Compositions containing vitamin b6 and nicotinamide and methods of using such compositions for use in promoting bone growth
A combination of vitamin B6 and nicotinamide optimizes bone mineralization by boosting osteoblast differentiation, addressing the limitations of current treatments for bone disorders by enhancing bone growth and preventing bone loss through nutritional compositions.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-09-30
- Publication Date
- 2026-04-09
AI Technical Summary
Current treatments for bone disorders related to bone loss and decreased bone strength, such as osteoporosis, are limited in effectiveness, and there is a need for new active compounds that can be used in the long term, particularly in the form of nutritional compositions, to promote bone growth and prevent bone loss.
A combination of specific amounts of vitamin B6 and nicotinamide is used to optimize bone mineralization by boosting osteoblast differentiation, administered through oral or intravenous routes in compositions like infant formula, nutritional supplements, or food products.
The combination of vitamin B6 and nicotinamide enhances bone growth, strengthens bones, and prevents bone loss by modulating bone stem cell function, providing a therapeutic benefit for individuals in need of bone health support.
Smart Images

Figure 00000032_0000 
Figure 00000032_0001 
Figure 00000033_0000
Abstract
Description
[0001] COMPOSITIONS CONTAINING VITAMIN B6 AND NICOTINAMIDE AND METHODS OF USING SUCH COMPOSITIONS FOR PROMOTING BONE GROWTH
[0002] Technical Field
[0003] The present disclosure generally relates to compositions containing vitamin B6 and nicotinamide and also relates to methods of preparing and using such compositions. The composition may be an oral nutritional composition, for example an infant formula, a follow up formula, a nutritional supplement, an oral nutritional supplement, a food product, a food for special medical purpose (FSMP). The composition can be administered for promoting bone growth, enhancing bone growth and / or bone strength or preventing bone loss and decreased bone strength, for example to an individual in need thereof. In particular, promoting bone growth and / or preventing bone loss and decreased bone strength may be achieved by administering the composition according to the present invention and thereby increasing bone function and / or strength by modulating bone stem cells function.
[0004] Background
[0005] Bone is a tissue that undergoes constant remodelling as a result of the destruction and de novo synthesis of bone tissue in a complex process involving two main types of cells, the osteoblasts which produce new bone tissue and the osteoclasts which destroy bone, respectively. The osteoblasts, the cells responsible for bone formation, differentiate from precursor cells and express and secrete many enzymes and many structural proteins of the bone matrix, including collagen type I, osteocalcin, osteopontin and alkaline phosphatase. The osteoclasts are multinucleated cells which are responsible for bone loss in a process generally designated bone resorption.
[0006] In a healthy adult, man or animal, the joint action of the osteoblasts and osteoclasts makes possible the maintenance of the bone mass over time and simultaneously ensures remodelling of bone tissue by resorption and de novo synthesis of bone. However, in osteoporotic individuals, an imbalance in the process of bone remodelling is produced which culminates in a loss of bone which proceeds at a more rapid rate than the rate of formation. Although this imbalance exists to a certain extent in most individuals as they age, it is much more severe and occurs at a younger age in osteoporotic individuals. Thus, in man and other mammals a great variety of disorders are related to abnormal metabolism of bone resorption and bone formation, leading to an imbalance in metabolism or bone remodelling.
[0007] Of the pathological disorders related to an imbalance in bone metabolism, particular mention may be made of the disorders or diseases such as osteoporosis, Paget's disease, bone loss or osteolysis observed close to a prosthesis, metastatic bone diseases, hypercalcemia due to a cancer, multiple myelomas and periodontal diseases. Some of the disorders or diseases of bone metabolism may be caused by long-term immobilisation, for example long-term hospitalisation or even after a period of weightlessness. Of the disorders linked to abnormal bone resorption, the most common is osteoporosis, the most frequent manifestation of which is observed in women after the start of menopause. Osteoporosis is a systemic skeletal disease characterised by a reduction of the bone mass and a deterioration of the microarchitecture of bone tissue, associated with an increase of the fragility of the bone and its susceptibility to fracture.
[0008] Since osteoporosis, like other disorders associated with bone loss, constitutes a chronic disorder, its prevention and its treatment must be planned in the long term.
[0009] It is currently accepted that early treatment must be preferred because the two critical phases for bone capital are: the period of growth during which the maximal bone mass (peak bone mass) is acquired; ageing which conditions the rate of loss of bone mass. The prevention of osteoporosis must hence no longer be restricted to the elderly individual.
[0010] Moreover, in man and animals, there are many conditions characterised by the need to increase bone formation. For example, in the case of bone fractures, it is necessary to stimulate bone growth in order to accelerate complete repair of the bone. This need is also present in the periodontal diseases, the metastatic diseases of bone, the osteolytic diseases and the conditions under which repair of the connective tissue is required, for example for the cicatrisation or regeneration of defects or traumatisms of cartilage. The stimulation of bone growth is also required in the case of primary and secondary hyperparathyroidism, as well as in osteoporosis associated with diabetes and in osteoporosis associated with glucocorticoids. Although there exists to-day a large variety of active compounds for stimulating bone formation and / or inhibiting bone resorption, there is a constant need for new active compounds, in particular owing to the limited success of the current treatments.
[0011] Furthermore, in view of the chronic character of some conditions caused by an imbalance in bone metabolism, there is a need for new active compounds which it will be possible to use in the long term in man and animals, and which are likely to be available in the form of a food additive, for example in the form of a nutritional composition.
[0012] Moreover, at an earlier stage, the growth and development of the human skeleton requires an adequate supply of many different nutritional factors. Classical nutrient deficiencies are associated with stunting (e.g. energy, protein, Zn), rickets (e.g. vitamin D) and other bone abnormalities (e.g. Cu, Zn, vitamin C). There is evidence to suggest that peak bone mass and later fracture risk are influenced by the pattern of growth and nutritional exposures in childhood. However, it is challenging to define dietary reference values using bone health as a criterion, and the question of what type of diet constitutes the best support for optimal bone growth and development remains open (see e.g. Prentice, A., et al., 2006. Proceedings of the Nutrition Society, 65(4), pp.348-360).
[0013] Several approaches may be taken to improve the intake of growth-limiting nutrients, including administration of micronutrient supplements, fortification of food with micronutrients or improved dietary intake. However, particularly in populations where dietary quality is poor, several micronutrient deficiencies can co-occur, in which case growth may be affected by more than one growth-limiting nutrient (see e.g. Rivera, J. A., et al., 2003. The Journal of nutrition, 133(11), pp.4010S-4020S).
[0014] Summary of the Invention
[0015] The inventors have surprisingly demonstrated that a combination of specific amounts of vitamin B6 and nicotinamide that are able to optimize bone mineralization by boosting osteoblast differentiation. Without these specific amounts of vitamin B6 and NAM, there is no significant impact on osteoblast bone formation. In an aspect of the present disclosure, a composition comprises a combination of pyridoxine (Vitamin B6) and nicotinamide preferably an amount of the combination that is therapeutically effective for at least one of the physiological benefits disclosed herein.
[0016] In an embodiment, the composition comprises vitamin B6 in an amount of a daily dosage of 0.001- 100 mg of vitamin B6 / day, for example 0.1-25.0 mg of vitamin B6 / day, for example 0.3-15.0 mg of vitamin B6 / day, for example 0.5- 10 mg of vitamin B6 / day, for example 0.5-7.5 mg of vitamin B6 / day.
[0017] In a preferred embodiment, the composition comprises vitamin B6 in an amount of a daily dosage of 0.5-5.0 mg of vitamin B6 / day, preferably 0.5-2.5 mg of vitamin B6 / day, more preferably 0.5- 1.5 mg of vitamin B6 / day, most preferably 0.5-1.0 mg of vitamin B6 / day.
[0018] In an embodiment, the composition comprises Nicotinamide in an amount of about 0.001 mg / day to about 2000 mg / day, for example about 0.005 mg / day to about 700 mg / day, for example about 0.01 mg / day to about 500 mg / day, for example about 0.04 mg / day to about 500 mg / day, for example about 0.08 mg / day to about 500 mg / day, for example about 1 mg / day to about 500 mg / day, for example of about 1 mg / day to about 350 mg / day, for example about 1 mg / day to about 220 mg / day.
[0019] In a preferred embodiment, the composition comprises nicotinamide in an amount of a daily dosage of 1.0-100 mg of nicotinamide / day, preferably 1.0-50 mg of nicotinamide / day, more preferably 1.0-25 mg of nicotinamide / day, most preferably 1.0-10.0 mg of nicotinamide / day.
[0020] However, in any given case, the amount of compound administered will depend on such factors as the solubility of the active component, the formulation used, subject condition (such as weight), and / or the route of administration. For example, the daily doses of Vitamin B6 or Nicotinamide disclosed above are non-limiting and, in some embodiments, may be different.
[0021] In an embodiment, the composition is in a form of a solid powder, a powdered stick, a capsule or a solution. The composition can be a food supplement, a medical food, a nutritional composition, for example an infant formula or a growing up milk. In another embodiment of the present disclosure, a method of preparing the composition is provided. The method can comprise combining Vitamin B6 (for example Pyridoxine) and Nicotinamide, and preferably an amount of the resultant combination that is therapeutically effective for at least one of the physiological benefits disclosed herein.
[0022] In another embodiment of the present disclosure, a nutritional composition or nutritional supplement comprises a therapeutically effective amount of any of the compositions disclosed herein. In an embodiment, the nutritional composition or nutritional supplement is an oral nutritional supplement (ONS). The nutritional composition or supplement can be in a form of a solid powder, a powdered stick, a capsule, or a solution. In an embodiment, the nutritional supplement comprises vitamin B6 in a daily dosage of 0.05 mg / day to about 100 mg / day of vitamin B6, preferably about 0.5 mg / day to about 5.0 mg / day, most preferably about 0.5 mg / day to about 1.5 mg / day. The nutritional supplement can comprise Nicotinamide in a total daily dosage 0.001 mg / day to about 1000 mg / day, preferably about 1.0 mg / day to about 100 mg / day, most preferably about 1.0 mg / day to about 10.0 mg / day.
[0023] In an embodiment, the food product further comprises one or more additional ingredients, for example a lipid, a protein, a carbohydrate, a vitamin, a mineral, or any combination thereof.
[0024] In another aspect of the present disclosure, a kit comprises a therapeutically effective amount of any of the compositions disclosed herein. In an embodiment, the kit is configured for oral administration of the composition. For example, the kit can comprise at least two capsules in which a first capsule comprises the vitamin B6 and a second capsule comprises Nicotinamide. In an embodiment, the kit comprises vitamin B6 in the first capsule in a daily dosage of 0.05 mg / day to about-100 mg / day of vitamin B6, preferably about 0.5 mg / day to about 5.0 mg / day, most preferably about 0.5 mg / day to about 1.5 mg / day of vitamin B6. In an embodiment, the kit comprises the Nicotinamide in the second capsule in a total daily dosage 0.001 mg / day to about 1000 mg / day, preferably about 1.0 mg / day to about 100 mg / day, most preferably about 1.0 mg / day to about 10.0 mg / day.
[0025] In another embodiment of the present disclosure, the invention provides a method of promoting bone growth, enhancing bone growth and / or bone strength or preventing bone loss and decreased bone strength. The method comprises administering to an individual in need thereof a therapeutically effective amount of a combination of vitamin B6 and Nicotinamide and / or derivatives. In an embodiment, the administration is by oral administration. In another embodiment, the administration is by intravenous administration.
[0026] In a further embodiment of the present disclosure, the invention provides a method of promoting bone growth, enhancing bone growth and / or bone strength or preventing bone loss and decreased bone strength, and a method of promoting muscle growth, of preventing suboptimal muscle growth and / or of increasing muscle function and / or muscle mass. The method comprises administering to an individual in need thereof a therapeutically effective amount of a combination of vitamin B6 and Nicotinamide and / or derivatives. In an embodiment, the administration is by oral administration. In another embodiment, the administration is by intravenous administration.
[0027] The present invention also provides a method of promoting bone growth, enhancing bone growth and / or bone strength or preventing bone loss and decreased bone strength, and increasing muscle function and / or muscle mass in a subject. In one embodiment, the invention also relates to a method of promoting bone growth, enhancing bone growth and / or bone strength or preventing bone loss and decreased bone strength, and increasing muscle function and / or muscle mass in a subject by modulating muscle stem cells. In another embodiment, the present invention also relates to a method of promoting bone growth, enhancing bone growth and / or bone strength or preventing bone loss and decreased bone strength, and promoting muscle growth and / or preventing sub optimal muscle growth (by increasing muscle function and / or muscle mass) in a subject.
[0028] In some embodiments, the subject suffered from and / or is suffering from stunted growth. The definition of stunting may refer to the "height for age" value to be less than two standard deviations of the WHO Child Growth Standards median (see e.g. De Onis, M. and Branca, F., 2016. Maternal & child nutrition, 12, pp.12-26).
[0029] In one embodiment, the subject is a human subject.
[0030] In one embodiment, the human subject is an infant or a child. In one embodiment, the subject is a companion animal, preferably a dog.
[0031] Brief Description of the Drawings
[0032] Figure 1: A&B - Impact of different ratios of pyridoxine-HCl: niacinamide (B6:NAM) on osteoblasts differentiation assessed through alkaline phosphatase (ALP) enzymatic activity
[0033] Figure 2: A-E - Impact of ratios (from 1:2 to 1: 100) of B6:NAM on osteoblasts differentiation assessed through gene expression of differentiation markers.
[0034] Figure 3: Synergistic effect of Nicotinamide (NAM) and pyridoxine (B6). The effect of nicotinamide and pyridoxine alone or combined on the MyoD+ cells was assessed on Human primary myoblasts from donor 3. For each condition, the number of MyoD+ cells was normalized to the number of MyoD+ cells in the control condition (DMSO 1%). Figure 3A represents the number of MyoD+ cells normalized to the control condition. Figure 3B represents the change in MyoD+ cell number compared to the control condition (DMSO 1%). AB6 or ANAM refers to the change from the control condition with B6 or NAM treatment, respectively. AB6+ANAM refers to the theoretical sum of the effects of B6 and NAM measured separately. A(B6+NAM) refers to the experimental effects of a combined treatment with B6 and NAM. A statistically significant synergistic effect between the nicotinamide and pyridoxine has been observed by applying a linear regression model (interaction term, p=0.05).
[0035] Figure 4: In vivo effect of the combination of nicotinamide (NAM) and pyridoxine (B6) on muscle stem cells function. Figure 4 represents early phase of expansion and subsequent phase of myogenic differentiation of Muscle Stem Cells, evaluated by counting the number of Pax7+ cells (Fig 4 A) and Myogenin+ cells (Fig 4B), respectively. Data are expressed as number of cells per area of injured muscle and expressed as a fold change compared to the control condition. *, **, ***, **** indicates difference from the control, One-way ANOVA, withp<0.05, p<0.01, p<0.001, p<0.0001, respectively. Data are presented as Mean + / - SEM.
[0036] Detailed Description
[0037] Definitions The term “infant” means a child under the age of 12 months. The expression “young child” or “toddler” means a child aged between one and less than three years. The expression “child” means a between three and seven years of age.
[0038] A “preterm” or “premature” means an infant or young child who was not bom at term. Generally, it refers to an infant or young child born prior 37 weeks of gestation.
[0039] The expression “nutritional composition” means a composition which nourishes a subject. This nutritional composition is usually to be taken orally or intravenously, and it usually includes a lipid or fat source and a protein source. Non limiting examples of nutritional composition according to the present invention are selected in the group consisting of: infant formula (for example, follow up formula), baby food, infant cereal composition, growing up milk, fortifier and nutritional supplement (for example paediatric supplement).
[0040] The expression "infant formula" as used herein refers to a foodstuff intended for particular nutritional use by infants during the first months of life and satisfying by itself the nutritional requirements of this category of person (Article 2(c) of the European Commission Directive 91 / 321 / EEC 2006 / 141 / EC of 22 December 2006 on infant formulae and follow-on formulae). It also refers to a nutritional composition intended for infants and as defined in Codex Alimentarius (Codex STAN 72-1981) and Infant Specialities (incl. Food for Special Medical Purpose). The expression "infant formula" encompasses both “starter infant formula” and “follow-up formula” or “follow-on formula”.
[0041] A “follow-up formula” or “follow-on formula” is given from the 6th month onwards. It constitutes the principal liquid element in the progressively diversified diet of this category of person.
[0042] The expression “baby food” means a foodstuff intended for particular nutritional use by infants or young children during the first years of life.
[0043] The expression “infant cereal composition” means a foodstuff intended for particular nutritional use by infants or young children during the first years of life. The expression “growing-up milk” (or GUM) refers to a milk-based drink generally with added vitamins and minerals, that is intended for young children or children.
[0044] The term “fortifier” refers to liquid or solid nutritional compositions suitable for fortifying or mixing with human milk, infant formula, growing-up milk or human breast milk fortified with other nutrients. Accordingly, the fortifier of the present invention can be administered after dissolution in human breast milk, in infant formula, in growing-up milk or in human breast milk fortified with other nutrients or otherwise it can be administered as a stand-alone composition. When administered as a stand-alone composition, the milk fortifier of the present invention can be also identified as being a “supplement”. In one embodiment, the milk fortifier of the present invention is a supplement.
[0045] The term “nutritional supplement” refers to a product which is intended to supplement the general diet of a subject.
[0046] The term “paediatric supplement” refers to a product which is intended to supplement the general diet of a infant, a young child or a child.
[0047] The expression “weaning period” means the period during which the mother's milk is substituted by other food in the diet of an infant or young child.
[0048] Some definitions are provided hereafter. Nevertheless, definitions may be located in the “Embodiments” section below, and the above header “Definitions” does not mean that such disclosures in the “Embodiments” section are not definitions.
[0049] All percentages expressed herein are by weight of the total weight of the composition unless expressed otherwise. When reference herein is made to the pH, values correspond to pH measured at 25 °C with standard equipment.
[0050] As used herein, “about,” “approximately” and “substantially” are understood to refer to numbers in a range of numerals, for example the range of -10% to +10% of the referenced number, preferably -5% to +5% of the referenced number, more preferably -1% to +1% of the referenced number, most preferably -0.1% to +0.1% of the referenced number. All numerical ranges herein should be understood to include all integers, whole or fractions, within the range. Moreover, these numerical ranges should be construed as providing support for a claim directed to any number or subset of numbers in that range. For example, a disclosure of from 1 to 10 should be construed as supporting a range of from 1 to 8, from 3 to 7, from 1 to 9, from 3.6 to 4.6, from 3.5 to 9.9, and so forth.
[0051] As used in this disclosure and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a component” or “the component” includes two or more components.
[0052] The words “comprise,” “comprises” and “comprising” are to be interpreted inclusively rather than exclusively. Likewise, the terms “include,” “including,” “containing” and “having” should all be construed to be inclusive, unless such a construction is clearly prohibited from the context. Further in this regard, these terms specify the presence of the stated features but not preclude the presence of additional or further features.
[0053] Nevertheless, the compositions and methods disclosed herein may lack any element that is not specifically disclosed herein. Thus, a disclosure of an embodiment using the term “comprising” is (i) a disclosure of embodiments having the identified components or steps and also additional components or steps, (ii) a disclosure of embodiments “consisting essentially of’ the identified components or steps, and (iii) a disclosure of embodiments “consisting of’ the identified components or steps. Any embodiment disclosed herein can be combined with any other embodiment disclosed herein.
[0054] The term “and / or” used in the context of “X and / or Y” should be interpreted as “X,” or “Y,” or “X and Y.” Similarly, “at least one of X or Y” should be interpreted as “X,” or “Y,” or “X and Y.” For example, “at least one of Nicotinamide or Vitamin B6” should be interpreted as “Nicotinamide,” or “Vitamin B6,” or “both Nicotinamide and Vitamin B6.”
[0055] Where used herein, the terms “example” and “such as,” particularly when followed by a listing of terms, are merely exemplary and illustrative and should not be deemed to be exclusive or comprehensive. A "subject" or “individual” is a mammal, preferably a human, for example an infant, young child or child. As used herein, an “effective amount” is an amount that prevents a deficiency, treats a disease or medical condition in an individual, or, more generally, reduces symptoms, manages progression of the disease, or provides a nutritional, physiological, or medical benefit to the individual.
[0056] The terms “treatment” and “treat” include both prophylactic or preventive treatment (that prevent and / or slow the development of a targeted pathologic condition or disorder) and curative, therapeutic or disease-modifying treatment, including therapeutic measures that cure, slow down, lessen symptoms of, and / or halt progression of a diagnosed pathologic condition or disorder; and treatment of patients at risk of contracting a disease or suspected to have contracted a disease, as well as patients who are ill or have been diagnosed as suffering from a disease or medical condition. The terms “treatment” and “treat” do not necessarily imply that a subject is treated until total recovery. The terms “treatment” and “treat” also refer to the maintenance and / or promotion of health in an individual not suffering from a disease but who may be susceptible to the development of an unhealthy condition. The terms “treatment” and “treat” are also intended to include the potentiation or otherwise enhancement of one or more primary prophylactic or therapeutic measures. As non-limiting examples, a treatment can be performed by a patient, a caregiver, a doctor, a nurse, or another healthcare professional.
[0057] The term "unit dosage form," as used herein, refers to physically discrete units suitable as unitary dosages for human and animal subjects, each unit containing a predetermined quantity of the composition disclosed herein in an amount sufficient to produce the desired effect, in association with a therapeutically effective diluent, carrier or vehicle. The specifications for the unit dosage form depend on the particular compounds employed, the effect to be achieved, and the pharmacodynamics associated with each compound in the host.
[0058] A “kit” means that the components of the kit are physically associated in or with one or more containers and considered a unit for manufacture, distribution, sale, or use. Containers include, but are not limited to, bags, boxes, cartons, bottles, packages of any type or design or material, over-wrap, shrink-wrap, affixed components (e.g., stapled, adhered, or the like), or combinations thereof. The term "substantially no" as used in reference to a particular component means that any of the component present constitutes less than about 2.0% by weight, such as less than about 1.0% by weight, preferably less than about 0.5% by weight or, more preferably, less than about 0.1% by weight.
[0059] The term “food for special medical purpose (FSMP)” refers to formula foods specially processed and prepared in order to meet special needs for nutrient or diet of those suffering from food intake restriction, disorder of digestive absorption, disorder of metabolic or certain diseases. Such foods shall be used alone or together with other foods under the guidance of a doctor or clinical nutritionist. FSMP is special dietary food, not medicine, but not ordinarily eaten by normal people. It is specially developed by clinicians and nutritionists based on scientific facts after extensive medical research.
[0060] The term “oral nutritional supplement (ONS)” refers to sterile liquids, semi-solids or powders, which provide macro and micronutrients. They are widely used within the acute and community health settings for individuals who are unable to meet their nutritional requirements through oral diet alone.
[0061] As used herein, “vitamin B6” can include one or more of the following: pyridoxine (PN), pyridoxal 5'-phosphate (PLP), pyridoxine 5'-phosphate (P5P), pyridoxal (PL), pyridoxamine (PM), pyridoxamine 5 '-phosphate (PMP), 4-pyridoxic acid, and pyritinol. In a preferred embodiment, at least a portion of any vitamin B6 is PN. At least a portion of the vitamin B6 can be PLP. Absorbed pyridoxamine is converted to PMP by pyridoxal kinase, which is further converted to PLP by pyridoxamine-phosphate transaminase or pyridoxine 5'-phosphate oxidase which also catalyzes the conversion of PNP to PLP. [2] Pyridoxine 5'-phosphate oxidase is dependent on flavin mononucleotide (FMN) as a cofactor produced from riboflavin (vitamin B2).
[0062] Within the context of the present invention, the term “niacinamide” is to be intended as a synonym of nicotinamide.
[0063] Embodiments
[0064] An aspect of the present disclosure is a composition comprising Vitamin B6 and nicotinamide. The composition comprising the Vitamin B6 and nicotinamide is advantageous in promoting bone growth, enhancing bone growth and / or bone strength or preventing bone loss and decreased bone strength. In one embodiment, the present invention provides for a composition comprising nicotinamide and pyridoxine.
[0065] Composition
[0066] Nicotinamide
[0067] Nicotinamide, also known as niacinamide or nicotinic acid amide, is the water-soluble, active form of vitamin B3.
[0068] The nicotinamide can be administered in an amount of about 0.001 mg / day to about 2000 mg / day, more preferably about 1 mg / day to about 750 mg / day, even more preferably about 1 mg / day to about 500 mg / day, most preferably about 1 mg / day to about 250 mg / day, for example about 1 mg / day to about 100 mg / day, about 1 mg / day to about 75 mg / day, about 1 mg / day to about 50 mg / day, about 1 mg / day to about 25 mg / day, or about 1 mg / day to about 10 mg / day. Of course, the daily dose can be administered in portions at various hours of the day. However, in any given case, the amount of compound administered will depend on such factors as the solubility of the active component, the formulation used, subject condition (such as weight), and / or the route of administration. For example, the daily doses of nicotinamide disclosed above are non-limiting and, in some embodiments, may be different; in particular, the compositions disclosed herein can be utilized as an acute care food for special medical purposes (FSMP) and contain up to about 2.0 g nicotinamide / day.
[0069] Vitamin B6
[0070] In an embodiment, vitamin B6 can include one or more of the following: pyridoxine (PN), pyridoxal 5'-phosphate (PLP), pyridoxine 5'-phosphate (P5P), pyridoxal (PL), pyridoxamine (PM), pyridoxamine 5'-phosphate (PMP), 4-pyridoxic acid, and pyritinol. In a preferred embodiment, at least a portion of any vitamin B6 is PN. At least a portion of the vitamin B6 can be PLP. Absorbed pyridoxamine is converted to PMP by pyridoxal kinase, which is further converted to PLP by pyridoxamine-phosphate transaminase or pyridoxine 5'-phosphate oxidase which also catalyzes the conversion of PNP to PLP. [2] Pyridoxine 5 '-phosphate oxidase is dependent on flavin mononucleotide (FMN) as a cofactor produced from riboflavin (vitamin B2).
[0071] Pyridoxine is the 4-methanol form of vitamin B6, an important water-soluble vitamin that is naturally present in many foods.
[0072] In one embodiment, Vitamin B6 is pyridoxine.
[0073] In an embodiment, Vitamin B6 can be administered in a daily dosage of 0.001-100.0 mg of the vitamin B6 / day.
[0074] In an embodiment, Vitamin B6 can be administered in a daily dosage of 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1.0. 5.0, 10.0, 15.0, 20.0, 25.0, 30,0, 35.0, 40.0, 45.0, 50.0, 55.0, 60.0, 65.0, 70.0, 75.0, 80.0, 85.0, 90.0, 95.0, or 100.0 mg of the vitamin B6 / day.
[0075] In an embodiment, Vitamin B6 can be administered in a daily dosage of 1.0-25.0 mg of the vitamin B6 / day.
[0076] In an embodiment, the combination is effective when the vitamin B6: nicotinamide are present in a ratio of from about 1: 100 to about 1:5, for example, about 1: 100, 1:90, 1:80, 1:70, 1:60, 1:50, 1:40, 1:30, 1 :20, 1: 10, or 1:5.
[0077] In an embodiment, the combination is effective when the vitamin B6: nicotinamide are present in a ratio of from about 1 :95, 1 :85, 1 :75, 1 :65, 1 :55, 1 :45, 1 :35, 1 :25 or 1: 15.
[0078] In an embodiment, the combination is particularly effective, when the vitamin B6: nicotinamide are present in a ratio of from about 1:85 to about 1:35, preferably from about 1 :80 to about 1 :35, preferably from about 1:75 to about 1:35, more preferably from about 1:60 to about 1:38, more preferably from about 1:35 to about 1:45, most preferably about 1:40.
[0079] In one embodiment, the vitamin B6: nicotinamide are present in a ratio of from about 1 : 15 to about 1 : 5, preferably about 1:10.
[0080] In some embodiments, the composition comprising a combination of the Vitamin B6 and nicotinamide is in the form of a nutritional composition. The nutritional composition according to the invention can be for example an infant formula, a starter infant formula, a follow-on or follow-up formula, a growing-up milk, a baby food, an infant cereal composition, a fortifier such as a human milk fortifier, or a supplement. In some particular embodiments, the composition of the invention is an infant formula, a fortifier or a supplement that may be intended for the first 4 or 6 months of age. In a preferred embodiment the nutritional composition of the invention is an infant formula.
[0081] In some other embodiments the nutritional composition of the present invention is a fortifier. The fortifier can be a breast milk fortifier (e.g. a human milk fortifier) or a formula fortifier such as an infant formula fortifier or a follow-on / follow-up formula fortifier.
[0082] In some embodiments, the composition comprising a combination of the Vitamin B6 and nicotinamide is in the form of a food product, food supplement, nutraceutical, food for special medical purpose (FSMP), nutritional supplement, dairy-based drink, low-volume liquid supplement or meal replacement beverage.
[0083] In some embodiments, the composition comprising a combination of the Vitamin B6 and nicotinamide is in the form of a food additive or a medicament.
[0084] A food additive or a medicament may be in the form of tablets, capsules, pastilles or a liquid for example. Food additives or medicaments are preferably provided as sustained release formulations, allowing a constant supply of the active ingredients for prolonged times.
[0085] The composition may be selected from the group consisting of milk-powder based products; instant drinks; ready-to-drink formulations; nutritional powders; nutritional liquids; milk-based products, in particular yoghurts or ice cream; cereal products; beverages; water; coffee; cappuccino; malt drinks; chocolate flavoured drinks; culinary products; soups; tablets; and / or syrups.
[0086] The composition may further contain protective hydrocolloids (such as gums, proteins, modified starches), binders, film forming agents, encapsulating agents / materials, wall / shell materials, matrix compounds, coatings, emulsifiers, surface active agents, solubilising agents (oils, fats, waxes, lecithins etc.), adsorbents, carriers, fillers, co-compounds, dispersing agents, wetting agents, processing aids (solvents), flowing agents, taste masking agents, weighting agents, jellifying agents, gel forming agents, antioxidants and antimicrobials.
[0087] Further, the composition may contain an organic or inorganic carrier material suitable for oral or enteral administration as well as vitamins, minerals trace elements and other micronutrients in accordance with the recommendations of government bodies such as the USRDA.
[0088] The composition of the invention may contain a protein source, a carbohydrate source and / or a lipid source.
[0089] Any suitable dietary protein may be used, for example animal proteins (such as milk proteins, meat proteins and egg proteins); vegetable proteins (such as soy protein, wheat protein, rice protein and pea protein); mixtures of free amino acids; or combinations thereof. Milk proteins such as casein and whey, and soy proteins are particularly preferred.
[0090] If the composition includes a fat source, the fat source preferably provides 5% to 40% of the energy of the formula; for example, 20% to 30% of the energy. DHA may be added. A suitable fat profile may be obtained using a blend of canola oil, corn oil and high-oleic acid sunflower oil.
[0091] A source of carbohydrates may more preferably provide between 40% to 80% of the energy of the composition. Any suitable carbohydrate may be used, for example sucrose, lactose, glucose, fructose, corn syrup solids, maltodextrins and mixtures thereof.
[0092] Another aspect of the present disclosure is a kit comprising a therapeutically effective amount of any of the compositions disclosed herein. In an embodiment, the kit is configured for oral administration of the composition. For example, the kit can be in a form of two capsules, wherein the first capsule comprises the vitamin B6 and the second capsule comprises the Nicotinamide.
[0093] Another aspect of the present disclosure is a method of preparing the composition. The method can comprise combining a therapeutically effective amount of a combination of Vitamin B6 and nicotinamide, preferably an amount of the combination that is therapeutically effective for at least one of the physiological benefits disclosed herein.
[0094] Method of treatment It is to be appreciated that all references herein to treatment include curative, palliative and prophylactic treatment. The treatment of mammals, particularly humans, is preferred. Both human and veterinary treatments are within the scope of the invention.
[0095] In an embodiment, the present invention provides a method for promoting bone growth, enhancing bone growth and / or bone strength or preventing bone loss and decreased bone strength in a subject. The method comprises administering to an individual in need thereof a therapeutically effective amount of any of the compositions disclosed herein. Non-limiting examples of the administration include oral administration. In an embodiment, the method comprises administering to an individual in need thereof a therapeutically effective amount of a combination of vitamin B6 and Nicotinamide.
[0096] In an embodiment, the present invention provides a method for promoting bone growth, enhancing bone growth and / or bone strength or preventing bone loss and decreased bone strength, and increasing muscle function and / or muscle mass and / or promote muscle growth in a subject. The method comprises administering to an individual in need thereof a therapeutically effective amount of any of the compositions disclosed herein. Non-limiting examples of the administration include oral administration. In an embodiment, the method comprises administering to an individual in need thereof a therapeutically effective amount of a combination of vitamin B6 and Nicotinamide.
[0097] In an embodiment, the present invention provides a composition comprising a combination of Vitamin B6 and Nicotinamide, in a therapeutically effective amount for use in promoting bone growth, enhancing bone growth and / or bone strength or preventing bone loss and decreased bone strength.
[0098] In an embodiment, the present invention provides a composition comprising a combination of Vitamin B6 and Nicotinamide, in a therapeutically effective amount for use in promoting bone growth, enhancing bone growth and / or bone strength or preventing bone loss and decreased bone strength, and for use in promoting muscle growth and / or preventing sub-optimal muscle growth or for use in increasing muscle function and / or muscle mass. In another embodiment, the method comprises administering to an individual in need thereof a therapeutically effective amount of a combination of an effective amount of vitamin B6 and Nicotinamide.
[0099] Although the composition for use in the invention can be administered alone, they will generally be administered in admixture with a pharmaceutical carrier, excipient or diluent, particularly for human therapy.
[0100] In a further embodiment of the invention, a compound or a composition of the invention may be used in a method of promoting bone growth, enhancing bone growth and / or bone strength or preventing bone loss and decreased bone strength in combination with a dietary intervention of high caloric, high protein, high carbohydrate, Vitamin B12 and / or Vitamin D supplementation, antioxidants, omega fatty acids, butyrate producers and / or polyphenols.
[0101] Within the context of the present invention, the expression “butyrate producer” indicate a substance or ingredient which, when administered to a subject, is able to deliver and / or stimulate the production of butyrate, for example, in the gut of said subject. Not limiting examples of butyrate producers are: sodium butyrate, potassium butyrate and / or triglycerides containing butyrate such as for example those described in the International Patent Application WO2019 / 228851of the same applicant.
[0102] In some embodiments, the composition comprising a combination of the Vitamin B6 and nicotinamide is in a combined preparation for simultaneous, separate or sequential use, preferably simultaneous.
[0103] The term “combination”, or terms “in combination”, “used in combination with” or “combined preparation” as used herein may refer to the combined administration of two or more agents simultaneously, sequentially or separately.
[0104] The term “simultaneous” as used herein means that the agents are administered concurrently, i.e. at the same time.
[0105] The term “sequential” as used herein means that the agents are administered one after the other. The term “separate” as used herein means that the agents are administered independently of each other but within a time interval that allows the agents to show a combined, preferably synergistic, effect. Thus, administration “separately” may permit one agent to be administered, for example, within 1 minute, 5 minutes or 10 minutes after the other.
[0106] The skilled person can readily determine an appropriate dose of one of the agents of the invention to administer to a subject without undue experimentation. Typically, a physician will determine the actual dosage which will be most suitable for an individual patient and it will depend on a variety of factors including the activity of the specific agent employed, the metabolic stability and length of action of that agent, the age, body weight, general health, sex, diet, mode and time of administration, rate of excretion, drug combination, the severity of the particular condition, and the individual undergoing therapy. There can of course be individual instances where higher or lower dosage ranges are merited, and such are within the scope of the invention.
[0107] In an embodiment, the method comprises administering to an individual in need thereof a therapeutically effective amount of a combination of vitamin B6 in a daily dosage of 0.5-25.0 mg of the vitamin B6 / day, preferably about 0.5 mg / day to about 15 mg / day and Nicotinamide in an amount of about 0.001 mg / day to about 500 mg / day, preferably about 1 mg / day to about 50 mg / day.
[0108] In an embodiment, the combination is administered to the individual for a time period of at least one month; preferably at least two months, more preferably at least three, four, five or six months; most preferably for at least one year. During the time period, the combination can be administered to the individual at least one day per week; preferably at least two days per week, more preferably at least three, four, five or six days per week; most preferably seven days per week. The combination can be administered in a single dose per day or in multiple separate doses per day.
[0109] The above examples of administration do not require continuous daily administration with no interruptions. Instead, there may be some short breaks in the administration, such as a break of two to four days during the period of administration. The ideal duration of the administration of the composition can be determined by those of skill in the art. Methods for enhancing bone growth and / or bone strength or preventing bone loss and decreased bone strength.
[0110] In an embodiment of the present invention, a composition comprising a combination of Vitamin B6 and Nicotinamide may be used in a method for promoting bone growth, enhancing bone growth and / or bone strength or preventing bone loss and decreased bone strength.
[0111] Within the context of the present invention, the term “enhancing bone growth and / or bone strength, or limiting / preventing bone loss” may refer to, in particular, one or more of the following physiological processes: bone catch-up growth, bone mass acquisition, optimization of peak bone mass, promotion of bone formation, promotion of bone anabolism, promotion of bone mineralization, increase of bone mineral density and micro-architecture, modulation of bone biomechanical properties, and modulation the ratio of bone formation and / or bone resorption, bone mass maintenance, reduction of bone resorption
[0112] As used herein “bone quality” may refer to aspects of bone composition and structure that contribute to bone strength independently of bone mineral density. These include bone turnover, microarchitecture, mineralisation, microdamage and the composition of bone matrix and mineral. Methods to measure bone quality are known in the art.
[0113] As used herein, “promoting bone growth and / or strength” may refer to the support of normal bone growth and / or strength, for example during childhood and adolescence. Supporting normal bone growth and / or strength may result in normal bone anatomy and physiology. Suitable methods and parameters to determine bone growth and bone strength will be known to the skilled person (see e.g. Donnelly, E., 2011. Clinical Orthopaedics and Related Research, 469(8), pp.2128-2138). Suitably, normal bone growth and / or strength may be determined using one or more bone parameter selected from: trabecular bone volume fraction (BV / TV), bone mineral density (BMD), bone mineral content (BMC), cortical bone volume (Ct.BV), medio-lateral diameter, anteroposterior diameter, bone ultimate force (FMax), and bone stiffness. In some embodiments, normal bone growth and / or strength is determined using one or more bone parameter selected from: bone mineral density (BMD), trabecular bone volume fraction (BV / TV), cortical bone volume (Ct.BV), and bone ultimate force (FMax). Suitable methods to determine these parameters will be available to the skilled person. A regular nutritional supply of the composition according to the present invention is also useful for preventing the bone loss that occurs with ageing and / or to protect bone cells during bone aging.
[0114] In an embodiment, the said composition is for use i) improving bone quality; ii) preventing or treating disorders linked to an imbalance in the relationship between bone formation and bone resorption.
[0115] By "reduction / inhibition of bone resorption" is meant according to the invention inhibition of the destructive activity of bone tissue by the osteoclast cells. In order to verify that the supply of the composition in man or animals inhibits bone resorption, the specialist skilled in the art can measure the urinary excretion of desoxypyridinoline as described in the examples, a diminution of the expression of desoxypyridinoline being the reflection of inhibition of bone resorption.
[0116] The supply of the composition according to the invention to an animal organism induces simultaneously a stimulation of bone formation and inhibition of bone resorption, the overall increase of bone mineralisation, and hence of the bone density, being the result of the induction of these two mechanisms.
[0117] In order to determine whether a subject presents a state of reduced bone mass and as a consequence requires a supply of the composition according to the present invention, the specialist skilled in the art will be able to refer in particular to the report of the World Health Organisation (WHO) of 1994 entitled "Assessment of fracture risk and its application to screening for post-menopausal osteoporosis" (WHO Technical Series-843).
[0118] The composition according to the present invention is also designed for Individuals presenting symptoms of bone deficit or likely to suffer from bone deficit, i.e. from an imbalance in the relationship between bone formation and bone resorption which, if it continues, induces a diminution of the bone mass. A composition according to the invention is also designed for individuals presenting symptoms of bone deficit resulting from a fracture, an operation or also a dental disease.
[0119] In particular, the composition is designed to prevent or treat diseases selected from osteoporosis, Paget's disease, bone loss or osteolysis observed close to a prosthesis, metastatic bone diseases, hypercalcemia due to a cancer, multiple myelomas, periodontal diseases or osteoarthritis. As has already been mentioned above, many disorders linked to an imbalance of bone metabolism, such as osteoporosis, develop gradually over a long period of time and require chronic treatments. Their prevention or their treatment can hence be carried out by means of a regular supply of the composition according to the present invention, preferably in the form of a nutritional composition.
[0120] Similarly, a regular nutritional supply of the composition according to the present invention to individuals, humans or animals, is such as to make possible the production of a high bone density and an elevated peak bone mass by stimulation of bone formation when these individuals attain adult age.
[0121] A regular nutritional supply of the composition according to the present invention is also useful for preventing the bone loss that occurs with ageing and / or to protect bone cells during bone aging.
[0122] Methods for promoting catch-up growth
[0123] A composition comprising a combination of Vitamin B6 and Nicotinamide, in a therapeutically effective amount, may thereby promote catch-up growth.
[0124] As used herein, “catch-up growth” may refer to height velocity (Growth velocity) above the limits of normal for age for at least 1 year after a transient period of growth inhibition and may be complete or incomplete (see e.g. Wit, J.M. and Boersma, B., 2002. Journal of Pediatric Endocrinology and Metabolism, 15, pp.1229- 1242.
[0125] Suitable method and parameters to determine catch-up growth will be known to the skilled person. Suitably, catch-up growth may be determined using height velocity or height standard deviation score (see e.g. Frongillo, E.A., Leroy, J.L. and Lapping, K., 2019. Advances in Nutrition, 10(3), pp.372-379 and Desmond, C. and Casale, D., 2017. PloS one, 12(12), p.e0189135).
[0126] In some embodiments, the catch-up growth is determined in absolute terms of linear growth (i.e. the height deficit from the healthy reference population mean is reduced). In some embodiments, the catch-up growth is determined in relative terms of linear growth (i.e. the height-for-age z-score is improved and / or passes the -2SD or -1SD cut-off points).
[0127] Within the context of the present invention, the term “promoting” indicates a factor or a number of factors causing a certain process to occur. Muscle stem cells
[0128] The term “muscle stem cell”, as used herein, may refer to satellite cells, preferably satellite cells that are quiescent and are uncommitted.
[0129] Satellite cells are precursors to skeletal muscle cells. In adult muscle, satellite cells are generally quiescent, but can activate and undergo myogenesis in response to disease or mechanical strain such as injury or exercise. Satellite cells are also involved in the normal growth of muscle. Upon activation, satellite cells proliferate before undergoing myogenic differentiation to finally fuse with existing myofibers or to form new myofibers, depending on the magnitude of tissue trauma. In addition to generating differentiated myogenic progeny, at least some satellite cells can self-renew, thereby meeting the defining criteria of bona fide resident stem cells.
[0130] MyoD+ is a commitment marker that may be used to distinguish quiescent from committed satellite cells.
[0131] Muscle function and mass
[0132] The compounds, compositions, uses and methods disclosed herein may provide for the maintenance of or increase in muscle function and / or mass.
[0133] The term “muscle function” refers to the ability of a muscle to perform in a manner that does not negatively impact on the life of a subject, and encompasses parameters of muscle strength, muscle contraction, muscle endurance, muscle elasticity, ability of a muscle to resist muscle fatigue and / or physical activities of daily living such as walking up stairs, getting out of a chair and other activities of daily living.
[0134] Suitable tests for assessing muscle function include grip strength assessment using a dynamometer; one repeat maximum on leg press, chest press or leg extension; gait speed; 6 min walk test; time up and go; short physical performance battery; Fried frailty criteria; and stair climbing time assessments. Other suitable tests include muscle strength, endurance and time to fatigue.
[0135] Muscle mass (which may equate with muscle volume, muscle thickness or myofiber size) may be measured by dual-energy X-ray absorptiometry (DXA) or bioimpedance tests. Similarly, MRI may be used for assessing muscle volume and ultra-sound may be used for assessing muscle thickness and pennation angle.
[0136] “Muscle wasting” may be a reduction in muscle mass, for example to the stage where the muscle loss becomes debilitating. In one embodiment, the subject does not lose more than 10%, 5%, 4%, 3%, 2% or 1% of their muscle mass.
[0137] Preferably, the compounds, compositions, uses and methods disclosed herein provide for the maintenance of or increase in muscle mass.
[0138] The term “maintains” refers to a particular parameter, such as muscle function and / or mass, remaining substantially unchanged over a period of time (e.g. 5, 10, 15, 20, 25, 30, 40, 50 or more years).
[0139] In one embodiment, muscle mass increases by at least 1%, 2%, 3%, 4%, 5%, 10%, 15% or 20%.
[0140] In another embodiment, muscle mass increases by 1-2.5%, 1-5%, 1-10% or 1-20%.
[0141] Preferably, the muscle is skeletal muscle.
[0142] Muscle growth
[0143] In one embodiment of the present invention, as a result of maintenance of or increase in muscle function and / or mass, the compounds, compositions, uses and methods disclosed herein provide for promotion of muscle growth and / or prevention of sub-optimal muscle growth in a subject, such as an infant, young child or child.
[0144] Within the context of the present invention the term “muscle growth” encompasses an increase of muscle mass, muscle volume and / or-muscle function, through time. Muscle growth may be evaluated by measuring muscle mass and / or function as above described.
[0145] Muscle growth can also be determined by an increase in muscle fiber number (hyperplasia) as well as an increase in muscle fiber size (hypertrophy).
[0146] Preferably, the muscle functionality that can be improved by the methods disclosed herein comprises a characteristic selected from the group consisting of muscle strength, gait speed, and combinations thereof. Muscle function is typically defined as strength per unit of appendicular skeletal muscle mass or per muscle volume.
[0147] The individual can be at risk of a disorder or condition (e.g., impairment in one or more of muscle functionality, muscle performance, or muscle strength), in which case the effective amount of the composition is a prophylactically effective dose; or the individual can have a disorder or condition, in which case the effective amount of the composition is a therapeutically effective dose. In some embodiments, the methods comprise identifying the individual as having the condition or being at risk of the condition before the administration.
[0148] Subject
[0149] In some embodiments, a subject is a human or non-human animal.
[0150] Non limiting examples of non-human animals include vertebrates, for example mammals, such as non-human primates (particularly higher primates), dogs, rodents (e.g. mice, rats or guinea pigs), pigs and cats. The non-human animal may be a companion animal.
[0151] Non- examples of non-human animal subjects are also avian, bovine, ovine or porcine animals. The present invention may also be useful in non-human animal subjects such as: avian, bovine, ovine or porcine animals, for optimizing meat production by increasing skeletal muscle mass and / or function.
[0152] Preferably, the subject is a human. In one embodiment, the subject is a human infant or young child. In one embodiment, the subject is a human preterm infant.
[0153] EXAMPLES
[0154] The following non-limiting examples support the unexpected effectiveness of a composition comprising vitamin B6 and nicotinamide for promoting bone growth, enhancing bone growth and / or bone strength or preventing bone loss and decreased bone strength.
[0155] Example 1: Osteoblast differentiation assessed through alkaline phosphatase (ALP) enzymatic activity MC3T3-E1 subclone 4 cells were maintained in growth medium (GM) composed of ascorbic acid- free aMEM (ThermoFisher Scientific), supplemented with 10% fetal calf serum (FCS, ThermoFisher Scientific) and 1% penicillin / streptomycin. To induce differentiation into osteoblasts, cells were seeded at 5 104cells / cm2and grown to confluency in GM for 24 h. Then, the medium was switched to differentiation medium (DM) composed of GM supplemented with 10 mM P-glycerophosphate, 50 pg / ml ascorbic acid (only for panel B) and treatment solutions of interest. Cells were differentiated for 7 days and were then collected for ALP activity measurement as described previously with minor modifications1. Briefly, cells were lysed by heat shock and collected in ALP buffer (1 M diethanolamine, 0.24 M MgC12, pH 9.8). Enzymatic reaction was monitored at 405 nm after 4-Nitrophenyl phosphate disodium salt hexahydrate addition. Michaelis-Menten kinetics were evaluated at 30 °C for 30 min. Vmax was used as a proxy for ALP activity. The activity value was normalized by protein content measured via the Pierce BCA Protein Assay Kit (ThermoFisher Scientific) according to the manufacturer’s instructions. Cell treatments were composed of lOpM NAM (DSM) with the corresponding ratio of B6 (DSM). A. Treatments were without ascorbic acid except for the positive control that was at 50 pg / ml ascorbic acid, p values are as compared to Negative control group. B. Treatments and control were with 50 pg / ml ascorbic acid, p values are as compared to control group.
[0156] As can be seen in Figures 1 A&B, B6:NAM, there is a positive increase in ALP activity in ratio’s from 1 : 5 to 1 : 100 demonstrating that these ratios consistently promote osteoblasts differentiation in-vitro with and without ascorbic acid. Other ratios (such as the 1:2) are less efficient in promoting osteoblasts differentiation.
[0157] 1. Littlefield, B. A., Gurpide, E., Markiewicz, L., McKinkey, B. & Hochberg, R. B. A simple and sensitive microtiter plate estrogen bioassay based on stimulation of alkaline phosphatase in Ishikawa cells: Estrogenic action of delta 5 adrenal steroids. Endocrinology. 127, 2757 (1990).
[0158] Example 2: Osteoblast differentiation assessed through gene expression of differentiation markers
[0159] MC3T3-E1 subclone 4 cells were maintained in growth medium (GM) composed of ascorbic acid- free aMEM (ThermoFisher Scientific), supplemented with 10% fetal calf serum (FCS, ThermoFisher Scientific) and 1% penicillin / streptomycin. To induce differentiation into osteoblasts, cells were seeded at 5 104cells / cm2and grown to confluency in GM for 24 h. Then, the medium was switched to differentiation medium (DM) composed of GM supplemented with 10 mM P-glycerophosphate, 50 pg / ml ascorbic acid and B6:NAM 1 / 40 with NAM put at lOpM. Cells were differentiated for 7 days and were then collected for gene expression analysis. RNA was extracted using the RNeasy plus mini kit (Qiagen; Hilden, Germany) with the QIAcube (Qiagen,) according to the manufacturer’s instructions. Briefly, cells were lysed in RLT buffer and spun in a QIAshredder column (Qiagen) before being processed by the QIAcube. RNA concentrations were measured using the DropSense96 (TRINEAN, Gentbrugge, Belgium). cDNAs were synthetized using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems; Waltham, Massachusetts, USA) according to the manufacturer’s instructions. Briefly, 0.9 pg of RNA were reverse transcribed with the following program: 10 min at 25 °C, 120 min at 37 °C, and 5 min at 85 °C. cDNAs were diluted 18X with RNase-free water and used for qPCR using the PowerTrack™ SYBR Green Master Mix (Applied Biosystems; Waltham, Massachusetts, USA) according to the manufacturer’s instructions. Briefly, cDNAs were diluted 5X in a solution containing the master mix and the DNA primers targeting transcriptional coactivator YAP1 (Yapl), osteopontin (Opn), transcription factor Sp7 (Osx), periostin (Postn), and catenin beta 1 (Ctnnbl) with following nucleotide sequences Yapl-f ACCAATAGTTCCGATCCCTTTC, Yapl-r TGTCTCCTGTATCCATTTCATCC; Opn-f GTGATTTGCTTTTGCCTGTTTG, Opn-r GAGATTCTGCTTCTGAGATGGG; Osx-f TGGCGTCCTCTCTGCTTGA, Osx-r GGCTAGAGCCGCCAAATTT; Postn-f TGGCCTTAGCGACCTCTACAA, Postn-r GATAGCCGTCCGATACACAAAGA; Ctnnbl -f TGCCTTCAGATCTTAGCTTATGG, Ctnnbl -r AGACAGCACCTTCAGCAC. Reaction ran in a LightCycler 480 II (Roche) with the following program: 2 min at 95 °C, 40 cycles of 5 s at 95 °C and 30 s at 60 °C. The relative gene expression was evaluated via the 2 -AACt method.
[0160] As can be seen from Figure 2, the B6:NAM ratios from 1:5 to 1: 100 with NAM set at 10 pM promote osteoblasts differentiation in vitro, all show a positive increase in osteoblastic gene expression.
[0161] Example 3: Myogenic amplification and commitment of muscle stem cells Human primary myoblasts were seeded in 384 well plates at a density of 1 ’000 cells per well in skeletal muscle growth medium (SKM-M, AMSbio). For treatment, compounds were directly added to the myoblast cultures 16 hours after initial plating.
[0162] All cultures were then grown for 96 hours. Cells were stained for Pax7 and MyoD expression using antibodies directed against Pax7 and MyoD and counterstained with Hoechst 33342 to visualize cell nuclei. Pax7+ cells are defined as cells that express Pax7 regardless of MyoD expression. MyoD+ cells are defined as cells that do not express Pax7 but express MyoD.. Image acquisition was performed using the ImageXpress (Molecular Devices) platform. Custom module analysis based on Multi-Wavelength Cell Scoring of the MetaXpress software was used for quantification.
[0163] *, **, ***, **** inciicatesdifference from the control, One-way ANOVA, with p<0.05, p<0.01, p<0.001, pO.OOOl, respectively. Data are presented as Mean + / - SEM
[0164] Figure 3 represents the effect of nicotinamide and pyridoxine alone or combined on MyoD+ cells. For each condition, the number of MyoD+ cells was normalized to the number of MyoD+ cells in the control condition (DMSO 1%). Figure 3A represents the number of MyoD+ cells normalized to the control condition. Figure 3B represents the increase in MyoD+ cell number compared to the control condition (DMSO 1%).
[0165] These data show that the effect of the combination of Nicotinamide and Pyridoxine is greater than the sum of the individual effect of Nicotinamide and Pyridoxine, indicating a synergistic effect. Indeed, by applying a linear regression model (interaction term, p=0.05), we were able to observe a statistically significant synergistic effect between the nicotinamide and pyridoxine.
[0166] Example 4: In vivo effect of the combination of nicotinamide (NAM) and pyridoxine (B6) on muscle stem cells function
[0167] In order to reproduce the physiological process of muscle regeneration that occurs in adult skeletal muscles in response to injury or disease, we performed an intramuscular injection of cardiotoxin into mouse hindlimb muscles. One week prior to the induction of the muscle injury, mice were given by oral gavage our compounds of interest (nicotinamide and pyridoxine at 200 and 4 mg / kg body weight, respectively) vs. water control. Mice were treated once a day until the end of the experiment. To evaluate the efficiency of the muscle regeneration, muscles that have been previously injured were harvested 5 days after the injury and cryosections were prepared. Several myogenic markers were then measured. Cryosections were stained for Pax7, Myogenin, laminin (to delineate myofibers) and embryonic Myosin Heavy Chain (to define the injured / regenerating area) expression using specific antibodies and counterstained with Hoechst 33342 to visualize cell nuclei. Early phase of expansion and subsequent phase of myogenic differentiation of Muscle Stem Cells were evaluated by counting the number of Pax7+ cells (Fig 4A) and Myogenin+ cells (Fig 4B).
[0168] Data are expressed as number of cells per area of injured muscle, expressed as a fold change compared to the control condition.
[0169] These data demonstrate that a combination of Nicotinamide and Pyridoxine promotes Muscle Stem Cell function by increasing the number of both amplifying (Pax7+) and differentiating (MyoD+) cells in an in-vivo preclinical model of muscle repair / regeneration (Fig. 4).
[0170] Various changes and modifications to the presently preferred embodiments disclosed herein will be apparent to those skilled in the art. Such changes and modifications can be made without departing from the spirit and scope of the present subject matter and without diminishing its intended advantages. It is therefore intended that such changes and modifications be covered by the appended claims.
Claims
Claims1. A composition comprising a combination of Vitamin B6 and Nicotinamide, in a therapeutically effective amount for use in promoting bone growth, enhancing bone growth and / or bone strength or preventing bone loss and decreased bone strength.
2. A composition for use according to claim 1 whereby promotion of bone growth, enhancing bone growth and / or bone strength or preventing bone loss and decreased bone strength is achieved by increasing osteoblast differentiation.
3. The composition for use according to claim 1 or 2, wherein the vitamin B6 is administered in an amount of 0.001- 100 mg vitamin B6 per day.
4. The composition for use according to any of claims 1 to 3, wherein the Nicotinamide is administered in an amount of about 0.001 mg / day to about 2000 mg / day.
5. The composition for use according to any of claims 1 to 4, wherein the Vitamin B6:Nicotinamide are present in a ratio of from about 1 : 5 to about 1 : 100.
6. The composition for use according to any of claims 1 to 5, wherein the Vitamin B6:Nicotinamide are present in a ratio of about 1:10.
7. The composition for use according to any of claims 1 to 6, wherein the composition is an oral nutritional composition, an infant formula, a follow up formula, a nutritional supplement, an oral nutritional supplement, a medical food, a food supplement, a food product, a food for special medical purpose (FSMP).
8. The composition for use according to any of claims 1 to 7, wherein the composition is in a form of a solid powder, a powdered stick, a capsule or a solution.
9. The composition for use according to any of claims 1 to 8, for promoting bone growth in a subject, for example in need thereof.
10. The composition for use according to any of claims 1 to 9, wherein the subject is an infant or a child.
11. The composition for use according to any of claims 1 to 10, wherein the Vitamin B6 and Nicotinamide are administered together in the same composition.
12. The composition for use according to any of claims 1 to 11, wherein the Vitamin B6 is administered separately in a different composition from the Nicotinamide.
13. The composition for use according to any of claims 1 to 12, wherein the Vitamin B6 and the nicotinamide are administered together in a food product further comprising a component selected from the group consisting of protein, carbohydrate, fat and mixtures thereof.
14. The composition for use according to anyone of claims 1 to 13, wherein Vitamin B6 is pyridoxine.
15. The composition for use according to anyone of claims 1 to 14, wherein the composition is also for use in promoting muscle growth and / or preventing sub-optimal muscle growth or for use in increasing muscle function and / or muscle mass.
16. A kit for promoting bone growth, enhancing bone growth and / or bone strength or preventing bone loss and decreased bone strength, the kit comprising a therapeutically effective amount of vitamin B6; and Nicotinamide.
Citation Information
Patent Citations
Dietary butyrate
WO2019228851A1
Bone health composition
CN110584120A
Composition and method for facilitating bone healing
US20050053673A1
Compositions containing nicotinamide and vitamin b6 and methods of using such compositions for promoting muscle growth
WO2022090473A1