Method for producing nucleic acid oligomer

The method improves nucleic acid oligomer production efficiency and purity by using gaseous nucleophiles and aprotic solvents to cleave and deprotect nucleic acid oligomers with protected hydroxyl groups, enhancing the cleavage and deprotection processes.

WO2026071145A1PCT designated stage Publication Date: 2026-04-02SUMITOMO CHEM CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-09-29
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

Existing methods for producing nucleic acid oligomers, particularly those with a protected hydroxyl group at the 2' position of ribose, suffer from inadequate purity and inefficiency in the cleavage and deprotection processes.

Method used

A method involving the use of a nucleic acid oligomer supported on an amino group via a linker, contacted with a gaseous nucleophile such as an inorganic or organic amine, followed by extraction in an aprotic solvent and subsequent deprotection with tetraalkylammonium fluoride, enhances the efficiency of cleavage and deprotection steps.

Benefits of technology

This method improves the purity and efficiency of nucleic acid oligomer production, particularly for those with protected hydroxyl groups at the 2' position of ribose, addressing the inefficiencies of previous techniques.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure JPOXMLDOC01-APPB-C000001
    Figure JPOXMLDOC01-APPB-C000001
  • Figure JPOXMLDOC01-APPB-C000002
    Figure JPOXMLDOC01-APPB-C000002
  • Figure JPOXMLDOC01-APPB-C000003
    Figure JPOXMLDOC01-APPB-C000003
Patent Text Reader

Abstract

The purpose of the present invention is to provide a method for efficiently producing a nucleic acid oligomer, in particular, a method which makes it possible to efficiently advance a process for cleaving a nucleic acid oligomer from a solid-phase support. Specifically, the present invention provides a method for producing a nucleic acid oligomer, the method including a step for bringing a nucleic acid oligomer into contact with a gaseous nucleophile such as an inorganic amine or an organic amine, the nucleic acid oligomer containing a ribose in which a hydroxyl group at position-2' is protected by a specific protective group and being supported, via a linker, onto an amino group on the surface of a solid-phase support, thereby cleaving the nucleic acid oligomer from the solid-phase support. The nucleophile is ammonia or the like.
Need to check novelty before this filing date? Find Prior Art

Description

Method for producing nucleic acid oligomers

[0001] This application claims priority and benefits of Japanese Patent Application No. 2024-170606, filed on 30 September 2024, the entire contents of which are incorporated herein by reference. The present invention relates to a method for producing nucleic acid oligomers.

[0002] In recent years, there has been growing interest in the medical applications of nucleic acid oligomers. Examples include antisense nucleic acids, aptamers, ribozymes, and nucleic acids that induce RNA interference (RNAi), such as siRNA, and these are collectively known as nucleic acid drugs.

[0003] Nucleic acid oligomers can be produced by solid-phase synthesis. Specifically, nucleic acid oligomers can be produced by solid-phase synthesis based on the phosphoramidite method. In the phosphoramidite method, a phosphoramidite compound in which the hydroxyl group at the 2' position of ribose is protected by a protecting group can be used as a raw material. Post-processing of the solid-phase synthesis method includes the steps of cleaving the nucleic acid oligomer from the solid support and deprotecting the protecting group from the hydroxyl group at the 2' position of ribose constituting the nucleic acid oligomer cleaved from the solid support.

[0004] Conventionally, the process of cleaving nucleic acid oligomers from solid support is carried out using amine solutions such as aqueous ammonia. However, there has been a problem in that the purity of nucleic acid oligomers produced in this way is not always satisfactory. Although methods for cleaving DNA oligomers from solid support using ammonia gas or amine gas have also been reported, these methods were not sufficient for application to nucleic acid oligomers containing ribose with a protected hydroxyl group at the 2' position (Non-Patent Literature 1).

[0005] Nucleic Acids Research, 1996, Vol. 24, No. 15, 3115-3117

[0006] The present invention aims to provide an efficient method for producing nucleic acid oligomers.

[0007] The inventors of this invention have conducted extensive research to solve the above problems and have found that by contacting a nucleic acid oligomer containing ribose with a specific protecting group at the 2' position, which is supported on an amino group on the surface of a solid support via a linker, with a gaseous nucleophile such as an inorganic amine or an organic amine, the process of cleaving the nucleic acid oligomer from the solid support can be carried out efficiently. Furthermore, the inventors have found that by extracting the nucleic acid oligomer cleaved from the solid support in an aprotic solvent, the subsequent process of deprotecting the protecting group at the 2' position can be carried out efficiently. As a result, the present invention can provide an efficient method for producing nucleic acid oligomers.

[0008] The present invention has been completed based on these findings and includes, but is not limited to, the following embodiments. [1] Step (A): The hydroxyl group at the 2' position is of the following formula (6): (In the formula, the asterisk (*) indicates the bond point between the hydroxyl group at the 2' position of ribose and the oxygen atom, q represents an integer from 0 to 5, and R a and R b A method for producing a nucleic acid oligomer, comprising the steps of: (A) a nucleic acid oligomer supported on an amino group on the surface of a solid support via a linker, containing ribose protected by a group represented by (Ew), and (B) a nucleic acid oligomer supported on an amino group on the surface of a solid support via a linker, and (A) a nucleic acid oligomer supported on an amino group on the surface of a solid support via a linker, and (B) a method for producing a nucleic acid oligomer, wherein the nucleophile is at least one selected from the group consisting of inorganic amines and organic amines. [2] The method for producing a nucleic acid oligomer according to [1], wherein the nucleophile is ammonia. [3] The method for producing a nucleic acid oligomer according to [1] or [2], wherein q is 0 or 1. [4] R a or R b A manufacturing method according to any one of [1] to [3], wherein one of them is a methyl group and the other is a hydrogen atom. [5] R a and R bThe production method according to any one of [1] to [3], wherein E is a hydrogen atom. [6] The production method according to any one of [1] to [5], wherein Ew is a cyano group. [7] The production method according to any one of [1] to [6], wherein the aprotic solvent contains at least one selected from the group consisting of dimethyl sulfoxide, dimethylformamide, diethylformamide, N,N-dimethylacetamide, N-methylpyrrolidone, 1,3-dimethyl-2-imidazolidinone, and acetonitrile. [8] The production method according to any one of [1] to [6], wherein the aprotic solvent is an aprotic solvent containing dimethyl sulfoxide. [9] The production method according to any one of [1] to [8], wherein step (A) is carried out in an atmosphere where the pressure of the gaseous nucleophile is 0.1 MPa to 1.0 MPa.

[10] The production method according to any one of [1] to [9], further comprising step (C): a step of contacting the nucleic acid oligomer extracted into the aprotic solvent in step (B) with tetraalkylammonium fluoride to deprotect the group represented by the formula (6).

[11] The production method according to any one of [1] to

[10] , wherein the chain length of the nucleic acid oligomer is 50 to 400 mer.

[12] The production method according to any one of [1] to

[11] , wherein the solid support is an inorganic porous support containing an inorganic porous body.

[13] The production method according to

[12] , wherein the inorganic porous body is silica gel, zeolite, or porous glass.

[14] The production method according to

[13] , wherein the porous glass is Controlled Porous Glass.

[15] The production method according to any one of [1] to

[14] , wherein the linker is a linker containing a succinyl group represented by the following formula (9): The production method according to any one of [1] to

[14] , wherein the linker contains a succinyl group represented by the formula.

[16] The nucleic acid oligomer supported on the amino group on the surface of the solid support via a linker is represented by the following formula (5): (In the formula, G 2 represents a hydrogen atom or the following group, G 4 represents a hydrogen atom or the following group, (In the formula, R 1 , R 2 and R 3 each independently represent the same or different hydrogen atom or alkoxy group.) Ba Each independently represents a nucleic acid base which may be protected by a protecting group, R represents a hydrogen atom, a fluorine atom, or an OQ group which independently represents a hydrogen atom, a fluorine atom, or an OQ group which independently represents a methyl group, a 2-methoxyethyl group, a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom of ribose, an ethylidene group bonded to the 4' carbon atom of ribose, or the group shown in formula (6) above which independently represents an oxygen atom or a sulfur atom which independently represents a hydrogen atom or a sulfur atom which independently represents a methyl group, Y represents an oxygen atom or a sulfur atom which independently represents a sulfur atom which independently represents an oxygen atom or a sulfur atom which independently represents an integer which independently represents an oxygen atom or a sulfur atom a methyl group, 2-methoxyethyl group, 2-methoxyethyl group, 2-methoxyethyl group, 2-methoxyethyl group, 2-methoxyethyl group, 2-methoxyethyl group, 2-methoxyethyl group, 2-methoxyethyl group, 2-methoxyethyl group, 2-methoxyethyl group, 2-methoxyethyl group, 2-methoxyethyl group, 2-methoxyethyl group, 2-methoxyethyl group, 2-methoxyethyl group, 2-methoxyethyl group, 2-methoxyethyl group, 2-methoxyethyl group, 2-methoxyethyl group, 2-methoxyethyl group, 2-methoxyethyl group, 2- 1 and X 1 (a) W 1 When represents an OV group, X 1 (b)W represents an OZ group. 1 When represents an OZ group, X 1 is a hydrogen atom, a fluorine atom, or an OQ' group; Q' is a methyl group, a 2-methoxyethyl group, a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, an ethylidene group bonded to the carbon atom at the 4' position of ribose, the group represented by formula (6), or a tert-butyldimethylsilyl group; V is a methyl group, a 2-methoxyethyl group, a tert-butyldimethylsilyl group, or the group represented by formula (6); Z is a group consisting of a solid support and a linkage portion connecting the solid support to the oxygen atom of the hydroxyl group at the 2' or 3' position of the ribose at the 3' end of the nucleic acid oligomer; however, R and W are not applicable. 1 , and X 1 At least one of the groups represents a hydroxyl group protected by the group shown in formula (6).) A method for producing a nucleic acid oligomer as described in any one of [1] to

[15] .

[17] R 1 and R 2 is a methoxy group, R3 The manufacturing method described in

[16] , wherein is a hydrogen atom.

[0009] This invention provides an efficient method for producing nucleic acid oligomers. This invention is expected to improve the purity of the produced nucleic acid oligomers.

[0010] The present invention will be described below with reference to embodiments, but the present invention is not limited to the following embodiments.

[0011] Hereinafter, a first embodiment of the present invention will be described as "a method for producing nucleic acid oligomers, comprising the steps (A) and (B) described above." Furthermore, a second embodiment of the present invention will be described as "a method for producing nucleic acid oligomers, comprising the steps (A) and (B) and further comprising the step (C) described above." In this specification, unless otherwise specified, the first embodiment and the second embodiment together will be referred to as "the method of the present invention."

[0012] As used herein, the term "nucleic acid oligomer" refers to nucleic acid oligomers having chain lengths of 2 mer or more, 10 mer or more, 20 mer or more, 40 mer or more, 50 mer or more, 60 mer or more, 80 mer or more, 100 mer or more, 200 mer or more, 300 mer or more, 2 to 400 mer, 2 to 300 mer, 2 to 200 mer, 2 to 150 mer, 50 to 400 mer, 50 to 300 mer, 50 to 200 mer, 50 to 150 mer, 100 to 400 mer, 100 to 300 mer, 100 to 200 mer, and 100 to 150 mer. The sugar constituting the nucleic acid oligomer may be ribose alone, or both ribose and deoxyribose. The 2' position of ribose may be a hydroxyl group, a hydroxyl group protected by a protecting group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethoxy group, or an OQ'' group. Q'' represents a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose. The bonds between nucleotides constituting the nucleic acid oligomer may be phosphodiester bonds or phosphorothioate bonds. Examples of nucleosides constituting the nucleic acid oligomer include various nucleosides described in Xiulong, Shen et al., Nucleic Acids Research, 2018, Vol. 46, No. 46, 1584-1600, and Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558.

[0013] As used herein, the term "oligonucleotide" has the same meaning as "nucleic acid oligomer" as described above.

[0014] Nucleic acid oligomers can be produced by solid-phase synthesis. Specifically, nucleic acid oligomers can be produced by solid-phase synthesis based on the phosphoramidite method.

[0015] Examples of protecting groups for the hydroxyl group at the 2' position of ribose include the group shown in formula (6) below.

[0016] Formula (6): In the formula, the asterisk (*) indicates the bond point between the hydroxyl group at the 2' position of ribose and the oxygen atom. q represents an integer from 0 to 5, preferably from 0 to 3, more preferably from 0 to 2, and even more preferably 0 or 1. R a and R b Each of these independently represents the same or distinct methyl group, ethyl group, or hydrogen atom. a or R b Either one of them may represent a methyl group and the other may represent a hydrogen atom, R a or R b Either one of them may represent a methyl group and the other may represent an ethyl group, R a or R b Either one of them may represent an ethyl group and the other may represent a hydrogen atom, R a and R b R may represent a methyl group. a and R b R may represent an ethyl group, a and R b q may represent a hydrogen atom. Ew represents an electron-withdrawing group. Examples of electron-withdrawing groups include cyano groups, nitro groups, alkylsulfonyl groups, halogen atoms, arylsulfonyl groups, trihalomethyl groups, and trialkylamino groups. Preferably, a cyano group is given. The group represented by formula (6) preferably has q representing 0 or 1, and R a and R b However, each of these independently represents the same or different methyl group, ethyl group, or hydrogen atom, and Ew represents a cyano group. The group represented by formula (6) is one in which q represents 0 or 1, and R a or R b Either one of them may represent a methyl group, the other a hydrogen atom, and Ew may represent a cyano group. The group represented by formula (6) may be such that q represents 0 or 1, and R a or R bEither one of them may represent a methyl group, the other an ethyl group, and Ew may represent a cyano group. The group represented by formula (6) may be such that q represents 0 or 1, and R a or R b Either one of them may represent an ethyl group, the other a hydrogen atom, and Ew may represent a cyano group. The group represented by formula (6) may be such that q represents 0 or 1, and R a and R b The group may be one in which is a methyl group and Ew is a cyano group. The group represented by formula (6) may be one in which q is 0 or 1 and R a and R b The group may be one in which is an ethyl group and Ew is a cyano group. The group represented by formula (6) may be one in which q is 0 or 1 and R a and R b The group may represent a hydrogen atom, and Ew may represent a cyano group.

[0017] The solid-phase support is not particularly limited and can be any support used in solid-phase synthesis of nucleic acids. Examples of solid-phase supports include inorganic porous supports and organic resin supports. Examples of inorganic porous supports include inorganic porous supports containing inorganic porous materials such as silica gel, zeolite, or porous glass. Examples of porous glass include porous glass commercially available under names such as Controlled Pore Glass (CPG). The shape of the inorganic porous material is not particularly limited and may be approximately spherical, polyhedral, approximately columnar, or crushed. Examples of organic resin supports include supports made of polystyrene.

[0018] The linker can be used without particular limitations as long as it can release nucleic acid oligomers from the solid support by reacting with an inorganic amine or organic amine. For example, a linker containing a succinyl group represented by the following formula (9) can be used. Formula (9):

[0019] Furthermore, the linker may include the structure shown in the following equations (8-1) to (8-8): Equations (8-1) to (8-8): In the formula, A independently represents a hydroxyl group, an alkoxy group, or an alkyl group. Examples of alkoxy groups include methoxy and ethoxy groups. Examples of alkyl groups include methyl, ethyl, isopropyl, and n-propyl groups. Si is bonded to the oxygen atom of the hydroxyl group on the solid support surface. The wavy line on the terminal amino group side represents the bond with the carbonyl carbon atom of the succinyl group shown in formula (9).

[0020] Examples of gaseous nucleophiles that can be used in step (A) of the method of the present invention include at least one selected from the group consisting of gaseous inorganic amines and gaseous organic amines.

[0021] Examples of inorganic amines include ammonia.

[0022] Examples of organic amines include methylamine, ethylamine, n-propylamine, isopropylamine, n-butylamine, isobutylamine, sec-butylamine, tert-butylamine, n-pentylamine, and n-hexylamine. Preferably, methylamine and ethylamine are used.

[0023] Preferably, the nucleophile in the gaseous nucleophile is ammonia, methylamine, and ethylamine, or a mixture of two or more of these. For example, it may be used as a mixture of ammonia and methylamine, as a mixture of ammonia and ethylamine, as a mixture of methylamine and ethylamine, or as a mixture of ammonia, methylamine, and ethylamine.

[0024] The aforementioned nucleophiles are all characterized in that they can act as cleavage agents in the process of cleaving a nucleic acid oligomer, which contains ribose in which the hydroxyl group at the 2' position is protected by the group represented by formula (6), from the solid support via a linker on the surface of the solid support (i.e., step (A)).

[0025] The pressure of the gaseous nucleophile is not particularly limited, but may be, for example, 0.1 MPa to 2.0 MPa, 0.1 MPa to 1.0 MPa, 0.1 MPa to 0.8 MPa, 0.2 MPa to 2.0 MPa, 0.2 MPa to 1.0 MPa, 0.2 MPa to 0.8 MPa, 0.4 MPa to 1.0 MPa, or 0.4 MPa to 0.8 MPa. The pressure of the gaseous nucleophile may be appropriately changed depending on the progress of the reaction.

[0026] The reaction temperature in step (A) of the method of the present invention is not particularly limited, but may be, for example, 80°C or lower, 70°C or lower, 60°C or lower, 50°C or lower, 40°C or lower, 35°C or lower, 30°C or lower, 25°C or lower, 20°C or lower, 15°C or lower, 10°C or lower, or 5°C or lower. Preferably, it is 5°C to 80°C, 10°C to 60°C, 20°C to 50°C, and 25°C to 40°C. The reaction temperature may be appropriately changed depending on the progress of the reaction.

[0027] The reaction time in step (A) of the method of the present invention can be appropriately adjusted depending on the type of nucleophile used, the pressure, and the reaction temperature. For example, it may be 1 minute or more, 5 minutes or more, 10 minutes or more, 15 minutes or more, 30 minutes or more, 1 hour or more, 1 hour to 100 hours, 1 to 24 hours, 2 to 12 hours, or 3 to 10 hours.

[0028] Step (A) in the method of the present invention may be carried out, for example, by contacting a nucleic acid oligomer with a gaseous inorganic amine or organic amine supplied from a cylinder or tank filled with an inorganic amine or organic amine. For example, ammonia gas supplied from a cylinder or tank filled with liquefied ammonia may be used, or methylamine gas supplied from a cylinder or tank filled with liquefied methylamine may be used.

[0029] In step (A) of the method of the present invention, if necessary, the reactor may be purged with an inert gas. The inert gas is not particularly limited, but examples include nitrogen gas, argon gas, helium gas, and carbon dioxide. Specifically, ammonia gas supplied from a cylinder or tank filled with liquefied ammonia may be introduced into the reactor containing the nucleic acid oligomer, the nucleic acid oligomer and the ammonia gas may be brought into contact, and then an inert gas may be introduced into the reactor to replace the ammonia gas with nitrogen gas.

[0030] The aprotic solvent that can be used in step (B) of the method of the present invention is not particularly limited as long as it is an organic solvent that is inert to the reaction, but examples include sulfoxide solvents, nitrile solvents, ether solvents, amide solvents, ketone solvents, aliphatic hydrocarbon solvents, ester solvents, and aromatic solvents, or mixtures of two or more of these. An example of a sulfoxide solvent is dimethyl sulfoxide. An example of a nitrile solvent is acetonitrile and propionitrile. An example of an ether solvent is tetrahydrofuran. An example of an amide solvent is dimethylformamide, diethylformamide, N,N-dimethylacetamide, N-methylpyrrolidone, and 1,3-dimethyl-2-imidazolidinone. An example of a ketone solvent is acetone and methyl ethyl ketone. An example of an aliphatic hydrocarbon solvent is hexane and heptane. An example of an ester solvent is methyl acetate and ethyl acetate. An example of an aromatic solvent is toluene and pyridine. The aprotic solvent is preferably at least one selected from the group consisting of dimethyl sulfoxide, dimethylformamide, diethylformamide, N,N-dimethylacetamide, N-methylpyrrolidone, 1,3-dimethyl-2-imidazolidinone, and acetonitrile. Particularly preferred are aprotic solvents containing dimethyl sulfoxide.

[0031] The amount of aprotic solvent used is not particularly limited, but may be, for example, 1 to 10,000 L, 5 to 8,000 L, 50 to 4,000 L, or 100 to 2,000 L per mole of nucleic acid oligomer containing ribose in which the hydroxyl group at the 2' position is protected by the group represented by formula (6).

[0032] Step (B) in the method of the present invention may be carried out, for example, by (i) adding an aprotic solvent to the nucleic acid oligomer cleaved from the solid support in step (A), (ii) adding the nucleic acid oligomer cleaved from the solid support in step (A) to an aprotic solvent, or (iii) adding the nucleic acid oligomer cleaved from the solid support in step (A) and the aprotic solvent simultaneously to the reaction system. Of the above methods (i) to (iii), method (i) is preferred. In any of the above methods (i) to (iii), a homogeneous solution may be prepared by stirring the solution containing the nucleic acid oligomer and the aprotic solvent.

[0033] The temperature during step (B) in the method of the present invention is not particularly limited, but may be, for example, 80°C or lower, 70°C or lower, 60°C or lower, 50°C or lower, 40°C or lower, 35°C or lower, 30°C or lower, 25°C or lower, 20°C or lower, 15°C or lower, 10°C or lower, or 5°C or lower. Preferably, it is 5°C to 80°C, 10°C to 40°C, 10°C to 35°C, and 25°C to 35°C. The time required to carry out step (B) is not particularly limited, but when adding an aprotic solvent to the nucleic acid oligomer, it may be carried out by, for example, a single-addition method, i.e., an inflow method, or by a dropwise addition method over a certain period of time.

[0034] Examples of tetraalkylammonium fluoride that can be used in step (C) of the method of the present invention include tetramethylammonium fluoride (TMAF), tetraethylammonium fluoride (TEAF), and tetra-n-butylammonium fluoride (TBAF). Preferably, tetra-n-butylammonium fluoride (TBAF) is used.

[0035] The amount of tetraalkylammonium fluoride used is not particularly limited, but may be, for example, 1 to 1000 moles, 1 to 500, 2 to 400 moles, 4 to 300 moles, or 10 to 200 moles per mole of the group represented by formula (6).

[0036] Step (C) in the method of the present invention may be carried out, for example, by (i) adding tetraalkylammonium fluoride to a mixture containing a nucleic acid oligomer containing ribose in which the hydroxyl group at the 2' position is protected by the group represented by formula (6) and an aprotic solvent; (ii) adding a mixture containing a nucleic acid oligomer containing ribose in which the hydroxyl group at the 2' position is protected by the group represented by formula (6) and an aprotic solvent to tetraalkylammonium fluoride; or (iii) adding a mixture containing a nucleic acid oligomer containing ribose in which the hydroxyl group at the 2' position is protected by the group represented by formula (6) and an aprotic solvent, and tetraalkylammonium fluoride to the reaction system simultaneously. Of the above methods (i) to (iii), method (i) is preferred. In any of the above methods (i) to (iii), tetraalkylammonium fluoride may be dissolved in an organic solvent that is inert to the reaction. The above aprotic solvent can similarly be used as the organic solvent that is inert to the reaction. The method of adding tetraalkylammonium fluoride is not particularly limited, but it may be carried out by a single-addition method, i.e., by inflow, or by a dropwise addition method over a certain period of time. The time required to add the entire amount of tetraalkylammonium fluoride is not particularly limited, but for example, it may be 1 minute or more, 5 minutes or more, 10 minutes or more, 15 minutes or more, 30 minutes or more, or 1 hour or more. The method of adding the solution containing nucleic acid oligomers is not particularly limited, but it may be carried out by a single-addition method, i.e., by inflow, or by a dropwise addition method over a certain period of time. The time required to add the entire amount of solution containing nucleic acid oligomers is not particularly limited, but for example, it may be 1 minute or more, 5 minutes or more, 10 minutes or more, 15 minutes or more, 30 minutes or more, or 1 hour or more.

[0037] The reaction temperature in step (C) of the method of the present invention is not particularly limited, but may be, for example, 80°C or lower, 70°C or lower, 60°C or lower, 50°C or lower, 40°C or lower, 35°C or lower, 30°C or lower, 25°C or lower, 20°C or lower, 15°C or lower, 10°C or lower, or 5°C or lower. Preferably, it is 5°C to 80°C, 10°C to 40°C, 10°C to 35°C, and 25°C to 35°C. When adding tetraalkylammonium fluoride to a solution containing nucleic acid oligomers, the reaction temperature may be appropriately changed after or during the addition of tetraalkylammonium fluoride. For example, tetraalkylammonium fluoride may be added to a solution containing nucleic acid oligomers while maintaining the temperature of the solution at 5 to 20°C, and the temperature of the solution may be raised to 20 to 40°C after or during the addition of tetraalkylammonium fluoride.

[0038] The reaction time in step (C) of the method of the present invention can be appropriately adjusted depending on the type of tetraalkylammonium fluoride used and the reaction temperature. For example, it may be 1 minute or more, 5 minutes or more, 10 minutes or more, 15 minutes or more, 30 minutes or more, 1 hour or more, 1 hour to 100 hours, 1 to 24 hours, 2 to 12 hours, or 3 to 6 hours. In addition, tetraalkylammonium fluoride may be added at any time depending on the progress of the reaction.

[0039] In step (C) of the method of the present invention, a solution obtained by dissolving tetra-n-butylammonium fluoride in an aprotic solvent such as dimethyl sulfoxide can be used. In this case, the solution may be used after being dehydrated by adding a dehydrating agent. Examples of the dehydrating agent include molecular sieves and sulfates, but molecular sieve 4A is preferred.

[0040] Step (C) in the method of the present invention may be carried out by stirring the reaction solution. When stirring the reaction solution, for example, the stirring power Pv may be 0.0 to 0.5 kW / m 3 Stirring may be performed within this range, and the stirring power Pv may be 0.1 to 0.3 kW / m 3 You may stir within this range.

[0041] Step (C) in the method of the present invention may be carried out under an inert gas atmosphere in which the oxygen concentration is adjusted to a certain level or lower. An inert gas atmosphere with an oxygen concentration of a certain level or lower may be carried out, for example, by preparing an inert gas with an oxygen concentration of a predetermined level or lower, supplying it to the reaction system, and measuring and confirming that the oxygen concentration in the gas phase is within the predetermined oxygen concentration range. Specifically, this can be adjusted by flowing a high-purity inert gas or an inert gas with an oxygen concentration adjusted to a predetermined level through the gas phase of the reaction system, or by replacing the gas phase atmosphere of the reaction system with the aforementioned inert gas or an inert gas with an adjusted concentration. Examples of inert gases that can be used in the method of the present invention include, but are not limited to, nitrogen gas, argon gas, helium gas, and carbon dioxide. Preferably, nitrogen gas and argon gas are used. The method for replacing the reaction system atmosphere may be vacuum displacement, pressurized displacement, flow displacement, displacement by bubbling, or displacement by freeze-degassing, and ultrasonic waves or heating may be applied during this process. More preferred methods are flow displacement or vacuum displacement. Examples of inert gas atmospheres with an oxygen concentration below a certain level include those with an oxygen concentration of 15% or less, those with an oxygen concentration of 10% or less, those with an oxygen concentration of 5% or less, and those with an oxygen concentration of 0%. The oxygen concentration can be measured using an oxygen concentration meter.

[0042] In step (C) of the method of the present invention, a quenching agent may be used. For example, an aqueous solution of ammonium acetate and Tris-HCl buffer can be used as quenching agents. Quenching may be carried out by adding the quenching agent to a solution containing a nucleic acid oligomer, tetraalkylammonium fluoride, and / or an aprotic solvent.

[0043] Conventional methods can be used as means for separating and purifying the nucleic acid oligomers produced by the method of the present invention, in which the group represented by formula (6) is deprotected. Examples of such methods include extraction, concentration, neutralization, filtration, centrifugation, recrystallization, silica gel column chromatography, thin-layer chromatography, reversed-phase column chromatography, ion-exchange column chromatography, gel filtration column chromatography, hydrophobic interaction chromatography, hydrophilic interaction liquid chromatography, affinity chromatography, precipitation (e.g., precipitation of nucleic acid oligomers using ethanol, isopropanol, methanol, or polyethylene glycol), dialysis, and ultrafiltration. When purifying the crude nucleic acid oligomer product obtained by the method of the present invention by reversed-phase column chromatography, the method may be carried out according to the method described on pages 102-104 of Synthesis of Therapeutic Oligonucleotides. Examples of silica or polymers that serve as a hydrophobic stationary phase include silica or polymers on which one or more selected from phenyl groups, C1-C20 alkyl groups, and cyanopropyl groups are immobilized. As the packing material, silica or polymer can be used, for example, with a particle size of 2 μm or more, or 5 μm or more. For reversed-phase column chromatography, a mobile phase containing alkylammonium salt, water-soluble organic solvent, and water can be used. Typically, monoalkylammonium salts, dialkylammonium salts, and trialkylammonium salts are used as alkylammonium salts, preferably monoalkylammonium salts and dialkylammonium salts, more preferably dialkylammonium salts. The number of carbon atoms in the monoalkylamine that forms the monoalkylammonium salt is preferably 3 to 10, more preferably 4 to 6, and even more preferably hexylamine. The number of carbon atoms in the dialkylamine that forms the dialkylammonium salt is preferably 4 to 10, more preferably 5 to 9. A preferred dialkylamine is di-n-butylamine.The trialkylamines that form trialkylammonium salts are preferably those having 6 to 12 carbon atoms, more preferably those having 6 to 9 carbon atoms, and specifically, triethylamine is an example. Acids that form monoalkylammonium salts, dialkylammonium salts, and trialkylammonium salts include, for example, carbonic acid, acetic acid, formic acid, trifluoroacetic acid, and propionic acid. Examples of water-soluble organic solvents include alcoholic organic solvents and nitrile organic solvents. Examples of alcoholic organic solvents include C1-4 alcohols, C1-3 alcohols, and C1-2 alcohols, and methanol is preferred. An example of a nitrile organic solvent is acetonitrile. The temperature for reversed-phase column chromatography is usually 20 to 100°C, preferably 30 to 80°C, and more preferably 40 to 70°C.

[0044] Nucleic acid oligomers supported on amino groups on the surface of a solid support via linkers include, for example, the nucleic acid oligomer represented by the following formula (5). Formula (5):

[0045] In the formula, G 2 G represents a protecting group for a hydrogen atom or a hydroxyl group. 2 When represents a protecting group for a hydroxyl group, examples include alkyl groups, alkenyl groups, alkynyl groups, cycloalkyl groups, haloalkyl groups, aryl groups, heteroaryl groups, arylalkyl groups, cycloalkenyl groups, cycloalkylalkyl groups, cyclylalkyl groups, hydroxyalkyl groups, aminoalkyl groups, alkoxyalkyl groups, heterocyclylalkenyl groups, heterocyclylalkyl groups, heteroarylalkyl groups, silyl groups, silyloxyalkyl groups, mono, dialkylsilyl or trialkylsilyl groups, or monoalkylsilyloxyalkyl groups, and dialkylsilyloxyalkyl groups or trialkylsilyloxyalkyl groups, which may be substituted with one or more electron-withdrawing groups. 2Preferably, the group is an alkyl group substituted with an electron-withdrawing group. Examples of electron-withdrawing groups include cyano groups, nitro groups, alkylsulfonyl groups, halogen atoms, arylsulfonyl groups, trihalomethyl groups, and trialkylamino groups. A cyano group is preferred. 2 Preferably, the following groups are used:

[0046] G 4 This represents a hydrogen atom or one of the following groups. (In the formula, R 1 , R 2 and R 3 Each of these independently represents either the same or different hydrogen atom or alkoxy group. 1 , R 2 and R 3 It is preferable that one of the atoms is a hydrogen atom and the remaining two are identical or different (preferably identical) alkoxy groups, with methoxy groups being particularly preferred as the alkoxy groups. 4 Examples of such groups include the 4,4'-dimethoxytrityl group (DMTr group), the 4-monomethoxytrityl group, and the 4,4',4''-trimethoxytrityl group. The 4,4'-dimethoxytrityl group (DMTr group) is particularly preferred.

[0047] B a Each of these independently represents a nucleic acid base that may be identical or distinct and protected by a protecting group. aExamples of nucleic acid bases represented by include adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, and 1-methylpseudracil. The nucleic acid base may be substituted with substituents. Examples of substituents include halogen atoms such as fluoro, chloro, bromo, and iodo groups; acyl groups such as acetyl groups; alkyl groups such as methyl and ethyl groups; arylalkyl groups such as benzyl groups; alkoxy groups such as methoxy groups; alkoxyalkyl groups such as methoxyethyl groups; cyanoalkyl groups such as cyanoethyl groups; hydroxyl groups; hydroxyalkyl groups; acyloxymethyl groups; amino groups; monoalkylamino groups; dialkylamino groups; carboxyl groups; cyano groups, and nitro groups, as well as combinations of two or more of these. When the nucleic acid base has an amino group outside the ring, the protecting group for the amino group is not particularly limited, and any protecting group used in known nucleic acid chemistry can be used. Examples of such protecting groups include benzoyl group, 4-methoxybenzoyl group, 4-methylbenzoyl group, acetyl group, propionyl group, butyryl group, isobutyryl group, phenylacetyl group, phenoxyacetyl group, 4-tert-butylphenoxyacetyl group, 4-isopropylphenoxyacetyl group, and (dimethylamino)methylene group, as well as combinations of two or more of these. a More specifically, the following are examples: (In the formula, R 4 R represents a hydrogen atom, a methyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or a benzoyl group. 5 R represents a hydrogen atom, an acetyl group, an isobutyryl group, or a benzoyl group. 6 R represents a hydrogen atom, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or an isobutyryl group. 7 R represents a 2-cyanoethyl group. 8R represents a hydrogen atom, a methyl group, a benzoyl group, a 4-methoxybenzoyl group, or a 4-methylbenzoyl group. 9 (This represents a dimethylaminomethylene group.)

[0048] Each R independently represents a hydrogen atom, a fluorine atom, or an OQ group, either identical or distinct in phase. Each Q independently represents a methyl group, a 2-methoxyethyl group, a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom of ribose, an ethylidene group bonded to the 4' carbon atom of ribose, or the group shown in formula (6) above, either identical or distinct in phase. Specific examples of the methylene group bonded to the 4' carbon atom of ribose, the ethylene group bonded to the 4' carbon atom of ribose, or the ethylidene group bonded to the 4' carbon atom of ribose include the structures shown in LNA-1, LNA-2, or LNA-3 below. (In the formula, B a (This is as defined above.)

[0049] Each Y independently represents either the same or different oxygen atom or a sulfur atom.

[0050] m represents an integer between 2 and 400. If necessary, when m is an integer greater than or equal to 3, non-nucleotide linkers may be incorporated instead of the p nucleotides between the 5' and 3' ends of each nucleotide (where p is a positive integer satisfying the equation: m-1 > p).

[0051] Examples of non-nucleotide linkers include linkers consisting of an amino acid skeleton (for example, linkers consisting of an amino acid skeleton described in Japanese Patent Publication No. 5157168 or Japanese Patent Publication No. 5554881). Specifically, examples include linkers represented by the following formulas (A14-1), (A14-2), or (A14-3) (for example, described in Japanese Patent Publication No. 5555346 or Japanese Patent Publication No. 5876890). In addition to these linkers, examples include linkers described in International Publication No. 2012 / 005368, International Publication No. 2018 / 182008, or International Publication No. 2019 / 074110. (In the formula, 5' and 3' represent the 5' end and 3' end of the nucleic acid oligomer, respectively, G 2 And Y is as described above.

[0052] W 1 and X 1 It is defined by either (a) or (b) below. (a) W 1 When represents an OV group, X 1 (b)W represents an OZ group. 1 When represents an OZ group, X 1 represents a hydrogen atom, a fluorine atom, or an OQ' group, where Q' represents a methyl group, a 2-methoxyethyl group, a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, an ethylidene group bonded to the carbon atom at the 4' position of ribose, the group represented by formula (6), or a tert-butyldimethylsilyl group. V represents a methyl group, a 2-methoxyethyl group, a tert-butyldimethylsilyl group, or the group represented by formula (6). Z represents a group consisting of a solid support and a linkage portion connecting the solid support to the oxygen atom of the hydroxyl group at the 2' or 3' position of the ribose at the 3' end of the nucleic acid oligomer. The linking portion connecting the solid support and the oxygen atom of the hydroxyl group at the 2' or 3' position of the ribose at the 3' end of the nucleic acid oligomer specifically includes a linker containing at least one of the structures shown in formulas (8-1) to (8-8) and the group shown in formula (9). Furthermore, the linking portion may also include structures derived from a universal linker. An example of a universal linker is UnyLinker, sold by ChemGenes, Inc., etc. TM Universal Supports are mentioned. R, W 1 , and X 1 At least one of these groups represents a hydroxyl group protected by the group shown in formula (6).

[0053] The nucleic acid oligomer represented by formula (5) can be produced, for example, by a solid-phase synthesis method based on the phosphoramidite method, which includes the following steps (1) to (4). The solid-phase synthesis method can be carried out according to generally known methods (for example, the method described in "Synthesis of Therapeutic Oligonucleotides"). It can also be carried out using an automated nucleic acid synthesizer. Step (1): A step of reacting a nucleoside or oligonucleotide, which is bonded to a solid support via a linker and whose hydroxyl group at the chain extension end is protected by a protecting group that can be deprotected under acidic conditions, with a deblocking solution to deprotect the protecting group at the hydroxyl group at the chain extension end from the nucleoside or oligonucleotide; Step (2): A step of subjecting the hydroxyl group at the chain extension end from which the protecting group was deprotected in Step (1) to a coupling reaction with a phosphoramidite compound to produce a phosphite triester; Step (3): A step of oxidizing or sulfidating the phosphite triester produced in Step (2) to convert it into a phosphate triester or a phosphorothioate triester; and Step (4): A step of synthesizing an oligonucleotide on a solid support by a chain extension reaction in which a series of reactions consisting of Steps (1) to (3), i.e., Step (1) the deblocking reaction, Step (2) the coupling reaction, and Step (3) the oxidation or sulfidation reaction, are repeated any number of times. Furthermore, in the solid-phase synthesis method, a step may be added before or after the oxidation or sulfidation step to cap the hydroxyl groups that did not undergo the coupling reaction with the phosphoramidite compound.

[0054] The nucleic acid oligomer represented by formula (5) obtained by the solid-phase synthesis method can then be subjected to the following step (5). Step (5): A step of cleaving and deprotecting the oligonucleotide synthesized on the solid-phase support in step (4). Specifically, step (5) includes the following steps (5-1), (5-2), (5-3), (5-4), (5-5), and (5-6). Here, the execution of step (5-1) is optional, steps (5-2), (5-3), and (5-4) may be performed simultaneously, or steps (5-3) and (5-4) may be performed after step (5-2). Step (5-1): A step to deprotect the protecting group of the hydroxyl group at the chain extension end of the oligonucleotide. Step (5-2): A step to deprotect the protecting group of the phosphate portion of the oligonucleotide. Step (5-3): A step to deprotect the protecting group of the nucleic acid base portion of the oligonucleotide. Step (5-4): A step to cleave the oligonucleotide from the solid support. Step (5-5): A step to extract the oligonucleotide cleaved from the solid support into an aprotic solvent. Step (5-6): A step to deprotect the protecting group of the hydroxyl group at the 2' position of the ribose contained in the oligonucleotide. Steps (1) to (5) will be described below. Step (5-4) can be carried out according to the method of step (A) in the method of the present invention, step (5-5) can be carried out according to the method of step (B) in the method of the present invention, and step (5-6) can be carried out according to the method of step (C) in the method of the present invention.

[0055] The deblocking reaction of step (1) can be carried out using an acid. As the acid, for example, trifluoroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid, and p-toluenesulfonic acid can be used. The acid can be used as a solution (deblocking solution) diluted with a solvent inert to the reaction. As the deblocking solution, for example, a toluene solution of dichloroacetic acid or a toluene solution of trichloroacetic acid can be used. A commercially available deblocking solution can also be used, or a commercially available acid diluted with a solvent such as toluene can be used as the deblocking solution. The amount of the deblocking solution used, the reaction time, and the reaction temperature in the deblocking reaction are not particularly limited and can be optimized as necessary.

[0056] The coupling reaction of step (2) can be carried out using a phosphoramidite compound and an activator. As the phosphoramidite compound, for example, a phosphoramidite compound represented by the following formula (A13) can be used. Formula (A13): In the formula, a B 2 G 4 G 3 and R are as defined in the above formula (5). 3 G 3 each independently represents the same or different alkyl group. 3 G 4 two G 9 may be bonded to each other to form a cyclic structure. c G cPreferably, both are isopropyl groups. The phosphoramidite compound represented by formula (A13) is a phosphoramidite compound used when synthesizing oligonucleotides from the 3' end to the 5' end. When synthesizing oligonucleotides from the 5' end to the 3' end, a phosphoramidite compound in which the substituent of the hydroxyl group at the 3' position and the substituent of the hydroxyl group at the 5' position are swapped, as in the phosphoramidite compound represented by formula (A13), can be used. An example of the phosphoramidite compound represented by formula (A13) is the PMM amidite described in International Publication No. 2019 / 208571. The aforementioned document discloses a PMM amidite containing uracil, cytosine having an acetyl-protected amino group, guanine having a phenoxyacetyl-protected amino group, and adenine having an acetyl-protected amino group as nucleic acid bases, but the types of nucleic acid bases are not limited to these. Examples of phosphoramidite compounds represented by formula (A13) include the CEM amidite described in Nucleic Acids Research, 2007, Vol.35, No.10, 3287-3296. The aforementioned document discloses a CEM amidite containing uracil, cytosine with an acetyl-protected amino group, guanine with a phenoxyacetyl-protected amino group, and adenine with an acetyl-protected amino group as nucleic acid bases, but the types of nucleic acid bases are not limited to these. Examples of phosphoramidite compounds represented by formula (A13) include the EMM amidite described in International Publication 2013 / 027843. The aforementioned document discloses an EMM amidite containing uracil, cytosine with an acetyl-protected amino group, guanine with a phenoxyacetyl-protected amino group, and adenine with an acetyl-protected amino group as nucleic acid bases, but the types of nucleic acid bases are not limited to these. Examples of the phosphoramidite compound represented by formula (A13) include the BMM amidite described in International Publication No. 2019 / 208571.The aforementioned document discloses a BMM amidite containing uracil as the nucleic acid base, but the type of nucleic acid base is not limited to these. An example of a phosphoramidite compound represented by formula (A13) is the TBM amidite described in International Publication No. 2019 / 208571. The aforementioned document discloses a TBM amidite containing uracil as the nucleic acid base, but the type of nucleic acid base is not limited to these. An example of a phosphoramidite compound represented by formula (A13) is the CPM amidite described in International Publication No. 2019 / 208571. The aforementioned document discloses a CPM amidite containing cytosine having an acetyl-protected amino group as the nucleic acid base, but the type of nucleic acid base is not limited to these. Examples of phosphoramidite compounds represented by formula (A13) include the TEM amidite described in Organic & Biomolecular Chemistry, 2007, 5, 333-343. This document discloses TEM amidites containing uracil, cytosine with an acetyl-protected amino group, guanine with a dimethylaminomethylene-protected amino group, and adenine with a phenoxyacetyl-protected amino group as nucleic acid bases, but the types of nucleic acid bases are not limited to these. Examples of phosphoramidite compounds represented by formula (A13) include the TPM amidite described in International Publication 2021 / 079617. This document discloses TPM amidites containing uracil as a nucleic acid base, but the types of nucleic acid bases are not limited to these. Examples of the phosphoramidite compounds represented by formula (A13) include 2'-OMe amidite, 2'-F amidite, 2'-O-methoxyethyl amidite, 2'-H amidite, and 2'-fluoro-2'-deoxy-β-D-arabinofuranosyl amidite. These phosphoramidite compounds can be purchased and used from the market. In addition, phosphoramidite compounds corresponding to LNA-1, LNA-2, or LNA-3 can be used. These phosphoramidite compounds can be purchased and used from the market.Furthermore, phosphoramidite compounds corresponding to the above formulas (A14-1), (A14-2), or (A14-3) can be used. These phosphoramidite compounds can be synthesized according to the methods described in Japanese Patent Publication No. 5157168, Japanese Patent Publication No. 5554881, Japanese Patent Publication No. 5555346, or Japanese Patent Publication No. 5876890. The phosphoramidite compounds can be used as a solution diluted with a solvent inert to the reaction (amidite solution). As the amidite solution, for example, a solution diluted with acetonitrile or a mixed solvent of acetonitrile and toluene can be used. As the activator, any activator used in the phosphoramidite method can be used without limitation. Examples of activators that can be used include 5-benzylthio-1H-tetrazole (BTT) (also known as 5-benzylmercapto-1H-tetrazole), 1H-tetrazole, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazole (ETT), N-methylbenzimidazolium triflate (N-MeBIT), benzimidazolium triflate (BIT), N-phenylimidazolium triflate (N-PhIMT), imidazolium triflate (IMT), 5-nitrobenzimidazolium triflate (NBT), 1-hydroxybenzotriazole (HOBT), and 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazole. The activator can be used as a solution diluted with a solvent inert to the reaction (activator solution). For example, a solution diluted with acetonitrile can be used as the activator solution. The amounts of amidite solution and activator solution used in the coupling reaction, as well as the reaction time and reaction temperature, are not particularly limited and can be optimized as needed.

[0057] The oxidation or sulfidation reaction in step (3) is a reaction that converts trivalent phosphorus to pentavalent phosphorus using an oxidizing agent or sulfiding agent. When converting phosphite triesters to phosphate triesters, any oxidizing agent used in the phosphoramidite process can be used without limitation. For example, iodine can be used as an oxidizing agent. The oxidizing agent can be used as a solution diluted with a solvent that is inert to the reaction (oxidation solution). For example, acetonitrile and tetrahydrofuran (THF) or a mixture of two or more of these solvents can be used as solvents. Water can be used as the oxygen source for oxidation. The oxidation solution may contain a base. For example, pyridine, N-methylimidazole (NMI), N-methylmorpholine, and triethylamine can be used as bases. As the oxidation solution, for example, a mixed solution of iodine, water, pyridine, and acetonitrile; a mixed solution of iodine, water, and pyridine; a mixed solution of iodine, water, pyridine, and NMI; and a mixed solution of iodine, water, pyridine, and THF can be used. The amount of oxidation solution used, the reaction time, and the reaction temperature in the oxidation reaction are not particularly limited and can be optimized as needed. When converting phosphite triesters to phosphorothioate triesters, any sulfiding agent used in the phosphoramidite process can be used without limitation. Examples of sulfiding agents that can be used include sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazoline-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazoline-3-one (POS), [(N,N-dimethylaminomethylidene)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT), and phenylacetyl disulfide (PADS). The sulfiding agent can be used as a solution diluted with a solvent that is inert to the reaction (sulfidation solution). Examples of solvents that can be used include dichloromethane, acetonitrile, and pyridine, or a mixture of two or more of these. The amount of sulfidation solution used, the reaction time, and the reaction temperature in the sulfidation reaction are not particularly limited and can be optimized as needed.When capping hydroxyl groups that did not undergo a coupling reaction with a phosphoramidite compound before or after an oxidation or sulfidation step, the capping solution can be any capping solution used in the phosphoramidite process without limitation. For example, an acetic anhydride-tetrahydrofuran solution and a phenoxyacetic anhydride / N-methylimidazole solution can be used as capping solutions. The amount of capping solution used, the reaction time, and the reaction temperature in the capping reaction are not particularly limited and can be optimized as needed.

[0058] The step of deprotecting the hydroxyl group at the chain extension end of the oligonucleotide in step (5-1) can be carried out using a deblocking solution. The deblocking solution used in step (1) can be the same as the deblocking solution used in step (1). The step of deprotecting the phosphate portion of the oligonucleotide in step (5-2) can be carried out using, for example, diethylamine. When using diethylamine, it may be used as a solution mixed with a solvent such as acetonitrile. The reagents, reaction time, and reaction temperature used in steps (5-1) and (5-2) are not particularly limited and can be optimized as needed. The step of deprotecting the nucleic acid base portion of the oligonucleotide in step (5-3) and the step of cleaving the oligonucleotide from the solid support in step (5-4) can be carried out according to the method of step (A) in the method of the present invention. The step of extracting the oligonucleotide cleaved from the solid support in step (5-5) into an aprotic solvent can be carried out according to the method of step (B) in the method of the present invention. The step of deprotecting the hydroxyl group at the 2' position of the ribose contained in the oligonucleotide in step (5-6) can be carried out according to the method of step (C) in the method of the present invention.

[0059] Examples of nucleic acid oligomers used before step (C) in the method of the present invention include nucleic acid oligomers represented by the following formula (3): Formula (3):

[0060] In the formula, G4 R, Y, and m are as defined in formula (5) above. 9 This represents an ammonium ion, an alkylammonium ion, an alkali metal ion, a hydrogen ion, or a hydroxyalkylammonium ion. Specific alkyl moieties for alkylammonium ions include, for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, dibutyl, isobutyl, tert-butyl, n-pentyl, isopentyl, or hexyl. More specifically, alkylammonium ions include, for example, diethylammonium ion, triethylammonium ion, tetrabutylammonium ion, hexylammonium ion, and dibutylammonium ion. Alkali metal ions include, for example, sodium ion and lithium ion. Specific hydroxyalkylammonium ions include, for example, hydroxymethyl, hydroxyethyl, hydroxy-n-propyl, hydroxyisopropyl, hydroxy-n-butyl, and trishydroxymethyl. More specifically, hydroxyalkylammonium ions include, for example, trishydroxymethylammonium ion. c Each of these independently represents a nucleic acid base, either identical or distinct. c Examples of nucleic acid bases represented by include adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, and 1-methylpseudracil. These nucleic acid bases may be substituted with substituents. Examples of substituents include halogen atoms such as fluoro, chloro, bromo, and iodo groups; acyl groups such as acetyl groups; alkyl groups such as methyl and ethyl groups; arylalkyl groups such as benzyl groups; alkoxy groups such as methoxy groups; alkoxyalkyl groups such as methoxyethyl groups; cyanoalkyl groups such as cyanoethyl groups; hydroxyl groups; hydroxyalkyl groups; acyloxymethyl groups; amino groups; monoalkylamino groups; dialkylamino groups; carboxyl groups; cyano groups; and nitro groups, as well as combinations of two or more of these.C More specifically, the following groups can be mentioned. (In the formula, R 4’ represents a hydrogen atom or a methyl group, and R 5’ represents a hydrogen atom or an acetyl group, and R 6’ represents a hydrogen atom, and R 7 represents a 2-cyanoethyl group, and R 8’ represents a hydrogen atom or a methyl group, and R 9 represents a dimethylaminomethylene group.) W and X are defined by either of the following (a) or (b). (a) When W represents an OV group, X represents a hydroxyl group. (b) When W represents a hydroxyl group, X represents a hydrogen atom, a fluorine atom, or an OQ' group, and Q' represents a methyl group, a 2-methoxyethyl group, a methylene group bonded to the 4'-position carbon atom of ribose, an ethylene group bonded to the 4'-position carbon atom of ribose, an ethylidene group bonded to the 4'-position carbon atom of ribose, the group represented by the above formula (6), or a tert-butyldimethylsilyl group. V is as defined in the above formula (5). However, at least one of the groups R, W, and X represents a hydroxyl group protected by the group represented by the above formula (6). And when m is an integer of 3 or more, instead of p (where p is a positive integer satisfying the formula: m - 1 > p) nucleotides between the 5'-terminal and 3'-terminal nucleotides of each, a non-nucleotide linker may be incorporated.)

[0061] Examples of the nucleic acid oligomer obtained by subjecting it to step (C) in the method of the present invention include, for example, the nucleic acid oligomer represented by the following formula (4). Formula (4): In the formula, G 4 , G 9 , B CY and m are as defined in formula (3) above. R' independently represents the same or different hydroxyl group, hydrogen atom, fluorine atom, methoxy group, 2-methoxyethoxy group, or OQ'' group. Q'' independently represents the same or different ethylene group bonded to the 4' carbon atom of ribose, the ethylene group bonded to the 4' carbon atom of ribose, or the ethylidene group bonded to the 4' carbon atom of ribose. W 0 X represents a hydroxyl group, a methoxy group, or a 2-methoxyethoxy group. 0 This represents the same definition as the R' group. Furthermore, when m is an integer greater than or equal to 3, a non-nucleotide linker may be incorporated in place of p nucleotides between the 5' and 3' terminal nucleotides (where p is a positive integer satisfying the formula: m-1 > p).

[0062] As one embodiment of the present invention, a method for producing nucleic acid oligomers is provided, comprising the steps of: (A) - contacting a nucleic acid oligomer supported on an amino group on the surface of a solid support via a linker, which contains ribose in which the hydroxyl group at the 2' position is protected with a (((1-cyanopropan-2-yl)oxy)methoxy)methyl group (PMM group), with a gaseous nucleophile to cleave the nucleic acid oligomer from the solid support; and (B) - extracting the nucleic acid oligomer cleaved from the solid support in step (A) into an aprotic solvent, wherein the solid support is an inorganic porous support containing an inorganic porous body, the nucleophile is a nucleophile containing ammonia, and the aprotic solvent is an aprotic solvent containing dimethyl sulfoxide.

[0063] As one embodiment of the present invention, a method for producing nucleic acid oligomers is provided, comprising the steps of: (A) contacting a nucleic acid oligomer, which contains ribose with a cyanoethoxymethyl group (CEM group) protected at the 2' position, with a linker on an amino group on the surface of a solid support, with a gaseous nucleophile to cleave the nucleic acid oligomer from the solid support; and (B) extracting the nucleic acid oligomer cleaved from the solid support in step (A) into an aprotic solvent, wherein the solid support is an inorganic porous support containing an inorganic porous body, the nucleophile is a nucleophile containing ammonia, and the aprotic solvent is an aprotic solvent containing dimethyl sulfoxide.

[0064] As one embodiment of the present invention, a method for producing nucleic acid oligomers is provided, comprising the steps of: (A) contacting a nucleic acid oligomer, which contains ribose with a cyanoethoxymethoxymethyl (EMM) hydroxyl group at the 2' position protected by a cyanoethoxymethoxymethyl (EMM) group, with a linker on an amino group on the surface of a solid support to cleave the nucleic acid oligomer from the solid support; and (B) extracting the nucleic acid oligomer cleaved from the solid support in step (A) into an aprotic solvent, wherein the solid support is an inorganic porous support containing an inorganic porous body, the nucleophile is a nucleophile containing ammonia, and the aprotic solvent is an aprotic solvent containing dimethyl sulfoxide.

[0065] As one embodiment of the present invention, a method for producing nucleic acid oligomers is provided, comprising the steps of: (A) excising nucleic acid oligomers supported on amino groups on the surface of a solid support via a linker, comprising ribose in which the hydroxyl group at the 2' position is protected with a (((1-cyanopropan-2-yl)oxy)methoxy)methyl group (PMM group); and ribose in which the 2' position is substituted with a fluorine atom, by contacting the nucleic acid oligomers with a gaseous nucleophile; and (B) extracting the nucleic acid oligomers excised from the solid support in step (A) into an aprotic solvent, wherein the solid support is an inorganic porous support comprising an inorganic porous body, the nucleophile is a nucleophile comprising ammonia, and the aprotic solvent is an aprotic solvent comprising dimethyl sulfoxide.

[0066] As one embodiment of the present invention, a method for producing nucleic acid oligomers is provided, comprising the steps of: (A) excising a nucleic acid oligomer supported on an amino group on the surface of a solid support via a linker, comprising ribose in which the hydroxyl group at the 2' position is protected with a (((1-cyanopropan-2-yl)oxy)methoxy)methyl group (PMM group); and ribose in which the 2' position is substituted with a fluorine atom, by contacting the nucleic acid oligomer with a gaseous nucleophile; and (B) extracting the nucleic acid oligomer excised from the solid support in step (A) into an aprotic solvent, wherein the solid support is an inorganic porous support including an inorganic porous body, the nucleophile is a nucleophile containing ammonia, the aprotic solvent is an aprotic solvent containing dimethyl sulfoxide, and at least one of the nucleotides constituting the ribose in which the 2' position is substituted with a fluorine atom is a nucleotide having a pyrimidine base which may be protected with a protecting group as a nucleic acid base.

[0067] As one embodiment of the present invention, a method for producing nucleic acid oligomers is provided, comprising the steps of: (A) excising a nucleic acid oligomer supported on an amino group on the surface of a solid support via a linker, comprising ribose in which the hydroxyl group at the 2' position is protected with a cyanoethoxymethyl group (CEM group); and ribose in which the 2' position is substituted with a fluorine atom, by contacting the nucleic acid oligomer with a gaseous nucleophile; and (B) extracting the nucleic acid oligomer excised from the solid support in step (A) into an aprotic solvent, wherein the solid support is an inorganic porous support comprising an inorganic porous body, the nucleophile is a nucleophile comprising ammonia, the aprotic solvent is an aprotic solvent comprising dimethyl sulfoxide, and at least one of the nucleotides constituting the ribose in which the 2' position is substituted with a fluorine atom is a nucleotide having a pyrimidine base which may be protected with a protecting group as a nucleic acid base.

[0068] As one embodiment of the present invention, a method for producing nucleic acid oligomers is provided, comprising the steps of: (A) excising a nucleic acid oligomer supported on an amino group on the surface of a solid support via a linker, comprising ribose in which the hydroxyl group at the 2' position is protected with a cyanoethoxymethoxymethyl group (EMM group); and ribose in which the 2' position is substituted with a fluorine atom, by contacting the nucleic acid oligomer with a gaseous nucleophile; and (B) extracting the nucleic acid oligomer excised from the solid support in step (A) into an aprotic solvent, wherein the solid support is an inorganic porous support including an inorganic porous body, the nucleophile is a nucleophile containing ammonia, the aprotic solvent is an aprotic solvent containing dimethyl sulfoxide, and at least one of the nucleotides constituting the ribose in which the 2' position is substituted with a fluorine atom is a nucleotide having a pyrimidine base which may be protected with a protecting group as a nucleic acid base.

[0069] As one embodiment of the present invention, a method for producing a nucleic acid oligomer is provided, comprising the steps of: (A) excising a nucleic acid oligomer supported on an amino group on the surface of a solid support via a linker, which contains ribose whose hydroxyl group at the 2' position is protected with a ((1-cyanopropan-2-yl)oxy)methoxy)methyl group (PMM group), with a gaseous nucleophile; and (B) extracting the nucleic acid oligomer excised from the solid support in step (A) into an aprotic solvent, wherein at least one of the nucleotides constituting the nucleic acid oligomer supported on the amino group on the surface of the solid support via a linker is a nucleotide having a nucleic acid base protected with a dimethylaminomethylene group, the solid support is an inorganic porous support containing an inorganic porous material, the nucleophile is a nucleophile containing ammonia, and the aprotic solvent is an aprotic solvent containing dimethyl sulfoxide.

[0070] As one embodiment of the present invention, step (A): A nucleic acid oligomer, supported on an amino group on the surface of a solid support via a linker, containing ribose whose hydroxyl group at the 2' position is protected with a (((1-cyanopropan-2-yl)oxy)methoxy)methyl group (PMM group), is contacted with a gaseous nucleophile to cleave the nucleic acid oligomer from the solid support. Step (B): The nucleic acid oligomer cleaved from the solid support in step (A) is extracted in an aprotic solvent, wherein at least one of the nucleotides constituting the nucleic acid oligomer supported on the amino group on the surface of the solid support via a linker is a nucleic acid base consisting of the following group: A method for producing nucleic acid oligomers is provided, wherein the nucleotide is a nucleotide having a nucleotide, the solid support is an inorganic porous support containing an inorganic porous material, the nucleophile is a nucleophile containing ammonia, and the aprotic solvent is an aprotic solvent containing dimethyl sulfoxide.

[0071] As one embodiment of the present invention, step (A): A nucleic acid oligomer, which contains ribose with a cyanoethoxymethyl group (CEM group) protected at the 2' position, is supported on an amino group on the surface of a solid support via a linker, and is brought into contact with a gaseous nucleophile to cleave the nucleic acid oligomer from the solid support. Step (B): The nucleic acid oligomer cleaved from the solid support in step (A) is extracted into an aprotic solvent, wherein at least one of the nucleotides constituting the nucleic acid oligomer supported on the amino group on the surface of the solid support via a linker is a nucleic acid base consisting of the following group: A method for producing nucleic acid oligomers is provided, wherein the nucleotide is a nucleotide having a nucleotide, the solid support is an inorganic porous support containing an inorganic porous material, the nucleophile is a nucleophile containing ammonia, and the aprotic solvent is an aprotic solvent containing dimethyl sulfoxide.

[0072] As one embodiment of the present invention, step (A): A nucleic acid oligomer, which contains ribose with a cyanoethoxymethoxymethyl (EMM) hydroxyl group at the 2' position protected by a cyanoethoxymethoxymethyl (EMM) group, is supported on an amino group on the surface of a solid support via a linker, is contacted with a gaseous nucleophile to cleave the nucleic acid oligomer from the solid support. Step (B): The nucleic acid oligomer cleaved from the solid support in step (A) is extracted into an aprotic solvent, wherein at least one of the nucleotides constituting the nucleic acid oligomer supported on the amino group on the surface of the solid support via a linker is a nucleic acid base consisting of the following group: A method for producing nucleic acid oligomers is provided, wherein the nucleotide is a nucleotide having a nucleotide, the solid support is an inorganic porous support containing an inorganic porous material, the nucleophile is a nucleophile containing ammonia, and the aprotic solvent is an aprotic solvent containing dimethyl sulfoxide.

[0073] As one embodiment of the present invention, step (A): A nucleic acid oligomer supported on an amino group on the surface of a solid support via a linker, comprising ribose in which the hydroxyl group at the 2' position is protected with a (((1-cyanopropan-2-yl)oxy)methoxy)methyl group (PMM group); and ribose in which the 2' position is substituted with a fluorine atom, is contacted with a gaseous nucleophile to cleave the nucleic acid oligomer from the solid support. Step (B): The nucleic acid oligomer cleaved from the solid support in step (A) is extracted in an aprotic solvent, wherein at least one of the nucleotides constituting the nucleic acid oligomer supported on the amino group on the surface of the solid support via a linker is a nucleic acid base consisting of the following group: A method for producing nucleic acid oligomers is provided, wherein the nucleotide is a nucleotide having a fluorine atom at the 2' position, the solid support is an inorganic porous support containing an inorganic porous body, the nucleophile is a nucleophile containing ammonia, the aprotic solvent is an aprotic solvent containing dimethyl sulfoxide, and at least one of the nucleotides constituting the ribose having a fluorine atom at the 2' position is a nucleotide having a pyrimidine base which may be protected by a protecting group as a nucleic acid base.

[0074] In the above embodiment, a nucleic acid oligomer supported on an amino group on the surface of a solid support via a linker includes ribose in which the hydroxyl group at the 2' position is protected with a (((1-cyanopropan-2-yl)oxy)methoxy)methyl group (PMM group); and ribose in which the 2' position is substituted with a fluorine atom, for example, in the nucleic acid oligomer represented by formula (5), at least one R or X 1 is a hydroxyl group protected by a PMM group, and has at least one R or X 1 The nucleic acid oligomer may be a fluorine atom. In the above embodiment, the nucleic acid oligomer supported on an amino group on the surface of a solid support via a linker includes ribose in which the hydroxyl group at the 2' position is protected with a cyanoethoxymethyl group (CEM group) and ribose in which the 2' position is substituted with a fluorine atom, for example, in the nucleic acid oligomer represented by formula (5), at least one R or X 1 is a hydroxyl group protected by a CEM group, and has at least one R or X 1 The nucleic acid oligomer may be a fluorine atom. In the above embodiment, the nucleic acid oligomer supported on an amino group on the surface of a solid support via a linker includes ribose in which the hydroxyl group at the 2' position is protected with a cyanoethoxymethoxymethyl group (EMM group) and ribose in which the 2' position is substituted with a fluorine atom, for example, in the nucleic acid oligomer represented by formula (5), at least one R or X 1 is a hydroxyl group protected by an EMM group, and at least one R or X 1 It may also be a nucleic acid oligomer in which is a fluorine atom. In the above embodiment, the (((1-cyanopropan-2-yl)oxy)methoxy)methyl group (PMM group) is the group represented by formula (6) above, in which q represents 1 and R a or R b In this group, one of the elements represents a methyl group, the other represents a hydrogen atom, and Ew represents a cyano group. In the above embodiment, the cyanoethoxymethyl group (CEM group) is the group represented by formula (6) above, where q represents 0 and R a and R bEw represents a hydrogen atom and Ew represents a cyano group. In the above embodiment, the cyanoethoxymethoxymethyl group (EMM group) is the group shown in formula (6) above, where q represents 1 and R a and R b Ew represents a hydrogen atom, and Ew represents a cyano group.

[0075] Typical examples of nucleic acid oligomers that can be produced by the method of the present invention are shown below, in addition to the examples described, but are not limited to these. In the following sequence descriptions, U represents uridine (ST.25 form), T represents uridine (ST.26 form), C represents cytidine, A represents adenosine, and G represents guanosine. Examples of nucleic acids having the following sequences (A) and (B) are described in International Publication No. 2019 / 060442. Sequence (A): 5'-AUGGAAUmACUCUUGGUUmACdTdT-3' (according to ST.25 format) (5'-ATGGAATmACTCTTGGTTmACdTdT-3' (according to ST.26 format)) (Antisense) (Sequence ID 1) 21mer Sequence (B): 5'-GUmAACmCmAAGAGUmAUmUmCmCmAUmdTdT-3' (according to ST.25 format) (5'-GTmAACmCmAAGAGTmATmTmCmCmATmdTdT-3' (according to ST.26 format)) (Sense) (Sequence ID 2) 21mer In sequences (A) and (B), Um represents 2'-O-methyluridine (ST.25 format), Tm represents 2'-O-methyluridine (ST.26 format), Cm represents 2'-O-methylcytidine, and dT represents thymidine. Unless otherwise specified, abbreviations in sequences apply to both ST.25 and ST.26 formats. Examples include nucleic acids described in Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No.2, 546-558 (see page 553). A typical example is the nucleic acid having the following sequence (C). The following nucleic acid having sequence (D) is listed in 36mer Nucleic Acids Research, 2019, Vol. 47, No. 2: 547: Sequence (C): 5'-AGAGCCAGCCUUCUUAUUGUUUUAGAGCUAUGCUGU-3' (according to ST.25 format) (5'-AGAGCCAGCCTTCTTATTGTTTTAGAGCTATGCTGT-3' (according to ST.26 format)) (Sequence ID 3)Sequence (D): 5'-ACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3' (according to ST.25 format) (5'-ACAGCATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT-3' (according to ST.26 format)) (Sequence ID 4) 67mer Nucleic acids having the following sequence (E) are listed on page 173 of Japanese Patent Publication No. 2015-523856. Sequence (E): 5'-GUUUUCCCUUUUCAAAGAAAUCUCCUGGGCACCUAUCUUCUUAGGUGCCCUCCCUUGUUUAAACCUGACCAGUUAACCGGCUGGUUAGGUUUUU-3' (according to ST.25 format) (5'-GTTTTCCCTTTTCAAAGAAATCTCCTGGGCACCTATCTTCTTAGGTGCCCTCCCTTGTTTAAACCTGACCAGTTAACCGGCTGGTTAGGTTTTT-3' (according to ST.26 format)) (Sequence No. 5) 94mer Nucleic acids described in Japanese Patent Publication No. 2017-537626 are listed. Typical examples include nucleic acids having the following sequences (F), (G), (H), and (J).Sequence (F): 5'-AGUCCUCAUCUCCCUCAAGCGUUUUAGAGCUAGUAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (according to ST.25 format) (5'-AGTCCTCATCTCCCTCAAGCGTTTTAGAGCTAGTAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' (according to ST.26 format)) (Sequence ID 6) 100mer Sequence (G): 5'-GCAGAUGUAGUGUUUCCACAGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (according to ST.25 format) (5'-GCAGATGTAGTGTTTCCACAGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3' (according to ST.26 format)) (Sequence ID 7) 113mer Sequence (H): 5'-dAdGdTdCdCdTdCdAdTdCdCdCdCdCdTdCdAdAdAdGdCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (according to ST.25 format) (5'-dAdGdTdCdCdCdTdCdAdTdCdCdCdCdTdCdAdAdAdGdCGTTTAAGAGCTATGCTGGTAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3' (according to ST.26 format)) (Sequence ID 8) 113mer In sequence (H), dT represents thymidine, dC represents 2'-deoxycytidine, dA represents 2'-deoxyadenosine, and dG represents 2'-deoxyguanosine.Sequence (J): 5'-AmsGmsUmsCCUCAUCUCCCUCAAGCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUmsUmsUmsU-3' (according to ST.25 format) (5'-AmsGmsTmsCCTCATCTCCCTCAAGCGTTTAAGAGCTATGCTGGTAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTmsTmsTmsTmsT-3' (according to ST.26 format)) (Sequence ID 9) 113mer In sequence (J), Um represents 2'-O-methyluridine (ST.25 form), Tm represents 2'-O-methyluridine (ST.26 form), Am represents 2'-O-methyladenosine, Gm represents 2'-O-methylguanosine, and s represents phosphorothioate modification.

[0076] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0077] The various measurement methods used in the following examples and comparative examples are shown below.

[0078] (Measurement Method 1: Measurement of Nucleic Acid Oligomer Purity) The purity of the crude nucleic acid oligomer produced by solid-phase synthesis was calculated by HPLC measurement. This purity represents the content (area percentage) of the target substance, which is the full chain length, in the crude nucleic acid oligomer produced. The HPLC measurement conditions are shown in Table A below.

[0079] (Measurement method 2: Measurement of nucleic acid oligomer yield) OD of crude nucleic acid oligomer product 260 The following was measured: OD 260 This represents the absorbance at UV 260 nm per 10 mm optical path length in a 1 mL solution (pH = 7.5). Generally, for RNA, 1 OD is used. 260 Since it is known that OD = 40 μg, 260 Based on the measured values, the yield of nucleic acid oligomers was calculated.

[0080] (Measurement Method 3: Measurement of Oxygen Concentration) The oxygen concentration in the reaction system atmosphere (gas phase) was measured using a PACK KEEPER (Residual Oxygen Meter) manufactured by IIJIMA ELECTRONICS CORP. Before measuring the oxygen concentration, the instrument was calibrated by measuring the oxygen concentration in air and pure nitrogen. Then, the needle attached to the instrument was inserted into a container such as a flask sealed with a septum, and the oxygen concentration in the gas phase of the system was measured. The measured oxygen concentration was displayed in real time, and the point where the measured value stabilized was taken as the oxygen concentration of that atmosphere.

[0081] The sequences of the nucleic acid oligomers produced in the following examples and comparative examples are shown below. Sequence (I): 5'-UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU-3' (according to ST.25 format) (5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-3' (according to ST.26 format)) (Sequence ID 10) 50mer Sequence (II): 5'-AmsUmsAmsACUCAAUUUGUAAAAAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUmsUmsUmsU-3' (according to ST.25 format) (5'-AmsTmsAmsACTCAATTTGTAAAAAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTmsTmsTmsTmsT-3' (according to ST.26 format)) (Sequence ID 11) 100mer In sequences (I) and (II), A represents adenosine, C represents cytidine, G represents guanosine, U represents uridine (ST.25 form), Um represents 2'-O-methyluridine (ST.25 form), Am represents 2'-O-methyladenosine, T represents uridine (ST.26 form), Tm represents 2'-O-methyluridine (ST.26 form), and s represents phosphorothioate modification. In this specification, unless otherwise specified, abbreviations in sequences apply to both ST.25 and ST.26 forms.

[0082] The Controlled Pore Glass (CPG) supporting the 2'-OTBS-U derivative described in the following examples and comparative examples was purchased from Synthepor and has an LCAA linker. The presumed structure of the 2'-OTBS-U derivative is shown below. The circle shown in the following structural formula schematically represents the CPG.

[0083] The 2'-PMM-A(Ac) amidite described in the following manufacturing examples has the structure shown in formula (19), the 2'-PMM-C(Ac) amidite has the structure shown in formula (20), the 2'-PMM-G(Pac) amidite has the structure shown in formula (21), and the 2'-PMM-U amidite has the structure shown in formula (22). In these amidites, the hydroxyl group at the 2' position of ribose is protected by a (((1-cyanopropan-2-yl)oxy)methoxy)methyl group (PMM group). These amidites were synthesized according to the method described in International Publication No. 2019 / 208571 and used in the following manufacturing examples. The 2'-CEM-U amidite described in the following manufacturing examples has the structure shown in formula (23). This amidite has a hydroxyl group at the 2' position of ribose protected by a cyanoethoxymethyl group (CEM group). This amidite was synthesized according to the method described in Nucleic Acids Research, 2007, Vol.35, No.10, 3287-3296, and used in the following manufacturing examples. The 2'-OMe-A(Bz) amidite described in the following manufacturing examples has the structure shown in formula (24) below and was purchased from Hongene Biotech (model number: PR1-001). The 2'-OMe-U amidite described in the following manufacturing examples has the structure shown in formula (25) below and was purchased from Hongene Biotech (model number: PR5-001). The ammonia gas described in the following manufacturing examples was supplied from a cylinder (manufactured by Sumitomo Seika Co., Ltd.) filled with high-purity liquefied ammonia gas. Formula (19): Formula (20): Formula (21): Formula (22): Equation (23): Equation (24): Equation (25):

[0084] (Manufacturing Example 1) Using a CPG (solid support) supporting 9.79 μmol of 2'-OTBS-U derivative, a nucleic acid oligomer of sequence (II) was synthesized from the 3' end to the 5' end using AKTA oligopilot plus 100 (Cytiva). First, a chain extension reaction was carried out, in which a series of reactions consisting of steps (1) deblocking, (2) coupling, and (3) oxidation or sulfurization and subsequent capping reactions was repeated 99 times. Step (1) was carried out by delivering a dichloroacetic acid:toluene = 3:97 (volume ratio) solution to the solid support. After step (1), acetonitrile was delivered to the solid support. Step (2) was carried out by delivering an acetonitrile solution of 2'-PMM-A(Ac) amidite, or an acetonitrile solution of 2'-PMM-C(Ac) amidite, or an acetonitrile solution of 2'-PMM-G(Pac) amidite, or an acetonitrile solution of 2'-PMM-U amidite, or an acetonitrile solution of 2'-OMe-A(Bz) amidite, or an acetonitrile:toluene = 80:20 (volume ratio) solution of 2'-OMe-U amidite, along with an acetonitrile solution of 5-benzylthio-1H-tetrazole, to the solid phase support. After step (2), acetonitrile was delivered to the solid phase support. Step (3) was carried out by delivering an oxidizing solution containing 50 mM iodine, or a pyridine:toluene = 50:50 (volume ratio) solution containing 20 mM MADTT, to the solid phase support. After step (3), acetonitrile was delivered to the solid support. Subsequently, a 0.1 M phenoxyacetic anhydride acetonitrile solution and a 10% N-methylimidazole / 10% 2,6-lutidine acetonitrile solution were delivered to the solid support to cap the hydroxyl groups that did not undergo the coupling reaction. After the capping reaction, acetonitrile was delivered to the solid support. After the chain extension reaction, the 5'-terminus DMTr group was removed by delivering a dichloroacetic acid:toluene = 3:97 (volume ratio) solution to the solid support, and then acetonitrile was delivered to the solid support. Subsequently, the cyanoethyl group of the phosphoric acid portion was removed by delivering a diethylamine:acetonitrile = 20:80 (volume ratio) solution to the solid support, and then acetonitrile was delivered to the solid support.Subsequently, the solid support was dried under reduced pressure to obtain a solid support carrying the nucleic acid oligomer of sequence (II) (hereinafter referred to as solid support A).

[0085] (Manufacturing Example 2) Using a CPG (solid support) supported with 0.99 μmol of 2'-OTBS-U derivative, the nucleic acid oligomer of sequence (I) was synthesized from the 3' end to the 5' end using NTS M-4MX-E (manufactured by Nippon Techno Service Co., Ltd.). First, a chain extension reaction was carried out, in which a series of reactions consisting of steps (1) deblocking, (2) coupling, and (3) oxidation and subsequent capping reactions was repeated 49 times. Step (1) was carried out by delivering a dichloroacetic acid:toluene = 3:97 (volume ratio) solution to the solid support. After step (1), acetonitrile was delivered to the solid support. Step (2) was carried out by delivering an acetonitrile solution of 2'-CEM-U amidite and an acetonitrile solution of 5-benzylthio-1H-tetrazole to the solid support. After step (2), acetonitrile was delivered to the solid support. Step (3) was carried out by delivering an oxidation solution containing 50 mM iodine to the solid support. After step (3), acetonitrile was delivered to the solid support. Subsequently, a 0.1 M phenoxyacetic anhydride acetonitrile solution and a 10% N-methylimidazole / 10% 2,6-lutidine acetonitrile solution were delivered to the solid support to cap the hydroxyl groups that did not undergo the coupling reaction. After the capping reaction, acetonitrile was delivered to the solid support. After the chain extension reaction, the 5'-terminus DMTr group was removed by delivering a dichloroacetic acid:toluene = 3:97 (volume ratio) solution to the solid support, and then acetonitrile was delivered to the solid support. Subsequently, the cyanoethyl group of the phosphoric acid portion was removed by delivering a diethylamine:acetonitrile = 20:80 (volume ratio) solution to the solid support, and then acetonitrile was delivered to the solid support. Subsequently, the solid support was dried under reduced pressure to obtain a solid support (hereinafter referred to as solid support B) on which the nucleic acid oligomer of sequence (I) was supported.

[0086] (Example 1) A solid support carrying 0.99 μmol of nucleic acid oligomer was collected from solid support A prepared in Production Example 1. The nucleic acid oligomer was cleaved from the solid support by incubating the solid support at 25°C for 8 hours under a 0.4 MPa ammonia gas atmosphere using a Chemistation PPV-3000 (manufactured by Tokyo Rikakiki Co., Ltd.). The ammonia gas was then replaced with nitrogen gas, and the solid support was washed with 4.0 mL of acetonitrile. Subsequently, 2.0 mL of dimethylformamide was added to the nucleic acid oligomer cleaved from the solid support to extract the nucleic acid oligomer into dimethylformamide, and a homogeneous solution containing the nucleic acid oligomer was prepared. A solution containing 0.49 μmol of nucleic acid oligomer was collected from this homogeneous solution. 0.28 mL of acetonitrile and 18 μL of nitromethane were added to the collected solution. To this solution, 1.46 mL of 1 M tetra-n-butylammonium fluoride (hereinafter referred to as TBAF) dimethyl sulfoxide solution, pre-dehydrated with molecular sieve 4A, was added dropwise at 15°C for 1 hour under an atmosphere of 0% oxygen concentration. The oxygen concentration was calculated according to measurement method 3. Subsequently, the reaction solution was heated to 25°C, and 0.37 mL of 1 M TBAF dimethyl sulfoxide solution was added dropwise at 25°C for 1 hour. The PMM group was deprotected by incubating the reaction solution at 30°C for 4 hours. After quenching by flowing 1.83 mL of 3 M aqueous ammonium acetate solution into the reaction solution, the crude product of the nucleic acid oligomer of sequence (II) was obtained by precipitation. As a result of measurement using measurement method 1, the purity of the obtained crude product was 40%. As a result of the measurement using the above measurement method 2, the yield of the obtained crude product was 8.01 mg, which, when converted to a yield per CPG supported with 1.00 μmol of 2'-OTBS-U derivative, was 16.3 mg. The results are shown in Table 1.

[0087] (Example 2) A solid support carrying 1.00 μmol of nucleic acid oligomer was collected from solid support A prepared in Production Example 1. The nucleic acid oligomer was cleaved from the solid support by incubating the solid support at 25°C for 8 hours under an ammonia gas atmosphere of 0.4 MPa using a Chemistation PPV-3000 (manufactured by Tokyo Rikakiki Co., Ltd.). The ammonia gas was then replaced with nitrogen gas, and the solid support was washed with 4.0 mL of acetonitrile. Subsequently, 2.0 mL of dimethyl sulfoxide was added to the nucleic acid oligomer cleaved from the solid support to extract the nucleic acid oligomer into dimethyl sulfoxide, and a homogeneous solution containing the nucleic acid oligomer was prepared. A solution containing 0.50 μmol of nucleic acid oligomer was collected from this homogeneous solution. 0.28 mL of acetonitrile and 18 μL of nitromethane were added to the collected solution. To this solution, 1.46 mL of 1MTBAF dimethyl sulfoxide solution, pre-dehydrated with molecular sieve 4A, was added dropwise over 1 hour at 15°C under an atmosphere of 0% oxygen concentration. The oxygen concentration was calculated according to measurement method 3. Subsequently, the reaction solution was heated to 25°C, and 0.37 mL of 1MTBAF dimethyl sulfoxide solution was added dropwise over 1 hour at 25°C. The PMM group was deprotected by incubating the reaction solution at 30°C for 4 hours. After quenching by flowing 1.83 mL of 3M aqueous ammonium acetate solution into the reaction solution, the crude product of the nucleic acid oligomer of sequence (II) was obtained by precipitation. As a result of measurement using measurement method 1, the purity of the obtained crude product was 40%. The results of the measurement using the above measurement method 2 showed that the yield of the crude product obtained was 8.31 mg, which, when converted to a yield per CPG supported with 1.00 μmol of 2'-OTBS-U derivative, was 16.6 mg. The results are shown in Table 1.

[0088] (Example 3) A solid support carrying 1.01 μmol of nucleic acid oligomer was collected from solid support A prepared in Production Example 1. The nucleic acid oligomer was cleaved from the solid support by incubating the solid support at 25°C for 4 hours under an ammonia gas atmosphere of 0.8 MPa using a Chemistation PPV-3000 (manufactured by Tokyo Rikakiki Co., Ltd.). The ammonia gas was then replaced with nitrogen gas, and the solid support was washed with 4.0 mL of acetonitrile. Subsequently, 2.0 mL of dimethyl sulfoxide was added to the nucleic acid oligomer cleaved from the solid support to extract the nucleic acid oligomer into dimethyl sulfoxide, and a homogeneous solution containing the nucleic acid oligomer was prepared. A solution containing 0.51 μmol of nucleic acid oligomer was collected from this homogeneous solution. 0.28 mL of acetonitrile and 18 μL of nitromethane were added to the collected solution. To this solution, 1.46 mL of 1MTBAF dimethyl sulfoxide solution, pre-dehydrated with molecular sieve 4A, was added dropwise over 1 hour at 15°C under an atmosphere of 0% oxygen concentration. The oxygen concentration was calculated according to measurement method 3. Subsequently, the reaction solution was heated to 25°C, and 0.37 mL of 1MTBAF dimethyl sulfoxide solution was added dropwise over 1 hour at 25°C. The PMM group was deprotected by incubating the reaction solution at 30°C for 4 hours. After quenching by flowing 1.83 mL of 3M aqueous ammonium acetate solution into the reaction solution, the crude product of the nucleic acid oligomer of sequence (II) was obtained by precipitation. As a result of measurement using measurement method 1, the purity of the obtained crude product was 40%. The results of the measurement using the above measurement method 2 showed that the yield of the crude product obtained was 8.15 mg, which, when converted to a yield per CPG supported with 1.00 μmol of 2'-OTBS-U derivative, was 16.0 mg. The results are shown in Table 1.

[0089] (Example 4) A solid support carrying 0.22 μmol of nucleic acid oligomer was collected from solid support B prepared in Production Example 2. The nucleic acid oligomer was cleaved from the solid support by incubating the solid support at 25°C for 8 hours under an ammonia gas atmosphere of 0.4 MPa using a Chemistation PPV-3000 (manufactured by Tokyo Rikakiki Co., Ltd.). The ammonia gas was then replaced with nitrogen gas, and the solid support was washed with 4.0 mL of acetonitrile. Subsequently, 2.0 mL of dimethyl sulfoxide was added to the nucleic acid oligomer cleaved from the solid support to extract the nucleic acid oligomer into dimethyl sulfoxide, and a homogeneous solution containing the nucleic acid oligomer was prepared. A solution containing 0.11 μmol of nucleic acid oligomer was collected from this homogeneous solution. 0.28 mL of acetonitrile and 18 μL of nitromethane were added to the collected solution. To this solution, 1.46 mL of 1MTBAF dimethyl sulfoxide solution, pre-dehydrated with molecular sieve 4A, was added dropwise at 15°C for 1 hour under an atmosphere of 0% oxygen concentration. The oxygen concentration was calculated according to measurement method 3. Subsequently, the reaction solution was heated to 25°C, and 0.37 mL of 1MTBAF dimethyl sulfoxide solution was added dropwise at 25°C for 1 hour. The CEM group was deprotected by incubating the reaction solution at 30°C for 4 hours. After quenching by flowing 1.83 mL of 3M aqueous ammonium acetate solution into the reaction solution, the crude product of the nucleic acid oligomer of sequence (I) was obtained by precipitation. As a result of measurement using measurement method 1, the purity of the obtained crude product was 74%. As a result of measurement using measurement method 2, the yield of the obtained crude product was 1.22 mg, which was converted to 11.1 mg per CPG supported with 1.00 μmol of 2'-OTBS-U derivative. The results are shown in Table 1.

[0090] (Comparative Example 1) A solid support carrying 1.00 μmol of nucleic acid oligomer was taken from solid support A prepared in Production Example 1, and 3.0 mL of 28% aqueous ammonia solution and 1.0 mL of ethanol were flowed into the solid support. The mixture was incubated at 40°C for 6 hours to cleave the nucleic acid oligomer from the solid support. The solid support was removed by filtration, and the filtrate was concentrated under reduced pressure to obtain a dry solid containing the nucleic acid oligomer. 2.0 mL of dimethyl sulfoxide was flowed into the dry solid to prepare a homogeneous solution containing the nucleic acid oligomer. A solution containing 0.49 μmol of nucleic acid oligomer was taken from the homogeneous solution. 0.28 mL of acetonitrile and 18 μL of nitromethane were added to the taken solution. To this solution, 1.46 mL of 1MTBAF dimethyl sulfoxide solution, pre-dehydrated with molecular sieve 4A, was added dropwise over 1 hour at 15°C under an atmosphere of 0% oxygen concentration. The oxygen concentration was calculated according to measurement method 3. Subsequently, the reaction solution was heated to 25°C, and 0.37 mL of 1MTBAF dimethyl sulfoxide solution was added dropwise over 1 hour at 25°C. The PMM group was deprotected by incubating the reaction solution at 30°C for 4 hours. After quenching by flowing 1.83 mL of 3M aqueous ammonium acetate solution into the reaction solution, the crude product of the nucleic acid oligomer of sequence (II) was obtained by precipitation. As a result of measurement using measurement method 1, the purity of the obtained crude product was 32%. The results of the measurement using the above measurement method 2 showed that the yield of the crude product obtained was 8.02 mg, which, when converted to a yield per CPG supported with 1.00 μmol of 2'-OTBS-U derivative, was 16.4 mg. The results are shown in Table 1.

[0091] (Comparative Example 2) A solid support carrying 1.01 μmol of nucleic acid oligomer was taken from solid support A prepared in Production Example 1, and 3.0 mL of 28% aqueous ammonia solution and 1.0 mL of ethanol were flowed into the solid support. The mixture was incubated at 25°C for 8 hours to cleave the nucleic acid oligomer from the solid support. The solid support was removed by filtration, and the filtrate was concentrated under reduced pressure to obtain a dry solid containing the nucleic acid oligomer. 2.0 mL of dimethyl sulfoxide was flowed into the dry solid to prepare a homogeneous solution containing the nucleic acid oligomer. A solution containing 0.51 μmol of nucleic acid oligomer was taken from the homogeneous solution. 0.28 mL of acetonitrile and 18 μL of nitromethane were added to the taken solution. To this solution, 1.46 mL of 1MTBAF dimethyl sulfoxide solution, pre-dehydrated with molecular sieve 4A, was added dropwise over 1 hour at 15°C under an atmosphere of 0% oxygen concentration. The oxygen concentration was calculated according to measurement method 3. Subsequently, the reaction solution was heated to 25°C, and 0.37 mL of 1MTBAF dimethyl sulfoxide solution was added dropwise over 1 hour at 25°C. The PMM group was deprotected by incubating the reaction solution at 30°C for 4 hours. After quenching by flowing 1.83 mL of 3M aqueous ammonium acetate solution into the reaction solution, the crude product of the nucleic acid oligomer of sequence (II) was obtained by precipitation. As a result of measurement using measurement method 1, the purity of the obtained crude product was 29%. The results of the measurement using the above measurement method 2 showed that the yield of the crude product obtained was 7.89 mg, which, when converted to a yield per CPG supported with 1.00 μmol of 2'-OTBS-U derivative, was 15.5 mg. The results are shown in Table 1.

[0092] (Comparative Example 3) A solid support carrying 0.25 μmol of nucleic acid oligomer was taken from solid support B prepared in Production Example 2, and 1.5 mL of 28% aqueous ammonia solution and 0.5 mL of ethanol were flowed into the solid support. The mixture was incubated at 40°C for 6 hours to cleave the nucleic acid oligomer from the solid support. The solid support was removed by filtration, and the filtrate was concentrated under reduced pressure to obtain a dry solid containing the nucleic acid oligomer. 2.0 mL of dimethyl sulfoxide was flowed into the dry solid to prepare a homogeneous solution containing the nucleic acid oligomer. A solution containing 0.13 μmol of nucleic acid oligomer was taken from the homogeneous solution. 0.28 mL of acetonitrile and 18 μL of nitromethane were added to the taken solution. To this solution, 1.46 mL of 1MTBAF dimethyl sulfoxide solution, pre-dehydrated with molecular sieve 4A, was added dropwise at 15°C for 1 hour under an atmosphere of 0% oxygen concentration. The oxygen concentration was calculated according to measurement method 3. Subsequently, the reaction solution was heated to 25°C, and 0.37 mL of 1MTBAF dimethyl sulfoxide solution was added dropwise at 25°C for 1 hour. The CEM group was deprotected by incubating the reaction solution at 30°C for 4 hours. After quenching by flowing 1.83 mL of 3M aqueous ammonium acetate solution into the reaction solution, the crude product of the nucleic acid oligomer of sequence (I) was obtained by precipitation. As a result of measurement using measurement method 1, the purity of the obtained crude product was 67%. As a result of measurement using measurement method 2, the yield of the obtained crude product was 1.32 mg, which was converted to a yield of 10.2 mg per CPG supported with 1.00 μmol of 2'-OTBS-U derivative. The results are shown in Table 1.

[0093] (Comparative Example 4) A solid support carrying 0.99 μmol of nucleic acid oligomer was collected from solid support A prepared in Production Example 1. The nucleic acid oligomer was cleaved from the solid support by incubating the solid support at 25°C for 8 hours under an ammonia gas atmosphere of 0.4 MPa using a Chemistation PPV-3000 (manufactured by Tokyo Rikakiki Co., Ltd.). The ammonia gas was then replaced with nitrogen gas, and the solid support was washed with 4.0 mL of acetonitrile. Subsequently, 2.0 mL of sterile water for injection was added to the nucleic acid oligomer cleaved from the solid support to extract the nucleic acid oligomer into water, and a homogeneous solution containing the nucleic acid oligomer was prepared. A solution containing 0.50 μmol of nucleic acid oligomer was collected from this homogeneous solution. 0.28 mL of acetonitrile and 18 μL of nitromethane were added to the collected solution. To this solution, 1.46 mL of 1MTBAF dimethyl sulfoxide solution, pre-dehydrated with molecular sieve 4A, was added dropwise at 15°C for 1 hour under an atmosphere of 0% oxygen concentration. The oxygen concentration was calculated according to measurement method 3. Subsequently, the reaction solution was heated to 25°C, and 0.37 mL of 1MTBAF dimethyl sulfoxide solution was added dropwise at 25°C for 1 hour. The PMM group was deprotected by incubating the reaction solution at 30°C for 4 hours. After quenching by flowing 1.83 mL of 3M aqueous ammonium acetate solution into the reaction solution, the crude product of the nucleic acid oligomer of sequence (II) was obtained by precipitation. As a result of measurement using measurement method 1, the purity of the obtained crude product was 0%. As a result of measurement using measurement method 2, the yield of the obtained crude product was 8.02 mg, which was converted to 16.0 mg per CPG supported with 1.00 μmol of 2'-OTBS-U derivative. The results are shown in Table 1.

[0094] (Comparative Example 5) A solid support carrying 0.24 μmol of nucleic acid oligomer was collected from solid support B prepared in Production Example 2. The nucleic acid oligomer was cleaved from the solid support by incubating the solid support at 25°C for 8 hours under a 0.4 MPa ammonia gas atmosphere using a Chemistation PPV-3000 (manufactured by Tokyo Rikakiki Co., Ltd.). The ammonia gas was then replaced with nitrogen gas, and the solid support was washed with 4.0 mL of acetonitrile. Subsequently, 2.0 mL of sterile water for injection was added to the nucleic acid oligomer cleaved from the solid support to extract the nucleic acid oligomer into water, and a homogeneous solution containing the nucleic acid oligomer was prepared. A solution containing 0.12 μmol of nucleic acid oligomer was collected from this homogeneous solution. 0.28 mL of acetonitrile and 18 μL of nitromethane were added to the collected solution. To this solution, 1.46 mL of 1MTBAF dimethyl sulfoxide solution, pre-dehydrated with molecular sieve 4A, was added dropwise at 15°C for 1 hour under an atmosphere of 0% oxygen concentration. The oxygen concentration was calculated according to measurement method 3. Subsequently, the reaction solution was heated to 25°C, and 0.37 mL of 1MTBAF dimethyl sulfoxide solution was added dropwise at 25°C for 1 hour. The CEM group was deprotected by incubating the reaction solution at 30°C for 4 hours. After quenching by flowing 1.83 mL of 3M aqueous ammonium acetate solution into the reaction solution, the crude product of the nucleic acid oligomer of sequence (I) was obtained by precipitation. As a result of measurement using measurement method 1, the purity of the obtained crude product was 0%. As a result of measurement using measurement method 2, the yield of the obtained crude product was 0.07 mg, which was converted to a yield of 0.6 mg per CPG supported with 1.00 μmol of 2'-OTBS-U derivative. The results are shown in Table 1.

[0095]

[0096] As shown in Table 1 above, the method of the present invention made it possible to efficiently cleave a nucleic acid oligomer, which contains ribose with the hydroxyl group at the 2' position protected by the group represented by formula (6), from the solid support via a linker to an amino group on the surface of the solid support. As a result, a high-purity nucleic acid oligomer could be obtained by the method of the present invention.

[0097] The present invention can provide an efficient method for producing nucleic acid oligomers.

[0098] Sequence numbers 1 to 11 in the sequence listing represent the base sequences of nucleic acid oligomers that can be produced according to the manufacturing method of the present invention.

Claims

1. Process (A): The hydroxyl group at the 2' position is in the following formula (6): (In the formula, the asterisk (*) indicates the bond point between the hydroxyl group at the 2' position of ribose and the oxygen atom, q represents an integer from 0 to 5, and R a and R b A method for producing a nucleic acid oligomer, comprising the steps of: (A) a nucleic acid oligomer supported on an amino group on the surface of a solid support via a linker, containing ribose protected with a group represented by (Ew), which is independently the same or distinct, and (Ew) represents an electron-withdrawing group; and (B) a step of extracting the nucleic acid oligomer from the solid support via a linker, wherein the nucleophile is at least one selected from the group consisting of inorganic amines and organic amines.

2. The manufacturing method according to claim 1, wherein the nucleophile is ammonia.

3. The manufacturing method according to claim 1 or 2, wherein q is 0 or 1.

4. R a or R b The manufacturing method according to any one of claims 1 to 3, wherein one of them is a methyl group and the other is a hydrogen atom.

5. R a and R b The manufacturing method according to any one of claims 1 to 3, wherein is a hydrogen atom.

6. The manufacturing method according to any one of claims 1 to 5, wherein Ew is a cyano group.

7. The method for producing according to any one of claims 1 to 6, wherein the aprotic solvent comprises at least one selected from the group consisting of dimethyl sulfoxide, dimethylformamide, diethylformamide, N,N-dimethylacetamide, N-methylpyrrolidone, 1,3-dimethyl-2-imidazolidinone, and acetonitrile.

8. The manufacturing method according to any one of claims 1 to 6, wherein the aprotic solvent is an aprotic solvent containing dimethyl sulfoxide.

9. The manufacturing method according to any one of claims 1 to 8, wherein step (A) is carried out in an atmosphere where the pressure of the gaseous nucleophile is 0.1 MPa to 1.0 MPa.

10. Step (C): The manufacturing method according to any one of claims 1 to 9, further comprising the step of contacting the nucleic acid oligomer extracted in step (B) with tetraalkylammonium fluoride to deprotect the group represented by formula (6).

11. The manufacturing method according to any one of claims 1 to 10, wherein the chain length of the nucleic acid oligomer is 50 to 400 mer.

12. The manufacturing method according to any one of claims 1 to 11, wherein the solid phase carrier is an inorganic porous carrier containing an inorganic porous body.

13. The manufacturing method according to claim 12, wherein the inorganic porous material is silica gel, zeolite, or porous glass.

14. The manufacturing method according to claim 13, wherein the porous glass is Controlled Pore Glass.

15. The linker is as follows: (9) A method for producing a linker according to any one of claims 1 to 14, wherein the linker contains a succinyl group represented by .

16. A nucleic acid oligomer supported via a linker on an amino group on the surface of a solid support has the following formula (5): (wherein, G 2 represents a hydrogen atom or the following group, G 4 represents a hydrogen atom or the following group, (wherein, R 1 , R 2 and R 3 each independently represent the same or different and represent a hydrogen atom or an alkoxy group.) B a each independently represent the same or different and represent a nucleobase which may be protected by a protecting group, R each independently represent the same or different and represent a hydrogen atom, a fluorine atom, or an OQ group, Q each independently represent the same or different and represent a methyl group, a 2-methoxyethyl group, a methylene group bonded to the 4'-carbon atom of ribose, an ethylene group bonded to the ical group represented by the above formula (6), Y each independently represent the same or different and represent an oxygen atom or a sulfur atom, m represents any integer from 2 to 400, when m is an integer of 3 or more, instead of p nucleotides (where p is a positive integer satisfying the formula: m - 1 > p) between the 5'-end and 3'-end nucleotides of each, a non-nucleotide linker may be incorporated, W 1 and X 1 are defined by either (a) or (b) below. (a) When W 1 represents an OV group, X 1 represents an OZ group. (b) When W 1 represents an OZ group, X 1 is a hydrogen atom, a fluorine atom, or an OQ' group; Q' is a methyl group, a 2-methoxyethyl group, a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, an ethylidene group bonded to the carbon atom at the 4' position of ribose, the group represented by formula (6), or a tert-butyldimethylsilyl group; V is a methyl group, a 2-methoxyethyl group, a tert-butyldimethylsilyl group, or the group represented by formula (6); Z is a group consisting of a solid support and a linkage portion connecting the solid support to the oxygen atom of the hydroxyl group at the 2' or 3' position of the ribose at the 3' end of the nucleic acid oligomer; however, R and W are not applicable. 1 , and X 1 A method for producing a nucleic acid oligomer according to any one of claims 1 to 15, wherein at least one of the groups represents a hydroxyl group protected by the group represented by formula (6).

17. R 1 and R 2 is a methoxy group, R 3 The manufacturing method according to claim 16, wherein is a hydrogen atom.

Citation Information

Patent Citations

  • Methods for Removing Universal Linkers from Oligonucleotides

    JP2004513629A

  • Protected monomer and method of final deprotection for RNA synthesis

    US20180186826A1

  • Method for producing nucleic acid oligomers

    WO2021070494A1

  • Production method for purified dichloroacetic acid

    WO2023054350A1