Lipid nanoparticle formulations of trems

Lipid nanoparticle formulations of TREMs address the challenge of delivering tRNA-based effector molecules to cells, enhancing PTC readthrough and protein expression, effectively treating associated diseases.

WO2026073260A1PCT designated stage Publication Date: 2026-04-02FLAGSHIP PIONEERING INNOVATIONS VI LLC +1
View PDF 20 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-09-30
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

Current technologies face challenges in effectively delivering tRNA-based effector molecules (TREMs) to cells to modulate cellular processes, particularly in overcoming premature termination codons (PTCs) associated with diseases such as cancers, genetic disorders, metabolic disorders, immune disorders, and neurological disorders.

Method used

Formulating TREMs in lipid nanoparticles (LNPs) to optimize their delivery and enhance the readthrough of PTCs, thereby modulating protein expression and treating PTC-related diseases.

Benefits of technology

The LNP-formulated TREMs improve the readthrough of PTCs, leading to increased protein production and functional rescue in cellular models, demonstrating efficacy in treating PTC diseases and disorders.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000008_0001
    Figure IMGF000008_0001
  • Figure IMGF000129_0001
    Figure IMGF000129_0001
  • Figure IMGF000131_0001
    Figure IMGF000131_0001
Patent Text Reader

Abstract

The disclosure relates generally to tRNA-based effector molecules (TREMs) formulated in lipid nanoparticles having a non-naturally occurring modification and compositions and methods relating thereto.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Attorney Docket No.: F2099-7045WO

[0002] LIPID NANOPARTICLE FORMULATIONS OF TREMS

[0003] CLAIM OF PRIORITY

[0004] This application claims priority to U.S. Provisional Application No. 63 / 701,485, filed on September 30, 2024; U.S. Provisional Application No. 63 / 701,488, filed on September 30, 2024; U.S. Provisional Application No. 63 / 728,031, filed on December 4, 2024; U.S. Provisional Application No. 63 / 728,036, filed on December 4, 2024; U.S. Provisional Application No. 63 / 804,391, filed on May 12, 2025; U.S. Provisional Application No. 63 / 804,395, filed on May 12, 2025; U.S. Provisional Application No. 63 / 868,163, filed on August 21, 2025; U.S. Provisional Application No. 63 / 868,160, filed on August 21, 2025; U.S. Provisional Application No. 63 / 884,859, filed on September 19, 2025; and U.S. Provisional Application No. 63 / 884,876, filed on September 19, 2025. The entire contents of each of the foregoing applications are incorporated herein by reference in their entirety.

[0005] BACKGROUND

[0006] Transfer RNAs (tRNAs) are complex, naturally occurring RNA molecules that possess a number of functions including initiation and elongation of proteins.

[0007] SUMMARY

[0008] The present disclosure features modified tRNA-based effector molecules (TREMs) formulated in lipid nanoparticles, as well as related compositions and uses thereof. TREMs are complex molecules which can mediate a variety of cellular processes. For example, the TREMs described herein may have the ability to: (i) support protein synthesis, (ii) be charged by a tRNA synthetase, (iii) be bound by an elongation factor, (iv) introduce an amino acid into a peptide chain, (v) support protein elongation, or (vi) support initiation of protein synthesis, e.g., in a cell.

[0009] BRIEF DESCRIPTION OF DRAWINGS

[0010] FIG. 1 shows dose-dependent increase in p53 protein and downstream target p21 in Calu-6 cells following SEQ ID NO: 2 transfections. Calu-6 cells were transfected with increasing doses of SEQ ID NO: 2 and SEQ ID NO: 3 and p53 protein was measured after 24 hours. FIG. 1A is an image of a Western blot for full-length p53 protein in cells transfected with SEQ ID Attorney Docket No.: F2099-7045WO

[0011] NO: 2; a total protein stain was used as a loading control for normalization. FIG. IB is a graph showing quantification of p53 expression in response to 1.56-12.5 nM SEQ ID NO: 2 and SEQ ID NO: 3 delivery. p53 protein rescue is shown as signal intensity in Calu-6 cells relative to wildtype (WT) p53 signal in a positive control cell line. FIG. 1C is an image of a Western blot for full-length p21 protein in cells transfected with SEQ ID NO: 2 at 48 hours; a total protein stain was used as a loading control for normalization. FIG. ID is a graph showing quantification of p21 expression in response to 1.56-12.5 nM SEQ ID NO: 2 and SEQ ID NO: 3 delivery. p21 protein expression is shown as signal intensity in Calu-6 cells relative to WT p21 signal in a positive control cell line.

[0012] FIG. 2 shows readthrough of a premature termination codon (PTC) by SEQ ID NO: 2 in the phenylalanine hydroxylate (PAH) gene in human HepG2 cells. FIG. 2A is an image of a Western blot of PAH protein expression in PKU HepG2 cells transfected with 0.4-50 nM SEQ ID NO: 2 48 hours post-transfection. The WT Mock sample was diluted down and the equivalent of 10% of WT MMUT protein was loaded. FIG. 2B is a graph showing quantification of PAH protein (relative to WT Mock) at 48 hours post-transfection in cells transfected with 0.4-12.5 nM of SEQ ID NO: 2 and SEQ ID NO: 3.

[0013] FIG. 3 shows premature termination codon (PTC) readthrough in the MMUT gene and functional rescue by SEQ ID NO: 2 in an in vitro MMA disease model (MMA HLCs). MMA HLCs were transfected with different doses of SEQ ID NO: 2 ranging from 0.4-100 nM using Lipofectamine 3000. SEQ ID NO: 3 was included at 50 nM as a benchmarking control; in addition, mock-transfected MMA HLCs were included as negative controls. Mock-transfected and SEQ ID NO: 3-transfected isogenic control HLCs were also included as positive (100% MMUT expression) and transfection controls. FIG. 3A is an image of a Western blot for MMUT protein expression in transfected MMA HLCs at 96 hours post-transfection. FIG. 3B is a graph showing quantification of MMUT protein in cells transfected with 0.4-50 nM SEQ ID NO: 2 at 96 hours post -transfection as a percentage of WT MMUT protein. FIG. 3C is a graph showing quantification of MMUT protein and MMA metabolite at 96 hours post-transfection at various SEQ ID NO: 2 doses.

[0014] FIG. 4 is a graph showing total SEQ ID NO: 3 and SEQ ID NO: 2 abundance in liver as measured by tRNA-Seq following a single administration of 3 mg / kg of SEQ ID NO: 3 or SEQ ID NO: 2 in a human / murine pharmacodynamic MMA mouse model. Adult transgenic MMA Attorney Docket No.: F2099-7045WO mice were dosed with LNP1 -formulated SEQ ID NO: 3 or SEQ ID NO: 2 (IV), and liver samples were collected at 96- and 336-hours post-dose. Each group contained 5 animals.

[0015] FIG. 5 is a graph showing human MMUT mRNA levels in liver following a single administration of 3 mg / kg of SEQ ID NO: 3 or SEQ ID NO: 2 in a human / murine pharmacodynamic MMA mouse model. Adult transgenic MMA mice were dosed with LNP1- formulated SEQ ID NO: 3 or SEQ ID NO: 2 (IV), and liver samples were collected at 96- and 336-hours post-dose. Each group contained 5 animals. Human MMUT mRNA levels in liver as measured by mRNAseq.

[0016] FIG. 6 is a graph showing human MMUT protein levels in liver following a single administration of 3 mg / kg of SEQ ID NO: 3 or SEQ ID NO: 2 in a human / murine pharmacodynamic MMA mouse model. Adult transgenic MMA mice were dosed with LNP1- formulated SEQ ID NO: 3 or SEQ ID NO: 2 (IV), and liver samples were collected at 96- and 336-hours post-dose. Each group contained 5 animals. LC-MS quantification of human MMUT protein in liver was determined using a human MMUT-specific peptide and expressed as fold change over SEQ ID NO: 3 treated group.

[0017] FIG. 7 is a graph showing human MMUT mRNA ribosome occupancy in liver following a single administration of 3 mg / kg of SEQ ID NO: 3 or SEQ ID NO: 2 in a human / murine pharmacodynamic MMA mouse model. Adult transgenic MMA mice were dosed with LNP1- formulated SEQ ID NO: 3 or SEQ ID NO: 2 (IV), and liver samples were collected at 96- and 336-hours post-dose. Each group contained 5 animals. Human MMUT mRNA ribosome occupancy in liver as measured by Ribo-Seq and expressed as reads per kilobase per million mapped reads (RPKM).

[0018] FIG. 8 is a graph showing human MMUT mRNA levels in liver following single administration of 3 mg / kg of SEQ ID NO: 3 or SEQ ID NO: 2 in a human / murine MMA pharmacodynamic mouse model. Adult transgenic MMA mice were dosed with LNP2- formulated SEQ ID NO: 3 or SEQ ID NO: 2 (IV), and liver samples were collected at 96- and 336-hours post-dose. Two different SEQ ID NO: 2 formulations were tested: SEQ ID NO: 2 in LNP2 N / P 6 and SEQ ID NO: 2 in LNP2 N / P 3. Each group contained 3-5 animals. Human MMUT mRNA levels in liver as measured by mRNAseq. Attorney Docket No.: F2099-7045WO

[0019] FIG. 9 is a graph showing total SEQ ID NO: 3 concentration upon administration of an IV bolus dose of 5 mg / kg. SEQ ID NO: 3 encapsulated in LNP1 and LNP2 formulations of various N / P ratios were compared.

[0020] FIG. 10 is a graph showing a comparison of liver area under the curve from 0-72 hours (AUCo-72h) of TREM upon administration of an IV bolus dose of 5 mg / kg SEQ ID NO: 3 in LNP1 and LNP2 with various N / P ratios.

[0021] FIG. 11 is a schematic showing the chemical structure of SEQ ID NO: 2.

[0022] FIG. 12 is a graph showing murine PAH protein (mPAH) levels in the liver following administration of SEQ ID NO: 2 in LNP2 at an IV dose of 3 mg / kg.

[0023] FIG. 13 is a set of fluorescent microscopy images showing PAH mRNA in hepatocytes following administration of SEQ ID NO: 2 in LNP2 at an IV dose of 3 mg / kg. Yellow indicates PAH mRNA and blue indicates cell nuclei.

[0024] FIG. 14 is a graph showing murine PAH protein (mPAH) levels and plasma phenylalanine (Phe) levels following administration of SEQ ID NO: 2 in LNP2 at an IV dose of 3 mg / kg.

[0025] FIG. 15 is a set of graphs showing murine PAH protein levels and plasma phenylalanine (Phe) levels following administration of SEQ ID NO: 2 in LNP2 to mice at an IV dose of 1, 3, or 10 mg / kg. FIG. 15A shows PAH protein levels in the liver 24-240 hours post-administration. FIG. 15B shows plasma Phe levels 8-240 hours post-administration.

[0026] FIG. 16 is a set of graphs showing human MMUT (hMMUT) protein levels and hMMut mRNA ribosome occupancy following administration of SEQ ID NO: 2 in LNP2 to mice at an IV dose of 1, 3, or 10 mg / kg. FIG. 16A shows hMMUT protein levels in the liver at 4, 14, and 21 days post-administration. FIG. 16B shows hMMut mRNA ribosome occupancy in the liver between 1 and 28 days post-administration.

[0027] FIG. 17 is a graph showing cytokine levels following administration of SEQ ID NO: 2 in LNP2 to non-human primates at an IV dose of 2 mg / kg.

[0028] FIG. 18 is a set of graphs showing plasma and liver concentrations of SEQ ID NO: 1 following administration to mice or non-human primates. FIG. 18A shows plasma concentrations of SEQ ID NO: 1 in mice at approximately 0.25, 0.5, 1, 4, 10 24, 48, 72, and 168 hours after a single IV dose of 3 mg / kg. FIG. 18B shows naturally modified and total liver concentrations of SEQ ID NO: 1 in mice at approximately 1, 4, 24, and 168 hours after a single Attorney Docket No.: F2099-7045WO

[0029] IV dose of 3 mg / kg. FIG. 18C shows plasma concentrations of SEQ ID NO: 1 in non-human primates at approximately 0.25, 0.5, 1, 1.5, 2, 3, 4, 8, 14 24, and 48 hours after a single IV dose of 2 mg / kg. FIG. 18D shows naturally modified and total liver concentrations of SEQ ID NO: 1 in non-human primates at approximately 1, 25, and 73 hours after a single IV dose of 2 mg / kg.

[0030] FIG. 19 is a set of graphs showing SEQ ID NO: 2 abundance, murine PAH (mPAH) protein levels in liver, and plasma phenylalanine (Phe) levels following administration of SEQ ID NO: 2 in LNP2 after 1, 2 or 4 weekly IV doses of 3 or 5 mg / kg in a murine pharmacodynamic and efficacy PKU mouse model. FIG. 19A shows total SEQ ID NO: 2 abundance in liver as measured by tRNA-Seq following 1, 2 or 4 weekly administrations. FIG. 19B shows naturally modified SEQ ID NO: 2 abundance in liver as measured by tRNA-Seq following 1, 2 or 4 weekly administrations. FIG. 19C shows mPAH protein levels in liver as measured by capillary electrophoresis following 1, 2 or 4 weekly administrations. FIG. 19D shows plasma Phe levels as measured by LC / MC following 1, 2 or 4 weekly administrations. Samples were taken at 72 or 96 hours post-dosing. Each group contained 3-5 animals.

[0031] DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS

[0032] The present disclosure features lipid nanoparticle formulations of tRNA-based effector molecules (TREMs), as well as compositions and related methods. As disclosed herein, TREMs are complex molecules which can mediate a variety of cellular processes. The inventors have discovered that the delivery of a TREM to a cell or subject may be optimized by encapsulating the TREM in a particular lipid nanoparticle. In an embodiment, the lipid nanoparticle formulation of a TREM is used to provide improved readthrough of a premature termination codon (PTC), in a transcript. In another embodiment, the lipid nanoparticle formulation of a TREM is used to treat a subject having a PTC disease or disorder.

[0033] Lipid nanoparticle TREM compositions, e.g., the TREMs described herein, can be administered to a cell, a tissue, or to a subject to modulate certain cellular functions. Also disclosed herein are methods of modulating expression of a protein in a subject or cell, wherein the protein is encoded by a nucleic acid comprising an endogenous open reading frame (ORF) having a first sequence, e.g., a mutation, e.g., a premature termination codon (PTC), and methods of treating a subject having an endogenous open reading frame (ORF) which comprises a Attorney Docket No.: F2099-7045WO premature termination codon (PTC). Further disclosed herein are TREMs comprising a non- naturally occurring modification, methods of making the same and compositions thereof.

[0034] Definitions

[0035] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which this disclosure belongs. As used in the specification and claims, the singular form “a”, “an” and “the” include plural references unless the context clearly dictates otherwise.

[0036] “Acquire” or “acquiring” as the terms are used herein, refer to obtaining possession of a value, e.g., a numerical value, by “directly acquiring” or “indirectly acquiring” the physical entity or value. “Directly acquiring” refers to performing a process (e.g., performing an analytical method) to obtain the value. “Indirectly acquiring” refers to receiving the value from another party or source (e.g., a third party laboratory that directly acquired the value).

[0037] “Lipid nanoparticle,” as used herein, refers to a particle having at least one dimension on the order of nanometers (i.e., less than 1000 nm), and which comprises a lipid component. Nonlimiting examples of lipid nanoparticles include liposomes, micelles, and solid lipid nanoparticles. In preferred embodiments, lipid nanoparticle refers to a solid lipid nanoparticle.

[0038] In some embodiments, a lipid nanoparticle may further comprise non-lipid components. In some embodiments, a lipid nanoparticle comprises a therapeutic agent (e.g, a nucleic acid, e.g., a tRNA).

[0039] “Lipid component,” as used herein, refers to any lipid or mixtures thereof which are present in a lipid nanoparticle. The lipid component typically includes a combination of ionizable lipids, neutral lipids, pegylated lipids, and sterols.

[0040] “Non-lipid component,” as used herein, refers to any other additive to the lipid nanoparticle besides the lipid component. Non-limiting examples of non-lipid components include buffers, salts, carbohydrates, preservatives, surfactants, excipients, or emulsifiers.

[0041] “Ionizable lipid,” as used herein, refers to a lipid that can exist in a charged or neutral form depending on pH. Ionizable lipids may refer to a lipid comprising one or more charged moieties. In some embodiments, an ionizable lipid may be positively charged or negatively charged. Attorney Docket No.: F2099-7045WO

[0042] “Cationic lipid,” as used herein, refers to an ionizable lipid that has a net positive formal charge. In some embodiments, the cationic lipid only has a net formal charge at a relevant pH (e.g., acidic pH, e.g., pH of a late endosome or lysosome), while having a formal charge of zero at another relevant pH (e.g., physiological pH). A cationic lipid may comprise one or more charged moieties.

[0043] “Neutral lipid,” as used herein, refers to a lipid species that exists either in an uncharged or neutral zwitterionic form at a relevant pH (e.g., physiological pH). Non-limiting examples of neutral lipids include phosphatidylcholine, phosphatidylethanolamine, phosphatidyl serine, phosphatidylinositol, phosphatidic acid, palmitoyloleoyl phosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine, dipalmitoylphosphatidylcholine, dioleoylphosphatidylcholine, distearoylphosphatidylcholine, and dilinoleoylphosphatidylcholine, and derivatives thereof.

[0044] “Sterol,” as used herein, refers to an organic compound comprising the following core structure: , wherein substitution is allowed at any of positions 1 to 16. Nonlimiting examples of sterols include cholesterol, campesterol, P-sitosterol, brassicasterol, ergosterol, dehydroergosterol, stigmasterol, fucosterol, and derivatives thereof. In some embodiments, sterol refers to cholesterol or a derivative thereof.

[0045] “Polymer-conjugated lipid,” as used herein, refers to a molecule comprising both a lipid portion and a polymer portion.

[0046] “Pegylated lipid,” as used herein, refers to a molecule comprising both a lipid portion and a polyethylene glycol (PEG) portion. Without wishing to be bound by theory, pegylated lipids may help to inhibit lipid nanoparticle aggregation, increase serum half-life, and decrease immune recognition of lipid nanoparticles. Non-limiting examples of pegylated lipids include PEG- diacylglycerol (PEG-DAG), PEG-dimyristoylglycerol (PEG-DMG), PEG- phosphatidylethanoloamine (PEG-PE), PEG-succinate diacylglycerol (PEG-S-DAG), and PEG- ceramide (PEG-CER). Attorney Docket No.: F2099-7045WO

[0047] A “disease or disorder associated with a PTC” as that term is used herein includes, but is not limited to, a disease or disorder in which cells express, or at one time expressed, a polypeptide encoded by an ORF comprising a PTC. In some embodiments, a disease associated with a PTC is chosen from: a proliferative disorder (e.g., a cancer), a genetic disorder, a metabolic disorder, an immune disorder, an inflammatory disorder or a neurological disorder. Exemplary diseases or disorders associated with a PTC are provided in any one of Tables 10, 11 and 12. In an embodiment, the disease associated with a PTC is a cancer. In an embodiment, the disease associated with a PTC is a monogenic disease.

[0048] An “isoacceptor,” as that term is used herein, refers to a plurality of tRNA molecule or TREMs wherein each molecule of the plurality comprises a different naturally occurring anticodon sequence and each molecule of the plurality mediates the incorporation of the same amino acid and that amino acid is the amino acid that naturally corresponds to the anticodons of the plurality.

[0049] A “modification,” as that term is used herein in regard to a TREM, may refer to a sequence modification or a chemical modification of the TREM. As this term is used to in reference to a sequence modification, the modification may include a nucleotide addition, nucleotide deletion or nucleotide substitution. As this term is used in reference to a chemical modification, the modification may include a modification of the chemical structure, e.g., a covalent modification, of the subject nucleotide. The chemical modification can be naturally occurring or non-naturally occurring. In an embodiment, the modification is non-naturally occurring. In an embodiment, the modification is naturally occurring. In an embodiment, the modification is a synthetic modification. In an embodiment, the modification is a modification provided in Table 4.

[0050] A “naturally occurring nucleotide,” as that term is used herein, refers to a nucleotide that does not comprise a non-naturally occurring modification. In an embodiment, it includes a naturally occurring modification.

[0051] A “non-naturally occurring modification,” as that term is used herein with reference to a nucleotide, refers to a chemical modification that: (a) a cell, e.g., a human cell, does not make on an endogenous tRNA; or (b) a cell, e.g., a human cell, can make on an endogenous tRNA but wherein such modification is in a location in which it does not occur on a native tRNA, e.g., the modification is in a domain, linker or arm, or on a nucleotide and / or at a position within a Attorney Docket No.: F2099-7045WO domain, linker or arm, which does not have such modification in nature. In either case, the modification is added synthetically, e.g., in a cell free reaction, e.g., in a solid state or liquid phase synthetic reaction. In an embodiment, the non-naturally occurring modification is a modification that is not present (in identity, location or position) if a sequence of the TREM is expressed in a mammalian cell, e.g., a HEK293 cell line. Exemplary non-naturally occurring modifications are found in Table 4.

[0052] A “non-naturally modified nucleotide,” as that term is used herein, refers a nucleotide comprising a non-naturally occurring modification on or of a sugar, nucleobase, or phosphate moiety.

[0053] A “nucleotide,” as that term is used herein, refers to an entity comprising a sugar, typically a pentameric sugar; a nucleobase; and a phosphate linking group. In an embodiment, a nucleotide comprises a naturally occurring, e.g., naturally occurring in a human cell, nucleotide, e.g., an adenine, thymine, guanine, cytosine, or uracil nucleotide.

[0054] A “premature termination codon” or “PTC” as those terms are used herein, refer to a stop codon that occurs in an open reading frame (ORF) of a DNA or mRNA. In an embodiment, a PTC occurs at a position upstream of a naturally occurring stop codon in an ORF. In an embodiment, a PTC that occurs upstream of a naturally occurring stop codon, e.g., in an ORF, results in modulation of a production parameter of the corresponding mRNA or polypeptide encoded by the ORF. In an embodiment, a PTC can differ (or arise) from a pre-mutation sequence by a point mutation, e.g., a nonsense mutation. In an embodiment, a PTC can differ (or arise) from a pre-mutation sequence by a genetic change, e.g., abnormality, other than a point mutation, e.g., a frameshift, a deletion, an insertion, a rearrangement, an inversion, a translocation, a duplication, or a transversion. In an embodiment, a PTC results in the production of a truncated protein which lacks a native activity or which is associated with a mutant, disease, or other unwanted phenotype. In an embodiment, the ORF comprising the PTC is an ORF from a tumor suppressor gene. In an embodiment, the mutation giving rise to the PTC is a driver mutation, e.g., a mutation that provides a growth advantage to a tumor cell.

[0055] A “functional parameter,” refers to an expression parameter and / or a signaling parameter. In an embodiment a functional parameter is an expression parameter. An expression parameter includes an expression parameter of a polypeptide or protein encoded by the endogenous ORF having a first sequence or PTC; or an expression parameter of an RNA, e.g., messenger RNA, Attorney Docket No.: F2099-7045WO encoded by the endogenous ORF having a first sequence or PTC. In an embodiment, an expression parameter can include:

[0056] (a) protein translation;

[0057] (b) expression level (e.g., of polypeptide or protein, or mRNA);

[0058] (c) post-translational modification of polypeptide or protein;

[0059] (d) folding (e.g., of polypeptide or protein, or mRNA),

[0060] (e) structure e.g., of polypeptide or protein, or mRNA),

[0061] (f) transduction (e.g., of polypeptide or protein),

[0062] (g) compartmentalization (e.g., of polypeptide or protein, or mRNA),

[0063] (h) incorporation (e.g., of polypeptide or protein, or mRNA) into a supermolecular structure, e.g., incorporation into a membrane, proteasome, or ribosome,

[0064] (i) incorporation into a multimeric polypeptide, e.g., a homo or heterodimer, and / or

[0065] (j) stability.

[0066] In an embodiment, a functional parameter is a signaling parameter. A signaling parameter can include:

[0067] (1) modulation of a signaling pathway, e.g., a cellular signaling pathway which is downstream or upstream of the protein encoded by the endogenous ORF having a first sequence or PTC;

[0068] (2) cell fate modulation;

[0069] (3) ribosome occupancy modulation;

[0070] (4) protein translation modulation;

[0071] (5) mRNA stability modulation;

[0072] (6) protein folding and structure modulation;

[0073] (7) protein transduction or compartmentalization modulation; and / or

[0074] (8) protein stability modulation.

[0075] An “ORF having a PTC” as that phrase is used herein, refers to an open reading frame (ORF) which comprises a premature termination codon (PTC). In an embodiment, the ORF having the PTC is associated with a disease or disorder associated with a PTC, e.g., as described herein, e.g., a disease or disorder listed in any one of Tables 9, 10, 11, and 12. In an embodiment, the ORF having the PTC is not associated with a disease or disorder associated with a PTC.

[0076] As used herein, the term “aqueous solution” refers to a composition comprising water. Attorney Docket No.: F2099-7045WO

[0077] “Serum-stable” in relation to nucleic acid-lipid nanoparticles means that the nucleotide is not significantly degraded after exposure to a serum or nuclease assay that would significantly degrade free DNA or RNA. Suitable assays include, for example, a standard serum assay, a DNAse assay, or an RNAse assay.

[0078] “Systemic delivery,” as used herein, refers to delivery of a therapeutic product that can result in a broad exposure of an active agent within an organism. Some techniques of administration can lead to the systemic delivery of certain agents, but not others. Systemic delivery means that a useful, preferably therapeutic, amount of an agent is exposed to most parts of the body. Systemic delivery of lipid nanoparticles can be by any means known in the art including, for example, intravenous, intraarterial, subcutaneous, and intraperitoneal delivery. In some embodiments, systemic delivery of lipid nanoparticles is by intravenous delivery.

[0079] “Local delivery,” as used herein, refers to delivery of an active agent directly to a target site within an organism. For example, an agent can be locally delivered by direct injection into a disease site such as a tumor, other target site such as a site of inflammation, or a target organ such as the liver, heart, pancreas, kidney, and the like. Local delivery can also include topical applications or localized injection techniques such as intramuscular, subcutaneous, or intradermal injection. Local delivery does not preclude a systemic pharmacological effect.

[0080] A “stop codon” as that term is used herein, refers to a three nucleotide contiguous sequence within messenger RNA that specifies a termination of translation. For example, UAG, UAA, UGA (in RNA) and TAG, TAA or TGA (in DNA) are stop codons. The stop codons are also known as amber (UAG), ochre (UAA), and opal (UGA).

[0081] A “tRNA-based effector molecule” or “TREM,” as that term is used herein, refers to an RNA molecule comprising a structure or property from (a)-(v) below, and which is a recombinant TREM, a synthetic TREM, or a TREM expressed from a heterologous cell. TREMs are chemically distinct, e.g., in terms of primary sequence, type or location of modifications from the endogenous tRNA molecules made in cells, e.g., in mammalian cells, e.g., in human cells. A TREM can have a plurality (e.g., 2, 3, 4, 5, 6, 7, 8, 9) of the structures and functions of (a)-(v).

[0082] In an embodiment, a TREM is non-native, as evaluated by structure or the way in which it was made. In an embodiment, a TREM comprises one or more of the following structures or properties: Attorney Docket No.: F2099-7045WO

[0083] (a’) an optional linker region of a consensus sequence provided in the “Consensus Sequence” section, e.g., a Linker 1 region;

[0084] (a) an amino acid attachment domain that binds an amino acid, e.g., an acceptor stem domain (AStD), wherein an AStD comprises sufficient RNA sequence to mediate, e.g., when present in an otherwise wildtype tRNA, acceptance of an amino acid, e.g., its cognate amino acid or a non-cognate amino acid, and transfer of the amino acid (AA) in the initiation or elongation of a polypeptide chain. Typically, the AStD comprises a 3 ’-end adenosine (CCA) for acceptor stem charging which is part of synthetase recognition.

[0085] (a’-l) a linker comprising residues Rs-R.9 of a consensus sequence provided in the “Consensus Sequence” section, e.g., a Linker 2 region;

[0086] (b) a dihydrouridine hairpin domain (DHD), wherein a DHD comprises sufficient RNA sequence to mediate, e.g., when present in an otherwise wildtype tRNA, recognition of aminoacyl-tRNA synthetase, e.g., acts as a recognition site for aminoacyl-tRNA synthetase for amino acid charging of the TREM.

[0087] (b’-l) a linker comprising residue R29 of a consensus sequence provided in the “Consensus Sequence” section, e.g., a Linker 3 region;

[0088] (c) an anticodon that binds a respective codon in an mRNA, e.g., an anticodon hairpin domain (ACHD), wherein an ACHD comprises sufficient sequence, e.g., an anticodon triplet, to mediate, e.g., when present in an otherwise wildtype tRNA, pairing (with or without wobble) with a codon.

[0089] (d) a variable loop domain (VLD), wherein a VLD comprises sufficient RNA sequence to mediate, e.g., when present in an otherwise wildtype tRNA, recognition of aminoacyl-tRNA synthetase, e.g., acts as a recognition site for aminoacyl-tRNA synthetase for amino acid charging of the TREM. In embodiments, a VLD mediates the stabilization of the TREM’s tertiary structure. In an embodiment, a VLD modulates, e.g., increases, the specificity of the TREM, e.g., for its cognate amino acid, e.g., the VLD modulates the TREM’s cognate adaptor function.

[0090] (e) a thymine hairpin domain (THD), wherein a THD comprises sufficient RNA sequence, to mediate, e.g., when present in an otherwise wildtype tRNA, recognition of the ribosome, e.g., acts as a recognition site for the ribosome to form a TREM-ribosome complex during translation. Attorney Docket No.: F2099-7045WO

[0091] (e’ l) a linker comprising residue R72 of a consensus sequence provided in the “Consensus Sequence” section, e.g., a Linker 4 region;

[0092] (f) under physiological conditions, it comprises a stem structure and one or a plurality of loop structures, e.g., 1, 2, or 3 loops. A loop can comprise a domain described herein, e.g., a domain selected from (a)-(e). A loop can comprise one or a plurality of domains.

[0093] (g) a tertiary structure, e.g., an L-shaped tertiary structure;

[0094] (h) adaptor function, i.e., the TREM mediates acceptance of an amino acid, e.g., its cognate amino acid and transfer of the AA in the initiation or elongation of a polypeptide chain;

[0095] (i) cognate adaptor function wherein the TREM mediates acceptance and incorporation of an amino acid (e.g., cognate amino acid) associated in nature with the anti-codon of the TREM to initiate or elongate a polypeptide chain;

[0096] (j) non-cognate adaptor function, wherein the TREM mediates acceptance and incorporation of an amino acid (e.g., non-cognate amino acid) other than the amino acid associated in nature with the anti -codon of the TREM in the initiation or elongation of a polypeptide chain;

[0097] (k) a regulatory function, e.g., an epigenetic function (e.g., gene silencing function or signaling pathway modulation function), cell fate modulation function, mRNA stability modulation function, protein stability modulation function, protein transduction modulation function, or protein compartmentalization function;

[0098] (l) a structure which allows for ribosome binding;

[0099] (m) a post-transcriptional modification, e.g., a naturally occurring post-transcriptional modification;

[0100] (n) the ability to inhibit a functional property of a tRNA, e.g., any of properties (h)-(k) possessed by a tRNA;

[0101] (o) the ability to modulate cell fate;

[0102] (p) the ability to modulate ribosome occupancy;

[0103] (q) the ability to modulate protein translation;

[0104] (r) the ability to modulate mRNA stability;

[0105] (s) the ability to modulate protein folding and structure and / or function;

[0106] (t) the ability to modulate protein transduction or compartmentalization;

[0107] (u) the ability to modulate protein stability; or Attorney Docket No.: F2099-7045WO

[0108] (v) the ability to modulate a signaling pathway, e.g., a cellular signaling pathway.

[0109] In an embodiment, a TREM is 75-90 nucleotides in length. In embodiments, a TREM or a fragment or functional fragment thereof is between 10-90 nucleotides, between 10-80 nucleotides, between 10-70 nucleotides, between 10-60 nucleotides, between 10-50 nucleotides, between 10-40 nucleotides, between 10-30 nucleotides, between 10-20 nucleotides, between 20- 90 nucleotides, between 20-80 nucleotides, 20-70 nucleotides, between 20-60 nucleotides, between 20-50 nucleotides, between 20-40 nucleotides, between 30-90 nucleotides, between 30- 80 nucleotides, between 30-70 nucleotides, between 30-60 nucleotides, or between 30-50 nucleotides.

[0110] In an embodiment, a TREM is aminoacylated, e.g., charged, with an amino acid by an aminoacyl tRNA synthetase. In an embodiment, a TREM is not charged with an amino acid, e.g., an uncharged TREM.

[0111] “Decreased expression,” as that term is used herein, refers to a decrease in comparison to a reference, e.g., in the case where altered control region, or addition of an agent, results in a decreased expression of the subject product, it is decreased relative to an otherwise similar cell without the alteration or addition.

[0112] An “exogenous nucleic acid,” as that term is used herein, refers to a nucleic acid sequence that is not present in or differs by at least one nucleotide from the closest sequence in a reference cell, e.g., a cell into which the exogenous nucleic acid is introduced. In an embodiment, an exogenous nucleic acid comprises a nucleic acid that encodes a TREM.

[0113] An “exogenous TREM,” as that term is used herein, refers to a TREM that:

[0114] (a) differs by at least one nucleotide or one post transcriptional modification from the closest sequence tRNA in a reference cell, e.g., a cell into which the exogenous nucleic acid is introduced;

[0115] (b) has been introduced into a cell other than the cell in which it was transcribed;

[0116] (c) is present in a cell other than one in which it naturally occurs; or

[0117] (d) has an expression profile, e.g., level or distribution, that is non-wildtype, e.g., it is expressed at a higher level than wildtype. In an embodiment, the expression profile can be mediated by a change introduced into a nucleic acid that modulates expression or by addition of an agent that modulates expression of the RNA molecule. In an embodiment an exogenous TREM comprises 1, 2, 3 or 4 of properties (a)-(d). Attorney Docket No.: F2099-7045WO

[0118] A “GMP-grade composition,” as that term is used herein, refers to a composition in compliance with current good manufacturing practice (cGMP) guidelines, or other similar requirements. In an embodiment, a GMP-grade composition can be used as a pharmaceutical product.

[0119] As used herein, the terms “increasing” and “decreasing” refer to modulating that results in, respectively, greater or lesser amounts of function, expression, or activity of a particular metric relative to a reference. For example, subsequent to administration to a cell, tissue or subject of a TREM described herein, the amount of a marker of a metric (e.g., protein translation, mRNA stability, protein folding) as described herein may be increased or decreased by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98%, 2X, 3X, 5X, 10X or more relative to the amount of the marker prior to administration or relative to the effect of a negative control agent. The metric may be measured subsequent to administration at a time that the administration has had the recited effect, e.g., at least 12 hours, 24 hours, one week, one month, 3 months, or 6 months, after a treatment has begun.

[0120] “Increased expression,” as that term is used herein, refers to an increase in comparison to a reference, e.g., in the case where altered control region, or addition of an agent, results in an increased expression of the subject product, it is increased relative to an otherwise similar cell without the alteration or addition.

[0121] A “non-cognate adaptor function TREM,” as that term is used herein, refers to a TREM which mediates initiation or elongation with an AA (a non-cognate AA) other than the AA associated in nature with the anti -codon of the TREM. In an embodiment, a non-cognate adaptor function TREM is also referred to as a mischarged TREM (mTREM).

[0122] A “non-naturally occurring sequence,” as that term is used herein, refers to a sequence wherein an Adenine is replaced by a residue other than an analog of Adenine, a Cytosine is replaced by a residue other than an analog of Cytosine, a Guanine is replaced by a residue other than an analog of Guanine, and a Uracil is replaced by a residue other than an analog of Uracil. An analog refers to any possible derivative of the ribonucleotides, A, G, C or U. In an embodiment, a sequence having a derivative of any one of ribonucleotides A, G, C or U is a non- naturally occurring sequence. Attorney Docket No.: F2099-7045WO

[0123] A “pharmaceutical TREM composition,” as that term is used herein, refers to a TREM composition that is suitable for pharmaceutical use. Typically, a pharmaceutical TREM composition comprises a pharmaceutical excipient. In an embodiment the TREM will be the only active ingredient in the pharmaceutical TREM composition. In embodiments the pharmaceutical TREM composition is free, substantially free, or has less than a pharmaceutically acceptable amount, of host cell proteins, DNA, e.g., host cell DNA, endotoxins, and bacteria.

[0124] A “post-transcriptional processing,” as that term is used herein, with respect to a subject molecule, e.g., a TREM, RNA or tRNAs, refers to a covalent modification of the subject molecule. In an embodiment, the covalent modification occurs post-transcriptionally. In an embodiment, the covalent modification occurs co-transcriptionally. In an embodiment the modification is made in vivo, e.g., in a cell used to produce a TREM. In an embodiment the modification is made ex vivo, e.g., it is made on a TREM isolated or obtained from the cell which produced the TREM. In an embodiment, the post-transcriptional modification is selected from a post-transcriptional modification listed in Table 4.

[0125] A “tRNA”, as that term is used herein, refers to a naturally occurring transfer ribonucleic acid in its native state.

[0126] A “TREM composition,” as that term is used herein, refers to a composition comprising a plurality of TREMs. A TREM composition can comprise one or more species of TREMs. In an embodiment, the composition comprises only a single species of TREM. In an embodiment, the TREM composition comprises a first TREM species; and a second TREM species. In an embodiment, the TREM composition comprises X TREM species, wherein X=2, 3, 4, 5, 6, 7, 8, 9, or 10. A TREM composition can comprise one or more species of TREMs. In an embodiment, the TREM composition is at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 95 or 99% dry weight TREMs (for a liquid composition dry weight refers to the weight after removal of substantially all liquid, e.g., after lyophilization). In an embodiment, the composition is a liquid. In an embodiment, the composition is dry, e.g., a lyophilized material. In an embodiment, the composition is a frozen composition. In an embodiment, the composition is sterile. In an embodiment, the composition comprises at least 0.5 g, 1.0 g, 5.0 g, 10 g, 15 g, 25 g, 50 g, 100 g, 200 g, 400 g, or 500 g (e.g., as determined by dry weight) of TREM. In an embodiment, at least X% of the TREMs in a TREM composition has a non-naturally occurring modification at a selected position, and X is 80, 90, 95, 96, 97, 98, 99, or 99.5. Attorney Docket No.: F2099-7045WO

[0127] In an embodiment, at least X% of the TREMs in a TREM composition has a non- naturally occurring modification at a first position and a non-naturally occurring modification at a second position, and X, independently, is 80, 90, 95, 96, 97, 98, 99, or 99.5. In embodiments, the modification at the first and second position is the same. In embodiments, the modification at the first and second position are different. In embodiments, the nucleotide at the first and second position is the same, e.g., both are adenine. In embodiments, the nucleotide at the first and second position are different, e.g., one is adenine and one is thymine.

[0128] In an embodiment, at least X% of the TREMs in a TREM composition has a non- naturally occurring modification at a first position and less than Y% have a non-naturally occurring modification at a second position, wherein X is 80, 90, 95, 96, 97, 98, 99, or 99.5 and Y is 20, 20, 5, 2, 1, .1, or .01. In embodiments, the nucleotide at the first and second position is the same, e.g., both are adenine. In embodiments the nucleotide at the first and second position are different, e.g., one is adenine and one is thymine.

[0129] Chemical Definitions

[0130] “Alkyl” refers to a straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms that is saturated (i.e., contains no double and / or triple bonds), having from one to twenty-four carbon atoms (C1-C24 alkyl), one to sixteen carbon atoms (C1-C16 alkyl), one to twelve carbon atoms (C1-C12 alkyl), six to twenty-four carbon atoms (C6-C24 alkyl), one to eight carbon atoms (Ci-Cg alkyl) or one to six carbon atoms (Ci-Ce alkyl) and which is attached to the rest of the molecule by a single bond, e.g., methyl, ethyl, n-propyl, 1 -methylethyl (iso propyl), n-butyl, n-pentyl, 1,1 -dimethylethyl (t-butyl), 3 -methylhexyl, 2-methylhexyl, and the like. Unless stated otherwise specifically in the specification, an alkyl group is optionally substituted.

[0131] “Alkoxy” refers to a radical with a formula -ORawhere Rais an alkyl radical as defined above. Unless stated otherwise specifically in the specification, an alkoxy group is optionally substituted.

[0132] “Alkenyl” refers to a straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms that contains at least one carbon-carbon double, having from one to twenty-four carbon atoms (C2-C24 alkenyl), one to twelve carbon atoms (C2-C12 alkenyl), six to twenty-four carbon atoms (C6-C24 alkenyl), two to sixteen carbon atoms (C2-C16 alkenyl), four to Attorney Docket No.: F2099-7045WO twelve carbon atoms (C4-C12 alkenyl), one to eight carbon atoms (C2-C8 alkenyl) or one to six carbon atoms (C2-C6 alkenyl) and which is attached to the rest of the molecule by a single bond, e.g., ethenyl, n-propenyl, 1 -methylethenyl, n-butenyl, n-pentenyl, 1,1 -dimethylethenyl, 3- methylhexenyl, 2-methylhexenyl, and the like. Unless stated otherwise specifically in the specification, an alkenyl group is optionally substituted.

[0133] “Alkynyl” refers to a straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms that contains at least one carbon-carbon triple bond, having from one to twenty -four carbon atoms (C2-C24 alkynyl), one to twelve carbon atoms (C2-C12 alkynyl), one to eight carbon atoms (C2-C8 alkynyl) or one to six carbon atoms (C2-C6 alkynyl) and which is attached to the rest of the molecule by a single bond, e.g., ethynyl, n-propynyl, 1-methylethynyl, n-butynyl, n-pentynyl, 1,1-dimethylethynyl, 3 -methylhexynyl, 2-methylhexynyl, and the like. Unless stated otherwise specifically in the specification, an alkynyl group is optionally substituted.

[0134] “Alkylene” or “alkylene chain” refers to a straight or branched divalent saturated hydrocarbon chain linking the rest of the molecule to a radical group, consisting solely of carbon and hydrogen. In some embodiments, an alkylene chain has from one to twenty -four carbon atoms (C1-C24 alkylene), one to fifteen carbon atoms (C1-C15 alkylene), one to twelve carbon atoms (C1-C12 alkylene), one to eight carbon atoms (Ci-Cs alkylene), one to six carbon atoms (Ci-Ce alkylene), four to six carbon atoms (C4-C6 alkylene), two to four carbon atoms (C2-C4 alkylene), one to two carbon atoms (C1-C2 alkylene), e.g., methylene, ethylene, propylene, / / -butylene, and the like. The alkylene chain is attached to the rest of the molecule through a single bond and to the radical group through a single bond. The points of attachment of the alkylene chain to the rest of the molecule and to the radical group can be through one carbon or any two carbons within the chain. Unless stated otherwise specifically in the specification, an alkylene chain is optionally substituted.

[0135] “Alkenylene” or “alkenylene chain” refers to a straight or branched divalent hydrocarbon chain linking the rest of the molecule to a radical group, consisting solely of carbon and hydrogen and which comprises at least one carbon-carbon double bond. In some embodiments, an alkenylene chain has from two to twenty -four carbon atoms (C2-C24 alkenylene), two to fifteen carbon atoms (C2-C15 alkenylene), two to twelve carbon atoms (C2-C12 alkenylene), two to eight carbon atoms (C2-C8 alkenylene), two to six carbon atoms (C2-C6 alkenylene), four to six Attorney Docket No.: F2099-7045WO carbon atoms (C4-C6 alkenylene), two to four carbon atoms (C2-C4 alkenylene), e.g., ethenylene, propenylene, n-butenylene, and the like. The alkenylene chain is attached to the rest of the molecule through a single bond and to the radical group through a single bond. The points of attachment of the alkenylene chain to the rest of the molecule and to the radical group can be through one carbon or any two carbons within the chain. Unless stated otherwise specifically in the specification, an alkenylene chain is optionally substituted.

[0136] “Cycloalkyl” or “carbocyclic ring” refers to a stable non aromatic monocyclic or polycyclic hydrocarbon radical consisting solely of carbon and hydrogen atoms, which may include fused or bridged ring systems, having from three to fifteen ring carbon atoms (C3-C15), from three to ten ring carbon atoms (C3-C10) or from three to eight ring carbon atoms (Cs-Cs), and which is saturated or unsaturated and attached to the rest of the molecule by a single bond. Monocyclic radicals include, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Polycyclic radicals include, for example, adamantyl, norbornyl, decalinyl, 7,7-dimethyl bicyclo[2.2.1]heptanyl, and the like. Unless otherwise stated specifically in the specification, a cycloalkyl group is optionally substituted.

[0137] “Aryl” refers to a carbocyclic ring system radical comprising hydrogen, 6 to 18 carbon atoms and at least one aromatic ring. For purposes of this disclosure, the aryl radical is a monocyclic, bicyclic, tricyclic, or tetracyclic ring system, which may include fused or bridged ring systems. Aryl radicals include, but are not limited to, aryl radicals derived from aceanthrylene, acenaphthylene, acephenanthrylene, anthracene, azulene, benzene, chrysene, fluoranthene, fluorene, c / .s-indaccnc, s-indacene, indane, indene, naphthalene, phenalene, phenanthrene, pleiadene, pyrene, and triphenylene.

[0138] “Arylalkyl” refers to a radical of the formula -Rb-Rc where Rb is an alkylene or alkenylene as defined above and Rcis one or more aryl radicals as defined above, for example, benzyl, diphenylmethyl and the like. Unless stated otherwise specifically in the specification, an arylalkyl group is optionally substituted.

[0139] “Heterocyclyl” or “heterocyclic ring” refers to a stable 3- to 18-membered non-aromatic ring radical having one to twelve ring carbon atoms (e.g., two to twelve) and from one to six ring heteroatoms selected from the group consisting of nitrogen, oxygen, and sulfur. Unless stated otherwise specifically in the specification, the heterocyclyl radical is a monocyclic, bicyclic, tricyclic, or tetracyclic ring system, which may include fused, spirocyclic (“spiro-heterocyclyl”) Attorney Docket No.: F2099-7045WO and / or bridged ring systems; and the nitrogen, carbon, or sulfur atoms in the heterocyclyl radical is optionally oxidized; the nitrogen atom is optionally quatemized; and the heterocyclyl radical is partially or fully saturated. Examples of such heterocyclyl radicals include, but are not limited to, dioxolanyl, thienylfl ,3]dithianyl, decahydroisoquinolyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2-oxopyrrolidinyl, oxazolidinyl, piperidinyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuryl, trithianyl, tetrahydropyranyl, thiomorpholinyl, thiamorpholinyl, 1-oxo-thiomorpholinyl, and 1,1-dioxo-thiomorpholinyl. Unless stated otherwise specifically in the specification, a heterocyclyl group is optionally substituted.

[0140] The term “substituted” used herein means any of the above groups (e. ., alkyl, alkylhydroxyl, alkenyl, alkynyl, alkylene, cycloalkyl, aryl, aralkyl or heterocyclyl) wherein at least one hydrogen atom is replaced by a bond to a non-hydrogen atoms such as, but not limited to: a halogen atom such as F, Cl, Br, and I; oxo groups (=0); hydroxyl groups (-OH); alkoxy groups (-ORa, where Rais C1-C12 alkyl or cycloalkyl); carboxyl groups (-OC(=O)Raor - C(=0)0Ra, where Rais H, C1-C12 alkyl or cycloalkyl); amine groups (-NRaRb, where Raand Rbare each independently H, C1-C12 alkyl or cycloalkyl); C1-C12 alkyl groups; and cycloalkyl groups. In some embodiments the substituent is a C1-C12 alkyl group. In other embodiments, the substituent is a cycloalkyl group. In other embodiments, the substituent is a halo group, such as fluoro. In other embodiments, the substituent is a oxo group. In other embodiments, the substituent is a hydroxyl group. In other embodiments, the substituent is an alkoxy group. In other embodiments, the substituent is a carboxyl group. In other embodiments, the substituent is an amine group.

[0141] “Optional” or “optionally” (e.g., optionally substituted) means that the subsequently described event of circumstances may or may not occur, and that the description includes instances where said event or circumstance occurs and instances in which it does not. For example, “optionally substituted alkyl” means that the alkyl radical may or may not be substituted and that the description includes both substituted alkyl radicals and alkyl radicals having no substitution. In some embodiments, “optionally substituted” means a particular radical is substituted with one or more substituents selected from the group consisting of halo (e.g., F, Cl, Br, and I), oxo (=0), hydroxyl (-0H), alkoxy (-0Ra, where Rais C1-C12 alkyl), cycloalkoxy Attorney Docket No.: F2099-7045WO

[0142] (-ORa, where Rais C3-C8 cycloalkyl), carboxyl (-OC(=O)Raor -C(=O)ORa, where Rais H, Ci- C12 alkyl, or C3-C8 cycloalkyl), amine (-NRaRb, where Raand Rbare each independently H, Ci- C12 alkyl, or C3-C8 cycloalkyl), C1-C12 alkyl, and C3-C8 cycloalkyl.

[0143] In some embodiments, “optionally substituted” means substituted with one or more halo substituents. In some embodiments, “optionally substituted” means substituted with one or more oxo substituents. In some embodiments, “optionally substituted” means substituted with one or more hydroxyl substituents. In certain embodiments, “optionally substituted” means substituted with one or more alkoxy substituents. In some embodiments, “optionally substituted” means substituted with one or more cycloalkoxy substituents. In certain embodiments, “optionally substituted” means substituted with one or more carboxy substituents. In some embodiments, “optionally substituted” means substituted with one or more amine substituents. In certain embodiments, “optionally substituted” means substituted with one or more C1-C12 alkyl substituents. In some embodiments, “optionally substituted” means substituted with one or more C3-C8 cycloalkyl substituents.

[0144] When a functional group is described as “optionally substituted,” and in turn, substituents on the functional group are also “optionally substituted” and so on, for the purposes of this disclosure, such iterations are limited to five, preferably such iterations are limited to two. In some embodiments, such iterations are limited to one. In some embodiments, such iterations are limited to zero.

[0145] This disclosure is also meant to encompass all pharmaceutically acceptable combinations of nucleic acids with LNPs comprising the compounds of Formula (I) being isotopically labelled by having one or more atoms replaced by an atom having a different atomic mass or mass number. Examples of isotopes that can be incorporated into the disclosed compounds include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorous, fluorine, chlorine, and iodine, such as2H,3H,nC,13C,14C,13N,15N,15O,17O,18O,31P,32P,35S,18F,36C1,123I, and125I, respectively. These radiolabeled compounds could be useful to help determine or measure the effectiveness of the compounds, by characterizing, for example, the site or mode of action, or binding affinity to pharmacologically important site of action. Certain isotopically labelled compounds of Formula (I), for example, those incorporating a radioactive isotope, are useful in drug and / or substrate tissue distribution studies. The radioactive isotopes tritium, z.e.,3H, and carbon-14, z.e.,14C, are Attorney Docket No.: F2099-7045WO particularly useful for this purpose in view of their ease of incorporation and ready means of detection.

[0146] Substitution with heavier isotopes such as deuterium, z.e.,2H, may afford certain therapeutic advantages resulting from greater metabolic stability, for example, increased in vivo half-life or reduced dosage requirements, and hence may be preferred in some circumstances.

[0147] Substitution with positron emitting isotopes, such asnC,18F,15O, and13N, can be useful in Positron Emission Topography (PET) studies for examining substrate receptor occupancy. Isotopically labeled compounds of Formula (I) can generally be prepared by conventional techniques known to those skilled in the art or by processes analogous to those described in the Preparations and Examples as set out below using an appropriate isotopically labeled reagent in place of the non-labeled reagent previously employed.

[0148] This disclosure is also meant to encompass the in vivo metabolic products of the disclosed compounds. Such products may result from, for example, the oxidation, reduction, hydrolysis, amidation, esterification, and the like of the administered compound, primarily due to enzymatic processes. Accordingly, the disclosure includes compounds produced by a process comprising administering a compound of this disclosure to a mammal for a period sufficient to yield a metabolic product thereof. Such products are typically identified by administering a radiolabeled compound of the disclosure in a detectable dose to an animal, such as rat, mouse, guinea pig, monkey, or to human, allowing sufficient time for metabolism to occur, and isolating its conversion products from the urine, blood, or other biological samples.

[0149] “Stable compound” and “stable structure” are meant to indicate a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent.

[0150] “Mammal” includes humans and both domestic animals such as laboratory animals and household pets (e.g., cats, dogs, swine, cattle, sheep, goats, horses, rabbits), and non-domestic animals such as wildlife and the like.

[0151] “Pharmaceutically acceptable carrier, diluent or excipient” includes without limitation any adjuvant, carrier, excipient, glidant, sweetening agent, diluent, preservative, dye / colorant, flavor enhancer, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonic agent, solvent, or emulsifier which has been approved by the United States Food and Drug Administration as being acceptable for use in humans or domestic animals. Attorney Docket No.: F2099-7045WO

[0152] “Pharmaceutically acceptable salt” includes both acid and base addition salts.

[0153] “Pharmaceutically acceptable acid addition salt” refers to those salts which retain the biological effectiveness and properties of the free bases, which are not biologically or otherwise undesirable, and which are formed with inorganic acids such as, but are not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like, and organic acids such as, but not limited to, acetic acid, 2,2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, camphoric acid, camphor- 10-sulfonic acid, capric acid, caproic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, cyclamic acid, dodecyl sulfuric acid, ethane-l,2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, galactaric acid, gentisic acid, glucoheptonic acid, gluconic acid, glucuronic acid, glutamic acid, glutaric acid, 2- oxo-glutaric acid, glycerophosphoric acid, glycolic acid, hippuric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, mucic acid, naphthalene-l,5-disulfonic acid, naphthalene-2-sulfonic acid, l-hydroxy-2-naphthoic acid, nicotinic acid, oleic acid, orotic acid, oxalic acid, palmitic acid, pamoic acid, propionic acid, pyroglutamic acid, pyruvic acid, salicylic acid, 4-aminosalicylic acid, sebacic acid, stearic acid, succinic acid, tartaric acid, thiocyanic acid, p-toluenesulfonic acid, tri fluoroacetic acid, undecylenic acid, and the like.

[0154] “Pharmaceutically acceptable base addition salt” refers to those salts which retain the biological effectiveness and properties of the free acids, which are not biologically or otherwise undesirable. These salts are prepared from addition of an inorganic base or an organic base to the free acid. Salts derived from inorganic bases include, but are not limited to, the sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like. Preferred inorganic salts are the ammonium, sodium, potassium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as ammonia, isopropylamine, trimethylamine, diethylamine, tri ethyl amine, tripropylamine, diethanolamine, ethanolamine, deanol, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, benethamine, benzathine, ethylenediamine, glucosamine, methylglucamine, theobromine, triethanolamine, Attorney Docket No.: F2099-7045WO tromethamine, purines, piperazine, piperidine, vV-ethylpiperidine, polyamine resins and the like. Particularly preferred organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline and caffeine.

[0155] Often crystallizations produce a solvate of the compound of the disclosure. As used herein, the term “solvate” refers to an aggregate that comprises one or more molecules of a compound of the disclosure with one or more molecules of solvent. The solvent may be water, in which case the solvate may be a hydrate. Alternatively, the solvent may be an organic solvent. Thus, the compounds of the present disclosure may exist as a hydrate, including a monohydrate, dihydrate, hemihydrate, sesquihydrate, trihydrate, tetrahydrate and the like, as well as the corresponding solvated forms. The compound of the disclosure may be true solvates, while in other cases, the compound of the disclosure may merely retain adventitious water or be a mixture of water plus some adventitious solvent.

[0156] A “pharmaceutical composition” refers to a formulation of a compound of the disclosure and a medium generally accepted in the art for the delivery of the biologically active compound to mammals, e.g., humans. Such a medium includes all pharmaceutically acceptable carriers, diluents, or excipients therefor.

[0157] “Effective amount” or “therapeutically effective amount” refers to that amount of a compound of the disclosure which, when administered to a mammal, preferably a human, is sufficient to effect treatment in the mammal, preferably a human. The amount of a lipid nanoparticle of the disclosure which constitutes a “therapeutically effective amount” will vary depending on the compound, the condition and its severity, the manner of administration, and the age of the mammal to be treated, but can be determined routinely by one of ordinary skill in the art having regard to his own knowledge and to this disclosure.

[0158] “Treating” or “treatment” as used herein covers the treatment of the disease or condition of interest in a mammal, preferably a human, having the disease or condition of interest, and includes:

[0159] (i) preventing the disease or condition from occurring in a mammal, in particular, when such mammal is predisposed to the condition but has not yet been diagnosed as having it;

[0160] (ii) inhibiting the disease or condition, i.e., arresting its development;

[0161] (iii) relieving the disease or condition, i.e., causing regression of the disease or condition; or Attorney Docket No.: F2099-7045WO

[0162] (iv) relieving the symptoms resulting from the disease or condition, i.e., relieving pain without addressing the underlying disease or condition. As used herein, the terms “disease” and “condition” may be used interchangeably or may be different in that the malady or condition may not have a known causative agent (so that etiology has not yet been worked out) and it is therefore not yet recognized as a disease but only as an undesirable condition or syndrome, wherein a more or less specific set of symptoms have been identified by clinicians.

[0163] The compounds of the disclosure, or their pharmaceutically acceptable salts may contain one or more asymmetric centers and may thus give rise to enantiomers, diastereomers, and other stereoisomeric forms that may be defined, in terms of absolute stereochemistry, as (R)- or (S)- or, as (D)- or (L)- for amino acids. The present disclosure is meant to include all such possible isomers, as well as their racemic and optically pure forms. Optically active (+) and (-), (R)- and (S)-, or (D)- and (L)- isomers may be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques, for example, chromatography and fractional crystallization. Conventional techniques for the preparation / isolation of individual enantiomers include chiral synthesis from a suitable optically pure precursor or resolution of the racemate (or the racemate of a salt or derivative) using, for example, chiral high-pressure liquid chromatography (HPLC). When the compounds described herein contain olefinic double bonds or other centers of geometric asymmetry, and unless specified otherwise, it is intended that the compounds include both E and Z geometric isomers. Likewise, all tautomeric forms are also intended to be included.

[0164] A “stereoisomer” refers to a compound made up of the same atoms bonded by the same bonds but having different three-dimensional structures, which are not interchangeable. The present disclosure contemplates various stereoisomers and mixtures thereof and includes “enantiomers,” which refers to two stereoisomers whose molecules are non-superimposable mirror images of one another.

[0165] A “tautomer” refers to a proton shift from one atom of a molecule to another atom of the same molecule. The present disclosure includes tautomers of any said compounds.

[0166] In an aspect, the disclosure provides a lipid nanoparticle (LNP) comprising:

[0167] (i) a cationic lipid;

[0168] (ii) a neutral lipid;

[0169] (iii) a polymer conjugated lipid (e.g., pegylated lipid); Attorney Docket No.: F2099-7045WO

[0170] (iv) a sterol; and

[0171] (v) a TREM capable of suppressing the premature termination codon (PTC) in an open reading frame of a gene, wherein the TREM is encapsulated within the LNP.

[0172] TREMs

[0173] A “tRNA-based effector molecule” or “TREM” refers to an RNA molecule comprising one or more of the properties described herein. A TREM can comprise a non-naturally occurring modification, e.g., as provided in Table 4. A TREM may further comprise a nucleotide modification, for example, a nucleotide substitution, nucleotide deletion, or nucleotide addition, relative to a second TREM.

[0174] In an embodiment, a TREM comprises a sequence of Formula A: [Ll]-[ASt Domainl]- [L2]-[DH Domain]-[L3]-[ACH Domain]-[VL Domain]-[TH Domain]-[L4]-[ASt Domain2], In an embodiment, [VL Domain] is optional. In an embodiment, [LI] is optional. In an embodiment, a TREM comprises a non-naturally occurring modification in each of the [ASt Domainl], the [DH Domain], the [ACH Domain], the [VL Domain], the [TH Domain], and the [ASt Domain2],

[0175] In an embodiment, a TREM can be charged with an amino acid (e.g., a cognate amino acid); charged with a non-cognate amino acid (e.g., a mischarged TREM (mTREM)); or not charged with an amino acid (e.g., an uncharged TREM (uTREM)). In an embodiment, a TREM can be charged with an amino acid selected from alanine, arginine, asparagine, aspartate, cysteine, glutamine, glutamate, glycine, histidine, isoleucine, methionine, leucine, lysine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, or valine.

[0176] In some embodiments, a non-extended anticodon is an anticodon of no more than three nucleotides. In an embodiment, a non-extended codon pairs with no more than three codon nucleotides on a nucleic acid being translated.

[0177] In an embodiment, the TREM is a cognate TREM. In an embodiment, the TREM is a non-cognate TREM. In an embodiment, the TREM recognizes a codon provided in Table 1 or Table 2.

[0178] Table 1: List of codons Attorney Docket No.: F2099-7045WO

[0179] Table 2: Amino acids and corresponding codons Attorney Docket No.: F2099-7045WO

[0180] Tryptophan UGG

[0181] In an embodiment, a TREM comprises a sequence listed in Table 3, wherein * indicates a phosphorothioate linkage, m indicates a 2’-O-methyl modification, f indicates a 2’-fluoro modification, and r indicates a ribonucleotide. Table 3. Exemplary TREM sequences. Attorney Docket No.: F2099-7045WO

[0182] A TREM described herein may comprise a non-naturally occurring modification, e.g., a modification described in Table 3. A non-naturally occurring modification can be made according to methods known in the art. In an embodiment, a non-naturally occurring modification is a modification that a cell, e.g., a human cell, does not make on an endogenous tRNA. In an embodiment, a non-naturally occurring modification is a modification that a cell, e.g., a human cell, can make on an endogenous tRNA, but wherein such modification is in a location in which it does not occur on a native tRNA. In an embodiment, the non-naturally occurring modification is in a domain, linker or arm which does not have such modification in nature. In an embodiment, the non-naturally occurring modification is at a position within a domain, linker or arm, which does not have such modification in nature. In an embodiment, the non-naturally occurring modification is on a nucleotide which does not have such modification in nature. In an embodiment, the non-naturally occurring modification is on a nucleotide at a position within a domain, linker or arm, which does not have such modification in nature.

[0183] The TREMs described herein may comprise a nucleotide sequence of one the TREMs provided in Table 3, or may comprise a nucleotide sequence having at least about 60 to at least about 99.9% sequence identity, e.g., at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9% sequence identity, to a TREM provided in Table 3. In one embodiment, a TREM described herein comprises the nucleotide sequence of SEQ ID NO: 11: GGCUCCG UGGCGCAAUGGAUAGCGCAUUGGACUUCAAAUUCAAAGGUUCCGGGUUCGAGUC CCGGCGGAGUCGCCA, or a sequence having at least about 60 to at least about 99.9% sequence identity, e.g., at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9% identity, to SEQ ID NO: 11. In another embodiment, a TREM described herein comprises the nucleotide sequence of SEQ ID NO: 12: GCCUCCGUGGCGCAAUGGAUA GCGCAGUGGACUUCAAAUUCACAGGUUCCGGGUUCGAGUCCCGGCGGAGGCGCCA , or a sequence having at least about 60 to at least about 99.9% sequence identity, e.g., at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9% identity, to SEQ ID NO: 12. In an embodiment, a TREM described herein comprises the nucleotide sequence of SEQ ID NO: 13: GGCUCCGUGGCGCAAUGGAUAGCGCAACCGUCUUCAAAACGGUAGGUU CCGGGUUCGAGUCCCGGCGGAGUCGCCA, or a sequence having at least about 60 to at least about 99.9% sequence identity, e.g., at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9% identity, to SEQ ID NO: 13. In an embodiment, a TREM described Attorney Docket No.: F2099-7045WO herein comprises the nucleotide sequence of SEQ ID NO: 14: GCCUCCGUGGCCUAAU GGAUAAGGCAUCGGCCUUCAAAGCCGGGGAUUGCGGGUUCGAGUCCCGUCGGAG GUGCCA, or a sequence having at least about 60 to at least about 99.9% sequence identity, e.g., at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9% identity, to SEQ ID NO: 14. In an embodiment, a TREM described herein comprises the nucleotide sequence of SEQ ID NO: 15: GGCUCCGUGGCGCAAUGGAUAGCGCAUCGGUCUUCAAA AUCGAAGGUUCCGGGUUCGAGUCCCGGCGGAGUCGCCA, or a sequence having at least about 60 to at least about 99.9% sequence identity, e.g., at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9% identity, to SEQ ID NO: 15.

[0184] In one embodiment, the TREM described herein has at least 1-30 nucleotide mutations, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotide mutations relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 1-20 nucleotide mutations relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 1-10 nucleotide mutations relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 10-20 nucleotide mutations relative to a TREM provided in Table 3. A nucleotide mutation, as described herein, refers to a substitution, insertion, or deletion of a nucleotide. In an embodiment, the TREM described herein has at least 1-30 nucleotide deletions, e.g, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotide deletions relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 1-20 nucleotide deletions relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 1-10 nucleotide deletions relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 10-20 nucleotide deletions relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 1-30 nucleotide insertions, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotide insertions relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 1-20 nucleotide insertions relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 1-10 nucleotide insertions relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 10-20 nucleotide insertions relative to a TREM provided in Table 3. In an embodiment, the TREM Attorney Docket No.: F2099-7045WO described herein has at least 1 -30 nucleotide substitutions, e.g., about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotide substitutions relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 1-20 nucleotide substitutions relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 1-10 nucleotide substitutions relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 10-20 nucleotide substitutions relative to a TREM provided in Table 3.

[0185] In an embodiment, a TREM described herein comprises at least 1-10 phosphorothioate modifications, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, phosphorothioate modifications. In an embodiment, the TREM described herein comprises at least 2-8 phosphorothioate modifications. In an embodiment, the TREM described herein comprises at least 3-5 phosphorothioate modifications. In an embodiment, the TREM described herein comprises at least 1-3 phosphorothioate modifications. In an embodiment, the TREM described herein comprises at least 1-10, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, additional phosphorothioate modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises at least 1-5 additional phosphorothioate modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises at least 5-10 additional phosphorothioate modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises at least 3-5 additional phosphorothioate modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises at about 1-4, e.g., about 1, 2, 3, or 4, fewer phosphorothioate modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises about 1-3 fewer phosphorothioate modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises about 1-2 fewer phosphorothioate modifications relative to a TREM provided in Table 3.

[0186] In an embodiment, a TREM described herein comprises at least 1-10 2’-O-methyl modifications, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, 2’-O-methyl modifications. In an embodiment, the TREM described herein comprises at least 2-8 2’-O-methyl modifications. In an embodiment, the TREM described herein comprises at least 3-5 2’-O-methyl modifications. In an embodiment, the TREM described herein comprises at least 1-3 2’-O-methyl modifications. In an embodiment, the TREM described herein comprises at least 1-10, e.g., about Attorney Docket No.: F2099-7045WO

[0187] 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, additional 2’-O-methyl modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises at least 1-5 additional 2’- O-methyl modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises at least 5-10 additional 2’-O-methyl modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises at least 3- 5 additional 2’-O-methyl modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises at about 1-7, e.g., about 1, 2, 3, 4, 5, 6, or 7, fewer 2’-O-methyl modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises about 2-6 fewer 2’-O-methyl modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises about 3-5 fewer 2’-O-methyl modifications relative to a TREM provided in Table 3.

[0188] In an embodiment, a TREM described herein comprises at least 1-10 2’-fluoro modifications, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, 2’-fluoro modifications. In an embodiment, the TREM described herein comprises at least 2-8 2’ -fluoro modifications. In an embodiment, the TREM described herein comprises at least 3-5 2’-fluoro modifications. In an embodiment, the TREM described herein comprises at least 1-3 2’ -fluoro modifications. In an embodiment, the TREM described herein comprises at least 1-10, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, additional 2’-fluoro modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises at least 1-5 additional 2’-fluoro modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises at least 5-10 additional 2’-fluoro modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises at least 3-5 additional 2’- fluoro modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises at about 1 fewer 2’ -fluoro modifications relative to a TREM provided in Table 3.

[0189] In another embodiment, a TREM described herein comprises a modification not present on a TREM provided in Table 3. For example, the modification not present on a TREM provided in Table 3 may be a modification present on the 2’ position of a nucleotide sugar, e.g., 2’ -deoxy, 2’-methyoxyethyl (2’ -MOE), 2’ -chloro, or within an intemucleotide region, e.g., a backbone modification. In an embodiment, a TREM described herein comprises a 2’ -deoxy modification. Attorney Docket No.: F2099-7045WO

[0190] In an embodiment, a TREM described herein comprises a 2’-M0E modification. In an embodiment, a TREM described herein comprises a 2’ -chloro modification.

[0191] Corresponding Nucleotide Positions

[0192] To determine if a selected nucleotide position in a candidate sequence corresponds to a selected position in a reference sequence (e.g., SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3), one or more of the following Evaluations is performed. Evaluation A:

[0193] 1.The candidate sequence is aligned with each of the consensus sequences in Table 5. The consensus sequence(s) having the most positions aligned (and which has at least 60% of the positions of the candidate sequence aligned) is selected.

[0194] The alignment is performed as follows. The candidate sequence and an isodecoder consensus sequence from Table 5 are aligned based on a global pairwise alignment calculated with the Needleman-Wunsch algorithm when run with match scores from Table 6, a mismatch penalty of -1, a gap opening penalty of -1, and a gap extension penalty of -0.5, and no penalty for end gaps. The alignment with the highest overall alignment score is then used to determine the percent similarity between the candidate and the consensus sequence by counting the number of matched positions in the alignment, dividing it by the larger of the number of non-N bases in the candidate sequence or the consensus sequence, and multiplying the result by 100. In cases where multiple alignments (of the candidate and a single consensus sequence) tie for the same score, the percent similarity is the largest percent similarity calculated from the tied alignments. This process is repeated for the candidate sequence with each of the remaining isodecoder consensus sequences in Table 5, and the alignment resulting in the greatest percent similarity is selected. If this alignment has a percent similarity equal to or greater than 60%, it is considered a valid alignment and used to relate positions in the candidate sequence to those in the consensus sequence, otherwise the candidate sequence is considered to have not aligned to any of the isodecoder consensus sequences. If there is a tie at this point, all tied consensus sequences are taken forward to step 2 in the analysis.

[0195] 2. Using the selected consensus sequence(s) from step 1, one determines the consensus sequence position number that aligns with the selected position (e.g., a modified position) in the candidate sequence. One then assigns the position number of the aligned position in the Attorney Docket No.: F2099-7045WO consensus sequence to the selected position in the candidate sequence, in other words, the selected position in the candidate sequence is numbered according to the numbering of the consensus sequence. If there were tied consensus sequences from step one, and they give different position numbers in this step 2, then all such position numbers are taken forward to step 5.

[0196] 3. The reference sequence is aligned with the consensus sequence chosen in step 1. The alignment is performed as described in step 1.

[0197] 4. From the alignment in step 3, one determines the consensus sequence position number that aligns with the selected position (e.g., a modified position) in the reference sequence. One then assigns the position number of the aligned position in the consensus sequence to the selected position in the reference sequence, in other words, the selected position in the reference sequence is numbered according to the numbering of the consensus sequence. If there is a tie at this point, all tied consensus sequences are taken forward to step 5 in the analysis.

[0198] 5. If a value for a position number determined for the reference sequence in step 2 is the same as the value for the position number determined for the candidate sequence in step 4, the positions are defined as corresponding.

[0199] Evaluation B:

[0200] The reference sequence (e.g., a TREM sequence described herein) and the candidate sequence are aligned with one another. The alignment is performed as follows.

[0201] The reference sequence and the candidate sequence are aligned based on a global pairwise alignment calculated with the Needleman-Wunsch algorithm when run with match scores from Table 6, a mismatch penalty of -1, a gap opening penalty of -1, and a gap extension penalty of -0.5, and no penalty for end gaps. The alignment with the highest overall alignment score is then used to determine the percent similarity between the candidate and reference sequence by counting the number of matched based in the alignment, dividing it by the larger of the number of non-N bases in the candidate or reference sequence, and multiplying the result by 100. In cases where multiple alignments tie for the same score, the percent similarity is the largest percent similarity calculated from the tied alignments. If this alignment has a percent similarity equal to or greater than 60%, it is considered a valid alignment and used to relate positions in the candidate sequence to those in the reference sequence, otherwise the candidate sequence is considered to have not aligned to the reference sequence. Attorney Docket No.: F2099-7045WO

[0202] If the selected nucleotide position in the reference sequence (e.g., a modified position) is paired with a selected nucleotide position (e.g., a modified position) in the candidate sequence, the positions are defined as corresponding.

[0203] Evaluation C:

[0204] The candidate sequence is assigned a nucleotide position number according to the comprehensive tRNA numbering system (CtNS), also referred to as the tRNAviz method e.g., as described in Lin et al., Nucleic Acids Research, 47:W1, pages W542-W547, 2 July 2019), which serves as a global numbering system for tRNA molecules. The alignment is performed as follows.

[0205] 1. The candidate sequence is assigned a nucleotide position according to the tRNAviz method. For a novel sequence not present in the tRNAviz database, the numbering for the sequence in the database with the highest sequence similarity to the novel sequence is obtained. For example, if a TREM differs at any given nucleotide position from a sequence in the database, the numbering for the tRNA having the wildtype sequence at said given nucleotide position is used.

[0206] 2. The reference sequence is assigned a nucleotide position according to the method described in 1.

[0207] 3. If a value for a position number determined for the reference sequence in step 1 is the same as the value for the position number determined for the candidate sequence in step 2, the positions are defined as corresponding.

[0208] If the selected position in the reference sequence and the candidate sequence are found to be corresponding in at least one of Evaluations A, B, and C, the positions correspond. For example, if two positions are found to be corresponding under Evaluation A, but do not correspond under Evaluation B or Evaluation C, the positions are defined as corresponding. Similarly, if two positions are found to be corresponding under Evaluation B, but do not correspond under Evaluation A or Evaluation C, the positions are defined as corresponding. In addition, if two positions are found to be corresponding under Evaluation C, but do not correspond under Evaluation A or Evaluation B, the positions are defined as corresponding

[0209] The numbering given above is used for ease of presentation and does not imply a required sequence. If more than one Evaluation is performed, they can be performed in any order. Attorney Docket No.: F2099-7045WO

[0210] Table 5. Consensus sequence computationally generated for each isodecoder by aligning members of the isodecoder family Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO

[0211] Table 6: Score values alignment

[0212] Premature termination codons (PTC) and ORFs comprising PTCs Mutations underlie many diseases. For example, a point mutation in the open reading frame (ORF) of a gene which creates a premature stop codon (PTC) can result in altered expression and / or activity of a polypeptide encoded by the gene. Table 7 provides single mutations in codons encoding amino acids which can result in a stop codon. In an embodiment, a PTC disclosed herein comprises a mutation disclosed in Table 7. In an embodiment, the codon having the first sequence or the PTC comprises a mutation disclosed in Table 7. In an embodiment, the non-mutated, e.g., wildtype, codon sequence of the codon having the first sequence or the PTC is an original codon sequence provided in Table 7 and the amino acid corresponding to the non-mutated codon is an original AA provided in Table 7. Attorney Docket No.: F2099-7045WO

[0213] In an embodiment, the TREM, TREM core fragment or TREM fragment recognizes a stop codon and mediates incorporation of the original AA provided in Table 7 at the position of the stop codon. In an embodiment, the TREM, TREM core fragment or TREM fragment recognizes a stop codon and mediates incorporation of an amino acid belonging to the same group as the original AA, e.g., as provided in Table 8. Other genetic abnormalities, such as insertions and / or deletions can also result in a PTC in an ORF.

[0214] Table 7. Select amino acids and stop codons

[0215] Table 8: Amino acids and amino acid groupings Attorney Docket No.: F2099-7045WO

[0216] Disclosed herein, inter alia, are endogenous ORFs comprising a codon having a first sequence, e.g., a mutation, e.g., a PTC. An ORF having a PTC, e.g., as described herein, can be present, or part of in any gene. As an example, the ORF can be present or be part of any gene in the human genome.

[0217] In an embodiment, a PTC disclosed herein is present in a gene disclosed in any one of Tables 9, 10, or 12. Exemplary genes having ORFs comprising a PTC are provided in Table 9.

[0218] Table 9: Exemplary genes with ORFs having a PTC Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO

[0219] Additional exemplary genes containing a PTC include FVIII, FIX, CFTR, MeCP2, NAGLU, DMD, GAA, RP1, RP2, ABCA4, PCDH15, REP1, GLA, MUT, TP53, and ATM. In an embodiment, the PTC is present within the FVIII gene and comprises an R mutation, e.g., an Attorney Docket No.: F2099-7045WO

[0220] R2228X mutation. In an embodiment, the PTC is present within the FIX gene and comprises an R mutation, e.g., an R29X mutation, an R116X mutation, an R248X mutation, an R252X mutation, an R333X mutation, and / or an R338X mutation. In an embodiment, the PTC is present within the CFTR gene and comprises an R mutation, e.g., an R553X mutation. In an embodiment, the PTC is present within the MeCP2 gene and comprises an R mutation, e.g., an R168X mutation. In an embodiment, the PTC is present within the NAGLU gene and comprises an R mutation, e.g., an R626X mutation. In an embodiment, the PTC is present within the DMD gene and comprises an R mutation, e.g., an R3881X mutation. In an embodiment, the PTC is present within the GAA gene and comprises an R mutation, e.g., an R854X mutation. In an embodiment, the PTC is present within the RP1 gene and comprises an R mutation, e.g., an R667X mutation. In an embodiment, the PTC is present within the RP2 gene and comprises an R mutation, e.g., an R120X mutation. In an embodiment, the PTC is present within the ABCA4 gene and comprises an R mutation, e.g., an R2030X mutation. In an embodiment, the PTC is present within the PCD gene and comprises an R mutation, e.g., an R245X mutation. In an embodiment, the PTC is present within the REP1 gene and comprises an R mutation, e.g., an R270X mutation. In an embodiment, the PTC is a mutation in the GLA gene, e.g., an R220X mutation and / or an R227X mutation. In an embodiment, the PTC is present within the MUT gene and comprises an R mutation, e.g., an R228X mutation, an R403X mutation, an R467X mutation, and / or an R727X mutation. In an embodiment, the PTC is present within the TP53 gene and comprises an R mutation, e.g., an R578X mutation. In an embodiment the PTC is present within the ATM gene and comprises an R mutation, e.g., an R35X mutation.

[0221] Diseases or disorders associated with a PTC

[0222] A TREM composition disclosed herein can be used treat a disorder or disease associated with a PTC, e.g., as described herein. Exemplary diseases or disorders associated with a PTC are listed in Tables 10, 11, and 12.

[0223] In an embodiment, the subject has a disease or disorder provided in any one of Tables 10- 12. In an embodiment, the cell is associated with, e.g., is obtained from a subject who has, a disorder or disease listed in any one of Tables 10-12.

[0224] For example, the disorder or disease can be chosen from the left column of Table 10. As another example, the disorder or disease is chosen from the left column of Table 10 and, in Attorney Docket No.: F2099-7045WO embodiments the PTC is in a gene chosen from the right column of Table 10, e.g., any one of the genes provided in the right column of Table 10. In some embodiments, the PTC is in a gene corresponding to the disorder or disease provided in the left column of Table 10. As a further non-limiting example, the PTC can be at a position provided in Table 10. As another example, the disorder or symptom is chosen from a disorder or disease provided in Table 11.

[0225] As yet another example, the disorder or symptom is chosen from a disorder or disease provided in Table 12. In an embodiment, the disorder or symptom is chosen from a disorder or disease provided in Table 12 and, in embodiments, the PTC is in any gene provided in Table 12. In an embodiment, the disorder or symptom is chosen from a disorder or disease provided in Table 12 and the PTC is in a corresponding gene provided in Table 12, e.g., a gene corresponding to the disease or disorder. In an embodiment, the disorder or symptom is chosen from a disorder or disease provided in Table 12 and the PTC is not in a gene provided in Table 12. In an embodiment of any of the methods disclosed herein, the PTC is at any position within the ORF of the gene, e.g., upstream of the naturally occurring stop codon.

[0226] Table 10: Exemplary diseases or disorders Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO

[0227] Table 11: Additional exemplary disorders Attorney Docket No.: F2099-7045WO

[0228] Table 12: Exemplary genes with ORFs comprising a PTC and exemplary disorders Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO

[0229] In an embodiment, the disease or disorder associated with a PTC is a lysosomal storage disease (e.g., Fabry disease, Gaucher disease, or Niemann-Pick disease). In some embodiments, the disease or disorder associated with a PTC is Fabry disease. In an embodiment, upon administration of a TREM e.g., a TREM described herein) to a cell or subject, the level of a GLA protein in the cell or subject is modulated, e.g., increased, by about 0.1%, 0.5%, 1%, 2%, 3%, 4% 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more, e.g., compared with a reference value (e.g., level of a GLA protein in a healthy, non-Fabry disease fibroblast).

[0230] In some embodiments, the disease or disorder associated with a PTC is a blood clotting disorder, e.g., Hemophilia B. In an embodiment, upon administration of a TREM (e.g., a TREM described herein) to a cell or subject, the level of a Factor IX (FIX) protein in the cell or subject is modulated, e.g., increased, by about 0.1%, 0.5%, 1%, 2%, 3%, 4% 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more, e.g., compared with a reference value (e.g., level of a FIX protein in a healthy, non-disease cell).

[0231] In some embodiments, the disease or disorder associated with a PTC is an autosomal recessive disorder, such as neuronal ceroid lipofuscinosis type 2 (CNL2). In an embodiment, upon administration of a TREM (e.g., a TREM described herein) to a cell or subject, the level of a tripeptidyl peptidase 1 (TPP1) protein in the cell or subject is modulated, e.g., increased, by about 0.1%, 0.5%, 1%, 2%, 3%, 4% 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more, e.g., compared with a reference value (e.g., level of a TPP1 protein in a healthy, non-disease cell).

[0232] In some embodiments, the disease or disorder associated with a PTC is a disease or disorder associated with hearing loss, such as Usher syndrome (e.g., Usher syndrome type IF). In an embodiment, upon administration of a TREM (e.g., a TREM described herein) to a cell or subject, the level of a protocadherin 15 precursor (PCDH15) protein in the cell or subject is modulated, e.g., increased, by about 0.1%, 0.5%, 1%, 2%, 3%, 4% 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, Attorney Docket No.: F2099-7045WO

[0233] 95%, or more, e.g, compared with a reference value (e.g., level of a PCDH15 protein in a healthy, non-disease cell).

[0234] In an embodiment, the disease or disorder associated with a PTC is a proliferative disease, such as a benign neoplasm or a cancer. In an embodiment, the proliferative disease is associated with a benign neoplasm. For example, a benign neoplasm may include adenoma, fibroma, hemangioma, tuberous sclerosis, and lipoma. All types of benign neoplasms disclosed herein or known in the art are contemplated as being within the scope of the disclosure.

[0235] In an embodiment, the proliferative disease is a cancer. As used herein, the term “cancer” refers to a malignant neoplasm (Stedman’s Medical Dictionary, 25th ed.; Hensyl ed.; Williams & Wilkins: Philadelphia, 1990). All types of cancers disclosed herein or known in the art are contemplated as being within the scope of the disclosure. Exemplary cancers include, but are not limited to, acoustic neuroma; adenocarcinoma; adrenal gland cancer; anal cancer; angiosarcoma (e.g., lymphangiosarcoma, lymphangioendotheliosarcoma, hemangiosarcoma); appendix cancer; benign monoclonal gammopathy; biliary cancer (e.g., cholangiocarcinoma); bladder cancer; breast cancer (e.g., adenocarcinoma of the breast, papillary carcinoma of the breast, mammary cancer, medullary carcinoma of the breast); brain cancer (e.g., meningioma, glioblastomas, glioma (e.g., astrocytoma, oligodendroglioma), medulloblastoma); bronchus cancer; carcinoid tumor; cervical cancer (e.g., cervical adenocarcinoma); choriocarcinoma; chordoma; craniopharyngioma; colorectal cancer (e.g., colon cancer, rectal cancer, colorectal adenocarcinoma); connective tissue cancer; epithelial carcinoma; ependymoma; endotheliosarcoma (e.g., Kaposi’s sarcoma, multiple idiopathic hemorrhagic sarcoma); endometrial cancer (e.g., uterine cancer, uterine sarcoma); esophageal cancer (e.g., adenocarcinoma of the esophagus, Barrett’s adenocarcinoma); Ewing’s sarcoma; eye cancer (e.g., intraocular melanoma, retinoblastoma); familiar hypereosinophilia; gall bladder cancer; gastric cancer (e.g., stomach adenocarcinoma); gastrointestinal stromal tumor (GIST); germ cell cancer; head and neck cancer (e.g., head and neck squamous cell carcinoma, oral cancer (e.g., oral squamous cell carcinoma), throat cancer (e.g., laryngeal cancer, pharyngeal cancer, nasopharyngeal cancer, oropharyngeal cancer), e.g., adenoid cystic carcinoma (ACC)); hematopoietic cancers (e.g., leukemia such as acute lymphocytic leukemia (ALL) (e.g., B-cell ALL, T-cell ALL), acute myelocytic leukemia (AML) (e.g., B-cell AML, T-cell AML), chronic myelocytic leukemia (CML) (e.g., B-cell CML, T-cell CML), and chronic lymphocytic leukemia Attorney Docket No.: F2099-7045WO

[0236] (CLL) (e.g., B-cell CLL, T-cell CLL)); lymphoma such as Hodgkin lymphoma (HL) (e.g., B-cell HL, T-cell HL) and non-Hodgkin lymphoma (NHL) (e.g., B-cell NHL such as diffuse large cell lymphoma (DLCL) (e.g., diffuse large B-cell lymphoma), follicular lymphoma, chronic lymphocytic leukemia / small lymphocytic lymphoma (CLL / SLL), mantle cell lymphoma (MCL), marginal zone B-cell lymphomas (e.g., mucosa-associated lymphoid tissue (MALT) lymphomas, nodal marginal zone B-cell lymphoma, splenic marginal zone B-cell lymphoma), primary mediastinal B-cell lymphoma, Burkitt lymphoma, lymphoplasmacytic lymphoma (i.e., Waldenstrom’s macroglobulinemia), hairy cell leukemia (HCL), immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma and primary central nervous system (CNS) lymphoma; and T-cell NHL such as precursor T-lymphoblastic lymphoma / leukemia, peripheral T-cell lymphoma (PTCL) (e.g., cutaneous T-cell lymphoma (CTCL) (e.g., mycosis fungoides, Sezary syndrome), angioimmunoblastic T-cell lymphoma, extranodal natural killer T-cell lymphoma, enteropathy type T-cell lymphoma, subcutaneous panniculitis-like T-cell lymphoma, and anaplastic large cell lymphoma); a mixture of one or more leukemia / lymphoma as described above; and multiple myeloma (MM)), heavy chain disease (e.g., alpha chain disease, gamma chain disease, mu chain disease); hemangioblastoma; hypopharynx cancer; inflammatory myofibroblastic tumors; immunocytic amyloidosis; kidney cancer (e.g., nephroblastoma a.k.a. Wilms’ tumor, renal cell carcinoma); liver cancer (e.g., hepatocellular cancer (HCC), malignant hepatoma); lung cancer (e.g., bronchogenic carcinoma, small cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), adenocarcinoma of the lung); leiomyosarcoma (LMS); mastocytosis (e.g., systemic mastocytosis); muscle cancer; myelodysplastic syndrome (MDS); mesothelioma; myeloproliferative disorder (MPD) (e.g., polycythemia vera (PV), essential thrombocytosis (ET), agnogenic myeloid metaplasia (AMM) a.k.a. myelofibrosis (MF), chronic idiopathic myelofibrosis, chronic myelocytic leukemia (CML), chronic neutrophilic leukemia (CNL), hypereosinophilic syndrome (HES)); neuroblastoma; neurofibroma (e.g., neurofibromatosis (NF) type 1 or type 2, schwannomatosis); neuroendocrine cancer (e.g., gastroenteropancreatic neuroendocrine tumor (GEP-NET), carcinoid tumor); osteosarcoma (e.g., bone cancer); ovarian cancer (e.g., cystadenocarcinoma, ovarian embryonal carcinoma, ovarian adenocarcinoma); papillary adenocarcinoma; pancreatic cancer (e.g., pancreatic adenocarcinoma, intraductal papillary mucinous neoplasm (IPMN), Islet cell tumors); penile cancer (e.g., Paget’s disease of the penis and scrotum); pinealoma; primitive neuroectodermal tumor (PNT); plasma cell Attorney Docket No.: F2099-7045WO neoplasia; paraneoplastic syndromes; intraepithelial neoplasms; prostate cancer (e.g, prostate adenocarcinoma); rectal cancer; rhabdomyosarcoma; salivary gland cancer; skin cancer (e.g., squamous cell carcinoma (SCC), keratoacanthoma (KA), melanoma, basal cell carcinoma (BCC)); small bowel cancer (e.g., appendix cancer); soft tissue sarcoma (e.g., malignant fibrous histiocytoma (MFH), liposarcoma, malignant peripheral nerve sheath tumor (MPNST), chondrosarcoma, fibrosarcoma, myxosarcoma); sebaceous gland carcinoma; small intestine cancer; sweat gland carcinoma; synovioma; testicular cancer (e.g., seminoma, testicular embryonal carcinoma); thyroid cancer (e.g., papillary carcinoma of the thyroid, papillary thyroid carcinoma (PTC), medullary thyroid cancer); urethral cancer; vaginal cancer; and vulvar cancer (e.g., Paget’s disease of the vulva). In some embodiments, the cancer is a solid tumor, such as a sarcoma or a carcinoma (e.g., lung cancer, brain cancer, breast cancer, bladder cancer, prostate cancer, colon cancer, rectal cancer).

[0237] In another aspect, the present disclosure features methods of treating a disease or disorder in a cell or subject by administration of a TREM (e.g., a TREM described herein) to the cell or subject. Exemplary diseases or disorders include hemophilias, aminoacidopathies, metal storage disorders, peroxisome biogenesis disorder, progressive rare lung disease, diseases related to lipid metabolism, diseases related to galactose metabolism, systemic organic acidemias, urea cycle disorders, cholestastis disorders, bilirubin metabolism disorders, lysososomal storage disorders, glycogen storage diseases, and oxalate metabolism disorders. In an embodiment, the disease or disorder is a hemophilia, e.g., hemophilia A or hemophilia B. In an embodiment, the disease or disorder is an aminoacidopathy, e.g., tyrosinemia type 1, tyrosinemia type 2, tyrosinemia type 3, maple syrup urine disease, alkaptonuria, or phenylketonuria. In an embodiment, the disease or disorder is a systemic organic acidemia, e.g., methylmalonic acidemia (MMUT), methylmalonic acidemia (non-MMUT), propionic acidemia type A, propionic acidemia type B, or isovaleric acidemia. In an embodiment, the disease or disorder is a urea cycle disorder, e.g, argininosuccinate lyase deficiency, argininosuccinate lyase deficiency-D, citrullinemia type 1, citrullinemia type 2, carbamoyl phosphate synthetase-D, ornithine transcarbamylase, arginemia, or hyperomithinemia-hyperammonemia-homocitrullinuria (HHH) syndrome. In an embodiment, the disease or disorder is lysosomal storage disorder, e.g., mucopolysaccharidosis 1, mucopolysaccharidosis 2, Fabry disease, lysosomal acid lipase deficiency, Pompe disease, Gaucher disease, Niemann Pick A, or Niemann Pick B. In an embodiment, the disease or Attorney Docket No.: F2099-7045WO disorder is a bilirubin metabolism disorder, e.g., Crigler-Najjar syndrome. In an embodiment, the disease or disorder is a cholestastis disorder, e.g., progressive familial intrahepatic cholestasis (PFIC) type 1, PFIC type 2, or PFIC type 3. In an embodiment, the disease or disorder is a disease related to lipid metabolism, e.g., sitosterolemia (ABCG5) or sitosterolemia (ABCG8). In an embodiment, the disease or disorder is a glycogen storage disease, e.g., glycogen storage disease la, glycogen storage disease lb, or glycogen storage disease 3a. In an embodiment, the disease or disorder is a metal storage disorder, e.g., Wilson disease or hereditary hemochromatosis. In an embodiment, the disease or disorder is a progressive rare lung disease, e.g., alpha- 1 antitrypsin deficiency. In an embodiment, the disease or disorder is a peroxisome biogenesis disorder, e.g., PBD RCDP1. In an embodiment, the disease or disorder is an oxalate metabolism disorder, e.g, primary hyperoxaluria type 1, primary hyperoxaluria type 2, or primary hyperoxaluria type 3. In an embodiment, the disease or disorder is a congenital disorder related to Notch signaling, e.g., Alagille syndrome. In an embodiment, the disease or disorder is an amyloidosis, e.g., familial amyloid polyneuropathy. In an embodiment, the disease or disorder is a neurodevelopment disorder, e.g., Rett syndrome, atypical Rett syndrome, Smith-Magenis syndrome. In an embodiment, the disease or disorder is a muscular dystrophy, e.g., Duchenne muscular dystrophy, congenital muscular dystrophy, Limb-girdle muscular dystrophy.

[0238] In one aspect, the present disclosure features a method of treating a disease or disorder in a subject, the method comprising administering to the subject a TREM comprising the nucleotide sequence of any one of the TREMs described herein. In an embodiment, the disease or disorder is selected from a hemophilia, aminoacidopathy, metal storage disorder, peroxisome biogenesis disorder, progressive rare lung disease, disease related to lipid metabolism, disease related to galactose metabolism, systemic organic acidemia, urea cycle disorder, cholestastis disorder, bilirubin metabolism disorder, lysososomal storage disorder, glycogen storage disease, and oxalate metabolism disorder. In an embodiment, the TREM comprises the sequence of any one of SEQ ID NO: 1 or 2, or a fragment or variant thereof.

[0239] A TREM described herein may read-through a premature termination codon (PTC) in the open reading frame of a gene, resulting in an increase in levels of the protein encoded by gene, e.g., a full-length protein, e.g., a functional protein. For example, a TREM having the sequence of SEQ ID NO: 2 or SEQ ID NO: 3 may increase production of a full-length protein comprising a PTC. Attorney Docket No.: F2099-7045WO

[0240] In an embodiment, a TREM, e.g., SEQ ID NO: 2 or SEQ ID NO: 3, can increase production of a full-length protein encoded by an ORF comprising a PTC, e.g., a full-length p53 protein encoded by an ORF comprising a PTC. In an embodiment, a TREM, e.g., SEQ ID NO: 2, can increase production of full-length p53 relative to full-length p53 levels present in the absence of the TREM, e.g., SEQ ID NO: 2, as shown in FIG. 1A. In an embodiment, a TREM, e.g., SEQ ID NO: 3, can increase production of full-length p53 to be about 0.25, about 0.5, or about 2 relative to wildtype p53 levels, e.g., as shown in FIG. IB. In an embodiment, a TREM, e.g., SEQ ID NO: 2, can increase production of full-length p53 to be about 0.25, about 2, about 4, about 6, or about 6.5 relative to wildtype p53 levels, e.g., as shown in FIG. IB.

[0241] In an embodiment, the increase in production of a full-length protein encoded by an ORF comprising a PTC results in an increase in levels of a downstream target of the protein encoded by an ORF comprising the PTC, e.g., increases levels of a functional full-length protein encoded by an ORF comprising a PTC. For example, an increase in levels of full-length p53 by a TREM, e.g., SEQ ID NO: 2 or SEQ ID NO: 3, may result in an increase in levels of the downstream target of p53, e.g., p21. In an embodiment, a TREM, e.g., SEQ ID NO: 2, can increase levels of p21 relative to p21 levels in the absence of the TREM, e.g., as shown in FIG. 1C. In an embodiment, a TREM, e.g., SEQ ID NO: 3, can increase levels of p21 to be about 1 or about 4 relative to wildtype p21 levels, e.g., as shown in FIG. ID. In an embodiment, a TREM, e.g., SEQ ID NO: 2, can increase levels of p21 to be about 1, about 2.5, about 9, or about 12.5 relative to wildtype p21 levels, e.g., as shown in FIG. ID.

[0242] In an embodiment, a TREM, e.g., SEQ ID NO: 2 or SEQ ID NO: 3, can increase production of a full-length protein encoded by an ORF comprising a PTC, e.g., a full-length phenylalanine hydroxylate (PAH) protein encoded by an ORF comprising a PTC. In an embodiment, a TREM, e.g., SEQ ID NO: 2, can increase production of full-length PAH relative to full-length PAH levels in the absence of the TREM, e.g., SEQ ID NO: 2, as shown in FIG. 2A. In an embodiment, a TREM, e.g., SEQ ID NO: 3, can increase production of full-length PAH to be about 2.5 or about 7.5 relative to wildtype PAH levels, e.g., as shown in FIG. 2B. In an embodiment, a TREM, e.g., SEQ ID NO: 2, can increase production of full-length PAH to be about 2, about 4, about 9, about 19, or about 20 relative to wildtype PAH levels, e.g., as shown in FIG. 2B. Attorney Docket No.: F2099-7045WO

[0243] In an embodiment, a TREM, e.g., SEQ ID NO: 2 or SEQ ID NO: 3, can increase production of a full-length protein encoded by an ORF comprising a PTC, e.g., a full-length methyl malonyl CoA mutase (MMUT) protein encoded by an ORF comprising a PTC. In an embodiment, a TREM, e.g., SEQ ID NO: 3, can increase production of full-length MMUT relative to full-length MMUT levels in the absence of the TREM, e.g., SEQ ID NO: 3, as shown in FIG. 3 A. In an embodiment, a TREM, e.g., SEQ ID NO: 2, can increase production of full- length MMUT relative to full-length MMUT levels in the absence of the TREM, e.g., SEQ ID NO: 2, as shown in FIGs. 3 A and 3C. In an embodiment, a TREM, e.g., SEQ ID NO: 2, can increase production of full-length MMUT to be about 0.25%, about 0.3%, about 0.5%, about 1%, about 1.5%, about 2.5%, about 3%, or about 3.5% relative to wildtype MMUT levels, e.g., as shown in FIG. 3B. In an embodiment, a TREM, e.g., SEQ ID NO: 2, can increase production of full-length MMUT to be about 1.5% or about 3% relative to full-length MMUT levels in the absence of the TREM, e.g., SEQ ID NO: 2, e.g., as shown in FIG. 3C.

[0244] In an embodiment, the increase in production of a full-length protein encoded by an ORF comprising a PTC results in a decrease in levels of a metabolite of the protein encoded by an ORF comprising the PTC, e.g., increases levels of a functional full-length protein encoded by an ORF comprising a PTC. For example, an increase in levels of full-length MMUT by a TREM, e.g., SEQ ID NO: 2 or SEQ ID NO: 3, may result in a decrease in levels of a metabolite of MMUT, e.g., methylmalonic acid (MMA). In an embodiment, a TREM, e.g., SEQ ID NO: 2, can decrease levels of MMA to be about 50% or about 60% relative to MMA levels in the absence of the TREM, e.g., SEQ ID NO: 2, e.g., as shown in FIG. 3C.

[0245] In an embodiment, a TREM, e.g., SEQ ID NO: 2 or SEQ ID NO: 3, delivered to a subject in a lipid nanoparticle (LNP) can be detected in the liver of the subject. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in an LNP to a subject results in about 4xl0'14mol / mg of TREM, e.g., SEQ ID NO: 3, in the liver of the subject after 96 hours, e.g., as shown in FIG. 4A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject results in about 8xl0'14mol / mg of TREM, e.g., SEQ ID NO: 2, in the liver of the subject after 96 hours, e.g., as shown in FIG. 4A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject results in about 2xl0’14mol / mg of TREM, e.g., SEQ ID NO: 2, in the liver of the subject after 336 hours, e.g., as shown in FIG. 4 A. Attorney Docket No.: F2099-7045WO

[0246] In an embodiment, a TREM, e.g., SEQ ID NO: 2 or SEQ ID NO: 3, delivered to a subject in a lipid nanoparticle (LNP) can increase levels of full-length messenger RNA (mRNA) transcribed from an ORF comprising a PTC, e.g., full-length methyl malonyl CoA mutase (MMUT) mRNA encoded by an ORF comprising a PTC. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in an LNP to a subject having an MMUT ORF comprising a PTC can increase full-length MMUT mRNA levels relative to full-length MMUT mRNA levels in the absence of the TREM after 96 hours, e.g., as shown in FIG. 5. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC can increase full-length MMUT mRNA levels relative to full-length MMUT mRNA levels in the absence of the TREM after 96 or 336 hours, e.g., as shown in FIG. 5. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC can increase full-length MMUT mRNA levels to be about 1.5 times greater than full-length MMUT mRNA levels resulting from delivery of a different TREM, e.g., SEQ ID NO: 3, e.g., as shown in FIG. 5. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC can increase full-length MMUT mRNA levels to be about 3 times greater than full-length MMUT mRNA levels resulting from delivery of a different TREM, e.g., SEQ ID NO: 3, e.g., as shown in FIG. 5.

[0247] In an embodiment, a TREM, e.g., SEQ ID NO: 2 or SEQ ID NO: 3, delivered to a subject in a lipid nanoparticle (LNP) can increase levels of a full-length protein encoded by an ORF comprising a PTC, e.g., full-length methyl malonyl CoA mutase (MMUT) encoded by an ORF comprising a PTC. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in an LNP to a subject having an MMUT ORF comprising a PTC can increase full-length MMUT levels relative to full-length MMUT levels in the absence of the TREM after 96 hours, e.g., as shown in FIG. 6. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC can increase full-length MMUT levels relative to full-length MMUT levels in the absence of the TREM after 96 or 336 hours, e.g., as shown in FIG. 6. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC can increase full-length MMUT levels to be about equal to full-length MMUT levels resulting from delivery of a different TREM, e.g., SEQ ID NO: 3, e.g., as shown in FIG. 6. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC can increase full-length MMUT levels to be about 7 Attorney Docket No.: F2099-7045WO times greater than full-length MMUT levels resulting from delivery of a different TREM, e.g., SEQ ID NO: 3, e.g., as shown in FIG. 6.

[0248] In an embodiment, a TREM, e.g., SEQ ID NO: 2 or SEQ ID NO: 3, delivered to a subject in a lipid nanoparticle (LNP) can increase ribosome occupancy on full-length mRNA encoded by an ORF comprising a PTC, e.g., increase ribosome occupancy on full-length methyl malonyl CoA mutase (MMUT) mRNA encoded by an ORF comprising a PTC. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in an LNP to a subject having an MMUT ORF comprising a PTC can increase ribosome occupancy on full-length MMUT mRNA relative to ribosome occupancy on full-length MMUT mRNA in the absence of the TREM after 96 hours, e.g., as shown in FIG. 7. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC can increase ribosome occupancy on full- length MMUT mRNA relative to ribosome occupancy on full-length MMUT mRNA in the absence of the TREM after 96 or 336 hours, e.g., as shown in FIG. 7. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in an LNP to a subject having an MMUT ORF comprising a PTC can increase ribosome occupancy on full-length MMUT mRNA to be about 20 RPKM after 96 hours, e.g., as shown in FIG. 7. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC can increase ribosome occupancy on full-length MMUT mRNA to be about 70 RPKM after 96 hours, e.g., as shown in FIG. 7. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC can increase ribosome occupancy on full-length MMUT mRNA to be about 20 RPKM after 336 hours, e.g., as shown in FIG. 7.

[0249] In an embodiment, the ratio of ionizable lipid, e.g., cationic lipid, to RNA phosphate (N / P ratio) of an LNP can modulate the activity of a TREM delivered to a subject in the LNP. For example, the levels of full-length mRNA encoded by an ORF comprising a PTC, e.g., full-length methyl malonyl CoA mutase (MMUT) mRNA encoded by an ORF comprising a PTC, can be modulated by the N / P ratio of an LNP comprising the TREM. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP having an N / P ratio of 6 to a subject having an MMUT ORF comprising a PTC can result in full-length MMUT mRNA levels about 2 times greater than full-length MMUT mRNA levels resulting from delivery of a different TREM, e.g., SEQ ID NO: 3, e.g., as shown in FIG. 8. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP having an N / P ratio of 6 to a subject having an MMUT ORF comprising a PTC can result in Attorney Docket No.: F2099-7045WO full-length MMUT mRNA levels about equal to full-length MMUT mRNA levels resulting from delivery of a different TREM, e.g., SEQ ID NO: 3, e.g., as shown in FIG. 8. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP having an N / P ratio of 3 to a subject having an MMUT ORF comprising a PTC can result in full-length MMUT mRNA levels about 1.3 times greater than full-length MMUT mRNA levels resulting from delivery of a different TREM, e.g., SEQ ID NO: 3, e.g., as shown in FIG. 8. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP having an N / P ratio of 3 to a subject having an MMUT ORF comprising a PTC can result in full-length MMUT mRNA levels about equal to full-length MMUT mRNA levels resulting from delivery of a different TREM, e.g., SEQ ID NO: 3, e.g., as shown in FIG. 8.

[0250] In an embodiment, the ratio of ionizable lipid, e.g., cationic lipid, to RNA phosphate (N / P ratio) of an LNP comprising a TREM does not affect the levels of the TREM in the liver of a subject following delivery of the TREM in the LNP to the subject. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in LNP1 having an N / P ratio of 3 can result in TREM levels of about 0.8 to about 10 pg / g in the liver of the subject, e.g., as shown in FIG. 9. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in LNP1 having an N / P ratio of 4.5 can result in TREM levels of about 2 to about 80 pg / g in the liver of the subject, e.g., as shown in FIG. 9. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in LNP2 having an N / P ratio of 3 can result in TREM levels of about 1 to about 70 pg / g in the liver of the subject, e.g., as shown in FIG. 9. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in LNP2 having an N / P ratio of 4.5 can result in TREM levels of about 0.5 to about 10 pg / g in the liver of the subject, e.g., as shown in FIG. 9. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in LNP2 having an N / P ratio of 6 can result in TREM levels of about 2 to about 20 pg / g in the liver of the subject, e.g., as shown in FIG. 9.

[0251] In an embodiment, the ratio of ionizable lipid, e.g., cationic lipid, to RNA phosphate (N / P ratio) of an LNP comprising a TREM does not affect the total amount of TREM in the liver of a subject over time, e.g., the area under the curve (AUC) of the amount of TREM over time, following delivery of the TREM in an LNP to the subject. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in LNP1 having an N / P ratio of 3 can result in an AUC of TREM from 0-72 hours in the liver of a subject of about 220 hr*pg / g, e.g., as shown in FIG. 10. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in LNP1 having an N / P ratio of 4.5 can result in an AUC of TREM from 0-72 hours in the liver of a subject of about 360 hr* pg / g, e.g., Attorney Docket No.: F2099-7045WO as shown in FIG. 10. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in LNP2 having an N / P ratio of 3 can result in an AUC of TREM from 0-72 hours in the liver of a subject of about 210 hr*pg / g, e.g., as shown in FIG. 10. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in LNP2 having an N / P ratio of 4.5 can result in an AUC of TREM from 0-72 hours in the liver of a subject of about 100 hr*pg / g, e.g., as shown in FIG. 10. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in LNP2 having an N / P ratio of 6 can result in an AUC of TREM from 0-72 hours in the liver of a subject of about 230 hr*pg / g, e.g., as shown in FIG. 10.

[0252] In an embodiment, a TREM, e.g., SEQ ID NO: 2, delivered to a subject in a lipid nanoparticle (LNP) increases levels of a protein encoded by an ORF comprising a PTC, e.g., phenylalanine hydroxylase (PAH) encoded by an ORF comprising a PTC. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having a PAH ORF comprising a PTC increases PAH levels relative to PAH levels in the absence of the TREM after 24-240 hours, e.g., as shown in FIG. 15 A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having a PAH ORF comprising a PTC at a dose of 1 mg / kg increases PAH levels to about 1%, e.g., relative to wildtype levels, e.g., after 24 hours, e.g., as shown in FIG. 15A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having a PAH ORF comprising a PTC at a dose of 3 mg / kg increases PAH levels to about 1%, e.g., relative to wildtype levels, e.g., after 72 hours, e.g., as shown in FIG. 15A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having a PAH ORF comprising a PTC at a dose of 3 mg / kg increases PAH levels to about 5%, e.g., relative to wildtype levels, e.g., after 24 hours, e.g., as shown in FIG. 15 A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having a PAH ORF comprising a PTC at a dose of 3 mg / kg increases PAH levels to about 4%, e.g., relative to wildtype levels, e.g., after 72 hours, e.g., as shown in FIG. 15A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having a PAH ORF comprising a PTC at a dose of 3 mg / kg increases PAH levels to about 2.5%, e.g., relative to wildtype levels, e.g., after 96 hours, e.g., as shown in FIG. 15A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having a PAH ORF comprising a PTC at a dose of 3 mg / kg increases PAH levels to about 1.5%, e.g., relative to wildtype levels, e.g., after 168 hours, e.g., as shown in FIG. 15 A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having a PAH Attorney Docket No.: F2099-7045WO

[0253] ORF comprising a PTC at a dose of 10 mg / kg increases PAH levels to about 5%, e.g., relative to wildtype levels, e.g., after 24 hours, e.g., as shown in FIG. 15 A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having a PAH ORF comprising a PTC at a dose of 10 mg / kg increases PAH levels to about 7.5%, e.g., relative to wildtype levels, e.g., after 72 hours, e.g., as shown in FIG. 15 A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having a PAH ORF comprising a PTC at a dose of 10 mg / kg increases PAH levels to about 6%, e.g., relative to wildtype levels, e.g., after 96 hours, e.g., as shown in FIG. 15 A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having a PAH ORF comprising a PTC at a dose of 10 mg / kg increases PAH levels to about 4%, e.g., relative to wildtype levels, e.g., after 168 hours, e.g., as shown in FIG. 15 A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having a PAH ORF comprising a PTC at a dose of 10 mg / kg increases PAH levels to about 3%, e.g., relative to wildtype levels, e.g., after 240 hours, e.g., as shown in FIG. 15 A.

[0254] In an embodiment, a TREM, e.g., SEQ ID NO: 2, delivered to a subject having phenylketonuria (PKU) in a lipid nanoparticle (LNP) decreases plasma phenylalanine levels. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU decreases plasma phenylalanine levels after 8-240 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 1 mg / kg decreases plasma phenylalanine levels to about 1,500 pM, e.g., after 8 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 1 mg / kg decreases plasma phenylalanine levels to about 1,700 pM, e.g., after 24 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 1 mg / kg decreases plasma phenylalanine levels to about 1,800 pM, e.g., after 72 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 3 mg / kg decreases plasma phenylalanine levels to about 1,400 pM, e.g., after 8 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 3 mg / kg decreases plasma phenylalanine levels to about 700 pM, e.g., after 24 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 3 mg / kg decreases plasma phenylalanine levels to about 600 pM, e.g., after 48 hours, e.g., as shown in FIG. 15B. In Attorney Docket No.: F2099-7045WO an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 3 mg / kg decreases plasma phenylalanine levels to about 500 pM, e.g., after 72 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 3 mg / kg decreases plasma phenylalanine levels to about 900 pM, e.g., after 96 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 3 mg / kg decreases plasma phenylalanine levels to about 1,800 pM, e.g., after 168 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 10 mg / kg decreases plasma phenylalanine levels to about 1,700 pM, e.g., after 8 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 10 mg / kg decreases plasma phenylalanine levels to about 1,000 pM, e.g., after 24 hours, e.g., as shown in FIG. 1 B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 10 mg / kg decreases plasma phenylalanine levels to about 300 pM, e.g., after 72 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 10 mg / kg decreases plasma phenylalanine levels to about 150 pM, e.g., after 96 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 10 mg / kg decreases plasma phenylalanine levels to about 800 pM, e.g., after 168 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 10 mg / kg decreases plasma phenylalanine levels to about 1,200 pM, e.g., after 240 hours, e.g., as shown in FIG. 15B.

[0255] In an embodiment, a TREM, e.g., SEQ ID NO: 2, delivered to a subject in a lipid nanoparticle (LNP) increases levels of a protein encoded by an ORF comprising a PTC, e.g., methyl malonyl CoA mutase (MMUT) encoded by an ORF comprising a PTC. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC increases MMUT levels relative to MMUT levels in the absence of the TREM after 4-21 days, e.g., as shown in FIG. 16 A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 1 mg / kg increases MMUT levels to about 5%, e.g., relative to wildtype levels, e.g., after 4 days, e.g., as shown in FIG. 16A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an Attorney Docket No.: F2099-7045WO

[0256] LNP to a subject having an MMUT ORF comprising a PTC at a dose of 3 mg / kg increases MMUT levels to about 37%, e.g., relative to wildtype levels, e.g., after 4 days, e.g., as shown in FIG. 16A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 3 mg / kg increases MMUT levels to about 8%, e.g., relative to wildtype levels, e.g., after 14 days, e.g., as shown in FIG. 16A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 10 mg / kg increases MMUT levels to about 35%, e.g., relative to wildtype levels, e.g., after 4 days, e.g., as shown in FIG. 16A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 10 mg / kg increases MMUT levels to about 25%, e.g., relative to wildtype levels, e.g., after 14 days, e.g., as shown in FIG. 16A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 10 mg / kg increases MMUT levels to about 5%, e.g., relative to wildtype levels, e.g., after 21 days, e.g., as shown in FIG. 16A.

[0257] In an embodiment, a TREM, e.g., SEQ ID NO: 2, delivered to a subject in a lipid nanoparticle (LNP) increases ribosome occupancy on mRNA encoded by an ORF comprising a PTC, e.g., increase ribosome occupancy on methyl malonyl CoA mutase (MMUT) mRNA encoded by an ORF comprising a PTC. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC increases ribosome occupancy on full-length MMUT mRNA relative to ribosome occupancy on MMUT mRNA in the absence of the TREM after 1 to 28 days, e.g., as shown in FIG. 16B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 3 mg / kg increases ribosome occupancy on MMUT mRNA to about 125 RPKM, e.g., after 1 day, e.g., as shown in FIG. 16B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 3 mg / kg increases ribosome occupancy on MMUT mRNA to about 85 RPKM, e.g., after 2 days, e.g., as shown in FIG. 16B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 3 mg / kg increases ribosome occupancy on MMUT mRNA to about 80 RPKM, e.g., after 4 days, e.g., as shown in FIG. 16B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 3 mg / kg increases ribosome Attorney Docket No.: F2099-7045WO occupancy on MMUT mRNA to about 25 RPKM, e.g., after 14 days, e.g., as shown in FIG. 16B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 3 mg / kg increases ribosome occupancy on MMUT mRNA to about 10 RPKM, e.g., after 21 days, e.g., as shown in FIG. 16B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 10 mg / kg increases ribosome occupancy on MMUT mRNA to about 90 RPKM, e.g., after 1 day, e.g., as shown in FIG. 16B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 10 mg / kg increases ribosome occupancy on MMUT mRNA to about 80 RPKM, e.g., after 2 days, e.g., as shown in FIG. 16B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 10 mg / kg increases ribosome occupancy on MMUT mRNA to about 95 RPKM, e.g., after 4 days, e.g., as shown in FIG. 16B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 10 mg / kg increases ribosome occupancy on MMUT mRNA to about 30 RPKM, e.g,. after 14 days, e.g., as shown in FIG. 16B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 10 mg / kg increases ribosome occupancy on MMUT mRNA to about 10 RPKM, e.g., after 21 days, e.g., as shown in FIG. 16B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 10 mg / kg increases ribosome occupancy on MMUT mRNA to about 5 RPKM, e.g., after 28 days, e.g., as shown in FIG. 16B.

[0258] In one aspect, a TREM has pharmacokinetic characteristics, e.g., plasma concentration, liver concentration, half-life, or area under the curve (AUC), upon administration to a subject. In an embodiment, the TREM has a plasma concentration between about 0.1 pg / mL and about 1 pg / mL, e.g., at 0.25 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18A. In an embodiment, the TREM has a plasma concentration between about 0.1 pg / mL and about 1 pg / mL, e.g., at 0.5 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18A. In an embodiment, the TREM has a plasma concentration between about 0.1 pg / mL and about 1 pg / mL, e.g., at 1 hour post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18 A. In an embodiment, the TREM has a plasma concentration between about 0.01 pg / mL and about 0.1 pg / mL, e.g., at 4 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18 A. In an Attorney Docket No.: F2099-7045WO embodiment, the TREM has a plasma concentration between about 0.01 pg / mL and about 0.1 pg / mL, e.g., at 6 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18 A. In an embodiment, the TREM has a plasma concentration between about 0.001 pg / mL and about 0.01 pg / mL, e.g., at 24 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18 A. In an embodiment, the TREM has a plasma concentration between about 0.001 pg / mL and about 0.01 pg / mL, e.g., at 48 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18 A. In an embodiment, the TREM has a plasma concentration between about 0.0001 pg / mL and about 0.001 pg / mL, e.g., at 72 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18A. In an embodiment, the TREM has a total liver concentration between about 1 pg / g and about 10 pg / g, e.g., at 1 hour post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18B. In an embodiment, the TREM has a total liver concentration between about 1 pg / g and about 10 pg / g, e.g., at 4 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18B. In an embodiment, the TREM has a total liver concentration between about 1 pg / g and about 10 pg / g, e.g., at 24 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18B. In an embodiment, the TREM has a total liver concentration between about 1 pg / g and about 10 pg / g, e.g., at 168 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18B. In an embodiment, the TREM has a naturally modified liver concentration between about 0.1 pg / g and about 1 pg / g, e.g., at 1 hour post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18B. In an embodiment, the TREM has a naturally modified liver concentration between about 1 pg / g and about 10 pg / g, e.g., at 4 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18B. In an embodiment, the TREM has a naturally modified liver concentration between about 1 pg / g and about 10 pg / g, e.g., at 24 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18B. In an embodiment, the TREM has a naturally modified liver concentration between about 1 pg / g and about 10 pg / g, e.g., at 168 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18B. In an embodiment, the TREM has a plasma concentration between about 1 pg / mL and about 10 pg / mL, e.g., at 0.25 hours post-delivery, e.g., in a nonhuman primate, e.g., as shown in FIG. 18C. In an embodiment, the TREM has a plasma concentration between about 1 pg / mL and about 10 pg / mL, e.g., at 0.5 hours post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18C. In an embodiment, the TREM has a plasma concentration between about 10 pg / mL and about 100 pg / mL, e.g., at 1 hour post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18C. In an embodiment, the TREM has a plasma concentration between about 1 pg / mL and about 10 pg / mL, e.g., at 1.5 hours post-delivery, e.g., Attorney Docket No.: F2099-7045WO in a non-human primate, e.g., as shown in FIG. 18C. In an embodiment, the TREM has a plasma concentration between about 1 pg / mL and about 10 pg / mL, e.g., at 2 hours post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18C. In an embodiment, the TREM has a plasma concentration between about 1 pg / mL and about 10 pg / mL, e.g., at 3 hours post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18C. In an embodiment, the TREM has a plasma concentration between about 1 pg / mL and about 10 pg / mL, e.g., at 4 hours post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18C. In an embodiment, the TREM has a plasma concentration between about 1 pg / mL and about 10 pg / mL, e.g., at 8 hours post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18C. In an embodiment, the TREM has a plasma concentration between about 0.1 pg / mL and about 1 pg / mL, e.g., at 14 hours post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18C. In an embodiment, the TREM has a plasma concentration between about 0.1 pg / mL and about 1 pg / mL, e.g., at 24 hours post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18C. In an embodiment, the TREM has a plasma concentration between about 0.1 pg / mL and about 1 pg / mL, e.g., at 48 hours post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18C. In an embodiment, the TREM has a total liver concentration between about 10 pg / g and about 100 pg / g, e.g., at 1 hour post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18D. In an embodiment, the TREM has a total liver concentration between about 0.1 pg / g and about 1 pg / g, e.g., at 25 hours post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18D. In an embodiment, the TREM has a total liver concentration between about 0.01 pg / g and about 0.1 pg / g, e.g., at 73 hours post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18D. In an embodiment, the TREM has a naturally modified liver concentration between about 0.01 pg / g and about 0.1 pg / g, e.g., at 25 hours post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18D. In an embodiment, the TREM has a naturally modified liver concentration between about 0.01 pg / g and about 0.1 pg / g, e.g., at 73 hours post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18D. In an embodiment, the TREM has a half-life of between about 20 hours and about 40 hours, e.g., in plasma, e.g., 1 day post-delivery, e.g., in a mouse. In an embodiment, the TREM has a half-life of between about 10 hours and about 30 hours, e.g., in plasma, e.g., 22 days post-delivery, e.g., in a mouse. In an embodiment, the TREM, e.g., naturally modified TREM, has a half-life of between about 50 hours and about 70 hours, e.g., in the liver, e.g., 1 day post-delivery, e.g., in a mouse. In an embodiment, the TREM, e.g., naturally modified TREM, Attorney Docket No.: F2099-7045WO has a half-life of between about 50 hours and about 70 hours, e.g., in the liver, e.g., 22 days postdelivery, e.g., in a mouse. In an embodiment, the TREM, e.g., total TREM, has a half-life of between about 40 hours and about 60 hours, e.g., in the liver, e.g., 1 day post-delivery, e.g., in a mouse. In an embodiment, the TREM, e.g., total TREM, has a half-life of between about 40 hours and about 60 hours, e.g., in the liver, e.g., 22 days post-delivery, e.g., in a mouse. In an embodiment, the TREM has a half-life of between about 1 hour and about 20 hours, e.g., in plasma, e.g., in a non-human primate. In an embodiment, the TREM has a plasma area under the curve (AUCiast) of between about 1 h*pg / mL and about 5 h*pg / mL, e.g., 1 day post-delivery, e.g., in a mouse. In an embodiment, the TREM has a plasma area under the curve (AUCiast) of between about 5 h*pg / mL and about 10 h*pg / mL, e.g., 22 days post-delivery, e.g., in a mouse. In an embodiment, the TREM has a plasma area under the curve (AUCiast) of between about 30 h*pg / mL and about 60 h*pg / mL, e.g., in a non-human primate. In an embodiment, the TREM, e.g., naturally modified TREM, has a liver area under the curve (AUCiast) of between about 120 h*pg / mL and about 140 h*pg / mL, e.g., 1 day post-delivery, e.g., in a mouse. In an embodiment, the TREM, e.g., naturally modified TREM, has a liver area under the curve (AUCiast) of between about 150 h*pg / mL and about 190 h*p.g / mL, e.g., 22 days post-delivery, e.g., in a mouse. In an embodiment, the TREM, e.g., total TREM, has a liver area under the curve (AUCiast) of between about 200 h*pg / mL and about 230 h*pg / mL, e.g., 1 day post-delivery, e.g., in a mouse. In an embodiment, the TREM, e.g., total TREM, has a liver area under the curve (AUCiast) of between about 230 h*pg / mL and about 250 h*pg / mL, e.g., 22 days post-delivery, e.g., in a mouse.

[0259] Method of making TREMs

[0260] In vitro methods for synthesizing TREMs are known in the art and can be used to make a TREM disclosed herein. For example, a TREM can be synthesized using solid state synthesis or liquid phase synthesis.

[0261] In an embodiment, a TREM made according to an in vitro synthesis method disclosed herein has a different modification profile compared to a TREM expressed and isolated from a cell, or compared to a naturally occurring tRNA.

[0262] An exemplary method for making a modified TREM is provided in Example 1. Additional synthetic methods are disclosed in Hartsei SA et al., (2005) Oligonucleotide Synthesis, 033-050, the entire contents of which are hereby incorporated by reference. Attorney Docket No.: F2099-7045WO

[0263] TREM composition

[0264] In an embodiment, a TREM composition, e.g., a TREM pharmaceutical composition, comprises a pharmaceutically acceptable excipient. Exemplary excipients include those provided in the FDA Inactive Ingredient Database (https: / / www.accessdata.fda.gov / scripts / cder / iig / index. Cfm).

[0265] In an embodiment, a TREM composition, e.g., a TREM pharmaceutical composition, comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or 150 grams of TREM. In an embodiment, a TREM composition, e.g., a TREM pharmaceutical composition, comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50 or 100 milligrams of TREM.

[0266] In an embodiment, a TREM composition, e.g., a TREM pharmaceutical composition, is at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 95 or 99% dry weight TREMs.

[0267] In an embodiment, a TREM composition comprises at least 1 x 106TREM molecules, at least 1 x 107TREM molecules, at least 1 x 108TREM molecules or at least 1 x 109TREM molecules.

[0268] In an embodiment, a TREM composition produced by any of the methods of making disclosed herein can be charged with an amino acid using an in vitro charging reaction as known in the art.

[0269] In an embodiment, a TREM composition comprise one or more species of TREMs. In an embodiment, a TREM composition comprises a single species of TREM. In an embodiment, a TREM composition comprises a first TREM species and a second TREM species. In an embodiment, the TREM composition comprises X TREM species, wherein X=2, 3, 4, 5, 6, 7, 8, 9, or 10.

[0270] In an embodiment, the TREM has at least 70, 75, 80, 85, 90, or 95, or has 100%, identity with a sequence encoded by a nucleic acid in Table 3.

[0271] In an embodiment, the TREM comprises a consensus sequence provided herein.

[0272] A TREM composition can be formulated as a liquid composition, as a lyophilized composition or as a frozen composition.

[0273] In some embodiments, a TREM composition can be formulated to be suitable for pharmaceutical use, e.g., a pharmaceutical TREM composition. In an embodiment, a Attorney Docket No.: F2099-7045WO pharmaceutical TREM composition is substantially free of materials and / or reagents used to separate and / or purify a TREM.

[0274] In some embodiments, a TREM composition can be formulated with water for injection. In some embodiments, a TREM composition formulated with water for injection is suitable for pharmaceutical use, e.g., comprises a pharmaceutical TREM composition.

[0275] TREM characterization

[0276] A TREM, or a TREM composition, e.g., a pharmaceutical TREM composition, produced by any of the methods disclosed herein can be assessed for a characteristic associated with the TREM or the TREM composition, such as purity, sterility, concentration, structure, or functional activity of the TREM. Any of the above-mentioned characteristics can be evaluated by providing a value for the characteristic, e.g., by evaluating or testing the TREM, or the TREM composition, or an intermediate in the production of the TREM composition. The value can also be compared with a standard or a reference value. Responsive to the evaluation, the TREM composition can be classified, e.g., as ready for release, meets production standard for human trials, complies with ISO standards, complies with cGMP standards, or complies with other pharmaceutical standards. Responsive to the evaluation, the TREM composition can be subjected to further processing, e.g., it can be divided into aliquots, e.g., into single or multi -dosage amounts, disposed in a container, e.g., an end-use vial, packaged, shipped, or put into commerce. In embodiments, in response to the evaluation, one or more of the characteristics can be modulated, processed or reprocessed to optimize the TREM composition. For example, the TREM composition can be modulated, processed or re-processed to (i) increase the purity of the TREM composition; (ii) decrease the amount of fragments in the composition; (iii) decrease the amount of endotoxins in the composition; (iv) increase the in vitro translation activity of the composition; (v) increase the TREM concentration of the composition; or (vi) inactivate or remove any viral contaminants present in the composition, e.g., by reducing the pH of the composition or by filtration.

[0277] In an embodiment, the TREM (e.g., TREM composition or an intermediate in the production of the TREM composition) has a purity of at least 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, i.e., by mass. Attorney Docket No.: F2099-7045WO

[0278] In an embodiment, the TREM (e.g., TREM composition or an intermediate in the production of the TREM composition) has less than 0.1%, 0,5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% TREM fragments relative to full length TREMs.

[0279] In an embodiment, the TREM (e.g., TREM composition or an intermediate in the production of the TREM composition) has low levels or absence of endotoxins, e.g., a negative result as measured by the Limulus amebocyte lysate (LAL) test.

[0280] In an embodiment, the TREM (e.g., TREM composition or an intermediate in the production of the TREM composition) has in-vitro translation activity, e.g., as measured by an assay described in Examples 12-13.

[0281] In an embodiment, the TREM (e.g., TREM composition or an intermediate in the production of the TREM composition) has a TREM concentration of at least 0.1 ng / mL, 0.5 ng / mL, 1 ng / mL, 5 ng / mL, 10 ng / mL, 50 ng / mL, 0.1 ug / mL, 0.5 ug / mL,l ug / mL, 2 ug / mL, 5 ug / mL, 10 ug / mL, 20 ug / mL, 30 ug / mL, 40 ug / mL, 50 ug / mL, 60 ug / mL, 70 ug / mL, 80 ug / mL, 100 ug / mL, 200 ug / mL, 300 ug / mL, 500 ug / mL, 1000 ug / mL, 5000 ug / mL, 10,000 ug / mL, or 100,000 ug / mL.

[0282] In an embodiment, the TREM (e.g., TREM composition or an intermediate in the production of the TREM composition) is sterile, e.g., the composition or preparation supports the growth of fewer than 100 viable microorganisms as tested under aseptic conditions, the composition or preparation meets the standard of USP <71>, and / or the composition or preparation meets the standard of USP <85>.

[0283] In an embodiment, the TREM (e.g., TREM composition or an intermediate in the production of the TREM composition) has an undetectable level of viral contaminants, e.g., no viral contaminants. In an embodiment, any viral contaminant, e.g., residual virus, present in the composition is inactivated or removed. In an embodiment, any viral contaminant, e.g., residual virus, is inactivated, e.g., by reducing the pH of the composition. In an embodiment, any viral contaminant, e.g., residual virus, is removed, e.g., by filtration or other methods known in the field.

[0284] Lipid Nanoparticles

[0285] Any TREM composition or pharmaceutical composition described herein can be administered to a cell, tissue or subject, e.g., by direct administration to a cell, tissue and / or an Attorney Docket No.: F2099-7045WO organ in vitro, ex-vivo or in vivo, by administration in a lipid nanoparticle. In-vivo administration may be via, e.g., by local, systemic and / or parenteral routes, for example intravenous, subcutaneous, intraperitoneal, intrathecal, intramuscular, ocular, nasal, urogenital, intradermal, dermal, enteral, intravitreal, intracerebral, intrathecal, or epidural.

[0286] Lipid nanoparticles (LNPs) typically comprise (i) an ionizable lipid (e.g., a cationic lipid); (ii) a neutral lipid; (iii) a pegylated lipid; and (iv) a sterol. Ionizable lipid is included in an LNP to establish an electrostatic interaction with a negatively charged nucleic acid (e.g., an RNA molecule, e.g., a tRNA molecule, e.g., a TREM), allowing for efficient encapsulation and delivery of the nucleic acid. Pegylated lipids serve to stabilize the particle formulation and to protect against immune recognition by the host. Other lipids such as neutral lipids and sterols allow for additional tuning of LNP properties.

[0287] Ionizable Lipid

[0288] The lipid nanoparticles described herein comprise one or more ionizable lipids (e.g., cationic lipids). The formal electronic charge of an ionizable lipid may change with the environmental conditions (e.g., changes in pH). Without wishing to be bound by theory, ionizable lipids (e.g., cationic lipids) may help to ensure both adequate nucleic acid encapsulation and intracellular delivery of the encapsulated nucleic acid in a lipid nanoparticle.

[0289] In some embodiments, the ionizable lipid comprises an amino group (i.e. an ionizable amino lipid). In some embodiments, the ionizable lipid comprises a tertiary amine group.

[0290] In some embodiments, the ionizable lipid is a compound of Formula (I):

[0291] (I), wherein R1is alkyl, alkenyl, alkynyl, or heteroalkyl, wherein each of alkyl, alkenyl, alkynyl, and heteroalkyl is optionally substituted by one or more R8; each of R2and R3is independently hydrogen or Ci-Ce alkyl; n is an integer from 1 to 15; X is -C(O)O-, -OC(O) -, - C(O)N(R')-, -N(R’)C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR’)O-, -S(O)2-, or -S-S-; R4is hydrogen, Ci-Ce alkyl, or Ci-Ce alkenyl; each of R5and R6is independently alkyl or alkenyl, each of which is optionally substituted with one or more R9; R7is alkyl, alkenyl, alkynyl, heteroalkyl, or R’YR”, wherein each of alkyl, alkenyl, alkynyl, and heteroalkyl is optionally substituted by one or more R10; Y is X is -C(O)O-, -OC(O) -, -C(O)N(R')-, - Attorney Docket No.: F2099-7045WO

[0292] N(R’)C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR’)O-, -S(O)2-, or -S-S-; each of R’ and R” is independently alkyl or alkenyl, optionally substituted with one or more R11; each of R8, R9, R10, and R11is independently

[0293] In some embodiments of Formula (I), R1is alkyl or heteroalkyl, each of which is optionally substituted with one or more R8. In some embodiments of Formula (I), R1is heteroalkyl, optionally substituted with one or more R8. In some embodiments of Formula (I), R1is C2-C6 heteroalkyl, optionally substituted with one or more R8. In some embodiments of Formula (I), R1is -CH2CH2OH or -CH2CH2CH2OH.

[0294] In some embodiments of Formula (I), each of R2and R3is independently hydrogen or Ci- C3 alkyl. In some embodiments of Formula (I), each of R2and R3is C1-C3 alkyl. In some embodiments of Formula (I), each of R2and R3is independently hydrogen.

[0295] In some embodiments of Formula (I), each of X and Y is independently -C(O)O-, -OC(O) -, or -C(O)-. In some embodiments of Formula (I), each of X and Y is independently -C(O)-. In some embodiments of Formula (I), X is -C(O)-. In some embodiments of Formula (I), Y is - C(O)-.

[0296] In some embodiments of Formula (I), R4is hydrogen, C1-C3 alkyl, or C2-C3 alkenyl. In some embodiments of Formula (I), R4is hydrogen or C1-C3 alkyl. In some embodiments of Formula (I), R4is C2-C3 alkenyl. In some embodiments of Formula (I), R4is hydrogen.

[0297] In some embodiments of Formula (I), R7is alkyl or R’YR”. In some embodiments of Formula (I), R7is Ci-Ce alkyl or R’YR”. In some embodiments of Formula (I), R7is Ci-Ce alkyl. In some embodiments of Formula (I), R7is R’YR”.

[0298] In some embodiments of Formula (I), R’ is alkyl or alkenyl. In some embodiments of Formula (I), R’ is C1-C10 alkyl, or C2-C10 alkenyl. In some embodiments of Formula (I), R’ is C3- Cs alkyl, or C3-C8 alkenyl. In some embodiments of Formula (I), R’ is C3-C8 alkyl. In some embodiments of Formula (I), R’ is C3-C8 alkenyl.

[0299] In some embodiments of Formula (I), R” is alkyl or alkenyl. In some embodiments of Formula (I), R” is C5-C20 alkyl, or C5-C20 alkenyl. In some embodiments of Formula (I), R” is C7-C12 alkyl, or C7-C 12 alkenyl. In some embodiments of Formula (I), R” is C7-C12 alkyl. In some embodiments of Formula (I), R” is C7-C12 alkenyl. Attorney Docket No.: F2099-7045WO

[0300] In some embodiments of Formula (I), R” is

[0301] R5is independently C5-C15 alkyl. In some embodiments of Formula (I), R5is C7-C12 alkyl. In some embodiments of Formula (I), R5is C7-C10 alkyl. In some embodiments of Formula (I), R5is C5-C20 alkyl. In some embodiments of Formula (I), R5is C10-C20 alkyl.

[0302] In some embodiments of Formula (I), R6is alkyl. In some embodiments of Formula (I), R6is C5-C15 alkyl. In some embodiments of Formula (I), R6is C7-C12 alkyl. In some embodiments of Formula (I), R6is C7-C10 alkyl. In some embodiments of Formula (I), R6is C5- C20 alkyl. In some embodiments of Formula (I), R6is C10-C20 alkyl.

[0303] In some embodiments of Formula (I), each of R5and R6is independently selected from:

[0304] In some embodiments, the compound of Formula (I) is a compound of Formula (I-a): wherein R1is alkyl, alkenyl, alkynyl, or heteroalkyl, wherein each of alkyl, alkenyl, alkynyl, and heteroalkyl is optionally substituted by one or more R8; each of R2and R3is independently hydrogen or Ci-Ce alkyl; n is an integer from 1 to 15; X is -C(O)O-, - Attorney Docket No.: F2099-7045WO

[0305] OC(O) -C(O)N(R')-, -N(R’)C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR’)O- , -S(O)2-, or -S-S-; R4is hydrogen, Ci-Ce alkyl, or Ci-Ce alkenyl; each of R5and R6is independently alkyl or alkenyl, each of which is optionally substituted with one or more R9; Y is X is -C(O)O-, -OC(O) -, -C(O)N(R')-, -N(R’)C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)- , -P(O)(OR’)O-, -S(O)2-, or -S-S-; each of R’ and R” is independently alkyl or alkenyl, optionally substituted with one or more R11.

[0306] In some embodiments, the cationic lipid is a compound of Formula (I-b): pharmaceutically acceptable salt or stereoisomer thereof, wherein: L1and L2are each independently -(C=O)O- or -O(C=O)-; G1and G2are each independently C4-C12 alkylene; G3is Ci-Ce alkylene; R12and R13are each independently C6-C24 alkyl; and R14is OH.

[0307] In some embodiments of Formula (I-b), each of G1and G2is each independently Ce-Cio alkylene.

[0308] In some embodiments of Formula (I-b), each of G3is C2-C4 alkylene.

[0309] In some embodiments of Formula (I-b), each of R12and R13is independently selected

[0310] In some embodiments, the ionizable lipid is a compound shown in Table 13. Attorney Docket No.: F2099-7045WO

[0311] In some embodiments, the ionizable lipid (e.g., an ionizable lipid of Formula (I)) is

[0312] In some embodiments, the ionizable lipid is a cationic lipid. In some embodiments, the cationic lipids for use in the LNPs have the following Structure (I):

[0313] I or a pharmaceutically acceptable salt, tautomer, or stereoisomer thereof, wherein: one -C(=O)S-, SC(=O)-, -NRaC(=O -NRaC(=O)O-, and the other of -S-S-, -C(=O)S-, SC(=O)-, -NRaC(=O)-, -C(=O)NRa-, ,NRaC(=O)NRa-, -OC(=O)NRa- or -NRaC(=O)O- or a direct bond;

[0314] G1and G2are each independently unsubstituted C1-C12 alkylene or C1-C12 alkenylene;

[0315] G3is C1-C24 alkylene, C1-C24 alkenylene, C3-C8 cycloalkylene, C3-C8 cycloalkenylene;

[0316] Rais H or C1-C12 alkyl;

[0317] R1and R2are each independently C6-C24 alkyl or C6-C24 alkenyl;

[0318] R3is H, OR5, CN, -C(=O)OR4, -OC(=O)R4or -NR5C(=O)R4;

[0319] R4is C1-C12 alkyl;

[0320] R5is H or Ci-Ce alkyl; and x is 0, 1 or 2.

[0321] In some embodiments of Structure (I):

[0322] L1and L2are each independently -(00)0- or -0(00)-;

[0323] G1and G2are each independently C4-C12 alkylene; Attorney Docket No.: F2099-7045WO

[0324] G3is Ci-Ce alkylene;

[0325] R1and R2are each independently C6-C24 alkyl; and

[0326] R3is OH.

[0327] In some of the foregoing embodiments, the cationic lipid has one of the following structures (IA) or (IB):

[0328] (IA) (IB) wherein:

[0329] A is a 3 to 8-membered cycloalkyl or cycloalkylene ring;

[0330] R6is, at each occurrence, independently H, OH or C1-C24 alkyl; n is an integer ranging from 1 to 15.

[0331] In some of the foregoing embodiments, the cationic lipid has structure (IA), and in other embodiments, the cationic lipid has structure (IB).

[0332] In other embodiments of the foregoing, the cationic lipid has one of the following Structures (IC) or (ID):

[0333] (IC) (ID) wherein y and z are each independently integers ranging from 1 to 12.

[0334] In any of the foregoing embodiments, one of L1or L2is -O(C=O)-. For example, in some embodiments each of L1and L2are -O(C=O)-. In some different embodiments of any of the foregoing, L1and L2are each independently -(C=O)O- or -O(C=O)-. For example, in some embodiments each of L1and L2is -(C=O)O-.

[0335] In some different embodiments of the foregoing, the cationic lipid has one of the following Structures (IE) or (IF): Attorney Docket No.: F2099-7045WO

[0336] (IE) (IF)

[0337] In some of the foregoing embodiments, the cationic lipid has one of the following

[0338] In some of the foregoing embodiments, n is an integer ranging from 2 to 12, for example from 2 to 8 or from 2 to 4. For example, in some embodiments, n is 3, 4, 5 or 6. In some embodiments, n is 3. In some embodiments, n is 4. In some embodiments, n is 5. In some embodiments, n is 6.

[0339] In some other of the foregoing embodiments, y and z are each independently an integer ranging from 2 to 10. For example, in some embodiments, y and z are each independently an integer ranging from 4 to 9 or from 4 to 6.

[0340] In some of the foregoing embodiments, R6is H. In other of the foregoing embodiments, R6is C1-C24 alkyl. In other embodiments, R6is OH.

[0341] In some embodiments of structure (I), wherein G1and G2are each independently Cg-Cio alkylene, for example C2-C4 alkylene. Attorney Docket No.: F2099-7045WO

[0342] In some embodiments, G3is unsubstituted. In other embodiments, G3 is substituted. In various different embodiments, G3is linear C1-C24 alkylene or linear C1-C24 alkenylene.

[0343] In some other foregoing embodiments, R1or R2, or both, is C6-C24 alkyl, for example C10-C20 alkyl, which is branched or unbranched. For example, in some embodiments, R1and R2each, independently have the following Structure: wherein:

[0344] R7aand R7hare, at each occurrence, independently H or C1-C12 alkyl; and a is an integer from 2 to 12, wherein R7a, R7band a are each selected such that R1and R2each independently comprise from 6 to 20 carbon atoms. For example, in some embodiments a is an integer ranging from 5 to 9 or from 8 to 12.

[0345] In some of the foregoing embodiments, at least one occurrence of R7ais H. For example, in some embodiments, R7ais H at each occurrence. In other different embodiments of the foregoing, at least one occurrence of R7bis Ci-Cg alkyl. For example, in some embodiments, Ci- Cs alkyl is methyl, ethyl, n-propyl, iso-propyl, n-butyl, iso-butyl, tert-butyl, n-hexyl or n-octyl.

[0346] In different embodiments, R1or R2, or both, has one of the following Structures:

[0347] In some of the foregoing embodiments, R3is OH, CN, -C(=O)OR4, -OC(=O)R4or -NHC(=O)R4. In some embodiments, R4is methyl or ethyl. In some embodiments, the cationic lipid has one of the following Structures: Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Other representative cationic lipids of structure (I) are set forth in Table 13 below.

[0348] Table 13: Representative Cationic lipids of Structure (I) Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO

[0349] In another embodiment, the cationic lipids for use in the LNPs have the following Structure (II):

[0350] II or a pharmaceutically acceptable salt, tautomer or stereoisomer thereof, wherein:

[0351] L1and L2are each independently -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O)X-, -S-S-, -C(=O)S-, -SC(=O)-, -NRaC(=O)-, -C(=O)NRa-, -NRaC(=O)NRa-, -OC(=O)NRa-, -NRaC(=O)O- or a direct bond;

[0352] G1is C1-C2 alkylene, -(C=O)- , -O(C=O)-, -SC(=O)-, -NRaC(=O)- or a direct bond;

[0353] G2is -C(=O)-, -(C=O)O-, -C(=O)S-, -C(=O)NRa- or a direct bond;

[0354] G3is Ci-Ce alkylene;

[0355] Rais H or C1-C12 alkyl;

[0356] Rlaand Rlbare, at each occurrence, independently either: (a) H or C1-C12 alkyl; or (b) Rlais H or C1-C12 alkyl, and Rlbtogether with the carbon atom to which it is bound is taken together with an adjacent Rlband the carbon atom to which it is bound to form a carbon-carbon double bond;

[0357] R2aand R2bare, at each occurrence, independently either: (a) H or C1-C12 alkyl; or (b) R2ais H or Ci-C 12 alkyl, and R- together with the carbon atom to which it is bound is taken Attorney Docket No.: F2099-7045WO together with an adjacent R2band the carbon atom to which it is bound to form a carbon-carbon double bond;

[0358] R3aand R3bare, at each occurrence, independently either: (a) H or C1-C12 alkyl; or (b) R3ais H or C1-C12 alkyl, and R3btogether with the carbon atom to which it is bound is taken together with an adjacent R3band the carbon atom to which it is bound to form a carbon-carbon double bond;

[0359] R4aand R4bare, at each occurrence, independently either: (a) H or C1-C12 alkyl; or (b) R4ais H or C1-C12 alkyl, and R4btogether with the carbon atom to which it is bound is taken together with an adjacent R4band the carbon atom to which it is bound to form a carbon-carbon double bond;

[0360] R5and R6are each independently H or methyl;

[0361] R7is C4-C20 alkyl;

[0362] R8and R9are each independently C1-C12 alkyl; or R8and R9, together with the nitrogen atom to which they are attached, form a 5, 6 or 7-membered heterocyclic ring; a, b, c and d are each independently an integer from 1 to 24; and x is 0, 1 or 2.

[0363] In some embodiments, L1and L2are each independently -O(C=O)-, -(C=O)O- or a direct bond. In other embodiments, G1and G2are each independently -(C=O)- or a direct bond. In some different embodiments, L1and L2are each independently -O(C=O)-, -(C=O)O- or a direct bond; and G1and G2are each independently - (C=O)- or a direct bond.

[0364] In some different embodiments, L1and L2are each independently -C(=O)-, -O-, -S(O)x-, -S-S-, -C(=O)S-, -SC(=O)-, -NRa-, -NRaC(=O)-, -C(=O)NRa-, -NRaC(=0)NRa, -OC(=O)NRa-, -NRaC(=O)O-, -NRaS(O)xNRa-, -NRaS(O)x- or -S(O)xNRa-.

[0365] In other of the foregoing embodiments, the cationic lipid has one of the following Structures (IIA) or (IIB): Attorney Docket No.: F2099-7045WO

[0366] (IIA) (IIB)

[0367] In some embodiments, the cationic lipid has structure (IIA). In other embodiments, the cationic lipid has structure (IIB).

[0368] In any of the foregoing embodiments, one of L1or L2is -O(C=O)-. For example, in some embodiments each of L1and L2are -O(C=O)-.

[0369] In some different embodiments of any of the foregoing, one of L1or L2is -(C=O)O-. For example, in some embodiments each of L1and L2is -(C=O)O-.

[0370] In different embodiments, one of L1or L2is a direct bond. As used herein, a “direct bond” means the group (e. , L1or L2) is absent. For example, in some embodiments each of L1and L2is a direct bond.

[0371] In other different embodiments of the foregoing, for at least one occurrence of Rlaand Rlb, Rlais H or Ci-C 12 alkyl, and Rlbtogether with the carbon atom to which it is bound is taken together with an adjacent R1band the carbon atom to which it is bound to form a carboncarbon double bond.

[0372] In still other different embodiments, for at least one occurrence of R4aand R4b, R4ais H or C1-C12 alkyl, and R4btogether with the carbon atom to which it is bound is taken together with an adjacent R4band the carbon atom to which it is bound to form a carbon-carbon double bond.

[0373] In more embodiments, for at least one occurrence of R2aand R2b, R2ais H or Ci- C12 alkyl, and R2btogether with the carbon atom to which it is bound is taken together with an adjacent R2band the carbon atom to which it is bound to form a carbon-carbon double bond.

[0374] In other different embodiments of any of the foregoing, for at least one occurrence of R3aand R3b, R3ais H or Ci-C 12 alkyl, and R3btogether with the carbon atom to which it is bound is Attorney Docket No.: F2099-7045WO taken together with an adjacent R3band the carbon atom to which it is bound to form a carboncarbon double bond.

[0375] It is understood that “carbon-carbon” double bond refers to one of the following structures: wherein Rcand Rdare, at each occurrence, independently H or a substituent. For example, in some embodiments Rcand Rdare, at each occurrence, independently H, C1-C12 alkyl or cycloalkyl, for example H or C1-C12 alkyl.

[0376] In various other embodiments, the cationic lipid has one of the following Structures (IIC) or (IID): wherein e, f, g and h are each independently an integer from 1 to 12.

[0377] In some embodiments, the cationic lipid has structure (IIC). In other embodiments, the cationic lipid has structure (IID).

[0378] In various embodiments of the cationic lipids of structures (IIC) or (IID), e, f, g and h are each independently an integer from 4 to 10. Attorney Docket No.: F2099-7045WO

[0379] In certain embodiments of the foregoing, a, b, c and d are each independently an integer from 2 to 12 or an integer from 4 to 12. In other embodiments, a, b, c and d are each independently an integer from 8 to 12 or 5 to 9. In some certain embodiments, a is 0. In some embodiments, a is 1. In other embodiments, a is 2. In more embodiments, a is 3. In yet other embodiments, a is 4. In some embodiments, a is 5. In other embodiments, a is 6. In more embodiments, a is 7. In yet other embodiments, a is 8. In some embodiments, a is 9. In other embodiments, a is 10. In more embodiments, a is 11. In yet other embodiments, a is 12. In some embodiments, a is 13. In other embodiments, a is 14. In more embodiments, a is 15. In yet other embodiments, a is 16.

[0380] In some embodiments, b is 1. In other embodiments, b is 2. In more embodiments, b is 3. In yet other embodiments, b is 4. In some embodiments, b is 5. In other embodiments, b is 6. In more embodiments, b is 7. In yet other embodiments, b is 8. In some embodiments, b is 9. In other embodiments, b is 10. In more embodiments, b is 11. In yet other embodiments, b is 12.

[0381] In some embodiments, b is 13. In other embodiments, b is 14. In more embodiments, b is 15. In yet other embodiments, b is 16.

[0382] In some embodiments, c is 1. In other embodiments, c is 2. In more embodiments, c is 3.

[0383] In yet other embodiments, c is 4. In some embodiments, c is 5. In other embodiments, c is 6. In more embodiments, c is 7. In yet other embodiments, c is 8. In some embodiments, c is 9. In other embodiments, c is 10. In more embodiments, c is 11. In yet other embodiments, c is 12.

[0384] In some embodiments, c is 13. In other embodiments, c is 14. In more embodiments, c is 15. In yet other embodiments, c is 16.

[0385] In some certain embodiments, d is 0. In some embodiments, d is 1. In other embodiments, d is 2. In more embodiments, d is 3. In yet other embodiments, d is 4. In some embodiments, d is 5. In other embodiments, d is 6. In more embodiments, d is 7. In yet other embodiments, d is 8. In some embodiments, d is 9. In other embodiments, d is 10. In more embodiments, d is 11. In yet other embodiments, d is 12. In some embodiments, d is 13. In other embodiments, d is 14. In more embodiments, d is 15. In yet other embodiments, d is 16.

[0386] In some embodiments, e is 1. In other embodiments, e is 2. In more embodiments, e is 3.

[0387] In yet other embodiments, e is 4. In some embodiments, e is 5. In other embodiments, e is 6. In more embodiments, e is 7. In yet other embodiments, e is 8. In some embodiments, e is 9. In other embodiments, e is 10. In more embodiments, e is 11. In yet other embodiments, e is 12. Attorney Docket No.: F2099-7045WO

[0388] In some embodiments, f is 1. In other embodiments, f is 2. In more embodiments, f is 3. In yet other embodiments, f is 4. In some embodiments, f is 5. In other embodiments, f is 6. In more embodiments, f is 7. In yet other embodiments, f is 8. In some embodiments, f is 9. In other embodiments, f is 10. In more embodiments, f is 11. In yet other embodiments, fis 12.

[0389] In some embodiments, g is 1. In other embodiments, g is 2. In more embodiments, g is 3. In yet other embodiments, g is 4. In some embodiments, g is 5. In other embodiments, g is 6. In more embodiments, g is 7. In yet other embodiments, g is 8. In some embodiments, g is 9. In other embodiments, g is 10. In more embodiments, g is 11. In yet other embodiments, g is 12.

[0390] In some embodiments, h is 1. In other embodiments, e is 2. In more embodiments, h is 3. In yet other embodiments, h is 4. In some embodiments, e is 5. In other embodiments, h is 6. In more embodiments, h is 7. In yet other embodiments, h is 8. In some embodiments, h is 9. In other embodiments, h is 10. In more embodiments, h is 11. In yet other embodiments, h is 12.

[0391] In some other various embodiments, a and d are the same. In some other embodiments, b and c are the same. In some other specific embodiments and a and d are the same and b and c are the same.

[0392] The sum of a and b and the sum of c and d are factors which may be varied to obtain a lipid having the desired properties. In one embodiment, a and b are chosen such that their sum is an integer ranging from 14 to 24. In other embodiments, c and d are chosen such that their sum is an integer ranging from 14 to 24. In further embodiment, the sum of a and b and the sum of c and d are the same. For example, in some embodiments the sum of a and b and the sum of c and d are both the same integer which may range from 14 to 24. In still more embodiments, a. b, c and d are selected such that the sum of a and b and the sum of c and d is 12 or greater.

[0393] The substituents at Rla, R2a, R3aand R4aare not particularly limited. In some embodiments, at least one of Rla, R2a, R3aand R4ais H. In certain embodiments Rla, R2a, R3aand R4aare H at each occurrence. In certain other embodiments at least one of Rla, R2a, R3aand R4ais C1-C12 alkyl. In certain other embodiments at least one of Rla, R2a, R3aand R4ais Ci-Cs alkyl. In certain other embodiments at least one of Rla, R2a, R3aand R4ais Ci-Ce alkyl. In some of the foregoing embodiments, the Ci-Cs alkyl is methyl, ethyl, n-propyl, iso-propyl, n-butyl, iso-butyl, tert-butyl, n-hexyl or n-octyl.

[0394] In certain embodiments of the foregoing, Rla, Rlb, R4aand R4bare C1-C12 alkyl at each occurrence. Attorney Docket No.: F2099-7045WO

[0395] In further embodiments of the foregoing, at least one of Rlb, R2b, R3band R4bis H or Rlb, R2b, R3band R4bare H at each occurrence.

[0396] In certain embodiments of the foregoing, Rlbtogether with the carbon atom to which it is bound is taken together with an adjacent Rlband the carbon atom to which it is bound to form a carbon-carbon double bond. In other embodiments of the foregoing R4btogether with the carbon atom to which it is bound is taken together with an adjacent R4band the carbon atom to which it is bound to form a carbon-carbon double bond.

[0397] The substituents at R5and R6are not particularly limited in the foregoing embodiments.

[0398] In certain embodiments one of R3or R6is methyl. In other embodiments each of R or R6is methyl.

[0399] The substituents at R7are not particularly limited in the foregoing embodiments. In certain embodiments R7is Ce-Ci6 alkyl. In some other embodiments, R7is C6-C9 alkyl. In some of these embodiments, R7is substituted with -(C=O)ORb, -O(C=O)Rb, -C(=O)Rb, -ORb, -S(O)xRb, -S-SRb, -C(=O)SRb, -SC(=O)Rb, -NRaRb, -NRaC(=O)Rb, -C(=O)NRaRb, -NRaC(=O)NRaRb, -OC(=O)NRaRb, -NRaC(=O)ORb, -NRaS(O)xNRaRb, -NRaS(O)xRbor -S(O)xNRaRb, wherein: Rais H or C1-C12 alkyl; Rbis C1-C15 alkyl; and x is 0, 1 or 2. For example, in some embodiments R7is substituted with -(C=O)ORbor -O(C=O)Rb.

[0400] In various of the foregoing embodiments, Rbis branched C1-C15 alkyl. For example, in some embodiments Rbhas one of the following structures:

[0401] In certain other of the foregoing embodiments, one of R8or R9is methyl. In other embodiments, both R8and R9are methyl. Attorney Docket No.: F2099-7045WO

[0402] In some different embodiments, R8and R9, together with the nitrogen atom to which they are attached, form a 5, 6 or 7-membered heterocyclic ring. In some embodiments of the foregoing, R8and R9, together with the nitrogen atom to which they are attached, form a 5- membered heterocyclic ring, for example a pyrrolidinyl ring. In some different embodiments of the foregoing, R8and R9, together with the nitrogen atom to which they are attached, form a 6- membered heterocyclic ring, for example a piperazinyl ring.

[0403] In still other embodiments of the foregoing cationic lipids, G3is C2-C4 alkylene, for example C3 alkylene.

[0404] In various different embodiments, the cationic lipid of Structure (II) has one of the structures set forth in Table 14 below.

[0405] Table 14: Representative Cationic Lipids of Structure (II) Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO

[0406] Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO

[0407] In other embodiments, the cationic lipids have the following Structure (III): Attorney Docket No.: F2099-7045WO or a pharmaceutically acceptable salt, tautomer, or stereoisomer thereof, wherein:

[0408] R1is optionally substituted C1-C24 alkyl or optionally substituted C2-C24 alkenyl; R2and R3are each independently optionally substituted C1-C36 alkyl;

[0409] R4and R5are each independently optionally substituted Ci-Ce alkyl, or R4and R5join, along with the N to which they are attached, to form a heterocyclyl or heteroaryl;

[0410] L1, L2, and L3are each independently optionally substituted Ci-Cis alkylene;

[0411] G1is a direct bond, -(CH2)nO(C=O)-, -(CH2)n(C=O)O-, or-(C=O)-; G2and G3are each independently -(C=O)O- or -O(C=O)-; and n is an integer greater than 0.

[0412] In some embodiments, the cationic lipid has the following Structure (IIIA): In some embodiments, the cationic lipid has the following Structure (IIIB): Attorney Docket No.: F2099-7045WO

[0413] In some embodiments, R1is optionally substituted Cs-Cis alkyl or C14-C18 alkenyl. In certain embodiments, R1is Cs alkyl, C9 alkyl, C10 alkyl, C12 alkyl, C14 alkyl, or Ci6 alkyl. In some more specific embodiments, R1is Ci6 alkenyl. In certain more specific embodiments, R1is unbranched. In some embodiments, R1is branched. In certain embodiments, R1is unsubstituted.

[0414] In some embodiments, G1is a direct bond, -(CH2)nO(C=O)-, or -(CH2)n(C=O)O-. In certain embodiments, G1is a direct bond. In some more specific embodiments, G1is - (CH2)n(C=O)O- and n is greater than 1. In some embodiments, n is 1-20. In some embodiments n is 1-10. In some embodiments n is 5-11. In some embodiments, n is 6-10. In certain more specific embodiments, n is 5, 6, 7, 8, 9, or 10. In some embodiments, n is 5. In some embodiments, n is 6. In some embodiments, n is 7. In certain embodiments, n is 8. In some embodiments, n is 9. In some embodiments, n is 10.

[0415] In some embodiments, L1is Ci-Ce alkylene. In certain embodiments, L1is C2 alkylene, C3 alkylene, or C4 alkylene. In some more specific embodiments, L1is unbranched. In certain more specific embodiments, L1is un substituted.

[0416] In some embodiments, R2is C8-C24 alkyl. In some embodiments, R3is C8-C24 alkyl. In some more specific embodiments, R2and R3are both C8-C24 alkyl. In some embodiments, R2and R3are each independently Cn alkyl, C12 alkyl, C13 alkyl, C14 alkyl, C15 alkyl, Ci6 alkyl, Cis alkyl, or C20 alkyl. In certain embodiments, R2is branched. In more specific embodiments, R3is branched. In some more specific embodiments, R2and R3each independently have one of the following structures: wherein:

[0417] R6and R7are each independently C2-C12 alkyl.

[0418] In some embodiments, R2and R3each independently have one of the following structures: Attorney Docket No.: F2099-7045WO

[0419] In some embodiments, L2and L3are each independently C4-C10 alkylene. In certain embodiments, L2and L3are both C5 alkylene. In some more specific embodiments, L2and L3are both Ce alkylene. In certain embodiments, L2and L3are both Cs alkylene. In some more specific embodiments, L2and L3are both C9 alkylene. In some embodiments, L2is unbranched. In some embodiments, L3is unbranched. In more specific embodiments, L2is unsubstituted. In some embodiments, L2is unsubstituted.

[0420] In some embodiments, R4and R5are each independently Ci-Ce alkyl. In more specific embodiments, R4and R3are both methyl. In certain embodiments, R4and R3are both ethyl. In certain embodiments, R4is methyl and R5is n-butyl. In some embodiments, R4and R3are both n-butyl. In different embodiments, R4is methyl and R5is n-hexyl.

[0421] In some embodiments, R4and R3join, along with the N to which they are attached, to form a heterocyclyl. In certain embodiments, the heterocyclyl is a 5-membered heterocyclyl. In some embodiments, the heterocyclyl has the following structure:

[0422] In various different embodiments, the cationic lipid of Structure (III) has one of the structures set forth in Table 15 below.

[0423] Table 15. Representative Cationic Lipids of Structure (III) Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO Attorney Docket No.: F2099-7045WO a concentration from 40 to 50 mol percent of the cationic lipid, based on total lipids in the LNP.

[0424] For example, in some embodiments, the LNP comprises from 45 to 50 mol percent of the cationic lipid, based on total lipids in the LNP. In other embodiments, the LNP comprises about 46, about 47, about 48 or about 49 mol percent of the cationic lipid, based on total lipids in the

[0425] LNP. In some specific embodiments, the LNP comprises from 47 to 48 mol percent of the cationic lipid, based on total lipids in the LNP, or about 47.5 mol percent of the cationic lipid, based on total lipids in the LNP.

[0426] In some embodiments, the ionizable lipid (e.g., an ionizable lipid of Formula (I)) comprises from about 30 mol % to about 95 mol % (e.g., from about 30 mol % to about 90 mol %, about 30 mol % to about 85 mol %, about 30 mol % to about 80 mol %, about 30 mol % to about 75 mol %, about 30 mol % to about 70 mol %, about 30 mol % to about 65 mol %, about Attorney Docket No.: F2099-7045WO

[0427] 30 mol % to about 60 mol %, about 30 mol % to about 55 mol %, about 30 mol % to about 50 mol %, about 35 mol % to about 90 mol %, about 35 mol % to about 85 mol %, about 35 mol % to about 80 mol %, about 35 mol % to about 75 mol %, about 35 mol % to about 70 mol %, about 35 mol % to about 65 mol %, about 35 mol % to about 60 mol %, about 35 mol % to about 55 mol %, about 35 mol % to about 50 mol %, about 40 mol % to about 90 mol %, about 40 mol % to about 85 mol %, about 40 mol % to about 80 mol %, about 40 mol % to about 75 mol %, about 40 mol % to about 70 mol %, about 40 mol % to about 65 mol %, about 40 mol % to about 60 mol %, about 40 mol % to about 55 mol %, about 40 mol % to about 50 mol %, about 45 mol % to about 90 mol %, about 45 mol % to about 85 mol %, about 45 mol % to about 80 mol %, about 45 mol % to about 75 mol %, about 45 mol % to about 70 mol %, about 45 mol % to about 65 mol %, about 45 mol % to about 60 mol %, about 45 mol % to about 55 mol %, about 45 mol % to about 50 mol %, about 50 mol % to about 90 mol %, about 50 mol % to about 85 mol %, about 50 mol % to about 80 mol %, about 50 mol % to about 75 mol %, about 50 mol % to about 70 mol %, about 50 mol % to about 65 mol %, about 50 mol % to about 60 mol %, about 50 mol % to about 55 mol %, about 55 mol % to about 90 mol %, about 55 mol % to about 85 mol %, about 55 mol % to about 80 mol %, about 55 mol % to about 75 mol %, about 55 mol % to about 70 mol %, about 55 mol % to about 65 mol %, about 55 mol % to about 60 mol %, about 60 mol % to about 90 mol %, about 60 mol % to about 85 mol %, about 60 mol % to about 80 mol %, about 60 mol % to about 75 mol %, about 60 mol % to about 70 mol %, about 60 mol % to about 65 mol %, about 65 mol % to about 90 mol %, about 65 mol % to about 85 mol %, about 65 mol % to about 80 mol %, about 65 mol % to about 75 mol %, about 65 mol % to about 70 mol %, about 70 mol % to about 90 mol %, about 70 mol % to about 85 mol %, about 70 mol % to about 80 mol %, about 70 mol % to about 75 mol %, about 75 mol % to about 90 mol %, about 75 mol % to about 85 mol %, about 75 mol % to about 80 mol %, about 80 mol % to about 90 mol %, about 80 mol % to about 85 mol %, or about 85 mol % to about 90 mol %) of the lipid component of the lipid nanoparticle.

[0428] In some embodiments, the ionizable lipid (e.g., an ionizable lipid of Formula (I)) comprises from about 40 mol % to about 50 mol %, or 45 mol % to about 50 mol % of the lipid component of the lipid nanoparticle. In some embodiments, the ionizable lipid (e.g., an ionizable lipid of Formula (I)) comprises from 45 mol % to about 50 mol % of the lipid component of the lipid nanoparticle. Attorney Docket No.: F2099-7045WO

[0429] In some embodiments, the ionizable lipid (e.g., an ionizable lipid of Formula (I)) comprises greater than about 30 mol %, 35 mol%, 40 mol%, 55 mol%, 50 mol%, 55 mol%, 60 mol%, 65 mol%, 70 mol%, 75 mol%, 80 mol%, 85 mol%, 90 mol%, or 95 mol% of the lipid component of the lipid nanoparticle.

[0430] In some embodiments, the ionizable lipid (e.g., an ionizable lipid of Formula (I)) comprises less than about 30 mol %, 35 mol%, 40 mol%, 55 mol%, 50 mol%, 55 mol%, 60 mol%, 65 mol%, 70 mol%, 75 mol%, 80 mol%, 85 mol%, 90 mol%, or 95 mol% of the lipid component of the lipid nanoparticle.

[0431] In some embodiments, the ionizable lipid (e.g., an ionizable lipid of Formula (I)) comprises about 30 mol %, 35 mol%, 40 mol%, 55 mol%, 50 mol%, 55 mol%, 60 mol%, 65 mol%, 70 mol%, 75 mol%, 80 mol%, 85 mol%, 90 mol%, or 95 mol% of the lipid component of the lipid nanoparticle.

[0432] In some embodiments, the cationic lipid (e.g., a cationic lipid of Formula (I)) comprises about 40 mol %, 41 mol %, 42 mol %, 43 mol %, 44 mol %, 45 mol %, 46 mol %, 47 mol %, 48 mol %, 49 mol %, 50 mol %, 51 mol %, 52 mol %, 53 mol %, 54 mol %, 55 mol %, 56 mol %, 57 mol %, 58 mol %, 59 mol %, or 60 mol % of the lipid component of the lipid nanoparticle.

[0433] In some embodiments, the cationic lipid (e.g., a cationic lipid of Formula (I)) comprises about 46 mol %, 47 mol %, 48 mol %, or 49 mol % of the lipid component of the lipid nanoparticle.

[0434] In some embodiments, the cationic lipid (e.g., a cationic lipid of Formula (I)) comprises about 47 mol%, 47.5 mol%, or 48 mol% of the lipid component of the lipid nanoparticle.

[0435] In some embodiments, the cationic lipid (e.g., a cationic lipid of Formula (I)) comprises from about 47 mol% to 48 mol% of the lipid component of the lipid nanoparticle.

[0436] In some embodiments, the cationic lipid (e.g., a cationic lipid of Formula (I)) comprises about 47.5 mol% of the lipid component of the lipid nanoparticle.

[0437] Neutral Lipid

[0438] The lipid nanoparticles described herein comprise one or more neutral lipids (e.g., a phospholipid). Without wishing to be bound by theory, neutral lipids may improve the stability and overall pharmacokinetic properties of a lipid nanoparticle.

[0439] In some embodiments, the neutral lipid is a compound of Formula (Il-i): Attorney Docket No.: F2099-7045WO wherein each of R31and R32is independently alkyl, alkenyl, or alkynyl, each of which is optionally substituted with one or more R35; R33is alkyl, alkenyl, alkynyl, or heteroalkyl, each of which is optionally substituted with one or more R36; R34is hydrogen or absent.

[0440] In some embodiments of Formula (Il-i) each of R31and R32is independently alkyl or alkenyl. In some embodiments of Formula (Il-i) each of R31and R32is alkyl. In some embodiments of Formula (Il-i) each of R31and R32is C1-C30 alkyl or C2-C30 alkenyl.

[0441] In some embodiments of Formula (Il-i) R33is alkyl or heteroalkyl, each of which is optionally substituted with one or more R36. In some embodiments of Formula (Il-i), R33is alkyl substituted with one or more R36. In some embodiments of Formula (Il-i), R33is heteroalkyl substituted with one or more R36.

[0442] In some embodiments of Formula (Il-i), R33is -CH2CH2N(CH3)2 or -CH2CH2N(CH3)3+. In some embodiments of Formula (Il-i), R33is -CH2CH2N(CH3)2. In some embodiments of Formula (Il-i), R33is -CH2CH2N(CH3)3+.

[0443] In some embodiments of Formula (Il-i), R34is absent. In some embodiments of Formula (Il-i), R34is hydrogen.

[0444] In some embodiments, the neutral lipid of Formula (Il-i) is a compound of Formula (Il-a): wherein each of R31and R32is independently alkyl, alkenyl, or alkynyl, each of which is optionally substituted with one or more R3; R33is alkyl, alkenyl, alkynyl, or heteroalkyl, each of which is optionally substituted with one or more R36; R34is hydrogen or absent.

[0445] In some embodiments, the neutral lipid of Formula (Il-i) is selected from: distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), Attorney Docket No.: F2099-7045WO dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-l carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), 16-0-monom ethyl PE, 16-O-dimethyl PE, 18-1-trans PE, l-stearioyl-2-oleoylphosphatidyethanol amine (SOPE) or 1,2-dielaidoyl-sn- glycero-3-phophoethanolamine (transDOPE).

[0446] In some embodiments, the neutral lipid of Formula (Il-i) is selected from: 1,2-Distearoyl- sn-glycero-3 -phosphocholine (DSPC), l,2-Dipalmitoyl-sn-glycero-3 -phosphocholine (DPPC), l,2-Dimyristoyl-sn-glycero-3-phosphocholine (DMPC), l-Palmitoyl-2-oleoyl-sn-glycero-3- phosphocholine (POPC), and l,2-dioleoyl-sn-glycero-3 -phosphocholine (DOPC), or derivatives thereof.

[0447] In some embodiments, the neutral lipid of Formula (Il-i) is selected from: 1,2-Distearoyl- sn-glycero-3 -phosphocholine (DSPC), l,2-Dipalmitoyl-sn-glycero-3 -phosphocholine (DPPC), l,2-Dimyristoyl-sn-glycero-3 -phosphocholine (DMPC), and l,2-dioleoyl-sn-glycero-3- phosphocholine (DOPC), or derivatives thereof.

[0448] In some embodiments, the neutral lipid of Formula (Il-i) is l,2-Distearoyl-sn-glycero-3- phosphocholine (DSPC).

[0449] In some embodiments, the neutral lipid of Formula (Il-i) is phosphatidylethanolamine or a derivative thereof. In some embodiments, the compound of Formula (Il-i) is selected from: 1,2- Dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE).

[0450] In some embodiments, the neutral lipid e.g., a neutral lipid of Formula (Il-i)) comprises from about 5 mol % to about 40 mol % (e.g., from about 5 mol % to about 40 mol %, about 5 mol % to about 35 mol %, about 5 mol % to about 30 mol %, about 5 mol % to about 25 mol %, about 5 mol % to about 20 mol %, about 5 mol % to about 15 mol %, about 5 mol % to about 10 mol %, about 10 mol % to about 40 mol %, about 10 mol % to about 35 mol %, about 10 mol % to about 30 mol %, about 10 mol % to about 25 mol %, about 10 mol % to about 20 mol %, about 10 mol % to about 15 mol %, about 15 mol % to about 40 mol %, about 15 mol % to about 35 mol %, about 15 mol % to about 30 mol %, about 15 mol % to about 25 mol %, about 15 mol % to about 20 mol %, about 20 mol % to about 40 mol %, about 20 mol % to about 35 mol %, about 20 mol % to about 30 mol %, about 20 mol % to about 25 mol %, about 25 mol % to about Attorney Docket No.: F2099-7045WO

[0451] 40 mol %, about 25 mol % to about 35 mol %, about 25 mol % to about 30 mol %, about 30 mol % to about 40 mol %, about 30 mol % to about 35 mol %, about 35 mol % to about 40 mol %) of the lipid component of the lipid nanoparticle.

[0452] In some embodiments, the neutral lipid (e.g., a neutral lipid of Formula (II-i)) comprises about 8-12 mol % of the lipid component of the lipid nanoparticle. In some embodiments, the neutral lipid (e.g., a neutral lipid of Formula (II-i)) comprises about 9-11 mol % of the lipid component of the lipid nanoparticle.

[0453] In some embodiments, the neutral lipid (e.g., a neutral lipid of Formula (II-i)) comprises greater than about 5 mol%, 10 mol %, 15 mol %, 20 mol %, 25 mol %, 30 mol %, 35 mol %, or 40 mol % of the lipid component of the lipid nanoparticle.

[0454] In some embodiments, the neutral lipid (e.g., a neutral lipid of Formula (II-i)) comprises less than about 5 mol%, 10 mol %, 15 mol %, 20 mol %, 25 mol %, 30 mol %, 35 mol %, or 40 mol % of the lipid component of the lipid nanoparticle.

[0455] In some embodiments, the neutral lipid (e.g., a neutral lipid of Formula (II-i)) comprises about 5 mol %, 10 mol %, 15 mol %, 20 mol %, 25 mol %, 30 mol %, 35 mol %, or 40 mol % of the lipid component of the lipid nanoparticle.

[0456] In some embodiments, the neutral lipid (e.g., a neutral lipid of Formula (II-i)) comprises about 5 mol %, 6 mol %, 7 mol %, 8 mol %, 9 mol %, 10 mol %, 11 mol %, 12 mol %, 13 mol %, 14 mol %, or 15 mol % of the lipid component of the lipid nanoparticle.

[0457] In some embodiments, the neutral lipid (e.g., a neutral lipid of Formula (II-i)) comprises about 10 mol % of the lipid component of the lipid nanoparticle.

[0458] Pegylated lipids

[0459] The lipid nanoparticles described herein comprise one or more pegylated lipids. Without wishing to be bound by theory, pegylated lipids may help to tune population size, improve dispersity, prevent aggregation, and improve storage stability of lipid nanoparticles. Other beneficial properties of pegylated lipids include improved nucleic acid encapsulation efficiency, pharmacokinetic properties, and immunogenicity of the lipid nanoparticles.

[0460] In some embodiments, the pegylated lipid is a compound of Formula (III): Attorney Docket No.: F2099-7045WO wherein each of R31and R52is independently alkyl, alkenyl, or alkynyl, each of which is optionally substituted with one or more R53; X is a bond, - C(O)O-, -OC(O) -, -C(O)N(R')-, -N(R’)C(O)-, -C(O)-, or -CH(OH)-; R33is alkyl, alkenyl, alkynyl, or heteroalkyl, each of which is optionally substituted with one or more R36; each of R’ is hydrogen or alkyl.

[0461] In some embodiments, the compound of Formula (III) is a compound of Formula (Ill-a): wherein each of R31and R52is independently alkyl, alkenyl, or alkynyl, each of which is optionally substituted with one or more R33. wherein each of R51and R52is independently alkyl, alkenyl, or alkynyl, each of which is optionally substituted with one or more R33.

[0462] In some embodiments, the pegylated lipid is a compound of Formula (IV): pharmaceutically acceptable salt, tautomer or stereoisomer thereof, wherein each of R61and R62is independently alkyl, alkenyl, or heteroalkyl, each of which is optionally substituted with one or more R63; and, the average value for w is an integer from 30 to 60.

[0463] In some embodiments of Formula (IV), each of R61and R62is independently branched or straight chain alkyl. In some embodiments of Formula (IV), each of R61and R62is independently branched or straight chain alkenyl.

[0464] In some embodiments of Formula (IV), each of R61and R62is independently alkyl or alkenyl. In some embodiments of Formula (IV), each of R61and R62is independently C10-C30 Attorney Docket No.: F2099-7045WO alkyl or C10-C30 alkenyl. In some embodiments of Formula (IV), each of R61and R62is independently C10-C30 alkyl. In some embodiments of Formula (IV), each of R61and R62is independently C10-C30 alkenyl.

[0465] In some embodiments of Formula (IV), each of R61and R62is independently C12-C16 alkyl. In some embodiments of Formula (IV), each of R61and R62is independently straight chain C12-C16 alkyl. In some embodiments of Formula (IV), each of R61and R62is independently C12- Ci6 alkenyl. In some embodiments of Formula (IV), each of R61and R62is independently straight chain C12-C16 alkenyl. In some embodiments of Formula (IV), each of R61and R62is independently straight chain C13 alkyl. In some embodiments of Formula (IV), R61is straight chain C13 alkyl. In some embodiments of Formula (IV), R62is straight chain C13 alkyl.

[0466] In some embodiments of Formula (IV), w is an integer from 40 to 60. In some embodiments of Formula (IV), w is an integer from 42 to 55.

[0467] In some embodiments, the pegylated lipid is a compound of Formula (IV-a): Formula (IV-a), or a pharmaceutically acceptable salt, tautomer or stereoisomer thereof, wherein: the average value for w is an integer from 42-55.

[0468] In some embodiments, the pegylated lipid is PEG-DAG, PEG-PE, PEG-S-DAG, PEG-cer or a PEG dialkyoxypropylcarbamate.

[0469] In some embodiments, the pegylated lipid is PEG-DMG.

[0470] In certain embodiments, the pegylated lipid has the following Formula (IV): or a pharmaceutically acceptable salt, tautomer, or stereoisomer thereof, wherein:

[0471] R10and R11are each independently a straight or branched, alkyl, alkenyl or alkynyl from 10 to 30 carbon atoms, wherein the alkyl, alkenyl or alkynyl is optionally interrupted by one or more ester bonds; and w has a value ranging from 30 to 60. Attorney Docket No.: F2099-7045WO

[0472] In certain embodiments, R10and R11are each independently straight alkyl chain containing from 12 to 16 carbon atoms. In some embodiments, the average w is about 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55. In some embodiments, the average w is about 49. In certain embodiments, w has a value ranging from 30 to 60. In some embodiments, w ranges from 40-50. In some embodiments, w is 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50.

[0473] In an embodiment, the pegylated lipid is a compound of Formula (V): wherein n is an average of between about 15 and about 75. between 15-75.

[0474] In an embodiment, the pegylated lipid of Formula (V) is Compound 42-6: , wherein n is an average of about 45. ( / .<?., 2-[2-(w-methoxy (polyethyleneglycol2000) ethoxy]-N,N- di tetradecyl acetami de) .

[0475] In certain embodiments, the pegylated lipids has the following structure: wherein the average value for w ranges from 42 to 55.

[0476] In some embodiments, the lipid nanoparticle or composition comprises a plurality of pegylated lipids of Formula (IV) and the average w for the plurality ranges from 40-50 or 42-55. In some embodiments, the average w is 43, 44, 45, 46, 47, or 48. Synthesis of pegylated lipids can be found in US Patent No. 9,738,593, the disclosure of which is hereby incorporated by reference.

[0477] In some embodiments, a PEG lipid is selected from the group consisting of: PEG-c- DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid. Attorney Docket No.: F2099-7045WO

[0478] In certain embodiments, the polymer conjugated lipid is a pegylated lipid. For example, some embodiments include a pegylated diacylglycerol (PEG-DAG) such as l-(monomethoxy-polyethyleneglycol)-2,3-dimyristoylglycerol (PEG-DMG), a pegylated phosphatidylethanoloamine (PEG-PE), a PEG succinate di acylglycerol (PEG-S-DAG) such as 4- O-(2’,3’-di(tetradecanoyloxy)propyl-l-O-(a>-methoxy(polyethoxy)ethyl)butanedioate (PEG-S- DMG), a pegylated ceramide (PEG-cer), or a PEG dialkoxypropylcarbamate such as ra- methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecanoxy)propyl)carbamate or 2,3- di(tetradecanoxy)propyl-N-(c£>-methoxy(polyethoxy)ethyl)carbamate.

[0479] In some embodiments, the pegylated lipid (e.g., a pegylated lipid of Formula (III)) comprises from about 0.1 mol % to about 5 mol % (e.g., from about 0.2 mol % to about 4 mol %, 0.2 mol % to about 3.8 mol %, 0.2 mol % to about 3.6 mol %, 0.2 mol % to about 3.4 mol %, 0.2 mol % to about 3.2 mol %, 0.2 mol % to about 3.0 mol %, 0.2 mol % to about 2.8 mol %, 0.2 mol % to about 2.6 mol %, 0.2 mol % to about 2.4 mol %, 0.2 mol % to about 2.2 mol %, 0.2 mol % to about 2.0 mol %, 0.2 mol % to about 1.8 mol %, 0.2 mol % to about 1.6 mol %, 0.2 mol % to about 1.4 mol %, 0.2 mol % to about 1.2 mol %, 0.2 mol % to about 1.0 mol %, 0.2 mol % to about 0.8 mol %, 0.2 mol % to about 0.6 mol %, 0.2 mol % to about 0.4 mol %, 0.4 mol % to about 4 mol %, 0.4 mol % to about 3.8 mol %, 0.4 mol % to about 3.6 mol %, 0.4 mol % to about 3.4 mol %, 0.4 mol % to about 3.2 mol %, 0.4 mol % to about 3.0 mol %, 0.4 mol % to about 2.8 mol %, 0.4 mol % to about 2.6 mol %, 0.4 mol % to about 2.4 mol %, 0.4 mol % to about 2.2 mol %, 0.4 mol % to about 2.0 mol %, 0.4 mol % to about 1.8 mol %, 0.4 mol % to about 1.6 mol %, 0.4 mol % to about 1.4 mol %, 0.4 mol % to about 1.2 mol %, 0.4 mol % to about 1.0 mol %, 0.4 mol % to about 0.8 mol %, 0.4 mol % to about 0.6 mol %, 0.6 mol % to about 4 mol %, 0.6 mol % to about 3.8 mol %, 0.6 mol % to about 3.6 mol %, 0.6 mol % to about 3.4 mol %, 0.6 mol % to about 3.2 mol %, 0.6 mol % to about 3.0 mol %, 0.6 mol % to about 2.8 mol %, 0.6 mol % to about 2.6 mol %, 0.6 mol % to about 2.4 mol %, 0.6 mol % to about 2.2 mol %, 0.6 mol % to about 2.0 mol %, 0.6 mol % to about 1.8 mol %, 0.6 mol % to about 1.6 mol %, 0.6 mol % to about 1.4 mol %, 0.6 mol % to about 1.2 mol %, 0.6 mol % to about 1.0 mol %, 0.6 mol % to about 0.8 mol %, 0.8 mol % to about 4 mol %, 0.8 mol % to about 3.8 mol %, 0.8 mol % to about 3.6 mol %, 0.8 mol % to about 3.4 mol %, 0.8 mol % to about 3.2 mol %, 0.8 mol % to about 3.0 mol %, 0.8 mol % to about 2.8 mol %, 0.8 mol % to about 2.6 mol %, 0.8 mol % to about 2.4 mol %, 0.8 mol % to about 2.2 mol %, 0.8 mol % to Attorney Docket No.: F2099-7045WO about 2.0 mol %, 0.8 mol % to about 1.8 mol %, 0.8 mol % to about 1 .6 mol %, 0.8 mol % to about 1.4 mol %, 0.8 mol % to about 1.2 mol %, 0.8 mol % to about 1.0 mol %, 1.0 mol % to about 4 mol %, 1.0 mol % to about 3.8 mol %, 1.0 mol % to about 3.6 mol %, 1.0 mol % to about 3.4 mol %, 1.0 mol % to about 3.2 mol %, 1.0 mol % to about 3.0 mol %, 1.0 mol % to about 2.8 mol %, 1.0 mol % to about 2.6 mol %, 1.0 mol % to about 2.4 mol %, 1.0 mol % to about 2.2 mol %, 1.0 mol % to about 2.0 mol %, 1.0 mol % to about 1.8 mol %, 1.0 mol % to about 1.6 mol %, 1.0 mol % to about 1.4 mol %, 1.0 mol % to about 1.2 mol %, 1.2 mol % to about 4 mol %, 1.2 mol % to about 3.8 mol %, 1.2 mol % to about 3.6 mol %, 1.2 mol % to about 3.4 mol %, 1.2 mol % to about 3.2 mol %, 1.2 mol % to about 3.0 mol %, 1.2 mol % to about 2.8 mol %, 1.2 mol % to about 2.6 mol %, 1.2 mol % to about 2.4 mol %, 1.2 mol % to about 2.2 mol %, 1.2 mol % to about 2.0 mol %, 1.2 mol % to about 1.8 mol %, 1.2 mol % to about 1.6 mol %, 1.2 mol % to about 1.4 mol %, 1.4 mol % to about 4 mol %, 1.4 mol % to about 3.8 mol %, 1.4 mol % to about 3.6 mol %, 1.4 mol % to about 3.4 mol %, 1.4 mol % to about 3.2 mol %, 1.4 mol % to about 3.0 mol %, 1.4 mol % to about 2.8 mol %, 1.4 mol % to about 2.6 mol %, 1.4 mol % to about 2.4 mol %, 1.4 mol % to about 2.2 mol %, 1.4 mol % to about 2.0 mol %, 1.4 mol % to about 1.8 mol %, 1.4 mol % to about 1.6 mol %,

[0480] In some embodiments, the pegylated lipid (e.g., a pegylated lipid of Formula (III)) comprises greater than 0.1 mol %, 0.2 mol %, 0.3 mol %, 0.4 mol %, 0.5 mol %, 0.6 mol %, 0.7 mol %, 0.8 mol %, 0.9 mol %, 1.0 mol %, 1.1 mol %, 1.2 mol %, 1.3 mol %, 1.4 mol %, 1.5 mol %, 1.6 mol %, 1.7 mol %, 1.8 mol %, 1.9 mol %, 2.0 mol %, 2.1 mol %, 2.2 mol %, 2.3 mol %, 2.4 mol %, 2.5 mol %, 2.6 mol %, 2.7 mol %, 2.8 mol %, 2.9 mol %, 3.0 mol %, 3.1 mol %, 3.2 mol %, 3.3 mol %, 3.4 mol %, 3.5 mol %, 3.6 mol %, 3.7 mol %, 3.8 mol %, 3.9 mol %, or 4.0 mol % of the lipid component of the lipid nanoparticle.

[0481] In some embodiments, the pegylated lipid (e.g., a pegylated lipid of Formula (III)) comprises less than 0.1 mol %, 0.2 mol %, 0.3 mol %, 0.4 mol %, 0.5 mol %, 0.6 mol %, 0.7 mol %, 0.8 mol %, 0.9 mol %, 1.0 mol %, 1.1 mol %, 1.2 mol %, 1.3 mol %, 1.4 mol %, 1.5 mol %, 1.6 mol %, 1.7 mol %, 1.8 mol %, 1.9 mol %, 2.0 mol %, 2.1 mol %, 2.2 mol %, 2.3 mol %, 2.4 mol %, 2.5 mol %, 2.6 mol %, 2.7 mol %, 2.8 mol %, 2.9 mol %, 3.0 mol %, 3.1 mol %, 3.2 mol %, 3.3 mol %, 3.4 mol %, 3.5 mol %, 3.6 mol %, 3.7 mol %, 3.8 mol %, 3.9 mol %, 4.0 mol % of the lipid component of the lipid nanoparticle. Attorney Docket No.: F2099-7045WO

[0482] In some embodiments, the pegylated lipid (e.g, a pegylated lipid of Formula (III)) comprises about 0 than 0.1 mol %, 0.2 mol %, 0.3 mol %, 0.4 mol %, 0.5 mol %, 0.6 mol %, 0.7 mol %, 0.8 mol %, 0.9 mol %, 1.0 mol %, 1.1 mol %, 1.2 mol %, 1.3 mol %, 1.4 mol %, 1.5 mol %, 1.6 mol %, 1.7 mol %, 1.8 mol %, 1.9 mol %, 2.0 mol %, 2.1 mol %, 2.2 mol %, 2.3 mol %, 2.4 mol %, 2.5 mol %, 2.6 mol %, 2.7 mol %, 2.8 mol %, 2.9 mol %, 3.0 mol %, 3.1 mol %, 3.2 mol %, 3.3 mol %, 3.4 mol %, 3.5 mol %, 3.6 mol %, 3.7 mol %, 3.8 mol %, 3.9 mol %, 4.0 mol % of the lipid component of the lipid nanoparticle.

[0483] Sterols

[0484] The lipid nanoparticles described herein comprise one or more sterols (e.g., cholesterol or a cholesterol derivative). Without wishing to be bound by theory, sterols may reduce protein adsorption and improve overall pharmacokinetic properties of a lipid nanoparticle.

[0485] In some embodiments, the sterol is selected from the group consisting of cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, and derivatives thereof.

[0486] In some embodiments, the sterol is cholesterol or a derivative thereof.

[0487] In some embodiments, the sterol (e.g., a sterol described herein, e.g., cholesterol) comprises from about 10 mol % to about 60 mol % e.g., from about 10 mol % to about 55 mol %, about 10 mol % to about 50 mol %, about 10 mol % to about 45 mol %, about 10 mol % to about 40 mol %, about 10 mol % to about 35 mol %, about 10 mol % to about 30 mol %, about 10 mol % to about 25 mol %, about 10 mol % to about 20 mol %, about 10 mol % to about 15 mol %, about 15 mol % to about 60 mol %, about 15 mol % to about 55 mol %, about 15 mol % to about 50 mol %, about 15 mol % to about 45 mol %, about 15 mol % to about 40 mol %, about 15 mol % to about 35 mol %, about 15 mol % to about 30 mol %, about 15 mol % to about 25 mol %, about 15 mol % to about 20 mol %, about 20 mol % to about 60 mol %, about 20 mol % to about 55 mol %, about 20 mol % to about 50 mol %, about 20 mol % to about 45 mol %, about 20 mol % to about 40 mol %, about 20 mol % to about 35 mol %, about 20 mol % to about 30 mol %, about 20 mol % to about 25 mol %, about 25 mol % to about 60 mol %, about 25 mol % to about 55 mol %, about 25 mol % to about 50 mol %, about 25 mol % to about 45 mol %, about 25 mol % to about 40 mol %, about 25 mol % to about 35 mol %, about 25 mol % to about 30 mol %, about 30 mol % to about 60 mol %, about 30 mol % to about 55 mol %, about 30 mol % to about 50 mol %, about 30 mol % to about 45 mol %, about 30 mol % to about 40 mol %, Attorney Docket No.: F2099-7045WO about 30 mol % to about 35 mol %, about 35 mol % to about 60 mol %, about 35 mol % to about 55 mol %, about 35 mol % to about 50 mol %, about 35 mol % to about 45 mol %, about 35 mol % to about 40 mol %, about 40 mol % to about 60 mol %, about 40 mol % to about 55 mol %, about 40 mol % to about 50 mol %, about 40 mol % to about 45 mol %, about 45 mol % to about 60 mol %, about 45 mol % to about 55 mol %, about 45 mol % to about 50 mol %, about 50 mol % to about 60 mol %, about 50 mol % to about 55 mol %, or about 55 mol % to about 60 mol%) of the lipid component of the lipid nanoparticle.

[0488] In some embodiments, the sterol (e.g., a sterol described herein, e.g., cholesterol) comprises greater than about 10 mol %, 15 mol %, 20 mol %, 25 mol %, 30 mol %, 35 mol %, 40 mol %, 45 mol %, 50 mol %, 55 mol %, or 60 mol % of the lipid component of the lipid nanoparticle.

[0489] In some embodiments, the sterol (e.g., a sterol described herein, e.g, cholesterol) comprises greater than about 30 mol %, 35 mol %, or 40 mol of the lipid component of the lipid nanoparticle.

[0490] In some embodiments, the sterol (e.g., a sterol described herein, e.g., cholesterol) comprises greater than about 35 mol % of the lipid component of the lipid nanoparticle.

[0491] In some embodiments, the sterol (e.g., a sterol described herein, e.g., cholesterol) comprises greater than about 40 mol % of the lipid component of the lipid nanoparticle.

[0492] In some embodiments, the sterol (e.g., a sterol described herein, e.g., cholesterol) comprises from about 35 mol % to 45 mol % of the lipid component of the lipid nanoparticle.

[0493] In some embodiments, the sterol (e.g., a sterol described herein, e.g., cholesterol) comprises from about 39 mol % to 41 mol % of the lipid component of the lipid nanoparticle.

[0494] In some embodiments, the sterol (e.g., a sterol described herein, e.g., cholesterol) comprises less than about 10 mol %, 15 mol %, 20 mol %, 25 mol %, 30 mol %, 35 mol %, 40 mol %, 45 mol %, 50 mol %, 55 mol %, or 60 mol % of the lipid component of the lipid nanoparticle.

[0495] In some embodiments, the sterol (e.g., a sterol described herein, e.g., cholesterol) comprises about 10 mol %, 15 mol %, 20 mol %, 25 mol %, 30 mol %, 35 mol %, 40 mol %, 45 mol %, 50 mol %, 55 mol %, or 60 mol % of the lipid component of the lipid nanoparticle.

[0496] Features of Lipid Nanoparticles Attorney Docket No.: F2099-7045WO

[0497] The present disclosure provides lipid nanoparticles and formulations thereof which are useful for facilitating the intracellular delivery of therapeutic agents such as nucleic acids (e.g., a TREM described herein). In preferred embodiments, the lipid component of a lipid nanoparticle comprises an ionizable lipid (e.g., a cationic lipid), a neutral lipid (e.g., a phospholipid), a pegylated lipid, and a sterol.

[0498] In some embodiments, a lipid nanoparticle comprises: (i) an ionizable lipid; (ii) a neutral lipid; (iii) a sterol; (iv) a pegylated lipid; and, (v) a TREM; wherein each of (i)-(v) are as described herein.

[0499] In some embodiments, a lipid nanoparticle comprises: (i) an ionizable lipid; (ii) a neutral lipid; (iii) a sterol; (iv) a pegylated lipid; and, (v) a TREM comprising the nucleotide sequence of one of SEQ ID NO: 1 or SEQ ID NO: 2.

[0500] In some embodiments, a lipid nanoparticle comprises: (i) an ionizable lipid; (ii) a neutral lipid; (iii) a sterol; (iv) a pegylated lipid; and, (v) a TREM comprising the nucleotide sequence of SEQ ID NO: 1.

[0501] In some embodiments, a lipid nanoparticle comprises: (i) an ionizable lipid; (ii) a neutral lipid; (iii) a sterol; (iv) a Pegylated lipid; and, (v) a TREM comprising the nucleotide sequence of SEQ ID NO: 2.

[0502] In some embodiments, a lipid nanoparticle comprises: (i) an ionizable lipid of Formula (I); (ii) a neutral lipid of Formula (Il-i); (iii) a sterol; (iv) a pegylated lipid of Formula (III); and, (v) a TREM composition.

[0503] In some embodiments, a lipid nanoparticle comprises: (i) an ionizable lipid of Formula (I); (ii) a neutral lipid of Formula (Il-i); (iii) a sterol; (iv) a pegylated lipid of Formula (III); and, (v) a TREM comprising the nucleotide sequence of one of SEQ ID NO: 1 or SEQ ID NO: 2.

[0504] In some embodiments, a lipid nanoparticle comprises: (i) an ionizable lipid of Formula (I); (ii) a neutral lipid of Formula (Il-i); (iii) a sterol; (iv) a pegylated lipid of Formula (III); and, (v) a TREM comprising the nucleotide sequence SEQ ID NO: 1.

[0505] In some embodiments, a lipid nanoparticle comprises: (i) an ionizable lipid of Formula (I); (ii) a neutral lipid of Formula (Il-i); (iii) a sterol; (iv) a pegylated lipid of Formula (III); and, (v) a TREM comprising the nucleotide sequence SEQ ID NO: 2. Attorney Docket No.: F2099-7045WO

[0506] In some embodiments, a lipid nanoparticle comprises: (i) an ionizable lipid; (ii) 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC); (iii) cholesterol; (iv) a pegylated lipid; and, (v) a TREM.

[0507] In some embodiments, a lipid nanoparticle comprises: (i) an ionizable lipid of Formula (I); (ii) l,2-distearoyl-sn-glycero-3 -phosphocholine (DSPC); (iii) cholesterol; (iv) a pegylated lipid of Formula (III); and, (v) a TREM comprising the nucleotide sequence of one of SEQ ID NO: 1 or SEQ ID NO: 2.

[0508] In some embodiments, a lipid nanoparticle comprises: (i) an ionizable lipid of Formula (I); (ii) l,2-distearoyl-sn-glycero-3 -phosphocholine (DSPC); (iii) cholesterol; (iv) a pegylated lipid of Formula (III); and, (v) a TREM comprising the nucleotide sequence of SEQ ID NO: 1.

[0509] In some embodiments, a lipid nanoparticle comprises: (i) an ionizable lipid of Formula (I); (ii) l,2-distearoyl-sn-glycero-3 -phosphocholine (DSPC); (iii) cholesterol; (iv) a pegylated lipid of Formula (III); and, (v) a TREM comprising the nucleotide sequence of SEQ ID NO: 2.

[0510] In some embodiments, a lipid nanoparticle comprises: (i) 20-60 mol % ionizable lipid; (ii) 5-25 mol % neutral lipid; (iii) 25-55 mol % sterol; (iv) 0.5-15% pegylated lipid; and, (v) a TREM; wherein the mol percentages of (i)-(v) do not exceed 100%.

[0511] In some embodiments, a lipid nanoparticle comprises: (i) 47.5mol % of Structure 1-45;

[0512] (ii) 10 mol % of l,2-distearoyl-sn-glycero-3 -phosphocholine (DSPC); (iii) 2.5 mol % of Compound 42-6; (iv) 40 mol % cholesterol; and (v) a TREM comprising the nucleotide sequence of one of SEQ ID NO: 1 or SEQ ID NO: 2; wherein the mol % is based on total moles of lipid components in the LNP.

[0513] In some embodiments, the molar ratio of ionization (e.g., cationic) lipid to RNA phosphate (i.e., N / P ratio) is between 1 : 1 to 10: 1. In some embodiments, the N / P ratio is between l : l to 9: l, 1:1 to 8:1, 1:1 to 7:1, 1:1 to 6:1, 1:1 to 5:1, l : l to 4:l, 1:1 to 3:1, 1: 1 to 2:1, or 1 : 1 to 1.5: 1.

[0514] In some embodiments, the N / P ratio is greater than 10:1. In some embodiments, the N / P ratio is greater than 9:1, 8: 1, 7: 1, 6:1, 5: 1, 4: 1, 3: 1, 2: 1, or 1.5: 1.

[0515] In some embodiments, the N / P ratio is less than 10: 1. In some embodiments, the N / P ratio is less than 9:1, 8: 1, 7:1, 6: 1, 5: 1, 4: 1, 3: 1, 2:1, or 1.5:1.

[0516] In some embodiments, the N / P ratio is about 2: 1 2.5: 1, 3: 1, 3.5: 1, 4: 1, 4.5: 1, 5: 1, 5.5: 1,

[0517] 6: 1, 6.5: 1, or 7: 1. Attorney Docket No.: F2099-7045WO

[0518] In some embodiments, the N / P ratio is about 3:1. In some embodiments, the N / P ratio is about 4.5:1. In some embodiments, the N / P ratio is about 6:1.

[0519] In some embodiments, the molar ratio of the cationic lipid to the neutral lipid is about 2: 1 to about 8:1 (e.g., about 2:1 to about 7:1, about 2:1 to about 6:1, about 2:1 to about 5:1, about 2:1 to about 4:1, about 2:1 to about 3:1, about 3:1 to about 7:1, about 3:1 to about 6:1, about 3:1 to about 5:1, about 3:1 to about 4:1, about 4:1 to about 7:1, about 4:1 to about 6:1, about 4:1 to about 5:1, about 5:1 to about 7:1, about 5:1 to about 6:1, or about 6:1 to about 7:1).

[0520] In some embodiments, the molar ratio of the cationic lipid to the sterol is from about 1 : 1 to about 5:1 (e.g., about 2:1 to 4:1, 2:1 to 3:1, 3:1 to 5:1, 3:1 to 4:1, or 4:1 to 5:1) in the lipid component of the lipid nanoparticle.

[0521] In some embodiments, the molar ratio of the cationic lipid to polymer-conjugated lipid ranges from about 10:1 to about 100:1 (e.g., from about 10:1 to about 95:1, about 10:1 to about 90:1, about 10:1 to about 85:1, about 10:1 to about 80:1, about 10:1 to about 75:1, about 10:1 to about 70:1, about 10:1 to about 65:1, about 10:1 to about 60:1, about 10:1 to about 55:1, about 10:1 to about 50:1, about 10:1 to about 45:1, about 10:1 to about 40:1, about 10:1 to about 35:1, about 10:1 to about 30:1, about 10:1 to about 25:1, about 10:1 to about 20:1, about 10:1 to about 15:1, about 10:1 to about 35:1).

[0522] In some embodiments, the ratio (wt / wt) between the lipid component and the TREM can be about 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1,20:1,21:1,22:1,23:1,24:1, 25:1, 26:1, 27:1, 28:1, 29:1, 30:1, 31:1, 32:1, 33:1, 34:1, 35:1, 36:1, 37:1, 38:1, 39:1, 40:1, 41:1, 42:1, 43:1, 44:1, 45:1, 46:1, 47:1, 48:1, 49:1, 50:1, 51:1, 52:1, 53:1, 54:1, 55:1, 56:1, 57:1, 58:1, 59:1 or 60:1.

[0523] In some embodiments, the lipid nanoparticles described herein have a diameter from about 1 nm to about 1000 nm (e.g., about 10 nm to about 900 nm, about 10 nm to about 800 nm, about 10 nm to about 700 nm, about 10 nm to about 600 nm, about 10 nm to about 500 nm, about 10 nm to about 400 nm, about 10 nm to about 300 nm, about 10 nm to about 200 nm, about 10 nm to about 100 nm, about 50 nm to about 900 nm, about 50 nm to about 800 nm, about 50 nm to about 700 nm, about 50 nm to about 600 nm, about 50 nm to about 500 nm, about 50 nm to about 400 nm, about 50 nm to about 300 nm, about 50 nm to about 200 nm, about 50 nm to about 100 nm, about 100 nm to about 900 nm, about 100 nm to about 800 nm, about 100 nm to about 700 nm, about 100 nm to about 600 nm, about 100 nm to about 500 nm, Attorney Docket No.: F2099-7045WO about 100 nm to about 400 nm, about 100 nm to about 300 nm, about 100 nm to about 200 nm, about 200 nm to about 900 nm, about 200 nm to about 800 nm, about 200 nm to about 700 nm, about 200 nm to about 600 nm, about 200 nm to about 500 nm, about 200 nm to about 400 nm, about 200 nm to about 300 nm, about 300 nm to about 900 nm, about 300 nm to about 800 nm, about 300 nm to about 700 nm, about 300 nm to about 600 nm, about 300 nm to about 500 nm, about 300 nm to about 400 nm, about 400 nm to about 800 nm, about 400 nm to about 700 nm, about 400 nm to about 600 nm, or about 400 nm to about 500 nm).

[0524] In some embodiments, the lipid nanoparticles described herein have a diameter greater than about 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 150 nm, 200 nm, 250 nm, 300 nm, 350 nm, 400 nm, 500 nm, 600 nm, 650 nm, 700 nm, 750 nm, 800 nm, 850 nm, 900 nm, 950 nm, or 1000 nm.

[0525] In some embodiments, the lipid nanoparticles described herein have a diameter less than about 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 150 nm, 200 nm, 250 nm, 300 nm, 350 nm, 400 nm, 500 nm, 600 nm, 650 nm, 700 nm, 750 nm, 800 nm, 850 nm, 900 nm, 950 nm, or 1000 nm.

[0526] In some embodiments, the lipid nanoparticles described herein have a diameter of about 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 150 nm, 200 nm, 250 nm, 300 nm, 350 nm, 400 nm, 500 nm, 600 nm, 650 nm, 700 nm, 750 nm, 800 nm, 850 nm, 900 nm, 950 nm, or 1000 nm.

[0527] In some embodiments, the lipid nanoparticles described herein have a diameter between about 40-100 nm. In some embodiments, the lipid nanoparticles described herein have a diameter between about 50-100 nm.

[0528] In some embodiments, the lipid nanoparticles described herein have a diameter from 50 nm to 70 nm, from 55 nm to 65 nm, from 50 nm to 60 nm, from 60 nm to 70 nm, from 70 nm to 80 nm or from 80 nm to 90 nm. In some embodiments, the lipid nanoparticles described herein have a diameter of about 47 nm, about 48 nm, about 49 nm, about 50 nm, about 51 nm, about 52 nm, about 53 nm, about 54 nm, about 55 nm, about 56 nm, about 57 nm, about 58 nm, about 59 nm, about 60 nm, about 61 nm, about 62 nm, about 63 nm, about 64 nm, about 65 nm, about 66 nm, about 67 nm, about 68 nm, about 69 nm, about 70 nm, about 71 nm, about 72 nm, about 73 nm, about 74 nm, about 75 nm, about 76 nm, about 77 nm, about 78 nm, about 79 nm, about 80 nm, about 81 nm, about 82 nm, about 83 nm, about 84 nm or about 85 nm. Attorney Docket No.: F2099-7045WO

[0529] In some embodiments, the lipid nanoparticle described herein have an encapsulation efficiency of greater than 80%, greater than 81%, greater than 82%, greater than 83%, greater than 84%, greater than 85%, greater than 86%, greater than 87%, greater than 88%, greater than 89%, greater than 90%, greater than 91%, greater than 92%, greater than 93%, greater than 94%, greater than 95%, greater than 96%, greater than 97%, greater than 98%, greater than 99%, greater than 99.5%, or greater than 99.9%.

[0530] In some embodiments, the lipid nanoparticles have a poly dispersity index ranging from 0 to 0.25, from about 0.10 to about 0.20, about 0.05 to about 0.15, less than about 0.1 or less than about 0.15. In some embodiments, the lipid nanoparticles have a poly dispersity index of less than 0.2.

[0531] In some embodiments, the lipid nanoparticles have an encapsulation efficiency of greater than 90%, e.g., greater than 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9%.

[0532] Lipid nanoparticle (LNP) compositions

[0533] TREM-containing lipid nanoparticles (LNPs) as described herein may be prepared according to the general procedures described in PCT Pub. Nos. WO 2015 / 199952 and WO 2017 / 075531. In an embodiment, an ionizable lipid of Formula (I), DSPC, cholesterol and neutral lipid of Formula (Il-i) may be solubilized in ethanol at a molar ratio of 47.5: 10:40:2.5. tRNA-containing lipid nanoparticles (LNP) may then be prepared at a total lipid : tRNA weight ratio of approximately 10: 1 to 40: 1. tRNA may then be diluted to about 0.2 mg / mL in 10 to 50 mM citrate buffer, pH 4 to 6 or 10 to 25 mM acetate buffer, pH 4 to 6. Syringe pumps may be used to mix the ethanolic lipid solution with the tRNA aqueous solution at a ratio of about 1:5 to 1 :3 (vol / vol) with total flow rates above 15 mL / min. The ethanol is then removed, and the external buffer replaced with PBS by dialysis. Finally, the tRNA-containing lipid nanoparticles may be filtered through a 0.2 pm pore sterile filter.

[0534] Use of TREMs

[0535] A TREM composition (e.g., a pharmaceutical TREM composition described herein) can modulate a function in a cell, tissue or subject. In embodiments, a TREM composition (e.g., a pharmaceutical TREM composition) described herein is contacted with a cell or tissue, or administered to a subject in need thereof, in an amount and for a time sufficient to modulate Attorney Docket No.: F2099-7045WO

[0536] (increase or decrease) one or more of the following parameters: adaptor function (e.g., cognate or non-cognate adaptor function), e.g., the rate, efficiency, robustness, and / or specificity of initiation or elongation of a polypeptide chain; ribosome binding and / or occupancy; regulatory function (e.g., gene silencing or signaling); cell fate; mRNA stability; protein stability; protein transduction; protein compartmentalization. A parameter may be modulated, e.g., by at least 5% (e.g., at least 10%, 15%, 20%, 25%, 30%, 40%. 50%. 60%. 70%, 80%, 90%, 100%, 150%, 200% or more) compared to a reference tissue, cell or subject (e.g., a healthy, wild-type or control cell, tissue or subject).

[0537] All references and publications cited herein are hereby incorporated by reference.

[0538] The following examples are provided to further illustrate some embodiments of the present disclosure, but are not intended to limit the scope of the invention; it will be understood by their exemplary nature that other procedures, methodologies, or techniques known to those skilled in the art may alternatively be used.

[0539] In one aspect, administration of a TREM composition (e.g., a pharmaceutical TREM composition described herein), for example, a TREM formulated in a lipid nanoparticle (LNP) modulates the level of a cytokine in a sample, e.g., a cell or subject. For example, administration of a TREM formulated in an LNP may modulate the level of IL-6, IL-10, IP-10, MCP-1, IFN- gamma, and IL-lbeta. In an embodiment, administration of a TREM formulated in an LNP increases the level of a cytokine in a sample, e.g., a cell or subject. In an embodiment, administration of a TREM formulated in an LNP decreases the level of a cytokine in a sample, e.g., a cell or subject. In an embodiment, upon administration of a TREM formulated in an LNP modulates the level of interleukin 6 (IL-6) in a sample, e.g., by at least 10%, 15%, 20%, 25%, 30%, 40%. 50%. 60%. 70%, 80%, 90%, 100%, 150%, 200% or more compared to a reference tissue, cell or subject (e.g., a healthy, wild-type or control cell, tissue or subject). In an embodiment, upon administration of a TREM formulated in an LNP modulates the level of interleukin 10 (IL-10) in a sample, e.g., by at least 10%, 15%, 20%, 25%, 30%, 40%. 50%. 60%. 70%, 80%, 90%, 100%, 150%, 200% or more compared to a reference tissue, cell or subject (e.g., a healthy, wild-type or control cell, tissue or subject). In an embodiment, upon administration of a TREM formulated in an LNP modulates the level of interferon gammainduced protein (IP-10) in a sample, e.g., by at least 10%, 15%, 20%, 25%, 30%, 40%. 50%. 60%. 70%, 80%, 90%, 100%, 150%, 200% or more compared to a reference tissue, cell or Attorney Docket No.: F2099-7045WO subject (e.g., a healthy, wild-type or control cell, tissue or subject). In an embodiment, upon administration of a TREM formulated in an LNP modulates the level of monocyte chemoattractant protein 1 (MCP-1) in a sample, e.g., by at least 10%, 15%, 20%, 25%, 30%, 40%. 50%. 60%. 70%, 80%, 90%, 100%, 150%, 200% or more compared to a reference tissue, cell or subject (e.g., a healthy, wild-type or control cell, tissue or subject). In an embodiment, upon administration of a TREM formulated in an LNP modulates the level of interferon gamma (IFN-gamma) in a sample, e.g., by at least 10%, 15%, 20%, 25%, 30%, 40%. 50%. 60%. 70%, 80%, 90%, 100%, 150%, 200% or more compared to a reference tissue, cell or subject (e.g., a healthy, wild-type or control cell, tissue or subject). In an embodiment, upon administration of a TREM formulated in an LNP modulates the level of interleukin Ibeta (IL-lbeta) in a sample, e.g., by at least 10%, 15%, 20%, 25%, 30%, 40%. 50%. 60%. 70%, 80%, 90%, 100%, 150%, 200% or more compared to a reference tissue, cell or subject (e.g., a healthy, wild-type or control cell, tissue or subject).

[0540] In another aspect, administration of a TREM composition (e.g., a pharmaceutical TREM composition described herein), for example, a TREM formulated in a lipid nanoparticle (LNP) modulates the level of a liver biomarker in a sample, e.g., a cell or subject. For example, administration of a TREM formulated in an LNP may modulate the level of alanine transaminase (ALT), bilirubin, or platelet levels. In an embodiment, administration of a TREM formulated in an LNP increases the level of a liver biomarker in a sample, e.g., a cell or subject. In an embodiment, administration of a TREM formulated in an LNP decreases the level of a liver biomarker in a sample, e.g., a cell or subject. In an embodiment, upon administration of a TREM formulated in an LNP modulates the level of ALT in a sample, e.g., by at least 10%, 15%, 20%, 25%, 30%, 40%. 50%. 60%. 70%, 80%, 90%, 100%, 150%, 200% or more compared to a reference tissue, cell or subject (e.g., a healthy, wild-type or control cell, tissue or subject). In an embodiment, upon administration of a TREM formulated in an LNP modulates the level of bilirubin in a sample, e.g., by at least 10%, 15%, 20%, 25%, 30%, 40%. 50%. 60%. 70%, 80%, 90%, 100%, 150%, 200% or more compared to a reference tissue, cell or subject (e.g., a healthy, wild-type or control cell, tissue or subject). In an embodiment, upon administration of a TREM formulated in an LNP modulates the level of platelets in a sample, e.g., by at least 10%, 15%, 20%, 25%, 30%, 40%. 50%. 60%. 70%, 80%, 90%, 100%, 150%, 200% or more compared to a reference tissue, cell or subject (e.g., a healthy, wild-type or control cell, tissue or subject). Attorney Docket No.: F2099-7045WO

[0541] In another aspect, the dosage of an exemplary TREM pharmaceutical composition (e.g, described herein) provides a consistent delivery dosage to a sample, e.g., a cell or subject. In an embodiment, the dosage, e.g., the amount of TREM administered to a subject, is the same across two species. In an embodiment, the delivery dosage, e.g., the amount of TREM delivered to a subject or tissue within the subject, is the same across two species. In an embodiment, upon administration, dosage level is monitored by measuring the area under the curve (AUC) of the amount of TREM present in a sample, e.g., plasma or tissue, over time. In an embodiment, the dosage level is monitored by the AUC of the amount of TREM present in the liver of a subject. Delivery, e.g., to a tissue of a subject, may differ by about 10%, 15%, 20%, 25%, 30%, 40%. 50%. 60%. 70%, 80%, 90%, 100%, 150%, 200% or more between species.

[0542] ENUMERATED EMBODIMENTS

[0543] 1. A lipid nanoparticle (LNP) comprising:

[0544] (i) a cationic lipid;

[0545] (ii) a neutral lipid;

[0546] (iii) a polymer conjugated lipid (e.g., a pegylated lipid);

[0547] (iv) a sterol; and

[0548] (v) a tRNA-based effector molecule (TREM) capable of suppressing the premature termination codon (PTC) in an open reading frame of a gene, wherein the TREM is encapsulated within the LNP, wherein the cationic lipid has a structure of Formula I:

[0549] I or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:

[0550] L1and L2are each independently -(C=O)O- or -O(C=O)-;

[0551] G1and G2are each independently C4-C12 alkylene;

[0552] G3is Ci-Ce alkylene;

[0553] R1and R2are each independently C6-C24 alkyl; and

[0554] R3is OH. Attorney Docket No.: F2099-7045WO

[0555] 2. The LNP of embodiment 1, having one of the following structures (IE) or (IF):

[0556] 3. The LNP of any one of embodiments 1-2, wherein G1and G2are each independently Ce- Cio alkylene.

[0557] 4. The LNP of any one of embodiments 1-3, wherein G3is C2-C4 alkylene.

[0558] 5. The LNP of any one of embodiments 1-4, wherein R1or R2, or both, is C10-C20 alkyl.

[0559] 6. The LNP of any one of embodiments 1-5, wherein R1or R2, or both, is branched C10-C20 alkyl. 7. The LNP of any one of embodiments 1-6, wherein R1or R2, or both, has one of the 8. The LNP of any one of embodiments 1-7, wherein the cationic lipid has one of the following structures: Attorney Docket No.: F2099-7045WO

[0560] 5 Attorney Docket No.: F2099-7045WO

[0561] 5 Attorney Docket No.: F2099-7045WO

[0562] 9. The LNP of any one of embodiments 1-8, wherein the cationic lipid has the following structure:

[0563] 10. The LNP of any one of embodiments 1-9, comprising from 40 to 50 mol percent of the cationic lipid, based on total lipids in the LNP.

[0564] 11. The LNP of any one of embodiments 1-10, comprising from 45 to 50 mol percent of the cationic lipid, based on total lipids in the LNP.

[0565] 12. The LNP of any one of embodiments 1-11, comprising about 46, about 47, about 48 or about 49 mol percent of the cationic lipid, based on total lipids in the LNP. Attorney Docket No.: F2099-7045WO

[0566] 13. The LNP of any one of embodiments 1-12, comprising from 47 to 48 mol percent of the cationic lipid, based on total lipids in the LNP.

[0567] 14. The LNP of any one of embodiments 1-13, comprising 47.5 mol percent of the cationic lipid, based on total lipids in the LNP.

[0568] 15. The LNP of any one of embodiments 1-14, wherein the neutral lipid is di stearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE) and dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-l carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), 16-0-monom ethyl PE, 16-O-dimethyl PE, 18-1-trans PE, l-stearioyl-2-oleoylphosphatidyethanol amine (SOPE) or 1,2-dielaidoyLsn- glycero-3-phophoethanolamine (transDOPE).

[0569] 16. The LNP of embodiment 15, wherein the neutral lipid is DSPC.

[0570] 17. The LNP of any one of embodiments 1-16, wherein the neutral lipid is present in a concentration ranging from 8 to 12 mol percent or 9 to 11 mol percent based on total lipids in the LNP.

[0571] 18. The LNP of any one of embodiments 1-17, wherein the neutral lipid is present in a concentration of about 10 mol percent, based on total lipids in the LNP.

[0572] 19. The LNP of any one of embodiments 1-18, wherein the molar ratio of the cationic lipid to the neutral lipid ranges from about 2: 1 to about 8:1. Attorney Docket No.: F2099-7045WO

[0573] 20. The LNP of any one of embodiments 1-19, wherein the molar ratio of the cationic lipid to the sterol ranges from 5: 1 to 1 : 1.

[0574] 21. The LNP of any one of embodiments 1-20, wherein the sterol is present in a concentration ranging from 35 to 45 mol percent, based on total lipids in the LNP.

[0575] 22. The LNP of any one of embodiments 1-21, wherein the sterol is present in a concentration ranging from 39 to 41 mol percent, based on total lipids in the LNP.

[0576] 23. The LNP of any one of embodiments 1-22, wherein the sterol is cholesterol.

[0577] 24. The LNP of any one of embodiments 1-23, wherein the molar ratio of the cationic lipid to the polymer-conjugated lipid ranges from about 100: 1 to about 10: 1.

[0578] 25. The LNP of any one of embodiments 1-24, wherein the polymer-conjugated lipid is present in a concentration ranging from 1.0 to 3.0 molar percent, based on total lipid in the LNP.

[0579] 26. The LNP of any one of embodiments 1-25, wherein the LNP comprises from 1.5 to 2.8 mol percent of the polymer-conjugated lipid.

[0580] 27. The LNP of any one of embodiments 1-25, wherein the LNP comprises from 2.2 to 3.3 mol percent of the polymer-conjugated lipid.

[0581] 28. The LNP of any one of embodiments 1-27, wherein the LNP comprises from 2.1 to 2.5 mol percent of the polymer-conjugated lipid.

[0582] 29. The LNP of any one of embodiments 1-28, wherein the LNP comprises about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7 or about 2.8 mol percent of the polymer- conjugated lipid. Attorney Docket No.: F2099-7045WO

[0583] 30. The LNP of any one of embodiments 1-29, wherein the polymer-conjugated lipid is a pegylated lipid.

[0584] 31. The LNP of embodiment 30, wherein the pegylated lipid is PEG-DAG, PEG-PE, PEG-S- DAG, PEG-cer or a PEG dialkyoxypropylcarbamate. 32. The LNP of embodiments 30, wherein the pegylated lipid has the following structure (II): or a pharmaceutically acceptable salt, tautomer or stereoisomer thereof, wherein:

[0585] R3and R4are each independently a straight or branched alkyl or alkenyl chain containing from 10 to 30 carbon atoms, wherein the alkyl chain is optionally interrupted by one or more ester bonds; and w has a mean value ranging from 30 to 60.

[0586] 33. The LNP of embodiment 32, wherein R3and R4are each independently straight alkyl chains containing from 12 to 16 carbon atoms. 34. The LNP of any one of embodiments 32 or 33, wherein the mean value of w ranges from

[0587] 42 to 55.

[0588] 35. The LNP of any one of embodiments 32-34, wherein the pegylated lipid has the following structure (Ila): Attorney Docket No.: F2099-7045WO

[0589] (Ila) wherein the average value for w ranges from 42 to 55.

[0590] 36. The LNP of any one of embodiments 1-35, wherein the ratio of the cationic lipid to the TREM (N / P ratio) ranges from 1 to 10.

[0591] 37. The LNP of embodiment 36, wherein the N / P ratio ranges from 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 to 1.5.

[0592] 38. The LNP of embodiment 37, wherein the N / P ratio is about 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, or 7.

[0593] 39. The LNP of any one of embodiments 1-38, wherein the LNP has a mean particle diameter ranging from 40 nm to 100 nm.

[0594] 40. The LNP of embodiment 39, wherein the mean particle diameter ranges from 50 nm to 70 nm, from 55 nm to 65 nm, from 50 nm to 60 nm, from 60 nm to 70 nm, from 70 nm to 80 nm or from 80 nm to 90 nm.

[0595] 41. The LNP of embodiment 40, wherein the mean particle diameter is about 47 nm, about 48 nm, about 49 nm, about 50 nm, about 51 nm, about 52 nm, about 53 nm, about 54 nm, about

[0596] 55 nm, about 56 nm, about 57 nm, about 58 nm, about 59 nm, about 60 nm, about 61 nm, about

[0597] 62 nm, about 63 nm, about 64 nm, about 65 nm, about 66 nm, about 67 nm, about 68 nm, about

[0598] 69 nm, about 70 nm, about 71 nm, about 72 nm, about 73 nm, about 74 nm, about 75 nm, about

[0599] 76 nm, about 77 nm, about 78 nm, about 79 nm, about 80 nm, about 81 nm, about 82 nm, about

[0600] 83 nm, about 84 nm or about 85 nm.

[0601] 42. The LNP of any one of embodiments 1-41, wherein the LNP has an encapsulation efficiency of greater than 80%, greater than 81%, greater than 82%, greater than 83%, greater than 84%, greater than 85%, greater than 86%, greater than 87%, greater than 88%, greater than Attorney Docket No.: F2099-7045WO

[0602] 89%, greater than 90%, greater than 91%, greater than 92%, greater than 93%, greater than 94%, greater than 95%, greater than 96%, greater than 97%, greater than 98%, greater than 99%, greater than 99.5%, or greater than 99.9%.

[0603] 43. The LNP of any one of embodiments 1-42, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

[0604] 44. The LNP of any one of embodiments 1-43, wherein the TREM has greater than 90%, greater than 91%, greater than 92%, greater than 93%, greater than 94%, greater than 95%, greater than 96%, greater than 97%, greater than 98%, greater than 99% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2.

[0605] 45. The LNP of any one of embodiments 1-44, wherein the TREM is transfer RNA (tRNA).

[0606] 46. The LNP of any one of embodiments 1-45, comprising:

[0607] (i) 35-60 mol % of Structure 1-45;

[0608] (ii) 5-15 mol % of l ,2-distearoyl-sn-glycero-3-phosphocholine (DSPC);

[0609] (iii) 1.8-3.2 mol % of Compound 42-6;

[0610] (iv) 25-55 mol % cholesterol; and

[0611] (v) a tRNA-based effector molecule (TREM), wherein the mol % is based on total moles of lipid components in the LNP.

[0612] 47. The LNP of any one of embodiments 1-46, comprising:

[0613] (i) 35-55 mol % of Structure 1-45;

[0614] (ii) 6-14 mol % of 1,2-di stearoyl -sn-glycero-3 -phosphocholine (DSPC);

[0615] (iii) 1.9-3.1 mol % of Compound 42-6;

[0616] (iv) 30-50 mol % cholesterol; and

[0617] (v) a tRNA-based effector molecule (TREM), wherein the mol % is based on total moles of lipid components in the LNP. Attorney Docket No.: F2099-7045WO The LNP of any one of embodiments 1-47, comprising:

[0618] (i) 40-50 mol % of Structure 1-45;

[0619] (ii) 7-13 mol % of l,2-distearoyl-sn-glycero-3 -phosphocholine (DSPC);

[0620] (iii) 2-3 mol % of Compound 42-6;

[0621] (iv) 35-45 mol % cholesterol; and

[0622] (v) a tRNA-based effector molecule (TREM), wherein the mol % is based on total moles of lipid components in the LNP. The LNP of any one of embodiments 1-48, comprising:

[0623] (i) 45-49% mol % of Structure 1-45;

[0624] (ii) 8-12 mol % of l,2-distearoyl-sn-glycero-3 -phosphocholine (DSPC);

[0625] (iii) 2.1-2.9 mol % of Compound 42-6;

[0626] (iv) 38-42 mol % cholesterol; and

[0627] (v) a tRNA-based effector molecule (TREM), wherein the mol % is based on total moles of lipid components in the LNP. The LNP of any one of embodiments 1-49, comprising:

[0628] (i) 47-48% mol % of Structure 1-45;

[0629] (ii) 9-11 mol % of l,2-distearoyl-sn-glycero-3 -phosphocholine (DSPC);

[0630] (iii) 2.2-2.8 mol % of Compound 42-6;

[0631] (iv) 39-41 mol % cholesterol; and

[0632] (v) a tRNA-based effector molecule (TREM), wherein the mol % is based on total moles of lipid components in the LNP. The LNP of any one of embodiments 1-50, comprising:

[0633] (i) 47.5 mol % of Structure 1-45;

[0634] (ii) 10 mol % of l,2-distearoyl-sn-glycero-3-phosphocholine (DSPC);

[0635] (iii) 2.5 mol % of Compound 42-6;

[0636] (iv) 40 mol % cholesterol; and

[0637] (v) a tRNA-based effector molecule (TREM), wherein the mol % is based on total moles of lipid components in the LNP. Attorney Docket No.: F2099-7045WO

[0638] 52. The LNP of any one of embodiments 1- 1, wherein the LNP comprises 35-60 mol % of Structure 1-45.

[0639] 53. The LNP of any one of embodiments 1-52, wherein the LNP comprises 35-55 mol % of Structure 1-45.

[0640] 54. The LNP of any one of embodiments 1-53, wherein the LNP comprises 40-50 mol % of Structure 1-45.

[0641] 55. The LNP of any one of embodiments 1-54, wherein the LNP comprises 45-49 mol % of Structure 1-45.

[0642] 56. The LNP of any one of embodiments 1-55, wherein the LNP comprises 47-48 mol % of Structure 1-45.

[0643] 57. The LNP of any one of embodiments 1-56, wherein the LNP comprises 47.5 mol % of Structure 1-45.

[0644] 58. The LNP of any one of embodiments 1-57, wherein the LNP comprises 5-15 mol % of DSPC.

[0645] 59. The LNP of any one of embodiments 1-58, wherein the LNP comprises 6-14 mol % of DSPC.

[0646] 60. The LNP of any one of embodiments 1-59, wherein the LNP comprises 7-13 mol % of DSPC.

[0647] 61. The LNP of any one of embodiments 1-60, wherein the LNP comprises 8-12 mol % of DSPC. Attorney Docket No.: F2099-7045WO

[0648] 62. The LNP of any one of embodiments 1-61, wherein the LNP comprises 9-11 mol % of DSPC.

[0649] 63. The LNP of any one of embodiments 1-62, wherein the LNP comprises 10 mol % of DSPC.

[0650] 64. The LNP of any one of embodiments 1-63, wherein the LNP comprises 1.8-3.2 mol % of Compound 42-6.

[0651] 65. The LNP of any one of embodiments 1-67, wherein the LNP comprises 1.9-3.1 mol % of Compound 42-6.

[0652] 66. The LNP of any one of embodiments 1-65, wherein the LNP comprises 2-3 mol % of Compound 42-6.

[0653] 67. The LNP of any one of embodiments 1-66, wherein the LNP comprises 2.1-2.9 mol % of Compound 42-6.

[0654] 68. The LNP of any one of embodiments 1-67, wherein the LNP comprises 2.2-2.8 mol % of Compound 42-6.

[0655] 69. The LNP of any one of embodiments 1-68, wherein the LNP comprises 2.5 mol % of Compound 42-6.

[0656] 70. The LNP of any one of embodiments 1-69, wherein the LNP comprises 25-55 mol % of cholesterol.

[0657] 71. The LNP of any one of embodiments 1-70, wherein the LNP comprises 30-50 mol % of cholesterol. Attorney Docket No.: F2099-7045WO

[0658] 72. The LNP of any one of embodiments 1-71, wherein the LNP comprises 35-45 mol % of cholesterol.

[0659] 73. The LNP of any one of embodiments 1-72, wherein the LNP comprises 38-42 mol % of cholesterol.

[0660] 74. The LNP of any one of embodiments 1-73, wherein the LNP comprises 39-41 mol % of cholesterol.

[0661] 75. The LNP of any one of embodiments 1-74, wherein the LNP comprises 40 mol % of cholesterol.

[0662] 76. The LNP of any one of embodiments 1-75, wherein the ratio of (i) to the TREM (N / P ratio) is between 3 to 9.

[0663] 77. The LNP of any one of embodiments 1-76, wherein the ratio of (i) to the TREM (N / P ratio) is between 4 to 8.

[0664] 78. The LNP of any one of embodiments 1-77, wherein the ratio of (i) to the TREM (N / P ratio) is between 5 to 7.

[0665] 79. The LNP of any one of embodiments 1-78, wherein the TREM comprises the sequence of a TREM provided in Table 3, or a sequence having at least about 60% to at least about 99.9%, e.g, about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9%, sequence identity to a TREM provided in Table 3.

[0666] 80. The LNP of any one of embodiments 1-79, wherein the TREM comprises a sequence having at least about 60% to at least about 99.9%, e.g., about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9%, sequence identity to a TREM provided in Table 3. Attorney Docket No.: F2099-7045WO

[0667] 81 . The LNP of any one of embodiments 1-80, wherein the TREM comprises the sequence of a TREM provided in Table 3, e.g., any one of SEQ ID NOs: 1-10, or a sequence having least about 60% to at least about 99.9%, e.g., about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9%, sequence identity to any one of SEQ ID NOs: 1-10.

[0668] 82. The LNP of any one of embodiments 1-81, wherein the TREM comprises any one of SEQ ID NOs: 1-10, or a sequence having least about 60% to at least about 99.9%, e.g., about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9%, sequence identity to any one of SEQ ID NOs: 1-10.

[0669] 83. The LNP of any one of embodiments 1-82, wherein the TREM comprises SEQ ID NO: 1, or a sequence having least about 60% to at least about 99.9%, e.g., about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9%, sequence identity to SEQ ID NO: 1.

[0670] 84. The LNP of any one of embodiments 1-83, wherein the TREM comprises SEQ ID NO: 2, or a sequence having least about 60% to at least about 99.9%, e.g., about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9%, sequence identity to SEQ ID NO: 2.

[0671] 85. The LNP of any one of embodiments 1-84, wherein the TREM comprises SEQ ID NO: 3, or a sequence having least about 60% to at least about 99.9%, e.g., about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9%, sequence identity to SEQ ID NO: 3.

[0672] 86. The LNP of any one of embodiments 1-85, wherein the TREM comprises SEQ ID NO: 4, or a sequence having least about 60% to at least about 99.9%, e.g., about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9%, sequence identity to SEQ ID NO: 4.

[0673] 87. The LNP of any one of embodiments 1-86, wherein the TREM comprises SEQ ID NO: 5, or a sequence having least about 60% to at least about 99.9%, e.g., about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9%, sequence identity to SEQ ID NO: 5. Attorney Docket No.: F2099-7045WO

[0674] 88. The LNP of any one of embodiments 1-87, wherein the TREM comprises SEQ ID NO: 6, or a sequence having least about 60% to at least about 99.9%, e.g., about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9%, sequence identity to SEQ ID NO: 6.

[0675] 89. The LNP of any one of embodiments 1-88, wherein the TREM comprises SEQ ID NO: 7, or a sequence having least about 60% to at least about 99.9%, e.g., about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9%, sequence identity to SEQ ID NO: 7.

[0676] 90. The LNP of any one of embodiments 1-89, wherein the TREM comprises SEQ ID NO: 8, or a sequence having least about 60% to at least about 99.9%, e.g., about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9%, sequence identity to SEQ ID NO: 8.

[0677] 91. The LNP of any one of embodiments 1-90, wherein the TREM comprises SEQ ID NO: 9, or a sequence having least about 60% to at least about 99.9%, e.g., about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9%, sequence identity to SEQ ID NO: 9.

[0678] 92. The LNP of any one of embodiments 1-91, wherein the TREM comprises SEQ ID NO: 10, or a sequence having least about 60% to at least about 99.9%, e.g., about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9%, sequence identity to SEQ ID NO: 10.

[0679] 93. The LNP of any one of embodiments 1-92, wherein the TREM consists of SEQ ID NO: 1.

[0680] 94. The LNP of any one of embodiments 1-93, wherein the TREM consists of SEQ ID NO:

[0681] 2.

[0682] 95. The LNP of any one of embodiments 1-94, wherein the TREM consists of SEQ ID NO:

[0683] 3.

[0684] 96. The LNP of any one of embodiments 1-95, wherein the TREM consists of SEQ ID NO:

[0685] 4. Attorney Docket No.: F2099-7045WO

[0686] 97. The LNP of any one of embodiments 1-96, wherein the TREM consists of SEQ ID NO:

[0687] 5.

[0688] 98. The LNP of any one of embodiments 1-97, wherein the TREM consists of SEQ ID NO:

[0689] 6.

[0690] 99. The LNP of any one of embodiments 1-98, wherein the TREM consists of SEQ ID NO:

[0691] 7.

[0692] 100. The LNP of any one of embodiments 1-99, wherein the TREM consists of SEQ ID NO:

[0693] 8.

[0694] 101. The LNP of any one of embodiments 1-100, wherein the TREM consists of SEQ ID NO:

[0695] 9.

[0696] 102. The LNP of any one of embodiments 1-101, wherein the TREM consists of SEQ ID NO:

[0697] 10.

[0698] 103. The LNP of any one of embodiments 1-102, wherein the LNP is dosed between about 0.5 mg / kg to about 10 mg / kg with respect to the TREM.

[0699] 104. The LNP of any one of embodiments 1-103, wherein the LNP is dosed between about 1 mg / kg to about 9 mg / kg with respect to the TREM.

[0700] 105. The LNP of any one of embodiments 1-104, wherein the LNP is dosed between about 2 mg / kg to about 8 mg / kg with respect to the TREM.

[0701] 106. The LNP of any one of embodiments 1-105, wherein the LNP is dosed between about 3 mg / kg to about 5 mg / kg with respect to the TREM. Attorney Docket No.: F2099-7045WO

[0702] 107. The LNP of any one of embodiments 1-106, wherein the LNP has a size of between 50 nm to 120 nm.

[0703] 108. The LNP of any one of embodiments 1-107, wherein the LNP has a size of between 60 nm to 110 nm.

[0704] 109. The LNP of any one of embodiments 1-108, wherein the LNP has a size of between 70 nm to 100 nm.

[0705] 110. A composition comprising a tRNA-based effector molecule (TREM) formulated in the LNP of any one of the preceding embodiments.

[0706] 111. The composition of embodiment 110, wherein the composition further comprises a buffering component.

[0707] 112. A method for delivering to a subject a composition comprising a tRNA-based effector molecule (TREM) formulated in the LNP of any one of the preceding embodiments.

[0708] 113. A method of treating a subject having a disease or disorder associated with a premature termination codon (PTC) in an open reading frame of a gene encoding a full length polypeptide, comprising administering to the subject a composition comprising a tRNA-based effector molecule (TREM) formulated in the LNP of any one of the preceding embodiments.

[0709] 114. The method of any one of embodiments 112-113, wherein the administering of the composition results in one or more of:

[0710] (a) suppression of the PTC in an open reading frame of a gene; and

[0711] (b) an increase in expression of the full length polypeptide in the subject, thereby treating the subject. Attorney Docket No.: F2099-7045WO

[0712] 115. The method of any one of embodiments 1 12-114, wherein the increase in expression of the full length polypeptide is detectable in serum at least 72 hours after administration of the composition relative to a reference sequence. 116. A composition for use in treating a subject having a disease or disorder associated with a premature termination codon (PTC) in an open reading frame of a gene encoding a full length polypeptide, wherein the composition comprises a tRNA-based effector molecule (TREM) formulated in the LNP of any one of the preceding embodiments. 117. The composition for use of embodiment 116, wherein administering the composition for use to the subject results in one or more of:

[0713] (a) suppression of the PTC in an open reading frame of a gene; and

[0714] (b) an increase in expression of the full length polypeptide in the subject. EXAMPLES

[0715] Table of Contents for Examples. Attorney Docket No.: F2099-7045WO

[0716] Example 1. Preparation of an ionizable (cationic) lipid of Structure (1-45).

[0717] A solution of nonan-l,9-diol (12.0 g) in methylene chloride (150 mL) was treated with 2- butyloctanoic acid (5.0 g), DCC (7.7 g) and DMAP (4.5 g). The solution was stirred overnight. The reaction mixture was filtered and the solvent removed. The residue was suspended in hexane and filtered. The filtrate was washed with dilute hydrochloric acid. The organic phase was dried over anhydrous magnesium sulfate, filtered through a silica gel bed, and the solvent removed. The crude product was passed down a silica gel column using a methanol / methylene chloride (0- 4%) gradient, to produce 9-(2’-butyloctanoyloxy)nonan-l-ol (6 g) as an oil. The 9-(2’-butyloctanoyloxy)nonan-l-ol was dissolved in methylene chloride (100 mL) and treated with pyridinium chlorochromate (3.8 g) overnight. Hexane (300 mL) was added and the supernatant filtered through a silica gel bed. The solvent was removed from the filtrate and resultant oil dissolved in hexane. The suspension was filtered through a silica gel bed and the solvent removed, yielding 9-(2’-butyloctanoyloxy)nonan-l-al (3.1 g) was obtained as a colorless oil.

[0718] A solution of 9-(2’-butyloctanoyloxy)nonan-l-al (2.6 g), acetic acid (0.17 g) and 3- ami nopropan- l-ol (0.21 g) in methylene chloride (50 mL) was treated with sodium triacetoxyborohydride (1.34 g) overnight. The solution was washed with aqueous sodium Attorney Docket No.: F2099-7045WO hydrogen carbonate solution. The organic phase was dried over anhydrous magnesium sulfate, filtered and the solvent removed. The residue was passed down a silica gel column using a using an acetic acid / methanol / methylene chloride (2-0 / 0-8 / 98-96%) gradient. Pure fractions were washed with aqueous sodium bicarbonate solution, yielding the ionizable (cationic) lipid of Structure (1-45) as a colorless oil (1.1 g).

[0719] Example 2. Preparation of pegylated lipid of formula (V)

[0720] Synthesis of pegylated lipid II

[0721] Pegylated lipid II was prepared according to the reaction scheme below, wherein n has a mean value of 40-50 and approximates the center of the range of ethylene oxide repeating units in the pegylated lipid.

[0722] Synthesis of ii-1 and ii-2 To a solution of myristic acid (6 g, 26 mmol) in toluene (50 mL) was added oxalyl chloride (39 mmol, 1.5 eq. 5 g) at RT. After the resulting mixture was heated at 70°C for 2h, the mixture was concentrated. The residue was taken up in toluene and concentrated again. The residual oil was added via a syringe to a concentrated ammonia solution (20 mL) at 10°C. The Attorney Docket No.: F2099-7045WO reaction mixture was filtered and washed with water. The white solid was dried in vacuo. The desired product was obtained as a white solid (3.47 g, 15 mmol, 58.7%).

[0723] Synthesis of ii-3

[0724] To a suspension of ii-2 (3.47 g, 15 mmol) in THF (70 mL) was added in portions lithium aluminium hydride (1.14 g, 30 mmol) at RT over 30 min, then the mixture was heated to reflux gently (oil bath at 65°C) overnight. The mixture was cooled to 5°C and sodium sulphate 9 hydrate was added. The mixture was stirred for 2h, filtered through a layer of celite, washed with 15% of MeOH in DCM (200 mL). The filtrate and washings were combined and concentrated. The residual solid was dried in vacuo. The desired product was obtained as a white solid (2.86 13.4 mmol, 89.5%).

[0725] Synthesis of ii-4

[0726] To a solution of myristic acid (3.86 g, 16.9 mmol) in benzene (40 mL) and DMF (1 drop) was added oxalyl chloride (25.35 mmol, 1.5 eq. 3.22 g) at RT. The mixture was stirred at RT for 1.5 h and heated at 60°C for 30 min. The mixture was concentrated. The residue was taken up in toluene and concentrated again. The residual oil (light yellow) was taken in 20 mL of benzene and added via syringe to a solution of ii-3 (2.86 13.4 mmol) and triethylamine (3.53 mL, 1.5 eq) in benzene (40 mL) at 10°C. After addition, the resulting mixture was stirred at RT overnight. The reaction mixture was diluted with water and was adjusted to pH 6-7 with 20% H2SO4. The mixture was filtered and washed with water. A pale solid was obtained. The crude product was recrystalized from methanol. This gave the desired product as an off-white solid (5.65 g, 13 mmol, 100%).

[0727] Synthesis of ii-5

[0728] To suspension of ii-4 (5.65 g, 13 mmol) in THF (60 mL) was added in portions lithium aluminium hydride (0.99 g, 26 mmol) at RT during 30 min period of time. Then the mixture was heated to reflux gently overnight. The mixture was cooled to 0 C and sodium sulphate 9 hydrate. The mixture was stirred for 2h, then filtered through a pad of celite and silica gel and washed with ether. The filtrate turned cloudy and precipitate formed. Filtration gave a white solid. The solid was recrystallized from MeOH and a colorless crystalline solid (2.43 g) was obtained.

[0729] The pad of celite and silica gel was then washed with 5% of MeOH in DCM (400 mL) and then 10% of MeOH in DCM with 1% of triethylamine (300 mL). The fractions containing the desired product were combined and concentrated, resulting in a white solid. The solid was Attorney Docket No.: F2099-7045WO recrystallized from MeOH and a colorless crystalline solid (0.79 g) was obtained. The above two solids (2.43 g and 0.79 g) were combined and dried in vacuo (3.20 g, 60%). 1HNMR (CDC13 at 7.27 ppm) 8: 2.58 (t-like, 7.2 Hz, 4H), 1.52-1.44 (m, 4H), 1.33-1.24 (m, 44H), 0.89 (t-like, 6.6 Hz, 6H), 2.1-1.3 (very broad, 1H).

[0730] Synthesis of pegylated lipid II

[0731] To a solution of ii-5 (7 mmol, 2.87 g) and triethylamine (30 mmol, 4.18 mL) in DCM (100 mL) was added a solution of mPEG-NHS (from NOF, 5.0 mmol, 9.97 g, PEG MW approx. 2,000, n = about 45) in DCM (120 mL,). After 24 h the reaction solution was washed with water (300 mL). The aqueous phase was extracted twice with DCM (100 mL x 2). DCM extracts were combined, washed with brine (100 mL). The organic phase was dried over sodium sulfate, filtered, and partially concentrated. The concentrated solution (ca 300 mL) was cooled at ca -15 C. Filtration gave a white solid (1.030 g, the unreacted starting amine). To the filtration was added Et3N (1.6 mmol, 0.222 mL, 4 eq) and acetic anhydride (1.6 mmol, 164 mg). The mixture was stirred at RT for 3h and then concentrated to a solid. The residual solid was purified by column chromatography on silica gel (0-8% methanol in DCM). This gave the desired product as a white solid (9.211 g). 1HNMR (CDC13 at 7.27 ppm) 8: 4.19 (s, 2H), 3.83-3.45 (m, 180-200H), 3.38 (s, 3H), 3.28 (t-like, 7.6 Hz, 2H, CH2N), 3.18 (t-like, 7.8 Hz, 2H, CH2N), 1.89 (s, 6.6 H, water), 1.58-1.48 (m, 4H), 1.36-1.21 (m, 48-50H), 0.88 (t-like, 6.6 Hz, 6H).

[0732] Example 3. Production of modified TREMs.

[0733] This example describes synthesis and purification of exemplary TREMs. Synthesis

[0734] Briefly, chemically-modified TREMs were produced by phosphoramidite solid-phase oligonucleotide synthesis (SPOS) from base-protected ribonucleoside phosphoramidites corresponding to A, C, G, U and selected 2'-modifications (e.g., 2'-O-methyl-C, 2'-O-methyl-G, 2'-fluoro-U). Chain elongation proceeded through iterative cycles of detritylation, coupling, oxidation and / or sulfurization, and capping. Upon completion, the full-length TREM was cleaved from the solid support and deprotected by amine-base ammonolysis (e.g., aqueous ammonium hydroxide and / or methylamine) followed by triethylamine trihydrofluoride (TEA.3HF) treatment to remove backbone and nucleobase protecting groups.

[0735] Purification and finishing Attorney Docket No.: F2099-7045WO

[0736] Crude solution was conditioned by tangential -flow filtration (TFF) for desalting and buffer exchange, then purified by ion-pair reversed-phase chromatography (IP-RP). Productcontaining fractions were water-diluted to reduce organic and ion-pair reagents, followed by anion-exchange chromatography (AEX) to resolve length / charge variants (e.g., n-l / n+1, cyclic- phosphate ends). Qualified fractions were pooled and TFF-desalted to predefined conduct! vity / resi dual limits, concentrated to a target range, sterile-filtered (0.22 pm), and lyophilized to a free-flowing powder suitable for storage and formulation.

[0737] Controls and characterization

[0738] Representative in-process controls included stepwise trityl monitoring (coupling efficiency), solvent dryness (Karl Fischer), oxidation / sulfurization logs, chromatographic pooling criteria, and TFF conductivity / diavolumes. Final material was tested by LC-MS-UV methods for identity (intact-mass LC-MS), purity (LC-UV), and assay / content (quantitative LC- UV). Additional controls may include 3 IP NMR (PO / PS composition), 19F NMR (for 2'-F), GC-headspace for residual solvents, specific assays for ion-pair reagents, Karl Fischer moisture, and endotoxin per specification.

[0739] Process flow steps

[0740] The process flow diagram of the manufacturing process used to produce an exemplary TREM, e.g., drug substance, is provided in Table 16.

[0741] Table 16. Process flow steps for drug substance manufacturing process.

[0742] Exemplary TREM production Attorney Docket No.: F2099-7045WO

[0743] An exemplary TREM (SEQ ID NO: 2) was synthesized from phosphorami dites of individual base-protected nucleotides (A, adenosine; C, cytidine; G, guanosine; U, uridine; mC, 2’-O-methylcytidine; mG, 2’-O-methylguanosine) using standard solid-supported oligonucleotide chemistry. After the repeated cycles of the chain-elongation steps (including detrityl ati on, coupling, oxidation / sulfurization of the linker, and capping), the full-length TREM is cleaved from the solid support and the backbone and bases of the TREM are deprotected using an amine base. Application of two sequential reverse-phase chromatography purifications utilizing gradients of acetonitrile / water and buffers, tangential flow filtration / concentration, and then lyophilization provide the final solid drug substance. This procedure was used to synthesize additional exemplary TREMs, e.g., TREMs provided in Table 3. Table 17 describes a series of modified TREMs synthesized according to this procedure.

[0744] Table 17. Exemplary TREM synthesis data.

[0745] Example 4. Characterization of chemically modified TREMs for readthrough of a premature termination codon (PTC) in a reporter protein.

[0746] This example describes an assay to test the ability of a non-cognate chemically modified TREM to readthrough a PTC in a cell line expressing a reporter protein having a PTC.

[0747] A cell line engineered to stably express the NanoLuc reporter construct containing a premature termination codon (PTC) was generated using the Flpin system according to the manufacturer’s instructions. Delivery of the chemically modified TREMs into the NanoLuc Attorney Docket No.: F2099-7045WO reporter cells was carried out via a reverse transfection reaction using lipofectamine RNAiMAX (ThermoFisher Scientific, USA) according to manufacturer instructions. Briefly, 5 pL of a 2.5uM solution of chemically modified TREM sample were diluted in a 20 pL RNAiMAX / OptiMEM mixture. After 30 minutes gentle mixing at room temperature, the 25 L TREM / transfection mixture was added to a 96-well plate and kept still for 20-30 minutes before adding the cells. The NanoLuc reporter cells were harvested and diluted to 4* 105cells / mL in complete growth medium, and 100 pL of the diluted cell suspension was added and mixed to the plate containing the TREM. After 24 hours, 100 pL complete growth medium was added to the 96-well plate for cell health.

[0748] To monitor the efficacy of the chemically modified TREM to read through the PTC in the reporter construct 48 hours after TREM delivery into cells, a NanoGio bioluminescent assay (Promega, USA) was performed according to manufacturer instruction. Briefly, cell media was replaced and allowed to equilibrate to room temperature. NanoGio reagent was prepared by mixing the buffer with substrate in a 50: 1 ratio. 50 pL of mixed NanoGio reagent was added to the 96-well plate and mixed on the shaker at 600 rpm for 10 minutes. After 2 minutes, the plate was centrifuged at 1000g, followed by a 5 minute incubation step at room temperature before measuring sample bioluminescence. As a positive control, a host cell expressing the NanoLuc reporter construct without a PTC was used. As a negative control, a host cell expressing the NanoLuc reporter construct with a PTC was used, but no TREM was transfected. The efficacy of the chemically modified TREMs was measured as a ratio of the NanoLuc luminescence in the experimental sample to the NanoLuc luminescence of the positive control or as a ratio of the NanoLuc luminescence in the experimental sample to the NanoLuc luminescence of the negative control. It was expected that if the sample TREM was functional, it would be able to read- through the stop mutation in the NanoLuc reporter and produce a luminescent reading higher than the luminescent reading measured in the negative control. If the sample TREM was not functional, the stop mutation is not rescued, and luminescence less or equal to the negative control is detected.

[0749] The results are outlined in Table 18, which describes the activity of an exemplary chemically modified TREMs, in which 2’-O-methyl, 2’-fluoro, and phosphorothioate (PS) modifications were installed at various locations in a TREM sequence. Attorney Docket No.: F2099-7045WO

[0750] In addition, the results of the activity screen are reported in Table 18 as log2 fold changes compared with mock-transfected cells, wherein “1” indicates less than a 6 log2 fold change; “2” indicates greater than or equal to 6 and less than 8.5 log2 fold change; and “3” indicates greater than or equal to 8.5 log2 fold change. The results show that the exemplary TREMs are capable of PTC readthrough and rescue of protein expression from an open reading frame comprising a PTC.

[0751] Table 18. PTC readthrough by exemplary TREMs.

[0752] Example 5. Production of a TREM in a lipid nanoparticle (LNP) formulation.

[0753] This example describes production of an exemplary TREM formulated in an LNP, e.g., a drug product.

[0754] TREMs in a lipid nanoparticle (LNP) formulation, referred to as the drug product, are prepared by mixing of an aqueous solution of the TREM drug substance (SEQ ID NO: 2) with an ethanolic solution of a lipid mixture comprising an ionizable lipid, a pegylated lipid, cholesterol, and l,2-distearoyl-sn-glycero-3-phosphocholine (DSPC). The resulting self-assembled lipid nanoparticles are further processed after mixing including buffer exchange and concentration by tangential flow filtration (TFF), dilution to target concentration with the addition of cryoprotectant, sterile filtration and fill / finish to glass vial to obtain the final drug product. The process flow diagram of the manufacturing of the drug product is provided in Table 19. The Attorney Docket No.: F2099-7045WO drug product has a particle size of less than 120 nm and an encapsulation efficiency of at least 80%. The poly dispersity index of a plurality of drug products is less than 0.30.

[0755] The drug product is stored at 1 mg / mL at less than -60°C but is stable at -80°C, -20°C, and 2-8°C for 1 month.

[0756] Table 19. Process flow steps for drug product manufacturing process.

[0757] As described herein, LNP1 comprises 47.5 mol % Structure 11-15, 10 mol % of 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC), 2.5 mol % Compound 42-6, and 40 mol % cholesterol. As described herein, LNP2 comprises 47.5 mol % Structure 1-45, 10 mol % of 1,2- distearoyl-sn-glycero-3 -phosphocholine (DSPC), 2.5 mol % Compound 42-6, and 40 mol % cholesterol.

[0758] Example 6. Premature termination codon (PTC) readthrough and functional assessment in vitro in human Calu-6 cells.

[0759] This example describes premature termination codon (PTC) readthrough in vitro in the Calu-6 lung cancer cell line containing a TP53 R196X (Arg— >-TGA; R— >X) nonsense mutation. Cells

[0760] Calu-6 cells were transfected with SEQ ID NO: 2 (1.56-200 nM) using Lipofectamine 3000 (Invitrogen, ThermoFisher). The cells were incubated with the transfection mixture at 37°C Attorney Docket No.: F2099-7045WO for 24 hours, and cells are lysed at 24 hours or 48 hours post-transfection. A wild-type (WT) cell line was included as a positive control for p53 expression. Mock-treated Calu-6 cells and Calu-6 cells transfected with SEQ ID NO: 3 were used as negative and benchmarking controls, respectively. Additionally, Calu-6 cells were transfected with SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

[0761] PTC Readthrough

[0762] PTC readthrough was determined by measuring full-length p53 protein levels by Western blot at 24 hours. Functional rescue was evaluated by quantifying p21 protein levels by Western blot at 48 hours. PTC readthrough was additionally determined by measuring full-length p53 protein levels by Western blot at 48 hours. Results

[0763] FIGs. 1A-B show that levels of p53 full-length protein increased in a concentrationdependent manner in Calu-6 cells transfected with SEQ ID NO: 2. In contrast, no increase in p53 protein was detected in the untransfected and mock-transfected samples, and only a small increase in p53 protein was detected in cells transfected with SEQ ID NO: 3 as shown in FIG. IB. Similar to p53, FIGs. 1C-D show that levels of p21 protein increased in a concentrationdependent manner in Calu-6 cells transfected with SEQ ID NO: 2, and to a lesser extent, in cells transfected with SEQ ID NO: 3. Additional data demonstrating p53 PTC readthrough are provided in Table 20, which shows the potency (ECref) fold increase in full-length p53 protein levels above the level resulting from transfection with SEQ ID NO: 3. In Table 20, a potency fold increase of “1” indicates a fold increase of less than 1.5; “2” indicates a fold increase of greater than or equal to 1.5 and less than 4; and “3” indicates a fold increase of greater than or equal to 4. Here, potency refers to the amount of TREM, e.g., dose, that leads to p53 expression at a normalized signal of 3.

[0764] Table 20. Fold increase in p53 levels by exemplary TREMs. Attorney Docket No.: F2099-7045WO

[0765] Example 7. Premature termination codon (PTC) readthrough in vitro in PKU HepG2 cells.

[0766] This example describes premature termination codon (PTC) readthrough in vitro in human HepG2 cells carrying a R261X nonsense mutation in the phenylalanine hydroxylate (PAH) gene, a disease-relevant in vitro model with a clinically prevalent PTC.

[0767] Cells

[0768] HepG2 cells were genetically altered using CRISPR / Cas9 to carry a bi-allelic PAH R261X nonsense mutation (Arg— >TGA; R— >X) in the PAH gene. Extensive cell line validation confirmed loss of PAH gene and protein expression.

[0769] P 1 C Readthrough

[0770] PKU HepG2 cells were transfected with different doses of SEQ ID NO: 2 ranging from 0.4-50 nM using Lipofectamine 3000. SEQ ID NO: 3 was included as a benchmarking control; in addition, untransfected and mock-transfected cells were included as negative controls. Mock- transfected isogenic control HepG2 cells were also included as a positive (100% PAH expression) and transfection control.

[0771] Results

[0772] As shown in FIGs. 2A-B, SEQ ID NO: 2 delivery to PKU HepG2 cells rescued the expression of full-length PAH protein in a dose-dependent manner. FIG. 2B shows that SEQ ID NO: 3 delivery to PKU HepG2 cells also rescued the expression of full-length PAH protein in a dose-dependent manner, but to a much lesser extent. In contrast, no detectable PAH protein was observed in untransfected or mock-transfected PKU HepG2 samples as shown in FIG. 2A.

[0773] Example 8. Premature termination codon (PTC) readthrough and efficacy assessment in vitro in MMA human hepatocyte-like cells. Attorney Docket No.: F2099-7045WO

[0774] This example describes premature termination codon (PTC) readthrough in vitro in human hepatocyte-like cells (HLCs) carrying a MMUT R403X nonsense mutation in the methyl malonyl CoA mutase (MMUT) gene, a pharmacologically relevant in vitro PTC disease model. Cells

[0775] Human H7 embryonic stem (ES) cells (CL-1430-001) were genetically altered using CRISPR / Cas9 to carry a bi-allelic MMUT R403X nonsense mutation (Arg— >TGA; R— >X) in the methyl malonyl CoA mutase (MMUT) gene. After gene editing, the mutated ES cells retain pluripotency markers such as Oct4, Nanog, Tra-1-60, Tra-1-81, Sox2, and SSEA4 and exhibit normal karyotype, indicating maintenance of their pluripotent state. Edited ES cells were then differentiated into HECs. By the end of the differentiation process, the percentage of cells committed to the hepatic lineage was -90%, as demonstrated by the upregulation of liverspecific markers such as albumin, a- 1 -antitrypsin (Al AT), and hepatocyte nuclear factor 4a (HNF4A).

[0776] PTC Readthrough

[0777] At 21 days post-differentiation, mutant HLCs (herein named MMA HECs) were transfected with SEQ ID NO: 2 (0.4-100 nM) using Lipofectamine 3000 (Invitrogen, ThermoFisher). HLCs were incubated with the transfection mixture for 24 hours, and cells were lysed 96 hours post-transfection. SEQ ID NO: 3 was included at 50 nM as a benchmarking control; in addition, mock-transfected cells were included as negative controls. Mock-transfected and SEQ ID NO: 3-transfected isogenic control HLCs with wildtype (WT) expression of MMUT were also included as positive and transfection controls, respectively. PTC readthrough was determined by quantifying full-length MMUT protein levels by Western blot. To determine SEQ ID NO: 2 efficacy, methylmalonic acid (MMA) metabolite levels in cell media collected at 96 hours post-transfection were quantified using liquid chromatography-mass spectrometry (LC- MS).

[0778] Results

[0779] FIGs. 3A-B show that SEQ ID NO: 2 delivery to MMA HLCs rescued the expression of full-length MMUT protein in a dose-dependent manner. In contrast, no detectable MMUT protein was observed in mock-transfected MMA HLC samples as shown in FIG. 3A. FIGs. 3B- C show that maximum percentage of MMUT protein rescue was -3.5% at 96 hours posttransfection and was sufficient to reduce MMA metabolite levels by >50% in MMA HLCs. Attorney Docket No.: F2099-7045WO

[0780] Example 9. Single dose duration of action in a pharmacodynamic mouse model of methylmalonic acidemia.

[0781] This example describes a non-GLP single dose and duration of action combined study conducted in adult transgenic mice carrying the human MMUT gene with an R403X mutation (human / murine pharmacodynamic MMA mouse model; mMut+ / +, hMUT Buck et al., PLoS One, 2012) to evaluate premature termination codon (PTC) readthrough and assess durability of TREM-mediated protein rescue.

[0782] Lipid nanoparticles (LNPs)

[0783] LNPs containing the TREMs corresponding to SEQ ID NO: 3 (a benchmark control oligonucleotide), or SEQ ID NO: 2 for liver delivery were formulated in LNP1 with an ionizable lipid / RNA phosphate (N / P) ratio of 6 using the procedure described in Example 5.

[0784] Treatment and sampling

[0785] A total of 5 mice per group were administered vehicle (saline; PBS), the LNP containing the TREM corresponding to SEQ ID NO: 3, and the LNP containing the TREM corresponding to SEQ ID NO: 2 at a dose of 3 mg / kg via a single IV (tail vein) injection. Details of the study design are captured in Table 21.

[0786] Liver samples were collected 96- or 336-hours post-dose to measure SEQ ID NO: 3 and SEQ ID NO: 2 TREM levels by tRNA-Seq, assess target engagement by quantifying human MMUT mRNA levels by mRNA-Seq, ribosome occupancy of human MMUT mRNA by Ribo- seq, and PTC readthrough by quantifying human MMUT protein levels by liquid chromatography -mass spectrometry (LC-MS).

[0787] Table 21. Protein rescue and duration of action in human / murine pharmacodynamic (PD) MMA mouse model. Attorney Docket No.: F2099-7045WO

[0788] Results

[0789] FIG. 4 shows that LNP1 -mediated SEQ ID NO: 3 or SEQ ID NO: 2 administration to mice resulted in detection of TREM payload in the liver. The lower levels of total tRNA observed at the later timepoint suggested clearance.

[0790] FIG. 5 shows that at 96 hours post-dosing, SEQ ID NO: 2 in LNP1 resulted in a ~3.5- fold increase in human MMUT mRNA levels over SEQ ID NO: 3. This was indicative of productive stabilization of mRNA transcripts normally subject to nonsense-mediated decay in vivo. A significant increase in gene expression remained at 336 hours, with human MMUT mRNA levels remaining at levels observed 96 hours after administration of SEQ ID NO: 3.

[0791] FIG. 6 shows that an ~8.5-fold increase in human MMUT protein levels over SEQ ID NO: 3 was observed at 96 hours using a human MMUT-specific peptide upstream of the PTC for detection. Human MMUT protein levels remained elevated 336 hours post-dosing with levels similar to those observed 96 hours post- SEQ ID NO: 3 administration.

[0792] This human MMUT protein level not only represented residual protein but also indicated active and sustained translation for at least 14 days post SEQ ID NO: 2 administration, as demonstrated by an increase in ribosome occupancy on human MMUT mRNA, which is shown in FIG. 7

[0793] Example 10. Lipid nanoparticle (LNP) evaluation in a combined single dose duration of action study in a pharmacodynamic mouse model of methylmalonic acidemia.

[0794] This example describes a non-GLP single dose pharmacodynamic and duration of action combined study conducted in adult transgenic mice carrying the human MMUT gene with an R403X mutation (human / murine pharmacodynamic MMA mouse model; mMut+ / +, hMUT rg403T<,tQ eva|uatePTC readthrough, assess durability of TREM-mediated protein rescue, and evaluate two different SEQ ID NO: 2 formulations.

[0795] Lipid nanoparticles Attorney Docket No.: F2099-7045WO

[0796] LNP formulations of a TREM (SEQ ID NO: 2) were produced using the procedure described in Example 5. Two LNP formulations of SEQ ID NO: 2 were tested: SEQ ID NO: 2 encapsulated in LNP2 with an ionizable lipid / RNA phosphate (N / P) ratio of 6 and SEQ ID NO: 2 encapsulated in LNP2 with an N / P ratio of 3. Treatment and sampling

[0797] A total of 5 mice per group were administered either vehicle (saline; PBS), SEQ ID NO: 3 in LNP2 with an N / P ratio of 6 (as a benchmark), SEQ ID NO: 2 in LNP2 with an N / P ratio of 6, or SEQ ID NO: 2 in LNP2 with an N / P ratio of 3 at a dose of 3 mg / kg via a single IV (tail vein) injection. Details of the study design are captured in Table 22. Liver samples were collected 96- or 336-hours post-dose to measure human MMUT mRNA levels by RNAseq. Analysis of previous studies using this model demonstrated that human MMUT mRNA levels correlate well with successful PTC readthrough and protein rescue; as such, mRNA stabilization can be used as a surrogate protein rescue read-out for this study. Table 22. Protein rescue and duration of action in human / murine MMA pharmacodynamic mouse model.

[0798] Results Attorney Docket No.: F2099-7045WO

[0799] FIG. 8 shows that at 96 hours post-dosing, SEQ ID NO: 3 in LNP2 at an N / P ratio of 6 resulted in a ~1.8-fold increase in human MMUT mRNA levels over vehicle. This was indicative of productive rescue of mRNA transcripts normally subject to nonsense-mediated decay in vivo. This level was roughly similar to that observed upon administration of SEQ ID NO: 3 formulated in LNP1 at an N / P ratio of 6 (FIG. 5).

[0800] FIG. 8 additionally shows that at 96 hours post-treatment, SEQ ID NO: 2 in LNP2 at an N / P ratio of 6 resulted in a ~4-fold increase over vehicle in human MMUT mRNA levels. This level of increase was roughly similar to that observed upon administration of SEQ ID NO: 2 formulated in LNP1 at an N / P ratio of 6 (FIG. 5).

[0801] Similar to data shown in Example 9 comparing target engagement of SEQ ID NO: 2 and SEQ ID NO: 3 formulated in LNP1 at an N / P ratio of 6, administration of SEQ ID NO: 2 formulated in LNP2 at an N / P ratio of 6 resulted in a ~2.1-fold increase in the human MMUT mRNA level compared to SEQ ID NO: 3 as shown in FIG. 8.

[0802] FIG. 8 additionally shows that administration of SEQ ID NO: 2 in LNP2 at an N / P ratio of 3 lead to an increase in human MMUT mRNA of ~2.5-fold over vehicle. In both SEQ ID NO: 2 formulations, a significant increase in gene expression remained at 336 hours with human MMUT mRNA levels remaining at levels near those observed 96 hours after administration of SEQ ID NO: 3 in LNP2 at an N / P ratio of 6.

[0803] Example 11. Comparison of lipid nanoparticle (LNP) formulations for liver distribution pharmacokinetic and exploratory safety in mice.

[0804] This example describes a non-GLP single dose study conducted in male C57BL / 6 mice to compare liver biodistribution pharmacokinetics and exploratory safety of LNP 1 and LNP2 formulations at various N / P ratios using SEQ ID NO: 3 as the TREM payload.

[0805] Lipid nanoparticles

[0806] LNP formulations of a TREM (SEQ ID NO: 3) in LNP1 or LNP2 were produced using the procedure described in Example 5. N / P ratios of 3 and 4.5 for LNP1 and N / P ratios of 3, 4.5, and 6 for LNP2 were included in the comparison.

[0807] Treatment and Sampling

[0808] Upon a single IV bolus dose of 5 mg / kg, liver (with perfusion) and serum samples were collected at 1, 8, 24 and 72h (3 animals per timepoint) for quantification of total TREM levels. Attorney Docket No.: F2099-7045WO

[0809] Table 23. Comparison of LNP1 and LNP2 formulations at various N / P ratios for liver distribution pharmacokinetic and exploratory safety following a single 5 mg / kg IV bolus dose of SEQ ID NO: 3 in mice.

[0810] Results

[0811] Similar liver pharmacokinetic profiles were observed for SEQ ID NO: 3 formulated in LNP1 and LNP2 at various N / P ratios. A slight increase in liver exposure was observed with increase of N / P ratio (3 vs. 4.5) for LNP1, but not for LNP2 as shown in FIG. 9 and Table 24. FIG. 10 shows the comparison of AUCo-72h of total SEQ ID NO: 3 tRNA following IV bolus doses across formulations.

[0812] Table 24. Mouse liver pharmacokinetic parameters of TREM upon administration of IV bolus doses of 5 mg / kg of SEQ ID NO: 3 formulated in LNP1 and LNP2 with various N / P ratios. Attorney Docket No.: F2099-7045WO

[0813] Example 12. Dose-dependent protein rescue and phenylalanine reduction in stop codon model for phenylketonuria (PKU).

[0814] This example describes rescue of a clinically relevant Arg-to-TGA stop mutation in the phenylalanine hydroxylase (PAH) gene in a murine model of PKU.

[0815] Lipid nanoparticles

[0816] LNPs containing the TREM corresponding to SEQ ID NO: 2 for liver delivery were formulated in LNP2 with an ionizable lipid / RNA phosphate (N / P) ratio of 6 using the procedure described in Example 5.

[0817] Treatment and sampling

[0818] PKU mice were dosed with SEQ ID NO: 2 in LNP2 at 1, 3, or 10 mg / kg in an intravenous bolus. Liver samples were analyzed for PAH protein restoration by capillary electrophoresis at 24, 72, 96, 168, and 240 hours post-administration. Plasma samples were analyzed for phenylalanine (Phe) reduction by liquid chromatography-mass spectrometry before administration (pre-bleed) and 8, 24, 48, 72, 96, 168, and 240 hours post-administration.

[0819] Results

[0820] The results are summarized in FIG. 15. FIG. 15A shows that PAH protein levels were increased to therapeutically relevant levels (above 3%) by SEQ ID NO: 2. FIG. 15B shows that plasma Phe levels were reduced to levels below the clinical targets of the EU (600 pM), US (360 pM), and diet-liberalization (120 pM), based on European and American guidelines for PKU diagnosis and management. Attorney Docket No.: F2099-7045WO

[0821] Example 13. Sustained protein rescue in stop codon model for methylmalonic acidemia (MMA).

[0822] This example describes rescue of an Arg-to-TGA stop mutation in the methylmalonyl- CoA mutase (MMUT) gene in a murine model of methylmalonic acidemia (MMA).

[0823] Lipid nanoparticles

[0824] LNPs containing the TREM corresponding to SEQ ID NO: 2 for liver delivery were formulated in LNP2 with an ionizable lipid / RNA phosphate (N / P) ratio of 6 using the procedure described in Example 5.

[0825] Treatment and sampling

[0826] Transgenic mice carrying a human MMUT gene with an Arg 403 to TGA stop mutation (hMMUT) in the background of a wildtype mouse were used in this study. Mice were dosed with SEQ ID NO: 2 in LNP2 at 1, 3, or 10 mg / kg in an intravenous bolus. Liver samples were analyzed for hMMUT protein restoration by liquid chromatography -mass spectrometry at 4, 14, and 21 days post-administration and for hMMUT mRNA ribosome occupancy (RPKM) by Ribo- seq at 1, 2, 4, 14, 21, and 28 days post-administration.

[0827] Results

[0828] The results are summarized in FIG. 16. FIG. 16A shows that hMMUT protein levels were increased by about 38% on average by SEQ ID NO: 2. FIG. 16B shows that hMMUT mRNA was actively translated at 21 days post-administration.

[0829] Example 14. In vivo evaluation of dosage and tolerance of exemplary TREMs in a lipid nanoparticle (LNP).

[0830] In this example, an exemplary TREM (SEQ ID NO: 2) was formulated in LNP2 using the procedure described in Example 5, and administered to either a mouse or a non-human primate at various dosages.

[0831] Delivery to mice

[0832] Upon a single intravenous bolus dose of 3 mg / kg to mice, liver necropsy samples were collected for quantification of total TREM levels.

[0833] Delivery to non-human primates

[0834] A single intravenous infusion of 2 mg / kg was given to non-human primates (n=2 animals). Blood samples were collected pre-dose and at 1, 8, 24, 48, and 72 hours post-dose for Attorney Docket No.: F2099-7045WO cytokine and liver safety biomarker analysis. Liver necropsy samples were taken for quantification of total TREM levels.

[0835] Results

[0836] Dose-dependent delivery in the mouse was observed with dosages from 1-10 mg / kg. As shown below in Table 25, the delivery across the two different species in spite of the difference in dosage was consistent. The area under the curve (AUC) of the amount of TREM present in the liver over time was similar between mice and non-human primates, indicating consistent delivery across species.

[0837] Table 25. Delivery of a TREM to mice and non-human primates.

[0838] In addition, various safety parameters were measured in non-human primates and observed to be within the normal range for other LNP-derived nucleic acids. As shown in FIG. 17, inflammatory cytokine (IL-6, IP-10, MCP-1, IFN-gamma, and IL-lbeta) levels transiently increased post-delivery. Further, liver safety markers were measured, wherein alanine transaminase (ALT) was less than 2.5 times over vehicle, bilirubin (transient) was measured to be less than 2 times over vehicle, and platelet reduction was shown to be less than 0.5 times over vehicle.

[0839] Example 15. In vivo evaluation of exemplary TREM concentration in plasma and the liver over time.

[0840] This example describes determination of the levels of an exemplary TREM (SEQ ID NO: 1) in the plasma and liver of mice or non-human primates at various time points following delivery in an exemplary lipid nanoparticle (LNP). An LNP formulation of SEQ ID NO: 1 was produced using the procedure described in Example 5.

[0841] Delivery to mice

[0842] Four intravenous bolus doses of 3 mg / kg were given to mice once per week (n=3 animals per time point). Blood samples were collected at 0.25, 0.5, 1, 4, 10 24, 48, 72, and 168 hours for Attorney Docket No.: F2099-7045WO quantification of TREM levels by next-generation sequencing. Liver necropsy samples were collected at 1, 4, 24, and 168 hours for quantification of total and naturally modified TREM levels by next-generation sequencing.

[0843] Delivery to non-human primates

[0844] A single intravenous infusion of 2 mg / kg was given over 1 hour to non-human primates (n=2 animals per time point). Blood samples were collected at 0.25, 0.5, 1, 1.5, 2, 3, 4, 8, 14 24, and 48 hours for quantification of TREM levels by liquid chromatography. Liver necropsy samples were taken at 1, 25, and 73 hours for quantification of total and naturally modified TREM levels by next-generation sequencing.

[0845] Results

[0846] The results are summarized in FIG. 18 and Tables 26-27. FIG. 18 shows plasma and liver pharmacokinetic profiles based on concentration of TREM (SEQ ID NO: 1) over time (after first dose for the mouse studies). Table 26 shows pharmacokinetic parameters in plasma for mice and non-human primates. Table 27 shows pharmacokinetic parameters in the liver for mice and non-human primates.

[0847] The plasma pharmacokinetic profile across both species appeared biphasic with a short distribution half-life and an extended terminal elimination half-life. Plasma pharmacokinetics is characterized by restricted (NHP) to large (mouse) volume of distribution and low systemic clearance. The TREM encapsulated in an LNP rapidly and extensively distributed to liver tissues after dosing similarly between species as evidenced by the detection of endogenously naturally modified TREM species. Following a single dose, the Cmax of the total TREM and naturally modified TREM in the liver were observed at 1 hour and 24 hours, respectively. In the mouse, elimination half-life of total TREM ranged between 50-60 hours in the liver. There was weak accumulation of TREM in mouse liver as calculated from the accumulation ratio using the AUC approach upon repeat dosing (once weekly for four weeks). The pharmacokinetic characteristics of the TREM are driven by the LNP in plasma with evidence of the TREM reaching the site of action (cytoplasm of hepatocytes). The pharmacokinetics additionally showed predictability from single to repeated dose and species translatability.

[0848] Table 26. Plasma pharmacokinetic parameters of a TREM following delivery to mice and non- human primates. Attorney Docket No.: F2099-7045WO

[0849] Table 27. Liver pharmacokinetic parameters of a TREM following delivery to mice.

[0850] Example 16: Premature termination codon (PTC) readthrough and efficacy assessment in vivo in a pharmacodynamic and efficacy model of phenylketonuria (PKU) following single and repeat dose administrations.

[0851] This example describes a non-GLP single and repeat dose study conducted in adult homozygous mice carrying an Arg-to-TGA stop mutation in the murine PAH gene (murine pharmacodynamic and efficacy PKU mouse model). Lipid nanoparticles Attorney Docket No.: F2099-7045WO

[0852] LNPs containing the TREM corresponding to SEQ ID NO: 2 for liver delivery were formulated in LNP2 with an ionizable lipid / RNA phosphate (N / P) ratio of 6 using the procedure described in Example 5.

[0853] Treatment and sampling Mice were dosed with SEQ ID NO: 2 in LNP2 at 3 or 5 mg / kg by intravenous bolus; animals received a single dose at 3 or 5 mg / kg, 2 weekly doses at 3 mg / kg, or 4 weekly doses at 5 mg / kg. Liver and plasma samples were processed 72 or 96 hours post-dose. Liver samples were analyzed for TREM abundance by tRNA-Seq and mPAH protein restoration by capillary electrophoresis; phenylalanine levels were analyzed in plasma by liquid chromatography -mass spectrometry.

[0854] Results

[0855] The results are summarized in FIG. 19. FIG. 19A and FIG. 19B show that the abundance of total and naturally modified TREM in liver was maintained after 1, 2 or 4 consecutive doses of SEQ ID NO: 2 in LNP2 at 3 or 5 mg / kg. FIG. 19C shows comparable mPAH protein after 1 or 2 administrations at 3 mg / kg 72 hours post-dose, and 1 or 4 administrations at 5 mg / kg 96 hours post-dose; a single 3 mg / kg dose is shown as a reference for the 96 hours-timepoint. FIG. 19D shows comparable plasma Phe levels after 1 or 2 administrations at 3 mg / kg 72 hours post-dose, and 1 and 4 administrations at 5 mg / kg 96 hours post-dose; a single 3 mg / kg dose is shown as a reference for the 96 hours timepoint.

Claims

1. Attorney Docket No.: F2099-7045WOWhat is claimed is:

1. A lipid nanoparticle (LNP) comprising:(i) a cationic lipid;(ii) a neutral lipid;(iii) a polymer conjugated lipid (e.g., a pegylated lipid);(iv) a sterol; and(v) a tRNA-based effector molecule (TREM) capable of suppressing the premature termination codon (PTC) in an open reading frame of a gene, wherein the TREM is encapsulated within the LNP, wherein the cationic lipid has a structure of Formula I:I or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:L1and L2are each independently -(C=O)O- or -O(C=O)-;G1and G2are each independently C4-C12 alkylene;G3is Ci-Ce alkylene;R1and R2are each independently C6-C24 alkyl; andR3is OH.

2. The LNP of claim 1, having one of the following structures (IE) or (IF):Attorney Docket No.: F2099-7045WO3. The LNP of any one of claims 1-2, wherein G1and G2are each independently Cs-Cio alkylene.

4. The LNP of any one of claims 1-3, wherein G3is C2-C4 alkylene.

5. The LNP of any one of claims 1-4, wherein R1or R2, or both, is C10-C20 alkyl.

6. The LNP of any one of claims 1-5, wherein R1or R2, or both, is branched C10-C20 alkyl.

8. The LNP of any one of claims 1-7, wherein the cationic lipid has one of the following structures:Attorney Docket No.: F2099-7045WOAttorney Docket No.: F2099-7045WOAttorney Docket No.: F2099-7045WO9. The LNP of any one of claims 1-8, wherein the cationic lipid has the following structure: o10. The LNP of any one of claims 1-9, comprising from 40 to 50 mol percent of the cationic lipid, based on total lipids in the LNP.

11. The LNP of any one of claims 1-10, comprising from 45 to 50 mol percent of the cationic lipid, based on total lipids in the LNP.

12. The LNP of any one of claims 1-11, comprising about 46, about 47, about 48 or about 49 mol percent of the cationic lipid, based on total lipids in the LNP.

13. The LNP of any one of claims 1-12, comprising from 47 to 48 mol percent of the cationic lipid, based on total lipids in the LNP.

14. The LNP of any one of claims 1-13, comprising 47.5 mol percent of the cationic lipid, based on total lipids in the LNP.

15. The LNP of any one of claims 1-14, wherein the neutral lipid is di stearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE)Attorney Docket No.: F2099-7045WO and dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-lcarboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), 16-0-monom ethyl PE, 16-O-dimethyl PE, 18-1-trans PE, l-stearioyl-2-oleoylphosphatidyethanol amine (SOPE) or 1,2-dielaidoyl-sn- glycero-3-phophoethanolamine (transDOPE).

16. The LNP of claim 15, wherein the neutral lipid is DSPC.

17. The LNP of any one of claims 1-16, wherein the neutral lipid is present in a concentration ranging from 8 to 12 mol percent or 9 to 11 mol percent based on total lipids in the LNP.

18. The LNP of any one of claims 1-17, wherein the neutral lipid is present in a concentration of about 10 mol percent, based on total lipids in the LNP.

19. The LNP of any one of claims 1-18, wherein the molar ratio of the cationic lipid to the neutral lipid ranges from about 2: 1 to about 8: 1.

20. The LNP of any one of claims 1-19, wherein the molar ratio of the cationic lipid to the sterol ranges from 5 : 1 to 1 : 1.

21. The LNP of any one of claims 1-20, wherein the sterol is present in a concentration ranging from 35 to 45 mol percent, based on total lipids in the LNP.

22. The LNP of any one of claims 1-21, wherein the sterol is present in a concentration ranging from 39 to 41 mol percent, based on total lipids in the LNP.

23. The LNP of any one of claims 1-22, wherein the sterol is cholesterol.

24. The LNP of any one of claims 1-23, wherein the molar ratio of the cationic lipid to the polymer-conjugated lipid ranges from about 100: 1 to about 10: 1.Attorney Docket No.: F2099-7045WO25. The LNP of any one of claims 1-24, wherein the polymer-conjugated lipid is present in a concentration ranging from 1.0 to 3.0 molar percent, based on total lipid in the LNP.

26. The LNP of any one of claims 1-25, wherein the LNP comprises from 1.5 to 2.8 mol percent of the polymer-conjugated lipid.

27. The LNP of any one of claims 1-25, wherein the LNP comprises from 2.2 to 3.3 mol percent of the polymer-conjugated lipid.

28. The LNP of any one of claims 1-27, wherein the LNP comprises from 2.1 to 2.5 mol percent of the polymer-conjugated lipid.

29. The LNP of any one of claims 1-28, wherein the LNP comprises about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7 or about 2.8 mol percent of the polymer-conjugated lipid.

30. The LNP of any one of claims 1-29, wherein the polymer-conjugated lipid is a pegylated lipid.

31. The LNP of claim 30, wherein the pegylated lipid is PEG-DAG, PEG-PE, PEG-S-DAG, PEG-cer or a PEG dialkyoxypropylcarbamate.

32. The LNP of claims 30, wherein the pegylated lipid has the following structure (II):or a pharmaceutically acceptable salt, tautomer or stereoisomer thereof, wherein:Attorney Docket No.: F2099-7045WOR3and R4are each independently a straight or branched alkyl or alkenyl chain containing from 10 to 30 carbon atoms, wherein the alkyl chain is optionally interrupted by one or more ester bonds; and w has a mean value ranging from 30 to 60.

33. The LNP of claim 32, wherein R3and R4are each independently straight alkyl chains containing from 12 to 16 carbon atoms.

34. The LNP of any one of claims 32 or 33, wherein the mean value of w ranges from 42 to 55.

35. The LNP of any one of claims 32-34, wherein the pegylated lipid has the following structure (Ila):wherein the average value for w ranges from 42 to 55.

36. The LNP of any one of claims 1-35, wherein the ratio of the cationic lipid to the TREM (N / P ratio) ranges from 1 to 10.

37. The LNP of claim 36, wherein the N / P ratio ranges from 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 to 1.5.

38. The LNP of claim 37, wherein the N / P ratio is about 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, or 7.Attorney Docket No.: F2099-7045WO39. The LNP of any one of claims 1-38, wherein the LNP has a mean particle diameter ranging from 40 nm to 100 nm.

40. The LNP of claim 39, wherein the mean particle diameter ranges from 50 nm to 70 nm, from 55 nm to 65 nm, from 50 nm to 60 nm, from 60 nm to 70 nm, from 70 nm to 80 nm or from 80 nm to 90 nm.

41. The LNP of claim 40, wherein the mean particle diameter is about 47 nm, about 48 nm, about 49 nm, about 50 nm, about 51 nm, about 52 nm, about 53 nm, about 54 nm, about 55 nm, about 56 nm, about 57 nm, about 58 nm, about 59 nm, about 60 nm, about 61 nm, about 62 nm, about 63 nm, about 64 nm, about 65 nm, about 66 nm, about 67 nm, about 68 nm, about 69 nm, about 70 nm, about 71 nm, about 72 nm, about 73 nm, about 74 nm, about 75 nm, about 76 nm, about 77 nm, about 78 nm, about 79 nm, about 80 nm, about 81 nm, about 82 nm, about 83 nm, about 84 nm or about 85 nm.

42. The LNP of any one of claims 1-41, wherein the LNP has an encapsulation efficiency of greater than 80%, greater than 81%, greater than 82%, greater than 83%, greater than 84%, greater than 85%, greater than 86%, greater than 87%, greater than 88%, greater than 89%, greater than 90%, greater than 91%, greater than 92%, greater than 93%, greater than 94%, greater than 95%, greater than 96%, greater than 97%, greater than 98%, greater than 99%, greater than 99.5%, or greater than 99.9%.

43. The LNP of any one of claims 1-42, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

44. The LNP of any one of claims 1-43, wherein the TREM has greater than 90%, greater than 91%, greater than 92%, greater than 93%, greater than 94%, greater than 95%, greater than 96%, greater than 97%, greater than 98%, greater than 99% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2Attorney Docket No.: F2099-7045WO45. The LNP of any one of claims 1 -44, wherein the TREM is transfer RNA (tRNA).

46. A composition comprising a population of the LNPs of any one of claims 1-45, and a pharmaceutically acceptable excipient.

47. The composition of claim 46, wherein the population of LNPs has a poly dispersity index ranging from 0 to 0.25, from about 0.10 to about 0.20, about 0.05 to about 0.15, less than about 0.1 or less than about 0.15.

48. A method of treating a subject having a disease or disorder associated with a premature termination codon (PTC) in an open reading frame of a gene encoding a full length polypeptide, comprising administering to the subject the LNP of any one of claims 1-46 or the composition of any one of claims 46 or 47, thereby treating the subject.

49. The method of claim 48, wherein the administering of the LNP or the composition results in one or more of:(a) suppression of the PTC in an open reading frame of a gene; and(b) an increase in expression of the full length polypeptide in the subject, thereby treating the subject.

50. The method of claim 49, wherein the increase in expression of the full length polypeptide is detectable in serum at least 72 hours after administration, relative to a reference sequence.

51. A composition comprising a tRNA-based effector molecule (TREM) comprising the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 formulated in a lipid nanoparticle, wherein the lipid nanoparticle comprises:(i) a cationic lipid;(ii) a neutral lipid;(iii) a polymer conjugated lipid (e.g., pegylated lipid); and(iv) a sterol; wherein the cationic lipid has a structure of Formula I:Attorney Docket No.: F2099-7045WOI or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:L1and L2are each independently -(C=O)O- or -O(C=O)-;G1and G2are each independently C4-C12 alkylene;G3is Ci-Ce alkylene;R1and R2are each independently C6-C24 alkyl; and R3is OH.

52. A method for delivering to a subject a composition comprising tRNA-based effector molecule (TREM) formulated in a lipid nanoparticle, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 and the lipid nanoparticle comprises:(i) a cationic lipid;(ii) a neutral lipid;(iii) a polymer conjugated lipid (e.g., pegylated lipid); and(iv) a sterol; wherein the cationic lipid has a structure of Formula I:I or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:L1and L2are each independently -(C=O)O- or -O(C=O)-;G1and G2are each independently C4-C12 alkylene;G3is Ci-Ce alkylene;R1and R2are each independently C6-C24 alkyl; andR3is OH thereby delivering the composition comprising an oligonucleotide formulated in a lipid nanoparticle to the subject.Attorney Docket No.: F2099-7045WO53. A method of treating a subject having a disease or disorder associated with a premature termination codon (PTC) in an open reading frame of a gene, comprising administering to the subject a composition comprising tRNA-based effector molecule (TREM) formulated in a lipid nanoparticle to the subject, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 and the lipid nanoparticle comprises:(i) a cationic lipid;(ii) a neutral lipid;(iii) a polymer conjugated lipid (e g., pegylated lipid); and(iv) a sterol; wherein the cationic lipid has a structure of Formula I:I or a pharmaceutically acceptable salt or stereoisomer thereof, wherein: L1and L2are each independently -(C=O)O- or -O(C=O)-; G1and G2are each independently C4-C12 alkylene;G3is Ci-Ce alkylene;R1and R2are each independently C6-C24 alkyl; andR3is OH thereby treating the subject.

54. A method of treating a subject having a disease or disorder associated with a premature termination codon (PTC) in an open reading frame of a gene, comprising administering to the subject a composition comprising tRNA-based effector molecule (TREM) formulated in a lipid nanoparticle to the subject, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 and the lipid nanoparticle comprises:(i) a cationic lipid;(ii) a neutral lipid;(iii) a polymer conjugated lipid (e.g., pegylated lipid); andAttorney Docket No.: F2099-7045WO(iv) a sterol; wherein the cationic lipid has a structure of Formula I:I or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:L1and L2are each independently -(C=O)O- or -O(C=O)-;G1and G2are each independently C4-C12 alkylene;G3is Ci-Ce alkylene;R1and R2are each independently C6-C24 alkyl; andR3is OH, wherein the administering of the composition results in one or more of:(a) suppression of the PTC in an open reading frame of a gene; and(b) an increase in expression of the full length polypeptide in the subject, thereby treating the subject.

55. The method of claim 54, wherein the increase in expression of the full length polypeptide is detectable in serum at least 72 hours after administration, e.g., relative to a reference sequence.

Citation Information

Patent Citations

  • Lipid nanoparticle formulations of trems

    US63701485P0

  • Lipid nanoparticle formulations of trems

    US63701488P0

  • Lipid nanoparticle formulations of trems

    US63728031P0

  • Lipid nanoparticle formulations of trems

    US63728036P0

  • Lipid nanoparticle formulations of trems

    US63804391P0