Nucleic acid molecule inhibiting expression of endothelin a receptor
Nucleic acid molecules with specific sequences and modifications inhibit ETAR expression, addressing side effects of current drugs and providing a more effective treatment for pulmonary arterial hypertension.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-09-29
- Publication Date
- 2026-04-02
AI Technical Summary
Current drugs targeting endothelin A receptor (ETAR) for conditions like pulmonary arterial hypertension have side effects, and there is a need for more effective and specific nucleic acid molecules to inhibit ETAR expression without these drawbacks.
Development of nucleic acid molecules, including double-stranded regions with complementary sense and antisense strands, modified nucleotides, and specific nucleotide sequences to inhibit ETAR expression, forming a double-stranded region with mRNA encoding ETAR, thereby reducing endothelin's vasoconstrictive effects.
The nucleic acid molecules effectively inhibit ETAR expression, potentially ameliorating conditions such as pulmonary arterial hypertension with reduced side effects compared to existing drugs.
Smart Images

Figure JPOXMLDOC01-APPB-C000010 
Figure JPOXMLDOC01-APPB-C000011 
Figure JPOXMLDOC01-APPB-C000012
Abstract
Description
Nucleic acid molecules that inhibit the expression of endothelin A receptor
[0001] The present invention relates to a pharmaceutical composition characterized by containing a nucleic acid molecule or a salt thereof that inhibits the expression of the endothelin A receptor, or a solvate thereof, and one or more thereof as an active ingredient. The present invention also relates to a preventive and / or therapeutic agent for diseases in which endothelin is suspected to be involved (e.g., pulmonary arterial hypertension).
[0002] Endothelin (ET) is a vasoactive contractile peptide derived from vascular endothelial cells, composed of 21 amino acids, isolated and identified from the supernatant of vascular endothelial cultures (Nature, 1988, 332, pp. 411-415). Currently, three isoforms of endothelin (ET-1, ET-2, and ET-3) are known from human gene cloning (Proc Natl Acad Sci, 1989, 86, pp. 2863-2867). It is expressed in organs throughout the body, including the lungs, and is mainly produced by vascular endothelial cells. Its secretion is enhanced by various factors such as cytokines (thrombin, TGF-β, interleukin-1, etc.) and shear stress. Because endothelin has a strong vasoconstrictive effect, it is known to be associated with conditions such as hypertension, pulmonary hypertension, stroke, heart failure, myocardial infarction, arteriosclerosis, intimal thickening of blood vessels, kidney disease (e.g., renal failure), and asthma.
[0003] The effects of endothelin are expressed via endothelin receptors. Two subtypes of endothelin receptors are known: endothelin A receptor (hereinafter also called "ETAR") and endothelin B receptor (hereinafter also called "ETBR"). ETAR has affinity for ET-1, ET-2, and ET-3 in the order of ET-1 ≥ ET-2 > ET-3, while ETBR shows equivalent affinity for ET-1, ET-2, and ET-3.
[0004] ETAR is primarily expressed in vascular smooth muscle and is involved in vasoconstriction, central sympathetic nerve activation, and aldosterone secretion promotion, while ETBR is highly expressed in vascular endothelial cells and is involved in vasodilation and endothelin clearance. Therefore, if drugs that can inhibit the expression of endothelin (ET-1, ET-2, ET-3), drugs that can antagonize endothelin at endothelin receptors (ETAR, ETBR) (endothelin receptor antagonists), or drugs that can inhibit the expression of endothelin receptors (ETAR, ETBR) are found, it is expected that prevention and / or treatment of diseases suspected to be related to endothelin will become possible.
[0005] Endothelin has attracted attention as a potential therapeutic target for cardiovascular diseases, and its clinical potential has been demonstrated, for example, in the treatment of pulmonary arterial hypertension (PAH). In recent years, drugs that act antagonistically to ETAR or ETBR, and are expected to improve the symptoms of pulmonary arterial hypertension by suppressing the vasoconstrictive effect and vascular smooth muscle cell proliferation effect of endothelin (e.g., small molecule drugs such as macitentan, bosentan, and ambrisentan) have been used in clinical practice. On the other hand, side effects such as headache, dizziness, anemia, hot flashes, flushing, edema, and liver dysfunction have been reported when using the aforementioned ETAR or ETBR antagonists.
[0006] U.S. Patent No. 9,295,631 discloses an siRNA that has the function of suppressing the expression of genes corresponding to ETAR or ETBR in relation to a skin whitening method (Patent Document 1). International Publication No. 2023 / 163497 discloses an siRNA that inhibits ETAR expression for use in the prevention or treatment of colorectal cancer (Patent Document 2).
[0007] Life Sci., 2019, 228, pp.295-304. discloses the nucleotide sequence of ETAR siRNA in the context of explaining the improvement of renal ischemia-reperfusion injury (Non-Patent Literature 1). Int J Mol Med., 2018, 41, pp.1619-1626. discloses the nucleotide sequence of ETAR siRNA in the context of explaining the control of gastric cancer cell proliferation, apoptosis, and invasion (Non-Patent Literature 2).
[0008] Nat Commun., 2016, 7, 10774, discloses the nucleotide sequences of human ETAR siRNA and others in an explanation of the intrinsic ability of vascular progenitor cells to develop into cardiac tissue and self-organize (Non-Patent Literature 3). Mol Cell Biochem., 2016, 415, pp.13-28, discloses the nucleotide sequences of ETAR siRNA and ETBR siRNA in an explanation of the activation of proMMP-2 by ET-1 in pulmonary artery smooth muscle cells (Non-Patent Literature 4).
[0009] The nucleotide sequences of ETAR siRNA and ETBR siRNA are disclosed in the explanation of the role of endothelin receptor signaling in squamous cell carcinoma in Int J Oncol., 2012, 40, pp.1011-1019 (Non-Patent Literature 5). The nucleotide sequence of ETAR siRNA is disclosed in the explanation of the proliferation stimulation of intravascular endothelin-1 in vitro by Chlamydia pneumoniae infection in Thromb Haemost., 2009, 102, pp.743-753 (Non-Patent Literature 6).
[0010] U.S. Patent No. 9,295,631, International Publication No. 2023 / 163,497
[0011] Life Sci., 2019, 228, pp.295-304.Int J Mol Med., 2018, 41, pp.1619-1626.Nat Commun., 2016, 7, 10774.Mol Cell Biochem., 2016, 415, pp.13-28.Int J Oncol., 2012, 40, pp.1011-1019. Thromb Haemost., 2009, 102, pp.743-753.
[0012] In the circumstances described above, the present invention aims to provide nucleic acid molecules, salts thereof, or solvates thereof that can inhibit the expression of endothelin A receptor (ETAR), and pharmaceutical compositions characterized by containing one or more thereof as active ingredients, and their pharmaceutical uses, particularly as preventive and / or therapeutic agents for diseases in which endothelin is suspected to be involved (e.g., pulmonary arterial hypertension). Furthermore, the present invention also aims to provide a method for producing the nucleic acid molecules, salts thereof, or solvates thereof.
[0013] As a result of diligent research, the present inventors have discovered a nucleic acid molecule or a salt thereof, or a solvate thereof, that can inhibit the expression of the endothelin A receptor (ETAR) and has the characteristics described below. Specifically, the present invention is characterized by a nucleic acid molecule for inhibiting the expression of ETAR, wherein the nucleic acid molecule includes a double-stranded region formed from a sense strand and an antisense strand complementary to the sense strand, the sense strand and the antisense strand each contain 19 to 29 nucleotides, the antisense strand includes a region complementary to a part of the mRNA encoding ETAR, and the nucleotides of the sense strand and the antisense strand may contain at least one modified nucleotide.
[0014] The nucleic acid molecules or salts thereof, or solvates thereof, that can inhibit the expression of the endothelin A receptor according to the present invention can inhibit the expression of ETAR, and therefore may have an ameliorative effect on diseases in which endothelin is suspected to be involved (e.g., pulmonary arterial hypertension). Based on this finding, the inventors have completed the present invention.
[0015] The present invention relates to nucleic acid molecules or salts thereof, or solvates thereof, that can inhibit the expression of the endothelin A receptor as shown in the following embodiments, and to pharmaceutical compositions characterized by containing one or more thereof as active ingredients, and to pharmaceutical uses thereof, more specifically as follows [1] to [6-1].
[0016] [1] A nucleic acid molecule or a salt thereof, or a solvate thereof, comprising a sense strand and an antisense strand, wherein the strands form a double-stranded region, and the sense strand and the antisense strand contain nucleotide sequences selected from combinations of sense strands and antisense strands indicated by the identification numbers in the table below. In the nucleotide sequences in the table, A represents adenosine-3'-phosphate; C represents cytidine-3'-phosphate; G represents guanosine-3'-phosphate; U represents uridine-3'-phosphate; dA represents 2'-deoxyadenosine-3'-phosphate; dC represents 2'-deoxycytidine-3'-phosphate; dG represents 2'-deoxyguanosine-3'-phosphate; dT represents thymidine-3'-phosphate.
[0017] [1-1A] The nucleic acid molecule or a salt thereof according to embodiment [1], or a solvate thereof, wherein the sense strand and the antisense strand each independently contain 19 to 29 nucleotides in length. [1-1B] The nucleic acid molecule or a salt thereof according to embodiment [1], or a solvate thereof, wherein the sense strand and the antisense strand each independently contain 19 to 27 nucleotides in length. [1-1C] The nucleic acid molecule or a salt thereof according to embodiment [1], or a solvate thereof, wherein the sense strand and the antisense strand each independently contain 21 to 23 nucleotides in length.
[0018] [1-2] The nucleic acid molecule or its salt, or their solvates according to any one of the above aspects [1] to [1-1C], wherein the sense strand and the antisense strand contain nucleotide sequences selected from combinations of the sense strand and the antisense strand indicated by the identification numbers in the following table. The letters of the nucleotide sequences in the table have the same definitions as those in the above aspect [1].
[0019] [1-3] The nucleic acid molecule or its salt, or their solvates according to any one of the above aspects [1] to [1-1C], wherein the sense strand and the antisense strand are nucleotide sequences selected from combinations of the sense strand and the antisense strand indicated by the identification numbers in the table described in the above aspect [1-2].
[0020] [1-4] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [1] to [1-3], wherein the nucleic acid base sequence of the antisense strand has at least about 80% complementarity with the isolength portion of mRNA encoding endothelin A receptor (ETAR) (SEQ ID NO: 1 shows the nucleic acid sequence of human ETAR mRNA; hereinafter simply referred to as "SEQ ID NO: 1"). [1-4-1] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [1] to [1-3], wherein the nucleic acid base sequence of the antisense strand has at least about 90% complementarity with the isolength portion of mRNA encoding endothelin A receptor (ETAR) (SEQ ID NO: 1). [1-4-2] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [1] to [1-3], wherein the nucleic acid base sequence of the antisense strand has 100% complementarity with the isolength portion of mRNA encoding endothelin A receptor (ETAR) (SEQ ID NO: 1). [1-4-3] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [1-4] to [1-4-2], wherein the antisense strand region complementary to the isolength portion of mRNA encoding endothelin A receptor (ETAR) (SEQ ID NO: 1) is 19 to 29 nucleotides long. [1-4-4] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [1-4] to [1-4-2], wherein the antisense strand region complementary to the isolength portion of mRNA encoding endothelin A receptor (ETAR) (SEQ ID NO: 1) is 19 to 27 nucleotides long. [1-4-5] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [1-4] to [1-4-2], wherein the antisense strand region complementary to the isolength portion of the mRNA encoding the endothelin A receptor (ETAR) (SEQ ID NO: 1) is 21 to 23 nucleotides long.
[0021] A nucleic acid molecule or a salt thereof, or a solvate thereof, comprising a [1-5] sense strand and an antisense strand, wherein the strands form a double-stranded region, and the sense strand and the antisense strand each independently comprise 19 to 29 nucleotides in length, and the nucleic acid base sequence of the antisense strand is counted from the 5'-position of the mRNA encoding ETAR (SEQ ID NO: 1), 549, 620, 716, 720, 737, 824, 828, 830, 832, 833, 893, 958, 959, 961, 962, 963, 967, 1008, 1010, 1012, 1014, 1015, 1018, 1019, 1110, 1111, 1113, 1144, 1271, 1301, 1390, 1391, 1392, 1448, 1450, 1451, 1452, 1452, 1453, 1454, 1455, 1456, 1457, 1458, 1459, 1534, 1535, 1536, 1550, 1552, 1554, 1556, 1557, 1558, 1559, 1560, 1561 or 1562, having at least about 80% complementarity to the nucleic acid base sequence portion starting from the nucleic acid molecule or a salt thereof, or a solvate thereof.
[0022] [1-5A] A nucleic acid molecule or salt thereof comprising a sense strand and an antisense strand, or a solvate thereof, wherein the strands form a double-stranded region, and each of the sense strand and the antisense strand independently comprises 19 to 29 nucleotides in length, and the nucleic acid base sequence of the antisense strand, counting from the 5' position of the mRNA encoding ETAR (SEQ ID NO: 1), is 4, 314, 343, 347, 382, 386, 391, 418, 422, 425, 430, 435, 439, 443, 520, 528, 529, 530, 531, 534, 548, 549, 550, 551, 59 1, 593, 594, 596, 615, 616, 617, 618, 619, 621, 622, 623, 639, 643, 647, 651, 656, 672, 717, 718, 719, 725, 729, 735, 736, 737, 742, 750, 792, 804, 809, 824 ,828,829,830,831,857,872,876,879,883,892,911,917,922,935,938,946,954,955,956,957,960,962,964,965,966,968,1004,1008,1014,1016, 1017, 1018, 1020, 1022, 1086, 1090, 1094, 1098, 1112, 1142, 1143, 1145, 1149, 1153, 1155, 1163, 1174, 1182, 1205, 1208, 1215, 1219, 1222, 1230, 1236, 1239, 1242, 1302, 1310, 1315, 1356, 1360, 1364, 1389, 1393, 1398, 1402, 1405, 1408, 1412, 1416, 1420, 1424, 1450, 1452, 1453, 1455, 1456, 1457, 1460, A nucleic acid molecule or salt thereof having at least approximately 80% complementarity to the nucleic acid base sequence portion starting at position 1461, 1480, 1488, 1494, 1503, 1544, 1548, 1551, 1554, 1555, 1556, 1557, 1558, 1560, 1614, 1615, 1616, 1950, 2002, 2005, 2209, 2292, 2295, 2302, 2440, 2558, 2569, 2777, 2919, 2954, 3146, 3299, 3559, 3617, 3647, 3651, 3813, 3904, 3908, or 3921,or their solvates.
[0023] [1-5-1] A nucleic acid molecule or salt thereof comprising a sense strand and an antisense strand, or a solvate thereof, wherein the strands form a double-stranded region, the sense strand and the antisense strand each independently comprises 19 to 29 nucleotides in length, and the nucleic acid base sequence of the antisense strand has at least about 80% complementarity with the nucleic acid base sequence portion of the mRNA encoding the ETAR shown below (SEQ ID NO: 1). Nucleic acid base sequence portion of Sequence ID No. 1: 549-569, 620-640, 716-736, 720-740, 737-757, 824-846, 828-846, 828-848, 828-850, 830-852, 832-852, 833-853, 893-913, 958-978, 959-979, 961-981, 962-980, 962-982, 963-983, 967-98 7, 1008-1036, 1010-1036, 1010-1036, 1012-1036, 1014-1036, 1015-1035, 1015-1037, 1018-1038, 1019-1039, 1110-1130, 1111-1131, 1113-1133, 1144-1164, 1271-1291, 1301-1321, 1390-1410, 1391-1411, 13 92-1412, 1448-1476, 1450-1476, 1451-1471, 1452-1472, 1452-1474, 1452-1476, 1452-1476, 1453-1473, 1453-1475, 1454-1474, 1454-1476, 1455-1473, 1455-1475, 1455-1477, 1456-1474, 1456-1476, 1457-1 475, 1457-1477, 1458-1478, 1459-1479, 1534-1554, 1535-1555, 1536-1556, 1550-1578, 1552-1578, 1554-1578, 1556-1578, 1557-1579, 1558-1580, 1559-1581, 1560-1578, 1560-1580, 1561-1581 or 1562-1582.
[0024] [1-5A-1] A nucleic acid molecule or salt thereof comprising a sense strand and an antisense strand, or a solvate thereof, wherein the strands form a double-stranded region, the sense strand and the antisense strand each independently comprises 19 to 29 nucleotides in length, and the nucleic acid base sequence of the antisense strand has at least about 80% complementarity with the nucleic acid base sequence portion of the mRNA encoding the ETAR shown below (SEQ ID NO: 1). Nucleic acid base sequence portion of Sequence ID No. 1: 4-26, 314-336, 343-365, 347-369, 382-404, 386-408, 391-413, 418-440, 422-444, 425-447, 430-452, 435-457, 439-461, 443-465, 520-542, 528-546, 529-547, 529-551, 530-548, 531-549, 534-556, 548-566, 549-571, 550-568, 551-569, 591-613, 593-611, 594-612, 596-618, 615-633, 616-634, 617-635, 618-636, 619-637, 621-639, 622-640, 623-641, 639-661, 643-665, 647-669, 651-673, 656-678, 672-694, 717-735, 718-736, 719-737, 725-747, 729-75 1, 735-753, 736-754, 737-755, 737-759, 742-764, 750-772, 792-814, 804-826, 809-831, 824-846, 828-846, 828-850, 829-847, 830-848, 831-849, 857-879, 872-894, 876-898, 879-901, 883-905, 892-914, 911-933, 917-939, 922-944, 935- 957, 938-960, 946-968, 954-972, 955-973, 956-974, 957-975, 960-978, 960-982, 962-980, 964-982, 965-983, 966-984, 968-986, 1004-1026, 1008-1030, 1014-1032, 1014-1036, 1016-1034, 1017-1035, 1018-1040, 1020-1038, 1022-1044,1086-1108, 1090-1112, 1094-1116, 1098-1120, 1112-1130, 1142-1164, 1143-1161, 1145-1163, 1145-1167, 1149-1171, 1153-1175, 1155-1177, 1163-1185, 1174-1196, 1182-1204, 1205-1227, 1208-1230, 1215-1237, 1219-1241, 1222-1244, 1230-1252, 1236-1258, 12 39-1261, 1242-1260, 1242-1264, 1302-1320, 1310-1332, 1315-1337, 1356-1378, 1360-1382, 1364-1386, 1389-1407, 1393-1415, 1398-1420, 1402-1424, 1405-1427, 1408-1430, 1412-1434, 1416-1438, 1420-1442, 1424-1446, 1450-1468, 1452-1474, 1453-1475, 1455- 1477, 1456-1474, 1457-1475, 1460-1478, 1461-1479, 1480-1502, 1488-1506, 1494-1516, 1503-1525, 1544-1566, 1548-1570, 1551-1573, 1554-1578, 1555-1578, 1556-1578, 1557-1579, 1558-1580, 1560-1578, 1560-1578, 1614-1632, 1615-1633, 1616-1634, 1950-197 2. 2002-2024, 2005-2027, 2209-2231, 2292-2314, 2295-2317, 2302-2324, 2440-2462, 2558-2580, 2569-2591, 2777-2799, 2919-2941, 2954-2976, 3146-3168, 3299-3321, 3559-3581, 3617-3639, 3647-3669, 3651-3673, 3813-3835, 3904-3926, 3908-3930, or 3921-3943.
[0025] [1-5-2] A nucleic acid molecule or salt thereof, or a solvate thereof, according to embodiment [1-5] or [1-5-1], wherein the nucleic acid base sequence of the antisense strand has at least about 90% complementarity with the isolength portion of mRNA encoding endothelin A receptor (ETAR) (SEQ ID NO: 1). [1-5-3] A nucleic acid molecule or salt thereof, or a solvate thereof, according to embodiment [1-5] or [1-5-1], wherein the nucleic acid base sequence of the antisense strand has 100% complementarity with the isolength portion of mRNA encoding endothelin A receptor (ETAR) (SEQ ID NO: 1). [1-5-4] A nucleic acid molecule or salt thereof, or a solvate thereof, according to any one of embodiments [1-5] to [1-5-3], wherein the region of the antisense strand complementary to the isolength portion of mRNA encoding endothelin A receptor (ETAR) (SEQ ID NO: 1) is 19 to 27 nucleotides long. [1-5-5] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [1-5] to [1-5-3], wherein the antisense strand region complementary to the isolength portion of the mRNA encoding the endothelin A receptor (ETAR) (SEQ ID NO: 1) is 21 to 23 nucleotides long.
[0026] [1-6] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [1] to [1-5-5], wherein at least one of the sense strand and the antisense strand has an overhang (protrusion) consisting of a single strand of 1 to 8 nucleotides in length at its 5' end and / or 3' end. [1-6-1] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [1] to [1-5-5], wherein at least one of the sense strand and the antisense strand has an overhang (protrusion) consisting of a single strand of 1 to 3 nucleotides in length at its 5' end and / or 3' end. [1-6-2] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [1] to [1-5-5], wherein at least one of the sense strand and the antisense strand has an overhang (protrusion) consisting of a single strand of 2 nucleotides in length at its 5' end and / or 3' end. [1-6-3] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [1] to [1-5-5], wherein the 5' end and / or 3' end overhangs (protrusions) are stabilized against decomposition.
[0027] [1-7] A nucleic acid molecule or salt thereof according to any one of embodiments [1] to [1-6-3], or a solvate thereof, wherein at least one of the sense strand and the antisense strand contains at least one modified nucleotide. [1-7-1] A nucleic acid molecule or salt thereof according to any one of embodiments [1] to [1-6-3], or a solvate thereof, wherein substantially all of the nucleotides of the sense strand contain a modified nucleotide. [1-7-2] A nucleic acid molecule or salt thereof according to any one of embodiments [1] to [1-6-3], or a solvate thereof, wherein substantially all of the nucleotides of the antisense strand contain a modified nucleotide. [1-7-3] A nucleic acid molecule or salt thereof according to any one of embodiments [1] to [1-6-3], or a solvate thereof, wherein substantially all of the nucleotides of the sense strand and the antisense strand contain a modified nucleotide. [1-7-4] A phosphate group (P(O)(OH) is attached to the hydroxyl group at the 5' position of the nucleotide at the 5' end of the sense strand or the antisense strand. 2) or thiophosphate group (P(S)(OH) 2 A nucleic acid molecule or a salt thereof according to any one of the embodiments [1] to [1-6-3], comprising a nucleotide substituted with ).
[0028] [1-8] The modified nucleotide is a 2'-deoxynucleotide, a 2'-O-alkyl modified nucleotide (2'-O-methyl(2'OMe) modified nucleotide, 2'-O-C 16 H 33 A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of the embodiments [1-7] to [1-7-4], comprising modification of one or more sugar groups selected from the group consisting of modified nucleotides, 2'-deoxy-2'-fluoro-modified nucleotides, 2'-deoxy-2'-NHAc-modified nucleotides, and debasalized nucleotides.
[0029] [1-9] A nucleic acid molecule or salt thereof, or a solvate thereof, according to any one of embodiments [1-7] to [1-8], wherein the modified nucleotide includes modification of one or more internucleoside bonds selected from the group consisting of phosphorothioate bonds, phosphorodithioate bonds, and boranophosphate bonds. [1-9-1] A nucleic acid molecule or salt thereof, or a solvate thereof, according to embodiment [1-9], wherein the modified nucleotide includes modification of an internucleoside bond which is a phosphorothioate bond.
[0030] [1-9-2] A nucleic acid molecule or a salt thereof according to any one of embodiments [1-7] to [1-9-1], wherein at least one of the sense strand and the antisense strand contains at least one phosphorothioate bond at its 5' end. [1-9-3] A nucleic acid molecule or a salt thereof according to any one of embodiments [1-7] to [1-9-1], wherein at least one of the sense strand and the antisense strand contains at least one phosphorothioate bond at its 3' end. [1-9-4] A nucleic acid molecule or a salt thereof according to any one of embodiments [1-7] to [1-9-1], wherein the sense strand and the antisense strand contain at least one phosphorothioate bond at their 5' and 3' ends. [1-9-5] A nucleic acid molecule or a salt thereof according to any one of embodiments [1-7] to [1-9-1], wherein the sense chain and the antisense chain each contain two phosphorothioate bonds at their 5' and 3' ends.
[0031] [1-10] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [1-7] to [1-9-4], wherein the modified nucleotide comprises modification of one or more sugar groups selected from the group consisting of 2'-deoxynucleotides, 2'-O-methyl (2'OMe) modified nucleotides, and 2'-fluoro (2'F) modified nucleotides, and further comprises at least one modification of internucleoside bonds which is a phosphorothioate bond at each of the 5' and 3' ends of the sense strand and / or antisense strand.
[0032] [1-11] A nucleic acid molecule or a salt thereof according to any one of the embodiments [1-7] to [1-10], wherein the sense strand and the antisense strand include a modified nucleotide sequence selected from combinations of sense strands and antisense strands indicated by the identification numbers in the table below. In the nucleotide sequences in the table, A is adenosine-3'-phosphate; C is cytidine-3'-phosphate; G is guanosine-3'-phosphate; U is uridine-3'-phosphate; dA is 2'-deoxyadenosine -3'-phosphate; dC or c is 2'-deoxycytidine-3'-phosphate; dG or g is 2'-deoxyguanosine-3'-phosphate; dT or T is thymidine-3'-phosphate; y is 2'-deoxyuridine-3'-phosphate; Am is 2'-O-methyladenosine-3'-phosphate; Cm is 2'-O-methylcytidine-3'-phosphate; Gm is 2'-O-methylguanosine-3'-phosphate; Um is 2' -O-methyluridine-3'-phosphate; Af is 2'-deoxy-2'-fluoroadenosine-3'-phosphate; Cf is 2'-deoxy-2'-fluorocytidine-3'-phosphate; Gf is 2'-deoxy-2'-fluoroguanosine-3'-phosphate; Uf is 2'-deoxy-2'-fluorouridine-3'-phosphate; U(NAc) is 2'-deoxy-2'-NHAc-uridine-3'-phosphate; U(Vp) is a modified nucleotide represented by the following formula: [Excluding the area outside the dashed line in the formula]; U(cPrp) is a modified nucleotide represented by the following formula: [Excluding the area outside the dashed line in the formula]; invAb is an inverted non-basic nucleotide represented by the following formula: [Excluding the area outside the dashed line in the formula]; A (C16) is a modified nucleotide represented by the following formula: [Excluding the area outside the dashed line in the formula]; C(C16) is a modified nucleotide represented by the following formula: [Excluding the area outside the dashed line in the formula]; = indicates a phosphorothioate bond (5'-3' bond).
[0033] [1-11-1] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of the embodiments [1-7] to [1-10], wherein the sense strand and the antisense strand include a modified nucleotide sequence selected from the combinations indicated by the identification numbers in the table below. The letters of the nucleotide sequences in the table have the same definition as in embodiment [1-11].
[0034] [1-11-2] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of the embodiments [1-7] to [1-10], wherein the sense strand and the antisense strand are modified nucleotide sequences selected from combinations of sense strands and antisense strands indicated by the identification numbers in the table described in embodiment [1-11-1].
[0035] [1-11-3] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [1-7] to [1-10], wherein a functional molecule is bound to the sense strand. [1-11-4] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to embodiment [1-11-3], wherein the binding position of the functional molecule is the oxygen atom at the 3' position of the nucleotide at the 3' end of the oligonucleotide of the sense strand, the oxygen atom at the 5' position of the nucleotide at the 5' end, the oxygen atom at the 2' position of any nucleotide of the oligonucleotide chain, or, if the nucleotide at the 5' end is invAb, the oxygen atom at the 3' position thereof. [1-11-5] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to embodiment [1-11-4], wherein the functional molecule is directly bound at the binding position described in embodiment [1-11-4]. [1-11-6] A nucleic acid molecule or salt thereof, or a solvate thereof, according to embodiment [1-11-4], wherein the functional molecule is bonded at the bond position described in embodiment [1-11-4] via a binding group such as a degradable group (e.g., a phosphate group, a thiophosphate group, an ester group, a carbamoyl group, a carbamate group, etc.) or an indegradable group (e.g., an alkyl group, an aryl group, a heteroaryl group, etc.). [1-11-7] A nucleic acid molecule or salt thereof, or a solvate thereof, according to embodiment [1-11-4], wherein the functional molecule is bonded at the bond position described in embodiment [1-11-4] via a binding group described in embodiment [1-11-6] and / or an arbitrary linker. [1-11-8] A nucleic acid molecule or salt thereof, or a solvate thereof, according to any one of embodiments [1-11-3] to [1-11-5], wherein the functional molecule is selected from lipids, proteins, peptides, antibodies, glycans, small molecule compounds, etc. [1-11-9] Functional molecules, or combinations of linkers and functional molecules, have the following structural formulas: A nucleic acid molecule or a salt thereof, or a solvate thereof, selected from the group consisting of [the part to the right of the dashed line in each formula], according to the embodiment [1-11-5].
[0036] [1-11-10] A nucleic acid molecule or a salt thereof, or a solvate thereof, containing a modified nucleotide sequence selected from a combination of a sense strand and an antisense strand, as indicated by the identification number in the table below. The letters and symbols of the nucleotide sequences in the table have the same definitions as in embodiments [1-11] and [1-11-7] above.
[0037] [1-12] A nucleic acid molecule or a salt thereof, or a solvate thereof, comprising a sense strand and an antisense strand, wherein the strands form a double-stranded region, the sense strand and the antisense strand are each 23 nucleotides long, and in the antisense strand, the nucleotides at positions 2, 6, 9, 14 and 16 in the 5'→3' direction of its sequence are 2'-deoxy-2'-fluoro modified nucleotides, and any nucleotide at positions 4, 8, 10, 12 or 18 may also be a 2'-deoxy-2'-fluoro modified nucleotide, and the total number of 2'-deoxy-2'-fluoro modified nucleotides in the antisense strand is 5 to 7.
[0038] [1-12-1] A nucleic acid molecule or a salt thereof according to embodiment [1-12], wherein the nucleotides at positions 2, 4, 6, 8, 9, 14 and 16 in the 5'→3' direction of the antisense chain are 2'-deoxy-2'-fluoromodified nucleotides. [1-12-2] A nucleic acid molecule or a salt thereof according to embodiment [1-12], wherein the nucleotides at positions 2, 4, 6, 9, 10, 14 and 16 in the 5'→3' direction of the antisense chain are 2'-deoxy-2'-fluoromodified nucleotides.
[0039] [1-12-3] A nucleic acid molecule or a salt thereof according to embodiment [1-12], wherein the nucleotides at positions 2, 4, 6, 9, 12, 14 and 16 in the 5'→3' direction of the antisense chain are 2'-deoxy-2'-fluoromodified nucleotides. [1-12-4] A nucleic acid molecule or a salt thereof according to embodiment [1-12], wherein the nucleotides at positions 2, 4, 6, 9, 14, 16 and 18 in the 5'→3' direction of the antisense chain are 2'-deoxy-2'-fluoromodified nucleotides.
[0040] [1-12-5] A nucleic acid molecule or a salt thereof according to embodiment [1-12], wherein the nucleotides at positions 2, 6, 8, 9, 10, 14 and 16 in the 5'→3' direction of the antisense chain are 2'-deoxy-2'-fluoromodified nucleotides. [1-12-6] A nucleic acid molecule or a salt thereof according to embodiment [1-12], wherein the nucleotides at positions 2, 6, 8, 9, 12, 14 and 16 in the 5'→3' direction of the antisense chain are 2'-deoxy-2'-fluoromodified nucleotides.
[0041] [1-12-7] A nucleic acid molecule or a salt thereof according to embodiment [1-12], wherein the nucleotides at positions 2, 6, 8, 9, 14, 16 and 18 in the 5'→3' direction of the antisense chain are 2'-deoxy-2'-fluoro-modified nucleotides. [1-12-8] A nucleic acid molecule or a salt thereof according to embodiment [1-12], wherein the nucleotides at positions 2, 6, 9, 10, 12, 14 and 16 in the 5'→3' direction of the antisense chain are 2'-deoxy-2'-fluoro-modified nucleotides.
[0042] [1-12-9] A nucleic acid molecule or a salt thereof according to embodiment [1-12], wherein the nucleotides at positions 2, 6, 9, 10, 14, 16 and 18 in the 5'→3' direction of the antisense chain are 2'-deoxy-2'-fluoromodified nucleotides. [1-12-10] A nucleic acid molecule or a salt thereof according to embodiment [1-12], wherein the nucleotides at positions 2, 6, 9, 12, 14, 16 and 18 in the 5'→3' direction of the antisense chain are 2'-deoxy-2'-fluoromodified nucleotides.
[0043] [1-12-11] A nucleic acid molecule or a salt thereof according to embodiment [1-12], wherein the nucleotides at positions 2, 6, 9, 14 and 16 in the 5'→3' direction of the antisense chain are 2'-deoxy-2'-fluoromodified nucleotides.
[0044] [1-13] A nucleic acid molecule or salt thereof according to any one of the embodiments [1] to [1-12-11], or a solvate thereof, which inhibits the expression of endothelin A receptor (ETAR). [1-13-1] Inhibition rate IC of endothelin A receptor (ETAR) expression 50 However, 0 < IC 50 [1-13-2] A nucleic acid molecule or salt thereof, or a solvate thereof, according to any one of the embodiments [1] to [1-12-11], wherein the inhibition rate of endothelin A receptor (ETAR) expression is approximately 30% or more, approximately 40% or more, approximately 50% or more, approximately 60% or more, approximately 70% or more, approximately 80% or more, approximately 90% or more, or approximately 95% or more, according to any one of the embodiments [1] to [1-12-11], wherein the inhibition rate of endothelin A receptor (ETAR) expression is approximately 80% or more, approximately 90% or more, or approximately 95% or more, according to any one of the embodiments [1] to [1-12-11], wherein the inhibition rate of endothelin A receptor (ETAR) expression is approximately 80% or more, approximately 90% or more, or approximately 95% or more, according to any one of the embodiments [1] to [1-12-11], or a solvate thereof. [1-13-4] The inhibition rate of endothelin A receptor (ETAR) expression is approximately 80% or higher, or the inhibition rate of ETAR expression IC 50 However, 0 < IC 50The nucleic acid molecule or its salt according to any one of the above aspects [1] to [1-12-11], or their solvate, which is ≦ about 1000 pM. [1-13-5] The inhibition rate of the expression of endothelin A receptor (ETAR) is about 50% or more, or the inhibition rate IC of the expression of ETAR 50 is such that 0 < IC 50 The nucleic acid molecule or its salt according to any one of the above aspects [1] to [1-12-11], or their solvate, which is ≦ about 1000 pM. [1-13-6] The inhibition rate of the expression of endothelin A receptor (ETAR) is about 30% or more, or the inhibition rate IC of the expression of ETAR 50 is such that 0 < IC 50 The nucleic acid molecule or its salt according to any one of the above aspects [1] to [1-12-11], or their solvate, which is ≦ about 1000 pM.
[0045] [1-14] The nucleic acid molecule or its salt according to any one of the above aspects [1] to [1-13-4], or their solvate, which contains 1 to 2 mismatched bases (non-complementary nucleobases) at any position in the double-stranded region.
[0046] [1-15] The nucleic acid molecule or its salt according to any one of the above aspects [1] to [1-14], or their solvate, wherein the nucleic acid molecule is siRNA.
[0047] [2] A pharmaceutical composition containing the nucleic acid molecule or its salt according to any one of the above aspects [1] to [1-14], or their solvate, and a pharmaceutically acceptable carrier. [2-1] The pharmaceutical composition according to the above aspect [2], wherein the nucleic acid molecule is siRNA.
[0048] [3] The pharmaceutical composition according to embodiment [2] or [2-1], for use in the treatment of a disease in which endothelin is presumed to be involved. [3-1] The pharmaceutical composition according to embodiment [3], wherein the disease in which endothelin is presumed to be involved is a disease such as pulmonary arterial hypertension (IPF), focal segmental glomerulosclerosis, IgA nephropathy, chronic kidney disease (including diabetic nephropathy), renal impairment associated with sickle cell anemia, acute kidney injury, hypertension, non-alcoholic steatohepatitis (NASH), cancer, pain associated with endometriosis, complications associated with scleroderma, cerebral vasospasm, hypertrophic cardiomyopathy, etc. [3-2] The pharmaceutical composition according to embodiment [3], wherein the disease in which endothelin is presumed to be involved is pulmonary arterial hypertension.
[0049] [4] A method for inhibiting the expression of endothelin A receptor (ETAR) in cells, comprising contacting the cells with a nucleic acid molecule or siRNA or a salt thereof described in any one of embodiments [1] to [1-15], or with a pharmaceutical composition described in embodiment [2] or [2-1]. [4-1] The method according to embodiment [4], wherein the cells are present in a living organism of a subject. [4-2] The method according to embodiment [4-1], wherein the subject is a human. [4-3] The method according to any one of embodiments [4] to [4-2], wherein the inhibition rate of endothelin A receptor (ETAR) expression is approximately 30% or more, approximately 40% or more, approximately 50% or more, approximately 60% or more, approximately 70% or more, approximately 80% or more, approximately 90% or more, or approximately 95% or more. [4-4] Inhibition rate of endothelin A receptor (ETAR) expression IC 50 However, 0 < IC 50 The method according to any one of the embodiments [4] to [4-2], wherein the concentration is ≤ approximately 1000 pM.
[0050] [5] A method for inhibiting the expression of endothelin A receptor (ETAR) in a subject, comprising administering to the subject in a therapeutically effective amount a nucleic acid molecule or siRNA or a salt thereof, or a solvate thereof, as described in any one of the embodiments [1] to [1-15], or a pharmaceutical composition as described in embodiment [2]. [5-1] The method according to embodiment [5], wherein the subject is a human. [5-2] The method according to embodiment [5] or [5-1], wherein the inhibition rate of endothelin A receptor (ETAR) expression is approximately 30% or more, approximately 40% or more, approximately 50% or more, approximately 60% or more, approximately 70% or more, approximately 80% or more, approximately 90% or more, or approximately 95% or more. [5-3] Inhibition rate IC of endothelin A receptor (ETAR) expression 50 However, 0 < IC 50 The method according to embodiment [5] or [5-1], wherein the concentration is ≤ approximately 1000 pM.
[0051] [6] A method for treating a subject suffering from a disease involving the endothelin A receptor (ETAR), comprising administering to the subject a therapeutically effective amount of a nucleic acid molecule or siRNA or a salt thereof, or a solvate thereof, as described in any one of the embodiments [1] to [1-15], or the pharmaceutical composition described in embodiment [2]. [6-1] The method according to embodiment [6], wherein the subject is a human.
[0052] The present invention provides nucleic acid molecules or salts thereof that can inhibit the expression of endothelin A receptor (ETAR), or solvates thereof, and pharmaceutical compositions containing one or more thereof. Furthermore, the nucleic acid molecules or salts thereof that can inhibit the expression of ETAR, or solvates thereof, contain a region complementary to a part of the gene (mRNA) encoding ETAR, and by inhibiting the expression of ETAR in conjunction with the gene, they have the effect of preventing and / or treating diseases in which endothelin is suspected to be involved.
[0053] By using the nucleic acid molecule of the present invention, it becomes possible to target genes involved in ETAR expression in mammals and degrade those genes. In in vitro tests of the nucleic acid molecule shown in the examples described below, it was demonstrated that the nucleic acid molecule of the present invention that can inhibit the expression of the endothelin A receptor significantly inhibits the expression of ETAR mRNA (in other words, the expression of ETAR). Therefore, the nucleic acid molecule of the present invention that can inhibit the expression of the endothelin A receptor is a useful siRNA for the prevention or treatment of diseases in which endothelin is suspected to be involved, such as pulmonary arterial hypertension.
[0054] The embodiments of the present invention will be described in detail below. However, the present invention is not limited to the embodiments described below, and can be implemented in any form without departing from the spirit of the invention. Furthermore, preferred and more preferred embodiments exemplified below can be combined with each other as appropriate, regardless of expressions such as "for example," "preferred," and "more preferred." In addition, the numerical ranges are described as examples, and the upper or lower limits of each range can be combined with the numerical values described in the examples as appropriate.
[0055] Definitions: "Nucleic acid" refers to a molecule composed of monomeric nucleotides. "Nucleic acid molecule" is not particularly limited, but may include, for example, oligonucleotides, ASOs, siRNA, shRNA, miRNA, single-stranded nucleic acid molecules, double-stranded nucleic acid molecules, RNA, DNA, etc. The nucleic acid molecule is capable of mediating RNA interference with ETAR gene expression, and is preferably siRNA. "Target protein" refers to a protein whose regulation is desired.
[0056] A "target nucleic acid" (sometimes called a "target sequence") refers to a nucleic acid that can be targeted by a nucleic acid molecule.
[0057] "Target segment" refers to the sequence of nucleotides of a target nucleic acid that is targeted by the nucleic acid molecule of the present invention.
[0058] "Nucleic acid base sequence" refers to a continuous sequence of nucleic acid bases independent of any sugar moiety, binding site, or modified nucleic acid base. "Nucleoside" refers to a compound in which a nucleic acid base and a sugar moiety are bonded. "Ribonucleoside" refers to a nucleoside in which the sugar moiety is ribose. "Deoxyribonucleoside" refers to a nucleoside in which the sugar moiety is D-2-deoxyribose. "Nucleotide" refers to a compound in which a phosphate group is bonded to the sugar moiety of a nucleoside. "Oligononucleotide" refers to a compound having a structure in which nucleotides are polymerized by phosphodiester bonds or modified phosphodiester bonds. Naturally occurring oligonucleotides include, for example, 2'-deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and oligonucleotides in which the sugar moiety, phosphate moiety, or nucleic acid base moiety are modified independently of each other.
[0059] RNA interference (RNAi) refers to sequence-specific post-transcriptional gene silencing in animals mediated by small interfering RNA (siRNA). It has been reported that intracellular RNAi responses are induced by double-stranded RNA (dsRNA). Certain intracellular dsRNAs are affected by the enzymes Dicer and ribonuclease III. Dicer can cleave dsRNA into short fragments, producing siRNA.
[0060] siRNA is known to be involved in the endonuclease complex, which is part of the RNA-induced silencing complex (RISC). siRNA possesses an AS (also called the guide strand) that is incorporated into the RISC, and this AS mediates the cleavage of target mRNA with a complementary sequence. The other strand of the AS in siRNA is called the SS (also called the passenger strand). Cleavage of the target nucleic acid occurs near the region complementary to the AS of the siRNA. siRNA has been reported to downregulate or knock down gene expression by mediating sequence-specific RNA interference.
[0061] A "double-stranded region (dsRNA)" refers to a region that has a double-stranded structure containing two complementary, antiparallel nucleic acid strands (sense strand / antisense strand).
[0062] The "sense strand (sometimes abbreviated as SS)" refers to the nucleotide sequence of an siRNA that is partially or completely complementary to at least a portion of the corresponding antisense strand of a nucleic acid molecule (for example, siRNA, and more specifically, siRNA that can inhibit the expression of the endothelin A receptor (ETAR siRNA). The same applies to the description of "nucleic acid molecule" below). The sense strand of a nucleic acid molecule may include a nucleic acid sequence that has homology to the base sequence of the target nucleic acid.
[0063] The “antisense strand (sometimes abbreviated as AS)” refers to the nucleotide sequence of a nucleic acid molecule that is partially or completely complementary to at least a portion of the base sequence of the target nucleic acid. The antisense strand of a nucleic acid molecule may include a nucleic acid sequence that is at least partially or completely complementary to the corresponding sense strand of the nucleic acid molecule. If the complementary region is not completely complementary to the target sequence (referred to as a “mismatch”), such mismatch may be located, for example, within the 10, 9, 8, 7, 6, 5, 4, 3, or 2 nucleotides at the 5' and / or 3' ends.
[0064] "Complementarity" refers to the ability of an oligonucleotide or polynucleotide containing a second nucleotide sequence to hybridize with an oligonucleotide or polynucleotide containing a first nucleotide sequence to form a double-stranded structure under specific conditions (specifically, stringent conditions). Examples include the ability to form base pairs (hybridization) between the nucleic acid bases of the antisense strand of a nucleic acid molecule and the corresponding nucleic acid bases in the target nucleic acid, and the ability to form base pairs between the nucleic acid bases of the antisense strand of a nucleic acid molecule and the nucleic acid bases of the sense strand. Base pairs are formed by Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonds between the corresponding nucleic acid bases. Methods for determining whether the antisense strand and sense strand of a nucleic acid molecule, or the antisense strand of a nucleic acid molecule and the target nucleic acid, are specifically capable of hybridization are well known in the art. "Complementarity" is sometimes also referred to as "base complementarity."
[0065] "Complementary" nucleotide sequences may include base pairs formed from non-Watson-Crick base pairs, non-natural and modified nucleotides, as long as the requirements for hybridization are met. Examples of such non-Watson-Crick base pairs include, but are not limited to, G-U fluctuations and Hoogsteen-type base pairs.
[0066] The "subject" may include, but is not limited to, humans, non-human mammals (e.g., dogs, cats, rats, mice, rabbits, monkeys, chimpanzees, cows, horses, pigs, sheep, goats, etc.), birds (e.g., chickens), etc. The "subject" is preferably humans.
[0067] A "mismatched base (non-complementary nucleic acid base)" refers to a nucleic acid base of a first nucleic acid that cannot pair with the corresponding nucleic acid base of a second nucleic acid or target nucleic acid. Introducing a mismatched base into the antisense strand of a nucleic acid molecule involves (i) substituting some nucleic acid bases of the antisense strand with nucleic acid bases that cannot pair with the target nucleic acid, (ii) including some nucleic acid bases of the antisense strand with nucleic acid bases that cannot pair with the target nucleic acid, resulting in an increase in the length of the consecutive nucleotides by the amount of those nucleic acid bases (insertion), and (iii) in the complementary portion of the antisense strand and the target nucleic acid, the oligonucleotides of the antisense strand lack nucleic acid bases that can pair with the target nucleic acid, resulting in a decrease in the length of the consecutive nucleotides by the amount of those nucleic acid bases (deletion).
[0068] The term "equal-length portion" refers to the portion formed by the hybridization of the antisense strand of a nucleic acid molecule and the corresponding nucleic acid base of the target nucleic acid. If the mismatched base described above is not introduced into the antisense strand of siRNA, the length (number of nucleosides) of the nucleotides of the antisense strand and the target segment are the same. If the mismatched base described in (i) above is introduced into the antisense strand of a nucleic acid molecule, the length (number of nucleosides) of the nucleotides of the antisense strand and the target segment are the same. If the insertion described in (ii) above is introduced into the antisense strand of a nucleic acid molecule, the equal-length portion of the target nucleic acid is shorter than the nucleotides of the antisense strand by the amount of the insertion base (also referred to as having a reduced number of nucleosides). If the deletion described in (iii) above is introduced into the antisense strand of a nucleic acid molecule, the equal-length portion of the target nucleic acid is longer than the nucleotides of the antisense strand by the amount of the deletion base (also referred to as having an increased number of nucleosides).
[0069] "Expression" may refer to gene expression or target protein expression. The presence or level of such expression can be measured by the methods described in the examples of this specification, or by methods known to those skilled in the art. Expression includes all functions by which the information encoded by a gene is converted into structures that exist and function within the cell. Such structures may include, but are not limited to, the products of transcription and translation.
[0070] "Inhibition" means that a certain event is reduced compared to a control condition. For example, it means that the level of gene expression or mRNA encoding one or more proteins, or the activity of one or more encoded proteins, measured in the presence of nucleic acid molecules, is lower than the activity measured in the absence of nucleic acid molecules.
[0071] For example, the level of expression, mRNA level, or encoded protein activity level is reduced by at least approximately 5%, at least approximately 10%, at least approximately 30%, at least approximately 50%, at least approximately 70%, at least approximately 90%, and at least approximately 95% compared to the activity level observed in the absence of the nucleic acid molecule. Note that "inhibit" can also be expressed as "suppress" or "downregulate."
[0072] When describing a product as "inhibiting ETAR expression," it may also include "inhibiting ETAR mRNA expression," and vice versa.
[0073] The nucleic acid molecule of the present invention is a compound capable of regulating the expression of ETAR or ETAR mRNA.
[0074] "Expression regulation" refers to the ability of oligonucleotides to alter the amount of ETAR protein or ETAR mRNA compared to the amount of ETAR or ETAR mRNA before administration of a nucleic acid molecule. Expression regulation is determined by comparison with a control. One form of "regulation" is understood as the ability of oligonucleotides to inhibit, downregulate, reduce, suppress, remove, stop, block, prevent, decrease, reduce, avoid, or terminate ETAR expression, for example, by degrading or blocking the translation of ETAR mRNA.
[0075] "Modified nucleotides" refer to nucleotides having modifications to the sugar group of a nucleotide, modifications to the internucleoside bond, modifications to the nucleic acid base of a nucleotide, and / or modifications to the structure of one or more nucleotides at the end of a nucleic acid molecule, or combinations thereof. "Modification of sugar group" refers to substitution, conversion, etc., from the natural sugar portion.
[0076] A "modified oligonucleotide" refers to an oligonucleotide containing at least one modified nucleoside bond, modified sugar, modified nucleic acid base, etc.
[0077] A nucleotide is a nucleoside containing a phosphate group covalently bonded to the sugar portion of the nucleoside. In nucleosides containing pentofuranosyl sugars, the phosphate group can be bonded to the 2', 3', or 5' hydroxyl portion of the sugar. Oligonucleotides are formed through covalent bonds between adjacent nucleosides, forming linear polymers. Within the oligonucleotide structure, the phosphate group typically forms internucleoside bonds. "Internucleoside bond" refers to a chemical bond between nucleosides. The natural internucleoside bond in RNA or DNA is a 3'-to-5' phosphodiester bond. Oligonucleotides having one or more modified internucleoside bonds may be used to obtain desirable properties such as high intracellular uptake, high affinity for target nucleic acids, and high stability in the presence of nucleases.
[0078] "5'-vinylphosphonate modified nucleotide" is a nucleotide with -CH at the 4' position. 2 The OH group is -CH=CH-P(O)(OH) 2 This refers to a modified nucleotide in which a base has been substituted. Furthermore, "2'-acetamide-5'-vinylphosphonate modified nucleotide" refers to a modified nucleotide in which the 2' position of "5'-vinylphosphonate modified nucleotide" is 2'-deoxy-2'-NHAc.
[0079] The "5'-phosphorus stabilization moiety" refers to a nucleotide structure in which a phosphate residue containing a phosphate ester or modified phosphate ester (e.g., phosphorothioate, phosphodiester, etc.) is substituted at the 5' end. An example of the structure of the 5'-phosphorus stabilization moiety is shown in the following formula: Examples of substructures represented by the formula [wherein Base represents a nucleic acid base; X represents any substituent; Y represents a hydrogen atom, alkyl group, hydroxyl group protecting group, etc.] (excluding the dashed line and the part to the right of the dashed line) are, but are not limited to, these.
[0080] "Diseases in which endothelin is suspected to be involved" include, but are not limited to, the diseases listed in "8. Diseases involving endothelin A receptors" below.
[0081] "Effective dose" refers to the amount of siRNA that is effective in achieving the desired pharmacological, prophylactic, therapeutic, or inhibitory effect.
[0082] "Pharmacologically acceptable carrier" refers to a carrier for administering a prophylactic or therapeutic drug.
[0083] Unless otherwise specified, "improvement" means a change in the symptoms or condition of a disease, prevention or delay of the worsening of symptoms or condition, reversal, prevention or delay of the progression of symptoms, or treatment of the disease.
[0084] Unless otherwise specified, "prevention" means preventing or delaying the onset of a disease in the subject, or reducing the risk of developing a disease.
[0085] Unless otherwise specified, "treatment" refers to any treatment of the disease in the subject (e.g., improvement of the disease, reduction of the disease, recovery from the disease, alleviation of the disease, suppression of the disease's progression, etc.). It may also include preventing the onset and / or progression of the disease in the subject.
[0086] The term "approximately" may include values up to ±20% of the given value, preferably up to ±10%. For example, when stating "ETAR expression was inhibited by approximately 80%", the level of inhibition may include inhibition within the range of 64% to 96%, preferably within the range of 72% to 88%.
[0087] "Substantially" means that the scope or degree of what is being covered is complete or nearly complete. For example, "substantially all" means 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more.
[0088] 1. Nucleic Acid Molecules that Inhibit Endothelin A Receptor Expression The nucleic acid molecules of the present invention have inhibitory activity against ETAR expression and contain a nucleic acid base sequence complementary to the gene encoding ETAR (ETAR mRNA). Furthermore, the nucleic acid molecules of the present invention can downregulate the expression of the gene encoding ETAR. Furthermore, the nucleic acid molecules of the present invention contain a nucleotide sequence that can mediate the silencing of ETAR gene expression. In some embodiments, the nucleic acid molecules of the present invention have a double-stranded region (dsRNA) of 19 to 27 nucleotides in length and include an antisense strand and a sense strand of 19 to 29 nucleotides in length. One embodiment of the nucleic acid molecules of the present invention is siRNA, and the description of nucleic acid molecules herein also applies to siRNA.
[0089] In some embodiments, the double-stranded region of the nucleic acid molecule of the present invention may contain 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or more, 29 or more; 29 or less, 28 or less, 27 or less, 26 or less, 25 or less, 24 or less, 23 or less, 22 or less, 21 or less, 20 or less, 19 or less; 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29 base pairs.
[0090] Generally, the sense and antisense strands of siRNA can be designed to be, for example, 19 to 29 nucleotides long, and may include base pairs in double-stranded regions with nucleotide lengths of, for example, 19 or more, 21 or more, 23 or more, 25 or more, 27 or more, and 27 or less, 25 or less, 23 or less, and 21 or less.
[0091] Generally, the majority of nucleotides in the sense and antisense strands are ribonucleotides, but one or both of these strands may contain at least one non-ribonucleotide, such as a deoxyribonucleotide and / or a modified nucleotide.
[0092] In some embodiments, the nucleic acid molecule of the present invention may have a continuous region of 19 to 29 nucleotides in length of antisense strands in its double-stranded region, which is complementary to the sequence of the gene encoding ETAR (ETAR mRNA).
[0093] In some embodiments, the nucleic acid molecule of the present invention may have a continuous region of 19 to 29 nucleotides in length of antisense strand that is complementary to the sequence of the gene encoding ETAR (ETAR mRNA).
[0094] In some embodiments, the antisense and sense strands of the nucleic acid molecule of the present invention can each independently have a nucleotide length of 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or more, 29 or more; 29 or less, 28 or less, 27 or less, 26 or less, 25 or less, 24 or less, 23 or less, 22 or less, 21 or less, 20 or less, 19 or less; 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29.
[0095] The sense chain of the nucleic acid molecule of the present invention is sequence numbers 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, It may contain 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 consecutive nucleotides as shown in 114, 157, 158, 162, 166, 167, 168, 169, 170, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 199, 200, 201, 202, 203, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, or 223.Furthermore, the sense strands of Mom nucleic acid molecules are sequence numbers 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 38 1, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 636, 637, 638, 639, 640, 641, 642, 643, 644, 645, It may contain 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 consecutive nucleotides shown as 646, 647, 648, 649, 650, 651, 652, 653, 654, 658, 659, 660, 660, 660, 660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 679, 680, 681, 682, 683, 684, 685, 686, 687, or 688.
[0096] The antisense chain of the nucleic acid molecule of the present invention is sequence numbers 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 115, 116, 11 7, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151 ,152,153,154,155,156,171,172,173,174,175,177,178,224,225,226,227,228,229,230,231,232,233,234,235,236,237,238,239,240,241,242,243,244,245, It may contain 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 consecutive nucleotides as shown in 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, or 265.Furthermore, the antisense chain of the χ molecule of the present invention is sequence numbers 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 54 0, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, It may contain 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 consecutive nucleotides as shown in 689, 690, 691, 692, 693, 694, 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, or 731.
[0097] In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 3 or a fragment thereof, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 38 or a fragment thereof. In another embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 4 or a fragment thereof, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 39 or a fragment thereof. In yet another embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 5 or a fragment thereof, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 40 or a fragment thereof.
[0098] In some embodiments, the nucleic acid molecule of the present invention comprises a sense strand selected from the sequences shown in Tables 1-1 to 1-8, Table 2, Tables 3-1 to 3-11, Tables 4-1 to 4-2, and Tables 6-1 to 6-2, or 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 nucleotide fragments thereof, and an antisense strand selected from the sequences shown in Tables 1-1 to 1-8, Table 2, Tables 3-1 to 3-11, Tables 4-1 to 4-2, and Tables 6-1 to 6-2, or 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 nucleotide fragments thereof.
[0099] The nucleic acid molecule of the present invention may have a blunt end. The nucleic acid molecule of the present invention may have one or more 3' overhangs.
[0100] The nucleic acid molecule of the present invention is a compound that, when administered to a target, can inhibit the expression of ETAR or the expression of the gene encoding ETAR in the target cells, tissues, organs, etc. Therefore, as a result of administration, the expression of ETAR in the target cells, tissues, organs, etc. can be inhibited, thereby inhibiting the action of endothelin.
[0101] In some embodiments, the nucleic acid base sequence of the antisense strand of the nucleic acid molecule of the present invention has complementarity to the isolength portion of the gene (mRNA) encoding the endothelin A receptor (SEQ ID NO: 1) of, for example, at least 80%, at least 85%, at least 90%, at least 95%, or 100%; preferably at least 85%, at least 90%, at least 95%, or 100%; more preferably at least 90%, at least 95%, or 100%.
[0102] The antisense or sense strand of a nucleic acid molecule can have its continuous nucleotide length increased or decreased, and it is also possible to introduce mismatched bases (non-complementary nucleic acid bases) while maintaining activity.
[0103] The antisense strand of the nucleic acid molecule of the present invention may contain nucleotide sequences in the isolength portion of the mRNA encoding the target nucleic acid, the endothelin A receptor (SEQ ID NO: 1), that have complete complementarity (100%) or substantial complementarity (for example, at least 80% to 100%, at least 85% to 100%, at least 90% to 100%, or at least 95% to 100%) with consecutive nucleic acid bases in the nucleotide sequence. "Consecutive nucleic acid bases" refers to nucleic acid bases that are directly adjacent to each other.
[0104] In some embodiments, the nucleic acid molecules of the present invention can inhibit the expression of ETAR mRNA by, for example, about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, and about 95% or more. The degree of inhibition of ETAR mRNA expression can be considered as the inhibition rate of ETAR expression.
[0105] The inhibition rates of ETAR expression are, for example, approximately 5-100%, 15-100%, 30-100%, 50-100%, 70-100%, 80-100%, and 90-100%. In the examples described later, the degree of inhibition of ETAR mRNA expression (the degree of inhibition of ETAR expression) is confirmed by measuring the expression level of ETAR mRNA in cells.
[0106] The nucleic acid molecule of the present invention exhibits an IC50 of less than approximately 1000 pM in in vitro tests. 50 These substances have the ability to advantageously inhibit the expression of mRNA encoding ETAR. Some of these substances can inhibit the expression level of mRNA encoding ETAR by at least approximately 30%, at least approximately 50%, or at least approximately 80%.
[0107] In some embodiments, the nucleic acid molecule of the present invention is, for example, a highly active IC at less than about 1000 pM, less than about 500 pM, less than about 300 pM, or less than about 100 pM. 50 It possesses a value that can inhibit the expression of ETAR mRNA.
[0108] Nucleic acid molecules can be constructed from separate polynucleotide chains (SS and AS). The SS and AS are at least partially complementary. The SS and AS can form a double-stranded region having, for example, 19 to 29 base pairs.
[0109] The nucleic acid molecule of the present invention can target genes encoding ETAR. For example, any homologous sequence of a gene encoding ETAR can be targeted using a complementary sequence or a sequence incorporating a non-standard base pair (e.g., a mismatched base pair).
[0110] The antisense strand (AS) of the nucleic acid molecule of the present invention comprises, for example, an oligonucleotide of length 19 to 29, and the nucleic acid base sequence of the AS is, counting from the 5' position in the nucleic acid base of Sequence ID No. 1 (human ETAR mRNA nucleic acid sequence (accession number: NM_001957.4)), for example, 549, 620, 716, 720, 737, 824, 828, 830, 832, 833, 893, 958, 959, 961, 962, 963, 967, 1008, 1010, 1012, 1014, 1015, 1018, 1019, 1110, 1111, 1113, 1144, 1 The base portions starting at positions 271, 1301, 1390, 1391, 1392, 1448, 1450, 1451, 1452, 1452, 1453, 1454, 1455, 1456, 1457, 1458, 1459, 1534, 1535, 1536, 1550, 1552, 1554, 1556, 1557, 1558, 1559, 1560, 1561, or 1562 are complementary by 19 to 29 lengths. Furthermore, this complementarity is, for example, approximately 80% to 100%, approximately 85% to 100%, approximately 90% to 100%, or approximately 95% to 100%.
[0111] The antisense strand (AS) of the nucleic acid molecule of the present invention comprises, for example, an oligonucleotide of length 19 to 29, and the nucleic acid base sequence of the AS is the nucleic acid base of Sequence ID No. 1 (human ETAR In the mRNA nucleic acid sequence (accession number: NM_001957.4), counting from the 5' position, the positions are 4, 314, 343, 347, 382, 386, 391, 418, 422, 425, 430, 435, 439, 443, 520, 528, 529, 530, 531, 534, 548, 549, 550, 551, 591, 593, 594, 596, 615, 616, 617, 618, 619, 621, 622, 623, 639, 643, 647, 651, 656, 672, 717, 718, 719, 725, 729, 735, 736, 737, 742, 750, 792, 804, 809, 824, 828, 829, 830, 831, 857, 872, 876, 879, 883, 892, 911, 917, 922, 935, 938, 946, 954, 955, 956, 957, 960, 962, 964, 965, 966, 968, 1004, 1008, 1014, 1016, 1017, 1018, 1020, 1022, 1086, 1090, 1094, 1098, 1 112, 1142, 1143, 1145, 1149, 1153, 1155, 1163, 1174, 1182, 1205, 1208, 1215, 1219, 1222, 1230, 1236, 1239, 1242, 1302, 1310, 1315, 1356, 1360, 1364, 1389, 1393, 1398, 1402, 1405, 1408, 1412, 1416, 1420, 1424, 1450, 1452, 1453, 1455, 1456, 1457, 1460, 1461, 148 It is 19 to 29 lengths complementary to the base portion starting at positions 0, 1488, 1494, 1503, 1544, 1548, 1551, 1554, 1555, 1556, 1557, 1558, 1560, 1614, 1615, 1616, 1950, 2002, 2005, 2209, 2292, 2295, 2302, 2440, 2558, 2569, 2777, 2919, 2954, 3146, 3299, 3559, 3617, 3647, 3651, 3813, 3904, 3908, or 3921.Furthermore, their complementarity is, for example, approximately 80% to 100%, approximately 85% to 100%, approximately 90% to 100%, or approximately 95% to 100%.
[0112] The antisense strand (AS) of the nucleic acid molecule of the present invention comprises, for example, an oligonucleotide of length 19 to 29, and the nucleic acid base sequence of the AS is, for example, in the nucleic acid base of Sequence ID No. 1 (the nucleic acid sequence of human ETAR mRNA (accession number: NM_001957.4)), 549-569, 620-640, 716-736, 720-740, 737-757, 824-846, 828-846, 828-848, 828-850, 830-852, 832-852, 833-853, 893-913, 958-978, 959-979, 961-981, 962-980, 962-982, 963-983, 967-987, 1008-1036, 101 0-1036, 1010-1036, 1012-1036, 1014-1036, 1015-1035, 1015-1037, 1018-1038, 1019-1039, 1110-1130, 1111-1131, 1113-1133, 1144-1164, 1271-1291, 1301-1321, 1390-1410, 1391-1411, 1392-1412, 1448-1 476, 1450-1476, 1451-1471, 1452-1472, 1452-1474, 1452-1476, 1452-1476, 1453-1473, 1453-1475, 1454-1474, 1454-1476, 1455-1473, 1455-1475, 1455-1477, 1456-1474, 1456-1476, 1457-1475, 1457-1477 It is complementary to the base portions of 1458-1478, 1459-1479, 1534-1554, 1535-1555, 1536-1556, 1550-1578, 1552-1578, 1554-1578, 1556-1578, 1557-1579, 1558-1580, 1559-1581, 1560-1578, 1560-1580, 1561-1581, or 1562-1582. Furthermore, the complementarity is, for example, about 80%-100%, about 85%-100%, about 90%-100%, or about 95%-100%.
[0113] The antisense strand (AS) of the nucleic acid molecule of the present invention comprises, for example, an oligonucleotide of length 19 to 29, and the nucleic acid base sequence of the AS is the nucleic acid base of Sequence ID No. 1 (human ETAR In the nucleic acid sequence of mRNA (accession number: NM_001957.4), for example, 4-26, 314-336, 343-365, 347-369, 382-404, 386-408, 391-413, 418-440, 422-444, 425-447, 430-452, 435-457, 439-461, 443-465, 520-542, 528-546, 529-547, 529-551, 530-548, 531-549, 534-556, 548-566, 549-571, 550-56 8, 551-569, 591-613, 593-611, 594-612, 596-618, 615-633, 616-634, 617-635, 618-636, 619-637, 621-639, 622-640, 623-641, 639-661, 643-665, 647-669, 651-673, 656-678, 672-694, 717-735, 718-736, 719-737, 725-747, 729-751, 735-753, 736-754, 737-755, 737-759, 742 ~764, 750~772, 792~814, 804~826, 809~831, 824~846, 828~846, 828~850, 829~847, 830~848, 831~849, 857~879, 872~894, 876~898, 879~901, 883~905, 892~914, 911~933, 917~939, 922~944, 935~957, 938~960, 946~968, 954~972, 955~973, 956~974, 957~975, 960~978, 960~982, 962-980, 964-982, 965-983, 966-984, 968-986, 1004-1026, 1008-1030, 1014-1032, 1014-1036, 1016-1034, 1017-1035, 1018-1040, 1020-1038, 1022-1044, 1086-1108, 1090-1112, 1094-1116, 1098-1120, 1112-1130, 1142-1164, 1143-1161, 1145-1163, 1145-1167, 1149-1171,1153-1175, 1155-1177, 1163-1185, 1174-1196, 1182-1204, 1205-1227, 1208-1230, 1215-1237, 1219-1241, 1222-1244, 1230-1252, 1236-1258, 1239-1261, 1242-1260, 1242-1264, 1302-1320, 1310-1332, 1315-1337, 1356-1378, 1360-1382, 1364-1386, 1389-1407, 1393-1415, 1398-1420, 1402-1424, 1405-1427, 1408-1430, 1412-1434, 1416-1438, 1420-1442, 1424-1446, 1450-1468, 1452-1474, 1453-1475, 1455-1477, 1456-1474, 1457-1475, 1460-1478, 1461-1479, 1480-1502, 1 488-1506, 1494-1516, 1503-1525, 1544-1566, 1548-1570, 1551-1573, 1554-1578, 1555-1578, 1556-1578, 1557-1579, 1558-1580, 1560-1578, 1560-1578, 1614-1632, 1615-1633, 1616-1634, 1950-1972, 2002-2024, 2005-2027, 2209-2231, 22 These bases are complementary to the bases 92–2314, 2295–2317, 2302–2324, 2440–2462, 2558–2580, 2569–2591, 2777–2799, 2919–2941, 2954–2976, 3146–3168, 3299–3321, 3559–3581, 3617–3639, 3647–3669, 3651–3673, 3813–3835, 3904–3926, 3908–3930, or 3921–3943. Furthermore, their complementarity is, for example, approximately 80% to 100%, 85% to 100%, 90% to 100%, or 95% to 100%.
[0114] Endothelin A receptors (ETARs) may include ETARs derived from any species. Examples of species include humans or non-human mammals (dogs, cats, rats, mice, monkeys, cattle, horses, pigs, sheep, etc.), preferably humans or non-human mammals (rats or mice), and more preferably humans.
[0115] 2. Modification The antisense strand (AS) and sense strand (SS) of the nucleic acid molecule of the present invention may each independently contain at least one (for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) modified nucleotides. Such modifications may result in properties such as increased gene silencing activity and potency. Specifically, it may be possible to obtain nucleic acid molecules with excellent serum stability without loss of siRNA activity (potency), or nucleic acid molecules with reduced off-target effects.
[0116] In some embodiments, the present invention may provide a variety of modifications (including chemical modifications) that can enhance the stability and potency of nucleic acid molecules.
[0117] The nucleic acid molecules of the present invention may have chemical modifications in the antisense strand (AS) or sense strand (SS), such as "modification of the sugar group of the nucleotide," "modification of the internucleoside bond," or "modification of the nucleic acid base of the nucleotide." In some embodiments, the chemical modifications in the nucleic acid molecule can be included in all oligonucleotides of the nucleic acid molecule.
[0118] Modification of the sugar group of a nucleotide includes, for example, 2'-deoxynucleotides, 2'-O-alkyl modified nucleotides (for example, 2'-O-methyl (2'OMe) modified nucleotides, 2'-O-C 16 H 33 Examples include, but are not limited to, modified nucleotides, 2'-deoxy-2'-fluoromodified nucleotides, 2'-deoxy-2'-NHAc modified nucleotides, debasalized nucleotides, or any combination thereof.
[0119] The hydroxyl group at the 5' position of the nucleotide at the 5' end of the sense strand or antisense strand of the nucleic acid molecule of the present invention is a phosphate group (P(O)(OH) 2) or thiophosphate group (P(S)(OH) 2 ) can be substituted with the group. Compounds substituted with the group can be obtained according to methods known in the literature, for example, by the synthesis method in the scheme below.
[0120] Modifications of nucleoside bonds include, but are not limited to, phosphorothioate bonds, phosphorodithioate bonds, boranophosphate bonds, or any combination thereof. Preferably, the modification of the nucleoside bond is a phosphorothioate bond.
[0121] In some embodiments, the nucleic acid molecule of the present invention may have an antisense strand (AS) and a sense strand (SS) in which positions 1 and 2 from the 5' end of the AS and / or positions 1 and 2 from the 3' end are modified with phosphorothioate bonds, and positions 1 and 2 from the 5' end of the SS and / or positions 1 and 2 from the 3' end are also modified with phosphorothioate bonds.
[0122] The nucleic acid bases of the nucleotides constituting the oligonucleotide are not particularly limited, but for example, adenine (A), guanine (G), thymine (T), cytosine (C), uracil (U), hypoxanthine, or modified nucleic acid bases thereof can be used.
[0123] Modifications of the nucleic acid bases of nucleotides include, but are not limited to, 5-alkylcytosine, 5-alkyluracil, or any combination thereof.
[0124] In some embodiments, the nucleic acid molecules of the present invention may include, for example, nucleic acid molecules having modifications at the 5' end, 3' end, or both ends of the AS or SS.
[0125] In some embodiments, the nucleic acid molecule of the present invention may have multiple deoxynucleotides (e.g., deoxythymidine (dT)) attached to the 3' end of AS or SS.
[0126] In some embodiments, the nucleic acid molecule of the present invention may have an inverted non-basic nucleotide (invAb) attached to the 5' or 3' end of the SS.
[0127] In some embodiments, the nucleic acid molecules of the present invention may include, for example, nucleic acid molecules having modifications that result in a mismatch in complementarity between AS and SS.
[0128] The nucleic acid molecule of the present invention may include one or more overhangs from the double-stranded region formed from AS and SS. An overhang is a single-stranded region in which no base pairs are formed. In some embodiments, the length of the overhang may be, for example, 1 to 8 nucleotides, 1 to 5 nucleotides, 1 to 3 nucleotides, or 1 to 2 nucleotides. The overhang may be a 3'-terminal overhang at the 3' end of AS or SS having a single-stranded region of, for example, 1 to 8 nucleotides, 1 to 5 nucleotides, 1 to 3 nucleotides, or 1 to 2 nucleotides, or a 5'-terminal overhang at the 5' end of AS or SS having a single-stranded region of, for example, 1 to 8 nucleotides, 1 to 5 nucleotides, 1 to 3 nucleotides, or 1 to 2 nucleotides. Furthermore, the lengths of each overhang may be the same or different.
[0129] The nucleic acid molecule of the present invention may have one or more blunt ends in which the double-stranded region ends without an overhang and the AS and SS bases are base-paired to the end of the double-stranded region. The nucleic acid molecule of the present invention may have one or more blunt ends, or one or more overhangs, or a combination of blunt ends and overhangs.
[0130] In some embodiments, the nucleic acid molecule of the present invention may contain at least one modified nucleotide (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) within the double-stranded region formed from AS and SS.
[0131] In some embodiments, the nucleic acid molecule of the present invention may be able to improve the degree of inhibition of ETAR mRNA expression by making the nucleotide at a specific position of AS a 2'-deoxy-2'-fluoromodified nucleotide.
[0132] For example, a nucleic acid molecule or a salt thereof, or a solvate thereof, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand and the antisense strand are each 23 nucleotides long, and in the antisense strand, the nucleotides at positions 2, 6, 9, 14, and 16 in the 5'→3' direction of its sequence are 2'-deoxy-2'-fluoro modified nucleotides, and any nucleotide at positions 4, 8, 10, 12, or 18 may also be a 2'-deoxy-2'-fluoro modified nucleotide, and the total number of 2'-deoxy-2'-fluoro modified nucleotides in the antisense strand is 5 to 7. The positions of the 2'-deoxy-2'-fluoromodified nucleotides in the antisense chain are, for example, positions 2, 4, 6, 8, 9, 14 and 16 in the 5'→3' direction of the sequence, for example, positions 2, 4, 6, 9, 10, 14 and 16, for example, positions 2, 4, 6, 9, 12, 14 and 16, for example, positions 2, 4, 6, 9, 14, 16 and 18, for example, positions 2, 6, 8, Examples include the 9th, 10th, 14th and 16th positions, for example, the 2nd, 6th, 8th, 9th, 12th, 14th and 16th positions, for example, the 2nd, 6th, 8th, 9th, 14th, 16th and 18th positions, for example, the 2nd, 6th, 9th, 10th, 12th, 14th and 16th positions, for example, the 2nd, 6th, 9th, 10th, 14th, 16th and 18th positions, for example, the 2nd, 6th, 9th, 12th, 14th, 16th and 18th positions, for example, the 2nd, 6th, 9th, 14th and 16th positions, etc.
[0133] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, comprising a sense strand and an antisense strand, are provided, wherein the sense strand and antisense strand form a double-stranded region, the sense strand is 21 nucleotides long, and the antisense strand is 23 nucleotides long and contains 7 to 11 2'-deoxy-2'-fluoromodified nucleotides.
[0134] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein in the antisense chain, the nucleotides at positions 2, 6, 14, and 16 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and any nucleotide at positions 4, 8, 9, 10, 12, 18, 20, or 22 may also be 2'-deoxy-2'-fluoro-modified nucleotides, and the antisense chain contains 7 to 11 2'-deoxy-2'-fluoro-modified nucleotides. In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein in the antisense chain, the nucleotides at positions 2, 6, 14, and 16 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and two or more nucleotides selected from positions 4, 8, 9, 10, and 12 contain 2'-deoxy-2'-fluoro-modified nucleotides.
[0135] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein in the antisense chain, the nucleotides at positions 2, 6, 14, and 16 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and three or more nucleotides selected from positions 4, 8, 9, 10, and 12 contain 2'-deoxy-2'-fluoro-modified nucleotides, and the antisense chain contains 7 to 10 2'-deoxy-2'-fluoro-modified nucleotides. In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein in the antisense chain, the nucleotides at positions 2, 6, 14, and 16 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and three nucleotides selected from positions 4, 8, 9, 10, and 12 contain 2'-deoxy-2'-fluoro-modified nucleotides, and the antisense chain contains 7 2'-deoxy-2'-fluoro-modified nucleotides.
[0136] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein in the antisense chain, only the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of the sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides. In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein in the antisense chain, only the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of the sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides.
[0137] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein in the antisense chain, only the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of the sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides.
[0138] In some embodiments, nucleic acid molecules, salts thereof, or solvates thereof are provided, wherein in the antisense chain, the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 3-5, 7, 11, 13, 15 and 17-23 include 2'-O-methyl (2'OMe)-modified nucleotides, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may include nucleotides in which the 2'-OMe group is substituted with any substituent. In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein in the antisense chain, the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11-13, 15, 17 and 19-23 include 2'-O-methyl (2'OMe)-modified nucleotides, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may include nucleotides in which the 2'-OMe group is substituted with any substituent.
[0139] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein in the antisense chain, the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11, 13, 15 and 17-23 include 2'-O-methyl (2'OMe)-modified nucleotides, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may include nucleotides in which the 2'-OMe group is substituted with any substituent. In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein the antisense chain contains nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of its sequence, 2'-deoxy-2'-fluoro-modified nucleotides, and nucleotides at positions 3-5, 7, 11-13, 15 and 17-23 contain 2'-O-methyl (2'OMe)-modified nucleotides, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may contain nucleotides in which the 2'-OMe group is substituted with any substituent.
[0140] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain contains a nucleotide other than a 2'-deoxy-2'-fluoro-modified nucleotide. In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain contains a 2'-O-methyl (2'OMe)-modified nucleotide, a 5'-vinylphosphonate-modified nucleotide, a 2'-acetamide-5'-vinylphosphonate-modified nucleotide, or thymidine-3'-phosphate (dT). In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein the antisense chain further contains a 5'-phosphorus-stabilizing moiety at the 5' end. In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein the 5'-phosphorus-stabilizing moiety is a 5'-vinylphosphonate-modified nucleotide.
[0141] In some embodiments, nucleic acid molecules, salts thereof, or solvates thereof are provided, wherein the antisense strand contains a 2'-O-methyl (2'OMe) modified nucleotide at position 7 in the 5'→3' direction of its sequence, and the sense strand contains a 2'-deoxy-2'-fluoro modified nucleotide complementary to the nucleotide at position 7 in the 5'→3' direction of the sequence of the antisense strand. In some embodiments, nucleic acid molecules, salts thereof, or solvates thereof are provided, wherein in the antisense chain, the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 3-5, 7, 11, 13, 15 and 17-23 include 2'-O-methyl (2'OMe)-modified nucleotides, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may include nucleotides in which the 2'-OMe group is substituted with any substituent.
[0142] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein in the antisense chain, the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11-13, 15, 17 and 19-23 include 2'-O-methyl (2'OMe)-modified nucleotides, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may include nucleotides in which the 2'-OMe group is substituted with any substituent. In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein in the antisense chain, the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11, 13, 15 and 17-23 include 2'-O-methyl (2'OMe)-modified nucleotides, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may include nucleotides in which the 2'-OMe group is substituted with any substituent.
[0143] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein the antisense chain contains nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of its sequence, 2'-deoxy-2'-fluoro-modified nucleotides, and nucleotides at positions 3-5, 7, 11-13, 15 and 17-23 contain 2'-O-methyl (2'OMe)-modified nucleotides, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may contain nucleotides in which the 2'-OMe group is substituted with any substituent.
[0144] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain contains a nucleotide other than a 2'-deoxy-2'-fluoro-modified nucleotide. In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain contains a 2'-O-methyl (2'OMe)-modified nucleotide, a 5'-vinylphosphonate-modified nucleotide, a 2'-acetamide-5'-vinylphosphonate-modified nucleotide, or thymidine-3'-phosphate (dT). In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein the antisense chain further contains a 5'-phosphorus-stabilizing moiety at the 5' end. In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein the 5'-phosphorus-stabilizing moiety is a 5'-vinylphosphonate-modified nucleotide.
[0145] In some embodiments, the sense strand contains nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence, which are 2'-deoxy-2'-fluoro-modified nucleotides, and nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-O-methyl (2'OMe)-modified nucleotides, and the antisense strand contains nucleotides at positions 2, 6, 14 and 16 in the 5'→3' direction of its sequence, which are 2'-deoxy-2'-fluoro-modified nucleotides, and any nucleotide at positions 4, 8-10, 12, 18, 20 or 22 may be a 2'-deoxy-2'-fluoro-modified nucleotide, and the antisense strand contains 7 to 11 2'-deoxy-2'-fluoro-modified nucleotides, and a nucleic acid molecule or a salt thereof, or a solvate thereof is provided. In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-O-methyl (2'OMe)-modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides.
[0146] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-O-methyl (2'OMe)-modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides. In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-O-methyl (2'OMe)-modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides.
[0147] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-O-methyl (2'OMe)-modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides. In some embodiments, nucleic acid molecules or salts thereof are provided, wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 3-5, 7, 11, 13, 15 and 17-23 include 2'-O-methyl (2'OMe)-modified nucleotides, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may include nucleotides in which the 2'-OMe group is substituted with any substituent.
[0148] In some embodiments, nucleic acid molecules or salts thereof are provided, wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of its sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11-13, 15, 17 and 19-23 include 2'-O-methyl (2'OMe)-modified nucleotides, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may include nucleotides in which the 2'-OMe group is substituted with any substituent. In some embodiments, nucleic acid molecules or salts thereof are provided, wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of its sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11, 13, 15 and 17-23 include 2'-O-methyl (2'OMe)-modified nucleotides, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may include nucleotides in which the 2'-OMe group is substituted with any substituent.
[0149] In some embodiments, nucleic acid molecules or salts thereof are provided, wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides; and in the antisense strand, the nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of its sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 3-5, 7, 11-13, 15 and 17-23 include 2'-O-methyl (2'OMe)-modified nucleotides, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may include nucleotides in which the 2'-OMe group is substituted with any substituent.
[0150] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain contains a nucleotide other than a 2'-deoxy-2'-fluoro-modified nucleotide. In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain contains a 2'-O-methyl (2'OMe)-modified nucleotide, a 5'-vinylphosphonate-modified nucleotide, a 2'-acetamide-5'-vinylphosphonate-modified nucleotide, or thymidine-3'-phosphate (dT). In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein the antisense chain further contains a 5'-phosphorus-stabilizing moiety at the 5' end. In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein the 5'-phosphorus-stabilizing moiety is a 5'-vinylphosphonate-modified nucleotide.
[0151] In some embodiments, the positions of the phosphorothioate bonds in the sense strand and antisense strand are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of the sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides, and nucleic acid molecules, salts thereof, or solvates thereof are provided. In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of the sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides.
[0152] In some embodiments, the positions of the phosphorothioate bonds in the sense strand and antisense strand are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of the sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides, and nucleic acid molecules, salts thereof, or solvates thereof are provided. In some embodiments, the positions of the phosphorothioate bonds in the sense strand and antisense strand are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of the sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides, and nucleic acid molecules, salts thereof, or solvates thereof are provided.
[0153] In some embodiments, the positions of the phosphorothioate bonds in the sense strand and antisense strand are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 3-5, 7, 11, 13, 15 and 17-23 include 2'-O-methyl (2'OMe)-modified nucleotides. The present invention provides nucleic acid molecules, salts thereof, or solvates thereof, wherein 0 to 3 of the 2'-O-methyl (2'OMe) modified nucleotides may contain nucleotides in which the 2'-OMe groups are substituted with any substituent.
[0154] In some embodiments, the positions of the phosphorothioate bonds in the sense strand and antisense strand are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides. The present invention provides nucleic acid molecules, salts thereof, or solvates thereof, wherein the antisense chain contains nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of its sequence, 2'-deoxy-2'-fluoro-modified nucleotides, and nucleotides at positions 3-5, 7-8, 11-13, 15, 17 and 19-23 contain nucleotides with 2'-O-methyl (2'OMe) modification, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may contain nucleotides in which the 2'-OMe group is substituted with any substituent.
[0155] In some embodiments, the positions of the phosphorothioate bonds in the sense strand and antisense strand are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence contain 2'-deoxy-2'-fluoro modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-O-methyl (2'OMe) modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of the sequence contain 2'-deoxy-2'-fluoro modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11, 13, 15 and 17-23 contain 2'-O-methyl (2'OMe) modified nucleotides. The present invention provides nucleic acid molecules, salts thereof, or solvates thereof, in which 0 to 3 of the 2'-O-methyl (2'OMe) modified nucleotides may include nucleotides in which the 2'-OMe group is substituted with any substituent.
[0156] In some embodiments, the positions of the phosphorothioate bonds in the sense strand and antisense strand are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 3-5, 7, 11-13, 15 and 17-23 include 2'-O-methyl (2'OMe)-modified nucleotides. The present invention provides nucleic acid molecules, salts thereof, or solvates thereof, in which 0 to 3 of the 2'-O-methyl (2'OMe) modified nucleotides may include nucleotides in which the 2'-OMe group is substituted with any substituent.
[0157] In some embodiments, the positions of the phosphorothioate bonds in the sense strand and antisense strand are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides. The present invention provides nucleic acid molecules or salts thereof, or solvates thereof, wherein the antisense strand contains 2'-deoxy-2'-fluoromodified nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of its sequence, and 2'-O-methyl (2'OMe) modified nucleotides at positions 3-5, 7, 11, 13, 15 and 17-23. In some embodiments, the positions of the phosphorothioate bonds in the sense strand and antisense strand are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides. The present invention provides nucleic acid molecules or salts thereof, or solvates thereof, wherein the antisense chain contains 2'-deoxy-2'-fluoro-modified nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of its sequence, and 2'-O-methyl (2'OMe)-modified nucleotides at positions 3-5, 7-8, 11-13, 15, 17 and 19-23.
[0158] In some embodiments, the positions of the phosphorothioate bonds in the sense strand and antisense strand are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides. The present invention provides nucleic acid molecules or salts thereof, or solvates thereof, wherein the antisense chain contains 2'-deoxy-2'-fluoromodified nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of its sequence, and 2'-O-methyl (2'OMe) modified nucleotides at positions 3-5, 7-8, 11, 13, 15 and 17-23. In some embodiments, the positions of the phosphorothioate bonds in the sense strand and antisense strand are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides. The present invention provides a nucleic acid molecule or a salt thereof, or a solvate thereof, wherein the antisense chain contains 2'-deoxy-2'-fluoromodified nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of its sequence, and 2'-O-methyl (2'OMe) modified nucleotides at positions 3-5, 7, 11-13, 15 and 17-23.
[0159] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain contains a nucleotide other than a 2'-deoxy-2'-fluoro-modified nucleotide. In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain contains a 2'-O-methyl (2'OMe)-modified nucleotide, a 5'-vinylphosphonate-modified nucleotide, a 2'-acetamide-5'-vinylphosphonate-modified nucleotide, or thymidine-3'-phosphate (dT).
[0160] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain is a 2'-O-methyl (2'OMe) modified nucleotide, a 5'-vinylphosphonate modified nucleotide, a 2'-acetamide-5'-vinylphosphonate modified nucleotide, or thymidine-3'-phosphate (dT). In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein the antisense chain further comprises a 5'-phosphorus stabilizing moiety at the 5' end. In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein the 5'-phosphorus stabilizing moiety is a 5'-vinylphosphonate modified nucleotide.
[0161] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof are provided, wherein the sense strand comprises the sequence of formula I below in its 5'→3' direction, the antisense strand comprises the sequence of formula II-(2) below in its 5'→3' direction, the sense strand and the antisense strand each contain four phosphorothioate bonds, and the positions of the phosphorothioate bonds in the sense strand and the antisense strand are between nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: M-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M Formula II-(2): A2-B2-C2-D2 In formula II-(2), A2 is represented by X-F-M-M-M-F, B2 is represented as M-F-F-M or M-M-F-F, C2 is represented as M-F-M-F-M-F or M-M-M-F-M-F, D2 is represented as M-M-M-M-M-M-M or M-F-M-M-M-M-M, in each of the above formulas, F is a 2'-deoxy-2'-fluoro modified nucleotide, and M is a 2'-O-methyl (2'OMe) modified nucleotide.
[0162] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof are provided, wherein the sense strand comprises the sequence of formula I below in its 5'→3' direction, the antisense strand comprises the sequence of formula II-(2) below in its 5'→3' direction, the sense strand and the antisense strand each contain four phosphorothioate bonds, and the positions of the phosphorothioate bonds in the sense strand and the antisense strand are between nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: M-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M Formula II-(2): A2-B2-C2-D2 In formula II-(2), A2 is represented by X-F-M-M-M-F, B2 is represented as M-F-F-M, C2 is represented as M-F-M-F-M-F, and D2 is represented as M-M-M-M-M-M-M, where F is a 2'-deoxy-2'-fluoro modified nucleotide and M is a 2'-O-methyl (2'OMe) modified nucleotide.
[0163] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof are provided, wherein the sense strand comprises the sequence of formula I below in its 5'→3' direction, the antisense strand comprises the sequence of formula II-(2) below in its 5'→3' direction, the sense strand and the antisense strand each contain four phosphorothioate bonds, and the positions of the phosphorothioate bonds in the sense strand and the antisense strand are between nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: M-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M Formula II-(2): A2-B2-C2-D2 In formula II-(2), A2 is represented by X-F-M-M-M-F, B2 is represented as M-M-F-F, C2 is represented as M-F-M-F-M-F, and D2 is represented as M-M-M-M-M-M-M, where F is a 2'-deoxy-2'-fluoro modified nucleotide and M is a 2'-O-methyl (2'OMe) modified nucleotide.
[0164] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein in the sense strand, the nucleotides at positions 13 to 20 in the 5'→3' direction are represented as M-M-F-M-M-M-M-M, and in the antisense strand, the nucleotides at positions 2 to 9 in the 5'→3' direction of the sequence are represented as F-M-M-F-M-M-F, F-M-M-F-M-F-F, F-M-F-M-F-M-M-M, or F-M-F-M-F-M-F-M.
[0165] In some embodiments, the nucleotides at positions 2 to 9 in the 5'→3' direction of the antisense chain are represented as F-M-M-M-F-M-M-F, and the antisense chain contains seven 2'-deoxy-2'-fluoro-modified nucleotides, as described in [19-3], or a salt thereof, or a solvate thereof. In some embodiments, the nucleotides at positions 2 to 9 in the 5'→3' direction of the antisense chain are represented as F-M-M-M-F-M-F-F, and the antisense chain contains seven 2'-deoxy-2'-fluoro-modified nucleotides, as described in [19-3], as a nucleic acid molecule or a salt thereof, or a solvate thereof.
[0166] In some embodiments, the nucleotide modified at the 2' position with any substituent is independently a 2'-deoxyribonucleotide or a 2'-O-alkyl-modified nucleotide (where alkyl is the carbon chain C). 1-18 A nucleic acid molecule or a salt thereof, or a solvate thereof, is provided, which is a nucleotide modified with an arbitrary substituent at the 2' position (including a 2'-O-alkyl modified nucleotide where the alkyl group is C). In some embodiments, a nucleic acid molecule or a salt thereof, or a solvate thereof, is provided, in which the nucleotide modified with an arbitrary substituent at the 2' position is present in the sense chain. In some embodiments, the nucleotide modified with an arbitrary substituent at the 2' position present in the sense chain is independently a 2'-O-alkyl modified nucleotide (where the alkyl group is C). 1-18 A nucleic acid molecule or a salt thereof, or a solvate thereof, is provided, which is a 2'-O-alkyl modified nucleotide (including an alkyl group of the nucleotide).
[0167] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein the nucleotides with the 2' position modified by any substituent are present in the antisense chain. In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein the nucleotides with the 2' position modified by any substituent present in the antisense chain are independently 2'-deoxyribonucleotides. In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein there are zero nucleotides with the 2' position modified by any substituent.
[0168] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided, wherein the nucleic acid molecule is siRNA. In some embodiments, pharmaceutical compositions are provided, comprising the aforementioned nucleic acid molecules or salts thereof, or solvates thereof, and a pharmaceutically acceptable carrier.
[0169] In some embodiments, the nucleic acid molecule of the present invention is a nucleic acid molecule for inhibiting the expression of the endothelin A receptor, comprising a sense strand and an antisense strand forming a double-stranded region, each independently comprising 19 to 29 nucleotides in length, and comprising at least a nucleotide sequence selected from the sense strand and antisense strand combinations indicated by the identification numbers in Tables 1-1 to 1-8, Table 2, Tables 3-1 to 3-11, Tables 4-1 to 4-2, and Tables 6-1 to 6-2, wherein the nucleic acid base sequence of the antisense strand has at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% complementarity with respect to the isolength portion of mRNA encoding the endothelin A receptor (SEQ ID NO: 1). The nucleic acid molecule may comprise salts thereof or solvates thereof.
[0170] 3. Salts and Solvates The nucleic acid molecules of the present invention may form salts. Such salts are not particularly limited as long as they are pharmaceutically acceptable, but examples include alkali metal salts such as sodium salts, potassium salts, and lithium salts; alkaline earth metal salts such as calcium salts and magnesium salts; metal salts such as aluminum salts, iron salts, zinc salts, copper salts, nickel salts, and cobalt salts; ammonium salts; t-octylamine salts, dibenzylamine salts, morpholine salts, glucosamine salts, phenylglycine alkyl ester salts, ethylenediamine salts, N-methylglucamine salts, guanidine salts, diethylamine salts, triethylamine salts, dicyclohexylamine salts, N,N'-dibenzylethylenediamine salts, chloroprocaine salts, procaine salts, diethanolamine salts, and N-benzylphenethylamine salts. Examples include organic amine salts such as piperazine salts, tetramethylammonium salts, and tris(hydroxymethyl)aminomethane salt; hydrohalides such as hydrofluoric acid, hydrochloride, hydrobromide, and hydroiodide; inorganic salts such as nitrates, perchlorates, sulfates, and phosphates; lower alkanesulfonates such as methanesulfonates, trifluoromethanesulfonates, and ethanesulfonates; arylsulfonates such as benzenesulfonates and p-toluenesulfonates; organic salts such as acetates, malates, fumarates, succinates, citrates, tartrates, oxalates, and maleates; and amino acid salts such as glycine salts, lysine salts, arginine salts, ornithine salts, glutamates, and aspartates. These salts can be produced by known methods.
[0171] The nucleic acid molecules of the present invention, or salts thereof, may exist in non-solvated or solvated forms. In this specification, "solvate" means a molecular complex comprising the nucleic acid molecule of the present invention, or a salt thereof, and one or more pharmaceutically acceptable solvent molecules (e.g., water, ethanol, etc.). When the solvent molecule is water, it is specifically referred to as a "hydrate." These solvates can be prepared by known methods.
[0172] The description of nucleic acid molecules in this invention may include descriptions of salts of nucleic acid molecules, solvates of nucleic acid molecules, and solvates of salts of nucleic acid molecules.
[0173] 4. Nucleic acid molecules can be bound with any functional molecule to enhance their activity, intracellular distribution, intracellular uptake, delivery to specific organs (target sites), etc. The functional molecule may be directly bound to the oxygen atom at the 3' position of the nucleotide at the 3' end of the oligonucleotide in the sense strand (SS) of the nucleic acid molecule, the oxygen atom at the 5' position of the nucleotide at the 5' end, the oxygen atom at the 2' position of any nucleotide in the oligonucleotide chain, or, if the nucleotide at the 5' end is invAb, to the oxygen atom at its 3' position. Alternatively, the functional molecule may be bound to the aforementioned sites of the oligonucleotide in the SS via a binding group (e.g., a degradable group (e.g., phosphate group, thiophosphate group, ester group, carbamoyl group, carbamate group, etc.), a non-degradable group (e.g., alkyl group, aryl group, heteroaryl group, etc.)), or via a binding group and any linker. Methods for binding functional molecules to oligonucleotides can be found in known literature.
[0174] In this specification, "alkyl group" includes, but is not limited to, groups such as methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, and hexyl. Unless otherwise specified, "alkyl group" includes linear or branched groups. In this specification, "C 1 - 18 "Alkyl" refers to a linear or branched alkyl group having 1 to 18 carbon atoms, and in addition to the alkyl groups exemplified above, heptyl (C) 7 ), Octyl (C 8 ), nonil (C 9 ), Decyl (C 10 ), Undecyl (C 11 ), dodecyl (C 12 ), tridecyl (C 13 ), tetradecyl (C 14 ), pentadecyl (C 15 ), hexadecyl (C 16 ), heptadecyl (C 17 ), octadecyl (C 18Examples of groups include ) and others. The alkyl group may be substituted with, for example, one to three halogen atoms, alkoxy, cyano, nitro, etc. In this specification, unless otherwise specified, "aryl group" refers to, for example, groups such as phenyl, naphthyl, and indanyl, but is not limited to these. In this specification, unless otherwise specified, "heteroaryl group" refers to, for example, groups such as triazolyl, pyridyl, pyridadinyl, pyrimidinyl, and pyrazinyl, but is not limited to these. The aryl group or heteroaryl group may be substituted with, for example, one to three halogen atoms, alkoxy, cyano, nitro, etc.
[0175] Functional molecules are not particularly limited, but they are molecules that, when bound, impart a desired function to nucleic acid molecules. Desired functions include, for example, delivery to target sites (various organs, tissues, cells, etc.). Functional molecules are not particularly limited, but include a wide variety of molecules such as lipids, proteins, peptides, antibodies, glycans, and small molecule compounds.
[0176] Examples of functional molecules, or functional molecules via linkers, include, but are not limited to, the following structural formulas [excluding the part to the right of the dashed line in each formula]. The compounds used to introduce the groups represented by the structural formulas No. L1 to L23, PEG30k-A, and PEG30k-B into nucleic acid molecules are available as commercially available compounds or can be synthesized from compounds known in the literature according to methods known in the literature. Furthermore, the introduction of the groups represented by the structural formulas No. L1 to L23, PEG30k-A, and PEG30k-B into nucleic acid molecules can be carried out according to methods known in the literature.
[0177] In this specification, in "Chemical structure (modified) sense chain (5'→3')", for example, L1Cm=Am=AmGmCmAmUfCmCfAfGfUmGmGmAmAmGmAmAmCm=Am=invAb (Identification number: ETM-166, Sequence ID: 670) means that the structure is one in which the group represented by L1 (a functional molecule via a linker) is bonded to the hydroxyl group at the 5' position of the modified nucleic acid Cm (2'-O-methylcytidine-3'-phosphate) at the 5' end via a phosphate bond. Furthermore, L3=Cm=Am=AmGmCmAmUfCmCfAfGfUmGmGmAmAmGmAmAm=Cm=Am (Identification number: ETM-159, Sequence ID: 663) means that the structure is one in which the group represented by L3 is attached to the hydroxyl group at the 5' position of the modified nucleic acid Cm at the 5' end via a thiophosphate bond. Furthermore, L3=invAb=Cm=AmAmGmCmAmUfCmCfAfGfUmGmGmAmAmGmAmAmCm=Am=invAb (Identification number: ETM-170, Sequence ID: 674) means that the structure is one in which the group represented by L3 is attached to the hydroxyl group at the 3' position of the invAb (inverted non-basic nucleotide) at the 5' end via a thiophosphate bond. Furthermore, invAb=Cm=AmAmGmCmAmUfCmCfAfGfUmGmGmAmAmGmAmA(PEG30k-B)Cm=Am=invAb (Identification number: ETM-198, Sequence ID: 685) means that the group represented by PEG30k-B is bonded to the hydroxyl group at the 2' position of A (adenosine-3'-phosphate) in the oligonucleotide chain.
[0178] Similarly, the other sense strands to which the functional molecule is substituted (specifically, the sense strands of the following identification numbers and sequence numbers: [Identification number: ETM-160, Sequence number: 664], [Identification number: ETM-161, Sequence number: 665], [Identification number: ETM-162, Sequence number: 666], [Identification number: ETM-163, Sequence number: 667], [Identification number: ETM-164, Sequence number: 668], [Identification number: ETM-165, Sequence number: 669], [Identification number: ETM-167, Sequence number: 671], [Identification number: ETM-168, Sequence number: 672], [Identification number: ETM-169, Sequence number: 673], [Identification number: ETM-169, Sequence number: 673], [Identification number: ETM-164, Sequence number: 668], [Identification number: ETM-164, Sequence number: 668], [Identification number: ETM-169, Sequence number: 673], [Identification number: ETM-164, Sequence number: 671], [Identification number: ETM-168, Sequence number: 672], [Identification number: ETM-169, Sequence number: 673], [Identification number: ETM-164, Sequence number: 673], [Identification number: ETM-164, Sequence number: 671] The chemical structures of [Identification Number: ETM-171, Sequence ID: 675], [Identification Number: ETM-172, Sequence ID: 676], [Identification Number: ETM-173, Sequence ID: 677], [Identification Number: ETM-174, Sequence ID: 678], [Identification Number: ETM-175, Sequence ID: 679], [Identification Number: ETM-197, Sequence ID: 684], [Identification Number: ETM-199, Sequence ID: 674], [Identification Number: ETM-200, Sequence ID: 686], [Identification Number: ETM-201, Sequence ID: 687], and [Identification Number: ETM-202, Sequence ID: 688] can also be understood in accordance with the examples above.
[0179] 5. Target nucleic acids of the endothelin A receptor (ETAR): Genes encoding the endothelin A receptor (ETAR) from species such as humans, rats, and mice have been cloned and sequenced and are available from GenBank. Nucleic acid sequences encoding human ETAR are available, such as the nucleic acid sequence of human ETAR mRNA (Genbank accession number: NM_001957.4, GI: 1519313402 [Homo sapiens endothelin receptor type A (EDNRA), transcript variant 1, mRNA]) (incorporated herein as SEQ ID NO: 1), and nucleotide sequences encoding rat ETAR are available, such as the nucleic acid sequence of rat ETAR mRNA (Genbank accession number: NM_012550.2, GI: 164565423 [Rattus norvegicus endothelin receptor type A (Ednra), mRNA]) (incorporated herein as SEQ ID NO: 2), and nucleotide sequences encoding mouse ETAR are available, such as the nucleic acid sequence of mouse ETAR mRNA (Genbank accession number: NM_010332.2 Examples of available sequences include, but are not limited to, GI: 93102407 (Mus musculus endothelin receptor type A (Ednra), mRNA). Since reported sequences may change over time, those skilled in the art can incorporate the necessary changes into the nucleic acid molecules described herein accordingly.
[0180] The nucleic acid molecule of the present invention is sequenced such that its antisense strand (AS) can complement (hybridize) at least one target region of a target nucleic acid to achieve the desired effect.
[0181] In some embodiments, the desired effect is, for example, a decrease in the expression level of ETAR, a decrease in the expression level of mRNA encoding ETAR, or a decrease in the amount of protein encoded by ETAR mRNA, but is not limited to these.
[0182] The target region may contain one or more target segments. The antisense strand (AS) of a nucleic acid molecule can complement at least one target segment within the target region. Furthermore, the antisense strand (AS) of a nucleic acid molecule may complement multiple target segments.
[0183] In some embodiments, the target segment within the target region may consist of, for example, 10 to 20, 15 to 25, 19 to 29, 20 to 30, or 25 to 35 nucleotides on the target nucleic acid, and may be the same length as or different from the nucleotide length of the antisense strand (AS) of the nucleic acid molecule.
[0184] In some embodiments, a decrease in ETAR mRNA expression indicates inhibition of ETAR expression. A decrease in ETAR protein expression indicates inhibition of ETAR mRNA expression. For example, improvement, prevention, or treatment of diseases involving ETAR can be achieved by inhibiting ETAR expression or ETAR mRNA expression.
[0185] 6. Complementarity with Target Genes The antisense strand (AS) of the nucleic acid molecule of the present invention specifically hybridizes with the nucleic acid (mRNA) encoding ETAR, which is the target nucleic acid, to form a double-stranded structure. The antisense strand of the nucleic acid molecule of the present invention becomes fully complementary or substantially complementary to each other if a sufficient number of its nucleic acid bases can form hydrogen bonds with the corresponding nucleic acid bases of the target nucleic acid. As a result, the desired effects described above are obtained.
[0186] In some embodiments, the complementary region of the AS of the nucleic acid molecule of the present invention has a nucleotide length of at least 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides. In some embodiments, the complementary region includes 19, 20, 21, 22, or 23 consecutive nucleotides of the nucleic acid base sequence shown in SEQ ID NO: 38. In some embodiments, the complementary region includes 19, 20, 21, 22, or 23 consecutive nucleotides of the nucleic acid base sequence shown in SEQ ID NO: 39. In some embodiments, the complementary region includes 19, 20, 21, 22, or 23 consecutive nucleotides of the nucleic acid base sequence shown in SEQ ID NO: 40.
[0187] In some embodiments, the AS of the nucleic acid molecule of the present invention or a particular portion thereof is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the target nucleic acid, its target region, target segment, or particular portion.
[0188] The complementarity (%) between the AS of the nucleic acid molecule of the present invention and a certain region of the target nucleic acid can be calculated using a known method in the art. For example, if 18 of the 20 nucleic acid bases of the oligonucleotide contained in the AS complement the target region of the target nucleic acid and the AS can specifically hybridize, then the AS will have a 90% complementarity.
[0189] In some embodiments, the AS of the nucleic acid molecule of the present invention or a specific portion thereof may be completely complementary (i.e., 100% complementary) to the target nucleic acid or a specific portion thereof. "Completely complementary (100% complementary)" means that each nucleic acid base of the AS can form a complete base pair with the corresponding nucleic acid base of the target nucleic acid.
[0190] Non-complementary nucleic acid bases (mismatched bases) may be located at the 5' or 3' end of the asthma nucleotide (AS), or they may be located within the AS. If two or more non-complementary nucleic acid bases are present, they may be consecutive or discontinuous.
[0191] In some embodiments, the antisense strand of the nucleic acid molecule of the present invention may contain, for example, four or fewer, three or fewer, two or fewer, or one or fewer non-complementary nucleic acid bases relative to the target nucleic acid or a specific portion thereof.
[0192] 7. Design and Manufacturing Method of Nucleic Acid Molecules When the nucleic acid molecule of the present invention is siRNA, for example, the nucleic acid sequence of Genbank's human ETAR mRNA (NM_001957.4) and the nucleic acid sequence of rat ETAR mRNA (NM_012550.2) can be used to design the siRNA. For example, the siRNA can be designed to contain an antisense strand with approximately 80% to 100% homology to each of these ETAR genes.
[0193] siRNA according to one aspect of the present invention can be prepared by appropriately selecting a method known to those skilled in the art. For example, after synthesizing the antisense strand and sense strand according to the method described in the examples below, siRNA can be obtained by performing annealing according to a known method. Even when the nucleic acid molecule of the present invention is something other than siRNA, it can be prepared by appropriately selecting a method known to those skilled in the art.
[0194] 8. Diseases in which endothelin is suspected to be involved Endothelin A receptor (ETAR) is expressed in cells, tissues, organs, etc. in the body, and a variety of diseases can develop due to its physiological effects. Therefore, if the expression of ETAR or the gene encoding ETAR (ETAR mRNA) can be inhibited at target sites such as cells, tissues, organs, etc. in the body by administering the ETAR siRNA of the present invention, it may be possible to prevent, improve, and / or treat diseases in which endothelin is suspected to be involved.
[0195] Diseases in which endothelin is suspected to be involved are not limited to these, but include, for example, pulmonary arterial hypertension, focal segmental glomerulosclerosis, IgA nephropathy, chronic kidney disease (including diabetic nephropathy), renal impairment associated with sickle cell anemia, acute kidney injury, hypertension, non-alcoholic steatohepatitis (NASH), cancer, pain associated with endometriosis, complications associated with scleroderma, cerebral vasospasm, hypertrophic cardiomyopathy, and others (see table below).
[0196]
[0197] Pulmonary arterial hypertension (PAH) is a disease characterized by high blood pressure in the pulmonary arteries. PAH is a disease in which pulmonary artery pressure rises due to thickening of the pulmonary artery walls and vasoconstriction. Early detection is difficult, and without adequate treatment, death occurs within a few years. The thickening of the pulmonary artery walls is caused by abnormal proliferation of vascular endothelial cells and smooth muscle cells in the vascular media, but the detailed mechanism is unknown, and therefore it is designated as a rare disease by the Ministry of Health, Labour and Welfare. There are reports that ETAR expression is elevated in patients with pulmonary arterial hypertension.
[0198] 9. Composition, preventive / therapeutic agent The present invention provides a pharmaceutical composition characterized by containing a nucleic acid molecule that inhibits ETAR expression as an active ingredient.
[0199] In some embodiments, a pharmaceutical composition is provided characterized by containing at least one nucleic acid molecule or salt thereof of the present invention, or a solvate thereof, as an active ingredient. Furthermore, the present invention can provide a pharmaceutical composition containing at least one nucleic acid molecule or salt thereof that inhibits ETAR expression, or a solvate thereof, as an active ingredient, and further containing a pharmaceutically acceptable carrier.
[0200] The nucleic acid molecules or salts thereof, or solvates thereof, and pharmaceutical compositions containing nucleic acid molecules or salts thereof, or solvates thereof, are useful for the prevention or treatment of diseases related to ETAR. The nucleic acid molecules or salts thereof, or solvates thereof, and pharmaceutical compositions containing nucleic acid molecules or salts thereof, or solvates thereof, can be administered to subjects requiring them in a sufficiently effective amount (therapeutic effective amount) to inhibit the expression of the ETAR gene.
[0201] In some embodiments, pharmaceutical compositions are provided for preventing, improving and / or treating diseases in which endothelin is suspected to be involved, comprising at least one nucleic acid molecule or salt thereof of the present invention, or a solvate thereof, as an active ingredient.
[0202] In some embodiments, the use of nucleic acid molecules or salts thereof, or solvates thereof, of the present invention is provided for the manufacture of agents for preventing, improving and / or treating diseases in which endothelin is suspected to be involved.
[0203] In some embodiments, an agent for the prevention, improvement, and / or treatment of diseases in which endothelin is suspected to be involved is provided, characterized by containing at least one nucleic acid molecule or salt thereof, or solvate thereof, as an active ingredient.
[0204] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided for the prevention, improvement and / or treatment of diseases in which endothelin is suspected to be involved.
[0205] In some embodiments, an ETAR expression inhibitor is provided that contains at least one of the nucleic acid molecules of the present invention or salts thereof, or solvates thereof.
[0206] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, for inhibiting ETAR expression are provided.
[0207] In some embodiments, the use of a pharmaceutical composition containing at least one of the nucleic acid molecules or salts thereof of the present invention, or solvates thereof, as an active ingredient is provided for the manufacture of a drug for preventing, improving and / or treating a disease in which endothelin is suspected to be involved.
[0208] In some embodiments, the use of nucleic acid molecules or salts thereof, or solvates thereof, as at least one pharmaceutical (including pharmaceutical compositions; the same applies hereinafter) is provided.
[0209] In some embodiments, the use of nucleic acid molecules or salts thereof, or solvates thereof, of the present invention for the manufacture of pharmaceuticals is provided.
[0210] In some embodiments, the use of at least one nucleic acid molecule or salt thereof, or solvate thereof, as an ETAR expression inhibitor is provided.
[0211] In some embodiments, the use of nucleic acid molecules or salts thereof, or solvates thereof, of the present invention is provided for the production of ETAR expression inhibitors.
[0212] In some embodiments, a method is provided for preventing, improving and / or treating a disease in which endothelin is suspected to be involved, comprising administering a pharmaceutical composition containing at least one nucleic acid molecule or salt thereof of the present invention, or a solvate thereof, as an active ingredient to a subject in need of prevention, improvement and / or treatment of the said disease.
[0213] In some embodiments, a method is provided for preventing and / or treating a disease in which endothelin is suspected to be involved, comprising administering a pharmaceutical composition containing at least one nucleic acid molecule or salt thereof of the present invention, or a solvate thereof, as an active ingredient to a subject in need of prevention and / or treatment of the said disease.
[0214] In some embodiments, a method is provided for preventing, improving and / or treating a disease in which endothelin is suspected to be involved, comprising administering a nucleic acid molecule or a salt thereof, or a solvate thereof, to a subject in need of prevention, improvement and / or treatment of the said disease.
[0215] In some embodiments, a method is provided for preventing and / or treating a disease in which endothelin is suspected to be involved, the method comprising administering a nucleic acid molecule or a salt thereof, or a solvate thereof, to a subject in need of prevention and / or treatment of the said disease.
[0216] Treatment methods for diseases mediated by ETAR expression (diseases in which endothelin is suspected to be involved) include administering a therapeutically effective amount of nucleic acid molecules targeting ETAR to the patient in need of treatment. The dosage of the nucleic acid molecule will be determined after considering the indication for the disease, the characteristics of the patient, etc., to ensure that a therapeutically effective amount is administered to the patient.
[0217] Examples of "pharmaceutically acceptable carriers" include, but are not limited to, sterile water, physiological saline, PBS, vegetable oil, solvents, bases, emulsifiers, suspending agents, surfactants, pH adjusters, stabilizers, flavoring agents, fragrances, excipients, vehicles, preservatives, binders, diluents, isotonic agents, analgesics, bulking agents, disintegrants, buffering agents, coating agents, lubricants, colorants, sweeteners, viscosity modifiers, flavor and odor modifiers, solubilizers, and other additives, as well as combinations thereof. Furthermore, such carriers may include, for example, inert solid diluents or fillers, sterile aqueous solutions, and various organic solvents.
[0218] The administration method of the composition containing the nucleic acid molecule of the present invention is not particularly limited as long as it is a pharmaceutically acceptable administration method, and examples include oral administration, intravenous administration, intra-arterial administration, intramuscular administration, intraperitoneal administration, subcutaneous administration, intradermal administration, intratissue administration, transdermal administration, intra-airway administration, transpulmonary administration, rectal administration, administration by intravenous fluid, and transnasal administration, which can be selected according to the treatment method.
[0219] The composition containing nucleic acid molecules of the present invention can be formulated by known pharmaceutical methods. The dosage form is not particularly limited and includes, for example, tablets, capsules, granules, fine granules, powders, pills, aerosols, inhalants, ointments, patches, topical preparations, transdermal preparations, lotions, suppositories, injections, lozenges, liquids, alcoholic preparations, suspensions, extracts, elixirs, lyophilized preparations, etc., which can be selected according to the method of administration.
[0220] The aqueous solvent that can be used to dissolve the nucleic acid molecules of the present invention is not particularly limited as long as it is an aqueous solvent, and examples include aqueous solvents such as water for injection, distilled water for injection, electrolyte solutions such as PBS and physiological saline, glucose solution and maltose solution.
[0221] The dosage of the composition of the present invention should preferably be adjusted considering the type of nucleic acid molecule contained in the present invention, the dosage form, the age, weight, and condition of the recipient, the route of administration, and the nature and severity of the disease. The dosage will also vary depending on the type of disease being targeted, the form of administration, and the target molecule. Furthermore, the number of administrations will be appropriately selected depending on whether it is for prevention or treatment.
[0222] The nucleic acid molecule of the present invention is expected to be an siRNA capable of improving, for example, activity level, stability, toxicity, resistance to enzymatic degradation, target tissue targeting, intracellular translocation, cytoplasmic translocation, pharmacokinetics, and administration method.
[0223] The present invention will be described in more detail below with reference to examples, but the embodiments of the present invention are not limited to the following examples.
[0224] (Example of siRNA production) Single-chain RNA was produced by solid-phase synthesis on a scale of 1 μmol using an NTS-M8 synthesizer (Nippon Techno Service Co., Ltd.), the corresponding phosphoramidite, and controlled-pore glass (Glen UnySupport® 1000, Glen Research) as a solid support. For solid-phase synthesis, a standard nucleoside phosphoramidite chemical reaction, as described in Current protocols in nucleic acid chemistry, Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, was used. Furthermore, the iodine oxidizing agent solution was replaced with a solution of DDTT (CAS: 1192027-04-5) (pyridine / acetonitrile = 6 / 4) to introduce a phosphorothioate bond.
[0225] Crude oligoribonucleotides were purified and deprotected using the Presep® DNA / RNA Type A reverse-phase solid-phase extraction column, following established procedures. Yield and concentration were determined by UV absorption of each RNA solution at a wavelength of 260 nm using a spectrophotometer (NanoDrop 1000, Thermo Fisher Scientific Inc.). Double-stranded RNA was generated by mixing equimolar solutions of complementary strands in water (0.1 mM), heating at 90°C for 5 minutes, and cooling to room temperature over approximately 30 minutes. The annealed RNA solutions were freeze-dried and stored in a freezer.
[0226] The manufactured siRNAs are shown in the table below by their identification numbers, along with the sequence information for their sense and antisense strands. In the table, identification numbers beginning with "ETN-" represent siRNAs consisting of a natural nucleic acid base sequence without chemical modification, while identification numbers beginning with "ETM-" represent siRNAs consisting of a nucleic acid base sequence with some or all chemical modification. In the table, the chemical structure (modified) sense strand (5'→3') or chemical structure (modified) antisense strand (5'→3') indicates the modification form of the sugar portion, nucleoside bond, or nucleic acid base portion of the oligonucleotide. The nucleic acid base sequence and the modified nucleic acid base sequence are described in the 5' to 3' direction. Furthermore, "U" in the table is represented as "T" in the sequence listing attached to this specification.
[0227]
[0228] (#1) This refers to the start position of the complementary region of the antisense strand of the ETAR siRNA, counted from the 5' position of the target nucleic acid (SEQ ID NO: 1). (#2) This refers to the end position of the complementary region of the antisense strand of the ETAR siRNA, counted from the 5' position of the target nucleic acid (SEQ ID NO: 1).
[0229]
[0230] (#1) This refers to the start position of the complementary region of the antisense strand of the ETAR siRNA, counted from the 5' position of the target nucleic acid (SEQ ID NO: 1). (#2) This refers to the end position of the complementary region of the antisense strand of the ETAR siRNA, counted from the 5' position of the target nucleic acid (SEQ ID NO: 1).
[0231] In the notation of nucleic acid base sequences and chemical structures in the examples, the nucleotide monomers used are represented by the following abbreviations: A is adenosine-3'-phosphate; C is cytidine-3'-phosphate; G is guanosine-3'-phosphate; U is uridine-3'-phosphate; dA is 2'-deoxyadenosine-3'-phosphate; dC or c is 2'-deoxycytidine-3'-phosphate; dG or g is 2'-deoxyguanosine-3'-phosphate; dT or T is thymidine-3'-phosphate; y is 2'-deoxyuridine-3'-phosphate; Am is 2'-O-methyladenosine-3'-phosphate; Cm is 2'-O-methylcytidine-3'-phosphate; Gm is 2'-O-methyl- Anosine-3'-phosphate; Um is 2'-O-methyluridine-3'-phosphate; Af is 2'-deoxy-2'-fluoroadenosine-3'-phosphate; Cf is 2'-deoxy-2'-fluorocytidine-3'-phosphate; Gf is 2'-deoxy-2'-fluoroguanosine-3'-phosphate; Uf is 2'-deoxy-2'-fluorouridine-3'-phosphate; U(NAc) is 2'-deoxy-2'-NHAc-uridine-3'-phosphate; U(Vp) is a modified nucleotide represented by the following formula: [Excluding the area outside the dashed line in the formula]; U(cPrp) is a modified nucleotide represented by the following formula: [Excluding the area outside the dashed line in the formula]; invAb is an inverted non-basic nucleotide represented by the following formula: [Excluding the area outside the dashed line in the formula]; A (C16) is a modified nucleotide represented by the following formula: [Excluding the area outside the dashed line in the formula]; C(C16) is a modified nucleotide represented by the following formula: [Excluding the area outside the dashed line in the formula]; = indicates a phosphorothioate bond (5'-3' bond). In the chemical structure notation in the examples, when "=" (phosphorothioate bond) is not indicated between two adjacent nucleosides, the internucleoside bond (5'-3' bond) between those two nucleosides represents a phosphodiester bond.
[0232] The introduction of U(NAc) can be carried out using the following amidide compound (CAS No. 164167-83-3) in accordance with methods known in the literature.
[0233] The introduction of U(Vp) can be carried out using the following amidide compound (CAS No. 2172373-55-4) in accordance with methods known in the literature.
[0234] The introduction of U(cPrp) can be carried out using the following amidide compound (see WO2017 / 214112) in accordance with methods known in the literature.
[0235] The introduction of invAb can be carried out using the following amidide compound (CAS No. 401813-16-9) in accordance with methods known in the literature. The formula is as follows:
[0236] The introduction of A(C16) can be carried out using the following amidide compound (CAS No. 2382942-35-8) in accordance with methods known in the literature.
[0237] The introduction of C (C16) can be carried out using the following amidide compound (CAS No. 2382942-38-1) in accordance with methods known in the literature.
[0238] Synthesis of nucleic acids with (PEG30k-A) introduced: Alkyne-modified nucleic acid (IM-1) synthesized by nucleic acid synthesis using N,N-bis(1-methylethyl)-Phosphoramidous acid-2-cyanoethyl 5-hexyn-1-yl ester (CAS No. 1048985-37-0; WuXi TIDES) (SM-1), and nucleic acid (ON-1) with (PEG30k-A) introduced were synthesized according to the method described in International Publication No. 2022 / 216920 using Azido PEG (Nanocs, PG1-AZ-30k) (IM-2).
[0239] Synthesis of nucleic acids with (PEG30k-B) introduced: Alkyne-modified nucleic acids (IM-3) synthesized by nucleic acid synthesis using the amidite (SM-2) of N-benzoyl-5′-O-[bis(4-methoxyphenyl)phenylmethyl]-2′-O-2-propyn-1-yl-Adenosine-3′-[2-cyanoethyl N,N-bis(1-methylethyl)phosphoramidite] (CAS No. 171486-59-2; WuXi TIDES) were synthesized, and nucleic acids with (PEG30k-B) introduced (ON-2) were synthesized using Azido PEG (Nanocs, PG1-AZ-30k) (IM-2) in accordance with the method described in International Publication No. 2022 / 216920.
[0240] Synthesis of nucleic acids with L23 introduced: Starting with the compound O-[bis(4-methoxyphenyl)phenylmethyl]-N-[(9H-fluoren-9-ylmethoxy)carbonyl]-L-Serine (CAS No. 151901-83-6) (SM-3), the protecting group was removed and amidation was performed according to the conventional method in the steps described in the scheme below. Then, amiditation was carried out according to the method described in International Publication No. 2017 / 214112 to obtain (S)-14-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-13,16-dioxo-3,6,9-trioxa-12,15-diazahentriacontyl (2-cyanoethyl) diisopropylphosphoramidite (IM-7). Nucleic acids with L23 added were synthesized using the compound (IM-7) and the amidite (RG-4) of 6-[bis(1-methylethyl)amino]-9-cyano-5,7-Dioxa-2-aza-6-phosphanonanoic acid 9H-fluoren-9-ylmethyl ester (CAS No. 105507-37-7) according to nucleic acid synthesis methods.
[0241] Synthesis of nucleic acids with L24 introduced: Starting with N-[(9H-fluoren-9-ylmethoxy)carbonyl]-L-Serine (CAS No. 73724-45-5) (SM-4), the carboxyl group was protected according to a conventional method in the steps described in the scheme below, and then amiditation was carried out according to the method described in International Publication No. 2017 / 214112 to obtain (2-chlorophenyl)diphenylmethyl N-(((9H-fluoren-9-yl)methoxy)carbonyl)-O-((2-cyanoethoxy)(diisopropylamino)phosphaneyl)-L-serinate (IM-9). Using compound (IM-9) and (S)-14-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-13,16-dioxo-3,6,9-trioxa-12,15-diazahentriacontyl (2-cyanoethyl) diisopropylphosphoramidite (IM-7) synthesized by the above method, nucleic acids into which L24 was introduced were synthesized according to the nucleic acid synthesis method.
[0242] (In vitro activity evaluation) 1. Evaluation of ETAR mRNA expression suppression in human cells HEK293 cells were used. Using Opti-MEM (registered trademark) (Thermo Fisher Scientific, cat #31985) as a medium, the prepared siRNA (test compound) and LipofectamineRNAiMax (Thermo Fisher Scientific, cat #13778) were mixed and incubated at room temperature for 5 minutes, then added to a 96-well plate at a concentration of 20 μL per well. Next, 100 μL of HEK293 cells suspended in DMEM (high-glucose) medium containing 10% inactivated FBS, 100 U / mL penicillin, and 0.1 mg / mL streptomycin was placed in 3.0 × 10⁶ wells. 4Transfection was performed by adding the siRNA to form cells. Single-concentration experiments were conducted at 10 nM, and dose-response experiments were conducted at final siRNA concentrations ranging from 0.002 to 40 nM. 37°C, 5% CO2 2 After culturing the cells for approximately 24 hours under these conditions, RNA was isolated from the cells, and the human ETAR mRNA expression level was measured by real-time PCR. RNA was extracted from the cells using RNeasy® Mini Kit (QIAGEN, cat #74106), and cDNA was obtained by reverse transcription using SuperScriptIV VILO master mix (Thermo Fisher Scientific, cat #11766500). Using the obtained cDNA, real-time PCR was performed on a QuantStudio® 3 real-time PCR system (Thermo Fisher Scientific) using TaqMan® Fast Advanced Master Mix (Thermo Fisher Scientific, cat #4444557) as the real-time PCR reagent. TaqMan® Gene Expression Assays (Thermo Fisher Scientific) were used as the primer-probe set to measure human ETAR (Assay ID Hs03988672_m1), human B2M (Assay ID Hs99999907_m1), or human ACTB (Assay ID Hs99999903_m1). The measurement results were analyzed using the ΔΔCt method with human B2M or human ACTB as the reference gene. The expression level (%) (ii) and the expression inhibition rate (%) (100%-ii) were calculated, with the expression level (i) of human ETAR mRNA in untreated cells with only the transfection reagent added set to 100%. The expression level (%) (expression inhibition rate (%)) and IC2 of human ETAR at 10 nM obtained by this method when the test compound is used as the test substance are as follows: 50 The values are listed in Tables 11-1 to 11-7 and Tables 12-1 to 12-6.
[0243]
[0244] 2. Evaluation of ETAR mRNA expression suppression in rat cells. A-10 cells were used. Using Opti-MEM® (Thermo Fisher Scientific, cat #31985) as a medium, the prepared siRNA (test compound) and LipofectamineRNAiMax (Thermo Fisher Scientific, cat #13778) were mixed and incubated at room temperature for 5 minutes. Then, the mixture was added to a 96-well plate at a concentration of 20 μL per well. Next, 100 μL of A-10 cells suspended in DMEM (high-glucose) medium containing 10% inactivated FBS, 100 U / mL penicillin, and 0.1 mg / mL streptomycin was added to each well at a concentration of 8.0 × 10⁶. 3 Add the siRNA to form cells and perform transfection. Single-concentration experiments are performed at 10 nM, and dose-response experiments are performed at final siRNA concentrations ranging from 0.002 to 40 nM. 37°C, 5% CO2 2After culturing the cells for approximately 24 hours under these conditions, RNA is isolated from the cells, and the rat ETAR mRNA expression level is measured by real-time PCR. RNA is extracted from the cells using RNeasy® Mini Kit (QIAGEN, cat #74106), and reverse transcription is performed using SuperScriptIV VILO master mix (Thermo Fisher Scientific, cat #11766500) to obtain cDNA. Using the obtained cDNA, real-time PCR was performed using TaqMan® Fast Advanced Master Mix (Thermo Fisher Scientific, cat #4444557) as the real-time PCR reagent and a QuantStudio® 3 real-time PCR system (Applied Biosystems). Using TaqMan® Gene Expression Assays (Thermo Fisher Scientific) as the primer-probe set, rat ETAR (Assay ID Rn00561137_m1) and rat ACTB (Assay ID Rn00667869_m1) were measured. The measurement results were analyzed using the ΔΔCt method with rat ACTB as the reference gene. The expression level (%) (ii) and the inhibition rate (%) (100% - ii) were calculated, with the expression level (i) of human ETAR mRNA in untreated cells with only the transfection reagent added being set to 100%.
[0245] (In vivo study) 1. Effects on pulmonary hypertension: Rats in which pulmonary hypertension is induced by administration of monocrotaline are used. The prepared test compound is administered transpulmonaryly at a frequency of once every week to once a month, and cardiac weight, right ventricular systolic pressure, etc. are evaluated.
[0246] 2. Evaluation of mRNA expression in tissues ETAR mRNA expression in mouse or rat tissue (lung, liver, kidney) collected after administration of the test compound will be evaluated using real-time PCR. RNA will be extracted from the tissue using TRIZOL® Reagent (Thermo Fisher Scientific, cat #15596) and RNeasy® Mini Kit (QIAGEN, cat #74106), and then reverse transcription will be performed using SuperScriptIV VILO master mix (Thermo Fisher Scientific, cat #11766500) to obtain cDNA. Using the obtained cDNA, real-time PCR is performed on a QuantStudio 3 real-time PCR system (Applied Biosystems) using TaqMan® Fast Advanced Master Mix (Thermo Fisher Scientific, cat #4444557) as the real-time PCR reagent. TaqMan® Gene Expression Assays (Thermo Fisher Scientific) are used as the probe and primer. Rat ETAR (Assay ID Rn00561137_m1), mouse ETAR (Assay ID Mm01243722_m1), and reference genes rat HPRT (Assay ID Rn01527840_m1) and mouse B2M (Assay ID Mm00437762_m1) were measured. The measurement results were analyzed using the ΔΔCt method with the reference genes, and the expression level of ETAR mRNA was shown with the expression in the control animal set to 100%.
[0247] Accession Number 1: Nucleic Acid Sequence of Human ETAR mRNA 1 agtcatcccg ctggtctgac gattgtggag aggcggtgga gaggcttcat ccatcccacc 61 cggtcgtcgc cggggattgg ggtcccagcg agacctcccc gggagaagca gtgcccagga 121 ggttttctga agccggggaa gctgtgcagc cgaagccgcc gccgcgccgg agcccgggac 181 accggccacc ctccgcgcca cccaccctcg ccggctccgg cttcctctgg cccaggcgcc 241 gcgcggaccc ggcagctgtc tgcgcacgcc gagctccacg gtgaaaaaaa agtgaaggtg 301 taaaagcagc acaagtgcaa taagagatat ttcctcaaat ttgcctcaag atggaaaccc 361 tttgcctcag ggcatccttt tggctggcac tggttggatg tgtaatcagt gataatcctg 421 agagatacag cacaaatcta agcaatcatg tggatgattt caccactttt cgtggcacag 481 agctcagctt cctggttacc actcatcaac ccactaattt ggtcctaccc agcaatggct 541 caatgcacaa ctattgccca cagcagacta aaattacttc agctttcaaa tacattaaca 601 ctgtgatatc ttgtactatt ttcatcgtgg gaatggtggg gaatgcaact ctgctcagga 661 tcatttacca gaacaaatgt atgaggaatg gccccaacgc gctgatagcc agtcttgccc 721 ttggagacct tatctatgtg gtcattgatc tccctatcaa tgtatttaag ctgctggctg 781 ggcgctggcc ttttgatcac aatgactttg gcgtatttct ttgcaagctg ttcccctttt841 tgcagaagtc ctcggtgggg atcaccgtcc tcaacctctg cgctcttagt gttgacaggt 901 acagagcagt tgcctcctgg agtcgtgttc agggaattgg gattcctttg gtaactgcca 961 ttgaaattgt ctccatctgg atcctgtcct ttatcctggc cattcctgaa gcgattggct 1021 tcgtcatggt accctttgaa tataggggtg aacagcataa aacctgtatg ctcaatgcca 1081 catcaaaatt catggagttc taccaagatg taaggactg gtggctcttc gggttctatt 1141 tctgtatgcc cttggtgtgc actgcgatct tctacaccct catgacttgt gagatgttga 1201 agaaggaa tggcagcttg agaattgccc tcagtgaaca tcttaagcag cgtcgagaag 1261 tggcaaaaaac agttttctgc ttggtgtaa ttttgctct ttgctggtc cctcttcatt 1321 taagccgtat attgaagaaa actgtgtata acgagatgga caagaaccga tgtgaattac 1381 ttagtttctt actgctcatg gattacatcg gtattaactt ggcaaccatg aattcatgta 1441 taaaccccat agctctgtat tttgtgagca agaaatttaa aaattgtttc cagtcatgcc 1501 tctgctgctg ctgttaccag tccaaaagtc tgatgacctc ggtccccatg aacggaacaa 1561 gcatccagtg gagaaccac gatcaaaaca accacaacac agaccggagc agccataagg 1621 acagcatgaa ctgaccaccc ttagaagcac tcctcggtac tcccataatc ctctcggaga 1681aaaaaatcac aaggcaactg tgagtccggg aatctcttct ctgatccttc ttccttaatt 1741 cactcccaca cccaagaga aatgctttcc aaaacccca gggtagactg gtttatccac 1801 ccacacacatc tacgaatcgt acttacttactttat 1861 attcagcact aaaaaatggt gggagctggg ggagaatgaa gactgttaaa tgaaaccaga 1921 aggatattta ctactttgc atgaaatag agctttcaag tacatgcta gctttatgg actgg 1981 cagttaaaatggt gatcagactgtta tggcatta tggcaga 2041 gattttac tttttaag tgattttt gtccttcagc caacacaat atgggctcaa 2101 gtcacttta tttgaaatgt catttgtgc cagtatttt taactgcata atagcctaac 2161 atgatttatt gaacttacaatttat tgaacaacata tagtattcag 2221 gtgagcaatt agattagtat ttccacgtc actgtttatt tttttaaac acaaattcta 2281 aagctacaac aaatactaca ggccttaaa gcacagtctg atgacacatt tggcagttta 2341 attagacaa ttatagattttattta ggtgttttat 2401 tacaagggac cttgaacatg tttgtagt taaattcaa agtaatgctt caatcagata 2461 gttcttttc acagttcaa tctgttttc atgtaaattt tgtatgaaa atcaatgtca 2521agtaccaaaa tgttaatgta tgtgtcattt aactctgcct gagactttca gtgcactgta 2581 tatagaagtc taaaacacac ctaagagaaa aagatcgaat ttttcagatg attcagaaat 2641 tttcattcag gtatttgtaa tagtgacata tatatg tacctactc 2701c tacattc cttaattttt cttaaaatgt taactggcag taagtcttt ttgatcattc ccttttccat 2761 ataggaaaca taattttgaa gtggccagat gagtttatca tgtcagtgaa aaataattac 2821 ccacaaatgc caccagaact tacgattctt cacttcttgg ggtcttgg atccaccta 28181cctac caacatctcc ctcccacatt gtcaccattt caaagggccc acagtgactt 2941 ttgctgggca tttcccaga tgtttacaga ctgtgagtac agcagaaaat cttttactag 3001 tgtgtgtgtg tatatatata aacaattgta aatttctttt agcccatttt tcctcttt 3ctctgttgtgtgta cttg6 tgtgtgatat atgcatgtgt gtgatggtat gtatggattt 3121 aatctaatct aataattgtg ccccgcagtt gtgccaaagt gcatagtctg agtaaaatct 3181 aggtgattgt tcatcatgac aacctgcctc agtccatttt aaccttgtagc aacctctc1tctaatcaat4 tgttaccatt acaaatggga tataagaggc agcgtgaaag 3301 cagatgagct gtggactagc aatatagggt tttgtttggt tggttggttt gataaagcag 3361tatttggggt catattgttt cctgtgctgg agcaaagtc attacactt gaagtattat 3421 attgttctta tcctcattc atgtgtga tgaaattgcc aggttctg attattctt 3481 cagacttcgc cagagtaccattagtatt gctga gctga 3541 tttaggacag gtaaaatac atcaggttcc agttgcttga attgcaggc tagaagtac 3601 tgcctttg tgtgttagca gtcaatcta ttattcact ggcgcatcat gttgattgattgat 3661 attgccattg ataggtcat accagcc atttaccc 3721 ciegatgctt tgtttcttc atatgaaaaa aatgcatttt aaattcag aaagtcatag 3781 atttctgaag gcgtcaacgt gcattttatt tatggactgg taagtactg tggtttacta 3841 gcaggaatatttttcaatttactactc tttgtagaaa 3901 tgagccagaa gccaaggccc tgagttggca gtgcccata agtgtaaaat aaagtttac 3961 agaaaccttg
[0248] Accession Number 2: Nucleic Acid Sequence of Rat ETAR mRNA 1 ctctggtctg gcagctgtgt ctaaagaggt ggggagcctc tctctgatcc aacggaccat 61 cgcaggagct tgcaggctga gcgagatctc ctctagagaa gccgggccgt cctgggaagt ttcctccagc cgagactggg ctgcagccct ggtcgcgcgc caccctcgaa ctccagctca ggctccgtct ggctccggcg cggacctggc gctgtctgcg tccgaggagc tctaagggga aggaaaggtg tgagaccaac ataacaggac gtttcttcag atccacatta agatgggtgt cctttgcttt ctggcgtcct tttggctggc cctggtggga ggcgcaatcg ctgacaatgc tgagagatac agtgctaatc taagcagcca cgtggaggac ttcacccctt ttccagggac agagttcgac tttctgggca ccacccttcg accccctaat ttggccctgc ctagcaatgg ctcaatgcat ggctattgcc cacagcagac aaaaatcacg acggctttca aatatatcaa cactgtgata tcctgtacca ttttcatcgt gggaatggtg gggaacgcca ctctcctaag aatcatttac caaaacaagt gtatgaggaa cggccccaat gcgctcatag ccagcctggc ccttggagac cttatctacg tggtcattga tctccccatc aatgtgttta agctgttggc ggggcgctgg ccttttgacc acaatgattt tggagtgttt ctctgcaagc tgttcccctt tttgcagaag tcgtccgtgg gcatcactgt cctgaatctc tgcgctctcagtgtggacag 841 gtacagagca gtggcttcct ggagccgggt tcaaggaatc gggatcccct tgattaccgc 901 cattgaaatt gtctccatct ggatcctttc ctttatcttg gccatcccag aagcaatcgg 961 cttcgtcatg gtacccttcg aatacaaggg cgagcagcac aggacctgca tgctcaacgc 1021 cacgaccaag ttcatggagt tttaccaaga cgtgaaggac tggtggctct ttggattcta 1081 cttctgcatg cccttggtgt gcacagcaat cttctatacc ctcatgacct gtgagatgct 1141 caacagaagg aatgggagct tgcggattgc cctcagcgaa cacctcaagc agcgtcgaga 1201 ggtggcaaag accgtcttct gcttggttgt catcttcgcc ctgtgctggt tccctcttca 1261 cttaagccga attttgaaga aaaccgtcta tgatgagatg gataagaacc ggtgtgaact 1321 gctcagcttc ttgctgctca tggattacat tggcattaac ctggcaacca tgaactcttg 1381 cataaaccca atagctctgt attttgtgag caagaaattc aaaaattgtt ttcagtcatg 1441 cctctgttgc tgttgtcacc agtccaaaag cctcatgacc tcggtcccca tgaatggaac 1501 gagtatccag tggaagaacc aggagcagaa ccacaacaca gaacggagca gccacaagga 1561 cagcatgaac taaccctgtg cagaagcacc gagcagtgtg ccttcgagtc ccaggatgaa 1621 acggtcacgc agcagctgcg ctcccaaaac ctcccaggtc tctcccctgcttttgtcta 1681 agtccagcct aagagaagaa atgctctcct gccctcccaa cagcacatga cggaccggtt 1741 ccactcacag ccatgggtct ttcctgagta ctgtccatga tttgcatacc gtgcctgtca 1801 tttccaacac ttgaaaatca ggacaactga gggggaaggt gacagttcaa ggaaaccatg 1861 tgtctgccac ctttgcttga acacagagtt tgcacgttca tttccagctt ccgtgcagtt 1921 ctatggaaca gccagtgggc actgttcatc ctaagattct agagcagtgg ttctcaacct 1981 tcccaatgct gcagcccctt aatacagttc cttatttccc agtgactccc caaccataa 2041 attttgttgc tacttcataa ctataattt gcaactgtta tgacttgtt tatctatctg 2101 atatttctga tagtcttagt ctgccctggt gaaagggcca ttcaattcga aaggggtcac 2161 aacctacaag ttgagaacta cagctctaga aattatgttg aatttgaagc cccgtgtcta 2221 aaatcctata actggagagg tgaggagaga tgatcaggtg ttcaaggaca gactcattta 2281 cagagttcag aaaagccagg gctacataag attctcacaa aaatacaaac agacaaaaag 2341 tgtttaaaag ttatgacaag attcattatt tttttacaac caaacacatt gtgaggttga 2401 agtattcttt tggaaatgac attcagtgtt gggattttat aactgcgtgg caccttagaa 2461 atgattgttt cctcttctat acatgcactt tgaaaaagaa gtgaggaggagaaagaggag 2521 gaggaggagg aggaagagga agaggaggag gaaagggagg gcatctgata aggaactagg 2581 ttctgtttct agggtactgc tttgtttgga aaagatgatt tccaaaggtg accaattacc 2641 accagtcagt ctaataactg ttagccaaagtt aacctttagtta 2701 gttgttgttt ggttgggttt tttgcttgag gctggccttg aattcacaga ggtcttcctg 2761 cttctgcctc caagggctgg gattgaggac acgtgcctag tactctagct tgggtatatg 2821 tttatgctaa attaaaaata aataatac aagcttccta ctcttaacat cctgaggctg aagcaggggg ctgtgagtgg gcgagtgccc 2941 acactaacta gaggtacttg cctccaaata ataataatta ataataatac ttagggccaa 3001 tggttctctc tttcataagc ccagtccttt gtaatgtg tttaacgtg 3061gtc ctgcagctta catgtcactg aagtatggcg agacttccag ccctacgtca gaagcattcc 3121 taggaaaaac atgctggctg gttctggagg gcctggacat ctcgtacaag ctccacagta 3181 gtagcacata tataatgcat gcttcctcg gtctcctcgtc 3241 ggctacactc ctgcccatgc cttcttccag acaggaaaca atgtctgagt ggccaaatga 3301 gctgattgtg tcaggcgaaa tggacaccac cggccatgaa cctttaactctttgctcctc 3361 tatgattgtg agacgaactt aaattttcat cctgtcccca actcctcagt ggtcactatt 3421 tcaaagggcc catggtaagt tactactggg cattttccca gatgtttaca gactgtgaga 3481 acaacaaatg tcttttattt gttatattat ttatatattat gtattattat 3541 agccaaattt tctgtggtta tctctatgga gtgtgtgtgt gtgtgtgtgt gtgtgtgtgt 3601 gtgtgtgtgt gtgtgtgtgt tgtggtacat atagatctgg tgtaatctta gaatgccctg 3661 tgtttgtgcc aaaacacata ttgggaggtgttgt attaccatgt32 ctttggtcag ttcttacaca taagaatctc aagcctccca cacttgctac ttagctacta 3781 ttacagatct gagagctgcc atgcaaggga aagtgactgc aggagggatt tgttaggttg 3841 gatgatctga ccaagtagga ttccgtcata gccttgtcct tgccctgca 3901g tcatagcctt gtccttgctg gagccaagag tcctatactt ggaagtatta cactttctctc 3961 tttactccct tgggtgttct ttttgtttct gttttttact gtttgctctg gggattaagc 4021 ccaggacctc tgctatgcta ggcaagtgccct ccacatttact 81 tagtccccag tggtagtgca actgacaagt cacctggagt ttctgtcaga taatcggtgg 4141 aaaactagct atcttaattt ttgcatcata ttttaataca gttaaaaatgaatcaaatat 4201 caaatcaag attaaaagt gcatcaagtt gcagttgctt gatttcagg gctgagaaat 4261 actaccctg tatgttagta gtcaagtgtg ccactgagta acacacaccc atacatgcct 4321 atacagtt agccagtaagac attatcttgt aaaagatgct 4381 ttgttttta tatataaaat gtatttttta ttcagaacat cgtaggtctg atacacagg 4441 cttcagtgtg cattttgttt atgactgta atgatttact catgaaaaca gttcaccaca 4501 cagagaattcacgac gggcctgtgt tggcagtggc 4561 ccattaaaca gaaataaaa gtttacagaa gcttt
Claims
1. A nucleic acid molecule or a salt thereof, or a solvate thereof, comprising a sense strand and an antisense strand, wherein the strands form a double-stranded region, and the sense strand and the antisense strand contain nucleotide sequences selected from combinations of sense strands and antisense strands shown in the identification numbers in Tables 1-1 to 1-8.
2. The nucleic acid molecule or salt thereof according to claim 1, or a solvate thereof, wherein the sense strand and the antisense strand each independently contain 19 to 29 nucleotides in length.
3. A nucleic acid molecule or a salt thereof, or a solvate thereof, according to claim 1, wherein at least one of the sense strand and the antisense strand comprises at least one modified nucleotide.
4. A phosphate group (P(O)(OH)) is attached to the hydroxyl group at the 5' position of the nucleotide at the 5' end of the sense strand or the antisense strand. 2 ) or thiophosphate group (P(S)(OH) 2 A nucleic acid molecule or a salt thereof according to claim 3, or a solvate thereof, comprising a nucleotide substituted with ).
5. The modified nucleotides are 2'-deoxynucleotides, 2'-O-methyl (2'OMe) modified nucleotides, and 2'-O-C 16 H 33 A nucleic acid molecule or a salt thereof according to claim 3, comprising modification of one or more sugar groups selected from the group consisting of modified nucleotides, 2'-deoxy-2'-fluoro-modified nucleotides, 2'-deoxy-2'-NHAc-modified nucleotides, and debasalized nucleotides, or a solvate thereof.
6. The nucleic acid molecule or salt thereof according to claim 3, or a solvate thereof, wherein the modified nucleotide comprises modification of an internucleoside bond which is a phosphorothioate bond.
7. A nucleic acid molecule or a salt thereof, or a solvate thereof, according to claim 3, wherein at least one of the sense strand and the antisense strand contains at least one phosphorothioate bond at its 5' end and 3' end, respectively.
8. The nucleic acid molecule or salt thereof, or a solvate thereof, according to claim 3, wherein the sense strand and the antisense strand include a modified nucleotide sequence selected from combinations of sense strands and antisense strands indicated by the identification numbers in Tables 3-1 to 3-11.
9. A nucleic acid molecule or a salt thereof according to claim 8, or a solvate thereof, wherein a functional molecule is bound to the sense chain.
10. A nucleic acid molecule or salt thereof according to any one of claims 1 to 9, or a solvate thereof, which inhibits the expression of the endothelin A receptor.
11. A nucleic acid molecule or a salt thereof according to any one of claims 1 to 10, or a solvate thereof, comprising one or two mismatched bases at any position in the double-stranded region.
12. A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of claims 1 to 11, wherein the nucleic acid molecule is siRNA.
13. A pharmaceutical composition comprising a nucleic acid molecule or siRNA or a salt thereof according to any one of claims 1 to 12, or a solvate thereof, and a pharmaceutically acceptable carrier.
14. The pharmaceutical composition according to claim 13, used for treating diseases involving endothelin A receptors.
15. The pharmaceutical composition according to claim 14, wherein the disease involving the endothelin A receptor is selected from the group consisting of pulmonary arterial hypertension, focal segmental glomerulosclerosis, IgA nephropathy, chronic kidney disease (including diabetic nephropathy), renal impairment associated with sickle cell anemia, acute kidney injury, hypertension, non-alcoholic steatohepatitis (NASH), cancer, pain associated with endometriosis, complications associated with scleroderma, cerebral vasospasm, and hypertrophic cardiomyopathy.