Method for increasing gene expression and improving herbicide resistance in plants
By inserting regulatory sequences upstream of the coding regions of HPPD and HIS1 genes and using expression regulatory elements such as SRE to enhance gene expression, the problems of low efficiency and high risk in traditional methods have been solved, and high-efficiency resistance to HPPD-inhibiting herbicides has been achieved.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-09-30
- Publication Date
- 2026-04-02
AI Technical Summary
Existing technologies are insufficient to efficiently enhance plant resistance to HPPD-inhibiting herbicides. Traditional methods suffer from low gene editing efficiency, uncertainty in genome insertion location, and the risk of introducing undesirable traits, making it difficult to meet the needs of practical production applications.
By using genome editing technology to replace or insert regulatory sequences upstream of the coding regions of genes such as HPPD and HIS1, and utilizing expression regulatory elements such as SRE, the expression level of target genes can be significantly enhanced, thereby achieving resistance to HPPD-inhibiting herbicides.
It significantly improves plant resistance to HPPD-inhibiting herbicides, reduces the risk of gene editing and the occurrence of undesirable traits, and is suitable for practical production applications.
Smart Images

Figure CN2025125861_02042026_PF_FP_ABST
Abstract
Description
Method for improving gene expression and improving herbicide resistance of plants TECHNICAL FIELD
[0001] The present disclosure belongs to the field of plant genetic engineering, and relates to a method for improving gene expression and improving herbicide resistance of plants, in particular, to a method for regulating gene expression by modifying the non-coding region of a gene through genome editing technology, and a method for producing herbicide-resistant plants, particularly herbicide-resistant rice, using the method. BACKGROUND
[0002] Gene expression plays an important role in determining the phenotypic diversity of organisms. Artificial manipulation of gene expression is key to optimizing the economic traits of industrial organisms, livestock and crops. The traditional method of regulating plant gene expression is to transform overexpression or suppression expression (such as RNAi) elements into plants by transgenic means. This method is usually subject to strict regulatory supervision due to the introduction of exogenous genes, and in addition, the insertion position of exogenous genes in the recipient genome is random, which has the risk of generating other undesirable traits or gene silencing. In recent years, with the development of gene editing technology, scientists have made more precise modifications and modifications to target genes using gene editing tools to achieve precise gene regulation. Specific methods include: using homologous recombination or NHEJ to insert a strong promoter near the target gene to enhance gene expression (Hummel et al., 2018); editing the promoter of the target gene by Cas9 or Cas12 to regulate the expression level and expression pattern of the gene, to achieve the resolution of the pleiotropic gene WOX9, the modification of the promoter of the IPA1 gene, and then to achieve the improvement of target traits (Hendelman et al., 2021, Song et al., 2022); by knocking out or generating upstream open reading frames (uORF), precisely up-regulating and down-regulating gene expression at the protein translation level (Xue et al., 2023, Zhang et al., 2018); by editing the upstream and downstream of the target gene, generating genomic structural variations (including gene inversion and duplication), enhancing the expression level of the gene (Lu et al., 2021); by knocking out the 3'UTR negative regulatory region, precisely modifying the sequence upstream of the ATG start codon to enhance the expression level of the gene (Wang et al., 2024a, Wang et al., 2024b). Using the above methods, although the expression of the target gene can be improved, there are limitations such as low gene editing efficiency, strong dependence on gene upstream and downstream sequences, or limited expression enhancement level, so it is necessary to develop a more efficient, simple and easy-to-use method for greatly enhancing gene expression.
[0003] There are two main mechanisms for plants to resist herbicides: (1) target resistance mechanism, such as mutation of target protein affecting herbicide binding kinetics or increasing expression of target protein; (2) non-target resistance mechanism, including increasing metabolic level of inhibitor molecules, translocation or transport isolation. Based on the above mechanisms, some traditional herbicide-resistant crops are obtained by mutagenesis breeding, which produces specific mutations in herbicide target proteins. In addition, most herbicide-resistant crops are obtained by overexpression of herbicide resistance related genes, including herbicide target protein genes, herbicide metabolic degradation and transport related genes, to improve herbicide resistance. Among them, overexpression of herbicide resistance related genes can usually confer higher resistance level to plants, so this method has a wide application in improving plant herbicide resistance traits. However, due to the uncertainty of the insertion site of traditional transgenic technology, excellent transformation events need to be screened from a large number of mutants, and the stability of the traits needs to be confirmed for many years. In recent years, gene "knock-up" technology based on gene editing technology has made some progress, but there are still great limitations in the development of herbicide-resistant crops. For example, uORF knockout, negative regulatory region deletion, and precise modification of ATG start codon upstream sequence methods have limited expression of genes, making it difficult to improve the resistance level to the actual production application level. In addition, not all genes contain uORF, negative regulatory sequence and modifiable ATG upstream sequence. For example, promoter insertion and genomic structural variation can greatly improve the expression level of the target gene, but the long fragment promoter or genomic structural variation introduced will have a great impact on the upstream and downstream genes, increasing the risk of introducing undesirable traits and genomic structural instability. Therefore, a method is needed to precisely modify the herbicide resistance related genes, which can produce minimal modification to the genome, but can greatly improve the expression level of the gene to make it applicable to actual production.
[0004] 4-hydroxyphenylpyruvate dioxygenase (HPPD) exists in various organisms, which is a ferrous-tyrosine protein, and exists in the form of homodimer, and was identified as a herbicide target protein in the 1990s (Bradley et al., 1986). In plants, HPPD enzyme can catalyze the conversion of 4-hydroxyphenylpyruvate (HPP) into 2,5-dihydroxyphenylacetate (HGA), and then into plastoquinone and tocopherol. And plastoquinone and tocopherol, as important antioxidants in plant photosynthesis, can protect the membrane structure of chloroplast from photooxidative stress caused by active oxygen (Grossmann and Ehrhardt, 2007). Therefore, HPPD inhibitor herbicides will simultaneously inhibit the tyrosine catabolism pathway and the biosynthesis metabolic pathway of plastoquinone and tocopherol in plants, and the accumulation of free radicals in the new bud tissue causes photooxidative damage to chlorophyll and photosynthetic membranes, resulting in typical whitening of new leaf tissue, and ultimately leading to plant death (Beaudegnies et al., 2009). In 2019, Japanese scientists discovered a rice gene HIS1, which confers resistance to BBC and other beta-triketone herbicides. HIS1 encodes a Fe(II) / 2-oxoglutarate-dependent oxygenase, which detoxifies beta-triketone herbicides by catalyzing their hydroxylation (Maeda et al., 2019). Rice is susceptible to many HPPD inhibitor herbicides that target monocotyledonous plants, making it almost impossible to use these herbicides to control grass weeds. Therefore, there is still a need in the art to develop crop plants, such as rice and wheat, that are resistant to HPPD inhibitor herbicides. SUMMARY
[0005] Problems to be Solved by the Invention
[0006] In order to develop rice and wheat that are resistant to HPPD inhibitor herbicides, the present disclosure screened a regulatory sequence that can effectively improve the expression of the target gene through a protoplast luciferase reporter system; by using the CRISPR / Cas9 method, the regulatory sequence was replaced or inserted upstream of the coding region of HPPD, HIS1, etc., to achieve the improvement of the expression of HPPD gene, HPPD resistance mutant allele and HIS1 gene, thereby creating HPPD inhibitor-resistant rice and wheat.
[0007] Solution for Solving the Problem
[0008] A first aspect of the present disclosure provides a method of increasing expression of an endogenous polynucleotide in a plant cell, the method comprising altering one or more nucleotides in a regulatory region of the endogenous polynucleotide such that the regulatory region of the endogenous polynucleotide comprises at least one copy of an expression regulatory element;
[0009] Optionally, the expression regulatory element is selected from at least one of SRE, ADSH2, ADSH3, ADSH6, ADSH8, ADSH12, RDSH1, RDSH3, GREGIONNTPRBIB, JERECRSTR, SV40, CaMV, MMV, FMV, OsFMV, CmYLCVR, and variants of the aforementioned elements.
[0010] Optionally, the at least one copy of the expression regulatory element comprises a nucleotide sequence selected from the group consisting of as set forth in SEQ ID NO: 1, 6, 7, 10, 12, 16, 17, 19, 22, 23, 25-29, 31, 38.
[0011] Optionally, the regulatory region comprises a non-coding region of the 5’ end of the endogenous polynucleotide.
[0012] Preferably, the non-coding region of the 5’ end comprises a promoter region and a 5’ UTR region.
[0013] In some embodiments, the one or more nucleotides are altered by genome modification.
[0014] In some embodiments, the method comprises:
[0015] (a) the at least one copy of the expression regulatory element is present in one or more configurations selected from the group consisting of head-to-head, head-to-tail, tail-to-head, tail-to-tail, and combinations thereof, for example, two copies of SRE as set forth in SEQ ID NO: 2 or three copies of SRE as set forth in SEQ ID NO: 3, optionally, the at least one copy is separated by a spacer sequence comprising 1 to 50 nucleotides, for example, three copies of SRE as set forth in SEQ ID NO: 4; and / or
[0016] (b) the variant comprises a truncation of the expression regulatory element, for example, a SRE truncation that truncates at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases from the 5’ end and / or 3’ end of SRE, such as a SRE truncation as set forth in SEQ ID NO: 38; and / or
[0017] (c) wherein the expression regulatory element is present within 0 to 1000 bp or 1000 bp upstream of the core promoter region from the transcription start site of the endogenous polynucleotide, for example, 50 to 110 bp, 30 to 235 bp, 130 to 405 bp, 61 to 78 bp, 173 to 233 bp, 187 to 233 bp, 38 to 59 bp, 35 to 56 bp, 57 to 78 bp, 111 to 132 bp, 33-241 bp, 79-100 bp, 134-403 bp, preferably 33-241, 134-403 bp and / or 33 to 233 bp; more preferably within 54 to 233 bp of the transcription start site;
[0018] Preferably, the at least one copy of the expression regulatory element comprises an amino acid sequence selected from the group consisting of as set forth in SEQ ID NOs: 1-4, 38.
[0019] In some embodiments, the method comprises:
[0020] (a) the expression regulatory element is heterologous to the endogenous polynucleotide; or
[0021] (b) creating the copy of the expression regulatory element by altering no more than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 27, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, or 69 nucleotides in a regulatory region of the endogenous polynucleotide.
[0022] In some embodiments, the method comprises:
[0023] (a) the expression regulatory element is upstream of the transcription start site of the endogenous polynucleotide;
[0024] (b) the expression regulatory element is downstream of the transcription start site of the endogenous polynucleotide;
[0025] (c) inserting the expression regulatory element into a regulatory region of the endogenous polynucleotide such that the expression regulatory element is operably linked to the endogenous polynucleotide;
[0026] (d) replacing a portion of a sequence of a regulatory region of the endogenous polynucleotide with the expression regulatory element such that the expression regulatory element is operably linked to the endogenous polynucleotide; or
[0027] (e) operably linking said expression modulating element to a core promoter.
[0028] In some embodiments, the method comprises:
[0029] (a) increased expression of the endogenous polynucleotide in the plant cell as compared to a control plant cell that does not comprise the expression modulating element operably linked to the endogenous polynucleotide; and / or
[0030] (b) the endogenous polynucleotide is involved in disease resistance, herbicide tolerance, pest resistance, yield increase, yield stability, or a combination thereof.
[0031] In some alternative embodiments, the endogenous polynucleotide is involved in herbicide tolerance, for example, the endogenous polynucleotide is derived from a rice HPPD gene; and further, the method comprises at least one of (a1)-(a3):
[0032] (a1) replacing a portion of the endogenous polynucleotide from 244 bp upstream to 59 bp downstream of the transcription start site, preferably from 100 bp upstream to 59 bp downstream of the transcription start site, more preferably from 38 bp downstream to 59 bp downstream of the transcription start site, from 35 bp upstream to 56 bp upstream of the transcription start site, or from 111 bp upstream to 132 bp upstream of the transcription start site, with 1X copy of SRE;
[0033] (a2) replacing a portion of the endogenous polynucleotide from 134 bp upstream to 403 bp upstream of the transcription start site, preferably from 343 bp upstream to 403 bp upstream, from 343 bp upstream to 391 bp upstream, from 335 bp upstream to 391 bp upstream, from 335 bp upstream to 363 bp upstream, from 278 bp upstream to 306 bp upstream, from 154 bp upstream to 184 bp upstream, or from 134 bp upstream to 184 bp upstream, with 2X copy of SRE;
[0034] (a3) inserting 3X copy of SRE between 180 bp and 181 bp upstream of the transcription start site or upstream of the 1000 bp core sequence of the promoter.
[0035] In other alternative embodiments, the endogenous polynucleotide is involved in herbicide tolerance, for example, the endogenous polynucleotide is derived from a rice HIS1 gene. In some embodiments, the method comprises at least one of (b1)-(b3):
[0036] (b1) replacing a portion of the endogenous polynucleotide from 33 bp upstream to 208 bp upstream of the transcription start site, preferably from 33 bp upstream to 54 bp upstream, from 91 bp upstream to 112 bp upstream, or from 187 bp upstream to 208 bp upstream, with 1X copy of SRE;
[0037] (b2) replacing 51 bp to 241 bp of the portion of the endogenous polynucleotide upstream of the transcription start site of the endogenous polynucleotide with 2X copies of an SRE, preferably 61 bp to 241 bp of the portion of the endogenous polynucleotide upstream of the transcription start site of the endogenous polynucleotide, more preferably 61 bp to 78 bp, 187 bp to 241 bp, 173 bp to 241 bp, or 187 bp to 233 bp upstream of the transcription start site;
[0038] (b3) replacing 187 bp to 233 bp of the portion of the endogenous polynucleotide upstream of the transcription start site of the endogenous polynucleotide with 3X copies of an SRE.
[0039] In some embodiments, the genomic modification is a site-specific single- or double-strand break mediated by a polynucleotide-directed nuclease, a zinc finger nuclease, a transcription activator-like effector nuclease (TALEN), a polynucleotide-directed recombinase, or an engineered site-specific meganuclease or Argonaute protein, or a site-specific base editing mediated by a C·G to T·A or A·T to G·C base-editing deaminase.
[0040] In some embodiments, the genomic modification is made by a polynucleotide- directed Cas9 nuclease;
[0041] Optionally, the genomic modification is made by a prime editing system, preferably an ePPEplus prime editing system;
[0042] Optionally, the ePPEplus prime editing system comprises:
[0043] (a) a CRISPR nuclease and / or an expression construct containing a nucleotide sequence encoding the CRISPR nuclease, and a reverse transcriptase and / or an expression construct containing a nucleotide sequence encoding the reverse transcriptase, and
[0044] (b) a prime editing guide RNA (pegRNA) directed to a genomic target sequence and / or an expression construct containing a nucleotide sequence encoding the prime editing guide RNA;
[0045] Optionally, the CRISPR nuclease is a Cas9 nuclease or a variant thereof.
[0046] Preferably, the Cas9 nuclease variant is an nCas9 nuclease.
[0047] Preferably, the pegRNA comprises a backbone sequence as set forth in SEQ ID NO: 39.
[0048] A second aspect of the present disclosure provides a method of increasing expression of a polynucleotide encoding a polypeptide in a plant, the method comprising expressing the polynucleotide by operably linking the polynucleotide to an expression modulating element having at least one copy of at least one selected from the group consisting of SRE, ADSH2, ADSH3, ADSH6, ADSH8, ADSH12, RDSH1, RDSH3, GREGIONNTPRBIB, JERECRSTR, SV40, CaMV, MMV, FMV, OsFMV, CmYLCVR, and variants of the above elements, wherein the expression modulating element is heterologous to the polynucleotide,
[0049] and the expression modulating element is heterologous to a promoter that functions in a plant;
[0050] Optionally, one copy of the expression modulating element comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1, 6, 7, 10, 12, 16, 17, 19, 22, 23, 25-29, 31, 38;
[0051] Optionally, the polypeptide confers herbicide tolerance, insect resistance, disease resistance, and / or abiotic stress tolerance;
[0052] Optionally, wherein the plant is selected from the group consisting of rice, wheat, barley, sorghum, maize, cotton, sunflower, oilseed rape, oat, Arabidopsis thaliana, Phalaris arundinacea, Brachypodium distachyon, soybean, and tobacco.
[0053] In some embodiments, the expression modulating element is introduced by genome editing;
[0054] Optionally, the expression modulating element increases expression of a polynucleotide involved in architectural structure of a plant or maturation of a plant.
[0055] A third aspect of the present disclosure provides a recombinant DNA construct comprising at least one expression modulating element selected from the group consisting of SRE, ADSH2, ADSH3, ADSH6, ADSH8, ADSH12, RDSH1, RDSH3, GREGIONNTPRBIB, JERECRSTR, SV40, CaMV, MMV, FMV, OsFMV, CmYLCVR, and variants of the above elements operably linked to at least one heterologous nucleic acid sequence, wherein the expression modulating element comprises at least one copy of an expression modulating element in a regulatory region of a polynucleotide;
[0056] Optionally, one copy of the expression control element comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1, 6, 7, 10, 12, 16, 17, 19, 22, 23, 25-29, 31, 38;
[0057] Optionally, the copies are separated by a spacer sequence comprising 1 to 50 nucleotides.
[0058] In some embodiments, wherein the at least one heterologous nucleic acid sequence comprises a genetic sequence selected from the group consisting of: a reporter gene in a plant, a selection marker, a disease resistance gene, a herbicide resistance gene, an insect resistance gene; a gene involved in carbohydrate metabolism, a gene involved in fatty acid metabolism, a gene involved in amino acid metabolism, a gene involved in plant development, a gene involved in plant growth regulation, a gene involved in yield improvement, a gene involved in drought resistance, a gene involved in increasing nutrient use efficiency, a gene involved in cold resistance, a gene involved in heat resistance, and a gene involved in salt resistance.
[0059] A fourth aspect of the present disclosure provides a method of expressing a coding sequence or RNA in a plant, the method comprising expressing a recombinant DNA construct as described above, wherein the at least one heterologous sequence comprises a coding sequence or a coding functional RNA.
[0060] A fifth aspect of the present disclosure provides a method of increasing expression of a polynucleotide of interest in a plant, the method comprising expressing a heterologous sequence operably linked to at least one copy of an expression control element selected from at least one of SRE, ADSH2, ADSH3, ADSH6, ADSH8, ADSH12, RDSH1, RDSH3, GREGIONNTPRBIB, JERECRSTR, SV40, CaMV, MMV, FMV, OsFMV, CmYLCVR, and variants of the aforementioned elements;
[0061] Optionally, one copy of the expression control element comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1, 6, 7, 10, 12, 16, 17, 19, 22, 23, 25-29, 31, 38;
[0062] Optionally, the expression control element is heterologous to the polynucleotide;
[0063] Optionally, the expression control element is heterologous to a promoter that functions in a plant.
[0064] In some embodiments, the heterologous sequence confers an agronomic characteristic selected from the group consisting of herbicide tolerance, insect resistance, disease resistance, carbohydrate metabolism, fatty acid metabolism, amino acid metabolism, plant development, plant growth regulation, yield improvement, drought resistance, cold tolerance, heat tolerance, nutrient use efficiency, nitrogen use efficiency, and salt tolerance.
[0065] In some embodiments, the plant comprises a monocot or a dicot, preferably the plant is a crop, including monocot crop plants and / or dicot crop plants.
[0066] Optionally, the plant is selected from the group consisting of rice, wheat, barley, sorghum, maize, cotton, sunflower, oilseed rape, oats, Arabidopsis, Phalaris arundinacea, Brachiaria plantaginea, soybean, and tobacco.
[0067] A sixth aspect of the present disclosure provides a method of increasing expression of a nucleotide sequence of interest in a plant, the method comprising expressing a polynucleotide sequence operably linked to an expression regulatory element that functions in a plant cell, wherein the expression regulatory element comprises at least one copy of an expression regulatory element in a regulatory region of the polynucleotide;
[0068] Optionally, the expression regulatory element is selected from at least one of SRE, ADSH2, ADSH3, ADSH6, ADSH8, ADSH12, RDSH1, RDSH3, GREGIONNTPRBIB, JERECRSTR, SV40, CaMV, MMV, FMV, OsFMV, CmYLCVR, and variants of the aforementioned elements.
[0069] Optionally, the copy of the expression regulatory element comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, 6, 7, 10, 12, 16, 17, 19, 22, 23, 25-29, 31, 38.
[0070] Optionally, the copies are separated by a spacer sequence comprising 1 to 50 nucleotides.
[0071] Optionally, the 5'UTR is a plant sequence.
[0072] A seventh aspect of the present disclosure provides a method of increasing expression of an endogenous gene of a plant, the method comprising introducing an expression regulatory element of at least one selected from SRE, ADSH2, ADSH3, ADSH6, ADSH8, ADSH12, RDSH1, RDSH3, GREGIONNTPRBIB, JERECRSTR, SV40, CaMV, MMV, FMV, OsFMV, CmYLCVR, and variants of the above elements by genome editing, wherein the expression regulatory element is comprised in the regulatory region of the endogenous gene in at least one copy;
[0073] Optionally, one copy of the expression regulatory element comprises a nucleotide sequence selected from the group consisting of as set forth in SEQ ID NO: 1, 6, 7, 10, 12, 16, 17, 19, 22, 23, 25-29, 31, 38;
[0074] Optionally, the copies are separated by a spacer sequence comprising 1 to 50 nucleotides.
[0075] In some embodiments, the genome editing is performed by a polynucleotide-guided Cas9 nuclease;
[0076] Optionally, the genome editing is performed by a prime editing system, preferably an ePPEplus prime editing system;
[0077] Optionally, the ePPEplus prime editing system comprises:
[0078] (a) a CRISPR nuclease and / or an expression construct containing a nucleotide sequence encoding the CRISPR nuclease, and a reverse transcriptase and / or an expression construct containing a nucleotide sequence encoding the reverse transcriptase;
[0079] (b) a prime editing guide RNA (pegRNA) directed to a genomic target sequence and / or an expression construct containing a nucleotide sequence encoding the prime editing guide RNA;
[0080] Optionally, the CRISPR nuclease is a Cas9 nuclease or a variant thereof;
[0081] Preferably, the Cas9 nuclease variant is a nCas9 nuclease;
[0082] Preferably, the pegRNA comprises a backbone sequence as set forth in SEQ ID NO: 39;
[0083] Optionally, the expression regulatory element is operably linked to a promoter sequence and a 5’UTR.
[0084] In some embodiments, the endogenous gene has the following properties:
[0085] (a) increased yield;
[0086] (b) increased drought tolerance; and
[0087] (c) encoding a herbicide resistance polypeptide or an insect resistance polypeptide.
[0088] The eighth aspect of the present disclosure provides a plant cell of non-propagating material, wherein the plant cell is generated by the method of any one of the first, second, fourth, fifth, and sixth aspects.
[0089] The ninth aspect of the present disclosure provides a plant cell of non-propagating material, wherein the expression of an endogenous gene associated with an agronomic characteristic is increased in the engineered plant cell.
[0090] Optionally, the agronomic characteristic is selected from the group consisting of herbicide tolerance, insect resistance, disease resistance, carbohydrate metabolism, fatty acid metabolism, amino acid metabolism, plant development, plant growth regulation, yield improvement, drought tolerance, cold tolerance, heat tolerance, nutrient use efficiency, nitrogen use efficiency, and salt tolerance.
[0091] Preferably, the endogenous gene associated with herbicide tolerance comprises a HPPD gene and / or a HIS1 gene.
[0092] In some embodiments, the plant comprises a monocot or a dicot, preferably the plant is a crop, which comprises a monocot crop plant and / or a dicot crop plant.
[0093] Optionally, the plant is selected from the group consisting of rice, wheat, barley, sorghum, maize, cotton, sunflower, oilseed rape, oat, Arabidopsis, Phalaris arundinacea, Brachypodium distachyon, soybean, and tobacco.
[0094] Optionally, the plant is selected from the group consisting of rice or a variant thereof, and wheat or a variant thereof.
[0095] Effects of the invention
[0096] In some embodiments, the expression of the reporter gene LUC is significantly increased by using the regulatory element, especially the SRE; further, by replacing or inserting the region upstream or downstream of the transcription initiation site of the target gene with 1 copy of SRE, 2 copies of SRE, 3 copies of SRE, or a truncated SRE, the expression level of the target gene can be significantly increased.
[0097] In some embodiments, the expression of the plant's herbicide resistance performance is significantly increased by regulating the OsHPPD gene and / or OsHIS1 gene associated with the plant's herbicide resistance performance by SRE.
[0098] In some embodiments, the plant's herbicide resistance performance is significantly improved by regulating the TaHPPD gene related to the plant's herbicide resistance performance through SRE. BRIEF DESCRIPTION OF DRAWINGS
[0099] Figure 1 is a schematic diagram of a dual luciferase reporter system; wherein, 35Sp: CaMV 35S promoter; RNE: Renilla reniformis Luciferase (REN); LUC: Firefly Luciferase (LUC); Term: terminator; MCS: multiple cloning site (MCS); HPPDCoreP-5'UTR: core promoter region (180bp) and 5'UTR region of OsHPPD gene.
[0100] Figure 2 shows the effect of different regulatory elements on gene expression in a dual luciferase reporter system.
[0101] Figures 3a-3c show the effect of different numbers of SREs at different positions on the expression of the reporter gene.
[0102] Figure 4 shows the efficiency of guide editors in introducing a single SRE into the OsHPPD gene in rice protoplasts.
[0103] Figure 5 shows the phenotype of T0 generation rice mutants after being cultured in MS medium containing 0.15 μM or 0.45 μM of mesotrione for 30 days.
[0104] Figure 6 shows the RNA and protein expression levels of HPPD in rice WT and homozygous mutant WT-SRE+38 (RP), WT-SRE-57 (RP), WT-SRE+38 (+24), WT-SRE-57 (+23) plants, and the phenotype of the plants after being cultured in MS medium containing 0.45 μM of mesotrione for 7 days and then being cultured in Murashige and Skoog (MS) medium for 7 days.
[0105] Figure 7 shows the RNA and protein expression levels of HPPD in rice homozygous mutant G414A and 414A (Ho)-SRE+38 (RP) plants, and the phenotype of the plants after being cultured in MS medium containing 0.45 μM of mesotrione for 7 days.
[0106] Figure 8 shows the RNA and protein expression levels of HPPD in rice heterozygous mutant G417A (He) and double allele mutant 417A (He)-SRE+38 (+7 / +27) plants, and the phenotype of the plants after being cultured in MS medium containing 0.45 μM of mesotrione for 7 days.
[0107] Figure 9 shows the phenotype of the rice mutants in Figure 6-8 after spraying with 4 times the recommended field dose (692 g.a.i / ha) of Rynaxpyr for 30 days.
[0108] Figure 10 shows the effect of different numbers of SREs at different positions in the OsHIS1 promoter region on the expression of the reporter gene.
[0109] Figure 11 shows the efficiency of the guide editor in introducing 1-3 SREs in the OsHIS1 gene in rice protoplasts.
[0110] Figure 12 shows the phenotype of homozygous mutant plants WT-SRE+38 (RP), WT-SRE+38 (+34)_HIST2T3, WT-SRE-57 (+28) and WT-SRE-57 (+38)_HIST9T10 after spraying with 4 times the recommended field concentration (692 g.a.i / ha) of Rynaxpyr for 21 days.
[0111] Figure 13 shows the effect of different numbers of SREs at different positions in the TaHPPD-B1 promoter region on the expression of the reporter gene.
[0112] Figure 14 shows the phenotype of wild-type wheat and homozygous mutant wheat SRE-G407A after being cultured in MS medium containing 0.15 μΜ Rynaxpyr for 11 days.
[0113] Figure 15 is a map of the pH-ePPEplus vector. DETAILED DESCRIPTION
[0114] Various exemplary embodiments, features, and aspects of the present disclosure will be described in detail below. The word "exemplary" is used herein to mean "serving as an example, instance, or illustration." Any implementation described herein as "exemplary" is not necessarily to be construed as preferred or advantageous over other implementations.
[0115] In addition, in order to better illustrate the present disclosure, numerous specific details are given in the following detailed description. Those skilled in the art will understand that the present disclosure can be practiced without certain specific details. In other instances, well-known methods, means, instruments and steps have not been described in detail in order to highlight the principles of the present disclosure.
[0116] Unless otherwise specified, the units used in the present specification are international standard units, and the numerical values and numerical ranges appearing in the present disclosure should be understood to include systematic errors that are inevitable in industrial production.
[0117] In the present specification, the meaning of "may" includes both the meaning of performing a certain process and the meaning of not performing a certain process.
[0118] In this specification, references to "some embodiments", "other embodiments", "an embodiment", "embodiment", etc. mean that the particular feature, structure, property, characteristic, etc. being referred to can be included in at least one embodiment of the disclosure, and can or can not be present in other embodiments. In addition, it is to be understood that described features, structures, properties, etc. can be combined in any suitable manner in various embodiments.
[0119] In this specification, "optional" and "optionally" mean that the subsequently described event or circumstance can or can not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.
[0120] In this specification, a numerical range expressed using "numerical value A ~ numerical value B" means a range including the end point numerical values A, B.
[0121] In this specification, "contains", "has" or "includes" includes "comprises", "consists essentially of", "consists substantially of", and "consists of"; "consists essentially of", "consists substantially of", and "consists of" are sub-concepts of "contains", "has" or "includes".
[0122] Although the disclosed content supports the definition of the term "or" as only the alternative and "and / or", unless it is explicitly stated that it is only the alternative or mutually exclusive between alternatives, the term "or" in the claims means "and / or". In this specification, the term "and / or" when used to connect two or more alternatives should be understood to mean any of the alternatives or any two or more of the alternatives.
[0123] The terms "preferably", "preferred", and similar terms as used herein, do not necessarily imply that certain features are critical, essential, or even important to the structure or function of the claimed disclosure. Rather, these terms merely indicate that the alternative or additional features can or can not be used in a particular embodiment of the disclosure.
[0124] The terms "polynucleotide," "polynucleotide sequence," "nucleic acid sequence," "nucleic acid fragment," and "isolated nucleic acid fragment" are used interchangeably herein. These terms encompass nucleotide sequences and the like. A polynucleotide can be a polymer of RNA or DNA that is single- or double-stranded, that optionally contains synthetic, non-natural or altered nucleotide bases. A polynucleotide in the form of a DNA polymer can be comprised of one or more segments of cDNA, genomic DNA, synthetic DNA, or mixtures thereof. Nucleotides, often found in their 5'-monophosphate form, are referred to by their single letter designation as follows: "A" for adenylate or deoxyadenylate (for RNA or DNA, respectively), "C" for cytosine, "G" for guanylate or deoxyguanylate, "U" for uridylate, "T" for deoxythymidylate, "R" for purines (A or G), "Y" for pyrimidines (C or T), "K" for G or T, "H" for A or C or T, "I" for inosine, and "N" for any nucleotide.
[0125] As used herein, the term "expression control element" refers to a nucleotide sequence that is located upstream of (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence and which affects the transcription, RNA processing or stability, or translation of the associated coding sequence. A plant expression control element refers to a nucleotide sequence capable of controlling the transcription, RNA processing or stability, or translation of a nucleotide sequence of interest in a plant. Expression control elements can include, but are not limited to, promoters, translation leader sequences, introns, enhancers, and polyadenylation recognition sequences. In some embodiments of the disclosure, the expression control element comprises at least one of SRE or a truncation thereof, ADSH3, ADSH4, ADSH6, ADSH8, ADSH12, RDSH1, RDSH2, RDSH3, GREGIONNTPRBIB, CaMV, MMV, FMV, OsFMV, and CmYLCVR.
[0126] A regulatory element generally refers to a transcriptional regulatory element involved in the regulation of a nucleic acid molecule, e.g., a gene or a target gene. A regulatory element is a nucleic acid and can include a promoter, an enhancer, an intron, a 5'-untranslated region (5'-UTR, also known as a leader sequence), or a 3'-UTR, or a combination thereof. A regulatory element can act in "cis" or "trans," and typically acts in "cis," i.e., it activates expression of a gene located on the same nucleic acid molecule (e.g., chromosome) on which the regulatory element is located. The nucleic acid molecule regulated by a regulatory element does not necessarily have to encode a functional peptide or functional polypeptide, e.g., a regulatory element can regulate expression of a short interfering RNA or an antisense RNA.
[0127] An enhancer element is any nucleic acid molecule that can increase transcription of a nucleic acid molecule when functionally linked to a promoter, regardless of its relative position. Enhancers can be intrinsic elements of a promoter or heterologous elements inserted to enhance the level or tissue specificity of a promoter.
[0128] A "promoter" generally refers to a nucleic acid segment that is capable of controlling the transcription of another nucleic acid segment. A promoter generally includes a core promoter (also referred to as a minimal promoter) sequence that includes a minimal regulatory region to initiate transcription (i.e., the transcription start site). Typically, the core promoter includes a TATA box and a GC-rich region associated with a CAAT box or CCAAT box. These elements function to bind RNA polymerase II to the promoter and assist in positioning the polymerase at the RNA start site. Some promoters can not contain a TATA box or a CAAT box or CCAAT box, but can contain initiation elements for the transcription start site. The core promoter is the minimal sequence required to direct the initiation of transcription and generally does not include enhancers or other UTRs. A promoter can be derived entirely from a natural gene, or be composed of different elements derived from different promoters found in nature, or even contain synthetic DNA segments. One skilled in the art will appreciate that different promoters can direct expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. The core promoter is often modified to create an artificial, chimeric, or hybrid promoter, and can be further used in combination with other regulatory elements (e.g., cis elements, 5' UTRs, enhancers, or introns) that are heterologous to the active core promoter or combined with its own part or complete regulatory elements.
[0129] The term "cis element" generally refers to a transcriptional regulatory element that affects or modulates the expression of an operably linked transcribable polynucleotide, where the transcribable polynucleotide is present in the same DNA sequence. The cis element can function to bind a transcription factor that is a trans-acting polypeptide that modulates transcription.
[0130] A "promoter functional in a plant" is a promoter that is capable of initiating transcription in a plant cell, whether or not it is derived from a plant cell.
[0131] A "heterologous nucleotide sequence" generally refers to a sequence that does not naturally occur with the expression regulatory element of the disclosure. While such a nucleotide sequence is heterologous to the expression regulatory element sequence, it can be homologous or native, or heterologous or foreign, with respect to the plant host. However, it is recognized that the expression regulatory element can be used with its native coding sequence to increase or decrease expression leading to phenotypic changes in the seed resulting from transformation. The terms "heterologous nucleotide sequence," "heterologous sequence," "heterologous nucleic acid segment," and "heterologous nucleic acid sequence" are used interchangeably herein.
[0132] A "functional fragment" refers to a portion or subsequence of a sequence described in the present disclosure in which the ability to regulate gene expression is retained. Fragments can be obtained by methods such as site-directed mutagenesis and synthetic construction. As with the provided promoter sequences described herein, a functional fragment acts to promote expression of an operably linked heterologous nucleotide sequence, forming a recombinant DNA construct (also referred to as a chimeric gene). For example, a fragment can be used to design a recombinant DNA construct to produce a desired phenotype in a transformed plant. Recombinant DNA constructs can be designed for co-suppression or antisense by linking a promoter fragment in the appropriate orientation relative to the heterologous nucleotide sequence. A nucleic acid fragment that is functionally equivalent to an expression regulatory element of the present disclosure is any nucleic acid fragment that is capable of regulating the expression of a coding sequence or functional RNA in a manner similar to the expression regulatory element of the present disclosure.
[0133] A "gene" includes a nucleic acid fragment that expresses a functional molecule (for example, but not limited to, a specific protein), including regulatory sequences preceding (5' non-coding sequences) and following (3' non-coding sequences) the coding sequence. A "native gene" generally refers to a gene as found in nature with its own inherent regulatory sequences. It shall be understood that "genomic DNA" refers to a gene in the context of the chromosome where it is found in nature.
[0134] As used herein, "rice HIS1 gene" and "OsHIS1" are used interchangeably.
[0135] As used herein, "rice HPPD gene" and "OsHPPD" are used interchangeably.
[0136] As used herein, "wheat HPPD gene" and "TaHPPD" are used interchangeably.
[0137] A "coding sequence" generally refers to a polynucleotide sequence that codes for a specific amino acid sequence. A "regulatory sequence" refers to a nucleotide sequence leading to the transcription, RNA processing or stability, or translation of an associated coding sequence. Regulatory sequences can include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences.
[0138] A 5' untranslated region (5' UTR) (also known as a translation leader sequence or leader RNA) is the region of an mRNA that lies immediately upstream of the start codon. This region is involved in the regulation of translation of the transcript by different mechanisms in viruses, prokaryotes, and eukaryotes.
[0139] The terms "operably linked" or "functionally linked" generally refer to the association of nucleic acid sequences on a single nucleic acid fragment such that one nucleic acid fragment is influenced by another. For example, when a promoter is capable of influencing the expression of a coding sequence, it is operably linked to the coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter). A coding sequence can be operably linked to a regulatory sequence in the sense or antisense orientation.
[0140] In the present specification, the "Transcription Start Site" (TSS) is the position where RNA polymerase is located during the process of gene transcription. The position of the Transcription Start Site is uniquely determined, which is located at the 5' end of the gene, and is related to the transcription of the gene in the positive and negative directions. The Transcription Start Site is also referred to as the transcription initiation site, to be distinguished from the transcription termination site (TTS).
[0141] As used herein, the term "expression" generally refers to the production of a functional end product, e.g., mRNA or protein (precursor or mature).
[0142] As used herein, the term "expression cassette" generally refers to a discrete nucleic acid fragment into which a nucleic acid sequence or fragment can be cloned or synthesized by molecular biological techniques.
[0143] "RNA transcript" generally refers to the RNA polymerase catalyzed product resulting from the processing of a DNA sequence. When the RNA transcript is a perfect complementary copy of the DNA sequence, it is referred to as the primary transcript or it can be a RNA sequence derived from post-transcriptional processing of the primary transcript and is referred to as the mature RNA. "Messenger RNA" ("mRNA") generally refers to RNA that is without introns and can be translated into protein by the cell. "cDNA" generally refers to DNA that is complementary, and synthesized using reverse transcriptase, from an mRNA template. The cDNA can be single-stranded or converted to double-stranded using the Klenow fragment of DNA polymerase I. "Sense" RNA generally refers to RNA that includes the mRNA and thus can be translated into a protein in cells or in vitro. "Antisense RNA" generally refers to RNA that is complementary to all or part of a target primary transcript or mRNA and blocks the expression or transcript accumulation of the target gene. The antisense RNA can be complementary to any part of the specific gene transcript, i.e., 5' non-coding sequences, 3' non-coding sequences, introns, or coding sequences. "Functional RNA" generally refers to antisense RNA, ribozyme RNA, or other RNA that can not be translated but still has an effect on cellular processes.
[0144] In the present specification, the terms "polypeptide," "peptide," and "protein" are used interchangeably herein and refer to an amino acid polymer of any length. The polymer can be linear or branched, it can comprise modified amino acids, and it can be interrupted by non-amino acids. The term also encompasses an amino acid polymer that has been modified (e.g., by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component).
[0145] "Altering expression" or "modulating expression" generally refers to producing one or more gene products in a plant in an amount or ratio that is significantly different from the amount or ratio of the corresponding wild-type plant (i.e., expression is increased or decreased).
[0146] In the present specification, "expression products of a gene" refer to various forms of molecules at various stages of the gene, such as, but not limited to, molecules produced during amplification, replication, transcription, splicing, processing, translation, modification processes of the gene, such as cDNA, mRNA, precursor protein, mature protein, and fragments thereof.
[0147] "Genome" (when applied to a plant cell) encompasses not only chromosomal DNA found within the nucleus, but also organelle DNA found within subcellular components (e.g., mitochondria, plastids).
[0148] "Genetically modified" generally refers to a modification of any nucleic acid sequence or genetic element by genome editing or by insertion of a recombinant nucleic acid (e.g., as part of a vector or construct in any region of the plant genomic DNA) by insertion, deletion, or substitution of one or more nucleotides in an endogenous nucleotide sequence. Examples of modifications of genetic components include, but are not limited to, promoter regions, 5' non-coding leader sequences, introns, genes, 3' non-coding regions, and other regulatory sequences or sequences that affect transcription or translation of one or more nucleic acid sequences.
[0149] "Architectural structure of a plant" refers to the form and structure of a plant body that enables the plant to perform photosynthesis, reproduction, support its own weight, and adapt to the environment efficiently. Architectural structure of a plant includes growth pattern, branching type, leaf arrangement, root structure, stem directional growth, rhythmic growth, branching order, growth unit, plant-environment interaction, etc. Growth pattern: The growth pattern of a plant can be deterministic or indeterministic; deterministic growth means that a plant adds new structural parts in a certain order and at certain times during its life cycle, while indeterministic growth allows a plant to add new structural parts at any point in its life cycle. Branching structure: The branching structure of a plant can be monopodial or sympodial; monopodial branching refers to a plant having only one main stem, while sympodial branching can have multiple main stems growing from the base or leaf axils. Leaf arrangement: The arrangement of leaves on a stem is crucial for the photosynthetic efficiency of a plant. Leaves can be arranged in a spiral pattern to maximize light capture, or in a specific pattern such as opposite or whorled. Root structure: The root structure of a plant plays an important role in supporting the plant, absorbing water and nutrients; the root system can be shallow, mainly distributed in the surface layer of soil, or deep, with a main root penetrating deep into the soil. Stem directional growth: The directional growth of a plant stem can be upright, climbing, or prostrate, depending on the species of the plant and the growth environment. Rhythmic growth: The growth of some plants is rhythmic, i.e., the apical meristem stops growing and is located in the bud during a certain growth period, while it continues to grow at other times. Branching order: The branching of a plant can be lateral (axillary) or terminal; branching order is rapidly increased in sympodial units, while it reflects branching order in monopodial units. Growth unit: The growth unit of a plant (such as a branch, leaf, and bud) can be repeated in a certain pattern, forming the architectural characteristics of the plant. Plant-environment interaction: The architectural structure of a plant not only affects its own physiological functions, but also affects its interaction with the environment, including photosynthesis, transpiration, and adaptation to environmental factors such as wind and rain.
[0150] In this specification, the term "sequence identity" or "percent identity" in comparison between two nucleic acids or polypeptides means that they are identical or have the same sequence-specific percentage when compared and aligned for maximum correspondence using a nucleotide or amino acid residue sequence comparison algorithm or by visual inspection. That is, the identity of nucleotide or amino acid sequences can be defined using the proportion of nucleotides or amino acids that are identical when two or more nucleotide or amino acid sequences are aligned for maximum correspondence with the addition of gaps as necessary. The proportion of nucleotides or amino acids that are identical in the aligned portion in the total number of nucleotides or amino acids in the aligned portion.
[0151] Methods to determine "sequence identity" or "percentage of identity" contemplated by the present disclosure include, but are not limited to: Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Sequence Analysis Primer, Gribskov, M., and Devereux, J., eds., M Stockton Press, New York, 1991; and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48:1073 (1988). Preferred methods to determine identity are those that give the largest match between the sequences tested. Methods to determine identity are codified in computer programs. Preferred computer program methods to determine identity between two sequences include, but are not limited to: the GCG program package (Devereux, J. et al., 1984), BLASTP, BLASTN, and FASTA (Altschul, S, F. et al., 1990). The BLASTX program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al., NCBI NLM NIH Bethesda, Md. 20894; Altschul, S. et al., 1990). The well-known Smith Waterman algorithm can also be used to determine identity.
[0152] As used herein, the term "very high stringency conditions" refers to prehybridization and hybridization at 42°C in 5X SSPE (saline sodium phosphate EDTA), 0.3% SDS, 200 micrograms / ml sheared and denatured salmon sperm DNA, and 50% formamide, followed by three washes at 70°C with 6X SSC, 0.2% SDS for 15 min each, for probes of at least 100 nucleotides long.
[0153] The genes of interest reflect the commercial market and interest in those genes involved in crop development. As knowledge of agronomic characteristics and traits (e.g., yield and heterosis) increases, the selection of genes for transformation will change accordingly. General categories of genes of interest include, but are not limited to, those involved in information transfer (e.g., zinc fingers), those involved in communication (e.g., kinases), and those involved in housekeeping (e.g., heat shock proteins). More specific categories include, but are not limited to, genes encoding traits important for agronomy, insect resistance, disease resistance, herbicide resistance, sterility, grain or seed characteristics, and commercial products. Genes of interest often include those involved in oil, starch, carbohydrate, or nutrient metabolism, as well as genes affecting seed size, plant development, plant growth regulation, and yield improvement. Plant development and growth regulation also refers to the development and growth regulation of various parts of the plant, such as flowers, seeds, roots, leaves, and shoots. Other commercially desirable traits are genes and proteins that confer cold, heat, salt, and drought tolerance.
[0154] Disease and / or insect resistance genes can encode resistance to pests with high yield inhibiting (e.g., like Northern Corn Leaf Blight, Head Smut, Anthracnose, Soybean Mosaic Virus, Soybean Cyst Nematode, Root Knot Nematode, Brown Spot Leaf Disease, Downy Mildew, Purple Stalk, Seed Rot, and Seedling Disease generally caused by fungal - Pythium species, Phytophthora species, Rhizoctonia species, Diaporthe species. Bacterial blight is caused by Pseudomonas syringae pv. Glycinea. Genes conferring insect resistance include, for example, Bacillus thuringiensis toxic protein genes (U.S. Patent Nos. 5,366,892; 5,747,450; 5,737,514; 5,723,756; 5,593,881; and Geiser et al. (1986) Gene 48:109); lectins (Van Damme et al. (1994) Plant Mol. Biol. 24:825); and the like.
[0155] As used herein, the term "plant" includes whole plants, and any descendant, plant cell, tissue, or part. The term "plant part" includes any part of a plant, including, for example and without limitation: seeds (including mature seeds, immature embryos without seed coats, and immature seeds); plant cuttings; plant cells; plant cell cultures; plant organs (for example, pollen, embryos, flowers, fruits, shoots, leaves, roots, stems, and related explants). A plant tissue or plant organ can be a seed, callus, or any other mass of plant cells that is organized into a structure or functional unit. A plant cell or tissue culture is capable of regenerating plants having the physiological and morphological characteristics of the plant from which the cell or tissue was obtained, and of regenerating plants having essentially the same genotype as the plant from which the cell or tissue was obtained. In contrast, some plant cells are not capable of regenerating a whole plant. Regenerable cells in a plant cell or tissue culture can be embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, roots, root tips, silk, flowers, kernels, ears, cobs, husks, or stalks.
[0156] As used herein, the term "engineered plant" includes a plant that comprises an exogenous polynucleotide or comprises a modified gene or expression regulatory sequence within its genome. The exogenous polynucleotide can be stably integrated into the genome and inherited through successive generations, for example. The exogenous polynucleotide can be integrated into the genome individually or as part of a recombinant DNA construct. The modified gene or expression regulatory sequence is one in which the sequence comprises single or multiple deoxynucleotide substitutions, deletions, and additions in the plant genome.
[0157] As used herein, "g a.i. / ha" or "g ai / ha" means grams of active ingredient per hectare. 1 As used herein, "g a.i. / ha" or "g ai / ha" means grams of active ingredient per hectare. 1 As used herein, "g a.i. / ha" or "g ai / ha" means grams of active ingredient per hectare.
[0158] The technical solutions of the present disclosure are described in detail as follows:
[0159] Method of increasing expression of an endogenous polynucleotide in a plant cell
[0160] To increase the expression of an endogenous polynucleotide in a plant cell, the inventors attempted to modify the core promoter region (180 bp) and the 5' UTR region of the polynucleotide of interest using expression regulatory elements, which modification included inserting expression regulatory elements into the core promoter region and the 5' UTR region or directly replacing part of the sequence of the core promoter region and the 5' UTR region with expression regulatory elements. After suitable expression regulatory elements were screened, the range of modification was expanded to the core promoter region (1000 bp) and the 5' UTR region of the gene of interest, and the key region and modification method that could increase the expression of the polynucleotide were screened.
[0161] Based on this, the first aspect of the present disclosure provides a method for increasing the expression of an endogenous polynucleotide in a plant cell, the method comprising:
[0162] altering one or more nucleotides in the regulatory region of the endogenous polynucleotide such that the regulatory region of the endogenous polynucleotide comprises one or more expression regulatory elements, the expression regulatory elements comprising at least one copy of the expression regulatory element in the regulatory region of the endogenous polynucleotide.
[0163] In some embodiments, the regulatory region includes the non-coding region at the 5' end of the endogenous nucleotide, further, the non-coding region at the 5' end includes the promoter region and the 5' UTR region.
[0164] In some embodiments, the expression regulatory element is selected from at least one of SRE, ADSH2, ADSH3, ADSH6, ADSH8, ADSH12, RDSH1, RDSH3, GREGIONNTPRBIB, JERECRSTR, SV40, CaMV, MMV, FMV, OsFMV, CmYLCVR, and variants of the above elements; preferably, the expression regulatory element is selected from at least one of ADSH3, ADSH6, RDSH1, CaMV, FMV, and SRE or variants thereof, more preferably SRE or variants thereof.
[0165] In some embodiments, the sequence of ADSH2, ADSH3, ADSH6, ADSH8, ADSH12, RDSH1, RDSH3, GREGIONNTPRBIB, JERECRSTR, SV40, CaMV, MMV, FMV, OsFMV, and CmYLCVR is set forth in SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, respectively.
[0166] In some alternative embodiments, the expression regulatory element comprises an SRE or a variant thereof, further, the SRE or a variant thereof comprises at least 1 copy of an SRE or a truncation thereof, preferably comprises 1 copy of an SRE, or 2 or 3 copies of an SRE. In some specific embodiments, the SRE comprises a sequence set forth in SEQ ID NO: 1; the SRE truncation is truncated by at least one, at least two, or at least three bases at the 5' end and / or 3' end of the SRE. Illustratively, the SRE truncation comprises a sequence set forth in SEQ ID NO: 38. In some embodiments, the expression regulatory element can have one or more copies of the same sequence arranged in a head-to-head, tail-to-head, or head-to-tail, or a combination thereof configuration. The copies are separated by a spacer sequence comprising 1 to 50 nucleotides. Illustratively, the 2 copies of SRE comprises a sequence set forth in SEQ ID NO: 2, the 3 copies of SRE comprises a sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 4.
[0167] In some embodiments, the expression regulatory element is heterologous to the endogenous polynucleotide. In some optional embodiments, the expression regulatory element is created in the genome of the plant cell by altering no more than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 of the regulatory regions of the endogenous polynucleotide.
[0168] In some embodiments, the regulatory region is created by altering no more than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 27, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, or 69 nucleotides in the regulatory region of the endogenous polynucleotide when one or more copies of the expression regulatory element is present. In some particular embodiments, the expression regulatory element is located upstream or downstream of the transcription start site of the endogenous polynucleotide. In some particular embodiments, the expression regulatory element is inserted (e.g., replaced) into the regulatory region of the endogenous polynucleotide such that the expression regulatory element is operably linked to the endogenous polynucleotide. In some particular embodiments, the expression of the endogenous polynucleotide in the plant cell is increased compared to a control plant cell that does not comprise the expression regulatory element operably linked to the endogenous polynucleotide.
[0169] In some particular embodiments, the expression regulatory element is present within 0 to 1000 bp from the transcription start site of the endogenous polynucleotide or 1000 bp upstream of the core promoter region, e.g., 50 to 110 bp, 30 to 235 bp, 130 to 405 bp, 61 to 78 bp, 173 to 233 bp, 187 to 233 bp, 38 to 59 bp, 35 to 56 bp, 57 to 78 bp, 111 to 132 bp, 33-241 bp, 79-100 bp, 134-403 bp, preferably 33-241, 134-403 bp, and / or 33 to 233 bp; more preferably within 54 to 233 bp from the transcription start site.
[0170] In some more particular embodiments, the method comprises:
[0171] (i) inserting an expression regulatory element upstream or downstream of the transcription start site of the endogenous polynucleotide; and / or
[0172] (ii) replacing a portion of the segment upstream or downstream of the transcription start site of the endogenous polynucleotide with an expression regulatory element.
[0173] The portion of the segment can or can not be the same length as the expression regulatory element. The portion of the segment can be longer than, the same length as, or shorter than the expression regulatory element.
[0174] In one embodiment, for the methods utilizing the expression modulating elements and compositions comprising expression modulating elements, suitable plant cells include plant cells from monocots and dicots (e.g., such as, rice, wheat, barley, sorghum, maize, cotton, sunflower, canola, oat, Arabidopsis, Phalaris, Brachiaria, soybean, and tobacco). In one embodiment, the endogenous polynucleotide is involved in drought tolerance, disease resistance, herbicide tolerance, pest resistance, yield increase, yield stability, nitrogen use efficiency, or a combination thereof.
[0175] In some exemplary embodiments, the endogenous polynucleotide is involved in herbicide tolerance, e.g., the endogenous polynucleotide is derived from a rice HPPD gene. In turn, the methods include at least one of (a1)-(a3):
[0176] (a1) replacing a portion of the endogenous polynucleotide from 244 bp upstream to 59 bp downstream of the transcription start site, preferably from 100 bp upstream to 59 bp downstream of the transcription start site, more preferably from 38 bp downstream to 59 bp downstream of the transcription start site, from 35 bp upstream to 56 bp upstream of the transcription start site, or from 111 bp upstream to 132 bp upstream of the transcription start site, with 1X copy of SRE;
[0177] (a2) replacing a portion of the endogenous polynucleotide from 134 bp upstream to 403 bp upstream of the transcription start site, preferably from 343 bp upstream to 403 bp upstream, from 343 bp upstream to 391 bp upstream, from 335 bp upstream to 391 bp upstream, from 335 bp upstream to 363 bp upstream, from 278 bp upstream to 306 bp upstream, from 154 bp upstream to 184 bp upstream, or from 134 bp upstream to 184 bp upstream, with 2X copy of SRE;
[0178] (a3) inserting 3X copy of SRE between 180 bp and 181 bp upstream of the transcription start site or upstream of the 1000 bp core sequence of the promoter.
[0179] In some embodiments, the expression of the endogenous polynucleotide derived from a rice HPPD gene can be significantly increased, e.g., by 3-fold or more, e.g., about 3-fold, about 5-fold, about 8-fold, about 10-fold, about 12-fold, about 14-fold, about 15-fold, about 20-fold, 25-fold, about 50-fold, about 60-fold, about 70-fold, about 80-fold, about 90-fold, 100-fold, about 110-fold, about 120-fold, about 130-fold, about 140-fold, by the replacement or insertion described above.
[0180] In other exemplary embodiments, the endogenous polynucleotide is involved in herbicide tolerance, e.g., the endogenous polynucleotide is derived from a rice HIS1 gene. In some embodiments, the methods include at least one of (b1)-(b3):
[0181] (b1) replacing a portion of 33bp to 208bp upstream of the transcription initiation site of the endogenous polynucleotide, preferably 33bp to 54bp, 91bp to 112bp or 187bp to 208bp upstream of the transcription initiation site, with 1X copy of SRE;
[0182] (b2) replacing a portion of 51bp to 241bp upstream of the transcription initiation site of the endogenous polynucleotide, preferably 61bp to 241bp upstream of the transcription initiation site of the endogenous polynucleotide, more preferably 61bp to 78bp, 187bp to 241bp, 173bp to 241bp or 187bp to 233bp upstream of the transcription initiation site, with 2X copy of SRE;
[0183] (b3) replacing a portion of 187bp to 233bp upstream of the transcription initiation site of the endogenous polynucleotide, with 3X copy of SRE.
[0184] By the above-mentioned replacement or insertion, the expression level of the endogenous polynucleotide derived from the rice HIS1 gene can be enhanced at different levels, for example, about 1-fold, about 2-fold, about 3-fold, about 5-fold, about 8-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold.
[0185] In other exemplary embodiments, the endogenous polynucleotide is involved in herbicide tolerance, for example, the endogenous polynucleotide is derived from the wheat HIS1 gene. In some embodiments, the method comprises at least one of (c1) to (c2):
[0186] (c1) replacing a portion of 106bp to 240bp upstream of the transcription initiation site of the endogenous polynucleotide, preferably 106bp to 127bp, 158bp to 179bp or 219bp to 240bp upstream of the transcription initiation site, with 1X copy of SRE;
[0187] (c2) replacing a portion of 106bp to 240bp upstream of the transcription initiation site of the endogenous polynucleotide, preferably 106bp to 127bp, 158bp to 179bp or 219bp to 240bp upstream of the transcription initiation site, with 2X copy of SRE.
[0188] In one embodiment, for the methods involving the use of expression regulatory elements and compositions comprising expression regulatory elements wherein a genomic modification is involved, suitable technologies include: a polynucleotide-directed nuclease, a zinc finger nuclease, a transcription activator-like effector nuclease (TALEN), a polynucleotide-directed recombinase, or an engineered site-specific meganuclease or Argonaute-mediated site-specific single- or double-strand break; or a C·G to T·A or A·T to G·C base-editing deaminase-mediated site-specific base editing. Preferably, the genomic modification is achieved by a gene editing system, which is a CRISPR-based gene editing system.
[0189] Further, the gene editing system can be a prime editing system, which includes a fusion of a CRISPR nuclease, i.e. Cas nuclease or its variant (e.g. Cas9-H840A or Cas9-D10A), with a reverse transcriptase (e.g. M-MLV reverse transcriptase) (prime editing fusion protein) and a prime editing guide RNA (pegRNA) directed to the target sequence with a repair template (RT template, RTT) and a primer binding site (PBS) for a free single strand at the 3’ end. The system binds the free single strand produced by the Cas nuclease or its variant (e.g. Cas9-H840A or Cas9-D10A) at the PBS and transcribes a single-stranded DNA sequence according to the given RTT, which can be repaired in the cell to achieve any change in the DNA sequence located downstream of the PAM sequence-3’, e.g. can be used to make changes to the target genomic site, including base substitution, insertion and deletion.
[0190] In some preferred embodiments, the prime editing system is an ePPEplus prime editing system, which is disclosed in Ni, P., Zhao, Y., Zhou, X. et al. Efficient and versatile multiplex prime editing in hexaploid wheat. Genome Biol 24, 156 (2023).
[0191] The pegRNA expression vector is used to target the desired region and is mediated by ePPEplus containing Cas nuclease and reverse transcriptase to achieve editing upstream and downstream of the transcription start site. In some embodiments, the ePPEplus vector expressing Cas nuclease and reverse transcriptase is disclosed on the Addgene website, with vector number Plasmid #205241, and the pegRNA contains a backbone sequence as shown in SEQ ID NO: 39.
[0192] <Method of increasing expression of a polynucleotide encoding a polypeptide in a plant>
[0193] In some embodiments, the method comprises expressing the polynucleotide by operably linking the polynucleotide to at least one copy of an expression regulatory element recited in the preceding <Method of increasing expression of an endogenous polynucleotide in a plant cell>, for example, an expression regulatory element selected from the group consisting of SEQ ID NOs: 1-4, 6, 7, 10, 12, 16, 17, 19, 22, 23, 25-29, 31, 38, preferably from the group consisting of SEQ ID NOs: 1-4, 38; wherein the expression regulatory element is heterologous to the polynucleotide and the expression regulatory element is heterologous to the promoter that functions in a plant.
[0194] In some embodiments, the polypeptide operably linked to one or more expression regulatory elements confers herbicide tolerance, insect resistance, disease resistance, abiotic stress tolerance, yield stability, yield increase, and combinations thereof. In one embodiment, the expression regulatory element increases or decreases expression of a polynucleotide involved in plant architectural structure or plant maturation.
[0195] <Recombinant DNA construct>
[0196] In some embodiments, a recombinant DNA construct is provided comprising a polynucleotide sequence comprising an expression regulatory element recited in the preceding <Method of increasing expression of an endogenous polynucleotide in a plant cell>, for example, any of the sequences listed in SEQ ID NOs: 1-4, 6, 7, 10, 12, 16, 17, 19, 22, 23, 25-29, 31, 38, preferably any of the sequences listed in SEQ ID NOs: 1-4, 38, operably linked to at least one heterologous nucleic acid sequence.
[0197] In some embodiments, a plant cell is provided, the plant cell comprising an expression regulatory element selected from the group consisting of SEQ ID NOs: 1-4, 6, 7, 10, 12, 16, 17, 19, 22, 23, 25-29, 31, 38, wherein the expression regulatory element is operably linked to a heterologous polynucleotide that encodes a polypeptide. In other embodiments, a cell comprising a recombinant DNA construct comprising one or more expression regulatory elements described herein; in one embodiment, the cell is a plant cell; a bacterial cell (e.g., Agrobacterium). In one embodiment, a plant that has stably incorporated such a recombinant construct into its genome. In one embodiment, a seed comprising such a recombinant DNA construct.
[0198] In some embodiments, a recombinant DNA construct comprising one or more expression regulatory elements described herein is operably linked to at least one heterologous nucleic acid sequence comprising a genetic sequence selected from the group consisting of: a reporter gene in a plant, a selection marker, a disease resistance gene, a herbicide resistance gene, an insect resistance gene; a gene involved in carbohydrate metabolism, a gene involved in fatty acid metabolism, a gene involved in amino acid metabolism, a gene involved in plant development, a gene involved in plant growth regulation, a gene involved in yield improvement, a gene involved in drought resistance, a gene involved in increasing nutrient use efficiency, a gene involved in cold resistance, a gene involved in heat resistance, and a gene involved in salt resistance.
[0199] <Methods of expressing a coding sequence or RNA in a plant>
[0200] In some embodiments, the method comprises expressing a recombinant DNA construct having one or more expression regulatory elements recited in the foregoing <Methods of increasing expression of an endogenous polynucleotide in a plant cell>, wherein the at least one heterologous sequence comprises a coding sequence or encodes a functional RNA.
[0201] <Methods of regulating expression of a nucleotide sequence of interest in a plant>
[0202] In some embodiments, the method comprises expressing a heterologous sequence operably linked to an expression control element sequence as described in the preceding <Method of increasing expression of an endogenous polynucleotide in a plant cell>, for example a sequence selected from the group consisting of SEQ ID NOs: 1-4, 6, 7, 10, 12, 16, 17, 19, 22, 23, 25-29, 31, 38, preferably from the group consisting of SEQ ID NOs: 1-4, 38. In one embodiment, the heterologous sequence confers an agronomic trait selected from the group consisting of disease resistance, herbicide resistance, insect resistance, carbohydrate metabolism, fatty acid metabolism, amino acid metabolism, plant development, plant growth regulation, yield improvement, drought resistance, cold resistance, heat resistance, nutrient use efficiency, nitrogen use efficiency, and salt resistance.
[0203] <Method of modulating expression of a nucleotide sequence of interest in a plant>
[0204] In some embodiments, the method comprises expressing a polynucleotide sequence operably linked to a heterologous expression control element having at least 95% identity to an expression control element as described in the preceding <Method of increasing expression of an endogenous polynucleotide in a plant cell>, for example a sequence selected from the group consisting of SEQ ID NOs: 1-4, 6, 7, 10, 12, 16, 17, 19, 22, 23, 25-29, 31, 38, preferably from the group consisting of SEQ ID NOs: 1-4, 38, with a 5' UTR functional in a plant cell. Preferably, the heterologous expression control element is selected from the group consisting of SEQ ID NOs: 1-4, 38.
[0205] <Plant stably transformed with a recombinant DNA construct>
[0206] In some embodiments, the recombinant DNA construct comprises an expression control element as described in the preceding <Method of increasing expression of an endogenous polynucleotide in a plant cell>, for example an expression control element selected from the group consisting of SEQ ID NOs: 1-4, 6, 7, 10, 12, 16, 17, 19, 22, 23, 25-29, 31, 38, or a sequence having at least 95% identity to any one of SEQ ID NOs: 1-4, 6, 7, 10, 12, 16, 17, 19, 22, 23, 25-29, 31, 38, wherein the plant comprises the expression control element operably linked to a heterologous nucleic acid in the genome of the plant, wherein the expression control element modulates expression of the heterologous nucleic acid.
[0207] In some preferred embodiments, the recombinant DNA construct comprises an expression modulating element selected from the group consisting of SEQ ID NOs: 1-4, 38, or a sequence having at least 95% identity to any one of SEQ ID NOs: 1-4, 38.
[0208] <Methods of modifying expression of an endogenous gene in a plant>
[0209] In some embodiments, the method comprises introducing an expression modulating element as recited in the preceding <Methods of increasing expression of an endogenous polynucleotide in a plant cell> such as an expression modulating element selected from the group consisting of SEQ ID NOs: 1-4, 6, 7, 10, 12, 16, 17, 19, 22, 23, 25-29, 31, 38, or a sequence having at least 95% identity to one of SEQ ID NOs: 1-4, 6, 7, 10, 12, 16, 17, 19, 22, 23, 25-29, 31, 38, such that the introduced expression modulating element is operably linked to modify expression of the endogenous gene.
[0210] In some preferred embodiments, the method comprises introducing an expression modulating element selected from the group consisting of SEQ ID NOs: 1-4, 38, or a sequence having at least 95% identity to any one of SEQ ID NOs: 1-4, 38.
[0211] In some embodiments, the method of modifying expression of an endogenous gene in a plant comprises increasing expression of an endogenous gene.
[0212] In some embodiments, the endogenous gene of the plant is associated with or encodes a polypeptide associated with an agronomic characteristic.
[0213] The agronomic characteristic is selected from the group consisting of herbicide tolerance, insect resistance, disease resistance, carbohydrate metabolism, fatty acid metabolism, amino acid metabolism, plant development, plant growth regulation, yield improvement, drought resistance, cold tolerance, heat tolerance, nutrient use efficiency, nitrogen use efficiency, and salt tolerance, etc.
[0214] In some alternative embodiments, the gene associated with herbicide tolerance comprises a HPPD gene and / or a HIS1 gene. In some exemplary embodiments, the herbicide tolerance of a plant is improved by increasing expression of a plant HPPD gene and / or a HIS1 gene.
[0215] In some specific embodiments, the method comprises:
[0216] (I) inserting an expression modulating element upstream or downstream of a transcription start site of a HPPD gene or a HIS1 gene; and / or
[0217] (II) replacing the expression regulatory element with a portion of the HPPD gene or the HIS1 gene upstream or downstream of the transcription start site.
[0218] In some embodiments, the HPPD gene or the HIS1 gene upstream of the transcription start site comprises 1000 bp upstream of the transcription start site and the HPPD gene or the HIS1 gene downstream of the transcription start site comprises 100 bp downstream of the transcription start site. Preferably, the HPPD gene or the HIS1 gene upstream of the transcription start site comprises 450 bp upstream of the transcription start site and the HPPD gene or the HIS1 gene downstream of the transcription start site comprises 60 bp downstream of the transcription start site.
[0219] In other embodiments, the HPPD gene upstream of the transcription start site comprises 1000 bp upstream of the transcription start site. Preferably, the HPPD gene upstream of the transcription start site comprises 240 bp upstream of the transcription start site, more preferably, the HPPD gene upstream of the transcription start site comprises 106 bp to 240 bp upstream of the transcription start site, more preferably, the HPPD gene upstream of the transcription start site comprises 106 bp to 127 bp, 158 bp to 179 bp, or 219 bp to 240 bp upstream of the transcription start site.
[0220] In some embodiments, the herbicide comprises an HPPD-inhibiting herbicide.
[0221] In some embodiments, the HPPD-inhibiting herbicide comprises, but is not limited to, pyrazoles, triketones, isoxazoles, diketonitriles, and diphonones, or any combination thereof.
[0222] In some embodiments, the HPPD-inhibiting herbicide comprises a triketone.
[0223] Suitable pyrazole compounds include, but are not limited to, benzofluor, pyrasulfotole, sulfentrazone, etc. Suitable triketone compounds include, but are not limited to, sulcotrione, mesotrione, tefuryltrione, tembotrione, bicyclopyrone, benzobicylonone, etc. Suitable isoxazole compounds include, but are not limited to, isoxaflutole. Suitable diketonitrile compounds include, but are not limited to, 2-cyano-3-cyclopropyl-1-(2-methylsulfonyl-4- trifluoromethylphenyl)-propane-1,3-dione and 2-cyano-1-[4-(methylsulfonyl)-2- trifluoromethylphenyl]-3-(1-methylcyclopropyl)propane-1,3-dione.
[0224] In some embodiments, the plant can be a plant susceptible to HPPD inhibitors, including monocot or dicot plants, preferably the plant is a crop, including monocot crop plants and / or dicot crop plants.
[0225] In some optional embodiments, the plant is selected from the group consisting of rice, wheat, barley, sorghum, maize, cotton, sunflower, oilseed rape, oat, Arabidopsis, Phalaris arundinacea, Brachiaria plantaginea, soybean and tobacco.
[0226] In some optional embodiments, the plant is selected from the group consisting of rice or variants thereof. Illustratively, the rice is Kitaake rice or is a Kitaake rice OsHPPD protein mutant, the Kitaake rice OsHPPD protein mutant is G414A Homo (homozygous mutant), G417A Homo (homozygous mutant) and G417A Heter (heterozygous mutant).
[0227] In some embodiments, the method comprises at least one of (A1)-(A3):
[0228] (A1) replacing or inserting a 1X copy of SRE between 38bp and 59bp downstream of the transcription start site of the HPPD gene;
[0229] (A2) replacing or inserting a 1X copy of SRE between 57bp and 78bp upstream of the transcription start site of the HPPD gene;
[0230] (A3) replacing a 1X copy of SRE between 35bp and 56bp upstream of the transcription start site of the HPPD gene;
[0231] (A4) inserting a 1X copy of SRE between 111bp and 132bp upstream of the transcription start site of the HPPD gene;
[0232] Preferably (A1) replacing or inserting a 1X copy of SRE between 38bp and 59bp downstream of the transcription start site of the HPPD gene; and / or,
[0233] Preferably (A2) replacing or inserting a 1X copy of SRE between 57bp and 78bp upstream of the transcription start site of the HPPD gene; and / or,
[0234] Preferably (A3) replacing a 1X copy of SRE between 35bp and 56bp upstream of the transcription start site of the HPPD gene.
[0235] In some specific embodiments, in the Kitaake rice or OsHPPD protein mutant of Kitaake rice, 1X copy SRE is replaced or inserted 38bp-59bp downstream of the transcription start site of the HPPD gene; illustratively, the modified non-coding region comprises a sequence as set forth in any one of SEQ ID NOs: 56-59, 67-82.
[0236] In some specific embodiments, in the Kitaake rice or OsHPPD protein mutant of Kitaake rice, 1X copy SRE is replaced or inserted 57bp-78bp downstream of the transcription start site of the HPPD gene; illustratively, the modified non-coding region comprises a sequence as set forth in any one of SEQ ID NOs: 61-65, SEQ ID NOs: 84-98.
[0237] In some preferred embodiments, the modified non-coding region of the HPPD gene comprises a sequence as set forth in any one of SEQ ID NOs: 67, 68, 84, 87.
[0238] In some embodiments, the method comprises at least one of (B1)-(B4):
[0239] (B1) replacing or inserting 1X copy SRE 187bp to 233bp upstream of the transcription start site of the HIS1 gene;
[0240] (B2) replacing or inserting 2X copy SRE 173bp to 233bp upstream of the transcription start site of the HIS1 gene;
[0241] (B3) replacing or inserting 2X copy SRE 61bp to 78bp upstream of the transcription start site of the HIS1 gene;
[0242] (B4) replacing or inserting 3X copy SRE 187bp to 233bp upstream of the transcription start site of the HIS1 gene;
[0243] Preferably, (B4) replaces 3X copy SRE 187bp to 233bp upstream of the transcription start site of the HIS1 gene.
[0244] In some specific embodiments, in the Kitaake rice or the OsHPPD protein mutant of Kitaake rice, 1X copy SRE is replaced or inserted 38bp-59bp downstream of the transcription start site of the HPPD gene, 1X copy SRE is replaced or inserted 187bp to 233bp upstream of the transcription start site of the HIS1 gene; exemplarily, the non-coding region of the reformed HPPD gene comprises a sequence as set forth in SEQ ID NO: 101, and the non-coding region of the reformed HIS1 gene comprises a sequence as set forth in SEQ ID NO: 106.
[0245] In some specific embodiments, in the Kitaake rice or the OsHPPD protein mutant of Kitaake rice, 1X copy SRE is replaced or inserted 57bp-78bp upstream of the transcription start site of the HPPD gene, 2X copy SRE is replaced or inserted 61bp to 78bp upstream of the transcription start site of the HIS1 gene; exemplarily, the non-coding region of the reformed HPPD gene comprises a sequence as set forth in SEQ ID NO: 104, and the non-coding region of the reformed HIS1 gene comprises a sequence as set forth in SEQ ID NO: 108.
[0246] In some alternative embodiments, the plant is selected from wheat or variants thereof. Exemplarily, the wheat is Kenmore 199 wheat or is a TaHPPD protein mutant of Kenmore 199 wheat (especially a mutant of the protein encoded by the TaHPPD gene in the B genome of Kenmore 199 wheat), and the TaHPPD protein mutant of Kenmore 199 wheat is G407A Homo (homozygous mutant); the G407A is homologous to the G417A site in rice OsHPPD, and exemplarily, the TaHPPD coding region of the G407A Homo comprises a sequence as set forth in SEQ ID NO: 40.
[0247] In some embodiments, the method comprises at least one of (C1)-(C6):
[0248] (C1) replacing 1X copy SRE 106bp to 127bp upstream of the transcription start site of the HPPD gene;
[0249] (C2) replacing 1X copy SRE 158bp to 179bp upstream of the transcription start site of the HPPD gene;
[0250] (C3) replacing 1X copy SRE between 219bp to 240bp upstream of the transcription start site of the HPPD gene;
[0251] (C4) replacing 2X copy SRE 106bp to 127bp upstream of the transcription start site of the HPPD gene;
[0252] (C5) replacing the fragment from 158 bp to 179 bp upstream of the transcription start site of the HPPD gene with 2X copies of SRE;
[0253] (C6) replacing the fragment from 219 bp to 240 bp upstream of the transcription start site of the HPPD gene with 2X copies of SRE;
[0254] (C4) replacing the fragment from 106 bp to 127 bp upstream of the transcription start site of the HPPD gene with 2X copies of SRE; and / or,
[0255] (C5) replacing the fragment from 158 bp to 179 bp upstream of the transcription start site of the HPPD gene with 2X copies of SRE; and / or,
[0256] (C6) replacing the fragment from 219 bp to 240 bp upstream of the transcription start site of the HPPD gene with 2X copies of SRE.
[0257] In some embodiments, the fragment from 106 bp to 127 bp upstream of the transcription start site in Triticum aestivum cv. Chinese Spring is replaced with 2X copies of SRE, exemplarily, the modified non-coding region comprises a sequence as set forth in SEQ ID NO: 110.
[0258] In some embodiments, the modification upstream and downstream of the transcription start site is achieved by a gene editing system, and the modification comprises replacement, insertion and deletion of DNA bases.
[0259] The gene editing system available in the present disclosure can be various gene editing systems known in the art, as long as it can perform targeted genome editing in plants. The gene editing system can be a CRISPR, ZFN or TALEN-based gene editing system. Preferably, the gene editing system is a CRISPR-based gene editing system.
[0260] Further, the gene editing system can be a prime editing system, which includes a fusion of a Cas nuclease or a variant thereof (e.g., Cas9-H840A or Cas9-D10A) with target strand nicking activity and a reverse transcriptase (e.g., M-MLV reverse transcriptase) (prime editing fusion protein) and a prime editing guide RNA (pegRNA) directed to the target sequence with a repair template (RT template, RTT) and a primer binding site (PBS) at the 3’ end. The system binds the free single strand produced by the Cas nuclease or a variant thereof (e.g., Cas9-H840A or Cas9-D10A) at the PBS and transcribes a single-stranded DNA sequence according to the given RTT, which can be repaired in the cell to achieve any change in the DNA sequence downstream of the PAM sequence-3’, e.g., to make changes at the target genomic site, including base substitutions, insertions, and deletions.
[0261] The pegRNA expression vector targets the desired region and mediates editing upstream and downstream of the transcription start site via ePPEplus containing Cas enzyme and reverse transcriptase. In some embodiments, the ePPEplus vector expressing Cas enzyme and reverse transcriptase is disclosed at Addgene website, vector number Plasmid #205241, and the pegRNA contains a backbone sequence as shown in SEQ ID NO: 39.
[0262] The gene editing system in the present disclosure can be introduced into plants by various methods known to those skilled in the art. Methods that can be used to introduce the gene editing system of the present disclosure into plants include biolistics, PEG-mediated protoplast transformation, Agrobacterium-mediated transformation, plant virus-mediated transformation, pollen tube pathway, and ovary injection.
[0263] In the present disclosure, only the introduction or production of the gene editing system in plant cells is required to achieve modification of the target sequence, and the modification can be stably inherited without stably transforming the plant with the gene editing system. This avoids potential off-target effects of the stably present gene editing system and avoids integration of exogenous nucleotide sequences into the plant genome, thereby having higher biosafety.
[0264] In some embodiments, the introducing is performed in the absence of selection pressure, thereby avoiding integration of the exogenous nucleotide sequence into the plant genome. The introducing comprises transforming the gene editing system into an isolated plant cell, tissue, protoplast, and then regenerating the transformed plant cell, tissue, protoplast into a whole plant. No selection agent for the selection gene carried on the expression vector is used during the tissue culture process. The use of no selection agent can improve the efficiency of plant regeneration and obtain herbicide-resistant plants that do not contain exogenous nucleotide sequences.
[0265] In some embodiments, the herbicide resistance in the plants can be improved by the above-mentioned methods, wherein "the herbicide resistance in the plants is improved" means that the herbicide resistance of the plants obtained using the methods for improving the herbicide resistance of plants provided by the present disclosure is improved by 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200% or more, relative to the plants that are not treated using the methods for improving the herbicide resistance of plants provided by the present disclosure. The methods for determining the herbicide resistance are known in the art. The resistance can be easily determined by a person skilled in the art according to the specific plant and the specific herbicide. In some embodiments, the plants with improved herbicide resistance obtained using the methods for improving the herbicide resistance of plants provided by the present disclosure are capable of normal growth in the presence of at least 0.1 μmol / L, at least 0.15 μmol / L, at least 0.2 μmol / L, at least 0.25 μmol / L, at least 0.3 μmol / L, at least 0.35 μmol / L, at least 0.4 μmol / L, at least 0.45 μmol / L, at least 0.5 μmol / L, at least 1 μmol / L, at least 2 μmol / L, at least 3 μmol / L, at least 4 μmol / L, at least 5 μmol / L, at least 10 μmol / L or more of the herbicide (e.g. HPPD inhibitor herbicide such as mesotrione).
[0266] In another aspect, the present disclosure also provides a herbicide-resistant plant produced by the above-mentioned methods for improving the herbicide resistance of plants.
[0267] The plant can be a plant susceptible to HPPD inhibitors, including monocot or dicot plants. Preferably, the plant is a crop plant, such as a monocot crop plant. Examples of suitable plants include, but are not limited to, rice, wheat, barley, sorghum, maize, oats, Arabidopsis, Phalaris arundinacea, wild soybean, soybean or tobacco, etc. In some preferred embodiments, the plant is rice. The present disclosure also encompasses the progeny of the herbicide-resistant plants.
[0268] <Plant cell>
[0269] The present disclosure further provides engineered plant cells produced by the methods described above for <Methods of increasing expression of an endogenous polynucleotide in a plant cell>, <Methods of increasing expression of a polynucleotide encoding a polypeptide in a plant>, <Methods of expressing a coding sequence or RNA in a plant>, <Methods of modulating expression of a nucleotide sequence of interest in a plant>, <Methods of modulating expression of a nucleotide sequence of interest in a plant>, <Methods of modifying expression of an endogenous gene in a plant>, and the like.
[0270] In some embodiments, the expression of an endogenous polynucleotide, endogenous gene, polynucleotide encoding a polypeptide, coding sequence or RNA, nucleotide sequence of interest associated with an agronomic characteristic is enhanced in the engineered plant cell.
[0271] In some embodiments, the agronomic characteristic is selected from the group consisting of herbicide tolerance, insect resistance, disease resistance, carbohydrate metabolism, fatty acid metabolism, amino acid metabolism, plant development, plant growth regulation, yield improvement, drought resistance, cold tolerance, heat tolerance, nutrient use efficiency, nitrogen use efficiency, and salt tolerance.
[0272] In some alternative embodiments, the gene associated with herbicide tolerance comprises a HPPD gene and / or a HIS1 gene. In some exemplary embodiments, the expression of a HPPD gene or a HIS1 gene is enhanced in the plant cell.
[0273] In some embodiments, the plant comprises a monocot or a dicot, preferably the plant is a crop, including monocot crop plants and / or dicot crop plants.
[0274] In some optional embodiments, the plant is selected from the group consisting of rice, wheat, barley, sorghum, maize, cotton, sunflower, oilseed rape, oat, Arabidopsis, Phalaris, Brachiaria, soybean, and tobacco.
[0275] In some alternative embodiments, the plant is selected from the group consisting of rice or variants thereof, including Kitaake rice or Kitaake rice OsHPPD protein mutants, which are Kitaake-414A Homo and Kitaake-417A Homo. The expression of a rice HPPD gene or a rice HIS1 gene is enhanced in the engineered Kitaake rice or Kitaake rice OsHPPD protein mutant cells.
[0276] In some alternative embodiments, the plant is selected from wheat or variants thereof, including Kenmore 199 wheat or a TaHPPD protein mutant of Kenmore 199 wheat, in particular a mutant of the protein encoded by the TaHPPD gene in the B genome of Kenmore 199 wheat, which is G407A Homo (homozygous mutant); the G407A is homologous to the G417A site in rice OsHPPD. Illustratively, the G407A Homo TaHPPD coding region comprises a sequence as set forth in SEQ ID NO: 40. In the engineered Kenmore 199 wheat or TaHPPD protein mutant of Kenmore 199 wheat, the expression level of the wheat HPPD gene is increased.
[0277] In some embodiments, the plant cell is a plant cell of non-propagating material.
[0278] <Plant breeding method>
[0279] In another aspect, the present disclosure provides a plant breeding method, comprising crossing a first plant having improved agronomic characteristics obtained by the methods described above in the <Method for increasing expression of an endogenous polynucleotide in a plant cell>, <Method for increasing expression of a polynucleotide encoding a polypeptide in a plant>, <Method for expressing a coding sequence or RNA in a plant>, <Method for modulating expression of a nucleotide sequence of interest in a plant>, <Method for modulating expression of a nucleotide sequence of interest in a plant>, <Method for modifying expression of an endogenous gene in a plant>, etc. with a second plant not having improved agronomic characteristics, thereby obtaining the second plant having improved agronomic characteristics.
[0280] In some exemplary embodiments, the improved agronomic characteristics include herbicide tolerance, and the plant can be a plant susceptible to HPPD inhibitors, including monocot or dicot plants. Preferably, the plant is a crop plant, such as a monocot crop plant. Examples of suitable plants include, but are not limited to, rice, wheat, barley, sorghum, maize, oat, Arabidopsis, Phalaris arundinacea, wild soybean, soybean, or tobacco, etc. In some preferred embodiments, the plant is rice. The present disclosure also encompasses the progeny of the herbicide-resistant plants.
[0281] Examples
[0282] The embodiments of the present disclosure will be described in detail below with reference to the examples, but those skilled in the art will understand that the following examples are only for illustration of the present disclosure and should not be regarded as limiting the scope of the present disclosure. If no specific conditions are specified in the examples, the conventional conditions or the conditions recommended by the manufacturer are used. If no manufacturer of the reagent or instrument is specified, it is a conventional product that can be obtained by purchase on the market.
[0283] Materials and methods
[0284] 1. Dual-luciferase activity assay
[0285] (1) Reagent preparation. Dilute 5×PLB with double-distilled water to make 1×PLB. Prepare fresh and use immediately. Store 5×PLB at -20℃. Dissolve lyophilized Luciferase Assay Substrate in Luciferase Assay Buffer II (LAR II). After aliquoting, store at -70℃ for at least one year, protected from light. Buffer will 50×Stop& Substrate diluted to 1×Stop& Substrate, oscillate for 10 seconds, prepare fresh before use.
[0286] (2) Cell lysis. Collect protoplasts at 12000 r / min for 5 min, add 100 μL of 1×PLB, vortex to mix, and then gently shake at room temperature for 15 min to lyse.
[0287] (3) Program preparation. The testing instrument used is a Promega single-tube multi-function testing instrument. After powering on, select the DLR-O-INJ program in Promega Protocols.
[0288] (4) Add 50 μL LAR II to a 1.5 mL centrifuge tube, add 10 μL PLB cell lysis buffer, and gently pipette four times to mix, being careful not to create air bubbles. Immediately place the tube into the analyzer and click Measure to perform the analysis.
[0289] (5) Remove the centrifuge tube and add 50 μL of 1×Stop& Substrate by gently blowing four times with a nozzle to mix thoroughly, being careful not to create air bubbles. Immediately place the mixture into the testing instrument and click OK to perform the test again.
[0290] (6) Record Result 1, Result 2, and Ratio values. Result 1 is the enzyme activity of firefly luciferase, Result 2 is the enzyme activity of kidney luciferase, and Ratio is the ratio of the two enzyme activities.
[0291] 2. Isolation of rice protoplasts
[0292] (1) Prepare the dehulled rice Kitaake seeds, wash with water to remove impurities; wash with 75% ethanol for 1 min, without interruption upside down; 3.5% sodium hypochlorite bleaching for 35 min, without interruption upside down; wash with sterile water for 5 times; spread on 1 / 2MS medium, 30°C, 12 hours light culture for 2 weeks.
[0293] (2) Cut the leaf sheath part of the seedling into about 0.5mm small pieces with a sharp blade.
[0294] (3) Immediately transfer to 0.6mol / L mannitol solution, room temperature, avoid light for 10 min.
[0295] (4) Filter out the mannitol solution with 40μm nylon membrane, transfer the tissue blocks to the enzyme solution, avoid light, vacuum for 30 min.
[0296] (5) Room temperature, avoid light, horizontal shaking bed, 50r / min speed, enzymolysis for 5-6h.
[0297] (6) After the end of enzymolysis, filter out the enzyme solution with 40μm nylon membrane.
[0298] (7) Add 50mL W5 solution, gently shake for 10s to release protoplasts, filter the protoplasts into round bottom 50mL centrifuge tube.
[0299] (8) Repeat step 7 for 2-3 times.
[0300] (9) 250g, the speed setting is 3, room temperature, horizontal centrifugation for 3 min.
[0301] (10) Discard the supernatant, add 10mL W5 solution to resuspend the protoplast.
[0302] (11) 250g, the speed setting is 3, room temperature, horizontal centrifugation for 3 min.
[0303] (12) Try to remove the W5 solution, add appropriate amount of MMG for subsequent transformation. Determine the protoplast concentration under the microscope with a hemocytometer (usually the protoplast concentration for transformation is 2×10 6 per milliliter).
[0304] 3. Rice protoplast transformation
[0305] (1) Add 10μg plasmid in round bottom 2mL centrifuge tube.
[0306] (2) Add 200μL protoplast, gently shake to mix.
[0307] (3) Add 220μL PEG, gently shake the centrifuge tube to mix the protoplast and PEG thoroughly.
[0308] (4) Incubate at room temperature in the dark for 25 min.
[0309] (5) Add 880 μL W5 solution to terminate the reaction, mix well by inverting the tube several times.
[0310] (6) 250g, set the acceleration and deceleration to 3, centrifuge at room temperature for 3 min.
[0311] (7) Discard the supernatant, add 1 mL WI, mix well by inverting the tube several times.
[0312] (8) Incubate at room temperature in the dark for 48 h.
[0313] 4. Small amount of genomic DNA extraction from protoplasts and plant tissues
[0314] Use the fast plant genomic extraction kit (TIANGEN DP321) to follow the steps below:
[0315] (1) Take 50 mg of plant leaves and freeze them in liquid nitrogen, then grind them thoroughly, or collect the protoplasts to be extracted into a 2 mL centrifuge tube.
[0316] (2) Add 200 μL of buffer FP1 and 3 μL of RNase A (10 mg / mL), vortex well for 1 min, and incubate at room temperature for 10 min.
[0317] (3) Add 65 μL of buffer FP2, mix well, and vortex for 1 min.
[0318] (4) Centrifuge at 12,000 rpm for 5 min, and transfer the supernatant to a new 1.5 mL centrifuge tube.
[0319] (5) Optional: Repeat step 4.
[0320] (6) Add 0.7 times the volume of pre-cooled isopropanol to the supernatant, mix well, and at this time, flocculent genomic DNA will appear. Centrifuge at 12,000 rpm for 2 min, discard the supernatant, and retain the precipitate.
[0321] (7) Add 600 μL of 70% ethanol, vortex for 5 seconds, centrifuge at 12,000 rpm for 2 min, and discard the supernatant.
[0322] (8) Repeat step 7.
[0323] (9) Invert the tube to dry the residual ethanol at room temperature for about 10 min.
[0324] (10) Add an appropriate amount of deionized water preheated to 65°C to dissolve the DNA, and store it at -20°C.
[0325] 5. Amplicon sequencing library preparation and sequencing
[0326] 5.1 Amplicon sequencing library preparation
[0327] Amplicon sequencing is a sequencing technology that uses next-generation sequencing platforms to sequence PCR products of specific segments to observe genetic mutations at specific sites. Amplicon sequencing has been widely used in the field of gene editing. The library preparation for amplicon sequencing in this study consists of the following steps:
[0328] (1) Using the extracted protoplast DNA as a template, a high-fidelity PCR polymerase FastPfu was used for one round of amplification. The amplification product was a DNA fragment of about 500 bp upstream and downstream of the target site.
[0329] (2) PCR was detected by agarose gel electrophoresis. The first round of PCR products were diluted 20-fold and used as templates for the second round of PCR. The second round of amplification primers contained a barcode sequence to distinguish different treatments. The length of the amplification product was between 180 bp and 250 bp.
[0330] (3) According to the brightness of the band, 5 to 20 μL of each PCR product was mixed. According to the sequencing depth requirement, 1 Gb of sequencing data could mix about 40 to 60 samples. The mixed library was purified using the AxyPrep DNA Gel Extraction Kit and sent to the next-generation sequencing company for sequencing. The sequencing platform used was Illumina NovaSeq.
[0331] 5.2 Amplicon sequencing library preparation
[0332] The analysis process of the next-generation sequencing data mainly refers to the analysis process published by the David R. Liu laboratory of Harvard University (Gaudelli et al., 2017). The specific process is as follows:
[0333] (1) Split the paired-end sequencing data of different treatments using labeled forward and reverse primer sequences.
[0334] (2) Use FLASH software to merge the paired-end data of each treatment group. The parameters are the default parameters of the software.
[0335] (3) Take wild type sequence as reference sequence, set two flank sequences, the sequence between the two flank sequences is the sequence to be analyzed for mutation. According to different experimental requirements, the length of the flank sequence (usually 7 bp) and the length of the sequence between the two flank sequences are determined. The sequence between the two flank sequences is compared with the wild type sequence to identify the mutation types of Insertion and Deletion, and the corresponding read number is reported.
[0336] 6. Genetic transformation of rice
[0337] The transformation process of Agrobacterium-mediated rice callus refers to the method disclosed in Hiei, Y., Ohta, S., Komari, T. & Kumashiro, T. Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J. 6, 271-282 (1994). The Agrobacterium strain used is AGL1, and the recipient material used is rice (Kitaake) mature embryo-induced callus. The process from Agrobacterium infection, tissue culture to plant regeneration takes about 12-15 weeks.
[0338] 7. Test of rice resistance to mesotrione
[0339] Select Kitaake rice tissue culture seedlings with consistent growth, two to three leaf stage, cut off the long roots to retain about 0.5 cm length, and transfer to medium containing 0.15 μM or 0.45 μM mesotrione (MST). Culture in a culture room at 30°C, 16 hours light / 8 hours dark, and after 14-30 days, observe the phenotype and take pictures according to the growth of the seedlings.
[0340] Example 1: Construction of dual luciferase reporter system for regulatory sequence screening
[0341] The commercialized plant promoter reporter system pGreenII 0800-LUC contains two expression cassettes, one is CaMV 35S promoter driven Renilla reniformis Luciferase (REN) and the other is the promoter to be detected driven Firefly Luciferase (LUC). After the reaction of REN and LUC with the substrate, chemical fluorescence is emitted, and the fluorescence intensity is proportional to the activity of luciferase within a certain range, so the expression amount of luciferase can be determined by measuring the fluorescence intensity, and thus the promoter strength can be determined.
[0342] In order to modify the system into a reporter system suitable for screening of regulatory sequences, the inventors inserted the core promoter region (180bp) and 5'UTR region of OsHPPD gene upstream of the Firefly Luciferase coding sequence. A multiple cloning site was reserved upstream of the core promoter region of OsHPPD gene for determination of regulatory sequences, and the reporter system was named pGreenII 0800-LUC-HPPDCoreP-5UTR (Figure 1).
[0343] The sequence of the core promoter region (180bp) and 5'UTR region of OsHPPD gene (the underlined part is the core promoter region, and the rest is the sequence of 5'UTR region):
[0344] Example 2: Screening of regulatory elements capable of greatly improving expression
[0345] Through literature retrieval, regulatory elements that can improve expression were obtained, and then the regulatory elements were inserted into the multiple cloning site MCS of the vector pGreenII 0800-LUC-HPPD-CoreP-5'UTR. Whether the regulatory elements in Table 1 enhance gene expression was tested by dual luciferase reporter gene assay, and the results showed that different regulatory elements can improve the expression of reporter gene LUC to different degrees, among which the insertion of SRE (pGreenII 0800-LUC-HPPD-CoreP-SRE-5'UTR) can improve the expression by about 15 times compared with CoreP without SRE (i.e. pGreenII 0800-LUC-HPPD-CoreP-5'UTR system) (Figure 2).
[0346] Table 1. Regulatory sequence name and length
[0347] Example 3: Use of regulatory element SRE to improve the expression level of OsHPPD gene
[0348] The above experimental results prove that the insertion of the regulatory element SRE into the 180bp core sequence upstream of the OsHPPD promoter can greatly enhance the expression of the reporter gene, but it cannot be determined whether the insertion of the element at this position is optimal, therefore, the inventors extended the 180bp core promoter of OsHPPD in the reporter system to 1000bp, the sequence is:
[0349] And 1-3 repeated SREs were introduced in the upstream and downstream regions of the transcription start site in the form of replacement or insertion, and through the dual luciferase reporter system assay in rice protoplasts, it was found that the replacement and insertion of 1-3 repeated SREs in the non-coding region and promoter region of the OsHPPD gene at different positions can enhance the expression level of the reporter gene to different degrees (Fig. 3a~Fig. 3b and Fig. 4). The specific insertion position and number of SRE are shown in Table 2.
[0350] Table 2. Different insertion modes of SRE sequence in the OsHPPD promoter region
[0351] The transcription start site is +1, and the upstream of the transcription start site is -1
[0352] In the region of +59bp to -244bp of the transcription start site of the OsHPPD gene, the insertion or replacement of a single SRE can enhance the expression of the LUC gene by up to 56 times of the control group HPPD-1000Pro+5'UTR (Fig. 3a), among which the expression in the region of +59bp to -100bp is increased by more than 3 times, and the replacement of a single SRE in the region of -111bp to -244bp does not show obvious expression enhancement (Fig. 3a). In the region of -133bp to -403bp, the replacement of two repeated SREs enhances the expression by 5-14 times (Fig. 3b), and the insertion of three repeated SREs at -180bp enhances the expression by about 140 times (Fig. 3c).
[0353] Example 4: Introducing SRE sequence upstream of the coding region of OsHPPD gene using guide editing tool to obtain rice with enhanced mesotrione resistance
[0354] The results of the dual luciferase reporter system experiment show that in the region of +59bp to -100bp of the transcription start site of the OsHPPD gene, the insertion or replacement of a single SRE can enhance the expression of the reporter gene by about 3-56 times, therefore, in this embodiment, the pegRNA is designed in the region of +59bp to -132bp of the transcription start site of the OsHPPD gene of rice Kitaake using the guide editing tool to introduce the SRE sequence.
[0355] The inventors co-transfected ePPEplus vector and pegRNA expression vector targeting different regions of OsHPPD gene (HPPD-SRE+38, HPPD-SRE-35, HPPD-SRE-57, HPPD-SRE-79, HPPD-SRE-111) into rice protoplasts, and after 48 hours of culture, genomic DNA was extracted, and the efficiency of guide editing at different target positions was determined by second-generation sequencing method.
[0356] The sequencing results showed that the guide editing efficiency at HPPD-SRE+38, HPPD-SRE-57 and HPPD-SRE-111 was all greater than 1% (Figure 4). Since HPPD-SRE+38 and HPPD-SRE-57 had more obvious expression effect in the reporter system, the inventors further selected HPPD-SRE+38 and HPPD-SRE-57 as the target points to construct Agrobacterium transformation vectors to obtain gene-edited rice plants. The Agrobacterium vector used for ePPEplus was named pH-ePPEplus (modified based on ePPEplus (addgene #205241), and the vector map is shown in Figure 15). After pH-ePPEplus was digested with BsaI, the pegRNA sequences of SRE+38 and SRE-57 were constructed into the Agrobacterium transformation vector by seamless cloning, and pH-ePPEplus-HPPD-SRE+38 and pH-ePPEplus-HPPD-SRE-57 were obtained. The calli of wild-type rice Kitaake or OsHPPD protein mutant rice (G414A Homo (homozygous mutant), G417A Homo (homozygous mutant) and G417A Heter (heterozygous mutant), which were all based on wild-type rice Kitaake and were mutated, and the construction method was disclosed in patent WO2022 / 127894Al, which is incorporated herein by reference) were transformed by Agrobacterium transformation method using pH-ePPEplus-HPPD-SRE+38 and pH-ePPEplus-HPPD-SRE-57 two Agrobacterium vectors, and transgenic plants (T0 generation) were obtained after tissue culture.
[0357] The genotypes of the T0 generation transgenic plants were identified by sequencing, and the herbicide resistance was identified by adding mesotrione in the medium: after the T0 generation plants were placed in the MS medium containing 0.15 μM or 0.45 μM mesotrione for 30 days, the mutant plants with inserted or replaced SRE sequence all showed higher resistance compared with the transformation receptor material (wild type rice Kitaake or G414A Homo and G417A Homo) (Figure 5), and the genotypes of the mutant plants are shown in Table 3.
[0358] Table 3. Genotypes of mesotrione-resistant plants in T0 generation
[0359] The underlined part is the SRE sequence, the bold part is the SRE truncated sequence, and the double underlined part is the SNP.
[0360] More T0 generation mutant rice plants were identified, and it was found that different forms of SRE introduction could all improve the resistance of rice to mesotrione. The specific SRE mutant alleles are shown in Table 4.
[0361] Table 4. Mesotrione-resistant mutant alleles
[0362] The underlined part is the SRE sequence, the bold part is the SRE truncated sequence, and the double underlined part is the SNP.
[0363] The inventors obtained T1 generation homozygous mutants WT-SRE+38(RP) (precise replacement (RP) at +38 site), WT-SRE+38(+24) (flexible insertion +24 at +38 site), WT-SRE-57(RP) (precise replacement (RP) at -57 site) and WT-SRE-57(+23) (flexible insertion +23 at -57 site) with wild-type coding region and different editing types in non-coding region through passage separation. The results of quantitative RT-PCR analysis and Western blotting experiment showed that the OsHPPD transcription and protein levels were all increased in all mutant plants containing SRE compared with the wild type control group (Figure 6). Regardless of the mutation type, the mutant at +38 site had a higher OsHPPD expression level than the mutant at -57 site (Figure 6), and the above results showed that the position of SRE in the genome had a more significant effect on expression than the mutation type (replacement and insertion). WT-SRE+38(RP), WT-SRE+38(+24), WT-SRE-57(RP), WT-SRE-57(+23) and WT all finally turned white and died in the MS medium containing 0.45 μM mesotrione (MST), but the mutants containing SRE died slower than WT (Figure 6).
[0364] The homozygous mutant 414A(Ho)-SRE+38(RP) with the G414A mutation in the coding region and the SRE introduced in the non-coding region of the substitution type can survive in the MS medium containing 0.45 μM mesotrione (Figure 7). The double allele mutant 417A(He)-SRE+38(+7 / +27) with the G417A mutation in the coding region and the SRE introduced in the non-coding region of the flexible insertion type can survive in the MS medium containing 0.45 μM mesotrione (Figure 8). In addition, the mutants 414A(Ho)-SRE+38(RP) and 417A(He)-SRE+38(+7 / +27) grow normally after spraying mesotrione at 4 times the field concentration (692 g.a.i / ha, a.i. refers to active ingredient, ha refers to hectare, g.a.i / ha refers to the amount of pesticide active ingredient used per hectare) for one month, while the wild type controls, WT-SRE+38(RP) and WT-SRE+38(+24) die (Figure 9). Therefore, the introduction of SRE can significantly improve the transcription and protein expression level of OsHPPD, especially in the case of mutations in the coding region, and the mutant plants can tolerate mesotrione at 4 times the field concentration.
[0365] Example 5: Use of regulatory element SRE to improve the expression level of OsHIS1 gene
[0366] The effect of the introduction of 1-3 repeats of SRE at different positions of the OsHIS1 gene promoter on gene expression was determined by a dual luciferase reporter system in rice protoplasts. The dual luciferase reporter vector containing 1000 bp OsHIS1 promoter and OsHIS1-5'UTR was used as a negative control.
[0367] 1000 bp OsHIS1 promoter sequence:
[0368] Sequence containing OsHIS1-5'UTR (containing 5'UTR sequence and intron sequence)
[0369] The experimental results show that the introduction of 1-3 repeats of SRE at different positions of the OsHIS1 gene promoter region can improve the expression level of the reporter gene to different degrees, and the introduction of 3 repeats of SRE sequence at the position of (-187) to (-233) bp improves the expression level of the reporter system by about 27 times (Figure 10). The specific insertion position and number of SRE are shown in Table 5.
[0370] Table 5. Different insertion methods of SRE sequence in the OsHIS1 promoter region
[0371] Example 6: Introducing SRE sequence upstream of OsHIS1 gene coding region using prime editing tool to obtain rice with improved mesotrione resistance
[0372] The results of the dual-luciferase reporter system experiment showed that the introduction of 1-3 SREs in the region from -33bp to -233bp upstream of the transcription start site of the OsHIS1 gene could increase the expression of the reporter gene by up to 27-fold. Therefore, in this embodiment, the pegRNA was designed to introduce SRE sequences in the region from -33bp to -233bp upstream of the transcription start site of the OsHIS gene of rice Kittake using the prime editing tool.
[0373] The ePPEplus vector and pegRNA expression vector targeting different regions of the OsHIS1 gene were co-transfected into rice protoplasts, and the genomic DNA was extracted after 48 hours of culture. The efficiency of prime editing at different target positions was determined by next-generation sequencing. The sequencing results showed that the editing efficiency at HIS-2SRE-T2T3 and HIS-2SRE-T9T10 was greater than 2% (Figure 11). Therefore, the inventors constructed Agrobacterium transformation vectors for HIS-2SRE-T2T3 and HIS-2SRE-T9T10 to obtain gene-edited rice plants. The pH-ePPEplus-HPPD+38-HIS-2SRE-T2T3 and pH-ePPEplus-HPPD-57-HIS-2SRE-T9T10 Agrobacterium vectors targeting both the HPPD gene and the HIS gene were used to transform wild-type rice Kitaak calli using the Agrobacterium transformation method. After obtaining transgenic plants through tissue culture, the genotype of the transgenic plants was identified by sequencing. Through planting and subculture, homozygous mutant plants with SRE introduced into the OsHIS1 gene were obtained in the T1 generation, and herbicide resistance was identified by spraying 4 times the field concentration of mesotrione (692g.a.i / ha). The results showed that the mutants with SRE introduced into the non-coding region of the OsHIS1 gene could further improve the plant's resistance to mesotrione (Figure 12), and the mutant genotypes are shown in Table 6.
[0374] Table 6. Genotypes of OsHIS1 mutant plants
[0375] Example 7: Using regulatory element SRE to improve the expression level of TaHPPD-B1 gene
[0376] The effect of introduction of 1-2 repeats of SRE at different positions of the promoter of TaHPPD-B1 gene (TaHPPD gene in B genome of wheat) on gene expression was determined by dual luciferase reporter system in wheat protoplasts. The dual luciferase reporter vector containing 1000 bp TaHPPD-B1 promoter and TaHPPD-B1-5'UTR was used as negative control.
[0377] Promoter region of TaHPPD-B1 gene (SEQ ID NO: 52):
[0378] The experimental results showed that introduction of 1-2 repeats of SRE at different positions of the promoter region of TaHPPD-B1 gene could improve the expression level of the reporter gene to different degrees (Figure 13). The specific insertion position and number of SRE are shown in Table 7.
[0379] Table 7. Different insertion modes of SRE sequence in the promoter region of TaHPPD-B1
[0380] Example 8: Introducing SRE sequence upstream of the coding region of TaHPPD-B1 gene and introducing G407A mutation in the coding region using prime editing tool to obtain wheat with improved mesotrione resistance
[0381] The inventors transformed immature embryos of Triticum aestivum cv. Kenong 199 with ePPEplus vector and pegRNA expression vector targeting B5 site in the non-coding region of TaHPPD-B1 gene and targeting TaHPPD-G407A (homologous to OsHPPD-G417A site in rice) by gene gun transformation method and obtained mutants. The T1 generation homozygous mutant SRE-G407A was cultured in MS medium containing 0.15 μM mesotrione, and the mutant plants (left in Figure 14) showed higher resistance compared with the wild type (right in Figure 14).
[0382] Table 8. Genotype of SRE-G407A mutant plants
[0383] SEQ ID NO: 53 pegRNA sequence in TaHPPD-SRE-B5
[0384] SEQ ID NO: 54 pegRNA sequence in TaHPPD-G407A
[0385] References
[0386] Bradley FC, Lindstedt S, Lipscomb JD, Que L, Jr Roe AL, Rundgren M (1986) 4-Hydroxyphenylpyruvate dioxygenase is an iron-tyrosinate protein. J Biol Chem 261 : 11693-11696
[0387] Beaudegnies, R, Edmunds AJ, Fraser TE, Hall RG, Hawkes TR, Mitchell G, Schaetzer J, Wendeborn S, Wibley J (2009) Herbicidal 4-hydroxyphenylpyruvate dioxygenase inhibitors - a review of the triketone chemistry story from a Syngenta perspective. Bioorg Med Chem 17:4134-4152
[0388] Maeda H, Murata K, Sakuma N, Takei S, Yamazaki A, Karim M R, Kawata M, Hirose S, Kawagishi-Kobayashi M, Taniguchi Y, et al. (2019) A rice gene that confers broad-spectrum resistance to β-triketone herbicides. Science 365:393-396. Gaudelli NM, Komor AC, Rees HA, Packer MS, Badran AH, Bryson DI, Liu DR (2017) Programmable base editing of A·T to G·C in genomic DNA without DNA cleavage. Nature 551 :464-471.
[0389] Hendelman A, Zebell S, Rodriguez-Leal D, et al., 2021. Conserved pleiotropy of an ancient plant homeobox gene uncovered by cis-regulatory dissection. Cell 184, 1724-39e16.
[0390] Hummel AW, Chauhan RD, Cermak T, et al., 2018. Allele exchange at the EPSPS locus confers glyphosate tolerance in cassava. Plant Biotechnol J 16, 1275-82.
[0391] Lu Y, Wang J, Chen B, et al., 2021. A donor-DNA-free CRISPR / Cas-based approach to gene knock-up in rice. Nat Plants 7, 1445-52.
[0392] Song X, Meng X, Guo H, et al., 2022. Targeting a gene regulatory element enhances rice grain yield by decoupling panicle number and size. Nat Biotechnol 40, 1403-11.
[0393] Wang H, Chen M, Zhang D, et al., 2024a. Shaping rice Green Revolution traits by engineering ATG immediate upstream 5'-UTR sequences of OsSBI and OsHTD1. Plant Biotechnol J 22, 532-4.
[0394] Wang H, Zhang D, Chen M, et al., 2024b. Genome editing of 3’UTR-embedded inhibitory region enables generation of gene knock-up alleles in plants. Plant Commun 5, 100745.
[0395] Xue C, Qiu F, Wang Y, et al., 2023. Tuning plant phenotypes by precise, graded downregulation of gene expression. Nat Biotechnol 41, 1758-64.
[0396] Zhang H, Si X, Ji X, et al., 2018. Genome editing of upstream open reading frames enables translational control in plants. Nat Biotechnol 36, 894-8.
[0397] Sequences referred to in the present disclosure:
[0398] SEQ ID NO:33 pegRNA sequence in HPPD-SRE+38
[0399] SEQ ID NO:34 pegRNA sequence in HPPD-SRE-35:
[0400] SEQ ID NO:35 pegRNA sequence in HPPD-SRE-57:
[0401] SEQ ID NO:36 pegRNA sequence in HPPD-SRE-79:
[0402] SEQ ID NO:37 pegRNA sequence in HPPD-SRE-111:
[0403] SEQ ID NO: 38 1SRE truncation: CAACGTAAGCGCTTACGCAC
[0404] SEQ ID NO: 39 Backbone sequence of esgRNA
[0405] SEQ ID NO: 41 pegRNA sequence in HIS-2SRE-T2
[0406] SEQ ID NO: 42 pegRNA sequence in HIS-2SRE-T3
[0407] SEQ ID NO: 43 pegRNA sequence in HIS-3SRE-T2
[0408] SEQ ID NO: 44 pegRNA sequence in HIS-3SRE-T3
[0409] SEQ ID NO: 45 pegRNA sequence in HIS-2SRE-T4
[0410] SEQ ID NO: 46 pegRNA sequence in HIS-2SRE-T9
[0411] SEQ ID NO: 47 pegRNA sequence in HIS-2SRE-T10
[0412] It should be noted that although the technical solutions of the present disclosure are introduced with specific examples, those skilled in the art can understand that the present disclosure should not be limited thereto.
[0413] Having described above several embodiments of the disclosure, any modifications and variations that fall within the scope of the described embodiments are also intended to be within the scope of the disclosure. As will be apparent to those skilled in the art, some modifications and variations to the embodiments described above can be practiced while staying within the scope and spirit of the described embodiments. The foregoing description of the described embodiments has been presented for the purposes of illustration and description. It is not intended to be exhaustive or to limit the described embodiments to the precise form disclosed. Many modifications and variations are possible in light of the above teachings. It is intended that the disclosed embodiments be limited only by the claims.
Claims
1. A method of increasing expression of an endogenous polynucleotide in a plant cell, the method comprising altering one or more nucleotides in a regulatory region of the endogenous polynucleotide such that the regulatory region of the endogenous polynucleotide comprises at least one copy of an expression regulatory element; optionally, the expression regulatory element is selected from at least one of SRE, ADSH2, ADSH3, ADSH6, ADSH8, ADSH12, RDSH1, RDSH3, GREGIONNTPRBIB, JERECRSTR, SV40, CaMV, MMV, FMV, OsFMV, CmYLCVR, and variants of the aforementioned elements; optionally, the one copy of the expression regulatory element comprises a nucleotide sequence selected from the group consisting of as set forth in SEQ ID NO: 1, 6, 7, 10, 12, 16, 17, 19, 22, 23, 25-29, 31, 38; optionally, the regulatory region comprises a non-coding region 5’ to the endogenous polynucleotide; preferably, the non-coding region 5’ comprises a promoter region and a 5’ UTR region.
2. The method of claim 1, wherein, altering one or more nucleotides by genome modification.
3. The method of claim 1 or 2, wherein, (a) the at least one copy of the expression regulatory element is present in one or more configurations selected from the group consisting of: head-to-head, head-to-tail, tail-to-head, tail-to-tail, and combinations thereof, for example, two copies of SRE as set forth in SEQ ID NO: 2 or three copies of SRE as set forth in SEQ ID NO: 3, optionally, the at least one copy is separated by a spacer sequence comprising 1 to 50 nucleotides, for example, three copies of SRE as set forth in SEQ ID NO: 4; and / or (b) the variant comprises a truncation of the expression regulatory element, for example, a SRE truncation that is truncated at the 5’ end and / or 3’ end of SRE by at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases, such as a SRE truncation as set forth in SEQ ID NO: 38; and / or (c) wherein the expression regulatory element is present within 0 to 1000 bp from the transcription start site of the endogenous polynucleotide or 1000 bp upstream of the core promoter region; preferably, the expression regulatory element is present within 33 to 403 bp from the transcription start site of the endogenous polynucleotide; preferably, the at least one copy of the expression regulatory element comprises an amino acid sequence selected from the group consisting of as set forth in SEQ ID NO: 1-4, 38.
4. The method of any one of claims 1-3, wherein, (a) the expression regulatory element is heterologous to the endogenous polynucleotide; or (a) the expression regulatory element is heterologous to the endogenous polynucleotide; or (b) creating the expression regulatory element of the copy by changing no more than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 27, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, or 69 nucleotides in a regulatory region of the endogenous polynucleotide.
5. The method of any one of claims 1-4, wherein, (a) the expression regulatory element is located upstream of a transcription start site of the endogenous polynucleotide; (b) the expression regulatory element is located downstream of a transcription start site of the endogenous polynucleotide; (c) the expression regulatory element is inserted into a regulatory region of the endogenous polynucleotide such that the expression regulatory element is operably linked to the endogenous polynucleotide; (d) the expression regulatory element replaces a portion of a regulatory region of the endogenous polynucleotide such that the expression regulatory element is operably linked to the endogenous polynucleotide; or (e) the expression regulatory element is operably linked to a core promoter.
6. The method of any one of claims 1-5, wherein, (a) expression of the endogenous polynucleotide in the plant cell is increased as compared to a control plant cell that does not comprise the expression regulatory element operably linked to the endogenous polynucleotide; and / or (b) the endogenous polynucleotide is involved in disease resistance, herbicide tolerance, pest resistance, yield increase, yield stability, or a combination thereof.
7. The method according to any one of claims 2 to 6, wherein, the genomic modification is a site-specific single- or double-strand break mediated by a polynucleotide-directed nuclease, a zinc finger nuclease, a transcription activator-like effector nuclease (TALEN), a polynucleotide-directed recombinase, or an engineered site-specific meganuclease or Argonaute protein, or a site-specific base editing mediated by a C.G to T.A or A.T to G.C base-editing deaminase.
8. The method of claim 7, wherein, the genomic modification is made by a polynucleotide-directed Cas9 nuclease; optionally, the genomic modification is made by a gene editing system, preferably an ePPEplus prime editing system; optionally, the ePPEplus prime editing system comprises: (a) a CRISPR nuclease and / or an expression construct containing a nucleotide sequence encoding the CRISPR nuclease, and a reverse transcriptase and / or an expression construct containing a nucleotide sequence encoding the reverse transcriptase, and (b) a prime editing guide RNA (pegRNA) directed to a genomic target sequence and / or an expression construct containing a nucleotide sequence encoding the prime editing guide RNA; optionally, the CRISPR nuclease is a Cas9 nuclease or a variant thereof; Preferably, the Cas9 nuclease variant is an nCas9 nuclease; Preferably, the pegRNA comprises a backbone sequence as set forth in SEQ ID NO:
39.
9. A method of increasing expression of a polynucleotide encoding a polypeptide in a plant, the method comprising expressing the polynucleotide by operably linking the polynucleotide to an expression modulating element having at least one copy of at least one selected from the group consisting of SRE, ADSH2, ADSH3, ADSH6, ADSH8, ADSH12, RDSH1, RDSH3, GREGIONNTPRBIB, JERECRSTR, SV40, CaMV, MMV, FMV, OsFMV, CmYLCVR, and variants of the aforementioned elements, wherein the expression modulating element is heterologous to the polynucleotide, and the expression modulating element is heterologous to a promoter that functions in a plant; Optionally, one copy of the expression modulating element comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1, 6, 7, 10, 12, 16, 17, 19, 22, 23, 25-29, 31, 38; Optionally, the polypeptide confers herbicide tolerance, insect resistance, disease resistance, and / or abiotic stress tolerance; Optionally, wherein the plant is selected from the group consisting of rice, wheat, barley, sorghum, maize, cotton, sunflower, oilseed rape, oat, Arabidopsis, Phalaris aquatica, Brachiaria plantaginea, soybean, and tobacco.
10. The method of claim 9, wherein, The expression modulating element is introduced by genome editing; Optionally, the expression modulating element increases expression of a polynucleotide involved in architectural structure of a plant or maturation of a plant.
11. A recombinant DNA construct comprising an expression modulating element selected from at least one of SRE, ADSH2, ADSH3, ADSH6, ADSH8, ADSH12, RDSH1, RDSH3, GREGIONNTPRBIB, JERECRSTR, SV40, CaMV, MMV, FMV, OsFMV, CmYLCVR, and variants of the aforementioned elements operably linked to at least one heterologous nucleic acid sequence, wherein the expression modulating element comprises at least one copy of an expression modulating element in a regulatory region of a polynucleotide; Optionally, one copy of the expression modulating element comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1, 6, 7, 10, 12, 16, 17, 19, 22, 23, 25-29, 31, 38; Optionally, the copies are separated by a spacer sequence comprising 1 to 50 nucleotides.
12. The recombinant DNA construct of claim 11, wherein the at least one heterologous nucleic acid sequence comprises a genetic sequence selected from the group consisting of a reporter gene, a selection marker, a disease resistance gene, a herbicide resistance gene, an insect resistance gene in a plant; a gene involved in carbohydrate metabolism, a gene involved in fatty acid metabolism, a gene involved in amino acid metabolism, a gene involved in plant development, a gene involved in plant growth regulation, a gene involved in yield improvement, a gene involved in drought resistance, a gene involved in increasing nutrient use efficiency, a gene involved in cold resistance, a gene involved in heat resistance, and a gene involved in salt resistance.
13. A method of expressing a coding sequence or RNA in a plant, the method comprising expressing the recombinant DNA construct of claim 11 or 12, wherein the at least one heterologous sequence comprises a coding sequence or a coding functional RNA.
14. A method of increasing expression of a polynucleotide of interest in a plant, the method comprising expressing a heterologous sequence operably linked to at least one copy of an expression regulatory element selected from at least one of SRE, ADSH2, ADSH3, ADSH6, ADSH8, ADSH12, RDSH1, RDSH3, GREGIONNTPRBIB, JERECRSTR, SV40, CaMV, MMV, FMV, OsFMV, CmYLCVR, and variants of the aforementioned elements; optionally, one copy of the expression regulatory element comprises a nucleotide sequence selected from the group consisting of as set forth in SEQ ID NO: 1, 6, 7, 10, 12, 16, 17, 19, 22, 23, 25-29, 31, 38; optionally, the expression regulatory element is heterologous to the polynucleotide; optionally, the expression regulatory element is heterologous to a promoter that functions in a plant.
15. The method of claim 14, wherein, the heterologous sequence confers an agronomic trait selected from the group consisting of herbicide tolerance, insect resistance, disease resistance, carbohydrate metabolism, fatty acid metabolism, amino acid metabolism, plant development, plant growth regulation, yield improvement, drought resistance, cold tolerance, heat resistance, nutrient use efficiency, nitrogen use efficiency, and salt tolerance.
16. The method of claim 14 or 15, wherein, the plant comprises a monocot or a dicot, preferably, the plant is a crop, which comprises a monocot crop plant and / or a dicot crop plant; optionally, the plant is selected from the group consisting of rice, wheat, barley, sorghum, maize, cotton, sunflower, oilseed rape, oat, Arabidopsis, Phalaris arundinacea, Brachiaria plantaginea, soybean, and tobacco.
17. A method of increasing expression of a nucleotide sequence of interest in a plant, the method comprising expressing a polynucleotide sequence operably linked to an expression regulatory element that functions with a 5' UTR in a plant cell, wherein the expression regulatory element comprises at least one copy of an expression regulatory element in a regulatory region of the polynucleotide; Optionally, the expression regulatory element is selected from at least one of SRE, ADSH2, ADSH3, ADSH6, ADSH8, ADSH12, RDSH1, RDSH3, GREGIONNTPRBIB, JERECRSTR, SV40, CaMV, MMV, FMV, OsFMV, CmYLCVR, and variants of the above elements; Optionally, one copy of the expression regulatory element comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1, 6, 7, 10, 12, 16, 17, 19, 22, 23, 25-29, 31, 38; Optionally, the copies are separated by a spacer sequence comprising 1 to 50 nucleotides; Optionally, the 5’ UTR is a plant sequence.
18. A method of increasing expression of an endogenous gene of a plant, the method comprising introducing, by genome editing, an expression regulatory element selected from at least one of SRE, ADSH2, ADSH3, ADSH6, ADSH8, ADSH12, RDSH1, RDSH3, GREGIONNTPRBIB, JERECRSTR, SV40, CaMV, MMV, FMV, OsFMV, CmYLCVR, and variants of the above elements, wherein the endogenous gene comprises at least one copy of the expression regulatory element in a regulatory region of the endogenous gene; Optionally, one copy of the expression regulatory element comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1, 6, 7, 10, 12, 16, 17, 19, 22, 23, 25-29, 31, 38; Optionally, the copies are separated by a spacer sequence comprising 1 to 50 nucleotides.
19. The method of claim 18, wherein the genome editing is performed by a polynucleotide-guided Cas9 nuclease; Optionally, the genome editing is performed by a prime editing system, preferably an ePPEplus prime editing system; Optionally, the ePPEplus prime editing system comprises: (a) a CRISPR nuclease and / or an expression construct containing a nucleotide sequence encoding the CRISPR nuclease, and a reverse transcriptase and / or an expression construct containing a nucleotide sequence encoding the reverse transcriptase; (b) a prime editing guide RNA (pegRNA) directed to a genomic target sequence and / or an expression construct containing a nucleotide sequence encoding the prime editing guide RNA; Optionally, the CRISPR nuclease is a Cas9 nuclease or a variant thereof; Preferably, the Cas9 nuclease variant is an nCas9 nuclease. Preferably, the pegRNA comprises a backbone sequence as set forth in SEQ ID NO: 39; Optionally, the expression regulatory element is operably linked to a promoter sequence and a 5’ UTR.
20. The method of claim 18 or 19, wherein the endogenous gene has the following properties: (a) increased yield; (b) increased drought tolerance; and (c) increased yield and drought tolerance. (c) encoding a herbicide resistance polypeptide or an insect resistance polypeptide.
21. A plant cell of engineered non-propagating material, wherein, The plant cell is produced by the method of any one of claims 1 to 8, 18 to 20.
22. A plant cell of engineered non-reproductive material, the engineered plant cell having increased expression of an endogenous gene associated with an agronomic characteristic; Optionally, the agronomic characteristic is selected from herbicide tolerance, insect resistance, disease resistance, carbohydrate metabolism, fatty acid metabolism, amino acid metabolism, plant development, plant growth regulation, yield improvement, drought tolerance, cold tolerance, heat tolerance, nutrient use efficiency, nitrogen use efficiency, and salt tolerance; Preferably, the endogenous gene associated with herbicide tolerance comprises a HPPD gene and / or a HIS1 gene.
23. The plant cell of claim 21 or 22, wherein the plant comprises a monocot or a dicot, preferably the plant is a crop, including a monocot crop plant and / or a dicot crop plant; Optionally, the plant is selected from the group consisting of rice, wheat, barley, sorghum, maize, cotton, sunflower, oilseed rape, oat, Arabidopsis, Phalaris, Vetch, soybean, and tobacco; Optionally, the plant is selected from the group consisting of rice or a variant thereof, wheat or a variant thereof.
Citation Information
Patent Citations
Expression modulating elements and use thereof
CN110709519A
Cis-acting adjusting element
CN115244178A
Expression modulating elements and methods of use
US20210388369A1