Method for treating treg programmed necrosis type autoimmune diseases

By using O-GlcNAcylation promoters such as the OGA inhibitor TMG, the O-GlcNAcylation levels of RIPK1 and RIPK3 in Treg cells were increased, solving the treatment challenge of Treg programmed necrosis-type autoimmune diseases and achieving the protection of Treg cell function and the improvement of autoimmune diseases.

WO2026067698A1PCT designated stage Publication Date: 2026-04-02SHANGHAI INST OF ORGANIC CHEM CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-09-28
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

Currently, there is a lack of effective treatments for regulatory T cell (Treg) programmed necrosis type autoimmune diseases, and existing technologies have failed to effectively resolve the relationship between HBP, programmed necrosis, and Treg.

Method used

O-GlcNAcylation promoters, such as the OGA inhibitor Thiamet-G (TMG), were used to increase the O-GlcNAcylation levels of RIPK1 and RIPK3 proteins, thereby inhibiting programmed necrosis of Treg cells. The O-GlcNAcylation levels of Treg cells were regulated through in vitro and in vivo culture and gene editing tools.

Benefits of technology

It effectively inhibits programmed necrosis of Treg cells, slows the progression of autoimmune diseases, improves kidney damage and immune cell infiltration, and enhances the anti-inflammatory response of Treg cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025124826-FTAPPB-I100001
    Figure PCTCN2025124826-FTAPPB-I100001
  • Figure PCTCN2025124826-FTAPPB-I100002
    Figure PCTCN2025124826-FTAPPB-I100002
  • Figure 00000025_0000
    Figure 00000025_0000
Patent Text Reader

Abstract

The use of an O-linked beta-N-acetylglucosaminylation (O-GlcNAcylation) enhancer, which is used for preparing a drug or formulation for treating programmed necrosis type autoimmune diseases. The O-GlcNAcylation enhancer is used to increase the O-GlcNAcylation level of RIPK1 / 3 protein, and can effectively suppress the Treg programmed necrosis, thereby relieving autoimmune diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Methods of treating treg programmed necrosis autoimmune diseases TECHNICAL FIELD

[0001] The present application relates to the field of biological medicine, and more particularly, the present application relates to methods of treating Treg programmed necrosis autoimmune diseases. BACKGROUND

[0002] Autoimmune diseases such as multiple sclerosis, systemic lupus erythematosus, rheumatoid arthritis, and the like are diseases caused by abnormal disorders of the immune system leading to self-tissue damage and organ dysfunction. Over-activity of T cells, B cells or other immune cells derived from hematopoietic stem cells can lead to persistent inflammation and damage to target organs in the body.

[0003] The hexosamine biosynthesis pathway (HBP) is one of the metabolic pathways of intracellular glucose. The end product of the hexosamine biosynthesis pathway, UDP-GlcNAc, is the substrate for O-GlcNAcylation modification. O-GlcNAcylation of RIPK1 and RIPK3 can prevent the interaction between RIPK1 and RIPK3, thereby inhibiting the subsequent programmed necrosis signaling cascade.

[0004] Programmed necrosis is a highly inflammatory mode of programmed cell death. When the inflammatory cytokine TNFα binds to the receptor TNFR1, it activates RIPK1, which initiates the programmed necrosis process. Activation of RIPK1 further activates RIPK3 and triggers the assembly of the RIPK1 / RIPK3 complex (called necrosome), which subsequently activates MLKL. Once activated, MLKL undergoes oligomerization and translocates to the cell membrane and forms pores in the membrane, leading to cell membrane rupture, triggering cell dysfunction and ultimately leading to cell death and release of inflammatory cell contents.

[0005] Regulatory T cells (Tregs) are a subtype of CD4 T cells that play a crucial role in regulating and suppressing inflammatory responses. Patients with various autoimmune diseases often exhibit defects in the number or function of Treg cells.

[0006] There is currently no report on the relationship and potential interaction between HBP, programmed necrosis, Treg and autoimmune diseases, and there is no treatment for Treg programmed necrosis autoimmune diseases. Therefore, there is an urgent need to develop a treatment for Treg programmed necrosis autoimmune diseases. SUMMARY

[0007] The present application aims to provide a method of treating Treg programmed necrosis autoimmune diseases.

[0008] In a first aspect of the present application, there is provided a use of an O-linked beta-N-acetylglucosaminylation (O-GlcNAcylation) promoting agent for the manufacture of a medicament or a preparation for treating Treg pyroptosis in an autoimmune disease.

[0009] In another preferred embodiment, the O-GlcNAcylation promoting agent is selected from the group consisting of a small molecule, an antibody, a polypeptide, an oligonucleotide, an aptamer, a gene editing reagent, or a combination thereof.

[0010] In another preferred embodiment, the O-GlcNAcylation promoting agent is selected from the group consisting of shRNA, interfering RNA, siRNA, microRNA, or a combination thereof.

[0011] In another preferred embodiment, the O-GlcNAcylation promoting agent is selected from the group consisting of an OGA (N-acetylglucosamine glycosidase) inhibitor, an OGT (N-acetylglucosamine transferase) agonist, an OGT expression vector, an O-GlcNAcylation modification donor, or a combination thereof.

[0012] In another preferred embodiment, the O-GlcNAcylation modification promoting agent is selected from the group consisting of a compound that down-regulates OGA expression, a compound or antibody that reduces OGA protein stability, a compound or antibody that down-regulates OGA activity, a gene editing tool that down-regulates or knocks out OGA expression, an antibody or aptamer that inhibits OGA activity, an oligonucleotide that inhibits OGA expression, a compound that promotes OGT activity, an OGT enzyme preparation, an mRNA for expressing OGT, a gene editing tool that promotes OGT overexpression, or a combination thereof.

[0013] In another preferred embodiment, the O-GlcNAcylation promoting agent increases the O-GlcNAcylation level of the RIPK1 protein and / or the O-GlcNAcylation level of the RIPK3 protein, thereby inhibiting or slowing down Treg pyroptosis.

[0014] In another preferred embodiment, the O-GlcNAcylation promoting agent comprises an OGA inhibitor or antagonist.

[0015] In another preferred embodiment, the OGA inhibitor or antagonist is selected from the group consisting of a small molecule compound or a pharmaceutically acceptable salt thereof, an antibody, a polypeptide, a nucleic acid, or a combination thereof.

[0016] In another preferred embodiment, the OGA inhibitor comprises Thiamet-G (abbreviated: TMG) or a pharmaceutically acceptable salt or ester thereof.

[0017] In another preferred embodiment, the Treg pyroptosis-related autoimmune disease is a Treg pyroptosis-related autoimmune disease.

[0018] In another preferred embodiment, the Treg pyroptosis-related autoimmune disease is a Treg pyroptosis-related autoimmune disease.

[0019] In another preferred embodiment, the autoimmune disease is selected from the group consisting of multiple sclerosis, systemic lupus erythematosus, rheumatoid arthritis, or a combination thereof.

[0020] In another preferred embodiment, the Treg pyroptosis-related autoimmune disease has one or more characteristics selected from the group consisting of:

[0021] (a) a significantly reduced O-GlcNAcylation level of RIPK1 protein;

[0022] (b) a significantly reduced O-GlcNAcylation level of RIPK3 protein;

[0023] (c) a significantly increased amount or level of activated RIPK1 (pRIPK1) protein;

[0024] (d) a significantly increased amount or level of activated RIPK3 (pRIPK3) protein;

[0025] (f) a significantly increased amount or level of activated MLKL (pMLKL) protein;

[0026] (g) a significantly reduced O-GlcNAcylation level of Treg cells;

[0027] (h) a significantly increased proportion of Treg cells undergoing pyroptosis.

[0028] In another preferred embodiment, the significantly reduced or significantly increased means that the reduction or increase is statistically significant.

[0029] In another preferred embodiment, for the O-GlcNAcylation level of a protein, the "significantly reduced" means that there is a statistically significant reduction in the O- acetylglucosamine level of the RIPK1 protein or the RIPK3 protein of the Treg cells of the subject, as compared to the corresponding O-GlcNAcylation level C0 in a control (e.g., Treg cells of a healthy individual), for example, the ratio C1 / C0 is ≤ 2 / 3, preferably ≤ 1 / 2, more preferably ≤ 1 / 3.

[0030] In another preferred embodiment, for the amount or level of protein, the "significant increase" means that the amount or level LI of pRIPK1, pRIPK3 or pMLKL in the Treg cells of the subject is statistically significantly increased compared to the amount or level L0 of the corresponding protein (pRIPK1, pRIPK3 or pMLKL) in the control (e.g. Treg cells of healthy individuals), for example, the ratio of LI / L0 is ≥ 1.5, preferably ≥ 2, more preferably ≥ 3.

[0031] In another preferred embodiment, for the O-GlcNAcylation level of the cell, the "significant decrease" means that the O-GlcNAcylation level CI of the Treg cells of the subject is statistically significantly decreased compared to the O-GlcNAcylation level CO of the control (e.g. Treg cells of healthy individuals), for example, the ratio of CI / CO is ≤ 2 / 3, preferably ≤ 1 / 2, more preferably ≤ 1 / 3.

[0032] In another preferred embodiment, for the proportion of cells undergoing programmed necrosis in the Treg cells, the "significant increase" means that the proportion R1 of Treg cells undergoing programmed necrosis in the Treg cells of the subject is statistically significantly increased compared to the proportion RO of Treg cells undergoing programmed necrosis in the control (e.g. Treg cells of healthy individuals), for example, the ratio of R1 / RO is ≥ 1.5, preferably ≥ 2, more preferably ≥ 3.

[0033] In another preferred embodiment, the programmed necrosis-resistant Treg cells are used to improve Treg programmed necrosis-type autoimmune diseases.

[0034] In another preferred embodiment, the programmed necrosis-resistant Treg cells are used to improve SLE.

[0035] In another preferred embodiment, the programmed necrosis-resistant Treg cell therapy is used to suppress self-reactive T cells and B cells.

[0036] In another preferred embodiment, the programmed necrosis-resistant Treg cell therapy is used to improve kidney injury. In another preferred embodiment, the kidney injury is manifested as a decrease in immune cell infiltration of kidney tissue, and / or glomerulonephritis.

[0037] In another preferred embodiment, the programmed necrosis-resistant Treg cells are selected from the group consisting of: MLKL-KO Treg cells, or shOGA Treg cells.

[0038] In a second aspect of the present application, there is provided a method for inhibiting necrosis of Treg cells in vitro, the method comprising the steps of:

[0039] (a) culturing the Treg cell in the presence of an O-GlcNAcylation-promoting agent, thereby inhibiting necrosis of the Treg cell.

[0040] In another preferred embodiment, the method causes the Treg cell to undergo a change selected from the group consisting of:

[0041] (a) increasing O-GlcNAcylation level of RIPK1 protein;

[0042] (b) increasing O-GlcNAcylation level of RIPK3 protein;

[0043] (c) decreasing amount or level of activated RIPK1 (pRIPK1) protein;

[0044] (d) decreasing amount or level of activated RIPK3 (pRIPK3) protein;

[0045] (f) decreasing amount or level of activated MLKL (pMLKL) protein;

[0046] (g) increasing O-GlcNAcylation level of the Treg cell;

[0047] or a combination thereof.

[0048] In another preferred embodiment, the necrosis of the Treg cell comprises programmed necrosis of the Treg cell.

[0049] In another preferred embodiment, the O-GlcNAcylation-promoting agent comprises an OGA inhibitor.

[0050] In another preferred embodiment, the OGA inhibitor comprises TMG.

[0051] In another preferred embodiment, the O-GlcNAcylation-promoting agent is administered in vitro at a concentration of 1-30 mM.

[0052] In another preferred embodiment, the O-GlcNAcylation-promoting agent is administered in vivo at a concentration of 10-30 mg / kg.

[0053] In another preferred embodiment, the Treg cell is a human Treg cell.

[0054] In a third aspect of the present application, there is provided a reagent combination comprising:

[0055] (Z1) a detection reagent for detecting programmed necrosis of Treg; and

[0056] (Z2) a first medicament for treating an autoimmune disease, the first medicament comprising an O-GlcNAcylation promoter.

[0057] In another preferred embodiment, the detection agent for detecting Treg programmed necrosis is selected from the group consisting of:

[0058] (Za) a detection agent for detecting the O-GlcNAcylation level of RIPK1 protein;

[0059] (Zb) a detection agent for detecting the O-GlcNAcylation level of RIPK3 protein;

[0060] (Zc) a detection agent for detecting the amount or level of activated RIPK1 (pRIPK1) protein;

[0061] (Zd) a detection agent for detecting the amount or level of activated RIPK3 (pRIPK3) protein;

[0062] (Zf) a detection agent for detecting the amount or level of activated MLKL (pMLKL) protein;

[0063] (Zg) a detection agent for detecting the O-GlcNAcylation level of Treg cells;

[0064] (Zh) a detection agent for detecting the proportion of Treg cells undergoing programmed necrosis;

[0065] or a combination thereof.

[0066] In another preferred embodiment, the combination of agents further comprises (Z3) a second medicament for treating an autoimmune disease, different from the first medicament.

[0067] In a fourth aspect of the present application, there is provided a kit comprising:

[0068] (Z1) a detection agent for detecting Treg programmed necrosis; and

[0069] (Z2) a first medicament for treating an autoimmune disease, the first medicament comprising an O-GlcNAcylation promoter.

[0070] In another preferred embodiment, the detection agent for detecting Treg programmed necrosis is selected from the group consisting of:

[0071] (Za) a detection agent for detecting the O-GlcNAcylation level of RIPK1 protein;

[0072] (Zb) a detection reagent for detecting the O-GlcNAcylation level of RIPK3 protein;

[0073] (Zc) a detection reagent for detecting the amount or level of activated RIPK1 (pRIPK1) protein;

[0074] (Zd) a detection reagent for detecting the amount or level of activated RIPK3 (pRIPK3) protein;

[0075] (Zf) a detection reagent for detecting the amount or level of activated MLKL (pMLKL) protein;

[0076] (Zg) a detection reagent for detecting the O-GlcNAcylation level of Treg cells;

[0077] (Zh) a detection reagent for detecting the proportion of Treg cells undergoing programmed necrosis;

[0078] or a combination thereof.

[0079] In another preferred embodiment, the kit further comprises (Z3) a second drug different from the first drug for treating autoimmune diseases.

[0080] In another preferred embodiment, the drug is a pharmaceutical composition comprising an active ingredient and a pharmaceutically acceptable carrier.

[0081] In another preferred embodiment, the pharmaceutical composition comprises:

[0082] (A) an O-GlcNAcylation promoter; and / or

[0083] (B) a pharmaceutically acceptable carrier.

[0084] In another preferred embodiment, the pharmaceutical composition is in a liquid, solid, or semi-solid state.

[0085] In another preferred embodiment, the dosage form of the pharmaceutical composition comprises a tablet, granule, capsule, oral liquid, or injection.

[0086] In another preferred embodiment, the pharmaceutical composition comprises the component (A) in an amount of 1-99 wt%, preferably 10-90 wt%, and more preferably 30-70 wt% based on the total weight of the pharmaceutical composition.

[0087] In another preferred embodiment, the composition further comprises other drugs for treating autoimmune diseases.

[0088] In another preferred embodiment, the other autoimmune disease treating agent or therapy is selected from the group consisting of a chimeric antigen receptor T cell therapy, a non-steroidal anti-inflammatory drug therapy, an immunosuppressant therapy, or a combination thereof.

[0089] In another preferred embodiment, the kit further comprises an instruction manual, which records the detection method and the administration method.

[0090] In a fifth aspect of the present application, there is provided the use of the reagent combination of the third aspect of the present application for the preparation of a kit for treating Treg pyroptosis-type autoimmune diseases.

[0091] In another preferred embodiment, the kit is the kit of the fourth aspect of the present application.

[0092] In a sixth aspect of the present application, there is provided a method for screening potential compounds for treating Treg pyroptosis-type autoimmune diseases, comprising the steps of:

[0093] (i) culturing Treg cells in the presence of a test compound in an experimental group, and culturing Treg cells in the same conditions as the experimental group but in the absence of the test compound in a control group;

[0094] (ii) detecting the level of O-GlcNAcylation in the experimental group and the control group;

[0095] wherein if one or more conditions selected from the group consisting of:

[0096] (a) the O-GlcNAcylation level of RIPK1 protein is significantly increased;

[0097] (b) the O-GlcNAcylation level of RIPK3 protein is significantly increased;

[0098] (c) the amount or level of activated RIPK1 (pRIPK1) protein is significantly reduced;

[0099] (d) the amount or level of activated RIPK3 (pRIPK3) protein is significantly reduced;

[0100] (f) the amount or level of activated MLKL (pMLKL) protein is significantly reduced;

[0101] (g) the O-GlcNAcylation level of Treg cells is significantly increased.

[0102] In another preferred embodiment, the method further comprises:

[0103] (iii) for the potential compound selected in the previous step, further test its effect on Treg cell programmed necrosis.

[0104] In another preferred embodiment, in step (iii), the validation is performed by in vivo or in vitro experiment.

[0105] In a seventh aspect of the present application, there is provided a method for identifying a Treg programmed necrosis type autoimmune disease, comprising the steps of:

[0106] (a) providing T cells of a subject;

[0107] (b) detecting using a detection reagent for detecting Treg programmed necrosis;

[0108] (c) analyzing the detection data, thereby identifying whether the subject has a Treg programmed necrosis type autoimmune disease.

[0109] In another preferred embodiment, the T cells can be taken from the group consisting of peripheral blood, bone marrow, or cerebrospinal fluid.

[0110] In another preferred embodiment, the method is a non-diagnostic non-therapeutic method.

[0111] It should be understood that, within the scope of the present application, all the technical features described above and in the following (e.g. in the examples) of the present application can be combined with each other to form new or preferred technical solutions. Due to the limited space, they are not listed one by one here. BRIEF DESCRIPTION OF DRAWINGS

[0112] Figure 1 shows: (a) clinical scores of EAE mice; (b) RIPK1 activation in peripheral immune cells of EAE mice at different time points; (c) RIPK1 activation in cells of WT and D138N mice without immunization with MOG35-55 (myelin antigen); (d) NF-κB inflammatory pathway, apoptosis and programmed necrosis pathway activation in CD4 T cells of EAE mice at different time points; (e) after Rag2-KO mice were transplanted with CD4 T cells of D138N mice, MLKL-KO mice and WT mice, they were immunized with MOG35-55 to induce EAE. The clinical phenotype of the mice was detected, MBP staining was used to characterize the degree of spinal cord demyelination, and the activation of microglia and astrocytes was used to characterize neuroinflammation.

[0113] Figure 2 shows: (a) CD4 T cell subset phenotyping; (b) expression levels of programmed necrosis related markers in Treg cells during EAE progression; (c) staining of programmed necrosis related markers in Treg cells by imaging flow cytometry; (d) inhibition of programmed necrosis pathway in Treg cells can significantly protect EAE pathological progression; (e) Caspase 1 knockout has no further protective effect on EAE pathological progression; (f) ASC expression levels in Treg cells are significantly lower compared to Tcons cells during EAE development.

[0114] Figure 3 shows: (a) TNF induces more significant programmed necrosis pathway activation in mouse peripheral blood Treg cells; (b) staining of programmed necrosis markers in Treg cells and Tcons cells after TNF treatment by imaging flow cytometry; (c) TNF treatment of in vitro cultured Thl and Treg cells induces more severe cell death in Treg cells, and this cell death can be protected by RIPK1 kinase inhibitor Nec1 and RIPK1 kinase inhibitor Gsk-872; (d) detection of programmed necrosis markers pRIPK1, pRIPK3 and pMLKL in Thl and Treg cells after TNF treatment by Western blotting; (e) inflammatory factor IFNy induces significant programmed necrosis in Treg cells.

[0115] Figure 4 shows: (a) Glutl expression levels are lower in Treg cells compared to Tcons cells. (b) A20 expression does not have significant differences in several cells; (c) the product levels of HBP metabolic pathway in Treg cells are significantly down-regulated; (d) the total O-GlcNAcylation levels in Treg cells are significantly reduced; (e) RIPK1 and RIPK3 O-GlcNAcylation levels in Treg cells are significantly lower compared to Tcons cells; (f) the use of TMG increases the total O-GlcNAcylation levels in Treg cells; (g) the O-GlcNAcylation levels of RIPK1 and RIPK3 in Treg cells are significantly increased after TMG treatment; (h) TMG treatment does not affect Foxp3 expression in Treg cells, and the ability of Treg cells to inhibit Tcons cell proliferation is not affected by TMG, as detected by CTV staining marker.

[0116] Figure 5 shows that: (a) TNF treatment of PBS and TMG administrated mice, TMG treatment significantly reduced the expression level of Treg cell programmed necrosis marker induced by TNF; (b) TMG treatment significantly reduced the cell death of Treg cells induced by TNF stimulation; (c) TMG treatment reduced the clinical disease severity of EAE mice compared with PBS administrated group; (d) and the damage of spinal cord white matter of mice was improved; (e) the expression level of inflammatory factors in the spinal cord of EAE mice was reduced after TMG treatment, and the activation of microglia and astrocytes in the spinal cord was significantly improved; (f) TMG treatment reduced the expression level of Treg cell programmed necrosis marker of EAE mice; (g) the ratio of Th1 / Treg and Th17 / Treg of EAE mice was reduced after TMG treatment; (h) after knocking out Treg cells in vivo, TMG treatment no longer protected the disease severity of EAE; (i) after transfecting Treg cells in vitro with lentivirus expressing shNC or shOGA for two weeks, the expression level of OGA in Treg cells was detected by flow cytometry; (j) after knocking down OGA in Treg cells with lentivirus, the O-GlcNAcylation level of RIPK1 and RIPK3 in Treg cells was increased; (k) knocking down OGA in Treg cells with lentivirus did not change the phenotype of Treg cells; (l) compared with shNC Treg cells, OGA-knockout Treg cells showed significant protective effect on the disease severity of EAE induced by Th1 and Th17 cells, which was manifested as reduced clinical score of mice, improved damage of spinal cord white matter and activation of microglia and astrocytes.

[0117] Figure 6 shows that: (a) illustrates the steps of constructing bm12 cell induced SLE mouse model. WT mice were injected with 1 x 10 6WT Treg cells, MLKL-KO Treg cells, shNC Treg cells or shOGA Treg cells, followed by intraperitoneal injection of 30 million splenocytes isolated from bm12 mice; (b) Analysis of the percentage of Tfh cells, plasma cells and GC B cells in the spleen of SLE mice on day 14 after injection of bm12 splenocytes by flow cytometry; (c) Proliferation of autoreactive bm12 splenocytes in the spleen of SLE mice on day 14 after injection of bm12 splenocytes, as determined by CTV intensity; (d and e) Pathological analysis of kidney tissue sections of SLE mice on day 30, using H&E and PAS staining (scale bar = 100 pm).

[0118] In each figure, Tcons cells are conventional CD4 T cells, including CD4 T cells that do not express FOXP3 protein; Treg cells are regulatory CD4 T cells, including CD4 T cells that express FOXP3 protein; D138N mice are mutant mice with inactivated RIPK1 kinase activity. DETAILED DESCRIPTION

[0119] The present inventors have made extensive and in-depth studies and first developed a treatment method for Treg programmed necrosis type autoimmune diseases. The present inventors have unexpectedly found that, compared with other T cells, Treg cells are more prone to programmed necrosis in an inflammatory environment. By inhibiting or knocking down O-acetylglucosamine (OGA) to increase the level of O-GlcNAcylation, the activation of the programmed necrosis pathway of Treg cells in an inflammatory environment can be effectively reduced, and the death of Treg cells and the resulting impairment of their function can be avoided, thereby benefiting the control and relief of autoimmune diseases. On this basis, the present application is completed.

[0120] TERMS

[0121] For the purposes of the present application, certain technical and scientific terms are specifically defined below. Unless specifically defined herein, all other technical and scientific terms used have the meanings that are commonly understood by one of ordinary skill in the art in the field of the present application. Before the present application is described, it is to be understood that this application is not limited to the particular methodology and experimental conditions described, as such methodology and conditions can vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present application will be limited only by the appended claims.

[0122] As used herein, the term "about," when used in reference to a particular recited numerical value, means that the value can vary from the recited value by not more than 1%. For example, as used herein, the expression "about 100" includes all values between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0123] As used herein, the terms "comprising," "including," "containing," can be used interchangeably, and are each inclusive, both of open- and closed-ended.

[0124] As used herein, the terms "OGA inhibitor" or "OGA antagonist" are used interchangeably to refer to an agent or reagent that reduces or decreases the amount and / or activity of OGA, representative examples of which include (but are not limited to) a compound that downregulates OGA expression, a compound or antibody that reduces OGA protein stability, a compound or antibody that downregulates OGA activity, a gene editing tool that downregulates or knocks out OGA expression, an antibody or aptamer that inhibits OGA activity, an oligonucleotide that inhibits OGA expression, and the like.

[0125] EAE

[0126] Experimental autoimmune encephalomyelitis is an animal model of multiple sclerosis.

[0127] CD4 T cells

[0128] CD4 T cells have four subgroups, Th1, Th2, Th17 and Treg, which have different roles in the development of EAE. Antigen-activated Th1 and Th17 cells infiltrate into the central nervous system, activate microglia and astrocytes by releasing chemotactic factors and inflammatory cytokines, and promote the development of EAE pathological process, while Treg cells reduce the severity of the disease and promote the recovery of the disease by inhibiting the proliferation and effector function of other immune cells.

[0129] Programmed cell death

[0130] Programmed cell death is a process of cell death mediated by specific gene regulation in cells. Currently known programmed cell death includes apoptosis, cell programmed necrosis and cell pyroptosis. Apoptosis is mainly activated by Caspase enzyme, which degrades the components in the cell, leading to cell death; cell programmed necrosis is caused by the destruction of cell membrane integrity after the activation of MLKL; cell pyroptosis is caused by the destruction of cell membrane integrity after the activation of Gasdermin protein.

[0131] RIPK1-RIPK3-MLKL pathway

[0132] Upon activation by external stimuli, RIPK1 further activates RIPK3 and triggers the assembly of a RIPK1 / RIPK3 complex (referred to as necrosome), which subsequently activates MLKL. This signaling pathway is referred to as the RIPK1-RIPK3-MLKL pathway.

[0133] O-GlcNAcylation

[0134] O-linked beta-N-acetylglucosaminylation (referred to as O-GlcNAcylation) is a rich and dynamic post-translational modification process. Unlike other modifications, O-GlcNAcylation modification is catalyzed by a pair of opposing enzymes, O-linked glycosyltransferase (OGT) and hydrolyase (OGA). OGT transfers beta-N-acetylglucosamine (O-GlcNAc) to the hydroxyl group of serine / threonine residues of nucleoplasmin, while OGA is responsible for removing the modification. This modification uses UDP-GlcNAc as a donor substrate, which is produced by the amino hexose biosynthesis pathway (HBP) that integrates glucose, amino acid, fatty acid and nucleotide metabolism.

[0135] O-GlcNAcylation Promoter

[0136] As used herein, the O-GlcNAcylation promoter of the present application refers to an O-GlcNAcylation modification promoter, or a pharmaceutically acceptable salt thereof, or an optical isomer thereof or a racemate thereof, or a solvate thereof. It should be understood that the term also includes a mixture of the above components.

[0137] TMG

[0138] O-GlcNAcylation of proteins is catalyzed by N-acetylglucosamine transferase (OGT), which is reversibly removed by N-acetylglucosamine hydrolyase (OGA). Thiamet G (TMG) is a potent OGA inhibitor that can enhance O-GlcNAcylation in vitro and in vivo.

[0139] The structural formula of TMG is:

[0140] Pharmaceutical compositions and methods of administration

[0141] The O-GlcNAcylation promoter (e.g., small molecule compounds and various crystal forms thereof, pharmaceutically acceptable inorganic or organic salts, hydrates or solvates) of the present application, and the pharmaceutical composition containing the O-GlcNAcylation promoter of the present application as a main active ingredient can be used for treating Treg programmed necrosis type autoimmune diseases.

[0142] The pharmaceutical composition of the present application contains a safe and effective amount of the compound of the present application or a pharmacologically acceptable salt thereof and a pharmacologically acceptable excipient or carrier. The "safe and effective amount" means an amount of the compound sufficient to significantly improve the condition without causing serious side effects. Generally, the pharmaceutical composition contains 1-2000 mg of the compound of the present application per dose, more preferably, 10-1000 mg of the compound of the present application per dose. Preferably, the "one dose" is one capsule or tablet.

[0143] The "pharmacologically acceptable carrier" means one or more compatible solid or liquid filler or gel materials, which are suitable for human use and must have sufficient purity and sufficiently low toxicity. "Compatibility" here means that the components of the composition can be blended with the compound of the present application and among themselves without significantly reducing the efficacy of the compound. Some examples of the pharmacologically acceptable carrier include cellulose and its derivatives (e.g., sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (e.g., stearic acid, magnesium stearate), calcium sulfate, vegetable oils (e.g., soybean oil, sesame oil, peanut oil, olive oil, etc.), polyhydric alcohols (e.g., propylene glycol, glycerol, mannitol, sorbitol, etc.), emulsifiers (e.g., Tween 20®, Tween 80®, Span 20®, Span 80®, etc.), wetting agents (e.g., sodium dodecyl sulfate), coloring agents, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, etc. The "pharmacologically acceptable carrier" means one or more compatible solid or liquid filler or gel materials, which are suitable for human use and must have sufficient purity and sufficiently low toxicity. "Compatibility" here means that the components of the composition can be blended with the compound of the present application and among themselves without significantly reducing the efficacy of the compound. Some examples of the pharmacologically acceptable carrier include cellulose and its derivatives (e.g., sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (e.g., stearic acid, magnesium stearate), calcium sulfate, vegetable oils (e.g., soybean oil, sesame oil, peanut oil, olive oil, etc.), polyhydric alcohols (e.g., propylene glycol, glycerol, mannitol, sorbitol, etc.), emulsifiers (e.g., Tween 20®, Tween 80®, Span 20®, Span 80®, etc.), wetting agents (e.g., sodium dodecyl sulfate), coloring agents, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

[0144] The pharmaceutical composition is an aerosol, a nasal drop, a powder, a gel, a microsphere preparation, a liposome preparation, an emulsion.

[0145] In solid dosage forms of the invention, the active compound will usually be mixed with at least one inert, pharmaceutically acceptable excipient (or carrier) such as sodium citrate or dicalcium phosphate and / or a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid; b) binders such as hydroxymethylcellulose, alginic acid, gelatin, polyvinylpyrrolidone, sucrose, and acacia; c) humectants such as glycerol; d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate; e) solution retarders such as paraffin; f) absorption accelerators such as quaternary ammonium compounds; g) wetting agents such as cetyl alcohol and glycerol monostearate; h) absorbents such as kaolin and bentonite clay; and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, or mixtures thereof.

[0146] Liquid dosage forms for nasal administration include pharmaceutically-acceptable emulsions, solutions, suspensions, or tinctures. In addition to the active compounds, the liquid dosage forms can contain inert diluents commonly used in the art such as water or other solvents, solubilizing agents and emulsifiers, as for example, ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, and the like, as well as mixtures thereof.

[0147] Besides such inert diluents, the composition can also include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents.

[0148] Besides the active compounds, the suspensions can contain suspending agents such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, and agar-agar, as well as mixtures thereof.

[0149] The compounds of the present invention can be administered alone or in combination with other pharmaceutically acceptable compounds.

[0150] The therapeutic methods of the present invention can be used alone or in combination with other therapeutic procedures or agents.

[0151] The pharmaceutical compositions of the present invention are administered in a safe and effective amount, which is an amount that is pharmaceutically effective for the intended use, and which is a quantity that is safe for administration to a mammal, such as a human, in need of treatment. For a 60 kg body weight human, the daily amount is usually 1 to 2000 mg, preferably 50 to 1000 mg. The specific dose will, of course, be determined by the person administering the composition and will depend on the host, the nature and severity of the condition being treated, and the form of administration. These factors are within the skill of the art.

[0152] Kits of the present invention and their use

[0153] The present application also provides a kit for companion diagnosis, which contains specific detection reagents, and can more accurately identify subjects suitable for the therapeutic regimen of the present application.

[0154] Based on the present application, preferred subjects suitable for the therapeutic regimen of the present application have one or more characteristics selected from the group consisting of:

[0155] (a) the O-GlcNAcylation level of RIPK1 protein is significantly reduced;

[0156] (b) the O-GlcNAcylation level of RIPK3 protein is significantly reduced;

[0157] (c) the amount or level of activated RIPK1 (pRIPK1) protein is significantly increased;

[0158] (d) the amount or level of activated RIPK3 (pRIPK3) protein is significantly increased;

[0159] (f) the amount or level of activated MLKL (pMLKL) protein is significantly increased;

[0160] (g) the O-GlcNAcylation level of Treg cells is significantly reduced;

[0161] (h) the proportion of Treg cells undergoing programmed necrosis is significantly increased.

[0162] Preferably, the kit of the present application contains, in addition to the O-GlcNAcylation promoter of the present application as an active ingredient, detection reagents for detecting the characteristics of Treg programmed necrosis.

[0163] In addition, the kit of the present application can further provide evaluation information or data for the therapeutic effect. If, after administration of the O-GlcNAcylation promoter of the present application, the O-GlcNAcylation level of RIPK1 / 3 protein in the Treg of the corresponding subject is increased, the amount of activated RIPK1 protein, activated RIPK3 protein or activated MLKL protein is reduced, or the O-GlcNAcylation level of Treg cells is increased, or the proportion of Treg cells undergoing programmed necrosis is reduced, it indicates that the therapeutic regimen of the present application is effective or can continue to be administered.

[0164] Compared with the prior art, the present application has the following advantages:

[0165] 1. The present application first discovers that Treg programmed necrosis is one of the pathogenic factors of autoimmune diseases.

[0166] 2. The present application first found that increasing the O-GlcNAcylation level of RIPK1 / 3 protein in Treg can effectively slow down the programmed death of Treg, thereby improving autoimmune diseases.

[0167] 3. The present application provides a treatment method for Treg programmed necrosis type autoimmune diseases.

[0168] 4. The present application also provides a detection reagent for identifying subjects suitable for the treatment regimen of the present application, so that subjects suitable for the treatment regimen of the present application, i.e. subjects with Treg programmed necrosis type autoimmune diseases, can be more accurately identified, and more precise treatment can be achieved.

[0169] The present application will be further described in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present application and are not used to limit the scope of the present application. The experimental methods in the following examples, if not specified, are generally carried out according to conventional conditions, such as the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts are weight percentages and weight parts.

[0170] Unless otherwise specified, the reagents in the examples are commercially available.

[0171] Experimental methods

[0172] 1. Flow cytometry

[0173] Single cell suspensions were obtained from mouse peripheral blood and red blood cells in peripheral blood were lysed with ACK lysis buffer for flow cytometry analysis. For surface antigen labeling, the indicated antibodies were used to stain for 30 min at 4°C. For cytoplasmic antigen labeling, cells were fixed with 2% PFA and permeabilized with 0.1% saponin solution, and the indicated antibodies were used to stain for 1 h at room temperature. For nuclear antigen labeling, cells were fixed and permeabilized with Foxp3 / transcription factor fixation and permeabilization kit (eBioscience, Cat#00-5523-00), and the indicated antibodies were used to stain for 1 h at room temperature. The antibodies used include: CD4 (BioLegend, Cat#100408); CD11b (BioLegend, Cat#101206); CD19 (BioLegend, Cat#115538); CD3 (BioLegend, Cat#100220); CD8 (BioLegend, Cat#100748); NK1.1 (BioLegend, Cat#156524); Ly-6G (BioLegend, Cat#127608); CD14 (BioLegend, Cat#123316); CXCR3 (BioLegend, Cat#126531); CCR4 (BioLegend, Cat#131217); CCR6 (BioLegend, Cat#129819); CD25 (BioLegend, Cat#102005); Phospho-RIP1 (S166) (Biolynx, Cat#BX60008); Phospho-RIP3 (Thr231 / Ser232) (CST, Cat#91702s); Phospho-MLKL (S345) (CST, Cat#37333S); Phospho-IKKa / b (Ser176 / 180) (CST, Cat#2697s); Cleaved Caspase-3 (Asp175) (CST, Cat#9661).

[0174] 2. Induction of EAE

[0175] Mice were immunized subcutaneously with 300 ng MOG35-55 (myelin antigen) (available from Hanhong, Cat#332P2372) emulsified in 300 pL CFA (Sigma, Cat#F5881) 1:1, and then intravenously injected with 200 ng pertussis toxin (Aventis, Cat#abs42024900) per mouse on day 0 and day 2. For adoptive transfer EAE model, donor mice were immunized as described above, but without injection of pertussis toxin. Spleen and draining lymph nodes were harvested 10 days after immunization.

[0176] Initial CD4 T cells were isolated using magnetic bead-based isolation kit. Cells were then cultured in vitro with MOG35-55 (20 pg / mL) under Th1 cell polarizing condition or Th17 cell polarizing condition for 5 days. Activated MOG-specific Th1 and Th17 cells were resuspended in PBS, counted and injected intravenously into Rag2-KO recipient mice. Each mouse received about 5 x 10 6 Initial CD4 T cells were isolated using magnetic bead-based isolation kit. Cells were then cultured in vitro with MOG35-55 (20 pg / mL) under Th1 cell polarizing condition or Th17 cell polarizing condition for 5 days. Activated MOG-specific Th1 and Th17 cells were resuspended in PBS, counted and injected intravenously into Rag2-KO recipient mice. Each mouse received about 5 x 10 6 Initial CD4 T cells were isolated using magnetic bead-based isolation kit. Cells were then cultured in vitro with MOG35-55 (20 pg / mL) under Th1 cell polarizing condition or Th17 cell polarizing condition for 5 days. Activated MOG-specific Th1 and Th17 cells were resuspended in PBS, counted and injected intravenously into Rag2-KO recipient mice. Each mouse received about 5 x 10

[0177] Mice were evaluated daily for EAE clinical scores. EAE score evaluation was as follows: 0, no clinical signs; 1, partial tail paralysis; 2, complete tail paralysis; 3, hind limb paralysis, uncoordinated movement; 4, one hind limb paralyzed; 5, both hind limbs paralyzed; 6, hind limb paralysis, forelimb weakness; 7, both hind limbs paralyzed, one forelimb paralyzed; 8, hind limb, forelimb paralysis; 9, moribund; 10, death.

[0178] 3. Immunofluorescence

[0179] Mice were perfused sequentially with 5 mL cold PBS, 10 mL 4% paraformaldehyde, and the spinal cord was removed and fixed with 4% paraformaldehyde at 4°C for 24 hours. After washing twice with PBS, the spinal cord was dehydrated sequentially with 10% and 30% sucrose solution. Finally, the spinal cord was embedded with OCT embedding medium on dry ice and frozen sections were prepared. The sections were blocked with 5% goat serum at room temperature for 2 hours, then incubated with the primary antibody at 4°C overnight. The next day, the primary antibody was washed with 0.1% Tween-20 three times, and the secondary antibody was incubated at room temperature for 2 hours.

[0180] 4. Western blotting

[0181] Protein concentration was determined using a protein assay kit (Bi Yun Tian, Cat#P0009). 10-50 pg of prepared protein sample was electrophoresed through 8% polyacrylamide gel and transferred to nitrocellulose membrane. The membrane was blocked with 5% milk powder at room temperature for 1 hour, and incubated with the appropriate primary antibody at 4°C overnight. The next day, it was washed with TBS-T three times for 10 min each, and incubated with the specific secondary antibody (1:1000) at room temperature for 1 hour. Then the secondary antibody was washed with TBS-T, and developed using chemiluminescence.

[0182] 5. LDH assay

[0183] Release of lactate dehydrogenase (LDH) is an important indicator reflecting the integrity of cell membrane. The cytotoxicity of TNF after the action was detected by lactate dehydrogenase cytotoxicity detection kit (Bi Yun Tian) to characterize the cell death. 30 μl of cell supernatant under different conditions was collected, the sample was treated according to the kit instructions, and the absorbance was measured at 490 nm. Nec-1s is a RIPK1 kinase activity inhibitor, and Gsk-872 is a RIPK3 kinase activity inhibitor.

[0184] 6. Proximity ligation assay

[0185] After the cell sample was fixed and permeabilized, two primary antibodies of different species (RIPK1 or RIPK3 from rabbit, O-GlcNAc from mouse) were incubated overnight at 4°C. The next day, a pair of oligonucleotide-labeled secondary antibodies (PLA probe / proximity probe) were combined with the primary antibody at 37°C. Then, the ligation oligonucleotide was added, which hybridized with the proximity probe when the pair of proximity probes were close enough, and under the action of ligase, a closed circular DNA was formed as a template for rolling circle amplification. Then, DNA polymerase was added, which used the PLA probe as a primer and the above-mentioned circular DNA as a template to synthesize a series of linked sequences through RCA reaction. Finally, the proximity ligation signal was quantitatively analyzed by fluorescence microscopy.

[0186] 7. Lentivirus construction

[0187] A plasmid carrying OGA shRNA (SEQ ID NO 1: GAGTACTAACCAATCCAAATT) was constructed, and it was co-transfected with packaging plasmid PSPAX2 and PMD2G into 293T cells under the action of transfection reagent PEI. After 6 h, fresh DMEM medium was replaced, and after 48 h, the medium containing the virus was collected and filtered with a 0.22 μm filter to obtain lentivirus carrying mouse OGA shRNA. The collected virus supernatant was stored at -80°C. NC shRNA (SEQ ID NO 2: AATTCTCCGAACGTGTCACGT) was used as a control.

[0188] 8. Systemic lupus erythematosus mouse model construction

[0189] The inducible bm12 systemic lupus erythematosus mouse model was established by transferring spleen cells from B6(C)-H2-Ab1bm12 / KhEgJ (bm12) mice into C57BL / 6 mice. Briefly, the spleen of the bm12 mouse was crushed through a 40 μm cell screen, and a single cell suspension was prepared using a syringe piston. The cells were centrifuged at 400 g for 5 minutes, and the supernatant was discarded. Then, 30 million bm12 mouse spleen cells were injected intraperitoneally into B6 mice.

[0190] 9. Kidney tissue section staining

[0191] The kidneys of SLE mice were collected and fixed with 4% paraformaldehyde (PFA) overnight. After washing with PBS and dehydrating through a gradient ethanol series, the tissues were washed in xylene, embedded in paraffin, and cut into 5 pm sections for pathological examination. Then, the tissue sections were stained using hematoxylin-eosin (H&E, G1076, Servicebio) and PAS (G1008, Servicebio) kits. Finally, the sections were mounted with neutral resin and observed under a microscope.

[0192] Example 1. Programmed necrosis of CD4 T cells aggravates EAE pathology

[0193] In this example, the correlation between autoimmune diseases such as EAE and T cells was studied.

[0194] Using wild-type mice (WT) and mutant mice with inactivated RIPK1 kinase activity (D138N) as controls, the marker of RIPK1 activation (phospho-S166 RIPK1 (pRIPK1)) in peripheral blood immune cells of EAE mice was analyzed by flow cytometry before onset, at peak, and during recovery of the disease, corresponding to the 7th, 14th, and 21st days after MOG35-55 immunization (Fig. la).

[0195] It was found that in the EAE group modeled by MOG35-55, the pRIPK1 expression level of CD4 T cells was significantly increased at each stage of EAE pathology compared with other white blood cells (Fig. lb). In the group of mice without MOG35-55 immunization, there was no activation of RIPK1 in CD4 T cells (Fig. lc).

[0196] The activation of RIPK1 can activate the NF-KB signaling pathway to promote the transcription of inflammatory factors on the one hand, and can induce apoptosis and programmed necrosis on the other hand. To study the downstream signaling of RIPK1 activation in CD4 T cells during EAE onset, the expression levels of phospho-IKK (S176 / S180, pIKK), cleaved-Caspase 3 (cCasp3), phospho-RIPK3 (T231, pRIPK3), and phospho-MLKL (S345, pMLKL) proteins were quantified by flow cytometry, and pIKK, cCasp3, pRIPK3 / pMLKL are markers of NF-κB inflammatory pathway activation, apoptosis, and programmed necrosis pathway, respectively.

[0197] It was found that the expression levels of pRIPK3 and pMLKL in CD4 T cells significantly increased during the development of EAE, while the expression of pIKK and cCasp3 did not show any increase (Figure 1d). This indicates that CD4 T cells are more prone to programmed necrosis during the pathological progression of EAE.

[0198] CD4 T cells were isolated from the spleens of D138N, MLKL-KO (MLKL-KO transgenic mice) and WT mice and injected into T cell deficient Rag2-KO mice, and the Rag2-KO mice were immunized with MOG35-55 peptide to construct an EAE model. The clinical phenotype scores of the mice, MBP staining, and microglial activation (IBA-1 staining) and astrocyte activation (GFAP staining) were counted.

[0199] It was found that when the RIPK1 kinase activity of CD4 T cells was lost or MLKL was knocked out, the severity of EAE mice was significantly reduced (Figure 1e), indicating that programmed necrosis of CD4 T cells is an important factor in exacerbating the severity of EAE.

[0200] In summary, on the one hand, during the development of EAE, RIPK1 is phosphorylated, leading to an increase in pRIPK1. The expression levels of pRIPK3 and pMLKL also increase. On the other hand, RIPK1 activity is inhibited or MLKL is down-regulated, and the severity of EAE is significantly reduced. These results suggest that programmed necrosis of CD4 T cells is one of the main pathogenic factors of autoimmune diseases such as EAE.

[0201] Example 2. Programmed necrosis of Treg cells promotes the pathological development of EAE

[0202] In this example, it was further determined which CD4 T cell subsets were prone to programmed necrosis during the progression of EAE.

[0203] Peripheral blood lymphocytes were extracted from D138N-EAE mice and WT-EAE mice, and different subsets were distinguished by cell surface markers (Figure 2a), and programmed necrosis-related markers were detected.

[0204] The results showed that during the progression of EAE, Treg cells were found to have significantly higher expression levels of programmed necrosis-related markers (such as pRIPK1, pRIPK3 and pMLKL) than Th1, Th2 and Th17 subsets (Figure 2b). This suggests that Treg cells are more prone to programmed necrosis than other types of CD4 T cells during EAE.

[0205] To further validate, the programmed necrosis markers pRIPK1 and pMLKL in Treg cells and conventional CD4 T cells (Tcons cells) in EAE mice were analyzed by staining with imaging flow cytometry.

[0206] As shown in Figure 2c, the results further confirmed that Treg cells were more susceptible to programmed necrosis than other types of CD4 T cells (Tcons cells) during EAE (Figure 2c).

[0207] These results suggest that programmed necrosis of Treg cells is a major pathogenic factor in autoimmune diseases such as EAE. This autoimmune disease characterized by programmed necrosis of Treg cells is defined as Treg programmed necrosis type autoimmune disease. Typically, there is a significant increase in pRIPK1, pRIPK3 and pMLKL in Treg cells compared to the control group.

[0208] Example 3. Inhibition of Treg cell programmed necrosis alleviates EAE progression

[0209] In view of the susceptibility of Treg cells to programmed necrosis in EAE, in this example, the potential effect of inhibiting Treg cell programmed necrosis on the pathological progression of EAE was evaluated.

[0210] Initial CD4 T cells derived from EAE mice were stimulated in vitro to differentiate into Th1 and Th17, and this antigen-activated Th1 and Th17 was transplanted into Rag2-KO mice to construct an adoptive transfer EAE model. At the same time, an equal amount of WT Treg cells or MLKL-KO Treg cells (derived from MLKL-KO transgenic mice) was injected into the above-mentioned Rag2-KO mice, and the clinical score, MBP staining, IBA-1 staining and GFAP staining of the mice were counted.

[0211] The results showed that both injection of WT Treg cells and injection of MLKL-KO Treg cells significantly reduced the EAE clinical score caused by Th1 and Th17 cells, and MLKL-KO Treg cells had greater improvement on EAE symptoms (Figure 2d), indicating that inhibition of Treg cell programmed necrosis helps to improve the pathological development of EAE.

[0212] To rule out that other types of cell death (such as pyroptosis) of Treg cells can also have a negative effect on the pathological development of EAE, an equal amount of WT or Caspase1-KO Treg cells was also injected into the above-mentioned Rag2-KO mice.

[0213] Results showed that injection of WT or Caspase1-KO Treg cells equally reduced the disease severity of EAE (Figure 2e), indicating that knocking out Caspase1 to inhibit pyroptosis of Treg did not further protect the course of EAE. Moreover, the expression of ASC, a key protein of pyroptosis pathway, was not detected in Treg cells of EAE mice (Figure 2f), indicating that the pathological development of EAE was not related to pyroptosis of Treg.

[0214] Example 4. Inflammatory cytokines induce programmed necrosis of Treg cells

[0215] TNF-TNFR1 is the most widely studied pathway that activates RIPK1 and triggers programmed necrosis signal transduction, and some inflammatory cytokines such as TNF are also important mediators in the pathogenesis of EAE. In this example, whether Treg cells are still susceptible to programmed necrosis under the action of inflammatory cytokines is explored.

[0216] Firstly, in vivo experiments were conducted by intravenously injecting TNF into mice, and collecting peripheral blood immune cells of mice for flow cytometry analysis after a period of action of TNF (Figure 3a), and the signals were characterized by imaging flow cytometry (Figure 3b).

[0217] Results showed that compared with other CD4 T cell subsets, Treg cells showed an increase in the expression level of programmed necrosis markers (such as pRIPK1, pRIPK3 and pMLKL) after injection of TNF.

[0218] Next, the sensitivity of Treg cells to programmed necrosis after TNF stimulation was verified by in vitro experiments. Lactate dehydrogenase (LDH) cytotoxicity detection experiments showed that Treg cells polarized in vitro were more susceptible to cell death under the stimulation of TNF than Th1 cells (Figure 3c), and this cell death could be protected by inhibitors of RIPK1 and RIPK3 kinases (Figure 3c), and the expression of programmed necrosis markers pRIPK1, pRIPK3 and pMLKL in TNF-treated Treg cells was verified by Western blotting (Figure 3d).

[0219] Results showed that Treg cells were more susceptible to programmed necrosis than other subsets under the stimulation of TNF.

[0220] In addition, Treg cells were stimulated with IFNγ, and results showed that intravenous injection of IFNγ could also induce more significant programmed necrosis of Treg cells (Figure 3e).

[0221] The above together indicate that Treg cells are susceptible to programmed necrosis under the action of inflammatory cytokines.

[0222] Example 5. Treg cell programmed necrosis is associated with O-GlcNAcylation of RIPK1 and RIPK3

[0223] Glut1, a key glucose transporter for T cells, was significantly downregulated in Treg cells compared to other CD4 T cell subsets both in the periphery and in vitro induced polarized Treg cells (Figure 4a).

[0224] Next, it was investigated whether glucose metabolism played a role in the susceptibility of Treg cell programmed necrosis. It was hypothesized that Treg cells might downregulate A20 expression, making them susceptible to programmed necrosis. The expression level of A20 in Treg cells and other CD4 T cell subsets was detected.

[0225] It was found that the expression level of A20 in Treg cells was actually comparable to that in other CD4 T cell subsets (Figure 4b), indicating that Treg cell programmed necrosis was not associated with A20.

[0226] In addition to the glycolytic pathway, glucose can also be metabolized downstream through the hexosamine biosynthesis pathway (HBP). Subsequently, the expression levels of proteins related to the HBP pathway were detected.

[0227] It was found that the products of the HBP metabolic pathway in Treg cells were significantly downregulated, including UDP-GlcNAc as an O-GlcNAcylation substrate (Figure 4c), consistent with reduced HBP metabolic activity, and the level of O-GlcNAcylation in Treg cells was weakened (Figure 4d), indicating that O-GlcNAcylation was associated with Treg cell programmed necrosis.

[0228] Next, the O-GlcNAcylation level of RIPK1 and RIPK3 in Treg cells was investigated.

[0229] The experimental results showed that the O-GlcNAcylation level of RIPK1 and RIPK3 in Treg cells was significantly lower than that in other CD4 T cell subsets (Figure 4e). TMG treatment could effectively increase the O-GlcNAcylation of Treg cells (Figure 4f). And after TMG treatment, the O-GlcNAcylation level of RIPK1 and RIPK3 in Treg cells was significantly increased (Figure 4g). The effect of TMG did not affect the expression of Foxp3 in Treg cells, and the ability of Treg cells to inhibit the proliferation of Tcons cells (Figure 4h).

[0230] The above results show that inhibition of OGA can effectively restore the O-GlcNAcylation levels of RIPK1 and RIPK3 in Treg cells without affecting their proliferation and suppressive capacity.

[0231] Example 6. Inhibition of OGA can alleviate Treg programmed necrosis, thereby affecting the pathological progression of EAE

[0232] 6.1 In vitro TMG treatment inhibits Treg cell death,

[0233] After 12 h of treatment with 10 mM TMG, the differentiated Treg cells were stimulated with 100 ng / ml TNF. At 6 h, 10 h, and 24 h after TNF stimulation, the release of lactate dehydrogenase (LDH) was detected in the TMG-treated group (TNF+TMG) and the control group (TNF). It was found that the degree of cell death of Treg cells in the TMG-treated group was significantly lower than that in the control group under TNF stimulation (Figure 5b).

[0234] 6.2 In vivo TMG administration to intervene in Treg cell programmed necrosis and protect the pathological progression of autoimmune diseases

[0235] Mice were intraperitoneally injected with 20 mg / kg TMG daily for 3 consecutive days. Then, 100 ul (4 ug) of TNF was injected into the tail vein of the mice to activate the TNF-TNFR1 pathway of peripheral immune cells. It was found that after the administration of TMG to induce an increase in the O-GlcNAcylation level of Treg cells, the expression level of Treg cell programmed necrosis markers induced by TNF within 0-4 hours was significantly reduced (Figure 5a).

[0236] The above results show that upregulating O-GlcNAcylation by inhibiting the activity of OGA is an effective intervention method for TNF-induced programmed necrosis of Treg cells.

[0237] In the EAE disease model, TMG treatment can reduce the severity of the disease in mice (Figure 5c), maintain the integrity of the myelin sheath (Figure 5d), and reduce inflammation in the central nervous system (Figure 5e). These effects of TMG are associated with a decrease in Treg cell programmed necrosis and a decrease in the Th1 / Treg and Th17 / Treg ratios (Figures 5f, g). In addition, after knocking out Treg cells in mice, TMG administration treatment did not protect the severity of EAE (Figure 5h).

[0238] The results show that TMG inhibits Treg cell programmed necrosis by upregulating the O-GlcNAcylation of RIPK1 and RIPK3 in Treg cells, thereby improving the pathological progression of EAE.

[0239] To further explore the effect of elevated O-GlcNAcylation of Treg cells targeting on regulating Treg programmed necrosis and disease progression in the context of EAE, lentiviral vectors carrying OGA shRNA were used to transfect in vitro induced and differentiated Treg cells to obtain OGA knockdown (KD) Treg cells (Figure 5i).

[0240] It was found that the O-GlcNAcylation levels of RIPK1 and RIPK3 in OGA KD Treg cells were elevated (Figure 5j). The expression levels of IL-17A and IFN-γ in OGA KD Treg cells were similar to those in untransfected Treg cells or Treg cells transfected with Ctrl shRNA (Figure 5k), indicating that OGA KD Treg cells can maintain their suppressive phenotype in vitro.

[0241] The established adoptive transfer EAE mouse model was used to study the potential effect of OGA KD Treg cells on the development of EAE. Compared with shNC Treg cells, OGA KD Treg cells showed a significant protective effect on the severity of EAE induced by Th1 and Th17 cells (Figure 5l).

[0242] The results showed that inhibiting the activity of OGA can prevent the loss of Treg cell number and function due to programmed necrosis in EAE.

[0243] Example 7. Programmed necrosis-resistant Treg cells can improve the pathological process of systemic lupus erythematosus (SLE)

[0244] In addition to multiple sclerosis, the loss and dysfunction of Treg cells can also promote the occurrence of systemic lupus erythematosus (SLE). It was next explored whether programmed necrosis-resistant Treg cells could exhibit better inhibitory capacity on the pathogenic autoimmune response in SLE.

[0245] The bm12 cell-induced SLE mouse model was constructed and the programmed necrosis-resistant Treg cells (MLKL-KO Treg cells, shOGA Treg cells) or their corresponding control cells (WT Treg cells, shNC Treg cells) were co-injected with the spleen lymphocytes from the bm12 mice into the recipient mice (Fig. 6a). Compared with the mice only receiving the bm12 lymphocytes, the proportion of Tfh cells, GC B cells and plasma cells in the spleen of the mice in the WT Treg cell or shNC Treg cell treatment group was reduced (Fig. 6b). Meanwhile, the MLKL-KO or shOGA Treg cells showed stronger inhibition on the expansion of the autoreactive T cells and B cells and the exogenous bm12 cells (Fig. 6b and c). Consistent with these results, the kidney injury of the mice receiving the programmed necrosis-resistant Treg cell treatment was significantly alleviated, as indicated by the reduced immune cell infiltration in the kidney tissue and the reduced severity of glomerulonephritis, while the kidney injury of the mice in the WT Treg cell or shNC Treg cell group was not improved to a great extent (Fig. 6d and e).

[0246] The results show that the programmed necrosis-resistant Treg cell therapy can improve the pathological process of systemic lupus erythematosus (SLE), providing a promising treatment strategy for SLE.

[0247] In summary, the reduced O-GlcNAcylation level of RIPK1 and RIPK3 in Treg cells triggers its susceptibility to programmed necrosis, and the O-GlcNAcylation level of RIPK1 and RIPK3 in Treg cells can be effectively restored by inhibiting OGA, thereby reducing the cell death of Treg cells under inflammatory stimulation.

[0248] All the documents mentioned in the present application are incorporated by reference in the present application as if each document was individually incorporated by reference. In addition, it should be understood that various modifications or changes can be made to the present application by those skilled in the art upon reading the above description of the present application, and these equivalent forms also fall within the scope defined by the appended claims of the present application.

Claims

1. Use of an O-linked beta-N-acetylglucosamine glycosylation (O-GlcNAcylation) promoting agent, characterized in that, For use in the preparation of a medicament or formulation for treating a Treg pyroptosis autoimmune disease.

2. Use according to claim 1, characterized in that, The O-GlcNAcylation-promoting agent is selected from the group consisting of a compound that downregulates OGA expression, a compound or antibody that decreases OGA protein stability, a compound or antibody that downregulates OGA activity, a gene editing tool that downregulates or knocks out OGA expression, an antibody or aptamer that inhibits OGA activity, an oligonucleotide that inhibits OGA expression, a compound that promotes OGT activity, an OGT enzyme preparation, an mRNA for expressing OGT, a gene editing tool that promotes OGT overexpression, or a combination thereof.

3. Use according to claim 1, characterized in that, The O-GlcNAcylation-promoting agent increases the O-GlcNAcylation level of RIPK1 protein and / or the O-GlcNAcylation level of RIPK3 protein, thereby inhibiting or slowing down Treg pyroptosis.

4. The use according to claim 1, characterized in that, The Treg pyroptosis autoimmune disease is mediated or caused primarily by Treg pyroptosis.

5. The use according to claim 1, characterized in that, The Treg pyroptosis autoimmune disease has one or more characteristics selected from the group consisting of: (a) a significantly decreased O-GlcNAcylation level of RIPK1 protein; (b) a significantly decreased O-GlcNAcylation level of RIPK3 protein; (c) a significantly increased number or level of activated RIPK1 (pRIPK1) protein; (d) a significantly increased number or level of activated RIPK3 (pRIPK3) protein; (f) a significantly increased number or level of activated MLKL (pMLKL) protein; (g) a significantly decreased O-GlcNAcylation level of Treg cells; (h) a significantly increased proportion of Treg cells undergoing pyroptosis.

6. A method of inhibiting necrosis of Treg cells in vitro, characterized in that, The method comprises the step of: (a) culturing Treg cells in the presence of an O-GlcNAcylation-promoting agent, thereby inhibiting Treg cell necrosis.

7. The method of claim 6, wherein, In the presence of the O-GlcNAcylation-promoting agent, the Treg cells undergo a change selected from the group consisting of: (a) an increased O-GlcNAcylation level of RIPK1 protein; (b) an increased O-GlcNAcylation level of RIPK3 protein; (c) a decreased number or level of activated RIPK1 (pRIPK1) protein; (d) a decreased number or level of activated RIPK3 (pRIPK3) protein; (f) a decreased number or level of activated MLKL (pMLKL) protein; (g) an increased O-GlcNAcylation level of Treg cells; or a combination thereof.

8. A reagent combination, characterized in that The reagent combination comprises: (Z1) a detection reagent for detecting Treg pyroptosis; and (Z2) a first medicament for treating an autoimmune disease, the first medicament comprising an O-GlcNAcylation-promoting agent.

9. The agent combination according to claim 8, wherein The detection reagent for detecting Treg pyroptosis is selected from the group consisting of: (Za) a detection reagent for detecting the O-GlcNAcylation level of RIPK1 protein; (Zb) a detection reagent for detecting the O-GlcNAcylation level of RIPK3 protein; (Zc) a detection reagent for detecting the amount or level of activated RIPK1 (pRIPK1) protein; (Zd) a detection reagent for detecting the amount or level of activated RIPK3 (pRIPK3) protein; (Zf) a detection reagent for detecting the amount or level of activated MLKL (pMLKL) protein; (Zg) a detection reagent for detecting the O-GlcNAcylation level of Treg cells; (Zh) a detection reagent for detecting the proportion of Treg cells undergoing programmed necrosis; or a combination thereof.

10. A method of screening for potential compounds for treating Treg pyroptosis-type autoimmune diseases, characterized in that, comprising the steps of: (i) culturing Treg cells in the presence of a test compound in an experimental group, and culturing Treg cells in the same conditions as the experimental group but in the absence of the test compound in a control group; (ii) detecting the level of O-GlcNAcylation in the experimental group and the control group; wherein if one or more conditions selected from the following group are met in the experimental group compared to the control group, it is suggested that the test compound is a potential compound for treating Treg programmed necrosis type autoimmune diseases: (a) the O-GlcNAcylation level of RIPK1 protein is significantly increased; (b) the O-GlcNAcylation level of RIPK3 protein is significantly increased; (c) the amount or level of activated RIPK1 (pRIPK1) protein is significantly decreased; (d) the amount or level of activated RIPK3 (pRIPK3) protein is significantly decreased; (f) the amount or level of activated MLKL (pMLKL) protein is significantly decreased; (g) the O-GlcNAcylation level of Treg cells is significantly increased.