Dsrna molecule for regulating TAU expression
By designing specific double-stranded RNA (dsRNA) molecules and using RNA interference mechanisms to inhibit TAU gene expression, the problem of treating TAU-related diseases in existing technologies has been solved, and effective treatment and prevention of various neurodegenerative diseases have been achieved.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-09-26
- Publication Date
- 2026-04-02
AI Technical Summary
Current technologies lack effective methods for treating neurodegenerative diseases associated with TAU, such as tau proteinosis and Alzheimer's disease.
A specially designed double-stranded RNA (dsRNA) molecule is used to inhibit the expression of the TAU gene through an RNA interference mechanism. The dsRNA molecule consists of a sense strand and an antisense strand, each 15-30 nucleotides in length, with a specific nucleotide sequence and modifications. It is used to prepare a pharmaceutical composition to reduce the expression of the TAU gene.
It effectively inhibits the expression of the TAU gene, reduces symptoms of related diseases, prevents disease progression, and provides treatment and prevention methods applicable to a variety of TAU-related diseases.
Smart Images

Figure PCTCN2025124501-FTAPPB-I100001 
Figure PCTCN2025124501-FTAPPB-I100002 
Figure PCTCN2025124501-FTAPPB-I100003
Abstract
Description
dsRNA molecules for modulating tau expression
[0001] This application claims priority to Chinese Patent Application No. 202411362798.4, filed on September 26, 2024, entitled "dsRNA molecules for modulating tau expression". TECHNICAL FIELD
[0002] The present application relates to the field of RNA interference. BACKGROUND
[0003] TAU (also known as MAPT) is a protein encoded by the TAU gene. Its abnormal expression is associated with a range of diseases, including tauopathies, Alzheimer's disease, frontotemporal dementia (FTD), behavioural variant frontotemporal dementia (bvFTD), nonfluent variant primary progressive aphasia (nfvPPA), primary progressive aphasia - semantic (PPA-S), primary progressive aphasia - logopenic (PPA-L), frontotemporal dementia and parkinsonism linked to chromosome 17 (FTDP-17), Pick's disease (PiD), agryophthalmia (AGD), multiple system tauopathy with presenile dementia (MSTD), white matter tauopathy with globular glial inclusions (FTLD with GGis), FTLD with MAPT mutations, neurofibrillary tangle (NFT) dementia, FTD with motor neuron disease, amyotrophic lateral sclerosis (ALS), corticobasal syndrome (CBS), corticobasal degeneration (CBD), progressive supranuclear palsy (PSP), Parkinson's disease, postencephalitic parkinsonism, Niemann-Pick disease, Huntington's disease, myotonic dystrophy type 1 and Down's syndrome (DS).
[0004] There is a need in the art for compositions and methods for treating diseases associated with TAU.
[0005] To this end, one treatment method is to reduce TAU expression by small interfering RNA (siRNA) based on the RNA interference mechanism to treat neurodegenerative diseases associated with TAU. SUMMARY
[0006] The present application provides novel double strand RNA (or simply dsRNA) for inhibiting TAU gene expression, cells, and pharmaceutical compositions and kits comprising the dsRNA or cells, and methods of using the dsRNA, cells, and pharmaceutical compositions and kits to inhibit or reduce TAU gene expression or to treat diseases or conditions that benefit from a reduction in TAU gene expression.
[0007] In a first aspect, the present application provides a double-stranded RNA (dsRNA) for inhibiting expression of a TAU gene, the dsRNA comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand and the antisense strand each independently are 15-30 nucleotides in length, and the antisense strand comprises a nucleotide sequence of at least 15 contiguous nucleotides of the nucleotide sequence set forth in any one of SEQ ID NOs: 721-1440. In some embodiments, the sense strand comprises a nucleotide sequence of at least 15 contiguous nucleotides of the nucleotide sequence set forth in any one of SEQ ID NOs: 1-720.
[0008] In some embodiments, a hairpin loop is formed between the sense strand and the antisense strand in the dsRNA. In other embodiments, the dsRNA is an siRNA.
[0009] In some embodiments, the sense strand and the antisense strand each independently are 15-27 nucleotides in length, preferably 18-25 nucleotides, more preferably 19-21 nucleotides in length. In some embodiments, the sense strand is 15-27 nucleotides in length, preferably 17-25 nucleotides, more preferably 18-23 nucleotides, more preferably 19-21 nucleotides in length, most preferably 19 amino acids in length. In some embodiments, the antisense strand is 15-27 nucleotides in length, preferably 17-25 nucleotides, more preferably 18-23 nucleotides, more preferably 19-22 nucleotides in length, most preferably 21 amino acids in length.
[0010] In some embodiments, the double-stranded region is 15-25 nucleotide pairs in length, preferably 16-23 nucleotide pairs, more preferably 18-20 nucleotide pairs, most preferably 19 nucleotide pairs in length.
[0011] In some embodiments, one or both of the sense strand and the antisense strand comprises a 3’ overhang and / or a 5’ overhang of at least 1 nucleotide, for example one or both of the sense strand and the antisense strand comprises a 3’ overhang and / or a 5’ overhang of at least 2 nucleotides. In some embodiments, the antisense strand has a 3’ overhang and / or a 5’ overhang of at least 1 nucleotide, preferably the antisense strand comprises a 3’ overhang and / or a 5’ overhang of 2 nucleotides. In some specific embodiments, the dsRNA has a two nucleotide overhang at the 3’ end of the antisense strand and a blunt end at the 5’ end of the antisense strand.
[0012] In some embodiments, the antisense strand comprises a nucleotide sequence of at least 16 contiguous nucleotides, a nucleotide sequence of at least 17 contiguous nucleotides, a nucleotide sequence of at least 18 contiguous nucleotides, a nucleotide sequence of at least 19 contiguous nucleotides, or a nucleotide sequence of at least 20 contiguous nucleotides of the nucleotide sequence set forth in any one of SEQ ID NOs: 721-1440. In preferred embodiments, the antisense strand comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 721-1440. In more preferred embodiments, the antisense strand comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 735, 739, 742, 757, 760, 763, 764, 768, 770, 776, 779, 780, 790, 793, 794, 802, 803, 806, 811, 817, 827, 831, 833, 865, and 898.
[0013] In some embodiments, the sense strand comprises a nucleotide sequence of at least 16 contiguous nucleotides, a nucleotide sequence of at least 17 contiguous nucleotides, or a nucleotide sequence of at least 18 contiguous nucleotides of the nucleotide sequence set forth in any one of SEQ ID NOs: 1-720. In preferred embodiments, the sense strand comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 1-720. In more preferred embodiments, the sense strand comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 15, 19, 22, 37, 40, 43, 44, 48, 50, 56, 59, 60, 70, 73, 74, 82, 83, 86, 91, 97, 107, 111, 113, 145, and 178.
[0014] In some embodiments, the dsRNA comprises any one of the pairs of paired sense strand sequences and antisense strand sequences as set forth in Table 3 of the specification.
[0015] In some embodiments, substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, or all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides.
[0016] In some embodiments, the sense strand and the antisense strand each independently comprise one or more modified nucleotides selected from the group consisting of 2'-0-alkyl modified nucleotides (e.g., 2'-0-methyl modified nucleotides), 2'-methoxyethyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy-modified nucleotides, inosine ribonucleotides, abasic nucleotides, inverted abasic deoxyribonucleotides, nucleotides comprising phosphorothioate groups, vinyl phosphonate modified nucleotides, locked nucleotides, unlocked nucleotides, 2'-amino-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-0-allyl modified nucleotides, morpholino nucleotides, phosphoramidates, nucleotides comprising non-natural bases, terminal nucleotides linked to a cholesteryl derivative or a dodecanoic acid didecanamide group, deoxyribonucleotides, 3'-terminal deoxythymine (dT) nucleotides, conformationally restricted nucleotides, restricted ethyl nucleotides, 2'-hydroxyl modified nucleotides, nucleotides comprising methylphosphonate groups, nucleotides comprising 5'-phosphates, nucleotides comprising 5'-phosphate mimics, glycol modified nucleotides (GNAs), 2-0-(N-methylacetamide) modified nucleotides, and SCP modified nucleotides.
[0017] In some embodiments, the sense strand and the antisense strand each independently comprise one or more nucleotide modifications selected from the group consisting of 2'-0-methyl modified nucleotides, 2'-fluoro modified nucleotides, nucleotides comprising phosphorothioate groups, and SCP modified nucleotides.
[0018] In some embodiments, the sense strand and / or the antisense strand comprises at least 2 2'-fluoro modified nucleotides. In some embodiments, the sense strand and / or the antisense strand comprises at least 8 2'-0-methyl modified nucleotides. In some embodiments, the 3' end and / or the 5' end of the sense strand and / or the antisense strand comprises 1-5 phosphorothioate internucleotide linkages, preferably 2-4 phosphorothioate internucleotide linkages.
[0019] In some embodiments, the antisense strand of the dsRNA has a length of 21 nucleotides and has (i) (counting from the 5' end) 2'-0-methyl modified nucleotides at positions 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21, and 2'-fluoro modified nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20; and / or
[0020] (ii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 19 and 20, and between nucleotide positions 20 and 21 (counting from the 5' end).
[0021] In some embodiments, the antisense strand of the dsRNA has a length of 21 nucleotides and has
[0022] (i) an SCP modification at position 1 (counting from the 5' end);
[0023] (ii) 2'-fluoro modifications at positions 2, 4, 6, 8, 10, 12, 14, 16, and 18 (counting from the 5' end);
[0024] (iii) 2'-O-methyl modifications at positions 3, 5, 7, 9, 11, 13, 15, 17, 19, 20, and 21 (counting from the 5' end); and / or
[0025] (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 19 and 20, and between nucleotide positions 20 and 21 (counting from the 5' end).
[0026] In some embodiments, the antisense strand of the dsRNA has a length of 21 nucleotides and has
[0027] (i) 2'-deoxy modifications at positions 2, 5, 7, and 12 (counting from the 5' end);
[0028] (ii) an SCP modification at position 1 (counting from the 5' end);
[0029] (iii) a 2'-fluoro modification at position 14 (counting from the 5' end);
[0030] (iv) 2'-O-methyl modifications at positions 3, 4, 6, 8, 9, 10, 11, 13, 15, 16, 17, 18, 19, 20, and 21 (counting from the 5' end); and / or
[0031] (v) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 19 and 20, and between nucleotide positions 20 and 21 (counting from the 5' end).
[0032] In some embodiments, the antisense strand of the dsRNA has a length of 21 nucleotides and has
[0033] (i) an SCP modification at position 1 (counting from the 5' end);
[0034] (ii) 2'-fluoro modifications at positions 2, 5, 7, 12, and 14 (counting from the 5' end);
[0035] (iii) 2'-0-methyl modifications at positions (counting from the 5' end) 3, 4, 6, 8, 9, 10, 11, 13, 15, 16, 17, 18, 19, 20, and 21; and / or
[0036] (iv) phosphorothioate intemucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 19 and 20, and between nucleotide positions 20 and 21 (counting from the 5' end).
[0037] In some embodiments, the antisense strand of the dsRNA has a length of 21 nucleotides and has
[0038] (i) an SCP modification at position 1 (counting from the 5' end);
[0039] (ii) 2'-fluoro modifications at positions 2, 7, 12, 14, 16 (counting from the 5' end);
[0040] (iii) 2'-0-methyl modifications at positions (counting from the 5' end) 3, 4, 5, 6, 8, 9, 10, 11, 13, 15, 17, 18, 19, 20, and 21; and / or
[0041] (iv) phosphorothioate intemucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 19 and 20, and between nucleotide positions 20 and 21 (counting from the 5' end).
[0042] In some embodiments, the antisense strand of the dsRNA has a length of 21 nucleotides and has
[0043] (i) 2'-0-methyl modifications at positions (counting from the 5' end) 1-6, 10-19, and 2'-fluoro modifications at positions 7-9; and / or
[0044] (ii) phosphorothioate intemucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, and between nucleotide positions 18 and 19 (counting from the 5' end).
[0045] In some embodiments, the antisense strand of the dsRNA has a length of 21 nucleotides and has
[0046] (i) 2'-0-methyl modifications at positions (counting from the 5' end) 1-6, 10-19, and 2'-fluoro modifications at positions 7-9; and / or
[0047] (ii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 17 and 18, and between nucleotide positions 18 and 19, counting from the 5' end.
[0048] In some embodiments, the sense strand of the dsRNA has a length of 19 nucleotides and has:
[0049] (i) 2'-0-methyl modified nucleotides at positions 1 to 6, 10 to 19, and 2'-fluoro modified nucleotides at positions 7-9, counting from the 5' end; and / or
[0050] (ii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 17 and 18, and between nucleotide positions 18 and 19, counting from the 5' end.
[0051] In some embodiments, the antisense strand of the dsRNA comprises any one of the modified nucleotide sequences shown in Table 5, and / or the sense strand comprises any one of the modified nucleotide sequences shown in Table 4. In some embodiments, the dsRNA comprises a paired modified sense strand sequence and a modified antisense strand sequence.
[0052] In some embodiments, the dsRNA of the present application is further conjugated to a ligand moiety comprising N-acetylgalactosamine, preferably the sense strand is conjugated to the ligand moiety, more preferably the 3' end of the sense strand is conjugated to the ligand moiety via a phosphorothioate.
[0053] In a second aspect, the present application provides a cell containing a dsRNA of the first aspect of the present application.
[0054] In a third aspect, the present application provides a pharmaceutical composition comprising a dsRNA of the first aspect of the present application or a cell of the second aspect of the present application, and optionally a pharmaceutically acceptable carrier or excipient.
[0055] In a fourth aspect, the present application provides a kit comprising a dsRNA of the first aspect of the present application, a cell of the second aspect of the present application, or a pharmaceutical composition of the third aspect of the present application.
[0056] In a fifth aspect, the present application provides a method of inhibiting expression of a TAU gene in a cell, the method comprising contacting the cell with a dsRNA as described in the first aspect of the present application or a pharmaceutical composition as described in the third aspect of the present application. In some embodiments, the method is performed in vitro.
[0057] In a sixth aspect, the present application provides a method of inhibiting TAU gene expression in a cell in a subject, the method comprising administering to the subject a dsRNA as described in the first aspect of the present application, a cell as described in the second aspect of the present application, or a pharmaceutical composition as described in the third aspect of the present application.
[0058] The present application also provides a method of treating a disease or disorder in a subject that benefits from a reduction in TAU gene expression, the method comprising administering to the subject a dsRNA as described in the first aspect of the present application, a cell as described in the second aspect of the present application, or a pharmaceutical composition as described in the third aspect of the present application.
[0059] The present application also provides a method of preventing at least one symptom in a subject having a disease or disorder that benefits from a reduction in TAU gene expression, the method comprising administering to the subject a dsRNA as described in the first aspect of the present application, a cell as described in the second aspect of the present application, or a pharmaceutical composition as described in the third aspect of the present application.
[0060] The present application also provides a method of preventing the progression of a disease or disorder in a subject that benefits from a reduction in TAU gene expression, the method comprising administering to the subject a dsRNA as described in the first aspect of the present application, a cell as described in the second aspect of the present application, or a pharmaceutical composition as described in the third aspect of the present application.
[0061] In some embodiments, the disease or disorder that benefits from a reduction in TAU gene expression is a TAU-associated disease. In some preferred embodiments, the TAU-associated disease is selected from the group consisting of a tauopathy, Alzheimer’s disease, frontotemporal dementia (FTD), behavioral variant frontotemporal dementia (bvFTD), nonfluent variant primary progressive aphasia (nfvPPA), primary progressive aphasia-semantic (PPA-S), primary progressive aphasia-languagereductive (PPA-L), frontotemporal dementia with Parkinsonism linked to chromosome 17 (FTDP-17), Pick’s disease (PiD), agryophilic grain disease (AGD), multiple system tauopathy with dementia of the Alzheimer’s type (MSTD), white matter tauopathy with globular glial inclusions (FTLD with GGis), FTLD with MAPT mutations, neurofibrillary tangle (NFT) dementia, FTD with motor neuron disease, amyotrophic lateral sclerosis (ALS), corticobasal syndrome (CBS), corticobasal degeneration (CBD), progressive supranuclear palsy (PSP), Parkinson’s disease, postencephalitic Parkinsonism, Niemann-Pick disease, Huntington’s disease, myotonic dystrophy type 1, and Down’s syndrome (DS).
[0062] In some embodiments, the dsRNA, cell or pharmaceutical composition is administered subcutaneously or intrathecally.
[0063] In some embodiments, the subject is a human.
[0064] DETAILED DESCRIPTION
[0065] The present application can also be carried out in other different embodiments and carried out or applied in other different ways, and the various details described herein can be varied greatly without departing from the spirit of the application.
[0066] It should be understood that the scope of the protection is not limited to the specific embodiments described below; in addition, it should be understood that the use of relative terms will be understood, and used by those skilled in the art, depending on the specific context in which they are used, and that, accordingly, the use of such terms in the description is meant to be taken as a description of a specific embodiment and is not a limitation of the scope of the application.
[0067] In this specification and in the claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.
[0068] When numerical ranges are given, it should be understood that every numerical value between the two endpoints, as well as any one numerical value in that range, is also specifically contemplated unless the context clearly indicates otherwise. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Any methods, devices and materials similar or equivalent to those described herein, according to the knowledge of those skilled in the art, and the disclosures of the present application, can be used in the practice of the application. The present embodiments are now described in closer detail.
[0069] Definitions
[0070] A "double-stranded region" refers herein to a region comprising two nucleic acid strands that are antiparallel and complementary or substantially complementary.
[0071] As used herein, the term "double-stranded RNA" or "dsRNA" refers to a ribonucleic acid molecule or complex of ribonucleic acid molecules comprising a double-stranded region as defined above. The two parts forming the double-stranded region can be two different parts of one larger RNA molecule, or they are separate RNA molecules.
[0072] When the two parts are separate RNA molecules, the dsRNAs herein are referred to as small interfering RNA (or short interfering RNA, siRNA).
[0073] When the two parts are two different parts of one larger molecule, i.e., when the 3' end of one part is linked to the 5' end of the other part by one or more unbroken nucleotides between the two, the unbroken nucleotides used for the linkage are referred to as a "hairpin loop." When the two parts are covalently linked to form a double-stranded region by means other than a hairpin loop, the linkage is referred to as a "linker." Such dsRNAs are cleaved into siRNAs by an endoribonuclease in the cell known as Dicer after introduction into the cell.
[0074] The term "siRNA" herein is a class of double-stranded RNA molecules comprising a sense strand and an antisense strand that can mediate the silencing of a target RNA (e.g., mRNA, e.g., a transcript of a gene encoding a protein) that is complementary or substantially complementary to the antisense strand. The siRNAs are typically double-stranded, comprising an antisense strand that is complementary to a target RNA, and a sense strand that is complementary or substantially complementary to the antisense strand. For convenience, such mRNA is also referred to herein as mRNA to be silenced. Such gene is also referred to as target gene. Typically, the RNA to be silenced is an endogenous gene or a pathogen gene. In addition, RNAs other than mRNA (e.g., tRNA) and viral RNAs can also be targeted.
[0075] As used herein, the term "antisense strand" refers to the strand in a dsRNA (particularly an siRNA) that comprises a region that is fully or substantially complementary to a target sequence.
[0076] As used herein, the term "complementary region" refers to the region on the antisense strand that is fully or substantially complementary to a target mRNA sequence. Where the complementary region is not fully complementary to the target sequence, the mismatches can be in the interior or in the terminal regions of the molecule. Typically, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, 2, or 1 nucleotides of the 5' and / or 3' end. The portion of the antisense strand that is most sensitive to mismatches is referred to as the "seed region." For example, in an siRNA comprising a 19 nt strand, the 19th position (from 5' to 3') can tolerate some mismatches.
[0077] The term "complementary," as used herein, refers to the capacity of a first polynucleotide to hybridize to a second polynucleotide under certain conditions, e.g., under stringent conditions. For example, stringent conditions can include 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA at 50°C or 70°C for 12-16 hours.
[0078] As used herein, "complementary" sequences can also include or be formed entirely from non-Watson-Crick base pairs and / or base pairs formed from non-natural and modified nucleotides, insofar as they meet the above requirements with respect to their ability to hybridize.
[0079] As used herein, a polynucleotide that is "at least partially complementary" or "substantially complementary" to a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding apolipoprotein(a)). For example, a polynucleotide is at least partially complementary to an mRNA encoding apolipoprotein(a) if the sequence is substantially complementary to a non-interrupted portion of the mRNA encoding apolipoprotein(a).
[0080] The terms "complementary," "fully complementary," and "substantially complementary" as used herein can be used in reference to base pairing between the sense strand and the antisense strand of a dsRNA, particularly an siRNA, or between the antisense strand of a dsRNA, particularly an siRNA, and a target sequence.
[0081] The term "sense strand" as used herein refers to the strand of an siRNA that includes a region that is substantially complementary to a region that is an antisense strand as defined herein.
[0082] A "nucleoside" is a compound consisting of a purine or pyrimidine base, and either ribose or deoxyribose, a "nucleotide" is a compound consisting of a purine or pyrimidine base, ribose or deoxyribose, and a phosphate, and an "oligonucleotide" refers to a nucleic acid molecule (RNA or DNA) having, for example, fewer than 100, 200, 300, or 400 nucleotides in length.
[0083] A "base" is the basic building block of synthetic nucleosides, nucleotides, and nucleic acids, which contains nitrogen among its constituent elements, also known as a "nitrogenous base." Herein, capital letters A, U, T, G, and C represent the base composition of nucleotides, adenine, uracil, thymine, guanine, and cytosine, respectively, unless otherwise specified.
[0084] As used herein, the term "nucleotide overhang" refers to at least one unpaired nucleotide that overhangs from the double-stranded region of an siRNA. A nucleotide overhang is present, for example, when the 3 '-end of one strand of an siRNA extends beyond the 5 '-end of the other strand, or vice versa. An siRNA can comprise an overhang of at least one nucleotide, an overhang of at least two nucleotides, an overhang of at least three nucleotides, an overhang of at least four nucleotides, an overhang of at least five nucleotides or more. A nucleotide overhang can comprise or consist of nucleotides / modified nucleotides (including deoxynucleotides / nucleosides). One or more overhangs can be on the sense strand or the antisense strand or any combination thereof. An overhang of one or more nucleotides can be present on the 5 '-end, the 3 '-end, or both ends of the antisense or sense strand of an siRNA.
[0085] "Blunt" or "blunt end" or "blunt-ended" means that there are no unpaired nucleotides at the end of the double-stranded siRNA, i.e., no nucleotide overhang. A "blunt-end siRNA" is an siRNA that is double-stranded over the entire length of the siRNA, i.e., there is no nucleotide overhang at either end of the molecule.
[0086] Essentially all of the nucleotides of a dsRNA (particularly an siRNA) of the application are modified. For example, essentially all of the nucleotides of the sense strand are modified nucleotides, or essentially all of the nucleotides of the antisense strand are modified nucleotides, or essentially all of the nucleotides of both the sense strand and the antisense strand are modified nucleotides. In other embodiments of the application, all of the nucleotides of a dsRNA (particularly an siRNA) of the application are modified nucleotides. For example, all of the nucleotides of the sense strand are modified nucleotides, or all of the nucleotides of the antisense strand are modified nucleotides, or all of the nucleotides of both the sense strand and the antisense strand are modified nucleotides. As used herein, "essentially all of the nucleotides are modified" means that a majority of the nucleotides of a dsRNA (particularly an siRNA) of the application are modified, but not all of the nucleotides are modified, and can include no more than 5, 4, 3, 2, or 1 unmodified nucleotides.
[0087] "2'-O-methyl modified nucleotide" refers to a nucleotide formed by substituting the 2'-hydroxyl of the ribose group with a methoxy group.
[0088] For example, "2'-fluoro modified nucleotide" refers to a nucleotide formed by substituting the hydroxyl group at the 2' position of the ribose group of the nucleotide with a fluorine. "2'-O-methyl modified nucleotide" refers to a nucleotide formed by substituting the 2'-hydroxyl of the ribose group with a methoxy group.
[0089] "Phosphorothioate internucleotide linkage" refers to a modification in which one or more of the oxygen atoms of the phosphate group in a nucleotide is replaced with a sulfur atom.
[0090] In some embodiments, the sense strand of a dsRNA (particularly an siRNA) of the present disclosure has 1 or 2 phosphorothioate internucleotide linkage modifications at positions 1-5 (counting from the 5' end) and / or has 1 or 2 phosphorothioate internucleotide linkage modifications at positions 1-5 (counting from the 3' end), and / or the antisense strand of a dsRNA (particularly an siRNA) of the present disclosure has 1 or 2 phosphorothioate internucleotide linkage modifications at positions 1-5 (counting from the 5' end) and / or has 1 or 2 phosphorothioate internucleotide linkage modifications at positions 1-5 (counting from the 3' end).
[0091] In some embodiments, the sense strand of a dsRNA (particularly an siRNA) of the present disclosure has 1 or 2 phosphorothioate internucleotide linkage modifications located at positions 1 to 4 (counting from the 5' end) and / or has 1 or 2 phosphorothioate internucleotide linkage modifications located at positions 1 to 4 (counting from the 3' end), and / or the antisense strand of a dsRNA (particularly an siRNA) of the present disclosure has 1 or 2 phosphorothioate internucleotide linkage modifications located at positions 1 to 4 (counting from the 5' end) and / or has 1 or 2 phosphorothioate internucleotide linkage modifications located at positions 1 to 4 (counting from the 3' end).
[0092] In some embodiments, the sense strand of a dsRNA (particularly an siRNA) of the present disclosure has 1 or 2 phosphorothioate internucleotide linkage modifications located at positions 1 to 3 (counting from the 5' end) and / or has 1 or 2 phosphorothioate internucleotide linkage modifications located at positions 1 to 3 (counting from the 3' end), and / or the antisense strand of a dsRNA (particularly an siRNA) of the present disclosure has 1 or 2 phosphorothioate internucleotide linkage modifications located at positions 1 to 3 (counting from the 5' end) and / or has 1 or 2 phosphorothioate internucleotide linkage modifications located at positions 1 to 3 (counting from the 3' end).
[0093] In some embodiments, the sense strand of a dsRNA (particularly an siRNA) of the present disclosure has 1 or 2 phosphorothioate internucleotide linkage modifications located at positions 1 and 2 (counting from the 5' end) and / or has 1 or 2 phosphorothioate internucleotide linkage modifications located at positions 1 and 2 (counting from the 3' end), and / or the antisense strand of a dsRNA (particularly an siRNA) of the present disclosure has 1 or 2 phosphorothioate internucleotide linkage modifications located at positions 1 to 2 (counting from the 5' end) and / or has 1 or 2 phosphorothioate internucleotide linkage modifications located at positions 1 to 2 (counting from the 3' end).
[0094] As used herein, the term "inhibit" is used interchangeably with "reduce," "silence," "down-regulate," and other similar terms, and includes inhibition at any level.
[0095] The phrase "inhibiting expression of a TAU gene" refers to inhibiting expression of any TAU gene as well as variants or mutants of TAU genes. Thus, the TAU gene can be a wild-type TAU gene, a mutant TAU gene, or a transgenic TAU gene in the context of a genetically manipulated cell, group of cells, or organism.
[0096] "Inhibiting expression of a TAU gene" includes any level of inhibition of a TAU gene, e.g., at least partial inhibition of TAU gene expression. TAU gene expression can be assessed based on the level or change in level of any variable associated with TAU gene expression, e.g., mRNA level of apolipoprotein(a), protein level of apolipoprotein(a). This level can be assessed in a single cell or in a group of cells, including, e.g., a sample derived from a subject.
[0097] Inhibition can be assessed by a decrease in the absolute or relative level of one or more variables associated with TAU gene expression compared to a control level. The control level can be any type of control level utilized in the art, e.g., pre-dose baseline level or a level determined from a similar untreated or control (e.g., buffer control or inert agent control) treated subject, cell, or sample.
[0098] As used herein, the terms "treat," "treatment," and the like, refer to administering an agent or performing a procedure in order to effect an outcome. These outcomes can be prophylactic, in terms of completely or partially preventing a disease or symptom thereof, and / or can be therapeutic, in terms of partially or completely curing a disease and / or symptoms of a disease. As used herein, "treatment" can include treatment of a disease or disorder in a mammal, particularly in a human, and includes: (a) preventing the disease or symptom of the disease from occurring (e.g., preventing a disease associated with or caused by the primary disease) in an individual that can be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; (c) relieving the disease, i.e., causing the disease to regress. Treatment can refer to any indication of success in treating or ameliorating or preventing cancer, including any objective or subjective parameters, e.g., elimination; remission; diminishing of symptoms or making the disease symptoms easier to tolerate; slowing in the rate of worsening or degeneration; or lessening of the disease's end-point. Treatment or amelioration of symptoms is based on one or more objective or subjective parameters; including results of a physician's examination. Thus, the term "treatment" includes the administration of a dsRNA, cell, or pharmaceutical composition disclosed herein to prevent or delay, to alleviate or arrest or inhibit the development of a symptom or condition associated with a disease. The term "therapeutic effect" refers to the reduction, elimination, or prevention of a disease, a symptom of a disease, or a side effect of a disease in a subject.
[0099] The term "effective amount" as used herein refers to an amount that is sufficient, when administered to a subject for treating a disease, to effect such treatment of the disease.
[0100] As used herein, the term "subject" refers to any mammalian subject in whom diagnosis, cure, mitigation, or treatment is desired. "Mammal" for purposes of treatment includes humans, domestic and farm animals, and laboratory and sports animals, e.g., dogs, horses, cats, cows, sheep, goats, pigs, mice, rats, rabbits, guinea pigs, monkeys, etc.
[0101] I. dsRNA
[0102] The present application provides a double-stranded RNA (dsRNA) for inhibiting TAU gene expression, the dsRNA comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand and the antisense strand are each independently 15-30 nucleotides in length, and the antisense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides of the nucleotide sequence set forth in any one of SEQ ID NOs: 721-1440.
[0103] In some embodiments, the double-stranded region formed by the sense strand and the antisense strand is fully complementary. In other embodiments, the double-stranded region formed by the sense strand and the antisense strand is substantially complementary, wherein it can comprise 1, 2, 3, 4, or 5 non-complementary sites.
[0104] In some specific embodiments, the sense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides of the nucleotide sequence set forth in any one of SEQ ID NOs: 1-720.
[0105] In some embodiments, the sense strand and the antisense strand are each independently 15-27 nucleotides in length, preferably 18-25 nucleotides in length, more preferably 19-21 nucleotides in length.
[0106] In some embodiments, the double-stranded region is 15-25 nucleotide pairs in length, preferably 16-23 nucleotide pairs in length, more preferably 18-20 nucleotide pairs in length.
[0107] In some embodiments, the dsRNA of the present application is an siRNA. In other embodiments, a hairpin loop is formed between the sense strand and the antisense strand of the dsRNA of the present application.
[0108] One or both of the sense strand and the antisense strand comprises a 3' overhang and / or a 5' overhang of at least 1 nucleotide. In some embodiments, one or both of the sense strand and the antisense strand comprises a 3' overhang and / or a 5' overhang of at least 1 nucleotide. In some specific embodiments, one or both of the sense strand and the antisense strand comprises a 3' overhang and / or a 5' overhang of 1 nucleotide. In some specific embodiments, one or both of the sense strand and the antisense strand comprises a 3' overhang and / or a 5' overhang of 2 nucleotides. In some specific embodiments, one or both of the sense strand and the antisense strand comprises a 3' overhang and / or a 5' overhang of 3 nucleotides. In some specific embodiments, one or both of the sense strand and the antisense strand comprises a 3' overhang and / or a 5' overhang of 4 nucleotides.
[0109] In some specific embodiments, the antisense strand comprises a 3' overhang and / or a 5' overhang of 1 nucleotide. In some embodiments, the antisense strand comprises a 3' overhang and / or a 5' overhang of 2 nucleotides. In some embodiments, the antisense strand comprises a 3' overhang and / or a 5' overhang of 3 nucleotides. In some embodiments, the antisense strand comprises a 3' overhang and / or a 5' overhang of 4 nucleotides. In some preferred embodiments, the antisense strand has a 3' overhang and / or a 5' overhang of at least 2 nucleotides.
[0110] Preferably the antisense strand comprises a 3' overhang and / or a 5' overhang of 2 nucleotides.
[0111] In some embodiments, the sense strand and the antisense strand are of the same length.
[0112] In some embodiments, the full length of the sense strand is complementary to the full length of the antisense strand forming a double strand, i.e. having a blunt end.
[0113] In other embodiments, the sense strand and the antisense strand are of the same length, a portion of the sense strand is complementary to a portion of the antisense strand, i.e. both the sense strand and the antisense strand have a 5' overhang. In some embodiments, the sense strand and the antisense strand are of different lengths. In preferred embodiments, the 5' end of the antisense strand has an overhang of at least 1 nucleotide, more preferably 2 or 3 nucleotides.
[0114] The dsRNAs of the application include dsRNAs having a nucleotide overhang at one end (i.e., agents having one overhang and one blunt end) or having a nucleotide overhang at both ends. For example, the 5 '-end of the sense strand of the dsRNA comprises an overhang of one or more nucleotides and the 3 '-end of the sense strand comprises an overhang of one or more nucleotides. For example, the 5 '-end of the antisense strand of the dsRNA comprises an overhang of one or more nucleotides and the 3 '-end of the antisense strand comprises an overhang of one or more nucleotides. For example, the 5 '-end of the sense strand of the dsRNA comprises an overhang of one or more nucleotides and the 5 '-end of the antisense strand comprises an overhang of one or more nucleotides. For example, the 3 '-end of the sense strand of the dsRNA comprises an overhang of one or more nucleotides and the 3 '-end of the antisense strand comprises an overhang of one or more nucleotides. For example, the 5 '-end of the sense strand of the dsRNA comprises an overhang of one or more nucleotides and the 3 '-end of the sense strand comprises a blunt end. For example, the 3 '-end of the sense strand of the dsRNA comprises an overhang of one or more nucleotides and the 5 '-end of the sense strand comprises a blunt end. For example, the 5 '-end of the antisense strand of the dsRNA comprises an overhang of one or more nucleotides and the 3 '-end of the antisense strand comprises a blunt end. For example, the 3 '-end of the antisense strand of the dsRNA comprises an overhang of one or more nucleotides and the 5 '-end of the antisense strand comprises a blunt end.
[0115] In some preferred embodiments, the 3 '-end of the antisense strand of the dsRNA of the application comprises an overhang of one or more nucleotides and the 5 '-end of the antisense strand comprises a blunt end. In some more preferred embodiments, the 3 '-end of the antisense strand of the dsRNA of the application comprises an overhang of 1, 2, 3, or 4 nucleotides and the 5 '-end of the antisense strand comprises a blunt end. In some more preferred embodiments, the 3 '-end of the antisense strand of the dsRNA of the application comprises an overhang of 2 nucleotides and the 5 '-end of the antisense strand comprises a blunt end.
[0116] In some embodiments, the antisense strand comprises a nucleotide sequence of at least 16 contiguous nucleotides, at least 17 contiguous nucleotides, at least 18 contiguous nucleotides, at least 19 contiguous nucleotides, or at least 20 contiguous nucleotides of the nucleotide sequence set forth in any one of SEQ ID NOs: 721-1440, preferably the antisense strand comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 721-1440.
[0117] In some embodiments, the sense strand comprises a nucleotide sequence of at least 16 contiguous nucleotides, at least 17 contiguous nucleotides, or at least 18 contiguous nucleotides of any of the nucleotide sequences set forth in SEQ ID NOs: 1-720, preferably the sense strand comprises the nucleotide sequence set forth in any of SEQ ID NOs: 1-720.
[0118] In some embodiments, the dsRNA comprises any of the pairs of paired sense strand sequences and antisense strand sequences as set forth in Table 3.
[0119] In some embodiments,
[0120] (a) the sense strand comprises CCAAGAGGGUGACACGGAA (SEQ ID NO: 15), and the antisense strand comprises UUCCGUGUCACCCUCUUGGUC (SEQ ID NO: 735);
[0121] (b) the sense strand comprises CUGGAAGACGAAGCUGCUA (SEQ ID NO: 19), and the antisense strand comprises UAGCAGCUUCGUCUUCCAGGC (SEQ ID NO: 739);
[0122] (c) the sense strand comprises AGACGAAGCUGCUGGUCAA (SEQ ID NO: 22), and the antisense strand comprises UUGACCAGCAGCUUCGUCUUC (SEQ ID NO: 742);
[0123] (d) the sense strand comprises GACCCAAGCUCGCAUGGUA (SEQ ID NO: 37), and the antisense strand comprises UACCAUGCGAGCUUGGGUCAC (SEQ ID NO: 757);
[0124] (e) the sense strand comprises CAAGCUCGCAUGGUCAGUA (SEQ ID NO: 40), and the antisense strand comprises UACUGACCAUGCGAGCUUGGG (SEQ ID NO: 760);
[0125] (f) the sense strand comprises CUCGCAUGGUCAGUAAAAA (SEQ ID NO: 43), and the antisense strand comprises UUUUUACUGACCAUGCGAGCU (SEQ ID NO: 763);
[0126] (g) the sense strand comprises UCGCAUGGUCAGUAAAAGA (SEQ ID NO: 44), and the antisense strand comprises UCUUUUACUGACCAUGCGAGC (SEQ ID NO: 764);
[0127] (h) the sense strand comprises CAGUAAAAGCAAAGACGGA (SEQ ID NO: 48), and the antisense strand comprises UCCGUCUUUGCUUUUACUGAC (SEQ ID NO: 768);
[0128] (i) the sense strand comprises AAGCAAAGACGGGACUGGA (SEQ ID NO: 50), and the antisense strand comprises UCCAGUCCCGUCUUUGCUUUU (SEQ ID NO: 770);
[0129] (j) the sense strand comprises AGACGGGACUGGAAGCGAA (SEQ ID NO: 56), and the antisense strand comprises UUCGCUUCCAGUCCCGUCUUU (SEQ ID NO: 776);
[0130] (k) the sense strand comprises GACUGGAAGCGAUGACAAA (SEQ ID NO: 59), and the antisense strand comprises UUUGUCAUCGCUUCCAGUCCC (SEQ ID NO: 779);
[0131] (l) the sense strand comprises CUGGAAGCGAUGACAAAAA (SEQ ID NO: 60), and the antisense strand comprises UUUUUGUCAUCGCUUCCAGUC (SEQ ID NO: 780);
[0132] (m) the sense strand comprises CCACCAGGAUUCCAGCAAA (SEQ ID NO: 70), and the antisense strand comprises UUUGCUGGAAUCCUGGUGGCG (SEQ ID NO: 790);
[0133] (n) the sense strand comprises CCAGGAUUCCAGCAAAAAA (SEQ ID NO: 73), and the antisense strand comprises UUUUUUGCUGGAAUCCUGGUG (SEQ ID NO: 793);
[0134] (o) the sense strand comprises CAGGAUUCCAGCAAAAACA (SEQ ID NO: 74), and the antisense strand comprises UGUUUUGCUGGAAUCCUGGU (SEQ ID NO: 794);
[0135] (p) the sense strand comprises CACCCAGCUCUGGUGAACA (SEQ ID NO: 82), and the antisense strand comprises UGUUCACCAGAGCUGGGUGGU (SEQ ID NO: 802);
[0136] (q) the sense strand comprises ACCCAGCUCUGGUGAACCA (SEQ ID NO: 83), and the antisense strand comprises UGGUUCACCAGAGCUGGGUGG (SEQ ID NO: 803);
[0137] (r) the sense strand comprises CAGCUCUGGUGAACCUCCA (SEQ ID NO: 86), and the antisense strand comprises UGGAGGUUCACCAGAGCUGGG (SEQ ID NO: 806);
[0138] (s) the sense strand comprises CUGGUGAACCUCCAAAAUA (SEQ ID NO: 91), and the antisense strand comprises UAUUUUGGAGGUUCACCAGAG (SEQ ID NO: 811);
[0139] (t) the sense strand comprises UGCCCAUGCCAGACCUGAA (SEQ ID NO: 97), and the antisense strand comprises UUCAGGUCUGGCAUGGGCACG (SEQ ID NO: 817);
[0140] (u) the sense strand comprises UAGUCUACAAACCAGUUGA (SEQ ID NO: 107), and the antisense strand comprises UCAACUGGUUUGUAGACUAUU (SEQ ID NO: 827);
[0141] (v) the sense strand comprises CCAGUUGACCUGAGCAAGA (SEQ ID NO: 111), and the antisense strand comprises UCUUGCUCAGGUCAACUGGUU (SEQ ID NO: 831);
[0142] (w) the sense strand comprises ACCUGAGCAAGGUGACCUA (SEQ ID NO: 113), and the antisense strand comprises UAGGUCACCUUGCUCAGGUCA (SEQ ID NO: 833);
[0143] (x) the sense strand comprises GGUGGAAGUAAAAUCUGAA (SEQ ID NO: 145), and the antisense strand comprises UUCAGAUUUUACUUCCACCUG (SEQ ID NO: 865); or
[0144] (y) the sense strand comprises GCAGCAUCGACAUGGUAGA (SEQ ID NO: 178), and the antisense strand comprises UCUACCAUGUCGAUGCUGCCG (SEQ ID NO: 898).
[0145] II. Modifications of Nucleotides
[0146] In some embodiments, substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides. In some embodiments, at least 80% of the nucleotides of the sense strand are modified nucleotides, and / or at least 80%, at least 85%, at least 90%, at least 92%, at least 95% of the nucleotides of the antisense strand are modified nucleotides. In some embodiments, at least 80% of the nucleotides of the antisense strand are modified nucleotides, and / or at least 80%, at least 85%, at least 90%, at least 92%, at least 95% of the nucleotides of the sense strand are modified nucleotides.
[0147] In some embodiments, all of the nucleotides of the sense strand are modified nucleotides and / or all of the nucleotides of the antisense strand are modified nucleotides.
[0148] The modifications of nucleotides described herein can be modifications to the phosphate group, the ribose group, and / or the base group of the nucleotide.
[0149] In some particular embodiments, the sense strand and the antisense strand each independently comprise one or more nucleotide modifications selected from the group consisting of: 2'-0-alkyl-modified nucleotides (e.g., 2'-0-methyl-modified nucleotides), 2'-methoxyethyl-modified nucleotides, 2'-fluoro-modified nucleotides, 2'-deoxy-modified nucleotides, inosine ribonucleotides, abasic nucleotides, inverted abasic deoxyribonucleotides, nucleotides comprising phosphorothioate groups, vinylphosphonate-modified nucleotides, locked nucleotides, unlocked nucleotides, 2'-amino-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-0-allyl-modified nucleotides, morpholino nucleotides, phosphoramidates, nucleotides comprising non-natural bases, terminal nucleotides linked to a cholesteryl derivative or dodecanoic acid didecanoyl amide group, deoxyribonucleotides, 3'-terminal deoxythymine (dT) nucleotides, conformationally restricted nucleotides, constrained ethyl nucleotides, 2'-hydroxyl-modified nucleotides, nucleotides comprising methylphosphonate groups, nucleotides comprising 5'-phosphates, nucleotides comprising 5'-phosphate mimics, glycol-modified nucleotides (GNAs), 2-0-(N-methylacetamide)-modified nucleotides, and SCP-modified nucleotides.
[0150] In some preferred embodiments, the sense strand and the antisense strand each independently comprise one or more nucleotide modifications selected from the group consisting of: 2'-0-methyl-modified nucleotides, 2'-fluoro-modified nucleotides, and nucleotides comprising phosphorothioate groups. In some preferred embodiments, the sense strand and / or the antisense strand comprises at least 2 2'-fluoro-modified nucleotides. In some preferred embodiments, the sense strand and / or the antisense strand comprises at least 8 2'-0-methyl-modified nucleotides. In some preferred embodiments, the 3' end and / or the 5' end of the sense strand and / or the antisense strand comprises 1-5 phosphorothioate internucleotide linkages, preferably 2-3 phosphorothioate internucleotide linkages.
[0151] In some preferred embodiments, the antisense strand comprises any one of the modified nucleotide sequences set forth in Table 5, and / or the sense strand comprises any one of the modified nucleotide sequences set forth in Table 4A. In some preferred embodiments, the dsRNA comprises any one of the pairs of paired modified sense strand sequences and modified antisense strand sequences.
[0152] IV. Inhibition of Tau Gene Expression
[0153] The dsRNAs of the application can inhibit TAU gene expression by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.
[0154] Inhibition of TAU gene expression can be manifested by a decrease in the amount of mRNA expressed by a first cell or group of cells (such cells can be present, for example, in a sample derived from a subject) in which the TAU gene is transcribed and which cell or cells have been treated (e.g., by contacting the cell or cells with a dsRNA of the application, or by administering a dsRNA of the application to a subject in which the cells now or formerly exist) such that TAU gene expression is inhibited as compared to a second cell or group of cells (control cell(s)) that is or are substantially identical to the first cell or group of cells but have not been so treated.
[0155] In preferred embodiments, the inhibition is assessed by expressing the level of mRNA in the treated cell as a percentage of the level of mRNA in the control cell using the following formula: % inhibition = 100 x (1 - (mRNA level in treated cell / mRNA level in control cell)). In some specific embodiments, the value 2 -△△Ct values are calculated to compare the difference between the experimental and control groups, where ΔΔCt = [(Ct experimental group gene of interest - Ct experimental group internal control) - (Ct control group gene of interest - Ct control group internal control)].
[0156] Control cells or groups of cells that can be used to assess inhibition of TAU gene expression include cells or groups of cells that have not been contacted with a dsRNA of the application. For example, the control cells or groups of cells can be derived from an individual subject (e.g., a human or animal subject) prior to treatment of the subject with a dsRNA.
[0157] V. Central nervous system ligands
[0158] The term "ligand moiety" as used herein refers to a chemical moiety conjugated to an siRNA and capable of altering the distribution, targeting, or lifetime of the siRNA. The term "central nervous system ligand" refers to one or more ligands, moieties, or conjugates that are chemically linked to an siRNA molecule that are capable of enhancing the activity, cellular distribution, or cellular uptake of the siRNA within cells of the central nervous system.
[0159] In some embodiments, the central nervous system ligand includes, but is not limited to, a lipid (e.g., cholesterol); a bile acid; a sulfide (e.g., benzyl-S-trityl mercaptan); a thiocholesterol; a fatty chain (e.g., dodecanediol or undecyl residue); a phospholipid (e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycerol-3-phosphonate, a polyamine or polyethylene glycol chain, or adamantane acetic acid); palmitoyl; octadecylamine or hexylamino-carbonyloxycholesterol.
[0160] When the central nervous system ligand is a lipid, it can be, for example, a C12, C14, C16, C18, C20, or C22 lipid or an analog thereof. Such a lipid can be attached to any position of the siRNA, preferably to the 5’ and / or 3’ end of the sense strand, or the 6th or 16th position from the 5’ end of the sense strand.
[0161] In some embodiments, the central nervous system ligand is a peptide, including but not limited to a cell-penetrating peptide, a cationic peptide, an amphipathic peptide, or a hydrophobic peptide. The cell-penetrating peptide can be an arginine-glycine-aspartic acid (RGD) peptide or RGD mimetic, an alpha-helical linear peptide (e.g., LL-37 or cecropin P1), a disulfide-containing peptide (e.g., alpha-defensin, beta-defensin, or bac7), or a peptide containing only one or two major amino acids (e.g., PR-39 or indolicidin).
[0162] In some embodiments, the central nervous system ligand can be a TrkB ligand (see, e.g., PCT Publication No. WO2023154896A2), a CB1 ligand (see, e.g., PCT Publication No. WO2023168296A2), an alpha4beta1 / 7 ligand (see, e.g., PCT Publication No. WO2023196342A1), an NMDA ligand (see, e.g., PCT Publication No. WO2024238396A1), or a SORT1 ligand.
[0163] In some embodiments, the SORT1 ligand is a small molecule compound, such as any of the compounds in Table 1 or Table 2 of PCT Publication No. WO2025087397A1. In some embodiments, the SORT1 ligand is a peptide.
[0164] In some preferred embodiments, the SORT1 ligand is selected from
[0165] In some embodiments, the SORT1 ligand can comprise a linker attached to the oligonucleotide. In some preferred embodiments, the SORT1 ligand is selected from:
[0166] VI. Cells
[0167] The present application provides cells comprising the dsRNA of the present application.
[0168] VII. Pharmaceutical Compositions
[0169] The present application provides pharmaceutical compositions comprising the dsRNA or cells of the present application, and optionally a pharmaceutically acceptable carrier or excipient.
[0170] As used herein, "pharmaceutically acceptable" means those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human subjects and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.
[0171] In the present context, a pharmaceutically acceptable carrier refers to a pharmaceutical carrier that aids in the administration of the dsRNA or cells comprising the same to the human body and / or facilitates its absorption or action. For example: diluents, excipients such as water, etc., fillers such as starch, sucrose, etc.; binders such as cellulose derivatives, alginates, gelatin and polyvinylpyrrolidone; humectants such as glycerol; disintegrants such as agar, calcium carbonate and sodium bicarbonate; absorption promoters such as quaternary ammonium compounds; surfactants such as cetyl alcohol; adsorptive carriers such as kaolin and bentonite clay; lubricants such as talc, calcium / magnesium stearate, polyethylene glycol, etc. Other adjuvants such as flavoring agents, sweeteners, etc. can also be added to the composition.
[0172] The pharmaceutical compositions of the present application can comprise a pharmaceutically acceptable diluent or sustained release matrix into which the dsRNA or cells of the present application are embedded.
[0173] The pharmaceutical compositions of the present application can comprise a drug delivery system for delivery of the dsRNA. The drug delivery systems of the present application include, but are not limited to, nanoparticles (e.g. lipid nanoparticles, polymer-based nanoparticles), polymers, PEG, or cationic delivery systems, polylactic acid (PLA) microspheres, poly lactic-co-glycolic acid (PLGA) microspheres, liposomes, micelles, inverse micelles, lipid cochleates, lipid microtubules, cholesterol, PEG lipid PEG-2000-C-DMG, PEG-2000-DMG (Moderna), ALC-0159, or DSPC.
[0174] In some embodiments, the dsRNA in the pharmaceutical compositions of the present application can be comprised in polymers and polymer-based nanoparticles.
[0175] In some specific embodiments, the polymer is a polymer based on poly(lactic-co-glycolic acid) (PLGA). In some specific embodiments, the PLGA-based polymer is modified to contain individual cationic groups.
[0176] In some specific embodiments, the polymer contains amine groups that can become cationic, such as polyethylenimine (PEI) and poly(L-lysine) (PLL), which can form complexes with dsRNA through electrostatic interactions and deliver the dsRNA into cells. In some embodiments, PEG and PLL are chemically modified to improve in vivo efficacy and tolerability.
[0177] In some embodiments, the siRNA or cell in the pharmaceutical composition of the present application can be delivered by a cationic polymer, poly(beta-amino ester) (PBAE).
[0178] VIII. Kits
[0179] The present application provides a kit comprising the dsRNA or cell described in the present application.
[0180] The present application also provides a kit for using the dsRNA or cell described in the present application and / or performing the methods of the present application. Such a kit comprises one or more dsRNA or cell described in the present application, and can further comprise instructions for use. The instructions for use can include instructions for inhibiting TAU gene expression in a cell by contacting the cell with a dsRNA described in the present application in an amount effective to inhibit TAU gene expression.
[0181] In the case where the dsRNA described in the present application is contacted with a cell in vitro, optionally, the kit of the present application can further comprise a means for contacting a cell with a dsRNA described in the present application (e.g., an injection device) or a means for measuring the inhibitory effect on the TAU gene (e.g., a device for measuring inhibition of TAU mRNA or protein). Such a device for measuring inhibition of the TAU gene can comprise a device for obtaining a sample from a subject.
[0182] In the case where the dsRNA described in the present application or a cell into which the dsRNA has been introduced in vitro is administered in vivo, the kit of the present application can further optionally comprise a device for administering the dsRNA or cell described in the present application to a subject or a device for determining a therapeutically effective amount or a prophylactically effective amount.
[0183] IX. Therapeutic methods, pharmaceutical uses
[0184] The present application provides a method of inhibiting expression of a TAU gene in a cell, the method comprising contacting the cell with a dsRNA or a pharmaceutical composition of the present application. In some embodiments, the method is performed in vitro. In some embodiments, the method is performed in vitro. The present application provides a dsRNA or a pharmaceutical composition of the present application for use in inhibiting expression of a TAU gene in a cell.
[0185] The present application provides a method of inhibiting expression of a TAU gene in a cell in a subject, the method comprising administering to the subject a dsRNA, a cell or a pharmaceutical composition of the present application. The present application provides a dsRNA, a cell or a pharmaceutical composition of the present application for use in inhibiting expression of a TAU gene in a cell in a subject. The present application provides use of a dsRNA, a cell or a pharmaceutical composition of the present application in the manufacture of a medicament for inhibiting expression of a TAU gene in a cell in a subject.
[0186] The present application also provides a method of treating a disease or disorder in a subject that benefits from a reduction in expression of a TAU gene, the method comprising administering to the subject a dsRNA, a cell or a pharmaceutical composition of the present application. The present application also provides a dsRNA, a cell or a pharmaceutical composition of the present application for use in treating a disease or disorder in a subject that benefits from a reduction in expression of a TAU gene. The present application also provides use of a dsRNA, a cell or a pharmaceutical composition of the present application in the manufacture of a medicament for treating a disease or disorder in a subject that benefits from a reduction in expression of a TAU gene.
[0187] The present application also provides a method of preventing at least one symptom in a subject having a disease or disorder that benefits from a reduction in expression of a TAU gene, the method comprising administering to the subject a dsRNA, a cell or a pharmaceutical composition of the present application. The present application also provides a dsRNA, a cell or a pharmaceutical composition of the present application for use in preventing in a subject having a disease or disorder that benefits from a reduction in expression of a TAU gene. The present application also provides use of a dsRNA, a cell or a pharmaceutical composition of the present application in the manufacture of a medicament for preventing in a subject having a disease or disorder that benefits from a reduction in expression of a TAU gene.
[0188] The present application also provides a method of preventing progression of a disease or disorder in a subject that benefits from a reduction in expression of a TAU gene, the method comprising administering to the subject a dsRNA, a cell or a pharmaceutical composition of the present application. The present application also provides a dsRNA, a cell or a pharmaceutical composition of the present application for use in preventing progression of a disease or disorder in a subject that benefits from a reduction in expression of a TAU gene. The present application also provides use of a dsRNA, a cell or a pharmaceutical composition of the present application in the manufacture of a medicament for preventing progression of a disease or disorder in a subject that benefits from a reduction in expression of a TAU gene.
[0189] In some embodiments, the disease or disorder that benefits from a reduction in TAU gene expression is a TAU-associated disease. In some preferred embodiments, the TAU-associated disease is selected from the group consisting of a tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), behavioral variant frontotemporal dementia (bvFTD), nonfluent variant primary progressive aphasia (nfvPPA), primary progressive aphasia - semantic (PPA-S), primary progressive aphasia - logopenic (PPA-L), Parkinson's disease with dementia associated with chromosome 17 (FTDP-17), Pick's disease (PiD), agryophilic grain disease (AGD), multiple system tauopathy with dementia (MSTD), white matter tauopathy with globular glial inclusions (FTLD with GGis), FTLD with MAPT mutations, neurofibrillary tangle (NFT) dementia, FTD with motor neuron disease, amyotrophic lateral sclerosis (ALS), corticobasal syndrome (CBS), corticobasal degeneration (CBD), progressive supranuclear palsy (PSP), Parkinson's disease, postencephalitic Parkinsonism, Niemann-Pick disease, Huntington's disease, myotonic dystrophy type 1, and Down's syndrome (DS).
[0190] In some embodiments, the dsRNA, cell, or pharmaceutical composition is administered subcutaneously or intrathecally.
[0191] In some embodiments, the subject is a mammal. In some embodiments, the subject is a primate mammal. In some embodiments, the subject is a human.
[0192] Sequence
[0193] The present application provides RNA sequences targeting the human TAU gene (or target gene, target mRNA sequence, target sequence). The target TAU mRNA sequence is, for example, the gene set forth in Ensembl Accession No. ENST00000446361.7.
[0194] Table 3. Nucleotide sequences of sense and antisense strands targeting TAU mRNA (sequences in the same row in this table are paired sequences)
[0195] Table 4 and Table 5 show modified RNA sequences used in the present application, respectively.
[0196] Herein, the meaning of each abbreviation is as follows:
[0197] A, U, G and C stand for natural adenosine ribonucleotides, uracil ribonucleotides, guanosine ribonucleotides and cytosine ribonucleotides, respectively.
[0198] d stands for a deoxyribonucleotide, whose right-adjacent nucleotide is a deoxyribonucleotide. For example, dA, dT, dG and dC stand for adenosine deoxyribonucleotide, thymine deoxyribonucleotide, guanosine deoxyribonucleotide and cytosine deoxyribonucleotide, respectively.
[0199] i stands for an inosine ribonucleotide.
[0200] m stands for a 2’-OCH3 modified nucleotide, whose left-adjacent nucleotide is a 2’-OCH3 modified nucleotide. For example, Am, Um, Gm and Cm stand for 2’-OCH3 modified A, U, G and C, respectively.
[0201] f stands for a 2’-fluoro modified nucleotide, whose left-adjacent nucleotide is a 2’-fluoro modified nucleotide. For example, Af, Uf, Gf and Cf stand for 2’-fluoro modified A, U, G and C, respectively.
[0202] “s” or s- stands for a phosphorothioate linkage between its left- and right-adjacent two nucleotides and / or delivery vehicle.
[0203] VP stands for a vinyl phosphonate modified nucleotide, whose right-adjacent nucleotide is a vinyl phosphonate modified nucleotide, which is well known in the art, see, for example, PCT Publication Nos. WO2011139702, WO2013033230 and WO2019105419.
[0204] IB stands for an inverted abasic deoxyribonucleotide, which can include the following three structures depending on its position / way of linkage in siRNA (for 5’ end, middle and 3’ end of a nucleic acid strand, respectively):
[0205] IB is well known in the art, see, for example, F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16 and PCT Publication Nos. WO2016011123 and WO2019051402.
[0206] “SCP modified nucleotide” refers to a modified nucleotide having the following structure: The Base is independently selected from H, modified or unmodified bases, or leaving groups. Preferably, the Base is an unmodified base, including adenine, guanine, uracil, and cytosine bases. In other embodiments, the Base is a modified base.
[0207] (SCP-U) indicates the above structure with a base of uracil.
[0208] DL0269-DCBO-C6 represents the following structure, and the corresponding intermediates and methods for linking this structure to oligonucleotides are known, for example, see PCT Publication No. WO2025087397A1.
[0209] Table 4A. Sensitive strand sequences of modified siRNAs targeting TAU mRNA
[0210] Table 4B: Sensitive strand sequences of modified siRNAs targeting TAU mRNA.
[0211] Table 5. Antisense strand sequences of modified siRNAs targeting TAU mRNA
[0212] The "paired modified sense strand sequence and modified antisense strand sequence" of the present application refers to the corresponding sense strand sequence in Table 4A and antisense strand sequence in Table 5, where "corresponding" refers to the sequence in Table 4A with the same sequence number as in Table 5. For example, in Table 4A, the sense strand sequence paired with Table 5 DR013404-AS is DR013404-SS'.
[0213] It is understood by those skilled in the art that the number and position of phosphorothioate internucleotide linkages in the siRNA compounds of the present application are not limited to the number and position shown in the sequences shown in Tables 4 and 5, and those skilled in the art can adjust the number and position of phosphorothioate internucleotide linkages without changing the sequence and methoxy / fluoro modifications according to the teachings of Tables 4 and 5, with or without the addition of a delivery vehicle, such as a delivery vehicle comprising a SORT1 ligand, and such adjusted sense strands, antisense strands, and paired siRNAs are also included within the scope of the present application.
[0214] The present application will be further illustrated by the following examples. It should be understood that the following examples are illustrative only and should not be taken in a limiting sense on the scope of the present application. Examples
[0215] Example 1 Preparation of siRNA
[0216] The siRNAs of the present application are prepared using the solid phase phosphoramidite method well known in the art. See, for example, PCT Publication Nos. WO2016081444 and WO2019105419 for specific methods, and summarized as follows.
[0217] 1.1 Synthesis of sense strand (SS strand)
[0218] By solid phase phosphoramidite synthesis method, blank CPG solid phase carrier is used as the starting cycle, and nucleoside monomers are connected one by one in the order of sense strand nucleotide arrangement from 3 '-5' direction. Each connection of a nucleoside monomer includes four steps of deprotection, coupling, capping, oxidation or thio, and the synthesis scale is 5 μmol of oligonucleotide synthesis conditions as follows:
[0219] Commercially available 2'-F, 2'-O-methyl and other modified phosphoramidites were used. Nucleoside monomers were provided as 0.05 mol / L solutions in acetonitrile, and the conditions for each step were the same, i.e. temperature 25°C, deprotection with 3% trichloroacetic acid in dichloromethane, deprotection 3 times; coupling with 0.25 mol / L ETT in acetonitrile, coupling 2 times; capping with 10% acetic anhydride in acetonitrile and pyridine / N-methylimidazole / acetonitrile (10:14:76, v / v / v), capping 2 times; oxidation with 0.05 mol / L iodine / tetrahydrofuran / pyridine / water (70 / 20 / 10, v / v / v), oxidation 2 times; thioation with 0.2 mol / L PADS in acetonitrile / 3-methylpyridine (1 / 1, v / v), thioation 2 times.
[0220] 1.2 Synthesis of antisense strand (AS strand)
[0221] By solid phase phosphoramidite synthesis method, blank CPG solid phase carrier was used as the starting cycle, and nucleoside monomers were connected one by one in the order of antisense strand nucleotide arrangement from 3'-5' direction. Each connection of a nucleoside monomer included four steps of deprotection, coupling, capping, oxidation or thioation, and the synthesis conditions of 5 umol of oligonucleic acid of the antisense strand were the same as those of the sense strand.
[0222] 1.3 Purification and annealing of oligonucleic acid
[0223] 1.3.1 Aminolysis
[0224] The synthesized solid phase carrier (sense strand or antisense strand) was added to a 5 mL centrifuge tube, 3% diethylamine / ammonia water (v / v) was added, and the reaction was carried out in a constant temperature water bath at 35°C for 16 hours (or in a constant temperature water bath at 55°C for 8 hours), then filtered, and the solid phase carrier was washed with ethanol / water three times, 1 mL each time. The filtrate was concentrated by centrifugation, and the crude product was purified.
[0225] 1.3.2 Purification
[0226] The method of purification and desalting is well known to those skilled in the art. For example, a strong anion filler column can be used, and a sodium chloride-sodium hydroxide system can be used for elution and purification. The product can be collected and purified. A gel filler purification column can be used for desalting, and the elution system is pure water.
[0227] 1.3.3 Annealing
[0228] According to Table 4A, Table 4B and Table 5, the sense strand (SS strand) and the antisense strand (AS strand) were mixed in a molar ratio (SS strand / AS strand = 1 / 1.05), the water bath pot was heated to 70-95°C and kept for 3-5 min, and then naturally cooled to room temperature. The system was freeze-dried to obtain the product.
[0229] The siRNA compounds synthesized in the embodiments of the present application are composed of the sense strand sequence in Table 4A or Table 4B and the antisense strand sequence in Table 5, for example, DR012600 refers to the siRNA compound with the sense strand of DR012600-SS and the antisense strand of DR012600-AS. For the case where the same sequence number is provided in Table 4A and Table 4B, the siRNA compound in the embodiments refers to the compound containing the sense strand sequence of Table 4B, unless otherwise specified.
[0230] Example 2 HEK293T cell line activity screening
[0231] Cell reverse transfection
[0232] Compound dilution: 20 μM compound stock solution was diluted with Opti-MEM to 400 nM, 200 nM and 2 nM, respectively, as 20 nM, 10 nM and 0.1 nM final concentration working solution.
[0233] Transfection complex preparation: 14.1 μL Opti-MEM was taken to dilute 0.9 μL RNAiMAX (Thermo, 13778150), and gently blown and mixed, and then placed at room temperature for 5 minutes. Then 15 μL of prepared RNAi-MAX mixture and 15 μL of diluted compound were gently blown and mixed, and then placed at room temperature for 10 minutes, and then added to a 96-well plate, 10 μL / well.
[0234] Cell plating and reverse transfection: HEK293T cells were trypsinized, counted after termination of digestion, and the cell suspension was diluted to 2.22 x 10 4 cells / well, 96-well cell plate was plated, 90 μL / well. After 48 hours of cell culture, RNA extraction and detection were performed.
[0235] RNA extraction
[0236] According to the operation instruction of high-throughput cell RNA extraction kit (Shanghai Fushen Biological, FSF0035-CS-96T), nucleic acid extractor (Hangzhou Aosheng, Auto-pure96) was used for cell RNA extraction.
[0237] RNA reverse transcription
[0238] Denaturation reaction mixture preparation: PrimeScript TMII 1st Strand cDNA Synthesis Kit(Takara, 6210B) single hole preparation volume: Oligo dT Primer 1 μL, dNTP Mixture 1 μL, template RNA 12.5 μL, 65°C in a conventional PCR instrument for 5 minutes, then quickly cool on ice for 2 minutes.
[0239] Reverse transcription reaction liquid preparation reference PrimeScript TM II 1st Strand cDNA Synthesis Kit(Takara, 6210B). Each well contains 5x Prime Script II Buffer 4 μL, RNase Inhibitor 0.5 μL, PrimeScript II RTase 1 μL.
[0240] Mix the denatured reaction solution 14.5 μL with the reverse transcription reaction solution slowly, incubate at 42°C for 45 minutes in a conventional PCR instrument for reverse transcription, incubate at 95°C for 5 minutes to inactivate the enzyme, and cool the reverse transcription product (cDNA) at 4°C.
[0241] After the reverse transcription is completed, add 30 μL of distilled water without DNase and RNase to the cDNA sample in each well.
[0242] Fluorescence quantitative PCR
[0243] Reference TaqMan TM Fast Advanced Master Mix(ABI, 4444965) operation process, 20 μL system for fluorescence quantitative PCR reaction (ABI, QuantStudio3). The reaction program is: (50°C, 2 minutes) x 1 Cycle; (95°C, 20 seconds) x 1 Cycle; (95°C, 1 second; 60°C, 24 seconds) x 40 Cycles.
[0244] Table 6. Primer information
[0245] Data statistics
[0246] Calculate 2 -△△Ct values and convert them into percentages to get the residual inhibition rate;
[0247] △△Ct = [(Ct experimental group target gene - Ct experimental group internal reference) - (Ct control group target gene - Ct control group internal reference)].
[0248] The target gene is hTAU, and the internal reference is hGAPDH.
[0249] The HEK293T cell line (purchased from ATCC) was used to select the final concentration of 10 nM and 0.1 nM of the compound for siRNA compound cell line activity high-throughput screening, and the experimental screening results are shown in the following table. ND indicates not detected.
[0250] Table 7. HEK293T cell line activity screening results ND = Not determined
[0251] Example 3 SK-N-BE(2)-C cell line activity screening
[0252] According to the method of Reference Example 2, the SK-N-BE(2)-C cell line (purchased from Procell) was selected, and the final concentration of 20 nM of the compound was selected for siRNA compound activity screening. The results are shown in the table below.
[0253] Table 8. SK-N-BE(2)-C cell line activity screening results
[0254] Example 4 In vivo activity screening
[0255] According to the compounds tested in the above-mentioned in vitro experiments, DR011855, DR011859, DR011862, DR011877, DR011880, DR011883, DR011884, DR011888, DR011890, DR011896, DR011899, DR011900, DR011910, DR011913, DR011914, DR011922, DR011923, DR011926, DR011931, DR011937, DR011978, DR011982, DR011984, DR012016, DR012056 were screened, and in vivo compounds were prepared according to Table 9, and in vivo activity tests were performed.
[0256] Experimental Method 1
[0257] SD rats (male, 8-10 weeks) were randomly divided into groups, 3 rats in each group for the vehicle (i.e. aCSF) control group and 5 rats in each group for the compound group. The compound was prepared with sterile artificial cerebrospinal fluid at a concentration of 30 mg / mL. After the animals were anesthetized, the corresponding compound was administered by intrathecal injection (L4-L6 level) at a dose of 0.9 mg / rat (30 μL / rat).
[0258] On day 14 after administration, the animals were euthanized with CO2, quickly separated and the following tissues were removed: brainstem, hippocampus, frontal cortex. After the samples were removed, they were placed in 5-10 times the volume of RNAlater, incubated at 2-8°C overnight, and then transferred to -80°C for storage for subsequent detection of TAU mRNA.
[0259] Tissue RNA extraction was performed according to the protocol of the high-throughput tissue RNA extraction kit (Shanghai Fushen Biotechnology, FSF0035-TS) using a nucleic acid extractor (Hangzhou Aosheng, Auto-pure96); reverse transcription was performed according to the PrimeScript TM II 1st Strand cDNA Synthesis Kit (Takara, 6210B); and fluorescence quantitative PCR reaction (ABI, QuantStudio3) was performed in a 20 μL system using TaqMan TM Fast Advanced Master Mix (ABI, 4444965).
[0260] Data statistics and analysis
[0261] The 2-△△Ct value was calculated and converted to a percentage to obtain the residual inhibition rate.
[0262] △△Ct = [(Ct experimental group target gene - Ct experimental group internal reference) - (Ct control group target gene - Ct control group internal reference)].
[0263] Experimental Method 2
[0264] C57 / B6J mice (male, 8-10 weeks) were randomly divided into groups, 3 mice in each group for the vehicle (i.e. aCSF) control group and 3 mice in each group for the compound group. The compound was prepared with sterile artificial cerebrospinal fluid at a concentration of 30 mg / mL. After the animals were anesthetized, the corresponding compound was administered by bilateral intracerebroventricular injection at a dose of 0.3 mg / rat (5 μL / side).
[0265] On day 14 after administration, the animals were euthanized with CO2, rapidly separated and the following tissues were removed: brainstem, hippocampus, frontal cortex, and the samples were placed in 5-10 times the volume of RNAlater after removal, overnight at 2-8°C, and then transferred to -80°C for storage for subsequent detection of TAU mRNA.
[0266] RNA extraction from tissues was performed according to the protocol of the high-throughput tissue RNA extraction kit (Shanghai Fushen Biotechnology, FSF0035-TS) using a nucleic acid extractor (Hangzhou Aosheng, Auto-pure96); reverse transcription was performed according to the PrimeScript TM II 1st Strand cDNA Synthesis Kit (Takara, 6210B); and fluorescence quantitative PCR was performed in a 20 μL system according to the TaqMan TM Fast Advanced Master Mix (ABI, 4444965) using an ABI QuantStudio3 instrument.
[0267] Data statistics and analysis
[0268] The 2-△△Ct value was calculated and converted to a percentage to obtain the residual inhibition rate.
[0269] △△Ct = [(Ct experimental group target gene - Ct experimental group internal reference) - (Ct control group target gene - Ct control group internal reference)].
[0270] The tested sequences can be specifically delivered to the central nervous system and effectively inhibit the expression of target genes in vivo.
[0271] Table 9. In vivo sequences (sense strand sequence is the sequence in Table 4B, and antisense strand sequence is the sequence in Table 5)
Claims
1. A double-stranded RNA (dsRNA) for inhibiting expression of a TAU gene, the dsRNA comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand and the antisense strand are each independently 15-30 nucleotides in length, and the antisense strand comprises a nucleotide sequence of at least 15 contiguous nucleotides of the nucleotide sequence set forth in any one of SEQ ID NOs: 721-1440.
2. The dsRNA of claim 1, wherein the sense strand comprises a nucleotide sequence of at least 15 contiguous nucleotides of the nucleotide sequence set forth in any one of SEQ ID NOs: 1-720.
3. The dsRNA of claim 1 or 2, wherein the dsRNA is an siRNA.
4. The dsRNA of any one of claims 1-3, wherein the double-stranded region is 15-25 nucleotide pairs in length, preferably 16-23 nucleotide pairs in length, more preferably 18-20 nucleotide pairs in length, most preferably 19 nucleotide pairs in length.
5. The dsRNA of any one of claims 1-4, wherein the antisense strand comprises a nucleotide sequence of at least 16 contiguous nucleotides, a nucleotide sequence of at least 17 contiguous nucleotides, a nucleotide sequence of at least 18 contiguous nucleotides, a nucleotide sequence of at least 19 contiguous nucleotides, or a nucleotide sequence of at least 20 contiguous nucleotides of the nucleotide sequence set forth in any one of SEQ ID NOs: 721-1440, preferably the antisense strand comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 721-1440, more preferably the antisense strand comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 735, 739, 742, 757, 760, 763, 764, 768, 770, 776, 779, 780, 790, 793, 794, 802, 803, 806, 811, 817, 827, 831, 833, 865, and 898.
6. The dsRNA of any one of claims 1-5, wherein the sense strand comprises a nucleotide sequence of at least 16 contiguous nucleotides, a nucleotide sequence of at least 17 contiguous nucleotides, or a nucleotide sequence of at least 18 contiguous nucleotides of the nucleotide sequence set forth in any one of SEQ ID NOs: 1-720, preferably the sense strand comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 1-720, more preferably the sense strand comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 15, 19, 22, 37, 40, 43, 44, 48, 50, 56, 59, 60, 70, 73, 74, 82, 83, 86, 91, 97, 107, 111, 113, 145, and 178.
7. The dsRNA of any one of claims 1-6, wherein the siRNA comprises any one of the paired sense strand sequence and antisense strand sequence as set forth in Table 3 of the specification.
8. The dsRNA of any one of claims 1-7, wherein: (a) the sense strand comprises CCAAGAGGGUGACACGGAA (SEQ ID NO: 15), and the antisense strand comprises UUCCGUGUCACCCUCUUGGUC (SEQ ID NO: 735); (b) the sense strand comprises CUGGAAGACGAAGCUGCUA (SEQ ID NO: 19), and the antisense strand comprises UAGCAGCUUCGUCUUCCAGGC (SEQ ID NO: 739); (c) the sense strand comprises AGACGAAGCUGCUGGUCAA (SEQ ID NO: 22), and the antisense strand comprises UUGACCAGCAGCUUCGUCUUC (SEQ ID NO: 742); (d) the sense strand comprises GACCCAAGCUCGCAUGGUA (SEQ ID NO: 37), and the antisense strand comprises UACCAUGCGAGCUUGGGUCAC (SEQ ID NO: 757); (e) the sense strand comprises CAAGCUCGCAUGGUCAGUA (SEQ ID NO: 40), and the antisense strand comprises UACUGACCAUGCGAGCUUGGG (SEQ ID NO: 760); (f) the sense strand comprises CUCGCAUGGUCAGUAAAAA (SEQ ID NO: 43), and the antisense strand comprises UUUUUACUGACCAUGCGAGCU (SEQ ID NO: 763); (g) the sense strand comprises UCGCAUGGUCAGUAAAAGA (SEQ ID NO: 44), and the antisense strand comprises UCUUUUACUGACCAUGCGAGC (SEQ ID NO: 764); (h) the sense strand comprises CAGUAAAAGCAAAGACGGA (SEQ ID NO: 48), and the antisense strand comprises UCCGUCUUUGCUUUUACUGAC (SEQ ID NO: 768); (i) the sense strand comprises AAGCAAAGACGGGACUGGA (SEQ ID NO: 50), and the antisense strand comprises UCCAGUCCCGUCUUUGCUUUU (SEQ ID NO: 770); (j) the sense strand comprises AGACGGGACUGGAAGCGAA (SEQ ID NO: 56), and the antisense strand comprises UUCGCUUCCAGUCCCGUCUUU (SEQ ID NO: 776); (k) the sense strand comprises GACUGGAAGCGAUGACAAA (SEQ ID NO: 59), and the antisense strand comprises UUUGUCAUCGCUUCCAGUCCC (SEQ ID NO: 779); (l) the sense strand comprises CUGGAAGCGAUGACAAAAA (SEQ ID NO: 60), and the antisense strand comprises UUUUUGUCAUCGCUUCCAGUC (SEQ ID NO: 780); (m) the sense strand comprises CCACCAGGAUUCCAGCAAA (SEQ ID NO: 70), and the antisense strand comprises UUUGCUGGAAUCCUGGUGGCG (SEQ ID NO: 790); (n) the sense strand comprises CCAGGAUUCCAGCAAAAAA (SEQ ID NO: 73), and the antisense strand comprises UUUUUUGCUGGAAUCCUGGUG (SEQ ID NO: 793); (o) the sense strand comprises CAGGAUUCCAGCAAAAACA (SEQ ID NO: 74), and the antisense strand comprises UGUUUUUGCUGGAAUCCUGGU (SEQ ID NO: 794); (p) the sense strand comprises CACCCAGCUCUGGUGAACA (SEQ ID NO: 82), and the antisense strand comprises UGUUCACCAGAGCUGGGUGGU (SEQ ID NO: 802); (q) the sense strand comprises ACCCAGCUCUGGUGAACCA (SEQ ID NO: 83), and the antisense strand comprises UGGUUCACCAGAGCUGGGUGG (SEQ ID NO: 803); (r) the sense strand comprises CAGCUCUGGUGAACCUCCA (SEQ ID NO: 86), and the antisense strand comprises UGGAGGUUCACCAGAGCUGGG (SEQ ID NO: 806); (s) the sense strand comprises CUGGUGAACCUCCAAAAUA (SEQ ID NO: 91), and the antisense strand comprises UAUUUUGGAGGUUCACCAGAG (SEQ ID NO: 811); (t) the sense strand comprises UGCCCAUGCCAGACCUGAA (SEQ ID NO: 97), and the antisense strand comprises UUCAGGUCUGGCAUGGGCACG (SEQ ID NO: 817); (u) the sense strand comprises UAGUCUACAAACCAGUUGA (SEQ ID NO: 107), and the antisense strand comprises UCAACUGGUUUGUAGACUAUU (SEQ ID NO: 827); (v) the sense strand comprises CCAGUUGACCUGAGCAAGA (SEQ ID NO: 111), and the antisense strand comprises UCUUGCUCAGGUCAACUGGUU (SEQ ID NO: 831); (w) the sense strand comprises ACCUGAGCAAGGUGACCUA (SEQ ID NO: 113), and the antisense strand comprises UAGGUCACCUUGCUCAGGUCA (SEQ ID NO: 833); (x) the sense strand comprises GGUGGAAGUAAAAUCUGAA (SEQ ID NO: 145), and the antisense strand comprises UUCAGAUUUUACUUCCACCUG (SEQ ID NO: 865); or (y) the sense strand comprises GCAGCAUCGACAUGGUAGA (SEQ ID NO: 178), and the antisense strand comprises UCUACCAUGUCGAUGCUGCCG (SEQ ID NO: 898).
9. The dsRNA of any one of claims 1-8, wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, or all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides.
10. The dsRNA of claim 9, wherein the sense strand and the antisense strand each independently comprise one or more modified nucleotides selected from the group consisting of: 2'-0-alkyl modified nucleotides (e.g., 2'-0-methyl modified nucleotides), 2'-methoxyethyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy-modified nucleotides, inosine ribonucleotides, abasic nucleotides, inverted abasic deoxyribonucleotides, nucleotides comprising phosphorothioate groups, vinyl phosphonate modified nucleotides, locked nucleotides, unlocked nucleotides, 2'-amino-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-0-allyl modified nucleotides, morpholino nucleotides, phosphoramidates, nucleotides comprising non-natural bases, terminal nucleotides linked to a cholesteryl derivative or dodecanoyl diamide group, deoxyribonucleotides, 3'-terminal deoxythymine (dT) nucleotides, conformationally restricted nucleotides, constrained ethyl nucleotides, 2'-hydroxyl modified nucleotides, nucleotides comprising methylphosphonate groups, nucleotides comprising 5'-phosphates, nucleotides comprising 5'-phosphate mimics, glycol modified nucleotides (GNAs), 2-O-(N-methylacetamide) modified nucleotides, and SCP modified nucleotides.
11. The dsRNA of claim 10, wherein the sense strand and the antisense strand each independently comprise one or more nucleotide modifications selected from the group consisting of: 2'-0-methyl modified nucleotides, 2'-fluoro modified nucleotides, nucleotides comprising phosphorothioate groups, and SCP modified nucleotides.
12. The dsRNA of any one of claims 9-11, wherein the 3' end and / or the 5' end of the sense strand and / or the antisense strand comprises 1-5 phosphorothioate internucleotide linkages, preferably 2-4 phosphorothioate internucleotide linkages.
13. The dsRNA of any one of claims 1-12, wherein the antisense strand has a length of 21 nucleotides and has (i) (counting from the 5' end) 2'-0-methyl modified nucleotides at positions 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21, and 2'-fluoro modified nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20; and / or (ii) (counting from the 5' end) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 19 and 20, and between nucleotide positions 20 and 21.
14. The dsRNA of any one of claims 1-12, wherein the antisense strand has a length of 21 nucleotides and has (i) (counting from the 5' end) an SCP modification at position 1; (ii) (counting from the 5' end) 2'-fluoro modifications at positions 2, 4, 6, 8, 10, 12, 14, 16, and 18; (iii) (counting from the 5' end) 2'-0-methyl modifications at positions 3, 5, 7, 9, 11, 13, 15, 17, 19, 20, and 21; and / or (iv) (counting from the 5' end) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 19 and 20, and between nucleotide positions 20 and 21.
15. The dsRNA of any one of claims 1-12, wherein the antisense strand has a length of 21 nucleotides and has (i) (counting from the 5' end) 2'-deoxy modifications at positions 2, 5, 7, and 12; (ii) (counting from the 5' end) an SCP modification at position 1; (iii) (counting from the 5' end) a 2'-fluoro modification at position 14; (iv) (counting from the 5' end) 2'-0-methyl modifications at positions 3, 4, 6, 8, 9, 10, 11, 13, 15, 16, 17, 18, 19, 20, and 21; and / or (v) (counting from the 5' end) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 19 and 20, and between nucleotide positions 20 and 21.
16. The dsRNA of any one of claims 1-12, wherein the antisense strand has a length of 21 nucleotides and has (i) (counting from the 5' end) an SCP modification at position 1; (ii) (counting from the 5' end) 2'-fluoro modifications at positions 2, 5, 7, 12, and 14; (iii) (counting from the 5' end) 2'-0-methyl modifications at positions 3, 4, 6, 8, 9, 10, 11, 13, 15, 16, 17, 18, 19, 20, and 21; and / or (iv) (counting from the 5' end) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 19 and 20, and between nucleotide positions 20 and 21. (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 (counting from the 5' end).
17. The dsRNA of any one of claims 1-12, wherein the antisense strand has a length of 21 nucleotides and has (i) a SCP modification at position 1 (counting from the 5' end); (ii) 2'-fluoro modifications at positions 2, 7, 12, 14, 16 (counting from the 5' end); (iii) 2'-O-methyl modifications at positions 3, 4, 5, 6, 8, 9, 10, 11, 13, 15, 17, 18, 19, 20, and 21 (counting from the 5' end); and / or (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 (counting from the 5' end).
18. The dsRNA of any one of claims 1-17, wherein the sense strand has a length of 19 nucleotides and has: (i) 2'-O-methyl modified nucleotides at positions 1 to 6, 10 to 19, and 2'-fluoro modified nucleotides at positions 7-9 (counting from the 5' end); and / or (ii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, 2 and 3, and 18 and 19 (counting from the 5' end).
19. The dsRNA of any one of claims 1-17, wherein the sense strand has a length of 19 nucleotides and has: (i) 2'-O-methyl modified nucleotides at positions 1 to 6, 10 to 19, and 2'-fluoro modified nucleotides at positions 7-9 (counting from the 5' end); and / or (ii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, 17 and 18, and 18 and 19 (counting from the 5' end).
20. The dsRNA of any one of claims 1-17, wherein the sense strand has a length of 19 nucleotides and has: (i) 2'-O-methyl modified nucleotides at positions 1 to 6, 10 to 19, and 2'-fluoro modified nucleotides at positions 7-9 (counting from the 5' end); and / or (ii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, 2 and 3, 17 and 18, and 18 and 19 (counting from the 5' end).
21. The dsRNA of claim 12, wherein the antisense strand comprises any one of the modified nucleotide sequences set forth in Table 5 of the specification, and / or the sense strand comprises any one of the modified nucleotide sequences set forth in Table 4A of the specification.
22. The dsRNA of claim 12, wherein the dsRNA comprises a paired modified sense strand sequence and a modified antisense strand sequence.
23. The dsRNA of any one of claims 1-21, wherein: (a) the sense strand comprises CmsCmAm AmGmAm GfGfGf UmGmAm CmAmCm GmGmsAms Am (SEQ ID NO: 2983), and the antisense strand comprises (SCP-U) sUfsCm CmGfUm GfUmCm AmCmCf CmUfCm UmUmGm GmsUmsCm (SEQ ID NO: 2956); (b) the sense strand comprises CmsUmGm GmAmAm GfAfCf GmAmAm GmCmUm GmCmsUms Am (SEQ ID NO: 2984), and the antisense strand comprises (SCP-U) sAfsGm CmAfGm CfUmUm CmGmUf CmUfUm CmCmAm GmsGmsCm (SEQ ID NO: 2957); (c) the sense strand comprises AmsGmAm CmGmAm AfGfCf UmGmCm UmGmGm UmCmsAms Am (SEQ ID NO: 2985), and the antisense strand comprises (SCP-U) sUfsGm AmCfCm AfGmCm AmGmCf UmUfCm GmUmCm UmsUmsCm (SEQ ID NO: 2958); (d) the sense strand comprises GmsAmCm CmCmAm AfGfCf UmCmGm CmAmUm GmGmsUms Am (SEQ ID NO: 2986), and the antisense strand comprises (SCP-U) sAfsCm CmAfUm GfCmGm AmGmCf UmUfGm GmGmUm CmsAmsCm (SEQ ID NO: 2959); (e) the sense strand comprises CmsAmAm GmCmUm CfGfCf AmUmGm GmUmCm AmGmsUms Am (SEQ ID NO: 2987), and the antisense strand comprises (SCP-U) sAfsCm UmGfAm CfCmAm UmGmCf GmAfGm CmUmUm GmsGmsGm (SEQ ID NO: 2960); (f) the sense strand comprises CmsUmCm GmCmAm UfGfGf UmCmAm GmUmAm AmAmsAms Am (SEQ ID NO: 2988), and the antisense strand comprises (SCP-U) sUfsUm UmUfAm CfUmGm AmCmCf AmUfGm CmGmAm GmsCmsUm (SEQ ID NO: 2961); (g) the sense strand comprises UmsCmGm CmAmUm GfGfUf CmAmGm UmAmAm AmAmsGms Am (SEQ ID NO: 2989), and the antisense strand comprises (SCP-U) sCfsUm UmUfUm AfCmUm GmAmCf CmAfUm GmCmGm AmsGmsCm (SEQ ID NO: 2962); (h) the sense strand comprises CmsAmGm UmAmAm AfAfGf CmAmAm AmGmAm CmGmsGms Am (SEQ ID NO: 2990), and the antisense strand comprises (SCP-U) sCfsCm GmUfCm UfUmUm GmCmUf UmUfUm AmCmUm GmsAmsCm (SEQ ID NO: 2963); (i) the sense strand comprises AmsAmGm CmAmAm AfGfAf CmGmGm GmAmCm UmGmsGms Am (SEQ ID NO: 2991), and the antisense strand comprises (SCP-U) sCfsCm AmGfUm CfCmCm GmUmCf UmUfUm GmCmUm UmsUmsUm (SEQ ID NO: 2964); (j) the sense strand comprises AmsGmAm CmGmGm GfAfCf UmGmGm AmAmGm CmGmsAms Am (SEQ ID NO: 2992), and the antisense strand comprises (SCP-U) sUfsCm GmCfUm UfCmCm AmGmUf CmCfCm GmUmCm UmsUmsUm (SEQ ID NO: 2965); (k) the sense strand comprises GmsAmCm UmGmGm AfAfGf CmGmAm UmGmAm CmAmsAms Am (SEQ ID NO: 2993), and the antisense strand comprises (SCP-U) sUfsUm GmUfCm AfUmCm GmCmUf UmCfCm AmGmUm CmsCmsCm (SEQ ID NO: 2966); (l) the sense strand comprises CmsUmGm GmAmAm GfCfGf AmUmGm AmCmAm AmAmsAms Am (SEQ ID NO: 2994), and the antisense strand comprises (SCP-U) sUfsUm UmUfGm UfCmAm UmCmGf CmUfUm CmCmAm GmsUmsCm (SEQ ID NO: 2967); (m) the sense strand comprises CmsCmAm CmCmAm GfGfAf UmUmCm CmAmGm CmAmsAms Am (SEQ ID NO: 2995), and the antisense strand comprises (SCP-U) sUfsUm GmCfUm GfGmAm AmUmCf CmUfGm GmUmGm GmsCmsGm (SEQ ID NO: 2968); (n) the sense strand comprises CmsCmAm GmGmAm UfUfCf CmAmGm CmAmAm AmAmsAms Am (SEQ ID NO: 2996), and the antisense strand comprises (SCP-U) sUfsUm UmUfUm GfCmUm GmGmAf AmUfCm CmUmGm GmsUmsGm (SEQ ID NO: 2969); (o) the sense strand comprises CmsAmGm GmAmUm UfCfCf AmGmCm AmAmAm AmAmsCms Am (SEQ ID NO: 2997), and the antisense strand comprises (SCP-U) sGfsUm UmUfUm UfGmCm UmGmGf AmAfUm CmCmUm GmsGmsUm (SEQ ID NO: 2970); (p) the sense strand comprises CmsAmCm CmCmAm GfCfUf CmUmGm GmUmGm AmAmsCms Am (SEQ ID NO: 2998), and the antisense strand comprises (SCP-U) sGfsUm UmCfAm CfCmAm GmAmGf CmUfGm GmGmUm GmsGmsUm (SEQ ID NO: 2971); (q) the sense strand comprises AmsCmCm CmAmGm CfUfCf UmGmGm UmGmAm AmCmsCms Am (SEQ ID NO: 2999), and the antisense strand comprises (SCP-U) sGfsGm UmUfCm AfCmCm AmGmAf GmCfUm GmGmGm UmsGmsGm (SEQ ID NO: 2972); (r) the sense strand comprises CmsAmGm CmUmCm UfGfGf UmGmAm AmCmCm UmCmsCms Am (SEQ ID NO: 3000), and the antisense strand comprises (SCP-U) sGfsGm AmGfGm UfUmCm AmCmCf AmGfAm GmCmUm GmsGmsGm (SEQ ID NO: 2973); (s) the sense strand comprises CmsUmGm GmUmGm AfAfCf CmUmCm CmAmAm AmAmsUms Am (SEQ ID NO: 3001), and the antisense strand comprises (SCP-U) sAfsUm UmUfUm GfGmAm GmGmUf UmCfAm CmCmAm GmsAmsGm (SEQ ID NO: 2974); (t) the sense strand comprises UmsGmCm CmCmAm UfGfCf CmAmGm AmCmCm UmGmsAms Am (SEQ ID NO: 3002), and the antisense strand comprises (SCP-U) sUfsCm AmGfGm UfCmUm GmGmCf AmUfGm GmGmCm AmsCmsGm (SEQ ID NO: 2975); (u) the sense strand comprises UmsAmGm UmCmUm AfCfAf AmAmCm CmAmGm UmUmsGms Am (SEQ ID NO: 3003), and the antisense strand comprises (SCP-U) sCfsAm AmCfUm GfGmUm UmUmGf UmAfGm AmCmUm AmsUmsUm (SEQ ID NO: 2976); (v) the sense strand comprises CmsCmAm GmUmUm GfAfCf CmUmGm AmGmCm AmAmsGms Am (SEQ ID NO: 3004), and the antisense strand comprises (SCP-U) sCfsUm UmGfCm UfCmAm GmGmUf CmAfAm CmUmGm GmsUmsUm (SEQ ID NO: 2977); (w) the sense strand comprises AmsCmCm UmGmAm GfCfAf AmGmGm UmGmAm CmCmsUms Am (SEQ ID NO: 3005), and the antisense strand comprises (SCP-U) sAfsGm GmUfCm AfCmCm UmUmGf CmUfCm AmGmGm UmsCmsAm (SEQ ID NO: 2978); (x) the sense strand comprises GmsGmUm GmGmAm AfGfUf AmAmAm AmUmCm UmGmsAms Am (SEQ ID NO: 3006), and the antisense strand comprises (SCP-U) sUfsCm AmGfAm UfUmUm UmAmCf UmUfCm CmAmCm CmsUmsGm (SEQ ID NO: 2979); (y) the sense strand comprises GmsCmAm GmCmAm UfCfGf AmCmAm UmGmGm UmAmsGms Am (SEQ ID NO: 3007), and the antisense strand comprises (SCP-U) sCfsUm AmCfCm AfUmGm UmCmGf AmUfGm CmUmGm CmsCmsGm (SEQ ID NO: 2980); (z) the sense strand comprises GmsCmAm GmCmAm UfCfGf AmCmAm UmGmGm UmAmsGms Am (SEQ ID NO: 3008), and the antisense strand comprises (SCP-U) sCfsUm AmCmCm AfUmGm UmCmGf AmUfGm CfUmGm CmsCmsGm (SEQ ID NO: 2981); or (aa) the sense strand comprises CmsAmCm CmCmAm GfCfUf CmUmGm GmUmGm AmAmsCms Am (SEQ ID NO: 3009), and the antisense strand comprises (SCP-U) sGfsUm UmCmAm CfCmAm GmAmGf CmUfGm GfGmUm GmsGmsUm (SEQ ID NO: 2982).
24. The dsRNA of any one of claims 1-23, wherein the dsRNA is further conjugated to a ligand moiety, preferably a central nervous system ligand.
25. The dsRNA of claim 24, wherein the central nervous system ligand is a SORT1 ligand, preferably the sense strand is conjugated to the SORT1 ligand, more preferably the 5’ end of the sense strand is conjugated to the SORT1 ligand via a phosphorothioate.
26. The dsRNA of claim 25, wherein the SORT1 ligand has the structure of:
27. A cell comprising the dsRNA of any one of claims 1-26.
28. A pharmaceutical composition comprising the dsRNA of any one of claims 1-26, or the cell of claim 27, and optionally a pharmaceutically acceptable carrier or excipient.
29. A kit comprising the dsRNA of any one of claims 1-26, the cell of claim 27, or the pharmaceutical composition of claim 28.
30. A method of inhibiting expression of a TAU gene in a cell, the method comprising contacting the cell with the dsRNA of any one of claims 1-26 or the pharmaceutical composition of claim 28.
31. A method of inhibiting TAU gene expression in a cell in a subject, the method comprising administering to the subject the dsRNA of any one of claims 1-26, the cell of claim 27, or the pharmaceutical composition of claim 28.
32. A method of treating a disease or disorder in a subject that benefits from a reduction in TAU gene expression, the method comprising the step of administering to the subject the dsRNA of any one of claims 1-26, the cell of claim 27, or the pharmaceutical composition of claim 28.
33. A method of preventing at least one symptom in a subject having a disease or disorder that benefits from a reduction in TAU gene expression, the method comprising the step of administering to the subject the dsRNA of any one of claims 1-26, the cell of claim 27, or the pharmaceutical composition of claim 28.
34. A method of preventing the progression of a disease or disorder in a subject that benefits from a reduction in TAU gene expression, the method comprising the step of administering to the subject the dsRNA of any one of claims 1-26, the cell of claim 27, or the pharmaceutical composition of claim 28.
35. The method of any one of claims 32-34, wherein the disease or disorder that benefits from a reduction in TAU gene expression is a TAU-associated disease, preferably a disease associated with TAU overexpression.
36. The method of claim 35, wherein the TAU-associated disease is selected from the group consisting of a tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), behavioral variant frontotemporal dementia (bvFTD), nonfluent variant primary progressive aphasia (nfvPPA), primary progressive aphasia - semantic (PPA-S), primary progressive aphasia - logopenic (PPA-L), Parkinson's disease with dementia associated with chromosome 17 (FTDP-17), Pick's disease (PiD), agryophilic grain disease (AGD), multiple system tauopathy with dementia (MSTD), white matter tauopathy with globular glial inclusions (FTLD with GGis), FTLD with MAPT mutations, neurofibrillary tangle (NFT) dementia, FTD with motor neuron disease, amyotrophic lateral sclerosis (ALS), corticobasal syndrome (CBS), corticobasal degeneration (CBD), progressive supranuclear palsy (PSP), Parkinson's disease, postencephalitic Parkinsonism, Niemann-Pick disease, Huntington's disease, myotonic dystrophy type 1, and Down's syndrome (DS).
37. The method of any one of claims 31-36, wherein the dsRNA, cell, or pharmaceutical composition is administered subcutaneously or intrathecally.
38. The method of any one of claims 31-37, wherein the subject is a human.
Citation Information
Patent Citations
MICROTUBULE ASSOCIATED PROTEIN TAU (MAPT) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
WO2021202511A2
Microtubule associated protein TAU (MAPT) irna agent compositions and methods of use thereof
WO2023049871A2
Compounds and methods for reducing TAU expression
WO2023064707A1
MAPT RNA interference agents
WO2023114700A1
Compositions and methods for inhibiting MAPT expression
WO2023220349A1