of VHH-Fc to human CLL-1 antigen

[0218] 5.2 Binding affinity of VHH-Fc antibody to cynomolgus monkey CLL-1 antigen​

[0219] The binding affinity of VHH-Fc antibodies to cynomolgus CLL-1 (Kangtai Biological Pharmacy (Shanghai) Co., Ltd., Cat. No. CLE-CM12A) antigen was detected and analyzed according to the method of Example 5.1. The results showed that CCAB003, CCAB008, CCAB016, CCAB019, CCAB025, CCAB034, CCAB043, CCAB044, CCAB052, CCAB055, CCAB057, CCAB059, CCAB060, CCAB061, CCAB064, and CCAB065 had strong binding affinity to cynomolgus CLL-1 antigen, with K D dissociation rate constant K -9 dissociation rate constant K D dissociation rate constant K -8 dissociation rate constant K -8 dissociation rate constant K 2 dissociation rate constant K

[0220] Table 12. Binding affinity (K D dissociation rate constant K

[0221] 5.3 Evaluation of the binding affinity of VHH-Fc antibodies to mouse CLL-1 antigen by bio-layer interferometry (BLI)

[0222] The VHH-Fc antibodies with good binding affinity to human and cynomolgus CLL-1 were selected, and the binding affinity of the VHH-Fc antibodies to mouse CLL-1 (Kangtai Biological Pharmacy (Shanghai) Co., Ltd., Cat. No. CLE-MM12A) antigen (concentration 100 nM) was detected and analyzed according to the method of Example 5.1. The results showed that the VHH-Fc antibodies did not bind to mouse CLL-1 antigen, and the dissociation rate constant K off dissociation rate constant K D dissociation rate constant K

[0223] Table 13. Binding affinity (K D dissociation rate constant K NA: No data available

[0224] Example 6 Flow cytometry (FACS) method to evaluate the binding ability of VHH-Fc antibody to human, cynomolgus monkey CLL-1 positive cells

[0225] 6.1 Binding ability of VHH-Fc antibody to hCLL1-293 and U937 cells

[0226] To evaluate the binding ability of VHH-Fc antibody to human CLL-1 positive cells, hCLL1-293 cells were cultured in a T75 culture flask to the logarithmic growth phase, the supernatant was discarded, and the cells were washed with sterile ice PBS, then 1 mL of 0.25% trypsin containing EDTA was added, and the cells were digested at room temperature. After the cells were detached from the bottom of the culture dish, 5 mL of complete medium was added, and the cells were uniformly blown with a sterile pipette. The cells were transferred to a 50 mL sterile centrifuge tube. U937 cells (Beijing Beina Biotechnology Research Institute, 211228) were cultured in a T75 culture flask to the logarithmic growth phase, and then transferred to a 50 mL sterile centrifuge tube. Centrifugation at 4°C, 300g for 4 min, and discard the supernatant. Add 25 mL of FACS Buffer (0.2% BSA in PBS) to the centrifuge tube with a sterile pipette, resuspend the cells by gently blowing, and centrifuge at 4°C, 300g for 4 min. Discard the supernatant. Repeat the washing twice. Resuspend the cells with FACS Buffer, count the cells, and adjust the cell concentration to 2.5x10 6 / mL. Add the cell suspension to a U-bottom 96-well plate, 80 μL per well. Dilute the VHH-Fc antibody to the working concentration with FACS Buffer (0.2% BSA in PBS solution), and add it to the U-bottom 96-well plate, 20 μL per well (final concentration 100 nM, 4-fold dilution, 8 concentration gradients), mix well, and incubate at 4°C for 1 hour. Centrifuge at 4°C, 300g for 4 min, and discard the supernatant. Repeat the washing 3 times. Dilute Goat anti-Human IgG Fc, Alexa Fluor 647 (Thermo, A55749) to the working concentration at 1:1000 with FACS Buffer (0.2% BSA in PBS), and add it to the U-bottom 96-well plate, 100 μL per well, and incubate at 4°C for 1 hour. Centrifuge at 4°C, 300g for 4 min, and discard the supernatant. Repeat the washing 3 times. Add FACS Buffer (0.2% BSA in PBS) to the U-bottom 96-well plate with a multichannel pipette, 200 μL per well, resuspend the cells by blowing, and detect the 647 (APC) channel mean fluorescence intensity (MFI) value with a flow cytometer. TM 647 (APC) channel mean fluorescence intensity (MFI) value with a flow cytometer.

[0227] The results show that the VHH-Fc antibody has strong binding ability to U937 cells, and the EC 50 50 all in nM (10-9 ) level (Table 14, Figures 14-15). Except for CCAB043 which has a moderately strong binding ability (EC 50 at 10 -8 level), the rest of the VHH-Fc antibodies have strong binding ability to hCLL1-293 cells with EC 50 all in nM (10 -9 ) level (Table 15, Figures 16-17).

[0228] Table 14. Concentration- mean fluorescence intensity and EC 50 values of VHH-Fc binding to U937 cells

[0229] Table 15. Concentration- mean fluorescence intensity and EC 50 values of VHH-Fc binding to hCLL1-293 cells

[0230] 6.2 Binding ability of VHH-Fc antibodies to cyno CLL1-293 cells

[0231] The binding affinity of VHH-Fc antibodies to cynomolgus monkey CLL-1 overexpressing 293 cells was evaluated following the method of Example 6.1. The results showed that, except for CCAB043 which is slightly weaker, the rest of the VHH-Fc antibodies have strong binding ability to cynomolgus monkey CLL1-293 cells (Table 16, Figure 18).

[0232] Table 16. Concentration- mean fluorescence intensity values of VHH-Fc binding ability to cynomolgus monkey CLL1-293 cells

[0233] Example 7 Bio-Layer Interferometry (BLI) method for analyzing the binding epitope of VHH-Fc antibodies to human CLL-1 antigen

[0234] The binding epitopes of different VHH-Fc antibodies to human CLL-1 antigen were grouped using a biofilm interference molecular interaction instrument (GatorBio, model: Gator Prime). The detection buffer was: 0.02% Tween (Beijing Solabio Technology Co., Ltd., catalog number: T8220) and 0.2% BSA IgG Free (Jackson ImmunoResearch, catalog number: 001-000-061) in PBS (10 mM, pH 7.4) solution. The VHH-Fc antibody was diluted to 5 μg / mL with the detection buffer, the concentration of human CLL-1 (Kaiyou Biotechnology (Shanghai) Co., Ltd., catalog number: CLE-HM12A) antigen was diluted to 200 nM, and human IgG1 Fc was diluted to 50 μg / mL as a blocking solution. The antibody diluent, antigen diluent, blocking solution, and detection buffer were added to the corresponding wells of the detection plate. The detection plate temperature was set to 30°C, the light signal acquisition rate was 5.0 HZ, and the probe rotation speed was 1000 rpm / min. In each detection cycle, the HFC probe (GatorBio, catalog number: 160003) was used to equilibrate in the detection buffer for 1 min, the first VHH-Fc antibody solution was loaded for 2 min, the detection buffer was equilibrated for 1 min, the human CLL-1 antigen was combined for 5 min, the blocking solution was blocked for 5 min, and the second VHH-Fc antibody solution was combined for 5 min. According to whether the second VHH-Fc antibody had a binding signal, it was determined whether the binding epitopes of the first VHH-Fc antibody and the second VHH-Fc antibody to human CLL-1 antigen were the same.

[0235] The results showed that the binding epitope (B) of CCAB043 to human CLL-1 antigen was different from that of other antibodies, and the binding epitope (C) of CCAB058 to human CLL-1 antigen was different from that of other antibodies, and the binding epitopes (A) of the remaining antibodies to human CLL-1 antigen were the same (Table 17).

[0236] Table 17. Grouping of VHH-Fc antibody binding epitopes to human CLL-1 antigen

[0237] Example 8 VHH-F C ADCC effect of antibody on hCLL1-293

[0238] hCLL1-293 cells were cultured in 10 cm dishes to the logarithmic growth phase, the supernatant was discarded, and the cells were washed with sterile ice PBS, 1 mL of 0.25% trypsin containing EDTA was added, and the cells were digested at room temperature. After the cells fell off the dish bottom by themselves, 5 mL of complete medium was added, and the cells were uniformly blown with a sterile pipette. The cells were transferred to a 50 mL sterile centrifuge tube, centrifuged at 300 g for 4 min, the supernatant was discarded, and the cells were resuspended in complete medium to 1.25 x 10 6 cells / mL, and 40 μL (5 x 10 4 hCLL1-293 cells were added to a U-bottom 96-well plate. The VHH-Fc antibody was diluted with PBS to the working concentration and added to the U-bottom 96-well plate, 20 μL per well (final concentration 120 nM, 5-fold dilution, 7 concentration gradients). The CD16-NFAT-Luc-Jurkat cells cultured in a T75 flask were centrifuged at 300 g for 4 min, the supernatant was discarded, and the cells were resuspended in complete medium to 2.5 x 10 6 cells / mL, and 40 μL (1 x 10 5 CD16-NFAT-Luc-Jurkat cells were added to a U-bottom 96-well plate, and the cells were mixed uniformly. The plate was incubated in a 37°C CO2 incubator for 16 hours. The 96-well plate was centrifuged at 300 g for 5 min, and 40 μL of cell supernatant was transferred to a white-bottom white-cover 96-well plate. 50 μL of QUANTI-Luc TM 4 Reagent working solution was added to each well, and the luminescence reading was immediately detected with a microplate reader for 500 ms.

[0239] The results are shown in Table 18 and FIG. 19: 19 VHH-Fc antibodies can produce reporter gene signals, and all have antibody-dependent cellular cytotoxicity (ADCC) effects.

[0240] Table 18. Luminescence and EC 50 values of ADCC effect of VHH-Fc on hCLL1-293 N / A: specific value cannot be calculated

[0241] Example 9 Analysis of antibody-dependent cellular phagocytosis (ADCP) effect by reporter gene method

[0242] hCLL1-293 cells were cultured in 10 cm dishes to the logarithmic growth phase, the supernatant was discarded, and the cells were washed with sterile ice PBS, 1 mL of 0.25% trypsin containing EDTA was added, and the cells were digested at room temperature. After the cells fell off the dish bottom by themselves, 5 mL of complete medium was added, and the cells were uniformly blown with a sterile pipette. The cells were transferred to a 50 mL sterile centrifuge tube, centrifuged at 300 g for 4 min, the supernatant was discarded, and the cells were resuspended in complete medium to 1.25 x 106 cells / mL, 40 μL (5 x 10 4 cells) hCLL1-293 cells were added to the U-bottom 96-well plate. VHH-Fc antibodies were diluted with PBS to working concentration and added to the U-bottom 96-well plate, 20 μL per well (final concentration 120 nM, 5-fold dilution, 7 concentration gradients), mixed well. CD32-NFAT-Luc-Jurkat cells cultured in T75 flask were centrifuged at 300 g for 4 min, the supernatant was discarded, resuspended with complete medium to 2.5 x 10 6 cells / mL, 40 μL (1 x 10 5 cells) CD32-NFAT-Luc-Jurkat cells were added to the U-bottom 96-well plate, mixed well, and incubated in a 37 °C CO2incubator for 16 hours. The 96-well plate was centrifuged at 300 g for 5 min; 40 μL of cell supernatant was transferred to a white-bottom white-cover 96-well plate. 50 μL QUANTI-Luc TM 4 Reagent working solution was added to each well, and the luminescence reading was immediately detected by a microplate reader for 500 ms.

[0243] The results are shown in Table 19 and Figure 20: 19 VHH-Fc antibodies can all produce reporter gene signals, and all have antibody-dependent cellular phagocytosis (ADCP) effect.

[0244] Table 19. Luminescence and EC 50 values of ADCP effect of VHH-Fc with hCLL1-293

Claims

1. A Nanobody or antigen binding fragment thereof that specifically binds to CLL-1, characterized in that, The nanobody or antigen-binding fragment thereof comprises a CDRs combination comprising: a CDR1, a CDR2 and a CDR3; the CDR1 comprises a HCDR1 of a VHH domain as set forth in any one of SEQ ID NOs: 1-20, the CDR2 comprises a HCDR2 of a VHH domain as set forth in any one of SEQ ID NOs: 21-44, and the CDR3 comprises a HCDR3 of a VHH domain as set forth in any one of SEQ ID NOs: 45-73, each of the CDR1, CDR2 and CDR3 is encoded according to the analysis method of IMGT.

2. The Nanobody or antigen binding fragment thereof specific for CLL-1 of claim 1, wherein, The CDR1, CDR2 and CDR3 have any sequence combination selected from the following or have 1, 2, 3 or more amino acid insertions, deletions and / or substitutions compared to the sequence combination, encoded according to the analysis method of IMGT as follows: Table 1. CDR sequence encoding according to IMGT analysis method Preferably, the substitution is a substitution of a conservative amino acid.

3. The nanobody or antigen-binding fragment of claim 1 or 2, encoded according to the analysis method of IMGT, characterized in that, (1) the CDR1, CDR2 and CDR3 are respectively as set forth in the sequences of SEQ ID NOs: 1, 21, 45; (2) the CDR1, CDR2 and CDR3 are respectively as set forth in the sequences of SEQ ID NOs: 2, 22, 46; (3) the CDR1, CDR2 and CDR3 are respectively as set forth in the sequences of SEQ ID NOs: 2, 23, 47; (4) the CDR1, CDR2 and CDR3 are respectively as set forth in the sequences of SEQ ID NOs: 3, 24, 48; (5) the CDR1, CDR2 and CDR3 are respectively as set forth in the sequences of SEQ ID NOs: 2, 25, 49; (6) the CDR1, CDR2 and CDR3 are respectively as set forth in the sequences of SEQ ID NOs: 4, 26, 50; (7) the CDR1, CDR2 and CDR3 are respectively as set forth in the sequences of SEQ ID NOs: 5, 27, 51; (8) the CDR1, CDR2 and CDR3 are respectively as set forth in the sequences of SEQ ID NOs: 2, 25, 47; (9) the CDR1, CDR2 and CDR3 are respectively as set forth in the sequences of SEQ ID NOs: 3, 28, 52; (10) the CDR1, CDR2 and CDR3 are respectively as set forth in the sequences of SEQ ID NOs: 6, 27, 53; (11) the CDR1, CDR2 and CDR3 are respectively as set forth in the sequences of SEQ ID NOs: 7, 29, 54; (12) the CDR1, CDR2 and CDR3 are respectively as set forth in the sequences of SEQ ID NOs: 2, 25, 55; (13) the CDR1, CDR2 and CDR3 are respectively as set forth in the sequences of SEQ ID NOs: 8, 30, 56; (14) the CDR1, CDR2 and CDR3 are respectively as set forth in the sequences of SEQ ID NOs: 9, 31, 57; (15) the CDR1, CDR2 and CDR3 are respectively as per the sequence set forth in SEQ ID NO: 2, 25, 47; (16) the CDR1, CDR2 and CDR3 are respectively as per the sequence set forth in SEQ ID NO: 1, 32, 58; (17) the CDR1, CDR2 and CDR3 are respectively as per the sequence set forth in SEQ ID NO: 3, 33, 59; (18) the CDR1, CDR2 and CDR3 are respectively as per the sequence set forth in SEQ ID NO: 2, 25, 55; (19) the CDR1, CDR2 and CDR3 are respectively as per the sequence set forth in SEQ ID NO: 2, 25, 60; (20) the CDR1, CDR2 and CDR3 are respectively as per the sequence set forth in SEQ ID NO: 10, 34, 61; (21) the CDR1, CDR2 and CDR3 are respectively as per the sequence set forth in SEQ ID NO: 11, 35, 62; (22) the CDR1, CDR2 and CDR3 are respectively as per the sequence set forth in SEQ ID NO: 10, 36, 63; (23) the CDR1, CDR2 and CDR3 are respectively as per the sequence set forth in SEQ ID NO: 12, 25, 64; (24) the CDR1, CDR2 and CDR3 are respectively as per the sequence set forth in SEQ ID NO: 13, 37, 65; (25) the CDR1, CDR2 and CDR3 are respectively as per the sequence set forth in SEQ ID NO: 14, 38, 66; (26) the CDR1, CDR2 and CDR3 are respectively as per the sequence set forth in SEQ ID NO: 3, 39, 67; (27) the CDR1, CDR2 and CDR3 are respectively as per the sequence set forth in SEQ ID NO: 15, 40, 68; (28) the CDR1, CDR2 and CDR3 are respectively as per the sequence set forth in SEQ ID NO: 16, 27, 51; (29) the CDR1, CDR2 and CDR3 are respectively as per the sequence set forth in SEQ ID NO: 17, 41, 69; (30) the CDR1, CDR2 and CDR3 are respectively as per the sequence set forth in SEQ ID NO: 18, 42, 70; (31) the CDR1, CDR2 and CDR3 are respectively as per the sequence set forth in SEQ ID NO: 1, 32, 71; (32) the CDR1, CDR2 and CDR3 are respectively as per the sequence set forth in SEQ ID NO: 19, 43, 72; (33) the CDR1, CDR2 and CDR3 are respectively as per the sequence set forth in SEQ ID NO: 20, 44, 73; or, (34) the CDR1, CDR2 and CDR3 are a sequence combination having 1, 2, 3 or more amino acid insertions, deletions and / or substitutions compared with the sequence combinations of (1)-(33) above; preferably substitutions, more preferably substitutions of conservative amino acid residues.

4. The nanobody or antigen-binding fragment according to any one of claims 1 to 3, wherein The nanobody or antigen binding fragment comprises: (1) the variable region has the sequence set forth in SEQ ID NO: 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, or 106; (2) an amino acid sequence having at least 90% identity, preferably at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the sequence set forth in (1) above; or, (3) the framework region of the Nanobody or antigen binding fragment has at least 90% identity, preferably at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the framework region of the amino acid sequence set forth in SEQ ID NO: 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, or 106.

5. The nanobody or antigen-binding fragment according to any one of claims 1 to 4, wherein having a dissociation constant (KD) for binding to human CLL-1 of no more than 10 -7 nM, and a dissociation constant (KD) for binding to cynomolgus monkey CLL-1 of no more than 10 -8 nM; Optionally, the Nanobody or antigen binding fragment binds to or does not bind to a monkey CLL-1 protein; Optionally, the Nanobody or antigen binding fragment binds to or does not bind to a murine CLL-1 protein.

6. The nanobody or antigen-binding fragment according to any one of claims 1 to 5, wherein The antibody or antigen binding fragment comprises a sequence of a constant region of any one of antibody IgGl, IgG2, IgG3, IgG4, IgA, IgM, IgE, or IgD; preferably a sequence of a constant region of antibody IgGl, IgG2, IgG3, or IgG4.

7. The nanobody or antigen-binding fragment of any of claims 1-6, wherein, The antibody or antigen binding fragment further comprises a sequence of an antibody constant region without a CH1 fragment.

8. The nanobody or antigen-binding fragment according to any one of claims 1 to 7, wherein The antibody or antigen binding fragment further comprises a sequence of an antibody constant region with a CH2 and a CH3 fragment, or the antibody or antigen binding fragment further comprises an antibody Fc region; The antibody constant region or antibody Fc region is linked to the antibody or antigen binding fragment with or without a linker peptide; Optionally, the antibody constant region or antibody Fc region is from a Camelidae, a mouse, a rat, a rabbit, a sheep, or a human; Optionally, the antibody constant region or antibody Fc region is from IgG, IgA, IgM, IgD, or IgE.

9. The nanobody or antigen-binding fragment according to any one of claims 1 to 8, wherein, The antibody or antigen binding fragment is: (1) a chimeric antibody or fragment thereof; (2) a humanized antibody or fragment thereof; or, (3) a fully human antibody or fragment thereof; Preferably, the antibody or antigen binding fragment is selected from a monoclonal antibody, a polyclonal antibody, a natural antibody, an engineered antibody, a monospecific antibody, a multispecific antibody (e.g., a bispecific antibody), a monovalent antibody, a multivalent antibody, a full-length antibody, an antibody fragment, a naked antibody, a conjugated antibody, a humanized antibody, a fully human antibody, a Fab, a Fab', a F(ab')2, a Fd, a Fv, a scFv, a diabody, or a single domain antibody.

10. The nanobody or antigen-binding fragment according to any one of claims 1 to 9, wherein, The nanobody or antigen-binding fragment is further conjugated to a therapeutic agent or a tracer; preferably, the therapeutic agent is selected from a radioisotope, a chemotherapeutic agent or an immunomodulatory agent, and the tracer is selected from a radiological contrast agent, a paramagnetic ion, a metal, a fluorescent label, a chemiluminescent label, an ultrasound contrast agent or a photosensitizer.

11. A multispecific antigen binding molecule, characterized in that, The multispecific antigen-binding molecule comprises a first antigen-binding module comprising the nanobody or antigen-binding fragment of any one of claims 1-10 and a second antigen-binding module that specifically binds to another antigen than CLL-1 or to a different epitope of CLL-1 than the first antigen-binding module; preferably, the other antigen is selected from CD3, PD-1, PD-L1, Her2, EpCAM, CD16, CD20, CD30, CD33, CD47, CD52, CD64, CD133, CEA, gpA33, Mucins, TAG-72, CIX, PSMA, folate-binding protein, GD2, GD3, GM2, VEGF, VEGFR, Integrin, alphaVbeta3, alpha5beta1, ERBB2, ERBB3, MET, IGF1R, EPHA3, TRAILR1, TRAILR2, RANKL or FAP; preferably, the multispecific antibody is a bispecific antibody, a trispecific antibody or a tetraspecific antibody.

12. A chimeric antigen receptor (CAR), characterized in that, The chimeric antigen receptor comprises at least an extracellular antigen-binding domain, a transmembrane domain and an intracellular signaling domain, the extracellular antigen-binding domain comprising the nanobody or antigen-binding fragment of any one of claims 1-10.

13. An immune effector cell, wherein the immune effector cell comprises a nucleic acid molecule encoding a CAR according to any one of claims 1 to 12. The immune effector cell comprises the chimeric antigen receptor of claim 12 or comprises a nucleic acid fragment encoding the chimeric antigen receptor of claim 12; preferably, the immune effector cell is selected from a T cell, a NK cell, a NKT cell, a monocyte, a macrophage, a dendritic cell or a mast cell; the T cell can be selected from an inflammatory T cell, a cytotoxic T cell, a regulatory T cell (Treg) or a helper T cell; preferably, the immune effector cell is an allogeneic immune effector cell or an autologous immune cell.

14. An isolated nucleic acid molecule, comprising, The nucleic acid molecule encodes the nanobody or antigen-binding fragment of any one of claims 1-10 or any combination thereof, the multispecific antigen-binding molecule of claim 11 or the chimeric antigen receptor of claim 12.

15. An expression vector comprising the isolated nucleic acid molecule of claim 14.

16. An isolated host cell comprising the isolated nucleic acid molecule of claim 14, or the expression vector of claim 15; preferably, the host cell is a eukaryotic cell or a prokaryotic cell; more preferably, the host cell is derived from a mammalian cell, a yeast cell, an insect cell, E. coli, and / or B. subtilis; more preferably, the host cell is selected from the group consisting of HEK293E or CHO cells.

17. A method of producing an antibody or antigen binding fragment according to any one of claims 1 to 10 or a multispecific antigen binding molecule according to claim 11, characterized in that, Culturing the host cell of claim 16 under appropriate conditions, and isolating the antibody or antigen-binding fragment or the multispecific antigen-binding molecule.

18. A method of making the immune effector cell of claim 13, wherein, The method comprises introducing a nucleic acid fragment encoding the chimeric antigen receptor of claim 12 into an immune effector cell, and optionally, the method further comprises initiating expression of the chimeric antigen receptor of claim 12 by the immune effector cell.

19. A pharmaceutical composition comprising, The composition comprises the antibody or antigen-binding fragment of any one of claims 1-10, the multispecific antigen-binding molecule of claim 11, the chimeric antigen receptor of claim 12, the immune effector cell of claim 13, the isolated nucleic acid molecule of claim 14, the expression vector of claim 15, the host cell of claim 16, or the product produced by the method of claim 17 or 18; preferably, the composition further comprises a pharmaceutically acceptable carrier, diluent, or adjuvant; preferably, the pharmaceutical composition further comprises an additional anti-neoplastic agent.

20. Use of the antibody or antigen-binding fragment of any one of claims 1-10, the multispecific antigen-binding molecule of claim 11, the chimeric antigen receptor of claim 12, the immune effector cell of claim 13, the isolated nucleic acid molecule of claim 14, the expression vector of claim 15, the host cell of claim 16, or the product produced by the method of claim 17 or 18, or the pharmaceutical composition of claim 19, for the manufacture of a medicament for the prevention and / or treatment of a CLL-1 mediated disease; preferably, the CLL-1 mediated disease is a myeloid leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute primary myelocytic leukemia, chronic myelogenous leukemia (CML), or a disease associated with myelodysplastic syndrome (MDS).

21. A method of preventing and / or treating a CLL-1 mediated disease, comprising administering to a patient in need thereof an effective amount of an antibody or antigen binding fragment according to any one of claims 1-10, a multispecific antigen binding molecule according to claim 11, a chimeric antigen receptor according to claim 12, an immune effector cell according to claim 13, an isolated nucleic acid molecule according to claim 14, an expression vector according to claim 15, a host cell according to claim 16, or a product produced by a process according to claim 17 or 18, or a pharmaceutical composition according to claim 19; preferably the CLL-1 mediated disease is a myeloid leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute primary myelocytic leukemia, chronic myelogenous leukemia (CML), or a myelodysplastic syndrome (MDS) related disease.

22. The antibody or antigen binding fragment of any one of claims 1-10, the multispecific antigen binding molecule of claim 11, the chimeric antigen receptor of claim 12, the immune effector cell of claim 13, the isolated nucleic acid molecule of claim 14, the expression vector of claim 15, the host cell of claim 16, or the product produced by the method of claim 17 or 18, or the pharmaceutical composition of claim 19, wherein, for use and / or in the treatment of a CLL-1 mediated disease; preferably the CLL-1 mediated disease is a myeloid leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute primary myelocytic leukemia, chronic myelogenous leukemia (CML), or a myelodysplastic syndrome (MDS) related disease.

23. A kit comprising an antibody or antigen binding fragment thereof according to any one of claims 1-10, a multispecific antigen binding molecule according to claim 11, a chimeric antigen receptor according to claim 12, an immune effector cell according to claim 13, an isolated nucleic acid molecule according to claim 14, an expression vector according to claim 15, a host cell according to claim 16, or a product produced by a process according to claim 17 or 18, or a pharmaceutical composition according to claim 19; further comprising instructions for use.

Images