One-step extraction-free RT-qpcr amplification composition for dsrna components in rnai crops and amplification method

Abstract

Provided are a one-step extraction-free RT-qPCR amplification composition for dsRNA components in RNAi crops and an amplification method, which relate to the technical field of biology. According to the method, leaves of RNAi crops are directly used as a template, and crop RNA does not need to be extracted. The reverse transcription experiment step and the PCR amplification step are performed in one step in a single tube under one reaction procedure, enabling closed-tube analysis and thereby avoiding contamination. The method comprises the following steps: S1) obtaining a sample to be detected, wherein a leaf punch is performed on leaves of a target rice plant to obtain a sample to be detected, and the diameter of the sample is 1.5 mm or less; S2) directly amplifying the sample to be detected using one-step RT-qPCR amplification, wherein the amplification reaction system used is the amplification composition; and S3) determining, based on a Ct value, whether dsRNA is expressed in the sample to be detected, wherein when the Ct value is ≤ 36, it is positive, indicating dsRNA is expressed; and when the Ct value is ˃ 36, it is negative, indicating dsRNA is not expressed.

Description

A one-step RT-qPCR amplification composition and method for extracting dsRNA components from RNAi crops. Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a one-step RT-qPCR amplification composition and method for extracting dsRNA components from RNAi crops. Background Technology

[0002] Plant-mediated RNA interference (PDRNA) is an emerging crop protection technology that modifies transgenic plants to express target insect-specific double-stranded RNAs (dsRNAs), thereby triggering RNA silencing in the target insects and achieving pest control. Existing methods for detecting plant RNA typically use a two-step RT-qPCR method, requiring the extraction of plant RNA followed by reverse transcription into cDNA, and then quantitative fluorescence analysis using the cDNA as a template. Traditional methods for extracting plant RNA are complex, involve numerous steps, are time-consuming, require a variety of instruments and reagents, and involve the use of toxic reagents such as phenol-chloroform and β-mercaptoethanol. Alternatively, rapid extraction kits for plant RNA are available. These kits use silica gel column purification during extraction, eliminating the need for toxic reagents and alcohol precipitation. However, the entire extraction process still requires centrifugation and various complex reagents and consumables for separation, purification, and impurity removal, taking several minutes and presenting limitations and complexities for field applications. Two-step RT-qPCR involves multiple sample loading steps and is complex to operate. It requires opening the reaction tube cap multiple times and involves more pipetting steps, which increases the risk of contamination and may also lead to more experimental errors. In addition, it also faces the problem of insufficient detection sensitivity.

[0003] Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention provides a one-step RT-qPCR amplification composition and method for extracting dsRNA components from RNAi crops.

[0005] The first aspect of the present invention provides an extraction-free one-step RT-qPCR amplification composition for dsRNA components in RNAi crops, the amplification composition comprising RT-qPCR detection-specific primers and RT-qPCR detection-specific probes, as well as an RT-qPCR reaction system;

[0006] The specific primers for RT-qPCR detection are shown in SEQ ID NO.1 (upstream primer) and SEQ ID NO.2 (downstream primer), and the specific probes for RT-qPCR detection are shown in SEQ ID NO.3.

[0007] The RT-qPCR reaction system includes reverse transcriptase Mix RRM014 and DNA polymerase Mix 200U.

[0008] Furthermore, the proportions of each component in the amplification composition are as follows: 10 μL DNA polymerase, 1 μL reverse transcriptase, 0.8 μL 0.6 μM upstream primer, 0.8 μL 0.6 μM downstream primer, and 0.4 μL 0.3 μM RT-qPCR detection-specific probe.

[0009] Furthermore, the amplification composition also includes 1 μL of RNA template or negative control and 6 μL of DEPC water.

[0010] A second aspect of this invention provides a method for detecting whether RNAi rice has successfully expressed the target dsRNA, the method comprising the following steps:

[0011] S1) Obtain the sample to be tested: The leaves of the target rice are punched to obtain the sample to be tested. The diameter of the sample is less than 2 mm.

[0012] S2) Directly amplify the sample to be tested. The amplification is performed using one-step RT-qPCR, and the amplification reaction system uses the above-mentioned amplification composition.

[0013] S3) Determine whether the sample to be tested expresses dsRNA based on the Ct value: when the Ct value is ≤36, it is positive, that is, dsRNA is expressed; when the Ct value is >36, it is negative, that is, dsRNA is not expressed.

[0014] Furthermore, in step S1), the diameter of the sample is 1.2-1.8 mm.

[0015] Furthermore, in step S1), the diameter of the sample is 1.4-1.6 mm.

[0016] Furthermore, in step S1), the diameter of the sample is 1.5 mm.

[0017] Further, the one-step RT-qPCR amplification in step S2) includes the following steps: reverse transcription at 55℃ for 2 min, pre-denaturation at 95℃ for 1 min, denaturation at 95℃ for 5 s, annealing / extension at 60℃ for 10 s, for 35-45 cycles.

[0018] Furthermore, step S2) involves 40 cycles of one-step RT-qPCR amplification.

[0019] This invention designs highly specific RT-qPCR detection primers targeting the gene sequence of the small heat shock protein gene (CssHsp) in RNAi rice materials, and establishes an efficient RT-qPCR detection method for crop RNA components by directly using RNAi crop leaves as templates. This method can identify whether RNAi crops have successfully expressed the target dsRNA in the early stages of crop growth. Beneficial effects

[0020] The inventors of this invention unexpectedly discovered that plants can also be detected using a one-step Taqman probe RT-qPCR method without extraction, providing a new option for direct field detection. According to existing technology, RNA is generally considered to require extraction before amplification. However, RNA is less stable than DNA, so the extraction process significantly affects the amplification results. This unexpected discovery overcomes the bias of existing technology; using the method and conditions of this invention, rapid and accurate amplification can be achieved even without an RNA extraction step.

[0021] The method provided by this invention is simple to operate, directly reduces experimental steps, and greatly shortens the time of detection experiments.

[0022] The one-tube, one-step reaction process eliminates the need for opening the cap, avoiding other contamination. It is simple and convenient to operate, improving experimental efficiency. Compared with the two-step method, it has higher fluorescence quantitative sensitivity and better stability. Moreover, it can be combined with portable rapid fluorescence amplification instruments to achieve rapid, convenient, and intelligent detection in the field.

[0023] The technical solution of this invention was supported by the National Major Project for Agricultural Biotechnology Breeding, project number 2023ZD04062. Attached Figure Description

[0024] Figure 1 shows the agarose gel electrophoresis results after the PCR reaction in Example 1.

[0025] Figure 2 shows the results of agarose gel electrophoresis detection of dsRNA integrity in Example 1.

[0026] Figure 3 shows the RT-qPCR amplification curve of Example 1.

[0027] Figure 4 shows the RT-qPCR amplification curves of different polymerase reaction systems screened in Example 2.

[0028] Figure 5 shows the RT-qPCR amplification curves of different polymerase reaction systems screened in Example 2.

[0029] Figure 6 shows the RT-qPCR amplification curves of different primer and probe concentrations optimized in Example 3.

[0030] Figure 7 shows the RT-qPCR amplification curves after optimization of different primer and probe concentrations in Example 3.

[0031] Figure 8 shows the optimized RT-qPCR amplification curve of the reaction procedure in Example 4.

[0032] Figure 9 shows the RT-qPCR amplification curve of the optimized reaction procedure in Example 4.

[0033] Figure 10 shows the optimized RT-qPCR amplification curve of the reaction procedure in Example 4.

[0034] Figure 11 shows the optimized RT-qPCR amplification curve of the reaction procedure in Example 4.

[0035] Figure 12 shows the RT-qPCR amplification curve of the specificity experiment in Example 5.

[0036] Figure 13 shows the RT-qPCR amplification curve of the sensitivity experiment in Example 5.

[0037] Figure 14 shows the standard curve of the sensitivity experiment in Example 5.

[0038] Figure 15 shows the RT-qPCR amplification curve of the repeatability experiment in Example 5.

[0039] Figure 16 shows the results of total RNA integrity detection by agarose gel electrophoresis in Example 6.

[0040] Figure 17 shows the amplification curve of rice RNAi detected by one-step TaqMan RT-qPCR in Example 6.

[0041] Figure 18 shows the amplification curve of direct amplification detection of leaves in Example 7.

[0042] Figure 19 shows the amplification curve for optimizing the sampling diameter of the leaf sample in Example 7.

[0043] Figure 20 compares the results of direct amplification of leaf samples, rapid RNA extraction from leaf samples, and conventional RNA extraction from leaf samples using RT-qPCR in Example 7. Figure 20A shows the test results of RNA extracted from leaf samples using the conventional method, Figure 20B shows the test results of RNA extracted from leaf samples using the rapid kit, and Figure 20C shows the test results of direct amplification of leaf samples. Detailed Implementation

[0044] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below, but should not be construed as limiting the scope of the present invention.

[0045] Example 1: Screening of a one-step RT-qPCR amplification composition for dsRNA components in RNAi crops

[0046] (1) Primer and probe design and synthesis

[0047] Based on the gene sequence of the small heat shock protein gene (CssHsp) of RNAi rice materials, RT-qPCR primers and probes were designed using Primer-BLAST from the NCBI website (www.ncbi.nlm.nih.gov / ) and in accordance with primer and probe design principles. A total of three pairs of primers were designed, and the primers are shown in Table 1. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0048] Table 1 Primer sequences for RT-qPCR reaction

[0049] (2) Primer screening

[0050] A 293bp target gene was synthesized at Sangon Biotech (Shanghai) Co., Ltd. as a template for screening primers and probes. Three pairs of primers were screened and verified to select the best primers, which were then used in conjunction with the TaqMan probe for subsequent RT-PCR reactions.

[0051] The PCR reaction system consisted of: 2.0 μL 10×PCR buffer, 2.0 μL 10 mM dNTPs, 1 μL DNA, 0.5 μL 10 μM upstream primer, 0.5 μL 10 μM downstream primer, 0.1 μL Taq, and 13.9 μL DEPC water.

[0052] The PCR reaction program was as follows: 98℃ for 2 min; 98℃ for 10 s, 55-65℃ for 15 s, 72℃ for 30 s, 35 cycles; 72℃ for 5 min; 12℃ for 1 min.

[0053] After the PCR reaction, 2% agarose gel electrophoresis was used for detection, as shown in Figure 1. Based on the detection results, SHSP-hn-1F and SHSP-hn-1R were selected for subsequent RT-PCR experiments.

[0054] (3) dsRNA synthesis

[0055] To validate the synthesized RT-qPCR primer-probe method, the synthesized target gene dsRNA was used as a template. The dsRNA synthesis steps were as follows: 1. Primer design and PCR amplification; 2. Agarose gel electrophoresis; 3. DNA gel recovery; 4. Ligation to construct recombinant vector; 5. Transformation and plating culture; 6. Bacterial picking and detection; 7. Plasmid extraction; 8. Synthesis and purification of dsRNA template; 9. dsRNA synthesis and purification.

[0056] (4) Determination of dsRNA quality and concentration

[0057] The integrity of dsRNA was detected by 2% agarose gel electrophoresis (Figure 2). After electrophoresis, the concentration and purity were detected using a Thermo NanoDrop2000 UV-Vis spectrophotometer (Thermo Fisher Scientific (China) Co., Ltd.), following the instrument's instruction manual. After the RNA quality and concentration were determined, the RNA was promptly stored in an ultra-low temperature freezer for later use.

[0058] (5) One-step TaqMan RT-qPCR detection of dsRNA

[0059] Synthetic dsRNA was diluted to 662 ng / μL as a template, and non-transgenic rice RNA was used as a negative control. A one-step TaqMan RT-qPCR reaction was performed in a 3-well repeat system to verify the synthetic RT-PCR primer and probe method.

[0060] The reaction system for RT-qPCR was as follows: DNA polymerase Mix 10 μL, reverse transcriptase Mix 1 μL, 10 μM upstream primer 0.8 μL, 10 μM downstream primer 0.8 μL, 10 μM probe primer 0.4 μL, RNA template 1 μL, and DEPC water 6 μL.

[0061] The RT-qPCR reaction program was as follows: contamination treatment at 37℃ for 2 min, reverse transcription at 52℃ for 5 min, pre-denaturation at 95℃ for 1 min, denaturation at 98℃ for 3 s, annealing / extension at 60℃ for 20 s, for 40 cycles.

[0062] The test results are shown in Figure 3. The amplification curve of the dsRNA positive sample is a typical S-shaped curve, while the negative control and blank control did not amplify.

[0063] Based on the above test results, the preferred RT-qPCR detection-specific primers are:

[0064] SHSP-hn-1F:GTTGAAGGGAAGCACGAGGA SEQ ID NO.1;

[0065] SHSP-hn-1R:GACTCGACAGTTTCCGGGTT SEQ ID NO.2;

[0066] SHSP-hn-1P:CGAGGCAGTTTAAGCGCAGGTAC SEQ ID NO. 3.

[0067] Example 2: Optimization of reverse transcriptase / DNA polymerase in one-step RT-qPCR

[0068] The specific primers used in this embodiment are the preferred RT-qPCR detection specific primers from Example 1: SHSP-hn-1F: GTTGAAGGGAAGCACGAGGA SEQ ID NO.1; SHSP-hn-1R: GACTCGACAGTTTCCGGGTT SEQ ID NO.2; SHSP-hn-1P: CGAGGCAGTTTAAGCGCAGGTAC SEQ ID NO.3. The template used is RNA extracted from RNAi rice materials. The enzymes in the amplification composition were optimized to achieve the best experimental enzyme combination system.

[0069] (1) RT-qPCR experiments were performed using a checkerboard method with four DNA polymerase mixes (200U-BB, 200U-WS, 200U, 200U-SS) and nine reverse transcriptase mixes (RRM002, RRM003, RRM005, RRM007, RRM010, RRM013, RRM014, RRM017, RRM022) (from Tianluo Diagnostics Technology Jiangsu Co., Ltd.). Each mix was used in a two-well replicate system. The appropriate enzyme composition was selected based on the CT value and fluorescence value.

[0070] The RT-qPCR reaction system consisted of: 10 μL DNA polymerase Mix, 1 μL reverse transcriptase Mix, 0.8 μL 10 μM upstream primer, 0.8 μL 10 μM downstream primer, 0.4 μL 10 μM probe primer, 1 μL RNA template, and 6 μL DEPC water. The RT-qPCR reaction procedure was the same as in Example 1. The test results are shown in Figure 4. For reverse transcriptase Mix (RRM014) and DNA polymerase Mix (200U-BB, 200U-WS, 200U, 200U-SS), and for reverse transcriptase Mix (RRM022) and DNA polymerase Mix (200U), the amplification curves showed lower CT values ​​and higher fluorescence values, indicating better results.

[0071] (2) For reverse transcriptase Mix (RRM014) and DNA polymerase Mix (200U-BB, 200U-WS, 200U, 200U-SS), and reverse transcriptase Mix (RRM022) and DNA polymerase Mix (200U), the sample RNA template was further compared by performing 10-fold serial dilutions of three gradients, with two replicate wells for each combination.

[0072] The reaction system for RT-qPCR consisted of: 10 μL DNA polymerase Mix, 1 μL reverse transcriptase Mix, 0.8 μL 10 μM upstream primer, 0.8 μL 10 μM downstream primer, 0.4 μL 10 μM probe primer, 1 μL RNA template, and 6 μL DEPC water. The RT-qPCR procedure was the same as in Example 1. The test results are shown in Figure 5. The combined amplification curve of reverse transcriptase Mix (RRM014) and DNA polymerase Mix (200 U) showed a smaller CT and higher fluorescence value, indicating better results. Therefore, it was selected as the enzyme for subsequent experiments.

[0073] Based on the above test results, the preferred combination of enzymes in the amplification composition is: reverse transcriptase Mix (RRM014) and DNA polymerase Mix (200U).

[0074] Example 3: Optimization of primer and probe concentrations for one-step RT-qPCR

[0075] In this embodiment, the enzymes used were the optimized reverse transcriptase Mix (RRM014) and DNA polymerase Mix (200U) from Example 2 for RT-qPCR experiments. The template used was RNA extracted from RNAi rice materials.

[0076] (1) Based on the RT-qPCR detection specific primers selected in Example 1, the 10 μM primers were diluted to 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM, 0.6 μM, 0.7 μM, and 0.8 μM primers, respectively. The 10 μM primer probes were diluted to 0.1 μM, 0.2 μM, 0.3 μM, and 0.4 μM probes, respectively. The RT-qPCR experiment was performed using the checkerboard method, with two replicate wells for each combination. The appropriate primer concentration was selected based on the CT value and fluorescence value.

[0077] The RT-qPCR reaction system consisted of: 10 μL DNA polymerase Mix (200 U), 1 μL reverse transcriptase Mix (RRM014), 0.8 μL upstream primer, 0.8 μL downstream primer, 0.4 μL probe primer, 1 μL RNA template, and 6 μL DEPC water. The RT-qPCR procedure was the same as in Example 1. The test results are shown in Figure 6. The amplification curves with 0.6 μM primer and 0.3 μM probe, and 0.8 μM primer and 0.4 μM probe, showed lower CT values ​​and higher fluorescence values, indicating better results.

[0078] (2) Further comparisons were made by performing 10-fold gradient dilutions of the sample RNA template with 0.6 μM primers, 0.3 μM probes and 0.8 μM primers and 0.4 μM probes, respectively, with two replicate wells for each combination.

[0079] The RT-qPCR reaction system consisted of: 10 μL DNA polymerase Mix (200 U), 1 μL reverse transcriptase Mix (RRM014), 1.6 μL upstream primer, 1.6 μL downstream primer, 0.8 μL probe primer, 1 μL RNA template, and 6 μL DEPC water. The RT-qPCR reaction procedure was the same as in Example 1. The test results are shown in Figure 7. Results with lower CT values ​​were prioritized, and 0.6 μM primer and 0.3 μM probe were selected as the primer concentrations for subsequent experiments.

[0080] Based on the above test results, the preferred combination of primer and probe concentrations in the amplification composition is: 0.6 μM primer and 0.3 μM probe.

[0081] Example 4: Optimization of the reaction procedure for one-step RT-qPCR

[0082] Based on the results of selecting specific primers and probes, optimizing enzymes and primer concentrations in Examples 1, 2 and 3, the template used was RNA extracted from RNAi rice materials. The RT-qPCR program of the portable real-time PCR instrument was optimized, and a 3-well repeat system was used.

[0083] The reaction system for RT-qPCR was as follows: DNA polymerase Mix (200U) 10μL, reverse transcriptase Mix (RRM014) 1μL, 0.6μM upstream primer 0.8μL, 0.6μM downstream primer 0.8μL, 0.3μM probe primer 0.4μL, RNA template 1μL, and DEPC water 6μL.

[0084] (1) The RT-qPCR reaction program was as follows: reverse transcription 55℃ for 2 min, pre-denaturation 95℃ for 1 min, denaturation 95℃ for 10 s, annealing / extension 60℃ for 30 s, for 40 cycles. The test results are shown in Figure 8, for a total of 50 min.

[0085] (2) The RT-qPCR reaction program was as follows: reverse transcription 55℃ for 2 min, pre-denaturation 95℃ for 1 min, denaturation 95℃ for 5 s, annealing / extension 60℃ for 10 s, for 40 cycles. The reaction system for the RT-qPCR reaction was the same as above. The test results are shown in Figure 9, with a total duration of 31 min.

[0086] (3) The RT-qPCR reaction program was as follows: reverse transcription 55℃ for 2 min, pre-denaturation 95℃ for 1 min, denaturation 95℃ for 5 s, annealing / extension 60℃ for 20 s, for 40 cycles. The reaction system for the RT-qPCR reaction was the same as above. The test results are shown in Figure 10, with a total duration of 38 min.

[0087] (4) The RT-qPCR reaction program was as follows: reverse transcription 55℃ for 2 min, pre-denaturation 95℃ for 1 min, denaturation 95℃ for 5 s, annealing / extension 60℃ for 15 s, for 40 cycles. The reaction system for the RT-qPCR reaction was the same as above. The test results are shown in Figure 11, with a total duration of 35 min.

[0088] Based on the above test results, the preferred amplification method program combination is as follows: reverse transcription 55℃ for 2 min, pre-denaturation 95℃ for 1 min, denaturation 95℃ for 5 s, annealing / extension 60℃ for 10 s, 40 cycles.

[0089] Example 5: Evaluation of the specificity, sensitivity, and repeatability of a one-step RT-qPCR amplification method.

[0090] (1) Specificity test

[0091] Non-GMO rice, corn, soybean, and rapeseed materials were obtained from a local supermarket. Total RNA extracted from these materials served as a negative control, while total RNA extracted from the RNAi rice material served as a positive control. A one-step TaqMan RT-qPCR reaction was performed in a two-well replicate system to detect specific expression. The reaction system and procedure for the RT-qPCR reaction were the same as in Example 4 and Example 1. The test results are shown in Figure 12. Only the RNAi rice material showed a typical S-shaped amplification curve; other materials did not amplify, demonstrating the specificity of the one-step RT-qPCR amplification method.

[0092] (2) Sensitivity Experiment

[0093] The total RNA extracted from the RNAi rice material was diluted to 250 ng / μL as a template, and then serially diluted 10-fold to 25 ng / μL, 2.5 ng / μL, 0.25 ng / μL, 0.025 ng / μL, and 0.0025 ng / μL. Based on the specific primers and probes, optimized enzyme combinations, and primer and probe concentrations selected in Examples 1, 2, and 3, RT-qPCR sensitivity experiments were performed using a three-well replicate system. The RT-qPCR reaction system and procedure were the same as in Example 4 and Example 1. The test results are shown in Figure 13, with a minimum detectable concentration of 0.0025 ng / μL.

[0094] A standard curve was established based on the results, as shown in Figure 14. The amplification efficiency was 93.8%, Ra 2 =0.998.

[0095] (3) Repeatable experiments

[0096] Total RNA extracted from RNAi rice materials was used as a template for RT-qPCR experiments in a three-well replicate system. The reaction system and procedure for the RT-qPCR were the same as in Example 4 and Example 1. The test results are shown in Figure 15. The amplification curves of the three replicates showed an S-shape, indicating good reproducibility.

[0097] Example 6: One-step RT-qPCR applied to the detection of dsRNA components in RNAi crops

[0098] (1) Extraction of total RNA from rice using RNAi

[0099] RNAi rice materials were obtained from Huazhong Agricultural University. RNA extraction was performed immediately after sampling. The RNA extraction procedure followed the instructions of the rapid extraction kit for total RNA from polysaccharide and polyphenol plants (with gDNA filter, Beijing Jinbaite Biotechnology Co., Ltd., catalog number: R318-50). Masks and rubber gloves were worn throughout the extraction process to ensure a sterile and RNase-free experimental environment.

[0100] (2) Determination of RNA quality and concentration

[0101] The integrity of total RNA was assessed using 2% agarose gel electrophoresis (Figure 16). After electrophoresis, the concentration and purity were determined using a Thermo NanoDrop2000 UV-Vis spectrophotometer (Thermo Fisher Scientific (China) Co., Ltd.), following the instrument's instruction manual. After RNA quality and concentration were determined, the RNA was promptly stored in an ultra-low temperature freezer for later use.

[0102] (3) One-step TaqMan RT-qPCR detection of dsRNA expression in rice RNAi crop

[0103] RNA extracted from RNAi rice was used as a template, and RNA from non-transgenic rice was used as a negative control. A one-step TaqMan RT-qPCR reaction was performed in a 3-well replicate system to detect dsRNA expression in the RNAi crop. The reaction system and procedure for the RT-qPCR reaction were the same as in Example 4 and Example 1.

[0104] The test results are shown in Figure 17. The amplification curve of the RNAi positive rice sample is a typical S-shaped curve, while no amplification occurred in the negative control and blank control.

[0105] (4) One-step TaqMan-based RT-qPCR combined with rapid RNA extraction to detect dsRNA expression in rice RNAi crop

[0106] RNA was extracted from the test samples using a commercially available rapid RNA extraction kit, and the RNA quality and concentration were determined. The extracted RNA was then subjected to RT-qPCR detection. Each RT-qPCR reaction consisted of a total volume of 20 μL, comprising: 10 μL DNA polymerase Mix (200 U), 1 μL reverse transcriptase Mix (RRM014), 0.8 μL 0.6 μM upstream primer, 0.8 μL 0.6 μM downstream primer, 0.4 μL 0.3 μM probe primer, 1 μL RNA template or negative control, and 6 μL DEPC water. Each assay included the test sample RNA, a negative control, and a blank control. The RT-qPCR reaction program was as follows: contamination treatment at 37℃ for 2 min, reverse transcription at 52℃ for 5 min, pre-denaturation at 95℃ for 1 min, denaturation at 95℃ for 3 s, annealing / extension at 60℃ for 20 s, for 40 cycles. After the reaction, the results were determined by the RT-qPCR amplification curve and CT value. If the test sample produced a typical S-shaped amplification curve in the absence of amplification curves in the negative and blank controls, the result was considered positive, indicating the presence of the target dsRNA (SHSP) band in the rice sample. If the sample produced no amplification curve or the amplification curve did not show a typical S-shaped curve, the result was considered negative. The standard RT-qPCR curve for standard RNAi rice containing the SHSP dsRNA band is shown in Figure 14, and the sensitivity detection results of conventional RT-qPCR are shown in Figure 13.

[0107] Example 7: A one-step RT-qPCR method for extracting dsRNA components from RNAi crops without extraction

[0108] (1) Direct amplification detection of leaves

[0109] RNAi rice materials were sampled by punching holes with a 1.5 mm diameter punch and then directly subjected to one-step RT-qPCR detection. A three-well replicate system was used. The RT-qPCR reaction system and procedure were the same as in Example 4 and Example 1. The test results are shown in Figure 18. The amplification curve of the RNAi rice positive leaf samples showed a typical S-shaped curve, while no amplification occurred in the blank control.

[0110] (2) Optimization of leaf sample diameter

[0111] RNAi rice materials were sampled by punching holes with diameters of 1.5 mm, 2 mm, 3 mm, 5 mm, and 6 mm, with three replicate wells. One-step RT-qPCR detection was performed directly on a portable quantitative PCR instrument. The reaction system and procedure for the RT-qPCR were the same as in Example 4 and Example 5, respectively. The test results are shown in Figure 19. The amplification curve of the 1.5 mm diameter RNAi rice positive leaf sample showed a typical S-shaped curve. The CT values ​​of the 2 mm and 3 mm diameter RNAi rice positive leaves were relatively high, while no amplification curve was observed for the 5 mm and 6 mm diameter leaves. Therefore, a 1.5 mm diameter punch was selected for sampling.

[0112] (3) Comparison of direct amplification of leaf samples with RT-qPCR amplification of rapidly extracted leaf sample RNA and conventionally extracted leaf sample RNA.

[0113] The reaction system and procedure for the RT-qPCR reaction were the same as in Example 4. The results of RNA extraction from leaf samples using conventional methods are shown in Figure 20A. The results of RNA extraction from leaf samples using the rapid kit are shown in Figure 20B. The results of direct amplification of leaf samples are shown in Figure 20C. Compared to Figure 20A, under the same reaction procedure on a portable quantitative PCR instrument, the CT value of the amplification curve in Figure 20B is smaller than that in Figure 20A, and the fluorescence value is higher. Figure 20C shows the direct amplification detection of leaves; because the target template is gradually released from the leaves during the reaction, the fluorescence value continuously increases. Under the same reaction procedure, direct amplification of leaves achieves a simpler and more efficient testing method.

[0114] Rice leaf samples were perforated using a 1.5 mm diameter punch. RT-qPCR was performed on the leaf samples. The total volume for each RT-qPCR reaction was 20 μL. The RT-qPCR system consisted of: 10 μL DNA polymerase Mix (200 U), 1 μL reverse transcriptase Mix (RRM014), 0.8 μL 0.6 μM upstream primer, 0.8 μL 0.6 μM downstream primer, 0.4 μL 0.3 μM probe primer, 1 μL RNA template or negative control, and 6 μL DEPC water. Each assay included the sample leaf, negative control, and blank control. The RT-qPCR program was: reverse transcription 55℃ for 2 min, pre-denaturation 95℃ for 1 min, denaturation 95℃ for 5 s, annealing / extension 60℃ for 10 s, for 40 cycles. After the reaction, the results were determined by the RT-qPCR amplification curve and CT value. If the test sample leaf produces an amplification curve with a typical S-shaped curve when there is no amplification curve in the negative control and blank control, the test result is determined to be positive, and the target dsRNA (SHSP) band is found in the rice leaf sample. If the sample leaf has no amplification curve or the amplification curve does not show a typical S-shaped curve, the result is determined to be negative.

Claims

1. An amplification composition for a dsRNA component one-step RT-qPCR without extraction, characterized by, The amplification composition includes RT-qPCR detection-specific primers and RT-qPCR detection-specific probes, as well as an RT-qPCR reaction system; The specific primers for RT-qPCR detection are shown in SEQ ID NO.1 (upstream primer) and SEQ ID NO.2 (downstream primer), and the specific probes for RT-qPCR detection are shown in SEQ ID NO.

3. The reverse transcriptase in the RT-qPCR reaction system was MixRRM014 and the DNA polymerase was Mix 200U.

2. The amplification composition of claim 1, wherein The amplification composition consists of the following components: 10 μL DNA polymerase, 1 μL reverse transcriptase, 0.8 μL 0.6 μM upstream primer, 0.8 μL 0.6 μM downstream primer, and 0.4 μL 0.3 μM RT-qPCR detection-specific probe.

3. The amplification composition of claim 1, wherein The amplification composition also includes 1 μL of RNA template or negative control and 6 μL of DEPC water.

4. A method for detecting whether RNAi rice successfully expresses a target dsRNA, characterized in that, The detection method includes the following steps: S1) Obtain the sample to be tested: The leaves of the target rice are punched to obtain the sample to be tested. The diameter of the sample is less than 2 mm. S2) Directly amplify the sample to be tested, using one-step RT-qPCR amplification, and the amplification reaction system is the amplification composition according to any one of claims 1-3; S3) Determine whether the sample to be tested expresses dsRNA based on the Ct value: when the Ct value is ≤36, it is positive, that is, dsRNA is expressed; when the Ct value is >36, it is negative, that is, dsRNA is not expressed.

5. The detection method of claim 4, characterized in that, In step S1), the diameter of the sample is 1.2-1.8 mm.

6. The detection method of claim 4, characterized in that, In step S1), the diameter of the sample is 1.4-1.6 mm.

7. The detection method of claim 4, characterized in that, The diameter of the sample in step S1) is 1.5 mm.

8. The detection method of claim 4, characterized in that, Step S2) One-step RT-qPCR amplification includes the following steps: reverse transcription 55℃ for 2 min, pre-denaturation 95℃ for 1 min, denaturation 95℃ for 5 s, annealing / extension 60℃ for 10 s, 35-45 cycles.

9. The assay of claim 4, wherein, Step S2) involves one-step RT-qPCR amplification, which includes 40 cycles.

10. Use of the amplification composition according to any one of claims 1-3 in the preparation of a reagent for identifying the small heat shock protein gene, a target gene in RNAi rice.

Images